CBB 20003 Principles of Microbiology

Experiment 6
Fungal Identification
Prelab Reading
The fungi constitute a group of heterotrophic organisms devoid of chlorophyll but that
historically have been compared to plants. They resemble plants in that, with few exceptions,
they have definite cell walls and reproduce by means of spores. However, fungi do not
possess stems, roots, or leaves as do higher plants, and have not developed complex vascular
system. Another characteristic that separates fungi the plants is the fact that their primary
carbohydrate storage product is glycogen rather than starch. Fungi are usually filamentous
and multicellular; their nuclei, although small, can be demonstrated with relative ease; and
their somatic structures, with few exceptions, exhibit little differentiation and practically no
division of labor.
Some fungal strains are beneficial, for example in fermentation and flavur development, but
others can result in food spoilage and diseases. In order to control fungal growth, it is
essential that effective methods are available for the identification and characterization of
these organisms. Recently, both morphological (macro and micro) and molecular (genetic)base techniques were considered to identify a fungal isolate. The most important advance in
this area has been the introduction of rapid techniques, including automated biochemical
systems, DNA sequencebased identification, and genetic typing methods such as repetitive
sequencebased polymerase chain reaction (repPCR).
Experimental Procedure
(A) Inoculation of Fungal Culture
1. Flame the inoculation needle until red hot.
2. Using the sterile inoculation needle, obtain a small amount of fungal material from the
7 days old of Penicillium sp. on PDA plate.
3. Inoculate on a fresh PDA plate by stabbing the needle into the agar.
4. Incubate the plate at 30 C for 7 days.
5. Measure the diameter of the fungal colony.
6. Repeat the protocol for Aspergillus niger and Rhizopus sp.
(B) Observation of Macromorphology
1. Record the major macroscopic features such as the diameter of colony, color of
conidia (if present), mycelia color, reverse color of the plate, color texture and
pigment production (if present).
(C) Observation under Light Microscope
1. Place a drop of the LPCB onto a clean microscope slide

CBB 20003 Principles of Microbiology

2. Using the inoculation needle, pick a small portion of the fungal colony and place it on
the LPCB drop. Mix the drop and place a cover slip over the drop gently and observe
the slide under the microscope from low to high magnification (40 X, 100X and
400X).
3. Draw and describe your observation, giving attention to the structure of the hyphae,
mycelia, fruiting bodies and spores.
(D) Determination of Fungal Spore Count
1. Prepare the spore suspension by suspending the spores from A. niger in 1 ml of
sterile distilled water. Mix spore solution well.
2. Place the coverslip over the hemocytometer. Add 10 l of spore solution to each side
of the hemocytometer. Place the pipette tip at the edge of the coverslip, and allow the
spore suspension to fill the space by capillary action. Fill the entire volume of the
chamber.
3. Observe under light microscope.
4. Count number of spores in zones A, B, C, D and E on both sides of hemocytometer.
a.
If a spore falls on the left or bottom line DO NOT count it.
b.
If a spore falls on the right or top line DO count it.

Total spores = Number of spores in A + B + C+ D

Average of total cells

= (A + B + C+ D)/4
= [(A + B + C+ D)/4] How many times the sample
has been diluted
= X cells

To obtain spores/ml, the volume of the hemocytometer must be calculated:

Volume = 1 mm (length) 1 mm (width) 0.1 mm (height)
Convert from mm to cm
Volume
= 0.1cm 0.1cm 0.01cm
= 0.0001 cm3
= 1 10-4 cm3
3
1 cm = 1ml
Therefore, 1 x 10-4 cm3 = 1 10-4 ml
Therefore spores/ml = X spores/ 1 10-4 ml
In the end, Spore/ml

= X 104 spores/ ml

CBB 20003 Principles of Microbiology

Tutorial Question
1.

Basic Local Alignment Search Tool (BLAST) compares nucleotide or protein

sequences to sequence databases and calculates the statistical significance of the
matches. BLAST can be used to infer functional and evolutionary relationship
between sequences as well as help identify member of gene families.

You have isolated an amylase-producing fungal strain from broad bean seed. The genomic
DNA was extracted and an amplicon of X base pairs was amplified via Polymerase Chain
Reaction (PCR). The amplicon was subjected for sequencing. The below sequence was
obtained.
AGSGSCCTCGTGGCCCAACCTCCCACCCTTGTCTCTATACACCTGTTGCTTTGGCG
GGCCCACCGGGGCCACCTGGTCGCCGGGGGACATCTGTCCCCGGGCCCGCGCCC
GCCGAAGCGCTCTGTGAACCCTGATGAAGATGGGCTGTCTGAGTACTATGAAAAT
TGTCAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGC
GAAATGCGATAAGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAAC
GCACATTGCGCCCCCTGGCATTCCGGGGGGCATGCCTGTCCGAGCGTCATTTCTGC
CCTCAAGCACGGCTTGTGTGTTGGGTGCGGTCCCCCCGGGGACCTGCCCGAAAGG
CAGCGGCGACGTCCGTCTGGTCCTCGAGCGTATGGGGCTTTGTCACTCGCTCGGG
AAGGACTGGCGGGGGTTGGTCACCACCAAAATTTTACCACGGTTGACCTCGGATC
AGGTAG
BLAST for species with genetic similarity from the database. Attach the results in your report
(Print-screen) and analyze the data. Give a conclusion of the molecular identification of this
isolate.