European Journal of Phycology

ISSN: 0967-0262 (Print) 1469-4433 (Online) Journal homepage: http://www.tandfonline.com/loi/tejp20

Unarmoured dinoflagellates with a small

hyposome: Torodinium and Lebouridinium gen.
nov. for Katodinium glaucum (Gymnodiniales,
Dinophyceae)
Fernando Gmez, Haruyoshi Takayama, David Moreira & Purificacin LpezGarca
To cite this article: Fernando Gmez, Haruyoshi Takayama, David Moreira & Purificacin
Lpez-Garca (2016) Unarmoured dinoflagellates with a small hyposome: Torodinium and
Lebouridinium gen. nov. for Katodinium glaucum (Gymnodiniales, Dinophyceae), European
Journal of Phycology, 51:2, 226-241, DOI: 10.1080/09670262.2015.1126767
To link to this article: http://dx.doi.org/10.1080/09670262.2015.1126767

Published online: 04 Mar 2016.

Submit your article to this journal

Article views: 14

View related articles

View Crossmark data

Full Terms & Conditions of access and use can be found at

http://www.tandfonline.com/action/journalInformation?journalCode=tejp20
Download by: [Fernando Gmez]

Date: 05 April 2016, At: 13:26

Eur. J. Phycol. (2016), 51: 226241

Unarmoured dinoagellates with a small hyposome:

Torodinium and Lebouridinium gen. nov. for Katodinium
glaucum (Gymnodiniales, Dinophyceae)

FERNANDO GMEZ1, HARUYOSHI TAKAYAMA2, DAVID MOREIRA3 AND PURIFICACIN

LPEZ-GARCA3
1

Laboratory of Plankton Systems, Oceanographic Institute, University of So Paulo, So Paulo 05508900, Brazil
Hatami 52013, Ondo-cho, Kure, Hiroshima 7371207, Japan
3
Unit dEcologie, Systmatique et Evolution, CNRS UMR 8079, Universit Paris-Sud, 91405 Orsay Cedex, France
2

Downloaded by [Fernando Gmez] at 13:26 05 April 2016

(Received 13 August 2015; revised 23 September 2015; accepted 12 October 2015)

We investigated the morphology and evolutionary relationships of Torodinium spp. and Katodinium glaucum, unarmoured dinoagellates characterized by a small hyposome. An emended generic description of Torodinium was
proposed based on light and scanning electron microscopy. Torodinium exhibited a unique combination of morphological features including a minute hyposome, a long episome with longitudinal ribs and a canal of unknown function on
the dextro-lateral side. Unlike any known dinoagellate both cingulum and sulcus extended in the episome. The apex
surface showed ribs that converged in a bill-like projection. The shape of the apical groove was a circular spiral that
extended around the apex running in 2.5 turns in an anticlockwise direction. The type species T. teredo was usually
longer than T. robustum. The longitudinal outline of T. teredo was linear, with almost parallel margins, a circular
transversal section, a relatively large hyposome and a conspicuous bill-like projection. The longitudinal outline of
T. robustum was oblong, widened in the middle, with an ellipsoidal transversal section, a small hyposome and a less
prominent bill-like projection. Several morphological features of Katodinium glaucum (=Gyrodinium glaucum)
resembled Gyrodinium, such as the cingular displacement, longitudinal ribs, trichocysts, rod-shaped and refractile
bodies and a capsule that surrounded the spherical nucleus. Distinctive features of K. glaucum were the horseshoeshaped apical groove under a tongue-shaped notch pointed towards the dorsal side, and a bifurcated proximal end of the
cingulum. Phylogenetic analysis revealed that Torodinium spp. and K. glaucum formed two independent lineages with
no close relationships with other known dinoagellates. The morphology of K. glaucum was distant from the type
species of Katodinium. We propose the new genus and combination Lebouridinium glaucum gen. nov., comb. nov. for
the species Katodinium glaucum.
Key words: acrobase, apical groove, athecate Dinoagellata, Gymnodinium, Gyrodinium, molecular phylogeny, naked
dinoagellate, new genus, taxonomy

INTRODUCTION
Two major groups of dinoagellates can be distinguished based on morphological criteria: thecate or
armoured species with discernible thecal plates and
athecate, unarmoured or naked species without
plates or with plates that are barely visible under the
light microscope. Unarmoured dinoagellates,
especially gymnodinioid forms, tend to be delicate,
easily damaged by net sampling and often too distorted by xation to be identied. Live specimens can
be easily deformed when they are examined under the
microscope (Kofoid & Swezy, 1921).

Correspondence to: Fernando Gmez. (e-mail: fernando.

gomez@toplancton.com).

Gymnodinium teredo C.H.G. Pouchet was

described as a fusiform unarmoured dinoagellate
with a very large episome that occupied most of the
cell body, a posterior cingulum and a much reduced
hyposome (Pouchet, 1885). Schtt (1895) illustrated
G. teredo in more detail, including the cell shape
variability, particularly the length of the episome, as
later remarked by Lebour (1917). Kofoid & Swezy
(1921) used the marked torsion of the sulcus, amounting to 0.5 turns, to support the erection of Torodinium
Kof. & Swezy as a genus independent from
Gymnodinium F. Stein. Kofoid & Swezy proposed
the type, Torodinium teredo (C.H.G. Pouchet) Kof.
& Swezy, and the new species Torodinium robustum
Kof. & Swezy based on their own observations and
some of the illustrations of G. teredo from Schtt

ISSN 0967-0262 (print)/ISSN 1469-4433 (online)/16/020226-241 2016 British Phycological Society

http://dx.doi.org/10.1080/09670262.2015.1126767

Downloaded by [Fernando Gmez] at 13:26 05 April 2016

Torodinium and Lebouridinium gen. nov.

(1895). Apparently Kofoid & Swezy (1921) did not
observe any specimens of T. teredo. However, they
considered that the apex of T. teredo lacked the apical
groove (which they called reversed terminal anterior
loop of the sulcus). This feature, together with the
relative ratio between the length and the transdiameter, with a stouter episome in T. robustum, was
used for species distinction.
The two Torodinium species have been commonly
reported in the literature and further authors agreed
with the diagnosis given by Kofoid & Swezy, with
no new taxonomic information (Elbrchter, 1979;
Dodge, 1982; Sournia, 1986; Hansen & Larsen,
1992; Steidinger & Tangen, 1997; Grate-Lizrraga
& Mucio-Mrquez, 2013). Gmez (2009) reported
that some specimens of Torodinium showed a body
extension that protrudes from the hyposome and
accumulation bodies (tentative food vacuoles).
These features supported the mixotrophic character
of Torodinium.
Kofoid & Swezy (1921, p. 390) reported a link
between Torodinium and Spirodinium glaucum M.
Lebour. The latter species was further reported as
Gyrodinium glaucum (M. Lebour) Kof. & Swezy,
Massartia glauca (M. Lebour) J. Schiller and
Katodinium glaucum (M. Lebour) A.R. Loebl.
Katodinium glaucum is devoid of plastids, with a
postmedian cingulum, marked cingular displacement, apex with a tongue-shaped notch, and the
cell surface is covered with longitudinal ribs
(Takayama, 1985, 1998). Daugbjerg et al. (2000)
placed K. glaucum again into the genus
Gyrodinium Kof. & Swezy. Kim & Kim (2007)
retained the name Katodinium glaucum because
they did not nd a close relationship with
Gyrodinium or other dinoagellates in their LSU
rDNA phylogenetic analysis. More than 40 species
have been described or transferred into the genus
Katodinium Fott. The type species, K. nieuportense
(W. Conrad) Loebl. & A.R. Loebl., only known
from the original description, is an unarmoured
dinoagellate with two to four plate-like, yellowish
chloroplasts and numerous, minute oil droplets. Its
apex is rounded and the cell surface smooth
(Conrad, 1926). Further studies have revealed that
Katodinium was a polyphyletic group that even
included thecate species (Hansen, 1995; Murray
et al., 2007; Calado, 2011; Kang et al., 2015).
Re et al. (2015) provided new sequences of
Torodinium and K. glaucum. In their SSU rDNA
phylogeny, T. robustum and K. glaucum branched
together with very low support (Re et al., 2015).
In this study, we provide a detailed study of the
morphology of the two species of Torodinium and
Katodinium glaucum. We re-examined the molecular phylogeny of these taxa with new sequences of
Torodinium spp.

227
MATERIALS AND METHODS
Sampling and isolation of material
In the Mediterranean Sea, the specimens of Torodinium spp.
were collected from October 2007 to September 2008 by
slowly ltering surface seawater taken from the pier of the
Station Marine dEndoume at Marseille (431648.05N, 5
2056.22E, bottom depth 3 m). A strainer of 20 m mesh
size was used to collect planktonic organisms from water
volumes ranging between 10 and 100 l, depending on particle
concentration. The plankton concentrate was scanned in settling chambers at 100 magnication with an inverted microscope (Nikon Eclipse TE200, Nikon Inc., Tokyo, Japan).
Cells were photographed alive at 200 or 400 magnication
with a Nikon Coolpix E995 digital camera. During the sampling on 1721 December 2007, the distinction between
species was not dened and we pooled a total of 20 specimens of Torodinium spp. into a single sample for PCR amplication and cloning (isolated cells FG212, FG213, FG21
4, GenBank accession numbers KR139781, KR139782,
KR139783). Sporadic samplings were carried out in the
Bay of Marseille at the SOMLIT (Service dObservation en
Milieu LITtoral) site (431452.8N, 51752.8E). Samples
were collected with Niskin bottles at the surface and 55 m
depth and analysed following the procedure described above.
In this case, a single specimen (#FG187) was analysed by
single-cell PCR (GenBank accession number KR139784).
Further specimens were collected using the same method
from October 2008 to August 2009 in the surface waters
(depth of 2 m) of the port of Banyuls-sur-Mer, France
(422850N, 30809E). The concentrated sample was
examined in Utermhl chambers with an inverted microscope (Olympus IX51, Olympus Inc., Tokyo, Japan) and
photographed with an Olympus DP71 digital camera.
Sampling continued from September 2009 to February
2010 in the Bay of Villefranche-sur-Mer, Ligurian Sea. For
this location, sampling was performed at the long-term monitoring site Point B (434110N, 71900E, water column
depth ~80 m). Water column samples (080 m) were
obtained using a phytoplankton net (53 m mesh size,
54 cm diameter, 280 cm length). Samples were prepared
according to the same procedure as described above and
specimens were observed with an inverted microscope
(Olympus IX51) and photographed with an Olympus DP71
digital camera. Sampling continued from May 2012 to
February 2013 in the port of Valencia, Spain (392738.13
N, 01921.29W, water column depth of 4 m). Specimens
were obtained using a phytoplankton net (20 m mesh size).
Samples were prepared according to the same procedure as
described above and specimens were observed with an
inverted microscope (Nikon Eclipse T2000) and photographed with an Olympus DP71 digital camera.
In addition, samples were collected during the BOUM
(Biogeochemistry from the Oligotrophic to the Ultra-oligotrophic Mediterranean) cruise on board R/V LAtalante from
the south of France to the south of Cyprus (20 June18 July
2008). Seawater samples were collected with Niskin bottles
from 30 stations. At each station 6 depths were sampled
between 5 and 125 m, with an additional sample at 250 m
depth. These samples were preserved with acid Lugols solution and stored at 5C. Samples of 500 ml were concentrated
via sedimentation in glass cylinders. The top 450 ml of

F. Gmez et al.
sample was slowly siphoned off with small-bore tubing over
6 days. The remaining 50 ml of concentrate, representing 500
ml whole water, was then settled in composite settling chambers. The sample was examined in Utermhl chambers at
100 magnication with a Nikon inverted microscope
(Nikon Eclipse TE200) and the specimens were photographed with a digital camera (Nikon Coolpix E995).
In the North Pacic Ocean, samples were collected with a
plankton net (30 m mesh size) from the coastal Inland Sea of
Japan at Kure (341030N, 1323321.6E). The living concentrated samples were observed at 400 and 1000 magnication with an upright microscope (Olympus BH2), and
photographed with a digital camera (Canon EOS Kiss F.,
Canon Inc., Tokyo, Japan).

Downloaded by [Fernando Gmez] at 13:26 05 April 2016

Scanning electron microscopy

Seawater samples were collected with a bucket from the
coastal areas of the Inland Sea of Japan along Hiroshima
Prefecture in 19801985 as described in Takayama (1998).
For scanning electron microscopy, dinoagellate cells were
pipetted individually, rinsed three times in ltered seawater
and placed on poly-lysine coated coverslips. They were xed
in 2% osmium tetroxide in seawater for 20 min. After washing in distilled water for 30 min, cells were dehydrated in an
ethanol series, 10 min in each change of 30%, 50%, 70%,
90% and 95%, followed by two 30 min changes in absolute
ethanol, and nally transferred to amyl acetate. The cells
were critical-point dried using liquid carbon dioxide and
ion sputter-coated with gold. They were observed using a
scanning electron microscope (Hitachi S430, Hitachi Ltd,
Tokyo, Japan) operated at 15 kV. The method is explained in
detail in Takayama (1998). Pictures were scanned and presented on a black background using Adobe Photoshop CS3
(Adobe Systems Inc., San Jos, California, USA).

PCR amplication of small subunit rRNA genes (SSU

rDNAs) and sequencing
For molecular analysis, each specimen was photographed and
then micropipetted individually with a ne capillary into a
clean chamber and washed several times in a series of drops
of 0.2 m-ltered and sterilized seawater. Finally, the specimen was placed in a 0.2 ml tube (ABgene; Thermo Fisher
Scientic Inc., Courtaboeuf, France) lled with several drops
of absolute ethanol. The sample was kept at room temperature
and in darkness until the molecular analysis could be performed. The specimens xed in ethanol were centrifuged for
5 min at 504 g. The ethanol was then evaporated in a vacuum
desiccator and single cells were resuspended directly in 25 l
of Ex TaKaRa buffer (TaKaRa, distributed by Lonza,
Levallois-Perret, France). PCRs were done in a volume of
3050 l reaction mix containing 1020 pmol of the eukaryotic-specic SSU rDNA primers EK-42F (5
CTCAARGAYTAAGCCATGCA3) and EK-1520R (5
CYGCAGGTTCACCTAC3) (Lpez-Garca et al., 2001).
PCRs were performed under the following conditions: 2 min
denaturation at 94C; 10 cycles of touch-down PCR (denaturation at 94C for 15 s; a 30 s annealing step at
decreasing temperature from 65 down to 55C, employing
a 1C decrease with each cycle, extension at 72C for 2
min); 20 additional cycles at 55C annealing temperature;

228
and a nal elongation step of 7 min at 72C. A nested
PCR was then carried out using 25 l of the rst PCR
products in a GoTaq (Promega, Lyon, France) polymerase
reaction mix containing the eukaryotic-specic primers
EK-82F (5GAAACTGCGAATGGCTC3) and EK1498R (5CACCTACGGAAACCTTGTTA3) (LpezGarca et al., 2001) and similar PCR conditions as
described above. Negative controls without template
DNA were used at all amplication steps. Amplicons of
the expected size (~1700 base pairs) were then sequenced
bi-directionally using primers EK-82F and EK-1498R
using an automated 96-capillary ABI PRISM 3730xl
sequencer (BC Genomics, Takeley, UK). In other samples, the amplied product was subsequently cloned
using the Topo TA Cloning system (Invitrogen, Life
Technologies, Saint Aubin, France) following the instructions provided by the manufacturers. Three clones were
picked and the corresponding insert amplied using vector primers. Amplicons of the expected size were fully
sequenced (Cogenics, Meylan, France) with vector primers using the same automated sequencer.

Phylogenetic analyses
The new SSU rDNA sequences were aligned to a large multiple sequence alignment containing ~1500 publicly available
complete or nearly complete (>1300 base pairs) dinoagellate sequences using the prole alignment option of
MUSCLE 3.7 (Edgar, 2004). The resulting alignment was
manually inspected using the program ED of the MUST
package (Philippe, 1993). Ambiguously aligned regions and
gaps were excluded in phylogenetic analyses. Preliminary
phylogenetic trees with all sequences were constructed
using the Neighbour joining method (Saitou & Nei, 1987)
implemented in the MUST package (Philippe, 1993). These
trees allowed identication of the closest relatives of our
sequences together with a sample of other dinoagellate
species, which were selected to carry out more computationally intensive Bayesian inference analyses. These analyses
were done with the program MrBayes 3.2.3 (Ronquist et al.,
2012) applying a GTR + 4 model of nucleotide substitution,
taking into account a -shaped distribution of substitution
rates with four rate categories. Four chains (three heated and
one cold) were run for 2 million generations with trees
sampled every 100 generations. The rst 5000 trees were
discarded as burn-in and a majority-rule consensus tree was
constructed with the remaining trees. Our sequences were
deposited in DDBJ/EMBL/GenBank under accession numbers KR139781KR139784.

RESULTS
Light microscopy of Torodinium spp.
The observations of Torodinium, with more or less
slender co-existing specimens, were sporadic in the
sampling areas. The separation of the two species of
Torodinium in the literature has traditionally been
based on morphometric parameters: T. teredo for larger slender specimens [length more than 3.54 depths
(=transdiameter sensu Kofoid & Swezy)] and T.
robustum for shorter and stouter specimens. We

Downloaded by [Fernando Gmez] at 13:26 05 April 2016

Torodinium and Lebouridinium gen. nov.

propose the separation of both species based on cell
length, with Torodinium teredo (55100 m long)
usually longer than T. robustum (4075 m long),
and outline of the cells. The outline of T. teredo was
linear, with almost parallel margins, while the outline
of T. robustum was oblong, widened in the middle
(Figs 124). The hyposome and the bill-like projection, the latter further described in detail, were more
conspicuous in T. teredo than in T. robustum. From the
pier of the Marine Station of Endoume, some records
corresponded to larger and more slender specimens in
agreement with the denition of T. teredo (Figs 16).
Other observations corresponded to shorter specimens
with an oblong shape in agreement with our denition
of T. robustum (Figs 711). One of the specimens of T.
teredo showed an interesting morphological feature
with a kind of edging of crenate margin (with rounded
teeth) that extended longitudinally in the episome
(Fig. 1).
Numerous specimens were observed in Lugol-xed
samples collected from the open Mediterranean Sea,
from Cyprus to the Gulf of Lions in summer 2008.
Torodinium reached an abundance of up to 64 cells l1.
Several of these xed specimens showed posterior
body extension in samples collected in the open
waters of the Sicily Strait, Algerian Basin and Gulf
of Lions (Fig. 12).
One specimen was isolated from a sample collected
off the Bay of Marseille at 55 m depth in July 2008
(Fig. 13). This specimen, ascribed to T. robustum,
showed a prominent vacuole and a stouter cell body
(Fig. 13). It was isolated for single-cell PCR analysis
(isolated cell FG187, GenBank accession number
KR139784).
Other specimens were observed in live samples
from Banyuls-sur-Mer (Figs 1417). The presence of
chlorophyll a was conrmed with epiuorescence
microscopy (Fig. 16). The cell showed longitudinal
chloroplasts along the antero-posterior axis in the dorsal side. The chloroplasts were oblique or transversal in
the apex and the cingulum (Fig. 16). All the observed
specimens of Torodinium showed slow swimming and
the length of the longitudinal agellum was similar to
the cell length (Fig. 17; see video S1 as supplementary
information, https://youtu.be/Y7RPT-UdqeE). Few
specimens were observed from samples collected at
Villefranche-sur-Mer (Fig. 18). This was very likely
due to the inappropriate sampling using a coarse plankton net (53 m mesh size) (Fig. 18). Torodinium teredo
and T. robustum co-existed in the samples from the
port of Valencia, with more frequent observations of T.
robustum. Under light microscopy the episomes of T.
robustum (Figs 1923) and T. teredo (Fig. 24) were
covered by longitudinal ribs between the cingulum and
the basis of the apex. Both species showed an apical
groove (named reversed terminal anterior loop of the
sulcus sensu Kofoid & Swezy) that was hardly visible
in LM (Figs 2324).

229
Emended generic description of Torodinium based on
scanning electron microscopy
The detailed morphology was examined from specimens of Torodinium spp. collected from the south of
Japan (Figs 2550). We rst established the orientation of the cells, whose ventral side was dened by the
position of the sulcus and the pore of the longitudinal
agellum. The hyposome was small and conical. The
ventral side of the hyposome was concave and occupied by the posterior end of the sulcus below the pore
of the longitudinal agellum (Figs 2528).
The sulcus extended for almost the entire ventral
side of the hyposome, occupying about 1/3 of the
contour of the hyposome (Figs 2829). The pore of
the longitudinal agellum was located in the sulcus
between the transversal agellar pore and the posterior end of the cingulum (Figs 2530). The posterior end of the sulcus, directed posteriorly from the
longitudinal agellar pore, was placed in a wide
concave area surrounded by the cingulum and the
hyposome in the left and right margins, respectively
(Figs 2627). The texture of the sulcus surface was
rugose, similar to the surface of the rest of the cell.
Towards the episome and after the longitudinal
agellar pore, the sulcus became thinner and
extended anteriorly describing a loop of about 1/6
of the cell contour towards the dextral side
(Figs 2632). Anteriorly, from the longitudinal agellar pore, the anterior margin of the sulcus
showed an overhanging tube-like structure that
separated it from the anterior extension of the cingulum (Figs 2628, 33). We named this structure
the sulcal lip. The sulcus extended along the episome to end below the beginning of the apical
groove (Fig. 34).
The transversal and longitudinal agellar pores
were separated by the sulcal lip (Fig. 26). The
pore of the transversal agellum delimited the two
sections of the cingulum. The transversal agellum
encircled the posterior section of the cingulum
above the hyposome and the posterior end of the
sulcus (Fig. 34). In contrast to the sulcus, the surface of the posterior cingulum was smooth and
lacked any ornamentation (Figs 28, 34). The anterior section of the cingulum was thinner than the
posterior one. The anterior cingulum continued parallel to the anterior (left) margin of the sulcus,
describing the same looping (Figs 28, 34). The
anterior extensions of the sulcus and cingulum
were separated by the sulcal lip from the agellar
pore to the convex basis of the episome. The anterior cingulum diverged from the sulcal lip and
shortly ended (Fig. 34).
Based on these observations, we established that
the cell of T. teredo showed a circular transversal
section, whereas T. robustum was laterally compressed instead of dorsoventrally compressed as

230

Downloaded by [Fernando Gmez] at 13:26 05 April 2016

F. Gmez et al.

Figs 124. Light microscopy (LM) images of Torodinium teredo and T. robustum. Bright eld optics, except Fig. 16 by epiuorescence microscopy. Figs 111. Specimens from Endoume, Marseille, France. Figs 16. T. teredo. Figs 711. T. robustum. Fig. 12.
(continued)

Downloaded by [Fernando Gmez] at 13:26 05 April 2016

Torodinium and Lebouridinium gen. nov.

previously reported (Fig. 28). The transdiameter sensu
Kofoid & Swezy corresponded to the cell depth (ventral to dorsal distance). The episome occupied about 9/
10 of the cell length and ended in a hemispheric
bonnet-shaped apex (Figs 27, 3550). The cell surface
of the episome was covered by well-marked longitudinal ribs. There were 1214 longitudinal ribs (~0.35
m wide) that were equidistant and separated by 34
m (Figs 3550). In addition to the ribs, at least on the
dextro-lateral side, the episome surface was covered
in ne longitudinal striae (Fig. 36). In addition to the
anterior extensions of the sulcus and cingulum, the
episome showed a third groove. This deep groove
appeared in the middle of a concave area on the
dextro-lateral side (Figs 33, 35, 38, 41). This concave
area was not observed in live cells and it could not be
ruled out that the depression of the deep groove was
due to a sample preparation artefact. The anterior and
posterior ends of this groove were different (Figs 33,
35). The anterior one ended in a straight line between
two longitudinal ribs that converged at their anterior
ends (Fig. 35). The posterior end of the groove was
located above the distal end of the anterior cingulum
and showed a short loop towards the left side
(Figs 2833, 35). We were unable to nd an analogous
structure in any other dinoagellate. This straight deep
groove was named a slender canal, anterior pusule
by Kofoid & Swezy (1921, p. 391). Following this
terminology, we named this groove the lateral canal.
The hemispherical apex showed unique morphological structures such as a spiral-shaped apical groove
and ribs that converged in a pointed projection
(Figs 3750). The posterior end of the apical groove
began above the anterior end of the sulcus (Figs 39,
55, 58). The apical groove continued below the basis
of the pointed projection and took 2.5 turns describing
an anticlockwise spiral that ended in the dextro-lateral
side, pointing to the lateral canal in T. teredo (Figs 42
45, 53).
The hemispherical apex showed a pointed projection oriented towards the sinistro-lateral or dorsal
sides in T. teredo and T. robustum, respectively
(Figs 27, 4250, 53, 57). This structure was here
named bill-like projection. Six or seven ribs coming
from the basis of the apical groove converged from
each side into the bill-like projection (Figs 27, 4250).
These transversal or oblique apical ribs were thinner
and they were not connected with the prominent longitudinal ribs on the episome. The most posterior apical
rib was placed above the apical groove (Figs 4850,

231
53, 57). The rst apical rib emerged in the dextrolateral side from the base of the apical groove. Each rib
emerged at each side of the basis of the apical groove
and converged between the sinistro-lateral and dorsal
sides. The last pair of apical ribs joined in a triangular
structure (Figs 48, 53, 57).
Differences between T. teredo and T. robustum
As reported above, under light microscopy T. teredo was usually longer than T. robustum. The
longitudinal outline of T. teredo was linear, with
almost parallel margins, a circular transversal section, a relatively large hyposome and a conspicuous bill-like projection. The longitudinal outline of
T. robustum was oblong, widened in the middle,
with an ellipsoidal transversal section, a small
hyposome and a less prominent bill-like projection. Based on SEM, the transversal section was
circular (Figs 5354) and ellipsoidal (Figs 5758)
in T. teredo and T. robustum, respectively.
Torodinium teredo (Figs 2729, 4647, 5152,
54) showed a larger hyposome than T. robustum
(Figs 2834, 35, 38, 41, 5556, 58). In T. teredo,
the proximal part of the anterior extension of the
sulcus and cingulum extended transversally
towards the dextral side and then described a
marked loop (Figs 52, 54). In contrast, in T. robustum the proximal part of the anterior extension of
the sulcus and cingulum extended obliquely
towards the episome (Figs 55, 58). The anterior
extension of the sulcus and cingulum was more
displaced towards the dextral side in T. teredo than
in T. robustum (Figs 52, 54, 55, 58). Consequently,
the proximal part of the anterior extension of the
cingulum and sulcus were visible in ventral view
in T. robustum (Fig. 55) and in dorsal view in T.
teredo (Fig. 52). In the apex of T. teredo, the billlike projection was more conspicuous, overlying
the episome, and oriented between the ventral
and sinistro-lateral sides (Figs 4550, 53). The
bill-like projection of T. robustum was more
reduced, and oriented between the sinistro-lateral
and dorsal sides (Figs 4041, 57).
Morphology of Katodinium glaucum
Cells were spindle-shaped, tapering at both the apex
and the antapex, and about 3540 m long and
about 1422 m wide (Figs 5963). The cells

Figs 124. Continued

Lugol-xed specimen of T. robustum from the open Algerian Basin, western Mediterranean Sea (BOUM cruise, station #21). The
arrow points to the body extension. Fig. 13. T. robustum from the Gulf of Lions, isolated cell #FG187 (GenBank accession number
KR139784). Figs 1416. T. teredo from Gulf of Lions. Note the chloroplasts in epiuorescence microscopy. Fig. 17. T. robustum
from Banyuls-sur-Mer. The arrow points to the longitudinal agellum. Fig. 18. Torodinium sp. from the Bay of Villefranche-sur-Mer,
France. Figs 1923. T. robustum from the port of Valencia, Spain. The arrows point to the longitudinal ribs. Fig. 24. T. teredo from the
port of Valencia. The arrow indicates the apical groove. ag = apical groove. bp = bill-like projection. lf = longitudinal agellum. lr =
longitudinal rib. Scale bars: 10 m.

232

Downloaded by [Fernando Gmez] at 13:26 05 April 2016

F. Gmez et al.

Figs 2534. Scanning electron microscopy (SEM) images focused on the hyposome of ve specimens of Torodinium. Figs 2527.
Three specimens of T. teredo. Figs 2834. Two specimens of T. robustum. The micrographs 2934 correspond to the same specimen
(also Figs 3644). Fig. 25. Ventral view. Fig. 26. Ventro-antapical view. Fig. 27. Ventral view. Fig. 28. Antapical view. Fig. 29.
Ventro-antapical view. Figs 3031. Ventral view. Fig. 32. Dorsal view. Fig. 33. Dextro-lateral view. Fig. 34. Ventral-dextro-lateral
view. ac = anterior cingulum. as = anterior sulcus. bp = bill-like projection. ci = cingulum. lc = lateral canal. lf = longitudinal
agellum. lfp = longitudinal agellar pore. sl = sulcal lip. su = sulcus. tf = transversal agellum. tfp = transversal agellum pore. Scale
bar: 5 m.

233

Downloaded by [Fernando Gmez] at 13:26 05 April 2016

Torodinium and Lebouridinium gen. nov.

Figs 3550. SEM focused on the hyposome of ve specimens of Torodinium. Figs 3544. T. robustum. Micrographs 3543
correspond to the same specimen (also Figs 2934). Figs 4450. T. teredo. Fig. 35. Dextro-lateral view. Fig. 36. The arrows point
to the longitudinal striae. Fig. 37. Apex. Fig. 38. Ventral view. Fig. 39. Apex. Figs 4041. Dextro-lateral dorsal view. Figs 4243.
Apex. Fig. 44. Another specimen of T. robustum in apical view. Fig. 45. T. teredo in apical-dorsal view. Figs 4648. Another
specimen in dorsal view. Fig. 49. Another specimen in sinistro-lateral view. Fig. 50. Dorsal view. ag = apical groove. ar = apical rib. as
= anterior sulcus. bp = bill-like projection. lc = lateral canal. lr = longitudinal rib. sl = sulcal lip. su = sulcus. Scale bar: 5 m.

under division reached 5560 m long (Figs 6466).

The hyposome was about 1/4 of the cell length. The
descending cingulum was displaced by three to four
cingular widths (Figs 5963). Cells lacked chloroplasts. Vacuoles and refractile bodies were observed

in the upper episome (Figs 5962). Groups of trichocysts and some rod-shaped bodies were situated
along the cell margin in the episome and the hyposome (Figs 6061). The nucleus was spherical and
located in the posterior part of the episome at the

F. Gmez et al.
51

234
52

53

55

56

57

lc
lc

ag

bp

as
ac

bp

sl

sl
as

ac

as

ag
ac

as
su

su
ci

lc

ci

lc

ac

54

58
lc

ac
as

Downloaded by [Fernando Gmez] at 13:26 05 April 2016

lc

Figs 5158. Line drawings of different views of Torodinium teredo (Figs 5154) and T. robustum (Figs 5558). Figs 51, 55. Ventral
view. Figs 52, 56. Dorsal view. Figs 53, 57. Apical view. Figs 54, 58. Antapical view. ac = anterior cingulum. ag = apical groove; as =
anterior sulcus. bp = bill-like projection. ci = cingulum. lc = lateral canal. sl = sulcal lip. su = sulcus.

middle of the cell (Figs 5962). A capsule surrounded the nucleus (Figs 60, 62). The proximal
end of the cingulum was bifurcated, with a short
anterior extension almost parallel to the cingulum
(Fig. 63). The cell surface showed longitudinal ribs,
hard to see on the hyposome (Figs 63, 65). Under
SEM, the proximal end of the cingulum was bifurcated (Figs 7172). The transverse agellum
emerged from the posterior end of the bifurcation
(Fig. 71). The anterior end of the bifurcation
extended parallel to the cingulum. This structure
could be interpreted as an anterior extension of the
cingulum. However, it could also be interpreted as a
notch that invaded and dissected the proximal end of
the cingulum (Fig. 71). The apex showed a tongueshaped notch (Figs 69, 7073). It was bordered by
two longitudinal ribs, and contained ve other longitudinal ribs that converged towards a pointed end in
the dorsal side (Figs 6769, 73). From the ve longitudinal ribs, the three central ones extended posteriorly along the episome (Figs 69, 7377). This
tongue-shaped notch extended over a horseshoeshaped apical groove with the ends oriented towards
the ventral side (Figs 69, 73). The cell surface of the
episome contained 24 equidistant longitudinal ribs
(Figs 73, 77). Those longitudinal ribs ended at the
basis of the apical groove, with the exception of
three ribs that extended towards the pointed end of
the tongue-shaped notch (Figs 7374). The texture
of the surface between the ribs was rugose, with two
or three transversal granules between each two ribs
(Figs 7374).

Molecular phylogeny
We obtained sequences of Torodinium from two
samples. One sample (#FG21) contained a mix of
20 specimens of T. teredo and T. robustum, collected from a pier at Marseille over ve days in
December 2007 (Figs 111). PCR amplication
and cloning provided three almost complete SSU
rDNA sequences (GenBank accession numbers
KR139781, KR139782, KR139783). These
sequences differed by 49 base pairs. The second
sample (#FG187) corresponded to a single specimen of T. robustum collected from offshore
Marseille at 55 m depth (Fig. 13). Sample
#FG187 was analysed by single-cell PCR and provided an almost complete SSU rDNA sequence
(GenBank accession number KR139784). The
sequences of T. robustum and the clones of
Torodinium spp. were 99% identical and differed
by 11 base pairs. The three clones of sample
#FG21 have been assigned to T. teredo.
We examined the phylogenetic position of
Torodinium spp. and Katodinium glaucum using a
data set including a variety of dinoagellate SSU
rDNA sequences. The Bayesian tree showed that all
Torodinium spp. sequences branched in a well-supported clade [posterior probability (PP) of 0.99]
together with several environmental sequences
(Fig. 78). The new sequence of T. robustum was
very similar to two sequences of T. robustum from
the NW Mediterranean Sea available in GenBank
(KP7901667) and an environmental clone
(KJ762990) retrieved from California off San

235

Downloaded by [Fernando Gmez] at 13:26 05 April 2016

Torodinium and Lebouridinium gen. nov.

Figs 5974. LM (Figs 5965) and SEM (Figs 6674) images of Katodinium glaucum from South Japan. Fig. 59. Specimen with a
large vacuole. Figs 6061. Another specimen. Note the capsule of the nucleus, the rod-shaped bodies, refractile bodies and
trichocysts. Figs 6263. Another specimen. Note the longitudinal ribs and the bifurcation of the proximal end of the cingulum,
named anterior cingular extension. Figs 6466. Specimen undergoing binary division. Fig. 67. Ventral view. Fig. 68. Dextro-lateral
view. Fig. 69. Dorsal-apical view. Fig. 70. Ventral view. Figs 7172. Sinistro-lateral and ventral view. The inset shows the proximal
end of the cingulum. Figs 7374. Detail of the apex. ac = anterior extension of the cingulum. ag = apical groove. ci = cingulum. lf =
longitudinal agellum. lr = longitudinal rib. n = nucleus. rb = refractile body. rsb = rod-shaped body. su = sulcus. tf = transversal
agellum. tr = trichocyst. v = food vacuole. Scale bars: 10 m.

F. Gmez et al.

75

236

76

ag

lr

rsb

Diego. The three clones assigned to T. teredo were

closer to an environmental clone (KJ759393) retrieved
from the Gulf Stream and formed the sister group of the
sequences of T. robustum. Two environmental
sequences retrieved from the under-ice waters of the
North Pole (HQ438140, HQ438165) were basal to the
whole clade of Torodinium spp. All these sequences
formed a strongly supported clade (PP = 1) that was
sister group of an environmental clone (KJ758208)
retrieved from the Ross Sea, Antarctica (PP = 0.98).
The three sequences of Katodinium glaucum available
in GenBank (KP7901602) formed a lineage not closely related to Torodinium spp. or to any other dinoagellate group. The sequences of Torodinium and
Katodinium glaucum branched within the large lineage
comprising Gymnodiniales, Peridiniales, Dinophysales
and Prorocentrales but with poor support, making it
difcult to infer the phylogenetic afnities of these
orders (Fig. 78).

77

tf

tf
lf

Downloaded by [Fernando Gmez] at 13:26 05 April 2016

Figs 7577. Line drawings of different views of Katodinium

glaucum. Fig. 75. Ventral view. Fig. 76. Sinistro-lateral view.
Fig. 77. Apical view. ag = apical groove. lf = longitudinal
agellum. lr = longitudinal rib. n = nucleus. rsb = rod-shaped
body. tf = transversal agellum. v = food vacuole.

0.88
1

Woloszynskia pascheri EF058253

Woloszynskia halophila EF058252
Polarella glacialis AY179607
0.8

Pelagodinium bei U41087

Symbiodinium microadriaticum M88521

1

1
0.94

Levanderina fissa AY421786

Levanderina fissa AF274261
1

Apicoporus parvidiaboli EU293238

0.76

Togula britannica AY443010

Amphidinium corpulentum AF274252
Cucumeridinium coeruleum KR139785
Cucumeridinium lira KR139787

1
Cochlodinium sp. DQ915170
Cochlodinium polykrikoides EU418944
Amphidinium herdmanii AF274253
0.78
Karenia brevis AF352818
0.97
Karenia papilionacea HM067005
Karenia bidigitata HM067002
Brachidinium capitatum HM066998
Ceratoperidinium falcatum KP790150
0.98
Prorocentrum micans AY585526
Prorocentrum minimum DQ336072
0.98
Gyrodinium fusiforme AB120002
0.96
Gyrodinium spirale AB120001
Gyrodinium dominans FN669510
Gyrodinium helveticum AB120004
0.98
Apicoporus glaber EU293235
Aduncodinium glandula LK934662
Lepidodinium viride AF022199
0.89
Gymnodinium impudicum DQ779993
0.97
0.96
Gymnodinium dorsalisulcum DQ837534
Gymnodinium dorsalisulcum LC054930
1
Dissodinium pseudolunula FJ473378
0.79
1
Chytriodinium affine FJ473380
Chytriodinium roseum FJ663049
Gymnodinium fuscum AF022194
0.86
Pheopolykrikos beauchampii DQ371294

0.88
0.89
0.89

0.85

0.83

Gymnodinium aureolum AY999082

0.84
0.54

0.92
0.93

0.88
0.76

0.64

0.94
0.74

0.73
0.9
0.7
0.73

0.85

Warnowia sp. FJ467492

Polykrikos hartmannii AY421789
Polykrikos herdmaniae DQ975470
0.97
Polykrikos kofoidii DQ371291

Gymnodinium sp. AF274260

Uncultured marine dinoflagellate HM581765
Uncultured marine dinoflagellate JQ956286
0.98
Takayama cf. pulchellum AY800130
Takayama acrotrocha HM067010
0.95
Karlodinium veneficum AF274262
Karlodinium veneficum JN986577
1 Azadinium trinitatum KJ481803
Azadinium spinosum FJ217814
Balechina pachydermata KR139791
0.98
Ankistrodinium semilunatum AF274256
Ankistrodinium semilunatum JQ179859
Bispinodinium angelaceum AB762397
Uncultured marine dinoflagellate AY664920
1
Uncultured marine dinoflagellate EF527103
Katodinium
glaucum
KP790161
0.77
Katodinium glaucum KP790160
Lebouridinium gen. nov.
0.99 Katodinium glaucum KP790162
Uncultured marine dinoflagellate KJ763303
Akashiwo
sanguinea
AY421770
1
0.97
Akashiwo sanguinea DQ779987
Akashiwo sanguinea AJ415513
Uncultured eukaryote KJ758208
0.74
Uncultured marine dinoflagellate HQ438165
0.98
Uncultured marine dinoflagellate HQ438140
1
0.9 Torodinium robustum KP790167
Torodinium robustum KP790166
Torodinium robustum FG187 KR139784
0.99
Uncultured eukaryote KJ762990
Uncultured eukaryote KJ759393
0.9
0.02
Torodinium teredo FG21-2 KR139781
Torodinium teredo FG21-3 KR139782
0.76
Torodinium
Torodinium teredo FG21-4 KR139783

Fig. 78. Bayesian phylogenetic tree of dinoagellate SSU rDNA sequences, based on 1584 aligned positions. Names in bold
represent sequences obtained in this study. Numbers at nodes are posterior probabilities (values <0.50 are omitted). The scale bar
represents the number of substitutions for a unit branch length.

Torodinium and Lebouridinium gen. nov.

Taxonomic description
Detailed study of the morphology of Katodinium glaucum conrmed that this species is not related to the type
species of Katodinium, K. nieuportense. Molecular and
morphological data did not support a close relationship
of K. glaucum with Torodinium, Gyrodinium or any
other known dinoagellate genus. Therefore, a new
genus is proposed here for K. glaucum.

Downloaded by [Fernando Gmez] at 13:26 05 April 2016

Lebouridinium F. Gmez, H. Takayama, D.

Moreira & P. Lpez- Garca, gen. nov. (Figs 5977)
DIAGNOSIS: Unarmoured spindle-shaped cells with
the hyposome about 1/4 of the cell length. The descending cingulum was displaced by three to four
cingular widths. The cells were devoid of plastids
and the cell surface was covered with longitudinal
ribs. The apex contained a tongue-shaped notch
pointed towards the dorsal side. The apical groove
was horseshoe-shaped and extended below the border
of the tongue-shaped notch. The proximal end of the
cingulum showed a bifurcation, alternatively interpreted as a short leftwards notch that transversally
divided the cingulum.
ETYMOLOGY: In honour of M.V. Lebour who rst
described the type species. The sufx dinium,
meaning vortex is commonly applied to dinoagellates. The gender is neuter.
TYPE SPECIES: Lebouridinium glaucum (M. Lebour) F.
Gmez, H. Takayama, D. Moreira & P. Lpez-Garca,
gen. & comb. nov. See description above.
BASIONYM: Spirodinium glaucum M. Lebour 1917 (J.
Mar. Biol. Ass. U.K. ser. 2, 11: 196, g. 13).
SYNONYMS: Gyrodinium glaucum (M. Lebour) Kof. &
Swezy 1921, p. 308, g. DD16, plate 9, g. 94;
Massartia glauca (M. Lebour) J. Schiller 1933, p. 436,
g. 462; Katodinium glaucum (M. Lebour) A.R. Loebl.
1965, p. 16 (non Gymnodinium glaucum W. Conrad
1926, nec Gymnodinium glaucum J. Schiller 1955).
EPITYPE: Fig. 72.
DISCUSSION
Comparison of Torodinium with previous descriptions
Our knowledge on the morphology of Torodinium has
remained almost unchanged since the original generic
description. Kofoid & Swezy (1921) contributed
greatly to the understanding of the unarmoured dinoagellates from specimens collected in the summer of
1917 off San Diego, California. However, in numerous cases Kofoid & Swezy proposed new species
based on the observation of single or few specimens,
consequently ignoring the potential intraspecic morphological variability. In addition, sometimes they
erroneously described life stages as new species

237
based exclusively on the illustrations from other
authors (i.e. Gymnodinium fulgens Kof. & Swezy,
Gyrodinium falcatum Kof. & Swezy). In the case of
Torodinium, Kofoid & Swezy (1921, p. 390) reported
we have found only the stouter of these two species,
Torodinium robustum, in which we include the rst
two of Schtts gures (1895, pl. 23, gs 74, 13).
Kofoid & Swezy (1921) described the genus
Torodinium with T. teredo as type species, based on
the illustrations of Gymnodinium teredo in Schtt
(1895). However, it is questionable to propose a new
genus and species with no personal observations of
the type species. In that case, Kofoid & Swezy were
right and the SSU rDNA molecular phylogeny conrms that T. robustum and T. teredo are independent
species (Fig. 78).
Unarmoured dinoagellates tend to show high morphological variability, especially in the extension of
the cell body (Gmez et al., 2004, 2005). Thus, the
relative elongation is a poor diagnostic criterion for
species separation. Kofoid & Swezy (1921) established T. teredo for specimens with a length greater
than 4 transdiameters, and less than 3.5 transdiameters
for T. robustum. The rst problem of this diagnostic
criterion is the discrimination of specimens with ratios
between 3.5 and 4 length-transdiameter. In most
recent literature, this has been solved by assigning to
T. teredo specimens with cell length > 3 width
(Steidinger & Tangen, 1997). The difculty is to
establish where the dorsoventral or lateral sides are.
Kofoid & Swezy (1921) erroneously used the term
transdiameter (= width) for the cell depth [i.e. the
length along the lateral sides (ventral to dorsal
distance)].
The distinction between the two species proposed by Kofoid & Swezy was not restricted to
only one morphometric character (length-depth
ratio). They added that T. robustum possessed an
apex with the apical groovereversed terminal apical loop of the sulcus, which was absent in T.
teredo. It should be noted that apparently Kofoid
& Swezy (1921) did not examine specimens of T.
teredo and this was based on Schtts illustrations.
Kofoid & Swezy and later authors represented the
apical groove of T. robustum as a looping of the
sulcus in the apex, while the type species lacked
the apical groove (Figs 7990). Elbrchter (1979)
illustrated T. robustum with the apical groove as an
anterior extension of the sulcus (Fig. 86), which
was absent in T. teredo (Fig. 85). Torodinium
teredo and T. robustum are closely related in the
SSU rDNA molecular phylogeny, so that the
absence of the apical groove in one of the species
would be very unusual. In contrast to previous
studies exclusively based on LM observations, we
have to consider that both Torodinium species may
possess an apical groove which is independent of
the sulcus (Figs 39, 44).

F. Gmez et al.

238

80

79

Rh

82

sulc.

84

83
rod.

c
Cp

gir.

epi.
pus.

81

rod.
n.
sulc.

gir.

Downloaded by [Fernando Gmez] at 13:26 05 April 2016

qG

hyp.
tr. fl.
long. fl.

qF

gir.
hyp.

gir.
hyp.

85

86

87

88

89

90

Figs 7990. Line drawings of Torodinium teredo and T. robustum in the literature. Fig. 79. Gymnodinium teredo redrawn from
Paulsen (1908). Figs 8082. T. robustum redrawn from Kofoid & Swezy (1921). Fig. 80. Ventral view. Fig. 81. Dextro-lateral view.
Fig. 82. Sinistro-lateral view. Fig. 83. T. teredo redrawn from Kofoid & Swezy (1921). Fig. 84. T. robustum redrawn from Lebour
(1925). Fig. 85. T. teredo redrawn from Elbrchter (1979). Fig. 86. T. robustum redrawn from Elbrchter (1979). Fig. 87. T. robustum
redrawn from Dodge (1982). Fig. 88. T. robustum redrawn from Sournia (1986). Fig. 89. T. robustum redrawn from Hansen & Larsen
(1992). Fig. 90. T. teredo redrawn from Steidinger & Tangen (1997).

Kofoid & Swezy (1921) reported also that both

species of Torodinium lacked striae on the cell
surface. However, the surface of the episome is
covered with prominent longitudinal ribs as is
even revealed by light microscopy (Fig. 23).
Some micrographs in the literature also showed
the ribs in the episome (Sournia, 1986; GrateLizrraga & Mucio-Mrquez, 2013). The pigmentation of Torodinium is another controversial matter. Elbrchter (1979) reported that the chloroplasts
were greenish-yellow to pale brown for T. teredo,
and brown for T. robustum. In contrast, Steidinger
& Tangen (1997) reported that the pigmentation
was brown and green for T. teredo and T. robustum, respectively. In our observations, some

specimens showed scarce pigmentation (Figs 2, 6,

25), while it was greenish in others (Fig. 18). The
rst micrograph of Torodinium under epiuorescence microscopy showed a specimen with few
long longitudinal plastids restricted to the ventral
side of the cell (Fig. 16).
The occurrence of three grooves in the episome
of Torodinium was not reported in previous studies. The anterior extension of the cingulum is
short and it very probably went unnoticed in
studies based on light microscopy. An anterior
extension of the cingulum has been reported in
some species of Gymnodinium, Cochlodinium F.
Schtt and Warnowia Lindemann (Takayama,
1985, 1998). To the best of our knowledge,

Torodinium and Lebouridinium gen. nov.

Downloaded by [Fernando Gmez] at 13:26 05 April 2016

91

96

92

239

94

93

95

97

98

99

100

Figs 91100. Line drawings of Katodinium nieuportense, Lebouridinium glaucum, Gymnodinium vesticii and Amphidinium
extensum. Fig. 91. Katodinium nieuportense redrawn from Conrad (1926). Fig. 92. Spirodinium glaucum redrawn from Lebour
(1917). Fig. 93. Gyrodinium glaucum redrawn from Lebour (1925). Fig. 94. G. glaucum redrawn from Kofoid & Swezy (1921).
Fig. 95. K. glaucum redrawn from Elbrchter (1979). Fig. 96. Gyrodinium glaucum redrawn from Dodge (1982). Fig. 97. K. glaucum
redrawn from Steidinger & Tangen (1997). Fig. 98. Gymnodinium vesticii redrawn from Paulsen (1908). Fig. 99. G. vesticii
redrawn from Kofoid & Swezy (1921). Fig. 100. Amphidinium extensum redrawn from Lebour (1925).

Torodinium is the only known genus with extensions of both sulcus and cingulum in the episome
(Figs 35, 52). Another distinctive character of
Torodinium is the sulcal lip (Figs 2627). A tentatively analogous feature has been reported as a
tube-like structure in the genus Takayama de
Salas, Bolch, L. Botes & Hallegr. (de Salas
et al., 2003).
Kofoid & Swezy (1921, p. 391) reported that
From the anterior agellar pore there runs anteriorly at the left of the nucleus a slender canal,
the anterior pusule. The lateral canal was erroneously reported in further literature as reaching
the cingulum, reaching the anterior agellar pore
or being confused with the sulcus (Figs 6470).
All previous studies have illustrated the lateral
canal in contact with the cingulum (Lebour, 1925;

Elbrchter, 1979; Dodge, 1982; Sournia, 1986).

Kofoid & Swezy denoted the lateral canal as a
pusule (Fig. 63). Several functions have been attributed to the dinoagellate pusule, including the
incorporation of particles (Klut et al., 1987). The
distribution of Torodinium in oligotrophic surface
oceanic waters, the scarce chloroplasts, the presence
of food vacuoles and the body extension suggest
that Torodinium is indeed able to ingest particulate
matter (Gmez, 2009). We have not yet observed
the mechanism of prey capture and ingestion. The
body extension was noticed only in specimens that
were xed immediately after collection (Gmez,
2009; Fig. 12). During observations of live specimens the body extension could be retracted due to
manipulation stress. The projection of a body extension from the hyposome is a feature known in other

Downloaded by [Fernando Gmez] at 13:26 05 April 2016

F. Gmez et al.
gymnodinioid dinoagellates (Persson et al., 2013).
Gymnodinioid dinoagellates typically ingest their
prey by direct engulfment through the sulcal area in
the hyposome [e.g. Gyrodinium spirale (Bergh)
Kof. & Swezy; Hansen, 1992]. However,
Torodinium has a minute hyposome and posterior
sulcus, probably insufcient for the ingestion of
large prey. The lateral canal is a structure unknown
in any other dinoagellate and its function remains
uncertain. It can be hypothesized that the body
extension that emerged from the hyposome may
facilitate prey capture and the subsequent ingestion
through the lateral canal (Figs 33, 35).
The apex of Torodinium is also highly distinctive.
Schtt (1895) illustrated a group of plastids around a
central plastid or oil globule forming a star of eight or
nine rays, further re-drawn by other authors (Figs 60,
6365). This unusual star-shaped distribution of the
plastids coincides with the apical ribs that form the
bill-like projection (Fig. 48). In one of the earliest
dinoagellate studies, Schtt (1895) was probably
confusing the apical ribs with plastids. The function
of the bill-like projection is unknown.
Previous observations of Lebouridinium
Our observations of Lebouridinium glaucum unequivocally correspond to the taxon described as
Spirodinium glaucum by Lebour (1917, 1925)
(Figs 9293). However, L. glaucum have been
reported earlier in the literature because it is a common
species (Lebour, 1917). Schtt (1895) described
Gymnodinium vesticii F. Schtt with a larger episome, lacking the surface striae and with an intrusion
of the sulcus into the episome (Fig. 98). Later, Kofoid
& Swezy (1921), in the absence of personal observations, added surface striations to the illustration of G.
vesticii (Fig. 99). Lebour (1925, p. 50) reported on G.
vesticii This species is not sufciently dened, but
bears so strong a resemblance to Gyrodinium glaucum
if turned upside down that one does not feel justied in
regarding it as a Gymnodinium until the agella have
been described. Even assuming that the orientation of
G. vesticii was turned upside down and it is covered
with surface striations, the prominent anterior extension of the sulcus and the low cingular displacement
do not indicate L. glaucum. Amphidinium extensum A.
Wulff was described from four illustrations in dorsal
view, lacking information on the sulcus or agella
(Lebour, 1925) (Fig. 100). Due to the poor descriptions, it is difcult to determine whether G. vesticii or
A. extensum corresponded to the earlier observations
of L. glaucum and, consequently, if any of these taxa
have priority versus Spirodinium glaucum.
Kofoid & Swezy (1921) and Elbrchter (1979)
illustrated Lebouridinium glaucum with an intrusion
of the sulcus in the episome (Figs 9495). However,
we did not observe that feature (Figs 7576). We

240
observed by light and scanning electron microscopy
(Figs 63, 7172) that the proximal end of the cingulum showed a short bifurcation or, alternatively, a
leftwards notch that transversally divided the cingulum (Figs 7576). This feature was not reported in the
literature. The tongue-shaped notch (Figs 9495) was
rst reported by Takayama (1985, 1998; Fig. 97).
Evolutionary afnities of Lebouridinium
The morphology of Lebouridinium glaucum is very
different from the type of Katodinium, K. nieuportense (Fig. 91), an insufciently described species
that is only known from the original description
(Conrad, 1926). Some morphological features such
as the cingular displacement, longitudinal ribs, trichocysts, rod-shaped and refractile bodies and a capsule
that surrounded the spherical nucleus resemble the
type of Gyrodinium (Hansen & Daugbjerg, 2004;
Takano & Horiguchi, 2004). However, other features
such as the apical groove, tongue-shaped notch or the
cingular structure, as well as the molecular data, do
not support a relationship between Lebouridinium and
Gyrodinium (Fig. 78; Kim & Kim, 2007). Since the
earlier studies, the small hyposome of L. glaucum
invited consideration of a relationship with
Torodinium (Lebour, 1917; Kofoid & Swezy, 1921).
Re et al. (2015) reported that Torodinium robustum
and L. glaucum branched together in the SSU rDNA
phylogenetic analysis, although with weak statistical
support (bootstrap value < 80%). In our SSU rDNA
phylogeny, including more sequences of Torodinium
and environmental clones, we did not nd a relationship between Torodinium spp. and L. glaucum
(Fig. 78). The detailed study of the morphology of
Torodinium and Lebouridinium does not reveal similarities in the distinctive diagnostic characters
between the two genera. Morphological features
such as the reduced hyposome or the cell surface
covered with longitudinal ribs are common characters
in the unarmoured dinoagellates (Takano &
Horiguchi, 2004; Gmez et al., 2015).

DISCLOSURE STATEMENT
No potential conict of interest was reported by the
author(s).

FUNDING
F.G. is supported by the Brazilian Conselho Nacional de
Desenvolvimento Cientco e Tecnolgico (grant number
BJT 370646/201314). We acknowledge nancial support
from the French CNRS, the European Research Council
under the European Unions Seventh Framework Program
ERC Grant Agreement 322669 ProtistWorld, and Ile de
France (SESAME project 13016398 Unicell).

Torodinium and Lebouridinium gen. nov.

AUTHOR CONTRIBUTIONS
F. Gmez: collection, isolation, light microscopy and drafting;
H. Takayama: collection, isolation, light and electron microscopy; P. Lpez-Garca: molecular analysis; D. Moreira: phylogenetic analysis.

Downloaded by [Fernando Gmez] at 13:26 05 April 2016

REFERENCES
Calado, A.J. (2011). On the identity of the freshwater dinoagellate
Glenodinium edax, with a discussion on the genera Tyrannodinium
and Katodinium, and the description of Opisthoaulax gen. nov.
Phycologia, 50: 641649.
Conrad, W. (1926). Recherches sur les agellates de nos eaux
saumtres. 1e partie: dinoagellates. Archiv fr Protistenkunde,
55: 63100.
Daugbjerg, N., Hansen, G., Larsen, J. & Moestrup, . (2000).
Phylogeny of some of the major genera of dinoagellates based
on ultrastructure and partial LSU rDNA sequence data, including
the erection of three new genera of unarmoured dinoagellates.
Phycologia, 39: 302317.
De Salas, M.F., Bolch, C.J.S., Botes, L., Nash, G., Wright, S.W. &
Hallegraeff, G.M. (2003). Takayama gen. nov. (Gymnodiniales,
Dinophyceae), a new genus of unarmoured dinoagellates with
sigmoid apical grooves, including the description of two new
species. Journal of Phycology, 39: 12331246.
Dodge, J.D. (1982). Marine dinoagellates of the British Isles. Her
Majestys Stationery Ofce, London.
Edgar, R.C. (2004). MUSCLE: multiple sequence alignment with
high accuracy and high throughput. Nucleic Acids Research, 32:
17921797.
Elbrchter, M. (1979). On the taxonomy of unarmoured dinophytes
(Dinophyta) from the Northwest African upwelling region.
Meteor Forschungs-Ergebnisse, Reihe D, 31: 122.
Grate-Lizrraga, I. & Mucio-Mrquez, R.E. (2013). New data on
the distribution of Torodinium robustum and T. teredo
(Dinophyceae: Gymnodiniales) in the Gulf of California. Check
List, 9: 809812.
Gmez, F. (2009). Torodinium and Pavillardia (Gymnodiniales,
Dinophyceae): two unarmoured dinoagellates with a body extension, collected from the open Pacic Ocean. Protistology, 6: 131135.
Gmez, F., Nagahama, Y., Fukuyo, Y. & Furuya, K. (2004).
Observations on Ceratoperidinium (Dinophyceae). Phycologia,
43: 416421.
Gmez, F., Nagahama, Y., Takayama, H. & Furuya, K. (2005). Is
Karenia a synonym of AsterodiniumBrachidinium? (Gymnodiniales, Dinophyceae). Acta Botanica Croatica, 64: 263274.
Gmez, F., Lpez-Garca, P., Takayama, H. & Moreira, D. (2015).
Balechina and the new genus Cucumeridinium gen. nov.
(Dinophyceae), unarmoured dinoagellates with thick cell coverings. Journal of Phycology 51: 10881105.
Hansen, G. (1995). Analysis of the thecal plate pattern in the dinoagellate Heterocapsa rotundata (Lohmann) comb. nov.
(=Katodinium rotundatum (Lohmann) Loeblich). Phycologia,
34: 166170.
Hansen, G. & Larsen, J. (1992). Dinoagellater i danske farvande. In
Plankton i de indre danske farvande (Thomsen, H.A., editor), 45
155. Havforskning fra Miljstyrelsen, n. 11, Copenhagen.
Hansen, G. & Daugbjerg, N. (2004). Ultrastructure of Gyrodinium
spirale, the type species of Gyrodinium (Dinophyceae), including
a phylogeny of G. dominans, G. rubrum and G. spirale deduced
from partial LSU rDNA sequences. Protist, 155: 271294.
Hansen, P.J. (1992). Prey size selection, feeding rates and growth
dynamics of heterotrophic dinoagellates with special emphasis
on Gyrodinium spirale. Marine Biology, 114: 327334.
Kang, N.S., Jeong, H.J., Moestrup, ., Jang, T.Y., Lee, S.Y. & Lee,
M.J. (2015). Aduncodinium gen. nov. and A. glandula comb. nov.

241
(Dinophyceae, Pesteriaceae), from coastal waters off Korea: morphology and molecular characterization. Harmful Algae, 41: 2537.
Kim, K.-Y. & Kim, C.-H. (2007). Phylogenetic relationships among
diverse dinoagellate species occurring in coastal waters off Korea
inferred from large subunit ribosomal DNA sequence data. Algae,
22: 5767.
Klut, M.E., Bisalputra, T. & Antia, N.J. (1987). Some observations
on the structure and function of the dinoagellate pusule.
Canadian Journal of Botany, 65: 736744.
Kofoid, C.A. & Swezy, O. (1921). The free-living unarmoured
Dinoagellata. Memoirs of the University of California, 5: 1562.
Lebour, M.V. (1917). The Peridiniales of Plymouth Sound from the
region beyond the breakwater. Journal of the Marine Biological
Association, Plymouth, 11: 183200.
Lebour, M.V. (1925). The Dinoagellates of Northern Seas. Marine
Biological Association of the United Kingdom, Plymouth.
Lpez-Garca, P., Rodrguez-Valera, F., Pedrs-Ali, C. & Moreira,
D. (2001). Unexpected diversity of small eukaryotes in deep-sea
Antarctic plankton. Nature, 409: 603607.
Murray, S., de Salas, M., Luong-Van, J. & Hallegraeff, G. (2007).
Phylogenetic study of Gymnodinium dorsalisulcum comb. nov.
from tropical Australian coastal waters (Dinophyceae).
Phycological Research, 55: 176184.
Paulsen, O. (1908). Peridiniales. In Nordisches Plankton (Brandt,
K. & Apstein, C., editors), 1124. Lepsius & Tischer, Leipzig.
Persson, A., Smith, B.C., Morton, S., Shuler A. & Wikfors, G.
H. (2013). Sexual life stages and temperature dependent morphological changes allow cryptic occurrence of the Florida red tide
dinoagellate Karenia brevis. Harmful Algae, 30: 19.
Philippe, H. (1993). MUST, a computer package of management
utilities for sequences and trees. Nucleic Acids Research, 21:
52645272.
Pouchet, G. (1885). Nouvelle contribution lhistoire des
Pridiniens marins. Journal de lAnatomie et de la Physiologie
Normale et Pathologique de lHomme et des Animaux, Paris,
21: 2888.
Re, A., Camp, J. & Garcs, E. (2015). Diversity and phylogeny of
Gymnodiniales (Dinophyceae) from the NW Mediterranean Sea
revealed by a morphological and molecular approach. Protist, 166:
234263.
Ronquist, F., Teslenko, M., van der Mark, P., Ayres, D.L., Darling,
A., Hhna, S., Larget, B., Liu, L., Suchard, M.A. & Huelsenbeck,
J.P. (2012). MrBayes 3.2: efcient Bayesian phylogenetic inference and model choice across a large model space. Systematics
Biology, 61: 539542.
Saitou, N. & Nei, M. (1987). The neighbor-joining method: a new
method for reconstructing phylogenetic trees. Molecular Biology
and Evolution, 4: 406425.
Schtt, F. (1895). Die Peridinien der Plankton-Expedition.
Ergebnisse der Plankton-Expedition der Humboldt-Stiftung, 4:
1170.
Sournia, A. (1986). Atlas du phytoplancton marin. Volume I:
Cyanophyces, Dictyophyces, Dinophyces, Raphidophyces.
ditions du CNRS, Paris.
Steidinger, K.A. & Tangen, K. (1997). Dinoagellates. In
Identifying Marine Phytoplankton (Tomas, C.R., editor), 387
598. Academic Press, San Diego, CA.
Takano, Y. & Horiguchi, T. (2004). Surface ultrastructure and molecular phylogenetics of four unarmored heterotrophic dinoagellates, including the type species of the genus Gyrodinium
(Dinophyceae). Phycological Research, 52: 107116.
Takayama, H. (1985). Apical grooves of unarmored dinoagellates.
Bulletin of the Plankton Society of Japan, 32: 129137.
Takayama, H. (1998). Morphological and taxonomical studies on
the free-living unarmored dinoagellates occurring in the Seto
Inland Sea and adjacent waters. Ph.D. dissertation, The
University of Tokyo, Tokyo.