Yeast 14, 943951 (998)

Heterologous Modules for Efficient and Versatile

PCR-based Gene Targeting in Schizosaccharomyces
pombe
JU
} RG BA
} HLER1, JIAN-QIU WU1, MARK S. LONGTINE1, NIRAV G. SHAH1, AMOS MKENZIE III1,
ALEXANDER B. STEEVER1, ACHIM WACH2, PETER PHILIPPSEN2 AND JOHN R. PRINGLE1*
1
2

Department of Biology, University of North Carolina, Chapel Hill, NC 275993280, U.S.A.

Institut fur Angewandte Mikrobiologie, Biozentrum, Universitat Basel, CH-4056 Basel, Switzerland

We describe a straightforward PCR-based approach to the deletion, tagging, and overexpression of genes in their
normal chromosomal locations in the fission yeast Schizosaccharomyces pombe. Using this approach and the
S. pombe ura4 + gene as a marker, nine genes were deleted with efficiencies of homologous integration ranging from
6 to 63%. We also constructed a series of plasmids containing the kanMX6 module, which allows selection of
G418-resistant cells and thus provides a new heterologous marker for use in S. pombe. The modular nature of these
constructs allows a small number of PCR primers to be used for a wide variety of gene manipulations, including
deletion, overexpression (using the regulatable nmt1 promoter), C- or N-terminal protein tagging (with HA, Myc,
GST, or GFP), and partial C- or N-terminal deletions with or without tagging. Nine genes were manipulated using
these kanMX6 constructs as templates for PCR. The PCR primers included 60 to 80 bp of flanking sequences
homologous to target sequences in the genome. Transformants were screened for homologous integration by PCR.
In most cases, the efficiency of homologous integration was d50%, and the lowest efficiency encountered was
17%. The methodology and constructs described here should greatly facilitate analysis of gene function in S. pombe.
 1998 John Wiley & Sons, Ltd.
fission yeast; gene deletions; gene truncations; overexpression studies; epitope tagging; polymerase
chain reaction; gene expression; green fluorescent protein

INTRODUCTION
Deletion and overexpression studies are central
to the functional analysis of genes in yeast. In
*Correspondence to: John Pringle, Department of Biology, University of North Carolina, Chapel Hill, NC 275993280, U.S.A.
Jurg Bahler and Jian-Qiu Wu contributed equally to this work.
Present address: Imperial Cancer Research Fund, Cell Cycle
Laboratory, 44 Lincolns Inn Fields, London WC2A 3PX, U.K.
Present address: Bureco AG, Stadtweg 4, CH-4310
Rheinfelden, Switzerland.
Contract/grant sponsor: NIH
Contract/grant number: GM31006
Contract/grant sponsor: RJEG Trust
Contract/grant sponsor: University of Basel
Contract/grant sponsor: Swiss Federal Office for Education and
Science
Contract/grant number: 95.0191
CCC 0749503X/98/10094309 $17.50
 1998 John Wiley & Sons, Ltd.

addition, tagging of proteins can allow simple and

efficient cell biological and biochemical analyses of
gene products (Smith and Johnson, 1988;
Kolodziej and Young, 1991; Prasher, 1995). In this
paper, we describe a set of plasmid templates and a
PCR-based method for the straightforward
manipulation of genes directly in the genome of
Schizosaccharomyces pombe. The approach is
based on the one-step gene disruption method
(Rothstein, 1983; Grimm and Kohli, 1988; Baudin
et al., 1993; Grallert et al., 1993). In Saccharomyces cerevisiae, it has been shown that transformation with PCR products that terminate in
short stretches of homology (provided by the
primers) to genomic target sequences frequently
yields homologous integrants, thus replacing the
Received 24 December 1997
Accepted 25 February 1998

944
region between the target sequences with the PCR
product (Baudin et al., 1993; Wach et al., 1997;
and references cited therein). This methodology
allows direct manipulations of chromosomal
genes, such as deletion, overexpression, and tagging of gene products, without any cloning steps.
Starting with plasmids described previously (Wach
et al., 1994, 1997), we constructed several plasmids
containing the heterologous selectable marker
kanMX6. These plasmids serve as templates for
PCR-based gene targeting in S. pombe.
Several different types of tags have proven to be
widely useful in localizing and isolating gene
products. We constructed plasmids containing
sequences encoding three copies of the influenza
virus hemagglutinin (HA) epitope (Field et al.,
1988; Tyers et al., 1992), 13 copies of the human
c-myc (Myc) epitope (Evan et al., 1985; Munro
and Pelham, 1987), glutathione S-transferase
(GST) from Schistosoma japonicum (Smith et al.,
1986), or the green fluorescent protein (GFP) from
the jellyfish Aequorea victoria (reviewed by
Prasher, 1995; Heim et al., 1995). Commercial
antibodies to the HA and Myc epitopes are available, and GST-tagged proteins can be purified
easily using commercially available glutathione
beads (Smith and Johnson, 1988). GFP fusion
proteins can be detected in living (and sometimes
in fixed) cells by fluorescence microscopy, and
antibodies to GFP are also available. To facilitate
tagging of proteins at their N-termini, as well as
the overexpression of both tagged and untagged
proteins, the plasmids constructed include ones
incorporating the regulatable nmt1 promoter
(Maundrell, 1990; Basi et al., 1993).
MATERIALS AND METHODS
Construction of plasmids containing PCR template
modules
Standard recombinant-DNA methods were used
(Sambrook et al., 1989). Plasmid DNA was prepared from bacteria and isolated from agarose gels
using Qiagen kits. Plasmid KS-ura4 (Figure 1A; a
kind gift of S. Parisi and J. Kohli, University of
Bern, Switzerland) contains the S. pombe ura4 +
gene (coding region plus flanking sequences) on a
18-kb HindIII fragment (Grimm et al., 1988) in
the HindIII site of pBluescript KS- (Stratagene).
Construction of pFA6a-kanMX6 and pFA6aGFP(S65T)-kanMX6 (Figure 1B) has been
described by Wach et al. (1997). Construction of
 1998 John Wiley & Sons, Ltd.

. .
the other plasmids shown in Figure 1B has been
described by Longtine et al. (1998).
Plasmids containing an nmt1 promoter together
with the kanMX6 marker (Figure 2) were constructed as follows. The wild-type nmt1 promoter
(Maundrell, 1990) and two attenuated versions of
this promoter (Basi et al., 1993) were amplified by
PCR (Expand system; see below) using the
pREP3X, pREP41X, and pREP81X vectors (Basi
et al., 1993; Maundrell, 1993; Forsburg, 1993)
as templates and the primers 5 -TAACCTGA
AGATCTCGCCATAAAAGACAGAATAAGT
CATC-3 and 5 -TACATGACTTAATTAAAGA
CATGATTTAACAAAGCGACTATAAGTCA
G-3 (restriction sites underlined), resulting in
12-kb fragments (from position
1163 to +6
of nmt1) with a BglII site near the upstream end
and a PacI site near the downstream end. The
PCR products were digested with BglII and PacI
and cloned into BglII/PacI-digested plasmid
pFA6a-kanMX6-PGAL1 (Longtine et al., 1998),
thus replacing the GAL1 promoter with one of
the versions of the nmt1 promoter to create plasmids pFA6a-kanMX6-P3nmt1, pFA6a-kanMX6P41nmt1, and pFA6a-kanMX6-P81nmt1 (Figure
2). About 200 bp of the downsteam end of the
nmt1 promoter in each plasmid were sequenced by
the UNC-CH Automated Sequencing Facility on
a Model 373A DNA Sequencer using the Taq
DyeDeoxy Terminator Cycle Sequencing Kit
(Applied Biosystems); each construct had the
expected sequence at the TATA box (Basi et al.,
1993) and the correct junction at the PacI site.
Sequences encoding a triple HA epitope, GST, or
GFP (carrying the S65T mutation: Heim et al.,
1995) were then cloned downstream of the nmt1
promoters. To this end, plasmids pFA6a-3HAkanMX6, pFA6a-GST-kanMX6, and pFA6aGFP(S65T)-kanMX6 (Figure 1B) were digested
with PacI and BglII, and the desired fragments
were gel-purified and cloned into PacI/BamHIdigested
plasmids
pFA6a-kanMX6-P3nmt1,
pFA6a-kanMX6-P41nmt1, and pFA6a-kanMX6P81nmt1. Both junctions of the inserted tag
sequences in the resulting plasmids were checked
by sequencing (as above), and the plasmids were
named as indicated in Figure 2.
PCR amplification of fragments for transformation
PCR primers were 80 to 101 nucleotides long
(see Tables 1 and 2); they were synthesized and
PAGE purified by Integrated DNA Technologies.
Yeast 14, 943951 (1998)

945

Figure 1. Modules for use as PCR templates to generate fragments to be used for complete
gene deletion, partial deletion of C-terminal sequences, C-terminal tagging of proteins, or gene
expression studies. Arrows within the boxes show directions of transcription; arrows outside
the boxes indicate PCR primers (not to scale; see Table 1). The approximate sizes of the
expected PCR products are indicated. (A) ura4 + module (including the S. pombe ura4 + coding
region and flanking sequences) cloned into the multiple cloning site of pBluescript KS-.
Restriction sites used for cloning and for identifying insert direction are indicated. (B)
kanMX6-based modules cloned into the multiple cloning site of pFA6a (Wach et al., 1994;
Longtine et al., 1998). Restriction sites used for cloning are indicated; the AscI site at the
junction of 13Myc and TADH1 sequences was lost during the construction of plasmid
pFA6a-13Myc-kanMX6 (Longtine et al., 1998). Gray boxes: kanMX6 module containing the
promoter and terminator sequences of the Ashbya gossypii translation elongation factor 1
gene together with the kanr gene from E. coli (Steiner and Philippsen, 1994; Wach et al., 1994,
1997). Black boxes: protein tagging modules containing the terminator sequence of the ADH1
gene from S. cerevisiae (Wach et al., 1994, 1997) together with the tags indicated.

DNA fragments were amplified using the

Expand High Fidelity PCR system (Boehringer
Mannheim) and the plasmids shown in Figures 1
and 2 as templates. PCR reactions were performed
in HotStart 100 tubes (Molecular Bio-Products).
The lower mix (total volume, 25 l) contained
25 l of Expand buffer with 15 m MgCl2, 08 m
of each dNTP, 10 g BSA, and 2 of each
primer. The upper mix (total volume, 75 l) contained 75 l of Expand buffer, 150 ng of DNA
template, and 075 l of Expand enzyme mixture.
20 cycles of 94C for 1 min, 55C for 1 min, and
68C for 2 (for plasmids of Figure 1) or 3 (for
plasmids of Figure 2) min were executed. Some
 1998 John Wiley & Sons, Ltd.

products could not be amplified under these conditions (depending on the sequences of the 5
portions of the primers). In these cases, Taq
polymerase (Promega) or the TaqPlus Precision
PCR system (Stratagene) were used together with
the buffers supplied. The amounts of enzymes and
MgCl2were as recommended by the suppliers, and
the reaction mixtures were otherwise as described
above. 35 cycles of 94C for 1 min, 55C for 1 min,
and 72C for 2 (for plasmids of Figure 1) or 3 (for
plasmids of Figure 2) min were executed followed
by an extension (72C for 10 min).
The products from two to five PCR reactions
(1020 g of DNA) were pooled, extracted with
Yeast 14, 943951 (1998)

. .

946

Figure 2. Modules for use as PCR templates to generate fragments to be used for gene overexpression, partial
deletion of N-terminal sequences, and/or N-terminal tagging of proteins. Modules were cloned into the multiple
cloning site of pFA6a (Wach et al., 1994; see Materials and Methods); restriction sites used for cloning are
indicated. Arrows within the boxes show directions of transcription; arrows outside the boxes indicate PCR
primers (not to scale; see Table 1). Gray boxes: kanMX6 module (Wach et al., 1994, 1997; see Figure 1B). White
boxes: S. pombe nmt1 promoter (each module is available both with the wild-type promoter and with two
attenuated versions; see text). Black boxes: protein tagging modules (see Figure 1B). The approximate sizes of the
expected PCR products are indicated.

an equal volume of phenol:chloroform:isoamyl

alcohol (25:24:1), precipitated with ethanol, and
dissolved in 10 l of TE (pH 8) buffer (Sambrook
et al., 1989). This concentrated DNA was used
directly for transformation of S. pombe cells (see
below).
Transformation of S. pombe and selection of
G418-resistant or Ura + transformants
S. pombe cells were transformed with the PCR
fragments using a protocol based on the method of
Keeney and Boeke (1994). Wild-type (strain 972;
Leupold, 1970) or ura4-D18 (Grimm and Kohli,
1988) cells were grown at 30C in YE medium
(Moreno et al., 1991) to 107 cells/ml (20 ml/
transformation). Cells were washed once with an
equal volume of water, and the cell pellet was
resuspended in 1 ml of water, transferred to an
Eppendorf tube, and washed once with 1 ml of
LiAc/TE made from 10filter-sterilized stocks
(10LiAc: 1 lithium acetate, adjusted to pH 75
with diluted acetic acid; 10TE: 01 TrisHCl,
001 EDTA, pH 75). The cell pellet was then
resuspended in LiAc/TE at 2109 cells/ml. 100 l
of the concentrated cells were mixed with 2 l
sheared herring testes DNA (10 mg/ml Yeastmaker carrier DNA; Clontech Laboratories) and
10 l of the transforming DNA. After 10 min
 1998 John Wiley & Sons, Ltd.

incubation at room temperature, 260 l of 40%

PEG/LiAc/TE (for 20 ml of solution: dissolve 8 g
of PEG 4000 in 2 ml of 10LiAc, 2 ml of
10TE, and 975 ml water, and filter sterilize; can
be stored up to 1 month) was added. The cell
suspension was mixed gently and incubated for
3060 min at 30C. 43 l of DMSO were added,
and the cells were heat shocked for 5 min at 42C.
Cells transformed with fragments carrying the
kanMX6 marker were then washed once with 1 ml
of water, resuspended in 05 ml of water, and
plated onto two YE plates (250 l/plate). These
plates were incubated for 18 h at 30C, resulting
in a lawn of cells. The cells were then replica plated
onto YE plates containing 100 mg/l G418/
Geneticin (Life Technologies; G418 was added
after autoclaving the medium, and plates were
stored at 4C in the dark). The replica plates
were incubated for 23 days at 30C, and large
colonies were restreaked onto fresh YE plates
containing G418. (The tiny colonies appearing
on the initial G418 plates were not stable transformants.) Cells transformed with fragments
carrying the ura4 + marker were washed with
water as described above, plated onto two EMM
plates without uracil, grown at 30C for 3 days,
and restreaked onto fresh EMM plates without
uracil.
Yeast 14, 943951 (1998)

-
Table 1.

947

PCR primers used to amplify the transformation modules.

Primer

Sequence

Modules of Figure 1
KS-ura4 (forward)
KS-ura4 (reverse)
pFA6a derivatives (forward)
pFA6a derivatives (reverse)

5 -(gene-specific
5 -(gene-specific
5 -(gene-specific
5 -(gene-specific

sequence)-CGCCAGGGTTTTCCCAGTCACGAC-3 a
sequence)-AGCGGATAACAATTTCACACAGGA-3 a
sequence)-CGG ATC CCC GGG TTA ATT AA-3 b
sequence)-GAATTCGAGCTCGTTTAAAC-3 c

Modules of Figure 2
All modules (forward)
Modules without tag (reverse)
Modules with 3HA (reverse)
Modules with GST (reverse)
Modules with GFP(S65T) (reverse)

5 -(gene-specific
5 -(gene-specific
5 -(gene-specific
5 -(gene-specific
5 -(gene-specific

sequence)-GAATTCGAGCTCGTTTAAAC-3 d
sequence)-CATGATTTAACAAAGCGACTATA-3 e
sequence)-GCA CTG AGC AGC GTA ATC TG-3 f
sequence)-ACG CGG AAC CAG ATC CGA TT-3 f
sequence)-TTT GTA TAG TTC ATC CAT GC-3 f

The sequences shown correspond to the M13 forward and reverse sequencing primers, as present in pBluescript on either side
of the multiple cloning site.
b
The reading frame for the tag sequences is indicated. The primer sequence includes the BamHI and PacI sites (underlined) of the
multiple cloning site of pFA6a (Wach et al., 1994; Figure 1B). For deletions, the gene-specific portion of the primer is typically
chosen to correspond to sequences immediately upstream of the start codon of the target gene. For C-terminal tagging of
full-length proteins, the gene-specific portion of the primer corresponds to the C-terminal codons of the target gene, ending just
upstream of the stop codon. For C-terminal deletions, the gene-specific portion of the primer corresponds to sequences in the
region where the truncation is desired. (If the gene fragment will not be tagged, a stop codon should be incorporated into the
primer; if the gene fragment will be tagged, the primer should preserve the reading frame.)
c
The primer sequence includes the EcoRI and PmeI sites (underlined) of the multiple cloning site of pFA6a (Wach et al., 1994;
Figure 1B). In the studies reported here, we typically used primers whose gene-specific portions corresponded to sequences
80200 bp downstream of the target gene stop codon (in order to leave a gap between the target sequences for C-terminal tagging).
However, primers whose gene-specific portions correspond to sequences immediately downstream of the stop codon would be
expected to work well for deletions and probably also are effective for C-terminal tagging (Longtine et al., 1998); the use of such
primers would reduce the risk of affecting the expression of neighboring genes.
d
The sequence includes the EcoRI and PmeI sites (underlined) of the multiple cloning site of pFA6a (Wach et al., 1994; Figure 2).
The gene-specific portion of the primer was typically chosen to correspond to sequences 90200 bp upstream of the start codon of
the target gene. However, primers whose gene-specific portions correspond to sequences immediately upstream of the start codon
may work as well (cf. note c).
e
The complement of the start codon is underlined. For overexpression of full-length proteins, the gene-specific portion of the primer
corresponds to the complement of the N-terminal codons of the target gene (without the start codon). For expression of
N-terminally deleted proteins, the gene-specific portion of the primer corresponds to sequences in the region where the truncation
is desired (preserving the reading frame with respect to the start codon provided in the primer).
f
The reading frames of the tag sequences are indicated. For N-terminal tagging of full-length proteins, the gene-specific portion of
the primer corresponds to the complement of the N-terminal codons of the target gene (including the start codon). For tagging of
N-terminally deleted proteins, the gene-specific portion of the primer corresponds to sequences in the region where the truncation
is desired (preserving the reading frame). The 3 portions of these primer sequences are specific to the tags and correspond to the
complement of the C-terminal codons of the tags (without the stop codons).

Screening transformants for homologous

integration by PCR
We checked G418-resistant or Ura + transformants by PCR for integration of the DNA fragment
by homologous recombination. Genomic DNA of
transformants was prepared using a procedure
based on that of Hoffman and Winston (1987). A
reisolated transformant was grown to stationary
phase in 5 ml of YE medium at 30C, centrifuged,
resuspended in 05 ml of water, and transferred to
an Eppendorf tube. After centrifugation, the cell
pellet was resuspended in 02 ml of 2% Triton
 1998 John Wiley & Sons, Ltd.

X-100, 1% SDS, 100 m NaCl, 10 m Tris, 1 m

EDTA, pH 80. 02 ml of phenol:chloroform:
isoamyl alcohol (25:24:1) and 03 g of acid-washed
glass beads (425600 m; Sigma) were added,
and the tube was vortexed for 25 min. After
centrifugation for 5 min, 160 l of the aqueous
layer were transferred to a new tube, and 1 ml
of ethanol was added. After mixing and centrifugation for 2 min, the pellet was dried and
then dissolved in 50 l TE (pH 80). 1 l of this
DNA preparation was then used as template for a
PCR reaction using Taq polymerase (see above).
Yeast 14, 943951 (1998)

. .

948

Table 2. Efficiency of homologous integration during PCR-based manipulations of

S. pombe genes.
Genea
1
2
3
4
5
6
7
8
pom1
plo1
spn5
spn6
9
10
11

12

Manipulationb
Deletion
Deletion
Deletion
Deletion
Deletion
Deletion
Deletion
Deletion
C tag
Deletion
C tag
OE
C tag
C tag
C tag
Deletion
C tag
Deletion
C tag
N tag
Deletion
C tag
OE
N tag
Deletion
C tag
OE
N tag

Marker

Length of homologyc

ura4 +
ura4 +
ura4 +
ura4 +
ura4 +
ura4 +
ura4 +
ura4 +
kanr
ura4 +
kanr
kanr
kanr
kanr
kanr
kanr
kanr
kanr
kanr
kanr
kanr
kanr
kanr
kanr
kanr
kanr
kanr
kanr

76
76
76
76
76
76
76
76
80
76
80
80
80
80
80
80
80
70
70
80
81
79
70
70
60
60
60
60

&
&
&
&
&
&
&
&
&
&
&
&
&
&
&
&
&
&
&
&
&
&
&
&
&
&
&
&

76
76
76
76
76
76
76
76
80
76
80
80
80
80
80
80
80
70
70
80
80
80
76
70
60
60
60
60

Positives/total checkedd
1/2
2/9
1/9
1/9
1/16
2/4
1/4
12/19
4/12
6/16
26/30
26/33
8/20
4/14
10/11
4/10
15/18
2/2
15/15
16/17
2/4
12/12
4/8
8/48
4/4
11/12
7/8
20/24

Known genes are indicated by name: pom1 (Bahler and Pringle, 1998); plo1 (Ohkura et al., 1995); spn5
and spn6 (septin-encoding genes: Longtine et al., 1996; O. Al-Awar et al., in preparation). Genes
indicated by numbers do not yet have names; they were identified either in an overexpression screen
(J. B. and J. R. P., unpublished results) or from genomic sequences available in the database.
b
C tag, C-terminal tagging; N tag, N-terminal tagging; OE, overexpression (nmt1 modules without
tags).
c
Numbers of nucleotides of homology to genomic target regions (forward & reverse primers).
d
Number of transformants with homologous integration at target gene/total number of transformants
checked by PCR (see Materials and Methods). For a given gene, the data for experiments with
different C-terminal or N-terminal tags are pooled, as are the data from experiments using the different
versions of the nmt1 promoter.

One primer corresponded to sequences within the

transforming fragment. For modules containing
kanMX6, we used primer 5 -GCTAGGATA
CAGTTCTCACATCACATCCG-3 (for the modules in Figure 1B; corresponds to nucleotides
42
to
14 with respect to the kanr gene start codon in
the kanMX6 module) or primer 5 -GCTACT
GGATGGTTCAGTCAC-3 (for the modules in
Figure 2; corresponds to nucleotides
247 to

227 in the nmt1 promoter). To test deletions
 1998 John Wiley & Sons, Ltd.

made using ura4 + , we used one of the primers that

had been used to generate the transformation
fragment (Table 1). In all cases, the second primer
corresponded to a region of the targeted gene
outside the sequences covered by the transforming
fragment. A PCR product of the expected size
should be observed if the DNA had integrated by
homologous recombination at the targeted gene.
In some cases, PCR checks were performed over
both junctions of chromosomal and inserted
Yeast 14, 943951 (1998)

-
DNA, using appropriate primers. To determine if
the transforming fragment had integrated at a
single site in the genome, strains with a positive
PCR reaction were crossed against a wild-type
strain, tetrads were dissected, and the resulting
spore colonies were analysed for a 2:2 segregation
of G418 resistance or the Ura4 + phenotype
(together with the correlated positive PCR reaction). Some transformants were also checked by
Southern blotting (Sambrook et al., 1989) using
appropriate restriction fragments as probes.
Requests for plasmids
Send plasmid requests either to Jurg Bahler (fax:
(+44) 171 269 3258; e-mail: J.Bahler@icrf.icnet.uk)
or to Jian-Qiu Wu (fax: (+1) 919 962 0320; e-mail:
jianqiu@email.unc.edu). Investigators who plan to
use one or more of the plasmids for commercial
purposes should state this fact in their requests.
For plasmids containing the GFP(S65T) allele, a
Howard Hughes Medical Institute material transfer agreement must be signed. To obtain this
document, contact Roger Y. Tsien, Howard
Hughes Medical Institute, Cellular and Molecular
Medicine, University of California at San Diego,
9500 Gilman Drive, La Jolla, CA 92093-0647 (fax:
(+1) 619 534 5270) and state that you will use the
pFA plasmids with GFP(S65T) registered to
A. Wach and P. Philippsen. A copy of the material
transfer agreement must be received before the
plasmids can be shipped.
RESULTS AND DISCUSSION
Gene deletion and tagging of protein C-termini
To make gene deletions using the S. pombe
ura4 + marker, we used plasmid KS-ura4 (Figure
1A) as a template for PCR. The primers had a
total length of 100 nucleotides; their 5 ends were
targeting sequences corresponding to 76 nucleotides immediately upstream and downstream of
the open reading frame to be deleted, and their
3 ends were 24 nucleotides corresponding to
sequences on either side of the pBluescript multiple
cloning site (Table 1). Thus, the resulting PCR
products contained the ura4 + gene on a 18-kb
HindIII fragment, short flanking sequences
(130 bp) derived from the pBluescript KS- vector, and the 76-bp tails homologous to the genomic
sequences where integration was desired. Using
this approach, we deleted nine genes in strains
containing the ura4-D18 deletion, which removes
 1998 John Wiley & Sons, Ltd.

949
all sequences corresponding to those of the ura4 +
marker (Grimm and Kohli, 1988). The efficiencies
of homologous integration ranged from 6 to 63%
(Table 2). This approach allows deletion of the
entire open reading frame or of precisely specified
segments of C-terminal coding sequence, depending on the target sequences in the forward primer.
It should also be possible to perform targeted
mutagenesis directly in the S. pombe genome
by a variation of the approach described for S.
cerevisiae by Langle-Rouault and Jacobs (1995).
We then asked if modules containing the
kanMX6 marker (Wach et al., 1997; Longtine
et al., 1998) could be used in S. pombe. We found
that the heterologous kanMX6 module does
indeed function in S. pombe, allowing selection of
G418-resistant transformants (see Materials and
Methods). The kanMX6-based modules shown in
Figure 1B allow gene deletion, tagging of protein
C-termini with any of several tags, and deletion of
C-terminal sequences with or without the addition
of tags. Because the tagged genes are in their
normal genomic locations and under their own
promoters, such tagging should closely reflect the
wild-type situation. It should also be possible to
use these modules for gene expression studies: the
open reading frame of a target gene would be
replaced by a tag, whose expression would then
be analysed. Because all of the modules shown can
be amplified by PCR using the same primer
sequences (Table 1), a wide variety of gene
manipulations can be performed with a small
number of primers; in particular, the same forward
and reverse primers can be used for C-terminal
tagging with each of the available tags, and the
same reverse primer can be used also for gene
deletion. Using these modules and primers with 60
to 81 nucleotides of homology to genomic target
sequences, we have deleted and/or tagged nine
genes with efficiencies of homologous integration
ranging from 29 to 100% (Table 2).
Gene overexpression and tagging of protein
N-termini
To allow the regulated expression and/or overexpression of genes, tagging of protein N-termini
with any of several tags, and deletion of
N-terminal coding sequences with or without the
addition of tags, we also constructed kanMX6based modules containing the S. pombe nmt1 promoter (Figure 2). Each module was constructed
both with the wild-type promoter (Maundrell,
Yeast 14, 943951 (1998)

. .

950
1990; designated P3nmt1) and with two weaker
derivatives
[designated
P41nmt1
(medium
strength) and P81nmt1 (low strength)] that contain
mutations that attenuate both repressed and
induced levels of expression (Basi et al., 1993;
Forsburg, 1993; Maundrell, 1993). Each version of
the promoter allows expression at a relatively low
level (with 5 mg/l thiamine in the medium) or
a relatively high level (without thiamine in the
medium), thus allowing a wide range of protein
expression in the transformed cells. N-terminal
tagging can sometimes yield functional proteins in
cases where C-terminal tagging does not, and
overexpression of tagged or normal proteins can
sometimes facilitate localization or biochemical
studies. All of the modules shown in Figure 2 can
be amplified using the same forward primer, but
they require different reverse primers (Table 1).
Using these modules and primers with 60 to 80
nucleotides of homology to genomic target
sequences, we have manipulated four genes with
efficiencies of homologous integration ranging
from 17 to 94% (Table 2).
Conclusions
The methodology and modules described above
should facilitate the analysis of gene function in S.
pombe. The possibility of using the heterologous
kanMX6 marker and selecting for G418-resistant
cells makes it unnecessary to target genes in
specific strain backgrounds, and the few other
selectable markers available for S. pombe can still
be used for other purposes (e.g., selection of plasmids) in the targeted strains. Various precise gene
manipulations can be carried out directly in the
genome without any cloning steps. In most cases,
we obtained d50% efficiency of homologous integration of the PCR products (Table 2). Kaur et al.
(1997) reported efficiencies of homologous integration in S. pombe of 13% using PCR products with
40 bp of sequence flanking the target genes. The
higher efficiencies observed in our study may
reflect the longer (6080 bp) flanking sequences
used. The efficiencies of homologous integration
varied in different cases, but none of the 16 genes
that we manipulated by the approach described
here presented special difficulties. The efficiencies
of homologous integration observed here are comparable to those observed in S. cerevisiae (Baudin
et al., 1993; Wach et al., 1997; Longtine et al.,
1998), although shorter flanking sequences seem to
be sufficient in S. cerevisiae. The efficiencies of
 1998 John Wiley & Sons, Ltd.

homologous integration at the desired target gene

were high even with the modules containing the
nmt1 promoter, which have 12 kb of sequence
from the nmt1 locus itself.
The method described here presumably depends
on a high quality of the long (80- to 100nucleotide) primers used, but we have had very few
problems with the PAGE-purified primers provided by our supplier. The high cost of such long
primers is a drawback of the method, but the
modular design of the templates allows a variety of
manipulations to be performed with a few primers.
Moreover, the high efficiencies of homologous
integration encourage the use of shorter primers
(<80 nucleotides), especially because the screening
for homologous integrants by PCR is straightforward (see Materials and Methods). Our experience
suggests that the specific transformation protocol
used is also important for success with this
method: although electroporation works well for
transformation with plasmids, the lithium acetatebased method described here (see Materials and
Methods) seems to be more effective for integration of linear PCR products into the S. pombe
genome.
ACKNOWLEDGEMENTS
We thank Sandro Parisi, Jurg Kohli, Susan
Forsburg, Odile Mondesert, and Paul Russell for
the kind gift of plasmids and Primo Schar for
initial advice on PCR-based deletions. Work in
J.R.P.s laboratory was supported by National
Institutes of Health grant GM31006 and by funds
from the RJEG Trust. Work in P.P.s laboratory
was supported by a grant from the University
of Basel and by grant 95.0191 from the Swiss
Federal Office for Education and Science. J.B.
was supported by fellowships from the Swiss
National Science Foundation and the Ciba-GeigyJubilaums-Stiftung. M.S.L. was supported in part
by a postdoctoral fellowship from the National
Institutes of Health (GM15766).
REFERENCES
Bahler, J. and Pringle, J. R. (1998). Pom1p, a fission
yeast protein kinase that provides positional information for both polarized growth and cytokinesis.
Genes Dev. 12, 13561370.
Basi, G., Schmid, E. and Maundrell, K. (1993). TATA
box mutations in the Schizosaccharomyces pombe
nmt1 promoter affect transcription efficiency but not
Yeast 14, 943951 (1998)

-
the transcription start point or thiamine repressibility.
Gene 123, 131136.
Baudin, A., Ozier-Kalogeropoulos, O., Denouel, A.,
Lacroute, F. and Cullin, C. (1993). A simple and
efficient method for direct gene deletion in Saccharomyces cerevisiae. Nucl. Acids Res. 21, 33293330.
Evan, G. I., Lewis, G. K., Ramsay, G. and Bishop, J. M.
(1985). Isolation of monoclonal antibodies specific for
human c-myc proto-oncogene product. Mol. Cell.
Biol. 5, 36103616.
Field, J., Nikawa, J.-I., Broek, D., et al. (1988). Purification of a RAS-responsive adenylyl cyclase complex
from Saccharomyces cerevisiae by use of an epitope
addition method. Mol. Cell. Biol. 8, 21592165.
Forsburg, S. L. (1993). Comparison of Schizosaccharomyces pombe expression systems. Nucl. Acids Res. 21,
29552956.
Grallert, B., Nurse, P. and Patterson, T. E. (1993). A
study of integrative transformation in Schizosaccharomyces pombe. Mol. Gen. Genet. 238, 2632.
Grimm, C. and Kohli, J. (1988). Observations on integrative transformation in Schizosaccharomyces
pombe. Mol. Gen. Genet. 215, 8793.
Grimm, C., Kohli, J., Murray, J. and Maundrell, K.
(1988). Genetic engineering of Schizosaccharomyces
pombe: a system for gene disruption and replacement
using the ura4 gene as a selectable marker. Mol. Gen.
Genet. 215, 8186.
Heim, R., Cubitt, A. B. and Tsien, R. Y. (1995).
Improved green fluorescence. Nature 373, 663664.
Hoffman, C. S. and Winston, F. (1987). A ten-minute
DNA preparation from yeast efficiently releases
autonomous plasmids for transformation of
Escherichia coli. Gene 57, 267272.
Kaur, R., Ingavale, S. S. and Bachhawat, A. K. (1997).
PCR-mediated direct gene disruption in Schizosaccharomyces pombe. Nucl. Acids Res. 25, 10801081.
Keeney, J. B. and Boeke, J. D. (1994). Efficient targeted
integration at leu132 and ura4294 in Schizosaccharomyces pombe. Genetics 136, 849856.
Kolodziej, P. A. and Young, R. A. (1991). Epitope
tagging and protein surveillance. Methods Enzymol.
194, 508519.
Langle-Rouault, F. and Jacobs, E. (1995). A method for
performing precise alterations in the yeast genome
using a recyclable selectable marker. Nucl. Acids Res.
23, 30793081.
Leupold, U. (1970). Genetical methods for Schizosaccharomyces pombe. Methods Cell Physiol. 4, 169177.
Longtine, M. S., DeMarini, D. J., Valencik, M. L., et al.
(1996). The septins: roles in cytokinesis and other
processes. Curr. Opin. Cell Biol. 8, 106119.
Longtine, M. S., McKenzie III, A., DeMarini, D. J.,
et al. (1998). Additional modules for versatile and

 1998 John Wiley & Sons, Ltd.

951
economical PCR-based gene deletion and modification in Saccharomyces cerevisiae. Yeast 13, 953961.
Maundrell, K. (1990). nmt1 of fission yeast. A highly
transcribed gene completely repressed by thiamine.
J. Biol. Chem. 265, 1085710864.
Maundrell, K. (1993). Thiamine-repressible expression
vectors pREP and pRIP for fission yeast. Gene 123,
127130.
Moreno, S., Klar, A. and Nurse, P. (1991). Molecular
genetic analysis of fission yeast Schizosaccharomyces
pombe. Methods Enzymol. 194, 795823.
Munro, S. and Pelham, H. R. B. (1987). A C-terminal
signal prevents secretion of luminal ER proteins. Cell
48, 899907.
Ohkura, H., Hagan, I. M. and Glover, D. M. (1995).
The conserved Schizosaccharomyces pombe kinase
plo1, required to form a bipolar spindle, the actin
ring, and septum, can drive septum formation in G1
and G2 cells. Genes Dev. 9, 10591073.
Prasher, D. C. (1995). Using GFP to see the light.
Trends Genet. 11, 320323.
Rothstein, R. J. (1983). One-step gene disruption in
yeast. Methods Enzymol. 101, 202211.
Sambrook, J., Fritsch, E. F. and Maniatis, T. (1989).
Molecular Cloning: A Laboratory Manual, 2nd edn.
Cold Spring Harbor Laboratory Press, Cold Spring
Harbor, NY.
Smith, D. B., Davern, K. M., Board, P. G., Tiu, W. U.,
Garcia, E. G. and Mitchell, G. F. (1986). Mr 26,000
antigen of Schistosoma japonicum recognized by
resistant WEHI 129/J mice is a parasite glutathione
S-transferase. Proc. Natl. Acad. Sci. USA 83, 8703
8707.
Smith, D. B. and Johnson, K. S. (1988). Single-step
purification of polypeptides expressed in Escherichia
coli as fusions with glutathione S-transferase. Gene 67,
3140.
Steiner, S. and Philippsen, P. (1994). Sequence and
promoter analysis of the highly expressed TEF gene of
the filamentous fungus Ashbya gossypii. Mol. Gen.
Genet. 242, 263271.
Tyers, M., Tokiwa, G., Nash, R. and Futcher, B. (1992).
The Cln3-Cdc28 kinase complex of S. cerevisiae is
regulated by proteolysis and phosphorylation. EMBO
J. 11, 17731784.
Wach, A., Brachat, A., Pohlmann, R. and Philippsen, P.
(1994). New heterologous modules for classical
or PCR-based gene disruptions in Saccharomyces
cerevisiae. Yeast 10, 17931808.
Wach, A., Brachat, A., Alberti-Segui, C., Rebischung,
C. and Philippsen, P. (1997). Heterologous HIS3
marker and GFP reporter modules for PCR-targeting
in Saccharomyces cerevisiae. Yeast 13, 10651075.

Yeast 14, 943951 (1998)