You are on page 1of 20

BISC 101 Lab 8 Tutorial Quiz - Lam

Lab 8 Tutorial Quiz (Station B)

1. Name the organ being pointed to in the picture


(0.5 marks) and name one biological molecule that is
digested within this organ (0.5 marks).
2. Name two locations in your body where starch is digested.
(1 mark)
3. Name two locations in your body where the enzymes for
digesting starch are produced
(1 mark).
1

BISC 101 Lab 8 Tutorial Quiz - Lam

Lab 8 Tutorial Quiz (Station C)

1. What organ is being viewed under the


microscope, in this picture? (0.5 marks).
2. Name one biological molecule that is digested
within this organ (0.5 marks).
3. Describe two structural features of this organ, and
explain how each structure helps this organ to
better perform its functions. (2 marks)

BISC 101 Lab 8 Tutorial Quiz - Lam

Lab 9 Tutorial Quiz (Station B)

1. What do you call the volume of air left in your lungs after you
exhale as much as you can? (0.5 marks)
2. Clearly explain how this leftover air makes O2 absorption in your
lungs less efficient (1.5 marks)
3. Which of the values shown in the figure above are most
important for determining your maximum rate of gas exchange
(i.e. which one should you focus on increasing)? Briefly justify
your answer (1 mark)

BISC 101 Lab 8 Tutorial Quiz - Lam

Lab 9 Tutorial Quiz (Station C)


1. Describe two structural differences between the left
and right sides of your heart (1 mark).
2. Describe a functional difference between the left and
right sides of your heart (1 mark).
3. Relate one of the structural differences from question 1
to the functional difference from question 2 (1 mark).
(i.e. explain why the structural difference makes sense,
by relating it to differences in the function of each side
of the heart)

BISC 101 Lab 8 Tutorial Quiz - Lam

Lab 10 Tutorial Quiz (Station A)


1. Name the two functions that your kidneys perform, to
maintain homeostasis in your body (1 mark).
2. For each function, list all of the part(s) of the nephron that
are necessary for performing that function (2 marks)

Lab 10 Tutorial Quiz (Station B)


1. Name the specific part of the nephron where the
glomerular filtrate first enters the nephron (0.5 marks)
2. Briefly describe at least 5 differences between the
glomerular filtrate and the urine that is excreted from the
body (2.5 marks)

BISC 101 Lab 8 Tutorial Quiz - Lam

Animals 4 Tutorial Quiz Station A

1. What type of tissue is shown in the figure (be very


specific!) (1 marks)
2. Describe two structural features that you used to
identify this type of tissue (2 mark)

BISC 101 Lab 8 Tutorial Quiz - Lam

Lab 2 Tutorial Quiz (Station B)


These are the solutions tested in RBC experiment 2:
Test solution

Mol. Wt.

**Dist. Coeff. (Oil/water)

_____________________________________________________________________________________________________________________________________________________________________________________________

0.3M Formamide

45

0.00076

0.3M Acetamide

59

0.00083

0.3M Proprionamide

73

0.0036

0.3M Butyramide

87

0.01

______________________________________________________________________________________________________________________________________________________________________________________________

Solute X is a non-polar solute that has a molecular weight


of 100 and a distribution coefficient of 0.4.
A. Would a 0.3M Solute X solution cause RBC lysis faster or
slower than 0.3M Butyramide? (1 mark).
B. Which structural component of the RBC membrane might
solute X pass through? (1 mark)
C. Name one additional variable (besides molecular weight
and polarity) that can affect RBC membrane permeability to
solutes, in general (1 mark).
7

BISC 101 Lab 8 Tutorial Quiz - Lam

Lab 2 Tutorial Quiz (Station C)


Point out 2 major mistakes in the following experiment (1
mark), and clearly explain how each mistake can result in
biased or misleading results (2 marks):
The researchers prepared two test tubes with 2mL of 0.3M
Urea solution in each tube. In the treatment tube, they added
0.01 mL of 0.3M HCl (to make it more acidic). In the control
tube, they added 0.01mL of distilled water. They then added
one drop of bovine blood to each tube simultaneously, shook
them immediately, and timed how long it took for the bold
text placed behind the tubes to be visible through the mixture.

Lab 4 Tutorial Quiz (Station A)


3. Name two variables that can affect the rate of an
enzyme-catalyzed reaction (1 mark)
4. For one of these variables, sketch a graph that
shows the relationship between reaction rate and
your chosen variable. (2 marks)
(Tip: Remember to label your axes!)

BISC 101 Lab 8 Tutorial Quiz - Lam

Lab 4 Tutorial Quiz (Station B)


Mixture

Reaction Rate

1. Starch + Amylase
0.8
2. Starch + Amylase + X
0.2
3. Starch (5 x concentrated) + 0.5
+ Amylase + X
1. Is X a competitive inhibitor or a non-competitive
inhibitor? (1 mark)

2. Clearly justify your answer using the experimental results


shown above. (2 marks)

BISC 101 Lab 8 Tutorial Quiz - Lam

Lab 1 Tutorial Quiz (Station A)


Imagine that you need to pipette 5.2 mL of a urine sample
into a test tube for analysis. Your lab has clean 10mL,
5mL, and 1mL serological pipettes available.

A. Which pipette(s) would you use to accurately transfer


this volume of urine? (1 mark)
B. A reddish tint to the urine may indicate the presence of
blood. Which piece of lab equipment might you use to
accurately and objectively test for the presence of a reddish
tint in the urine sample?
(1 mark)

C. Describe one common mistake that students make when


using the above equipment (1 mark).

10

BISC 101 Lab 8 Tutorial Quiz - Lam

Lab 1 Tutorial Quiz (Station B)


Imagine that you are analyzing two ocean water samples
for the presence of red tide, which is caused by high
concentrations red-coloured microscopic algae.

A. Choose one piece of lab equipment that you would use


to accurately compare the concentrations of red tide
algae in your two samples (1 mark).

B. Briefly explain the steps you would take to compare


your two samples, using this piece of equipment (2
marks).

11

BISC 101 Lab 8 Tutorial Quiz - Lam

Lab 3 Tutorial Quiz 1


5 CGAUUGUAUAUGUCUUAACAUAAU 3
5. Imagine that an mRNA molecule, with the sequence of
bases shown above, was translated by a ribosome. Name
the amino acids found in the polypeptide that would be
produced (3 marks):

12

BISC 101 Lab 8 Tutorial Quiz - Lam

Lab 3 Tutorial Quiz 2


1. Which step of translation is illustrated in the picture
below (1 mark)?
2. In which direction is the mRNA moving, relative to the
ribosome, as translation continues (left or right)? (1
mark)
3. A diamond-shaped amino acid is being added to the
growing polypeptide chain. Clearly draw the shape of
the amino acid that will be bonded directly to this new,
diamond-shaped amino acid. (1 mark).

13

BISC 101 Lab 8 Tutorial Quiz - Lam

Lab 5 Tutorial Quiz 2


1. When using paper chromatography to separate the
pigments found in a mixture, when should the filter paper
be removed from the tube of chromatography solvent? (1
mark)

2. Once the pigments had been separated by paper


chromatography, you used several different kinds of
observations to identify each pigment. Name at least two of
these observations (1 mark)

3. What role(s) do these pigments play in photosynthesis?


(1 mark)

14

BISC 101 Lab 8 Tutorial Quiz - Lam

Lab 5 Tutorial Quiz 3


1. During your photosynthesis lab, you used a
spectrophotometer to make a series of measurements with
your plant-leaf extract.
What were you measuring? (Hint: you drew a graph
using those measurements what does that graph
illustrate?) (1 mark)

2. Clearly describe at least one way in which these


measurements can be used to increase efficiency of food
production in a greenhouse (1 mark).

3. Imagine that you repeated these measurements with just a


single type of pigment (at the same total concentration),
instead of the mixture of 4 different pigments that you
measured in lab.
Clearly describe one difference that you would expect to
see, between the two resulting graphs.

15

BISC 101 Lab 8 Tutorial Quiz - Lam

Lab 6 Tutorial Quiz 1


Answer the following questions about this cross section:

1. Is this a root or a stem? (0.5 marks).


Clearly justify your answer (1 mark).
2. Name one tissue that can act as a barrier to keep
unwanted solutes from entering the vascular bundle (0.5
marks). Describe one structural feature of this tissue that
can hinder the passage of an unwanted solute (1 mark).
16

BISC 101 Lab 8 Tutorial Quiz - Lam

Lab 7 Tutorial Quiz 1


Structure A:

1. What is the function of structure A? (1 mark)


(i.e. Explain what action the plant would have difficulty
performing, if structure A did not exist).

2. Name two specific parts of structure A (1 mark).

3. For one of these specific parts, explain how it helps


structure A to perform its function. (1 mark).

17

BISC 101 Lab 8 Tutorial Quiz - Lam

Lab 7 Tutorial Quiz 4


1. In many eudicot plants, most of the stomata are found
on the bottom surface of leaves, and few (if any)
stomata are found on the top surface. Give at least one
functional reason for this (1 mark).
2. Besides closing their stomata, clearly describe at least
two additional ways in which a plant can reduces water
loss from their leaves (2 marks)
(Hint: do not give a one-word answer. Clearly explain
how each structural feature reduces water loss)

18

BISC 101 Lab 8 Tutorial Quiz - Lam

19

BISC 101 Lab 8 Tutorial Quiz - Lam

Lab 11 Tutorial Quiz (Station A)


6. Name the amino acids found in the polypeptide that will
be translated from the following mRNA molecule (2
marks):

5 CGAUUGUAUAUGUCUUAACAUAAU 3

7. Where does translation take place, within a eukaryotic cell


(1 mark)?

20

You might also like