Analytica Chimica Acta 694 (2011) 115119

Contents lists available at ScienceDirect

Analytica Chimica Acta

journal homepage: www.elsevier.com/locate/aca

Colorimetric assay for mercury (II) based on mercury-specic deoxyribonucleic

acid-functionalized gold nanoparticles
Jikui Wu a,b , Lanying Li a , Dan Zhu a , Pingang He a , Yuzhi Fang a , Guifang Cheng a,
a
b

Department of Chemistry, East China Normal University, Shanghai 200062, China

College of Food Science and Technology, Shanghai Ocean University, Shanghai 201306, China

a r t i c l e

i n f o

Article history:
Received 23 December 2010
Received in revised form 9 February 2011
Accepted 20 February 2011
Available online 8 April 2011
Keywords:
Colorimetric detection
Mercury
DNA
Nanoparticles
Sensors

a b s t r a c t
A colorimetric nanoprobemercury-specic DNA-functionalized gold nanoparticles (AuMSD) was
developed for sensing Hg2+ . The new mercury-sensing concept relies on measuring changes in the inhibition of non-crosslinking aggregation of AuMSD-induced by the folding of mercury-specic DNA
strand through the thymineHg2+ thymine (THg2+ T) coordination. In the absence of Hg2+ , a high concentration of MgCl2 (50 mM) results in a rapid aggregation of AuMSD because of the removal of charge
repulsion. When Hg2+ is present, the particles remain stable due to the folding of MSD functionalized on
the particle surface. The assay enables the colorimetric detection of Hg2+ in the concentration range of
0.110 M Hg2+ ions with a detection limit of 60 nM, and allows for the selective discrimination of Hg2+
ions from the other competitive metal ions. Toward the goal for practical applications, the sensor was
further evaluated by monitoring Hg2+ in sh tissue samples.
2011 Elsevier B.V. All rights reserved.

1. Introduction
Mercury is a dangerous and widespread global pollutant with
lethal effects on the environment and human health. Most of
mercury emissions arise from solid waste incineration and the combustion of fossil fuels [1]. The long atmospheric residence time
of mercury causes the contamination of vast amounts of water
and soil. Furthermore, bacteria living in the marine environment
convert inorganic mercury into methyl mercury, which accumulates along the food chain in higher organisms, especially in large
edible sh [25]. Exposure to mercury by the consumption of
contaminated seafood products results in mortality, reproductive
failure, and other health effects in predatory wildlife and humans.
Current analytical techniques for mercury, such as atomic absorption/emission spectrometry [6] and inductively coupled plasma
mass spectrometry [7], all require expensive and complicated
instruments. Consequently, green environment and safe human
consumption require simple, rapid, and practical sensors for the
detection of mercury. Several types of sensing platforms based
upon small organic molecules [811], conjugated polymers [12],
oligonucleotides [13], DNAzymes [14], and proteins [15] have been
examined for the detection of Hg2+ . Most of these methods, however, suffer from cross-sensitivities toward other competing metal
ions, slow Hg2+ response time, and/or low water solubility.

Corresponding author. Tel.: +86 021 62233798; fax: +86 021 62233508.
E-mail address: gfcheng@chem.ecnu.edu.cn (G. Cheng).
0003-2670/$ see front matter 2011 Elsevier B.V. All rights reserved.
doi:10.1016/j.aca.2011.02.045

Recently, DNA/gold nanoparticle (DNA/AuNP)-based colorimetric assay [16] offers a promising approach for simple and
rapid tracking of mercury ions. These assays rely on the sizedependent surface plasmon resonance (SPR) properties of AuNP
and thymineHg2+ thymine (THg2+ T) coordination chemistry
[17]. Based on this principle, two general types of colorimetric
assays, using unmodied AuNPs (type I) [1820] and DNA-modied
AuNPs (type II) [21,22], have been developed. Willners group
developed the type I assay-based on the fact that at an appropriate
salt concentration, AuNPs are stabilized in the presence of unmodied ssDNA, but aggregated in the formation of Hg2+ -mediated
hairpin structure of DNA [18]. Mirkin and co-workers pioneered
the type II assay in which they utilized Hg2+ -induced interparticle crosslinking aggregation of oligonucleotide-modied AuNPs
to generate a color change [21]. Lius group further improved the
assay by optimizing DNA sequences and introducing an appropriate
oligonucleotide linker [22]. Nevertheless, the both assays required
two different sequences of DNA for the preparation of functionalized AuNPs.
Herein, we utilize mercury-specic-DNA (MSD)-functionalized
AuNPs (designated as AuMSD) as a colorimetric probe
to detect mercury ions at room temperature. Scheme 1
illustrates
the
design
strategy.
AuNPs
(13 nm)
are
functionalized with only one thiolated-MSD sequence (5 -HSC10 TCATGTTTGTTTGTTGGCCCCCCTTCTTTCTTA-3 ).
The sequence can specically interact with Hg2+ ions and form
the folding structure of THg2+ T complexes (Scheme 1a) [23].
In the absence of Hg2+ , rapid aggregation of AuMSD occurs

116

J. Wu et al. / Analytica Chimica Acta 694 (2011) 115119

Scheme 1. (a) The sequences of MSD probe and recognition of the target mercury ions of AuMSD. (b) Schematic illustration of MSD-based AuNP sensor for colorimetric
detection of mercury ions.

under a chosen salt condition due to the signicant decrease of

interparticle electrostatic repulsion. In the presence of Hg2+ , the
formation of Hg2+ MSD complexes on AuNP surface (designated as
AuMSDHg) stabilizes AuNPs and inhibits the salt-induced aggregation of AuMSD under the same salt condition (Scheme 1b) [24].
Furthermore, the degree of inhibition of color change is directly
related to the amount of Hg2+ . Thus, this system may be ideally
suited as a colorimetric sensor for detecting Hg2+ in aqueous solution.

Hydrogen tetrachloroaurate (III) hydrate (HAuCl4 ) was

purchased from Strem Chemicals (Newburyport, MA, USA).
Trisodium citrate, 4-(2-Hydroxyethyl)-1-piperazineethanesulfonic
acid (HEPES), and 6-mercapto-1-hexanol (MCH), were
obtained from SigmaAldrich (St. Louis, Mo, USA). Hg (NO3 )2
and other metal salts were purchased from Sinopharm
Group Chemical Reagent Co., Ltd. (Shanghai, China). All
chemicals were of analytical reagent grade and used as
received without further purication. The thiol-modied
MSD
(5 -HS-C10 TCATGTTTGTTTGTTGGCCCCCCTTCTTTCTTA3 ) and control DNA sequence (5 -HS-C10 AGAAGAAAGAAAGAAGGGGGGGAAGAAAGAAAA-3 ) were synthesized and puried
by HPLC in Sangon Biotechnology Co., Inc. (Shanghai, China). Water
used in all experiments was doubly distilled and puried by a
Milli-Q system (Millipore, Milford, MA).

TEM analysis (JEM-2100, Japan). The concentration was estimated

by UVvis spectroscopy to be 10.5 nM, based on an extinction coefcient of 2.7 108 M1 cm1 at max = 520 nm.
Before DNA loading, the thiol functionality on the probe oligonucleotides was deprotected by soaking the oligonecleotides in
20 mM HEPES (pH 7.4) containing 100 mM dithiothreitol for at
least 2 h. Next, aliquots of deprotected DNA solution were puried through a desalting NAP-5 column. The MSD-functionalized
AuNPs were then prepared using the standard surface modication protocol-based on AuS chemistry [26]. In brief, an AuNPs
solution (1200 L, 10.5 nM) was mixed with thiol-modied MSD
(340 L, 10 M). The solution was then incubated at room temperature for 12 h in HEPES buffer (90 L, 0.2 M, pH 7.4). Aqueous
NaCl (180 L, 1 M) were added, and the mixture was incubated for
another 12 h. After that, HEPES buffer (46 L, 0.2 M, pH 7.4) and
aqueous NaCl (94 L, 5 M) were added, and the mixture was further incubated for 18 h at room temperature. The solution was then
separated by a centrifuge at 13000 rpm for 30 min. After washed
with double-deionized H2 O (ddH2 O, 600 L) twice, the precipitated
MSD-modied AuNPs were redispersed in 600 L 20 mM HEPES
buffer (pH 7.4, 100 mM NaNO3 ).
The resulting MSD-modied AuNPs were then treated with
MCH. MCH was added to give a nal MCH concentration of 4 M.
The reaction was performed at room temperature for 30 min and
then quenched by three washes with equal volumes of ethyl acetate
in order to remove excess MCH from the aqueous solution. Finally,
the MSD-modied AuNPs (AuMSD) were redispersed in 600 L
working solution (20 mM HEPES, pH 7.4, 100 mM NaNO3 ), and
stored at 4 C until use ([AuMSD] = 10 nM).

2.2. Instrumentation

2.4. Colorimetric detection of Hg2+

The absorption spectra were recorded on a Cary 50 UVvis spectrophotometer (Varian, USA) at room temperature. Photographs
were taken with an Olympus S600 digital camera. Transmission electron microscopy (TEM) was performed on a transmission
microscope (JEM-2100, Janpan). A Delsa nano zeta potential analyzer (Beckman Coulter Inc., U.S.) was used for zeta potential
measurements. Circular dichroism (CD) was measured using a Jasco
J-810 spectrodichrometer.

Aliquots (900 L) of working solution containing 3 nM AuMSD

(or Au-control DNA) and various amounts of Hg2+ were incubated
at room temperature for 10 min. A solution (100 L) of 0.5 M MgCl2
(the nal concentration of MgCl2 is 50 mM) was then added to the
mixture rapidly. UVvis spectra were recorded on Cary 50 UVvis
spectrophotometer every 30 s for 5 min at room temperature after
the addition of 50 mM MgCl2 .

2. Materials and methods

2.1. Chemicals and materials

2.5. Selectivity of the colorimetric assay

2.3. Preparation and functionalization of AuNPs
AuNPs were synthesized using the reported method [25]. The
sizes of the nanoparticles were estimated to be 13.1 0.5 nm by

Other metal ions, including Ca2+ , Zn2+ , Mn2+ , Ni2+ , Co2+ , Cd2+ ,
Pb2+ , and K+ at a concentration of 10 M, were investigated respectively under the identical conditions as in the case of 10 M Hg2+ .

J. Wu et al. / Analytica Chimica Acta 694 (2011) 115119

117

The competition experiments were conducted by incubating 3 nM

AuMSD with 10 M Hg2+ and 100 M one other metal ion at room
temperature for 10 min. UVvis spectra were then recorded at
3 min after the addition of 50 mM MgCl2 .
2.6. Preparation of sh assay samples
Samples of sh tissue (100200 mg) were dissected from frozen
whole specimens after scale removal and digested in nitric acid
(200500 L) at 180 C with 300 W microwave irradiation for
510 min. The resulting solutions were neutralized with 10 N NaOH
and HEPES buffer. Final solutions were brought to 20 mM HEPES,
pH 7.4, 100 mM NaNO3 [27].
3. Results and discussion
3.1. Sensing mechanism
To test the feasibility of the colorimetric assay, AuMSD (3 nM)
was incubated with 10 M Hg2+ in 20 mM HEPES (pH 7.4, 100 mM
NaNO3 ) for 1 h at room temperature. The solution was monitored by
UVvis spectroscopy. We did not observe any red-shift of the strong
absorption band (SPR) of AuNPs at 520 nm, which excluded the
possibility of the formation of interparticle THg2+ T complexes
(Fig. 1).
Next, The colloidal stability of AuMSD and AuMSDHg against
salt-induced aggregation was examined at different concentrations of MgCl2 , where the salt-induced AuNP aggregation process
was interpreted using the increase of the ratio of the absorbance
at 600 nm and 520 nm (A600 /A520 ) as a function of time because
A600 /A520 represents the relative quantities of dispersed and aggregated AuNPs. AuMSDHg was found to be more stable than
AuMSD. AuMSD can only be stabilized at salt concentrations
less than 20 mM MgCl2 , whereas AuMSDHg was still stable at
MgCl2 concentrations as high as 50 mM. Moreover, AuMSD and
AuMSDHg had the vastly different stabilities at 50 mM MgCl2
(Fig. 2).

Fig. 1. UVvis spectra of the AuMSD solution (3 nM) in the presence of Hg2+
(10 M) were recorded every 6 min for 60 min at room temperature.

Finally, to provide a direct contrast between the colloidal stability of AuMSD and AuMSDHg, 50 mM MgCl2 was added to
both solutions. As shown in Fig. 3, the AuMSD solution immediately changed from red to purple (Fig. 1c, inset); correspondingly, a
characteristic red-shift and broadening of surface plasmon band in
UVvis spectrum was also observed (Fig. 1a, dash line). In contrast,
AuMSDHg did not show any signicant color change (Fig. 1d,
inset) or peak shift in UVvis spectrum (Fig. 1a, solid line) at
the same conditions. The Hg2+ -induced inhibition of salt-induced
aggregation of AuNPs was further supported by TEM images (Fig. 3c
and d). The zeta potentials of AuMSD and AuMSDHg were measured to be 3.2 mV and 13.8 mV, respectively. Circular dichroism
was employed to exploit the interaction between the MSD and
Hg2+ (Fig. 3b). In CD spectrum of the free MSD, a positive peak was
observed at 278 nm. The increase of Hg2+ concentrations resulted in
a red-shift of the positive peak along with gradual decrease in inten-

Fig. 2. Kinetics of aggregation of AuMSD (dash line) and AuMSDHg (solid line, 10 M Hg2+ ) at different salt concentrations: (a) 20 mM MgCl2 , (b) 50 mM MgCl2 , (c) 80 mM
MgCl2 .

118

J. Wu et al. / Analytica Chimica Acta 694 (2011) 115119

Fig. 3. (a) UVvis spectra of AuMSD before (dotted line) and after (dash line) the addition of 50 mM MgCl2 . Solid line is UVvis spectrum for AuMSDHg (10 M Hg2+ )
with 50 mM MgCl2 . Spectra were taken 5 min after the addition of MgCl2 . (b) Ellipticity of 2 M MSD in the absence and presence of Hg2+ ions (0, 5, 10, 12.5, 15, and 20 M).
Buffer: 20 mM HEPES, pH 7.4, 100 mM NaNO3 was used to prepare the solutions. (c and d) The TEM images and photographs (inset) of AuMSD and AuMSDHg at 5 min
after the addition of 50 mM MgCl2 , respectively. Buffer: 20 mM HEPES (pH 7.4, 100 mM NaNO3 ).

sity. Meanwhile, a negative peak appeared, gradually increased in

intensity, and red shifted toward 267 nm. The results supported
the conformational change of MSD in the presence of Hg2+ . The
aforementioned results suggested that upon binding Hg2+ , MSD
underwent a structure switch and formed THg2+ T complexes.
The resulting bulky THg2+ T complexes enhanced the surface
charge of AuNPs and repulsed each other, thereby signicantly
inhibiting the salt-induced aggregation of AuMSD. We further
performed control experiments using a control-DNA sequence (5 HS-C10 AGAAGAAAGAAAGAAGGGGGGGAAGAAAGAAAA-3 ) under
identical conditions. As expected, the addition of Hg2+ did not
lead to any signicant inhibition of the salt-induced aggregation
of AuNPs. Taken together, these observations implied that the colloidal stabilization effect was indeed as a result of MSD folding upon
binding Hg2+ .
3.2. Sensitivity for Hg2+ detection
Fig. 4a showed kinetics of the AuMSD aggregation in the presence of various amounts of Hg2+ at a salt concentration of 50 mM
MgCl2 . Clearly, the addition of Hg2+ indeed inhibited the saltinduced aggregation of AuMSD, and the degree of the inhibition of
AuMSD aggregation was directly related to the concentration of
Hg2+ . To further quantify the Hg2+ concentration, A600 /A520 at 3 min
after the addition of 50 mM MgCl2 was plotted as a function of Hg2+
concentrations. A sigmoid quantication curve was obtained in the
concentration range from 0.1 M to 10 M Hg2+ (Fig. 4b). The assay
had a detection limit of 60 nM (S/N = 3), which was much lower
than U.S. EPA dened toxicity level of Hg2+ in edible sh samples
(2.4 M) [28].
3.3. Selectivity for Hg2+ detection
The selectivity of the assay for Hg2+ was investigated by testing the A600 /A520 response of AuMSD to mercury and other metal

Fig. 4. (a) Kinetics of AuMSD aggregation in the presence of various amounts

of Hg2+ . (b) A600 /A520 at 3 min was plotted as a function of Hg2+ concentration in
order to quantify Hg2+ . The error bars represent standard deviations based on three
independent measurements.

J. Wu et al. / Analytica Chimica Acta 694 (2011) 115119

119

4. Conclusions
In summary, we proposed a label-free MSD-based colorimetric
assay of Hg2+ using modied AuNPs as probes. The assay involves
the mechanism of salt-induced, noncrosslinking AuNP aggregation
and the application of structure-switching MSD. The present assay
shows some advantages: (1) the assay is simple and cost-effective,
which requires only commercially available materials and common equipment. (2) The assay is faster than the other colorimetric
assay-based on interparticle crosslinking. The detection of Hg2+ is
completed within 15 min. (3) The sensitivity of the assay to detect
Hg2+ is about 23 orders of magnitude higher than the EPA standard
limit in edible sh samples. Moreover, this detection strategy could
be extended to the detection of other heavy metal ions by substituting MSD with synthetic articial bases that selectively bind other
metal ions.
Fig. 5. Selectivity of this assay. The dark bars represent A600 /A520 responses of
AuMSD in the presence of 10 M cations of interest. The light bars represent
A600 /A520 responses in the presence of 10 M Hg2+ together with 100 M one other
metal ion. The data are recorded at 3 min after the addition of 50 mM MgCl2. The
error bars represent standard deviations based on three independent measurements.

Table 1
Determination of Hg2+ in sh samples using the proposed method and CVAAS.
Fish samples

Added (mol L1 )

Proposed methoda
(mol L1 )

CVAASb
(mol L1 )

1
2
3

5 107
1.5 106
4.5 106

5.3 107 (0.4)

1.7 106 (0.3)
4.6 106 (0.1)

5.1 107
1.6 106
4.7 106

a
b

Average of three replicates SD.

Cold vapor atom adsorption spectroscopy.

ions, including Ca2+ , Zn2+ , Mn2+ , Ni2+ , Co2+ , Cd2+ , Pb2+ and K+
at a concentration of 10 M. The A600 /A520 response of AuMSD
to various cations and its selectivity for Hg2+ were illustrated
in Fig. 5. Under identical conditions, only Hg2+ ions resulted in
a signicant decrease of A600 /A520 relative to that of the blank,
revealing the exceptional specicity of this present method (the
dark bars). The competition experiments revealed that the Hg2+ induced inhibition of A600 /A520 response of AuMSD was unaffected
in the background of 10 equiv of other metal ions, indicating
that the method had a remarkable selectivity for Hg2+ (the light
bars).
3.4. Application
To further investigate the potential practical application of
this colorimetric assay, we tested this probe with sh collected from eld studies. Fish tissue samples were digested by
microwave in nitric acid, and the resulting solutions were neutralized with NaOH, brought to pH 7.4 in 20 mM HEPES buffer,
and analyzed with AuMSD. All sh samples were spiked with
Hg2+ at different concentration levels. The results, summarized
in Table 1, are good agreement with the expected and found
values.

Acknowledgements
This research was nancially supported by the National 264
High Technology Research and Development Program of China
265 (863Program, no. 2007AA06A406) and the National Science
266 Foundation of China (no. 20675031),Shanghai Science and
Technology Committee (no. 06PJ14032), and the Natural Science
Foundation of Shanghai,China (no. 11ZR1415400).
References
[1] Mercury Update: Impact on Fish Advisories, EPA Fact Sheet EPA-823-F-01-011,
EPA Ofce of Water, Washington, DC, 2001.
[2] H.H. Harris, I.J. Pickering, G.N. George, Science 301 (2003) 1203.
[3] S. Yoon, A.E. Albers, A.P. Wong, C.J. Chang, J. Am. Chem. Soc. 127 (2005)
1603016031.
[4] S. Park, M.A. Johnson, Nutr. Rev. 64 (2006) 250256.
[5] D.W. Boening, Chemosphere 40 (2000) 13351351.
[6] N. Bloom, W.F. Fitzgerald, Anal. Chim. Acta 208 (1988) 151161.
[7] J.A. Moreton, H.T. Delves, J. Anal. At. Spectrosc. 13 (1998) 659665.
[8] E.M. Nolan, S.J. Lippard, J. Am. Chem. Soc. 125 (2003) 1427014271.

[9] J.V. Ros-Lis, M.D. Marcos, R. Mrtinez-Mnez,

K. Rurack, J. Soto, Angew. Chem.
Int. Ed. 44 (2005) 44054407.
[10] B. Liu, H. Tian, Chem. Commun. (2005) 31563158.
[11] S.Y. Moon, N.J. Youn, S.M. Park, S.K. Chang, J. Org. Chem. 70 (2005) 23942397.
[12] X. Liu, Y. Tang, L. Wang, J. zhang, S. Song, C. Fan, S. Wang, Adv. Mater. 19 (2007)
14711474.
[13] A. Ono, H. Togashi, Angew. Chem. Int. Ed. 43 (2004) 43004302.
[14] J.W. Liu, Y. Lu, Angew. Chem. Int. Ed. 46 (2007) 75877590.
[15] S.V. Wegner, A. Okesli, P. Chen, C. He, J. Am. Chem. Soc. 129 (2007) 34743475.
[16] W. Zhao, M.A. Brook, Y. Li, ChemBioChem 9 (2008) 23632371.
[17] Y. Miyake, H. Togashi, M. Tashiro, H. Yamaguchi, S. Oda, M. Kudo, Y. Tanaka, Y.
Kondo, R. Sawa, T. Fujimoto, T. Machinami, A. Ono, J. Am. Chem. Soc. 128 (2006)
21722173.
[18] D. Li, A. Wieckowska, I. Willner, Angew. Chem. Int. Ed. 47 (2008) 39273931.
[19] C.W. Liu, Y.T. Hsieh, C.C. Huang, Z.H. Lin, H.T. Chang, Chem. Commun. (2008)
22422244.
[20] L. Wang, J. Zhang, X. Wang, Q. Huang, D. Pan, S. Song, C. Fan, Gold Bull. 41 (2008)
3741.
[21] J.S. Lee, M.S. Han, C.A. Mirkin, Angew. Chem. Int. Ed. 46 (2007) 40934096.
[22] X.J. Xue, F. Wang, X.G. Liu, J. Am. Chem. Soc. 130 (2008) 32443245.
[23] Z.D. Wang, J.H. Lee, Y. Lu, Chem. Commun. (2008) 60056007.
[24] W.A. Zhao, W. Chiuman, J.C.F. Lam, S.A. McManus, W. Chen, Y.G. Cui, R. Pelton,
M.A. Brook, Y.F. Li, J. Am. Chem. Soc. 130 (2008) 36103618.
[25] P.C. Lee, D. Meisel, J. Phys. Chem. 86 (1982) 33913395.
[26] J. Liu, Y. Lu, Nat. Protoc. 1 (2006) 246252.
[27] O. Brmmer, J.J.L. Clair, K.D. Kim, D. Janda, Bioorg. Med. Chem. 9 (2001)
10671071.
[28] U.S. EPA, Regulatory Impact Analysis of the Clean Air Mercury Rule, EPA-452/R05-003, 2005.