CHAPTER 1

INTRODUCTION

1.1.CANCER
The human body is made up of trillions of living cells. Cancer results from a series of molecular
events that fundamentally alter the normal properties of cells. In cancer cells the normal control
systems that prevent cell overgrowth and the invasion of other tissues are disabled. These altered
cells divide and grow in the presence of signals that normally inhibit cell growth; therefore, they
no longer require special signals to induce cell growth and division. As these cells grow they
develop new characteristics, including changes in cell structure, decreased cell adhesion, and
production of new enzymes. The main characteristics of malignancies have been proposed:
sustaining proliferative signaling, evading growth suppressors, resisting cell death, enabling
replicative immortality, inducing angiogenesis, and activating invasion and metastasis.
Today, millions of people are living with cancer or have had cancer. In 2007, cancer caused
about 13% of all human deaths worldwide (7.9 million). In 2020 there are predicted to be 20
million new cases and 12 million deaths. There are over 200 different known cancers that affect
humans. The causes of cancer are diverse, complex, and only partially understood. Many things
are known to increase the risk of cancer, including tobacco use, dietary factors, certain
infections, exposure to radiation, and lack of physical activity, obesity, and environmental
pollutants. Cancer is usually treated with chemotherapy, radiation therapy and surgery [Juan et
al., 1998].
1.1.1. Cancer: Origin and Terminology
Cancer is known medically as a malignant neoplasm, is a broad group of diseases involving
unregulated cell growth. Cancer cells behave as independent cells, growing without control to
form tumours. Tumours grow in a series of steps. The first step is hyperplasia, meaning that there
1

are too many cells resulting from uncontrolled cell division. These cells appear normal, but
changes have occurred that result in some loss of control of growth. The second step is dysplasia,
resulting from further growth, accompanied by abnormal changes to the cells. The third step
requires additional changes, which result in cells that are even more abnormal and can now
spread over a wider area of tissue. These cells begin to lose their original function; such cells are
called anaplastic. At this stage, because the tumour is still contained within its original location
(called in situ) and is not invasive, it is not considered malignant, it is potentially malignant. The
last step occurs when the cells in the tumour metastasize, which means that they can invade
surrounding tissue, including the bloodstream, and spread to other locations. This is the most
serious type of tumour, but not all tumours progress to this point. Non-invasive tumours are said
to be benign. In order for a normal cell to transform into a cancer cell, the genes which regulate
cell growth and differentiation must be altered. The affected genes are divided into two broad
categories. Oncogenes are genes which promote cell growth and reproduction. Tumour
suppressor genes are genes which inhibit cell division and survival. Malignant transformation
can occur through the formation of novel Oncogenes, the inappropriate over-expression of
normal Oncogenes, or by the under-expression or disabling of tumour suppressor genes [Juan et
al., 1998].
1.1.2. Etiology of Cancer
Cancer can be caused by a variety of factors. Some of the factors include: Exposure to radiation
like ultraviolet and X-rays; physical agents like asbestos, powdered metallic cobalt and nickel;
chemical agents like tobacco, alcohol; biological agents include human papilloma virus (genital
carcinomas), hepatitis B (liver carcinoma) and Epstein-Barr virus (Burkitts lymphoma and
nasopharyngeal carcinoma) [Juan et al., 1998].
1.1.3. Classification of Cancer
The type of tumor that forms depends on the type of cell that was initially altered. There are
mainly five types of tumors:

Carcinomas result from altered epithelial cells, which cover the surface of our skin and
internal organs. Most cancers are carcinomas and include nearly all those developing in
the breast, prostate, lung, pancreas, and colon.

Sarcomas are cancers arising from connective tissue (i.e. bone, cartilage, fat, nerve),
each of which develop from cells originating in mesenchymal cells outside the bone
marrow.

Leukemia results from malignant white blood cells.

Lymphoma is a cancer of the lymphatic system cells that derive from bone marrow.

Myelomas are cancers of specialized white blood cells that make antibodies

1.2. LEUKEMIA
Leukemia is a type of cancer of the blood or bone marrow characterized by an abnormal
increase of immature white blood cells called "blasts". Leukemia is a broad term covering a
spectrum of diseases. In turn, it is part of the even broader group of diseases affecting the blood,
bone marrow, and lymphoid system, which are all known as hematological neoplasms.
A basic defect of the leukemic leukocytes, especially in the acute forms is a lack of normal
maturation. So long as these cells remain immature, they retain the capacity for further
proliferation and their lifetime may therefore be greatly increased. Indeed many leukemic cells
may be regarded as effectively immortal. The leukemic cells may have a prolonged total and
reproductive life, they are likely to accumulate in the tissues, and this may be an essential
element in the pathology of the disease. Once leukemia arises, it results in an excessive
accumulation of abnormal hemopoietic cells, called blast cells in the bone marrow and peripheral
blood.
It is often associated with abnormal WBC counts and abnormal increase in leukocytic mass
leading to anaemia, thrombocytopenia and death. Many studies have revealed that recurrent
chromosomal changes occur in over one half of all cases of leukemia. Leukemia accounts for the
largest number of cases of adolescent and childhood cancer and are the main cause of cancer
related deaths in adolescents.
3

1.2.1. Etiology of Leukemia

The main risk factors of leukemia include:
Radiation: Radiation is the best known and most studied risk for leukemia. Nonionizing
radiation, in the form of extremely-low-frequency electromagnetic field exposure induced by
electricity has been suggested as a possible risk factor for leukemia. Power linemen, utilities
workers, electronics workers and others are most often mentioned as possibly at risk.
Chemicals:

Workers

in

petroleum

manufacturing,

chemical

manufacturing,

rubber

manufacturing, and shoe manufacturing as well as printers and painters have been included in the
categories at risk. Styrene, butadiene and benzene have primarily been associated with
lymphomas and with Chronic Lymphocytic Leukemia (CLL). Cigarette smoking has only been
recognized as a potential cause of leukemia since 1986.
Viruses: Infection with Human T-cell Lymphotropic Virus-1 (HTLV-I) is linked to the
development of Adult T-cell Leukemia/Lymphoma (ATLL), a cancer of activated mature T
lymphocytes.
Heredity: Children with Down syndrome (DS) have a roughly 20-fold increased risk of
developing childhood leukemia compared to children without DS. Of all the major hematological
malignancies, CLL shows the highest family influence, suggesting a genetic component to the
cause of the disease. It is becoming increasingly evident that familial leukemia can be associated
with chromosome instability that is inherited.
Mutation: Leukemia, like other cancers results from mutations in the DNA. Certain mutations
can trigger leukemia by activating oncogenes or deactivating tumor suppressor genes, and
thereby disrupting the regulation of cell death, differentiation or division.
1.2.2. Epidemiology

Leukemias were reported as one of the 9th and 10th common cancers in men and women
respectively. The number of new cases of leukemia was 13 per 100,000 men and women per
4

year. The number of deaths was 7.1 per 100,000 men and women per year. In 2010, globally,
approximately 281,500 people died of leukemia. In 2014, it is estimated that there will be 52,380
new cases of leukemia and an estimated 24,090 people will die of this disease Incidence rates for
all types of leukemia are higher among males than among females. Although leukemia is among
the most common childhood cancers, it most often occurs in older adults; the median age at
diagnosis is 66 years. The most common types of leukemia in adults are Acute Myelogenous
Leukemia (AML), Chronic Myelogenous Leukemia (CML) and Chronic Lymphocytic Leukemia
(CLL). From 2006 to 2010 there were 5,493 children and adolescents under the age of 20 years
diagnosed with leukemia, including 4,148 diagnosed with Acute Lymphocytic Leukemia (ALL).
Leukemia is the tenth most frequently occurring type of cancer in all races or ethnicities.
Leukemia incidence is highest among non-Hispanic whites (13.6 per 100,000 populations);
incidence is lowest among Asian and Pacific Islander populations (7.4 per 100,000 population)
and American Indian and Alaska Native populations (7.3 per 100,000 populations).
1.2.3. History
Leukemia was first observed by pathologist Rudolf Virchow in 1845. Other European physicians
in the 19th century observed that their patients had abnormally high levels of white blood cells,
and they called the disease weisses blut, meaning white blood. The term leukemia that is
used now comes from the Greek words leukos and heima, also meaning white blood.
Around ten years after Virchow's findings, pathologist Franz Ernst Christian Neumann found
that one deceased leukemia patient's bone marrow was coloured "dirty green-yellow" as opposed
to the normal red. This finding allowed Neumann to conclude that a bone marrow problem was
responsible for the abnormal blood of leukemia patients. By 1900 leukemia was viewed as a
family of diseases as opposed to a single disease. In 1913, four types of leukemia were classified:
chronic lymphocytic leukemia, chronic myelogenous leukemia, acute lymphocytic leukemia, and
erythroleukemia. By 1947 Boston pathologist Sidney Farber believed from past experiments that
aminopterin, a folic acid mimic, could potentially cure leukemia in children. In 1962, researchers
Emil J. Freireich Jr. and Emil Frei III used combination chemotherapy to attempt to cure
leukemia. In 1970, it was first confirmed that some patients could be cured of leukemia, and by
the 1980s and 1990s the cure rates for leukemia were around 70% [Thomas et al., 2013].
5

1.2.4. Classification
Clinically and pathologically, leukemia is subdivided into a variety of large groups. The first
division is between its acute and chronic forms.

Acute leukemia is characterized by a rapid increase in the number of immature blood

cells. Crowding due to such cells makes the bone marrow unable to produce healthy
blood cells. Immediate treatment is required in acute leukemia due to the rapid
progression and accumulation of the malignant cells, which then spill over into the
bloodstream and spread to other organs of the body. Acute forms of leukemia are the
most common forms of leukemia in children.

Chronic leukemia is characterized by the excessive build up of relatively mature, but

still abnormal, white blood cells. Typically taking months or years to progress, the cells
are produced at a much higher rate than normal, resulting in many abnormal white blood
cells. Whereas acute leukemia must be treated immediately, chronic forms are sometimes
monitored for some time before treatment to ensure maximum effectiveness of therapy.
Chronic leukemia mostly occurs in older people, but can theoretically occur in any age
group.

Additionally, the diseases are subdivided according to which kind of blood cell is affected. This
split divides leukemias into lymphoblastic or lymphocytic leukemias and myeloid or
myelogenous leukemias:

In lymphoblastic or lymphocytic leukemias, the cancerous change takes place in a type

of marrow cell that normally goes on to form lymphocytes, which are infection-fighting
immune system cells. Most lymphocytic leukemias involve a specific subtype of
lymphocyte, the B cell.

In myeloid or myelogenous leukemias, the cancerous change takes place in a type of

marrow cell that normally goes on to form red blood cells, some other types of white
cells, and platelets.

Combining these two classifications provides a total of four main categories:

6

Acute lymphocytic leukemia (ALL) is the most common type of leukemia in young
children. This disease also affects adults, especially those ages 65 and older. Standard
treatments involve chemotherapy and radiotherapy. The survival rates vary by age:
85% in children and 50% in adults.

Chronic lymphocytic leukemia (CLL) most often affects adults over the age of 55.
It sometimes occurs in younger adults, but it almost never affects children. Twothirds of affected people are men. The five-year survival rate is 75%. It is incurable,
but there are many effective treatments.

Acute myelogenous leukemia (AML) occurs more commonly in adults than in

children, and more commonly in men than women. AML is treated with
chemotherapy. The five-year survival rate is 40%, except for APL, which is over
90%.

Chronic myelogenous leukemia (CML) occurs mainly in adults; a very small

number of children also develop this disease. Treatment is with imatinib (Gleevec in
United States, Glivec in Europe) or other drugs. The five-year survival rate is 90%.

1.3. CHRONIC MYELOGENOUS LEUKEMIA (CML)

Chronic myelogenous (or myeloid) leukemia (CML), also known as chronic granulocytic
leukemia (CGL) or chronic myelocytic leukemia is a cancer of the white blood cells. It is a form
of leukemia characterized by the increased and unregulated growth of predominantly myeloid
cells in the bone marrow and the accumulation of these cells in the blood. The blast count is
usually normal; <5% of the marrow cells. About 40% of the patients are asymptomatic at the
time of presentation, and the diagnosis is based upon an abnormal white blood cell count. It is a
type of myeloproliferative disease associated with a characteristic chromosomal translocation
called the Philadelphia chromosome. The CML cells grow and survive better than the normal
cells; if untreated, over time they crowd out the normal cells. The typical result of an
uncontrolled growth of CML cells in the marrow is an increase in the number of CML cells in
the blood. CML does not completely interfere with the development of mature red cells, white
cells and platelets. As a result, chronic phase myeloid leukemia is generally less severe than
acute leukemia [Druker, 2002; Shet et al., 2002]. The symptoms of chronic myeloid leukemia
7

(CML) are often vague and are more often caused by other things. They include weakness,
fatigue, night sweats, weight loss, fever, bone pain, enlarged spleen (i.e. splenomegaly), pain or a
sense of fullness of belly [Vardiman et al., 2001].
1.3.1. The Philadelphia Chromosome
Normal cells have 23 pairs of chromosomes (structures in the nucleus of the cell that contain
genes). They consist of 22 numbered pairs, with the sex chromosomes (XX for a female and XY
for a male) constituting the 23rd pair. CML was initially distinguished from other types of
leukemia by the presence of a genetic abnormality of chromosome 22 in CML cells called the
Philadelphia (Ph) chromosome. The Ph chromosome was first reported in 1960 by Peter Nowell
and David Hungerford in the University of Pennsylvania in Philadelphia, United States after
studying peripheral blood samples of patients with leukemia, including two CML patients. They
considered the shortened chromosome 22 as a deletion and named it as Philadelphia
chromosome (Ph chromosome)after the city where it was discovered. Later the origin of Ph
chromosome was discovered as a reciprocal (two way) translocation between the long arms of
chromosomes 9 and 22. This translocation creates an elongated derivative chromosome 9 and a
shortened derivative chromosome 22, the latter of which is the Ph chromosome [Fig 1].

Fig 1: Schematic representation of translocation of chromosomes on 9 and 22.

High resolution cytogenetic analyses refined the exact breakpoints to subbands 9q34.1 and
22q11.2, so the translocation is marked as t(9;22) (q34.1;q11.2) [Nowell PC, Hungerford, 1960;
Rowley, 1973]. This exchange brings together two genes: the BCR (breakpoint cluster region)
gene on chromosome 22 and the proto-oncogene ABL (Ableson leukemia virus oncogene) on
Chromosome 9 [Wong et al., 2004]. The resulting hybrid gene BCR-ABL codes for a fusion
protein with tyrosine kinase activity which activates signal transduction pathways leading to
uncontrolled cell growth.

1.3.2. The BCR-ABL fusion gene

BCR-ABL is a 210 kD chimeric oncoprotein generated by reciprocal translocation between

chromosomes 9 and 22 and is implicated in the pathogenesis of Philadelphia-positive (Ph+)
human leukemias. The t (9;22) anomaly leads to an exchange of DNA between chromosomes 9
and 22. The 3 part of the ABL gene is moved from chromosome 9 to chromosome 22 and is
juxtaposed to the proximal segment of the disrupted BCR gene on chromosome 22. The result is
a chimeric BCR-ABL gene. The native ABL kinase is located mainly in the nucleus and has
tightly regulated kinase activity, while the BCR-ABL fusion protein is located in the cytoplasm
and has a constitutively activated tyrosine kinase. Similar to other kinases, BCR-ABL functions
by binding to ATP and transfers phosphate from ATP to tyrosine residues, activating multiple
signal transduction pathways. These events cause excessive cellular proliferation, prevent
apoptosis and decrease cellular adhesion. It has been shown that the enhanced tyrosine kinase
activity of BCR-ABL is essential for CML pathogenesis and is likely to represent the initiating
event [Savage et al., 2002].

1.3.3. BCR-ABL oncogene

The Abelson Murine Leukemia Viral Oncogene Homolog 1 (ABL) Gene: The 145 kD ABL
is encoded by the Abelson murine leukemia viral oncogene homolog 1 (ABL, ABL1) gene
located in the chromosome region 9q34.1 and it functions as a non-receptor tyrosine kinase
enzyme. Tyrosine kinases are enzymes that phosphorylate (add a phosphate group) to a tyrosine
9

in a substrate. They have a catalytic domain, which promotes the transfer of the terminal
phosphoryl group from adenosine triphosphate (ATP) to a tyrosine amino group acceptor in a
substrate (or they may autophosphorylate). Normal Abl phosphorylation is tightly controlled,
probably by motifs in the N-terminal. Loss of this region (as occurs in the formation of BCRABL) results in high constitutive kinase enzymatic activity, a key factor in the oncogenic
potential of transforming Abl proteins.

The Breakpoint cluster region (BCR) gene: The 160 kD BCR protein is encoded by BCR gene
situated on the long arm of chromosome 22 (22q11.2). The most important function is serine and
threonine kinase enzymatic activity which is pivotal to oncogenesis. It can phosphorylate itself as
well as key substrates and, hence, propagates cellular signals.

1.3.4. The Phases of CML

CML is often divided into three phases based on clinical characteristics. In the absence of
intervention, CML typically begins in the chronic phase, and over the course of several years
progresses to an accelerated phase and ultimately to a blast crisis. One of the drivers of the
progression from chronic phase through acceleration and blast crisis is the acquisition of new
chromosomal abnormalities (in addition to the Philadelphia chromosome). Some patients may
already be in the accelerated phase or blast crisis by the time they are diagnosed.
Chronic Phase: In the chronic phase, fewer than 10 percent of the cells in the blood and bone
marrow are immature white blood cells (blasts). People with chronic phase CML may or may not
have symptoms, have an increased number of white blood cells. When treated, the symptoms
resolve quickly. White blood cell counts return to near-normal levels, spleen reduces in size,
haemoglobin concentration improves, general well-being of a patient is restored and normal
activities can continue (Leukemia and Lymphoma society, 2014).
Accelerated phase: According to WHO criteria, accelerated phase can be defined by any of the
features like 1019% myeloblasts in the blood or bone marrow, >20% basophils in the blood or
bone marrow, Platelet count <100,000, unrelated to therapy, Platelet count >1,000,000,
10

unresponsive to therapy, Cytogenetic evolution with new abnormalities in addition to the

Philadelphia chromosome, Increasing splenomegaly or white blood cell count, unresponsive to
therapy. The accelerated phase is significant because it signals that the disease is progressing and
transformation to blast crisis is imminent.
Blast crisis: Blast crisis is the final phase in the evolution of CML, and behaves like an acute
leukemia, with rapid progression and short survival. Blast crisis is diagnosed if any of the
following are present in a patient with CML like >20% myeloblasts or lymphoblasts in the blood
or bone marrow, large clusters of blasts in the bone marrow on biopsy, development of a
chloroma (solid focus of leukemia outside the bone marrow) [Melo et al., 2004]. In about 25
percent of people with CML, the blast crisis phase resembles acute lymphoblastic leukemia;
however, in most people, it looks like acute myeloid leukemia. The goal in treating accelerated
or blast crisis phase CML is, as with the chronic phase, to eliminate all cells that contain the
BCR-ABL gene, leading to remission. If this is not possible, the goal is to return the disease to
the chronic phase (Leukemia and Lymphoma society, 2014)
A small number of patients progress from chronic phase, which can usually be well managed, to
accelerated phase or blast crisis phase. This is because there are additional genetic changes in the
leukemic stem cells. Some of these additional chromosome abnormalities are identifiable by
cytogenetic analysis. However, there appear to be other genetic changes (low levels of drugresistant mutations that may be present at diagnosis) in the CML stem cells that cannot be
identified by the laboratory tests that are currently available.
1.3.5. Epidemiology
CML is one of the most common of the chronic myeloproliferative disorders, but still a rare
disease worldwide. It accounts for 15-20% of all leukemia cases. The annual incidence of the
disease is approximately 1 case per 75,000 100,000 of population. There is a slight male
predominance, with a male-to-female ratio 1.3 to 1. CML patients are most often diagnosed
between the fourth and sixth decades of life, but the median age of the newly diagnosed CML
patients is decreasing due to earlier time point of diagnosis. As prognosis of CML is improving
with current therapies, prevalence of the disease is steadily increasing. CML can also be
11

diagnosed in children, but childhood CML is extremely rare, as it affects approximately one case
per one million children annually. Factors predisposing to CML are not known. Exposure to
ionizing radiation has been implicated in some cases, but majority of cases arise sporadically
without any know causative factor [Vardiman et al., 2001].
1.4. DIAGNOSTIC METHODS
1.4.1. Cytogenetic Analysis (Karyotyping)
Karyotyping is the systematic arrangement of chromosomes from a cell according to their length,
position of centromere and specific banding patterns. This test measures the number and
structure of the chromosomes. Samples from the bone marrow are examined to confirm the
blood test findings and to determine if there is a chromosomal abnormality such as the
Philadelphia chromosome. The bone marrow aspiration and bone marrow biopsy, are
usually done during the same procedure. For a bone marrow aspiration, a special needle is
inserted through the hip bone into the marrow to aspirate marrow cells. For a bone marrow
biopsy, a special needle is used to remove a core sample of bone that contains marrow. The
presence of the Ph chromosome confirms the diagnosis of CML.
1.4.2. Fluorescence In Situ Hybridization (FISH)
The bone marrow cells of about 90 percent of people with CML have Ph chromosomes
detectable by cytogenetic analysis. A small percentage of people with clinical signs of CML do
not have cytogenetically detectable Ph chromosomes, but they almost always test positive for the
BCR-ABL fusion gene on chromosome 22. FISH is a more sensitive method for detecting CML
than the standard cytogenetic tests that identify the Ph chromosome. FISH is a quantitative test
that can identify the presence of the BCR-ABL gene. Genes are made up of DNA segments. FISH
uses DNA-binding agents that are specific for selected pieces of DNA in this case, ABL and
BCR. The probes for both BCR and ABL are labeled with chemicals that each releases a different
colour of light. The colour shows on the chromosome that contains the gene normally
chromosome 9 for ABL and chromosome 22 for BCR, so FISH can detect the piece of
chromosome 9 that has moved to chromosome 22 in CML cells. Since FISH can detect
12

BCR-ABL in cells found in the blood, it can be used to determine if there is a significant decrease
in the number of circulating CML cells as a result of treatment [Landstrom et al., 2006].
1.4.3 Polymerase Chain Reaction (PCR)
The BCR-ABL gene is also detectable by molecular analysis. A quantitative PCR test is the most
sensitive molecular testing method available. This test can be performed with either blood or
bone marrow cells. The PCR test essentially increases or amplifies small amounts of specific
pieces of either RNA or DNA to make them easier to detect and measure. So, the BCR-ABL
gene abnormality can be detected by PCR even when present in a very low number of cells.
About one abnormal cell in one million cells can be detected by PCR testing.
1.5. TREATMENT
Chemotherapy: The term chemotherapy, or chemo, refers to a wide range of drugs used to treat
cancer. Chemotherapeutic drugs are chemically designed to target cells that are dividing and
growing rapidly. The common chemotherapeutic drugs used to treat CML were busulfan,
hydroxyurea and IFN . These drugs had shown efficacy in controlling elevated white blood cell
(WBC) counts and spleen size over a period of several years but was not able to eliminate the
Philadelphia chromosome positive (Ph+) cells from bone marrow. Toxicities associated with this
therapy include nausea, vomiting, stomatitis, and rash.
Stem Cell Transplantation: Hematopoietic stem cell transplantation (HSCT) is the
transplantation of multipotent hematopoietic stem cells, usually derived from bone marrow,
peripheral blood, or umbilical cord blood. This involves giving very high doses of chemotherapy,
sometimes in combination with radiotherapy, in an attempt to completely destroy the abnormal
stem cells in your bone marrow. These cells are then replaced with donated healthy stem cells.
Donor transplants carry significant risks and are only suitable as a second or third line of therapy.
Immunotherapy: Immunotherapy is a type of therapy that uses immune responses to
specifically kill cancer cells. Monoclonal antibody therapy, cancer vaccines and donor
lymphocyte infusion (DLI) are types of immunotherapy.
13

Targeted Therapy: A targeted therapy is one that is designed to treat only the cancer cells and
minimize damage to normal, healthy cells. Targeted cancer therapies are drugs or other
substances that block the growth and spread of cancer by interfering with specific molecules
involved in tumour growth and progression. Many of these therapies focus on proteins that are
involved in cell signaling pathways.

Chronic myeloid leukemia (CML) cells contain an oncogene, BCR-ABL, which encodes a type of
protein known as a tyrosine kinase. Drugs known as tyrosine kinase inhibitors (TKIs) that target
BCR-ABL are the standard treatment for CML. These drugs are less likely to affect normal cells,
so their side effects are generally not as severe as those seen with other drugs that can be used to
treat CML, such as traditional chemotherapy drugs or interferon. Three drugs, imatinib mesylate
(Gleevec), dasatinib (Sprycel) and Nilotinib (Tasigna) have been approved as initial
therapy for chronic phase CML and all three are reasonable options for newly diagnosed
patients.

1.6. IMATINIB MESYLATE

The first of this new class of tyrosine kinase inhibitor drugs was imatinib mesylate (marketed as
Gleevec or Glivec), approved by the U.S. Food and Drug Administration (FDA) in 2001. It
works by preventing a tyrosine kinase enzyme, BCR-ABL, from phosphorylating subsequent
proteins and initiating the signalling cascade necessary for cancer development, thus preventing
the growth of cancer cells and leading to their death by apoptosis. Because the BCR-ABL
tyrosine kinase enzyme exists only in cancer cells and not in healthy cells, imatinib works as a
form of targeted therapy, only cancer cells are killed through the drug's action. It is a highly
effective oral drug therapy that, for the majority of people treated, brings about a stable
remission. Studies have shown that imatinib can keep the chronic phase of CML under control
for at least 10 years, the length of the observation period since this drugs approval. Because it
was the first TKI, imatinib is known as a first generation tyrosine kinase inhibitor. Common side
effects can include diarrhea, nausea, muscle pain, and fatigue [Fausel et al., 2007].
14

1.6.1. Imatinib Mesylate-Mechanism of Action

Imatinib is a 2-phenyl amino pyrimidine derivative that functions as a specific inhibitor of a

number of tyrosine kinase enzymes. It occupies the TK active site, leading to a decrease in
activity. There are a large number of TK enzymes in the body, including the insulin receptor.
Imatinib is specific for the TK domain in abl (the Abelson proto-oncogene), c-kit and PDGF-R
(platelet-derived growth factor receptor). In chronic myelogenous leukemia, the Philadelphia
chromosome leads to a fusion protein of abl with bcr (breakpoint cluster region), termed
bcr-abl. As this is now a constitutively active tyrosine kinase, imatinib is used to decrease
bcr-abl activity. The active sites of tyrosine kinases each have a binding site for ATP. The
enzymatic activity catalyzed by a tyrosine kinase is the transfer of the terminal phosphate from
ATP to tyrosine residues on its substrates, a process known as protein tyrosine phosphorylation.
Imatinib works by binding close to the ATP binding site of bcr-abl, locking it in a closed or
self-inhibited conformation, and therefore inhibiting the enzyme activity of the protein
semi-competitively [Fig 2]. This fact explains why many BCR-ABL mutations can cause
resistance to imatinib by shifting its equilibrium toward the open or active conformation. If the
ATP binding site is occupied, then ATP cannot donate the phosphate and BCR-ABL can no
longer activate downstream signalling proteins that promote cell division. Disease progression is
essentially stopped by blocking this ATP binding site that happens to sit at the initiating node of
a large and complex signal transduction cascade [Crossman et al., 2004].

15

.
Fig 2: Schematic representation of mechanism of action of imatinib mesylate

1.6.2 CML-AP and BP patients: a therapeutic challenge

In the past, CML-BP was often treated with drugs used for acute leukemias, but patients usually
relapsed within a few months. The introduction of TKIs has improved prognosis to some degree.
The majority of CML-BP patients not previously treated with TKIs do initially respond to
treatment with these agents, either alone or in combination with conventional chemotherapeutic
drugs, but most still relapse within a few months of achieving a seemingly complete hematologic
or even cytogenetic response. Therefore, any CML-BP patient who does respond to modern
therapy should proceed, if possible, to allogeneic stem cell transplant prior to relapse.

However, as a minority of patients will still progress to CML-BP, the routine use of TKIs may
need to be supplemented with other agents, any of which might prevent BP. Possible examples
are antioxidants, which protect against cancer-causing DNA mutations; farnesyl transferase
inhibitors, which inhibit RAS signaling; hydroxychloroquine, which inhibits autophagy in some
situations; sonic hedgehog pathway antagonists, which impair self-renewal pathways only when
used in combination with TKIs; and activators of protein phosphatase 2A (PP2A), which targets
BCR-ABL1 and other downstream oncogenic signaling cascades. Extrapolating from the good
16

clinical outcomes of treating CML-CP with TKIs and the dismal responses achieved in treating
CML-BP, one might reasonably conclude that the best approach to CML-BP would be
prevention.

1.6.3 Mechanisms of disease progression

Although the BCR-ABL gene plays a central role in the pathogenesis of chronic phase CML and
its continued expression is required for the proliferation of cells in the acute phase, the molecular
events leading to the evolution to blast crisis are not fully understood. CML cells develop
additional cytogenetic or molecular defects that commonly precede blast crisis. The significance
of these cytogenetic and molecular defects and their impact on disease transformation will be
discussed in this section.

Genetic events

Chromosomal Abnormalities

Cytogenetic and molecular changes occur in the majority of the patients during evolution to blast
crisis. Approximately 7080% of patients with classical Ph-positive CML show additional nonrandom chromosomal changes involving chromosomes 8, 17, 19 and 22 with duplication of the
Ph chromosome or trisomy 8 being the most frequent. In about 15% of patients, progression of
the disease is associated with 7, 17, +17, +21 and Y. At the molecular level, the most
frequent abnormality is a deletion of p53, a tumor suppressor gene located on the short arm of
chromosome 17, leading chiefly to myeloid blast crisis. About 50% of patients with lymphoid
blast crisis have a homozygous deletion of the p16INK4a gene located on chromosome 9. Other
less frequent acquired genetic abnormalities are deletions of the retinoblastoma gene,
overexpression of c-MYC or N-RAS and generation of an oncogene AML-EVI-1.

17

Inactivation of tumor suppressor genes

DNA damage in eukaryotic organisms leads to activation of DNA damage sensor proteins such
as ATM. These proteins when activated phosphorylate p53, which in turn upregulates expression
of proteins such as BAX, CD95 and DR5, all members of core apoptotic pathways. In addition,
activated p53 causes increased expression of cell cycle blocking genes such as p21cip1, leading
to cell cycle arrest at the G1S phase to allow cell repair. The p53 gene is located on
chromosome 17 and its inactivation has been shown to be important in the evolution of CML to
blast crisis. Loss of p53 function can be due to mutations, deletions and rearrangements and is
seen in 25% of myeloid blast crisis. This rapid progression of chronic phase to blast crisis was
due to loss of function of the remaining p53 allele. Similarly, transplantation of p53-deficient
bone marrow cells transduced with BCR-ABL cDNA led to rapid blast crisis.

Activation of oncogenes

Increased levels of BCR-ABL mRNA and protein are associated with disease progression. This
can be due to duplication of the Philadelphia chromosome. In other patients increased levels of
BCR-ABL mRNA may represent increased translational activity of the existing BCR-ABL gene.
c-MYC appears to play a role in BCR-ABL-mediated transformation and may mediate its effects
either by antagonising the function of p53 or by acting as a co-operative oncogene with the
BCR-ABL. MYC expression is normal in chronic phase CML but is increased in patients with
blast crisis. Overexpression of c-MYC occurs as a result of increased transcription or trisomy 8
frequently observed during disease progression or stabilization of c-MYC m-RNA due to
polyadenylation. Additional translocations like t(3;21) have been reported in high frequency in
blast crisis. This results in the formation of the chimeric AML/EVI-1 fusion protein that blocks
differentiation and stimulates proliferation.

18

Impaired DNA repair

Genetic instability due to dysfunction of DNA repair has long been considered a cause of the
non-random chromosomal abnormalities that contributes to disease progression. However, not all
the studies support the notion of genomic instability in CML. Additionally, whether genomic
instability is a cause or effect of disease progression is also not known. In a recent study it was
shown in murine and human p210BCR/ABL containing cells that BCR-ABL might down-regulate
the DNA repair protein DNA-PKcs. These findings suggest that increasing levels of BCR-ABL
protein lead to inhibition of DNA repair that can lead to accumulation of other genetic defects
and disease progression.

Cellular events

Decreased apoptosis

Apoptosis or programmed cell death can be considered a protective mechanism against cancer
and its derangement has significance in many malignancies. Signals instructing a cell to undergo
apoptosis are multiple, complex and highly redundant. Protection against apoptosis is relatively
minimal in chronic phase CML but there is evidence that BCR-ABL mediates resistance to
apoptosis in a dose-dependent fashion. Increased expression of the BCR-ABL mRNA, often
associated with disease progression may therefore lead to increased resistance to apoptosis in
accelerated phase and blast crisis.

Differentiation block

During the process of hematopoeitic differentiation, pluripotent stem cells become lineage
committed and eventually differentiate morphologically and functionally into distinct blood cell
types. Although the p210BCR/ABL itself does not significantly affect terminal cell differentiation in
chronic phase, differentiation is blocked in blast phase CML. The role of BCR-ABL itself or
other events in this phenomenon is not fully elucidated. Additional mutations, formation of new
19

oncogenes, elevated cytokine levels, inactivation of tumor suppressor genes are hypothetical
reasons for this phenomenon.

Decreased immune surveillance

MHC-restricted and MHC-unrestricted mechanisms play an important role in the natural control
of the Ph clone in chronic phase as well as during progression of CML. Among the
MHC-restricted mechanisms, T lymphocyte-mediated killing of target cells via Fas-receptor
triggering plays an important role in elimination of malignant CML cells. CML progenitor cells
also express functional Fas-ligand, which may be an important immune surveillance escape
factor. In comparison to the chronic phase, CML cells derived from patients in blast crisis are
refractory to Fas-mediated apoptosis, regardless of the expression levels of Fas, suggesting that
an immune mediated selection pressure could result in acquisition of Fas resistance.

Drug resistance

CML progenitors obtained from patients during chronic phase and blast crisis are equally
sensitive to STI-571 by in vitro assay methods. Despite this observation there is a lower response
rate in accelerated phase and blast crisis compared with chronic phase CML indicating
development of drug resistance in vivo. The other possibility to consider is the presence of
additional genetic errors that can stimulate the malignant clone in the absence of BCR-ABL. The
observation that some patients who initially respond to STI-571 redevelop Ph positive
hematopoiesis may also indicate development of drug resistance. Drug resistance may be
contributory to the change in character of chronic phase CML. There are multiple mechanisms
involved in resistance to therapy, which could impact on disease progression. These include
expression of the MDR-1 gene, AGP-1 reduplication of BCR-ABL or its overexpression,
decreased apoptosis74 and possibly defective drug transport.

20

1.6.4. Imatinib Resistance

Resistance to imatinib has been documented across all phases of CML. The emergence of
resistance to imatinib has dampened the enthusiasm for this drug. The rate of relapse and
resistance appear to correlate with disease stage, and the incidence increases as CML progresses.
Resistance to imatinib can be divided into primary resistance, in which patients show lack of
efficacy to this tyrosine kinase inhibitor (TKI) from the start of the therapy, and secondary
resistance, also known as acquired resistance, which is defined as a loss of hematologic,
cytogenetic or molecular response, as well as progression to advanced phases of CML.
Resistance can be further divided into hematologic (lack of normalization of peripheral blood
counts), cytogenetic (persistence of Ph chromosome), and molecular (persistence of BCR ABL
transcripts).
Drug efflux mechanism: Several other mechanisms of resistance to imatinib have been also
identified, but possible importance of drug transporter proteins that affect drug concentration,
such as permeability glycoprotein (P-gp), human organic cationic transporter (hOCT), and ATP
binding cassette G2, has only been appreciated. The general mechanism is down regulation of
human organic cation transporter-1 and upregulation of the adenosine triphosphate
(ATP)binding cassette (ABC) transporter ABCB1 (MDR-1) and ABCG2, responsible for the
influx and efflux of imatinib, respectively [Vaidya et al., 2011].

1.7. MDR1 (MULTIDRUG RESISTANCE GENE)

The resistance of human tumor to multiple chemotherapeutic drugs has been recognized as a
major reason for the failure of cancer therapy. Multidrug resistance (MDR) is a well-known
phenomenon of cross-resistance of mammalian cells to a number of structurally and functionally
unrelated anticancer agents following exposure to one such drug. Intracellular drug concentration
is partly mediated by drug transporter proteins, called the ATP-binding cassette (ABC) proteins
that transfer different substrates in (influx) and out (efflux) of the cells. ABC transporters also
have an important role in multidrug resistance (MDR). MDR1 (ABCB1) gene, located on
chromosome 7q21 encodes a 170 kD membrane transporter Permeability-glycoprotein [P-gp]
that acts as an energy dependent, efflux pump. P-gp plays an important role in regulating drug
21

absorption, distribution, and elimination. P-gp exhibits wide substrate specificity for structurally
different drugs and thus mediates resistance to a variety of drugs including vinca alkaloid
compounds such as vincristine, actinomycin D, adriamycin and bacterial and fungal antibiotics,
such as anthracyclines and etoposide. Over expressions of P-gp in malignant cells serve to pump
anticancer drugs out of the cell, resulting in lack of intracellular levels of the drug necessary for
effective therapy. It was first detected in cancer cells where it is responsible for multiple
resistances to anticancer agents; however, it is also highly expressed in normal tissues such as in
intestinal lining epithelium, endothelial cells, bone marrow progenitor xenocells, peripheral
blood lymphocytes, natural killer cells adrenal cortex, brain, liver, kidney, placenta, gut, and
testes. Though very low MDR1 expression levels are found in normal haematopoietic cells (total
bone marrow, spleen, purified peripheral blood lymphocytes), in almost all types of leukaemia,
elevated levels are reported. Imatinib is a substrate for P-gp and therefore overexpression of P-gp
may therefore result in excess transport of imatinib out of the cells conferring intrinsic resistance
to the treatment [Gottesman and Pastan, 1993; Juliano and Ling, 1976; He et al., 2011].

There are three known isoforms of P-gp namely, class I, II and III. Rodent cells have all three
P-gp genes, encoding classes I, II, and III P-gp, whereas human cells have two, encoding class I
and III P-gp (MDR1 and MDR3). The P-gp molecule is composed of two halves, each consisting
of transmembrane helices and the cytoplasmic ATP-binding domain. The two half molecules
are separated by a highly charged linker region which is phosphorylated at several sites by
protein kinase C. Each half contains a highly hydrophobic domain with 6 transmembrane
helices (TMDs) and a hydrophilic domain located at the cytoplasmic face of the membrane,
nucleotide binding domain (NBD) [Fig 3]. The protein molecule also contains the substrate(s)
binding domain(s). The substrates of P-gp are large hydrophobic and amphipathic molecules that
are able to intercalate into the membrane and enter the cytosol by passive diffusion.

22

Fig 3: Schematic representation of structure of P-glycoprotein

After binding of the substrate, ATP hydrolysis induces, conformation changes in the protein
molecule that opens the central pore and allows transport of hydrophobic drugs directly from the
lipid bilayer into the central pore of the transporter expelling the substrate out of the cell [Fig 4]
[Mahon et al., 2003].

Fig 4: Schematic representation of mechanism of action of P-glycoprotein

23

CHAPTER 2
REVIEW OF LITERATURE
2.1 CHRONIC MYELOGENOUS LEUKEMIA
The oldest description of cancer was discovered in Egypt and dates back to approximately 1600
BC. The origin of the word cancer to describe non ulcer forming and ulcer forming tumors
is credited to the Greek physician Hipocrates (460 370 BC). Velpeau described the first case of
leukemia in 1827. Chronic myeloid leukemia (CML), a clonal myeloproliferative disorder of a
pluripotent stem cell was first described by John Hughes Bennett in 1845 at the Royal Infirmary
of Edinburgh and Virchow in Berlin. In 1847, Virchow reported a second case and for the first
time used the name leukamie (leukemia) (the name leukemia is a combination of the Greek
words leukos and heima which means white blood) to describe this newly observed
disease. Newmann stated in 1872 that leukemia was a disease of the bone marrow. Reschad,
Schilling and Torgau in 1913 classified four types of leukemia: chronic lymphocytic leukemia,
chronic myelogenous leukemia, acute lymphocytic leukemia and erythroleukemia. A first
classification between acute and chronic forms of leukemia was introduced in 1857 by Nikolaus
Friedreich. Theodor Boveri was the first who proposed in 1914 the concept of chromosomal
instability as a cause of abnormal growth and cancer. CML was the first type of leukemia to be
described with a consistent chromosomal abnormality named Philadelphia chromosome.
2.2 PHILADELPHIA CHROMOSOME
Approximately 90% of patients with CML have an acquired genetic abnormality, the
Philadelphia chromosome (Ph), a shortened chromosome 22 resulting from a reciprocal
translocation between the long arms of chromosomes 9 and 22 t(9;22)(q34;q11). It was in 1960,
Peter Nowell and David Hungerford, working in Philadelphia, described a consistent
chromosomal abnormality in patients with CML, an acrocentric chromosome that was thought to
be a chromosomal deletion. Then, in 1973, Dr. Janet Rowley with the advent of chromosomal
banding techniques determined that the shortened chromosome 22, the so called Philadelphia
24

(Ph) chromosome, was the product of a reciprocal translocation between the long arms of
chromosomes 9 and 22, t(9:22)(q34;q11). In 1976, Kamada et al., reported chromosomal
abnormalities in addition to Ph chromosome in patients with CML. Lawler et al., (1976), Whang
et al., (1968) supported the observation by demonstrating other translocations in addition to
(9,22) such as extra number of 8, a second Ph, and loss of Y chromosome. A second Ph
chromosome results from the duplication of the original 22q chromosome. The presence of
additional abnormality seems to carry poorer prognosis. In 1977 Mayall et al., showed that the
amount of DNA added to the chromosome 9 is equal to that missing from Ph, thus no detectable
DNA is lost in chromosomal rearrangement. Saglio et al., in 1988 found out that molecular
heterogeneity of the Ph chromosome complicates the relationship existing between the clinical
phenotype, the type of BCR/ABL rearrangement present on chromosome 22 and possibly the
abnormal type of CABL protein expressed.
2.3 ABL BCR AND BCR ABL FUSION GENE
The crucial genetic event in CML is the generation of a t(9;22)(q34;q11) reciprocal
chromosomal translocation in a hematopoietic stem cell. Following the cloning of the t(9;22)
(q34;q11) breakpoints, Heisterkamp et al., (1983) had shown that the molecular consequence
was fusion of ABL gene (9q34) and BCR (22q11), forming a chimeric BCR/ABL gene. Gale and
Cannani (1984) found out that product of BCRABL was an oncoprotein, provided with
constitutive phosphorylating activity. They identified an abnormally large ABL related mRNA in
Ph positive cells and in CML cells, but not in normal cells and in Ph negative leukemias. Konopa
et al., (1984) characterized a large (210 kD) ABL related phosphoprotein, the p210, reinforced
the concept that CML as related to fusion gene. Kuzrock et al., (1988) described that the ABL
gene encoding a non-receptor tyrosine kinase, which spans 230 kbp regions at band q34 of
chromosome 9 and consist of 11 exons with 2 alternate exons 1a and 1b. Lugo et al., (1990)
observed that the product of BCR - ABL fusion was an abnormal kinase that stimulates the
proliferation of myeloid cells to produce CML. Melo et al., (1993) showed that the translocation
creates two new genes, BCR ABL on the 22q- or Ph chromosome, and the reciprocal
ABLBCR on the derivative 9q+. The latter gene, although transcriptionally active, does not
appear to have any functional role in the disease. Pear et al., (1998) described that expression of
25

BCRABL fusion oncoprotein leads to CML like disease in mice receiving bone marrow cells
transduced by BCRABL encoding retroviruses. All mice that received transduced bone marrow
cells developed myeloproliferative disease between 3 and 5 weeks after transplantation.
Melo et al., (2003) observed that BCRABL oncoprotein is the best molecular target presented
by CML cells because it is not expressed by normal cells. The dissection of the signal
transduction pathways affected by the deregulated kinase activity of BCRABL provided
information on additional or alternative signaling steps that could be interrupted in an attempt to
eliminate the oncogenic effect of BCRABL. Xiaomin Zheng et al., (2009) discovered the
reciprocal ABLBCR fusion protein as second oncogene encode by the t(9;22) in addition to
BCRABL and suggested that ABLBCR contribute to the determination of the leukemic
phenotype through their influence on the lineage commitment.
2.4

CONVENTIONAL

CYTOGENETICS

AND

FLUORESCENCE

INSITU

HYBRIDIZATION (FISH)
Human chromosomes were first observed by Flemming and Arnold in the 1880s. And in 1888
the term chromosome (Greek for stained body) was coined by Waldeyer. Human
cytogenetic analysis commenced in 1956 following the discovery by Tijo and Leven that the true
chromosome number in man was 46. In 1966, cytogeneticists classified the 23 pairs of
chromosomes into seven groups (A to G) based on the differences in the relative size of human
chromosomes and the position of the centromeric constrictions. Chromosome banding
techniques were first used in the cytogenetic study of leukemia for identification of the Ph
chromosome. Caspersson et al., (1970) ORiordan et al., (1971) reported independently that the
Ph chromosome was a no. 22q- with the development of staining protocols that produced highly
reproducible patterns of dark and light bands along the length of each chromosome. The
band naming convention was introduced in 1971 and the different kinds of bands were Q
(Quinacrine), C(Centromere), G(Giemsa band with trpsin) and R(Reverse) bands. G banding
with trypsin (GTG) introduced by Seabright is the most common technique used in the
karyotypic analysis of leukemic blood samples. Rowley et al., (1978) examined the karyotypes
of 569 Ph+ patients with CML with banding techniques and the 9;22 translocation has been
identified in 529 cases (94%).
26

The molecular cytogenetic technique fluorescence in situ hybridization (FISH) allowed

chromosomal and nuclear locations of specific DNA sequences to be seen through the
microscope. The concept of applying molecular hybridization directly to cytological material
was initially pioneered by Gall and Pardue in 1969 by using radioactive probes. The first
application of fluorescent in situ detection was reported by Baumann et al., in 1980, when RNA
that was directly labeled on the 3 end with fluorophore used as a probe for specific DNA
sequences. Pinkel et al., (1986) developed a method to visualize chromosomes using
fluorescent - labeled probes called FISH. Quantitative analysis of fluorescence images was first
used as the basis for rudimentary cytogenetic tests. FISH utilizes fluorescent DNA probes to
detect the location of BCR and ABL genes directly in the genome in either metaphase and/or
interphase cells.
FISH is a highly sensitive molecular genetic technique, which enables to detect breakpoint
cluster region-Abelson (BCR-ABL) complex, and minimal residual disease in all Ph positive
CML. Patients not only in metaphase but also in interphase cells. Jha C B et al., (2006)
conducted a study to detect the Ph chromosome in CML patients by the use of conventional
cytogenetics and FISH. They conducted that conventional cytogenetic is a useful method for
detection of Ph chromosome in metaphase stage of cell division and FISH can be used in
interphase stage of cell division for the same purpose.
Fluorescence In Situ Hybridization on peripheral blood specimens is a reliable method to
evaluate Cytogenetic response in Chronic Myeloid Leukemia. Steven Le Gouill et al., (2000)
studied the usefulness of fluorescence in situ hybridization (FISH) on peripheral-blood
specimens to evaluate the cytogenetic response to treatment in patients with chronic myeloid
leukemia (CML). They analyzed 60 paired sets of bone marrow and peripheral-blood specimens
with interphase FISH. Their study suggested that follow-up of cytogenetic response to therapy
can be evaluated on peripheral-blood specimens, thus enabling an easier and more frequent
evaluation of patients.
Qiu HR, et al., (2009) evaluated the clinical significance of the application of fish in detecting
chronic myeloid leukemia. Fish technique using dual colour dual fusion (DC-DF) BCR/ABL
27

probe was performed in 158 cases and R-banding was also employed for karyotyping in some
patients. The result showed that FISH technique is of great value for the diagnosis of CML and
conformation of variant translocation, occult Ph translocation, and derivative chromosome 9
deletions, therapeutic effect of interferon and Gleevec as well as detection of minimal residual
disease after bone marrow transplantation.
Frank Dicker et al., (2006) used a simple method for in vitro stimulation of CLL cells. In their
study of CLL patients, they successfully stimulated for metaphase generation by culture with the
immune stimulatory CpG-oligonucleotide DSP30 plus interleukin 2. Conventional cytogenetics
frequently detected balanced and unbalanced translocations. A significant correlation of the
poor-prognosis unmutated IgVH status with unbalanced translocations and of the likewise
poor-prognosis CD38 expression to balanced translocations and complex aberrant karyotype was
found. They demonstrated that FISH analysis underestimates the complexity of chromosomal
aberrations in CLL.
A special Fluorescent In Situ Hybridization technique to study peripheral blood and assess the
effectiveness of Interferon Therapy in Chronic Myeloid Leukemia was done by Ismael Buno
et al., (1998). Using a highly sensitive fluorescence in situ hybridization method with probes for
BCR and ABL1 (D-FISH), from patients before and during treatment for chronic myeloid
leukemia (CML). The result indicated that D-FISH is useful to test blood from patients with
CML to monitor therapy. Consequently, D-FISH analyses of interphase nuclei from blood could
substitute for Q-cytogenetic studies on bone marrow.
D-FISH uses DNA probes with fluorescence in situ hybridization to detect two fusion signals in
cells with a t(9;22)(q34;q11.2) from patients with chronic myeloid leukemia. Dewald W et al.,
(1999) studied a typical BCR and ABL D-FISH pattern in chronic myeloid leukemia and their
possible role in therapy. Using D-FISH 147 patients with CML were studied and considerable
macrogenetic variations cause observed among their Ph chromosome. They concluded the
proportion of patients that responded to therapy with interferon alpha-2b or interferon alpha-2b
and ara-C for 36 patients with typical patients was similar to 7 patients with atypical patterns.

28

Schoch C et al., (2002) compared chromosome banding analysis, interphase and

hypermetaphaseFISH, qualitative and quantitative PCR for diagnosis and for follow up in
chronic myeloid leukemia. They analyzed 350 CML patients at different stages of disease in
parallel

with

chromosome

banding

analysis

(CA),

interphaseFISH

(IPFISH),

hypermetaphase FISH (HM FISH) and RT PCR. A comparison of IP FISH performed on

uncultivated cells versus cells cultivated for 48 hours revealed a higher proportion of
BCR ABL + cells in the cultivated sample. They concluded CA, IP FISH, HM FISH and
RT PCR give reliable result but difference due to measurement of different target structures.
Nathalie Douet Guilbert et al., (2004) conducted several attempts to determine whether
interphase fluorescence in situ hybridization (I-FISH) on bone marrow or peripheral blood
specimens is a good alternative to conventional cytogenetics (CC). Nineteen patients were
selected for I-FISH follow-up compared to CC. I-FISH was performed using the LSI bcr/abl
dual ES color probe. They concluded that dual color I-FISH is a reliable method to monitor the
size of the Ph chromosome positive clone in bone marrow of treated CML patients.
U Reinhold et al., (2003) compared I-FISH and cytogenetics in patients on imatinib and patients
on other therapy mainly IFN (non-imatinib therapies). They demonstrated that correlation
between I-FISH and cytogenetics is much weaker on imatinib than in patients on non-imatinib
therapies. By contrast I-FISH of peripheral blood (PB) neutrophils was much better correlated
with bone marrow cytogenetics. They concluded that I-FISH on unselected PB white cells is not
suitable for monitoring patients on imatinib.
Brain J Druker et al., (2006) investigated the effect of imatinib on CML patients. The cause of
CML is a constitutively active BCR-ABL tyrosine kinase. Imatinib inhibits this kinase and in a
short term study was superior to interferon alfa plus cytarabine for newly diagnosed CML in the
chronic phase. After five years of follow-up, continuous treatment of chronic phase CML with
imatinib as initial therapy was found to induce durable response in a high proportion of patients.
Francis Giles et al., (2006) studied that resistance to imatinib mesylate can occur in chronic
myelogenous leukemia (CML). Preclinical in vitro studies have shown that nilotinib (AMN107),
a new BCR-ABL tyrosine kinase inhibitor, is more potent than imatinib against CML cells by a
29

factor of 20 to 50. Of 33 patients with the blastic phase of disease, 13 had a hematologic
response and 9 had a cytogenetic response; of 46 patients with the accelerated phase, 33 had a
hematologic response and 22 had a cytogenetic response; 11 of 12 patients with the chronic
phase had a complete hematologic remission. Nilotinib has a relatively favorable safety profile
and is active in imatinib-resistant CML.
Divergent clinical outcome in two CML patients who discontinued imatinib therapy after
achieving a molecular remission was done by Michael J Mauro et al.,(2003). This report
describes divergent clinical outcomes in two patients with chronic phase CML who discontinued
imatinib therapy after obtaining a molecular remission; one patient who maintained a complete
molecular response throughout a period of interruption, and a second patient with overt relapse,
highlighting the uncertainty of discontinuing imatinib therapy.
Lee Anne McLean et al., (2004) had done pharmacogenomic analysis of Cytogenetic response in
Chronic Myeloid Leukemia patients treated with Imatinib. Cytogenetic response was determined
based on the percentage of Ph +cells from bone marrow following a median of 13 months of
treatment. They concluded that many of the genes identified appear to be strongly related to
reported mechanisms of BCR-ABL transformation and warrant additional research as potential
drug targets.
Alfonso Quints-Cardama, et al., (2009) reviewed the known mechanisms of primary and
secondary resistance to imatinib and other TKIs used in the management of CML. The vast
majority of patients with chronic myeloid leukemia (CML) respond to the tyrosine kinase
inhibitor (TKI) imatinib mesylate, resistance might occur de novo or during treatment. They
concluded that mutations within the kinase domain of BCR-ABLI account for 30% to 40% of
cases of imatinib resistance.
The study Dasatinib versus Imatinib in newly diagnosed chronic phase chronic myeloid
leukemia by Hagop Kantarjian, et al., in 2010.they assessed the efficiency and safety of
dasatinib, as compared with imatinib. They concluded that complete cytogenetic and molecular
response within 12 months has been associated with better long term, progression-free survival,
30

dasatinib may improve the long-term out comes among patients with newly diagnosed chronic
phase CML.
Neil P Shah et al., (2010) assessed durability of response to a tolerability of dasatinib data from a
two year minimum follow-up. In this study chronic phase CML patients with resistance,
Intolerance or sub optimal response to imatinib were randomized to dasatinib 100mg once- daily,
50 mg twice -daily, 140mg once- daily or 70mg twice- daily. They reported that 100mg once
daily achieves major cytogenetic response and complete cytogenetic response rates comparable
to those in the other treatment arms, and reduces the frequency of key side effects.
In a study conducted by G. Fugazz, et al., (2004), Cytogenetic and Fluorescence In Situ
Hybridization monitoring in Ph+ Chronic Myeloid Leukemia patients treated with Imatinib
Mesylate. They analyzed 40 Ph+ CML patients in the chronic phase who had previously been
treated with interferon alpha (IFN ) and who were receiving imatinib. They suggested that
cytogenetic evaluation of patients on imatinib therapy should be performed by utilizing the
classic banding technique (metaphase examination), but also by using the FISH technique
(interphase examination), since the two methodologies may provide different results.
Tim P.Hughes et al., (2003) studied the major molecular response to imatinib or interferon alpha
plus cytarabine in newly diagnosed CML. They measured levels of BCR-ABL transcripts in the
blood of all patients in this trial who had a complete cytogenetic remission. Levels of BCR-ABL
transcripts were measured by a quantitative real-time polymerase-chain-reaction assay. They
found that the proportion of patients with CML who had a reduction in BCR-ABL transcript
levels of at least 3 logs by 12 months of therapy was far greater with imatinib treatment than with
treatment with interferon plus cytarabine
An investigative study on 92 patients alive after 6 year follow-up on chronic myeloid leukemia
in blast crisis treated with imatinib 600mg was done by Francesca Palandri et al., (2008). After a
median observation time of 66 months 8% patients are alive. Three of these patients are on
imatinib treatment. Three patients are in complete remission after allogenic stem cell
transplantation and one patient is alive in blast crisis, on therapy with a second-generation
tyrosine kinase inhibitor. They concluded that imatinib was effective and safe in short-term
31

treatment of chronic myeloid leukemia in blast crisis but longer term outcome was not
significantly influenced.
Farnaz Razmkhah, et al., studies hematologic and molecular response to imatinib in chronic
phase CML patients. Physical examination, CBC test, and peripheral blood smear were
performed in order to assess the hematologic response in patients. Molecular response was
evaluated through quantitative assessment of BCR-ABL fusion gene expression by Real time
reverse transcriptase polymerase chain reaction (RT-PCR). The study result indicated that
molecular response and hematologic response to imatinib were acceptably good.

2.5 MULTIDRUG RESISTANCE GENE

Multidrug resistance (MDR) is the phenomenon of the development by a malignancy of
resistance to a variety of agents that have little similarity in structure or mechanism of action.
The presence or absence of increased expression of the MDR1 gene, the MDR1 protein (MDR1),
a 170-kilodalton transmembrane transport glycoprotein, correlates with the presence of MDR. In
addition to being expressed in cytotoxic-resistant malignant cells, MDR1 is expressed in some
normal tissues, including the adrenal cortex, proximal renal tubules, and hepatic bile canaliculi.
In drug-resistant malignant cells, MDR1 lowers the intracellular concentration of cytotoxic
agents by binding and actively pumping drugs out of the cell before they reach critical cytotoxic
concentrations.
Multidrug resistance gene (MDR1) polymorphisms are associated with major molecular
responses to standard-dose imatinib in chronic myeloid leukemia was done by Stphanie Dulucq
et al.,(2004). In their study, they focused on the ABCB1 (MDR1) genotype. They analyzed the 3
most relevant single nucleotide polymorphisms of MDR1 in 90 CML patients treated with
imatinib. Among the patients homozygous for allele 1236T, 85% achieved a major molecular
response versus 47.7% for the other genotypes . They demonstrated the usefulness of these single
nucleotide polymorphisms in the identification of CML who may or may not respond optimally
to imatinib.

32

Imatinib is an intracellular acting drug that demonstrates high activity against BCR-ABL positive
chronic myelogenous leukemia (CML) or acute lymphoblastic leukemia (ALL). However, many
patients, especially with advanced disease, develop drug resistance. T Illmer et al., (2004)
showed a novel high-performance liquid chromatography-based method that intracellular levels
of imatinib decrease in P-glycoprotein positive leukemic cells. They found that MDR1 over
expression must therefore be considered as an important clinical mechanism in the diversity of
resistance development to imatinib treatment.
Mutations in the kinase domain (KD) of BCR-ABL are the most prevalent mechanism of acquired
imatinib resistance in patients with chronic myeloid leukemia (CML). Thomas O'Hare et al., in
2008 examined predisposing factors underlying acquisition of KD mutations. They also provide
a perspective on how the second-line Abl inhibitors dasatinib and nilotinib are faring in the
treatment of imatinib-resistant CML, especially in relation to specific KD mutations. They
assessed the potential of Abl kinase inhibitor combinations to induce stable responses even in
advanced CML and interpret the emerging data in the context of CML pathogenesis.
Chung-Pu Wu et al., (1990) studied the function and significance of ATP-binding cassette
transporters in the development of multidrug resistance in cancer cells. They studied blood and
bone marrow cells from 42 patients with Ph-chromosome positive chronic myeloid leukemia
(CML) and 20 normal subjects for amplification of the multidrug resistance gene (MDR-1) by
southern blotting and for over expression of P-glycoprotein (P-170) by immunocytochemistry on
intact cells with the monoclonal antibody C219. They concluded that resistance to busulfan and
hydroxyurea in chronic phase and resistance of blast cells to other cytotoxic drugs in
transformation are not mediated primarily through the MDR-1/P-170 pathway.
Marjan Yaghmaie et al., (2008) analyzed Peripheral blood samples by multiplex RT-PCR from
75 adult Iranian chronic myeloid leukemia patients to detect different types of BCR-ABL
transcripts of the t(9;22). All patients examined were positive for some type of BCR/ABL
rearrangement. The majority of the patients (83%) expressed one of the p210 BCR-ABL
transcripts (b3a2, 62% and b2a2, 20%), while the remaining showed one of the transcripts of
b3a3, b2a3, e1a2 or co-expression of b3a2 and b2a2. They did not see any co-expression of
33

p210/p190. They concluded that co-expression may be due to alternative splicing or to

phenotypic variation, with clinical course different from classic chronic myeloid leukemia.
Branford S et al., (1999) developed a rapid real time quantitative PCR method for measuring
BCRABL mRNA levels in peripheral blood in chronic myeloid leukemia (CML). The
technique was used to monitor minimal residual disease for the early detection of relapse and as
an assessment of treatment response. The molecular data was correlated with philadelphia
chromosome levels in bone marrow and a good correlation was found when treatment induces a
cytogenetic response. They concluded that real time quantitative PCR monitoring of peripheral
blood can be used to reliably monitor disease response in CML.
The monitoring of BCR-ABL transcript levels by real-time quantitative polymerase chain
reaction (RT-qPCR) has become important to assess minimal residual disease (MRD). Mariana
Serpa et al., (2010) performed a prospective, sequential analysis using RT-qPCR monitoring of
BCR-ABL gene rearrangements in blood samples from 91 CML patients in chronic phase (CP)
who achieved complete cytogenetic remission (CCyR) and major molecular remission (MMR)
throughout imatinib treatment. They found that an increase level of BCR-ABL/BCR ratio
variations by RT-qPCR, the majority of CML patients with MMR remained in CCyR.
Eder M et al., (1999) monitored BCR-ABL expression using real-time RT-PCR in CML after
bone marrow or peripheral blood stem cell transplantation. They generated pairs of PCRprimers and TaqMan probes specific for either the b2a2- or the b3a2- variant of bcr-abl. In a
retrospective analysis 13 patients with CML were analyzed by both real-time and conventional
nested RT-PCR. They demonstrated that real-time RT-PCR is valuable to quantitate bcr-abl
expression in CML patients after transplantation.
Dario A. Sastre et al., (2007) describe the advantages of multiplex-PCR in the specific detection
of BCR-ABL transcripts in different hematological disorders and its sensitivity compared to
nested PCR. Fifty-three patients were studied for the presence of BCR-ABL transcripts: 24
patients with chronic myeloid leukemia (CML), 20 with acute leukemia (AL), and 9 patients
with other hematological disorders. They concluded that multiplex-PCR allows rapid, specific
34

and simultaneous detection of different types of BCR-ABL transcripts in CML and ABL-BCR
(+) AL. A full correlation was observed when multiplex-PCR was compared with nested PCR.

Francis J. Giles et al., (1999) investigated MDR1 levels and their association with patient and
tumor characteristics, responsiveness to therapy, and long term prognosis in 198 CML patients.
These included 127 patients in early chronic phase (ECP) CML, 31 patients in late chronic phase
(LCP) CML, and 40 patients in accelerated or blastic phase CML. MDR1 expression was
analyzed by Western blot analysis and quantitative solid-phase plate radioimmunoassay. MDR1
levels were measured on cell lysates obtained from the bone marrow mononuclear cell fraction.
The results of the study demonstrated that MDR1 overexpression was not associated with disease
progression, responsiveness to IFN-a therapy, or survival in patients with ECP CML.

Hagop M. Kantarjian et al., (2003) investigated whether increasing the dose of imatinib mesylate
might overcome drug resistance in patients with Philadelphia (Ph) chromosomepositive chronic
myelogenous leukemia (CML) whose disease manifests relapse or refractoriness to therapy.
Fifty-four patients with Ph CML in chronic phase and with hematologic or cytogenetic resistance
or relapse on imatinib mesylate therapy at 400 mg orally daily were treated with a higher dose of
400 mg orally twice daily. They concluded that higher doses of imatinib mesylate may overcome
disease-poor response to conventional doses.

Serial measurement of BCR-ABL transcripts in the peripheral blood after allogeneic stem cell
transplantation for chronic myeloid leukemia was done by Jaspal Kaeda et al., in 2015. They
identified 243 patients with Philadelphia (Ph) chromosomepositive chronic myeloid leukemia
(CML) who had BCR-ABL transcripts monitored by quantitative reverse transcriptase
polymerase chain reaction (RT-PCR). They concluded that the pattern of BCR-ABL transcript
levels after allograft is variable; only a minority of patients with fluctuating or persistent low
levels of BCR-ABL transcripts, whereas the majority of patients who did so were likely to
progress further.
Stephanie Dulucq et al., (2015) focused on the ABCB1 (MDR1) genotype. They analyzed the 3
most relevant single nucleotide polymorphisms of MDR1 in 90 CML patients treated with
35

imatinib. Patients with 1236TT genotype had higher imatinib concentrations. One of the
haplotypes (1236C-2677G-3435C) was statistically linked to less frequent major molecular
response. They demonstrated the usefulness of these single nucleotide polymorphisms in the
identification of CML who may or may not respond optimally to imatinib.

36

CHAPTER 3
AIM AND OBJECTIVE

To characterize the genetic alterations in all the three clinical phases of Chronic Myeloid
Leukemia (CML) patients by using conventional cytogenetics.

To confirm the presence of BCR/ABL fusion gene in CML patients using FISH.

To investigate the efficiency of cytogenetics and FISH in giving an accurate diagnosis for
Chronic Myeloid Leukemia.

To evaluate the mechanism responsible for drug resistance in advanced phase of CML
mediated through MDR1/P- gp drug efflux by Multiplex PCR analysis.

37

CHAPTER 4
SUBJECTS AND METHODS

The Regional Cancer Centre (RCC), Thiruvananthapuram, is a pioneer institution for the
treatment and research on cancer. Nearly 15,000 new cases are registered annually. The bone
marrow aspirations are processed and examined in the Department of Cytopathology. The
clinical laboratory in the Regional Cancer Centre is involved in routine clinical, hematological
and biochemical investigation. The Cytogenetics laboratory in the Division of Cancer Research
is involved in the Cancer Genetic Research as well as chromosome analysis for diagnostic
confirmation and prognostic prediction of various types of leukemia.
During the study period from 1st April 2015 to 20th June 2015, a total of 25 Chronic Myeloid
Leukemia (CML) patients were selected. These patients were cytopathologically confirmed with
CML, who attended the medical oncology out-patient clinic of the Regional Cancer Centre,
Trivandrum.
Cytogenetic studies were done in the bone marrow aspirate of the patients with CML. Bone
marrow specimen must be collected in to sterilized heparinized tubes. The first few millilitres of
the bone marrow tap contain the highest proportion of cells are the best sample for the
cytogenetic studies.

4.1. CYTOGENETIC ANALYSIS (VERMA AND BABU, 1989)

Chromosome analysis requires the provision of numerous cells in division since it is only the
prometaphase or commonly used metaphase stage, which allows detailed study under
microscope. Direct chromosome preparation, requires cells, which are rapidly dividing in vivo
e.g. bone marrow, spleen, lymph nodes, fetal tissue etc. In hematological malignancies the
commonly used tissue for chromosome preparation is bone marrow. For cytogenetic analysis the
cell division is blocked by metaphase arrest through the disruption of the spindle apparatus by
38

reaction of metaphase arresting agent colchicine or colcemid. Then the cells are treated with
hypotonic solution (0.075 M KCl) for swelling. After hypotonic treatment, the cells are fixed,
overnight in fixative consisting of methanol and glacial acetic acid in 3:1 ratio. On the next day
cells are washed repeatedly with the fixative and slides were prepared.
4.1.1. Chromosome Preparation from Bone Marrow
Bone marrow contains continuously proliferating cells and therefore can be used for direct
chromosome preparation. However chromosomes are more condensed and appear short and
stubby and are very sensitive to pretreatment. Various culture protocols and synchronization
procedures are used to obtain high mitotic index and longer chromosome with improved
morphology.
Reagents: Tissue culture medium RPMI 1640 (without NaHCO), Sodium bicarbonate,
Penicillin, Streptomycin, Fetal bovine serum, Fixative (Methanol: Acetic acid), Sorensons
buffer, KCl, Triple distilled water, Colchicine, Giemsa stain
Culture is to be set under sterile conditions and all the apparatus and materials should be sterile.
Culture can be set up in a laminar flow fitted with UV light. UV light should be switched on for
1 to 2 hrs before use and switched off while working. Tabletop should be swabbed with spirit
and mouth of all the glass wares flamed before use.
Procedure:
Bone Marrow Culture

1 - 2 ml of bone marrow was collected in a heparinized syringe or sterile heparinized screw

capped tube.

5 - 10 drops of bone marrow was added to 10 ml of unsupplemented prewarmed medium in

a 15 ml centrifuge tube and the cells were suspended.

The suspension was centrifuged for 8 min at 800 rpm and then resuspended in
unsupplemented medium. (Washing the cells improves the quality of chromosome
preparation by the cell surface glycoprotein or carbohydrate that may be present on the cell
membrane).
39

The cells were exposed for 1 - 2 hrs at 37oC with Colchicine, with the culture tube inclined
at an angle.

The culture was harvested at the end of this period.

Harvesting

The culture tubes were centrifuged at 800 rpm for 10 min (if there were any tough cell
aggregates that could not be dissociated, they were removed before centrifugation).

The supernatant was discarded by pipetting off the media, leaving as little media as possible
over the cell button.

The cell button was resuspended in 10 ml of hypotonic solution (0.075M KCl) an incubated
for 15 - 20 mins in a water bath at 37oC (Hypotonic solution should be pre-warmed at 37oC
before use).

6 - 8 drops of freshly made fixative was added to each tube and mixed gently by inverting
the tube once or twice. Centrifuged at 800 rpm for 10 minutes (cells should be handled very
gently following hypotonic treatment. Any harsh treatment may rupture the cells, leading to
many undesirable incomplete metaphases in final preparation. To prevent any such undue
damage to the cells, avoided passing the suspension through narrow tipped droppers or
pipettes at this stage).

The supernatant was discarded. The pellet was distributed thoroughly by tapping at the
bottom of the tube. The pellet was resuspended in freshly prepared fixative (avoided
pipetting). Kept the solution in refrigerator overnight.

The following day, again the tubes were centrifuged at 800 rpm for 10 minutes, the
supernatant was discarded and the cells were suspended in fresh fixative. This step was
repeated an additional 3 - 4 times in order to get a clear cell button.

After the final centrifugation, the cells were suspended in a small volume of fixative
approximately 0.5 ml to 1 ml (depending on the size of the cell button) to give a slightly
opaque suspension.

40

Slide Preparation

The cell suspension (3 - 4 drops) was dropped from a height of 1-3 feet evenly on a cold wet
slide and allowed to dry at room temperature. After this slide was stained with Giemsa stain
for 10 minutes, wash, dried and examined under magnification (10 X or 100 X) phase
objective to check the cell density and spread of metaphase chromosomes. If the cell density
was too low, the suspension was centrifuged and the pellet was resuspended in a smaller
volume of fixative.

The first slide or slides were examined before making a large number of final slides. If the
preparation were satisfactory, a large number of slides were prepared. Slide preparation was one
of the important and critical steps in obtaining quality chromosomes spreads. Assuming that the
cells were subjected to an appropriate length of hypotonic treatment before fixing, ambient
temperature and relative humidity play a significant role in chromosome spreading.
4.1.2. Chromosome Banding [G Bands by Trypsin Using Giemsa (GTG) (Seabright 1971,
ISCN, 2009)
The Giemsa bands (G bands) obtained by digesting the chromosome with the proteolytic enzyme
trypsin are the most widely used in the clinical laboratories for routine analysis.
Reagents: Trypsin solution, Sorensons buffer, Giemsa staining solution
Procedure:

Aged the air-dried preparation overnight at 55 oC to 60 oC in a hot air oven.

Treated the slides in trypsin solution (0.01%) for 5 to 10 seconds.

Rinsed the slide briefly in Sorensons buffer.

Stained the treated slides in Giemsa staining solution for 2 minutes.

Rinsed in distilled water and allowed to dry.

The slides were examined without mounting using dry objectives. If satisfactory, then they
are mounted using DPX and examined under oil immersion objectives.

41

Chromosome identification and Karyotyping

After staining with the Giemsa, each slides was observed under low power (10 X) high dry (40
X) and oil immersion (100 X) bright field optics. Chromosomes were recognized in preparation
of the metaphase by their size, shape and the pattern of light and dark bands observed after
staining by specific procedures. The chromosomes were counted in as many well spread and
intact metaphase figures as possible. At least 20 well spread metaphases were counted and the
images were acquired by the camera attached to the microscope and send to computer installed
with cytogenetic software. The metaphase were applied on Cytovision software (USA) and
karyotyped according to universally accepted International System for Human Cytogenetic
Nomenclature (ISCN, 2013). Karyotyping is the systematic arrangement of chromosome in
group of homologous pairs according to features that are important for characterizing
chromosomal compliments of a given cell. This includes the morphology as well as the distinct
banding patterns produced by certain staining reactions.
Nomenclature
The chromosome and their bands have been numbered by a universally accepted nomenclature
(ISCN, 2013).The short and long arm of each chromosome is referred as p and q respectively.
For karyotypes the unknown chromosomes are arranged in descending order of length and their
specific banding pattern. The chromosome X and Y are given traditional letter designation.
Human karyotype consists of 7 groups- A, B, C, D, E, F & G [Table 1].
Somatic Chromosomes
The recognition of human somatic chromosomes is based largely on morphological differences
and comparative differences. The characteristics such as secondary constrictions and the
presence or absence of satellites assist very little chromosome identification but such markers
may be of use in linkage studies.
The morphology of particular chromosome is governed by two factors; it is the total length and
position of centromere. The length of chromosomes is usually represented as relative length
i.e. the ratio of length of a cell to cell and subject to comparison. The correlation enables cell to
cell and subjected to subject comparison. The position of centromere can be represented by
42

either arm ratio (A), which is the length of long arm (q) divided by length of short arm (p) or
centromere index (C) that is ratio of the length of short arm to the chromosomal length (p/p+q).
Then indices are related algebraically. Gianelli and Howlett combined them into a single core,
which they termed the total chromosome length by arm ratio.
M = p + q q/p or p (p+q)/q
Centromere index when expressed as percentage may be written as:
C= (p/p+q) 100
Chromosome 1 and 3

Large Metacentric

Chromosome 2

Large Submetacentric

Group B

Chromosome 4-5

Large Submetacentric

Group C

Chromosome 6-12 and X

Medium sized

Group A

Submetacentric
Group D

Chromosome 13-15

Large Acrocentric

Group E

Chromosome 16-18

Relatively

short

metacentric

or

Submetacentric
Group F

Chromosome 19-20

Short Metacentric

Group G

Chromosome 21-22 and Y Small Acrocentric

Table 1: Grouping of Human chromosomes

Morphological characteristics of human somatic chromosomes

Group A (1-3): This group consists of three longest pairs of chromosomes. Pairs 1 and 3 are
metacentric with the centromere indices of 0.45-0.50. Pair 3 is shorter than pair 1. Pair 2 is
submetacentric but the same length pair 1 with the centromere index of 0.38-0.40. Each of these

43

chromosomes can be recognized in all cells. Prominently secondary constrictions can often be
seen in long arm adjacent to the centromere in chromosome number.
Group B (4&5): These are long submetacentric chromosomes. Pair 4 defined as longer of the
two pairs.
Group C (X, 6-12): A group of minimum sized chromosomes with median of submedian
centromeres. Pairs 6, 7, 8 and 11 are defined as submetacentric and X chromosome is included in
this subgroup and falls in the 6-8 group size range. Three pairs (No. 9, 10 and 12) have
submedian centromeres. One of the pairs has a secondary constriction in the proximal region of
the long arm and this is usually defined as No. 9. The X chromosome can be separated from the
autosomes in either sex by any pairing off process. Patau gave the relative length of X as 4.8% of
the haploid female set and the arm ratio as 1.5.
Group D (13-15): This is a group of three pairs of large sized, satellite, acrocentric
chromosomes, which are difficult to separate on morphological grounds alone. The satellites are
seen only when the preparation is optimal. But there is variation in the size of short arm and in
the frequency of the satellites between different cells and between different individuals.
Group E (16-18): These are medium to short chromosomes with median or submedian
centromere. Chromosome No.16 often has secondary constriction in the proximal part of the
long arm and is one of the few chromosome pairs which can be readily identified on
morphological grounds alone. Chromosome No.17 and No.18 can be separated by morphological
inspections, No.17 being longer and more metacentric than No.18.
Group F (19-20): These are short metacentric chromosomes.
Group G (21, 22, Y): These are very short acrocentric chromosome with satellite short arm. The
Y chromosome is larger than either chromosome No. 21 or 22. Its centric constriction is often
terminal, indistinct and a secondary constriction is often terminal, indistinct and a secondary
constriction is frequently seen in long arms. The terminal region of long arm may be poorly
defined. Typically the long arms chromatid of Y appears to diverge from each other less than
those of the other chromosome in the G group. In most cells Y can be separated from autosome
44

of 21-22 groups by morphological mean along. The Y may vary in size between different
individuals.
4.2. MOLECULAR ANALYSIS BY FLUORESCENCE IN SITU HYBRIDIZATION
(FISH) ANALYSIS
Most recently, cytogenetic methodology has merged with the DNA technology through
fluorescence in situ hybridization (FISH) that allows the visualization of specific nucleic acid
sequences in morphologically preserved chromosomes, cells or tissue sections. It is based on
precise annealing of a single strand DNA probe labelled with fluorescence in to complementary
target sequences. The site of hybridization of the probe with the cellular DNA is visible as
fluorescent signals when observed under fluorescence microscope.
The probe (DNA or RNA sequence) of interest and the locus (i.e. the target sequence to which
the probe hybridizes) are the major components of the FISH procedure. A fluorescent tag is
attached to the probe in order to visualize the hybridization of the probe to the target.
Outline of FISH Procedure

Selection of the appropriate probe is a very important step that depends on the intended
use and available technology in the laboratory. Locus specific probes or single copy gene
probes are used to detect translocations. These probes are commercially available, ready to
use from several companies.

Selection of targeted sequences to which the probe hybridizes on the metaphase

chromosome or the interphase nuclei. Appropriate positive and negative control slides of
high quality should be used with each FISH experiment.

Probe and the target sequences are combined and allowed to hybridize.

If the probe is directly labelled with a fluorochrome, a counter stain (with antifade solution)
such as DAPI (4, 6-diamideno-2-phenylindole) or PI (Propidium iodide) is applied and the
preparations are ready for microscopy.

Fluorescence microscope equipped with appropriate excitation and emission filters is used
for visualization of the signal (i.e. the site of hybridization of probe with target).
45

For documentation (i.e. record keeping and /or photography) imaging is performed. The
images are captured from the microscope using a video or a CCD camera and analysed using
appropriate FISH software (Cytovision software, USA).

Preparing the Specimen target

Prepare slides from fixed cell suspension used for cytogenetic analysis as described before.

Mark the hybridization area (i.e. area where there is high density of metaphase spreads or
interphase nuclei as seen under the phase contrast microscope), with a diamond tipped scribe
on the specimen slide.

Hybridization of Probe with Target and Post Hybridization Washes

The following figure [Fig 5] show an outline of FISH working principle.

Fig 5: An outline of FISH procedure

DNA FISH probes

The LSI (Locus Specific Identifier) probe consists of DNA probe sequences homologous to
specific DNA regions, gene sequences or loci and is directly labeled with one of the Vysis
fluorophores. Unlabelled blocking DNA is included with probe to suppress sequences contained
within the loci that are common to the other chromosomes. When hybridized and visualized,
46

these probes show specific changes, such as amplification, deletions, visualized, these probes
show specific changes, such as amplification, deletions or translocations, to specific genes loci
chromosomal regions.
Reagents:

Vysis LSI BCR/ABL Dual color, Dual Fusion Translocation Probe Set.

Vysis LSI AML/ETO Dual color, Dual Fusion Translocation Probe Set.

Vysis LSI PML/RARA Dual color, Dual Fusion Translocation Probe Set.

Vysis LSI CBFB Dual colour, Break apart Rearrangement probe set.

Vysis LSI Hybridization Buffer

NP-40

DAPI II

20X Saline Sodium Citrate (SSC)

2X SSC

Triple Distilled Water

Pepsin solution

Neutral buffered formalin

1X Phosphate Buffer Saline (PBS)

Ethanol washes solution (70%, 85%, and 100%)

0.4X SSC wash solution (pH 7 ) with 0.3% Tween 20

2X SSC with 0.1% Tween 20

Procedure: Day 1
Pre-Treatment

Pre-treated freshly prepared sample slides were first dipped in 2X SSC, pH 7.0 0.2 at
73C 1C for 2 minutes.

Washed the slides in TDW.

Dipped the slides in protease (pepsin) solution for 14 mins.

Washed in PBS to remove pepsin.

47

Treated the slides in neutral buffered formalin for 5 mins for nucleus fixation.

Again washed in PBS for 5 mins.

Dehydrated in 70%, 85%, 100% ethanol for 2 minutes each.

Air dried at room temperature.

Probe preparation
2l probe, 1l triple distilled water and 7l hybridization buffer were mixed well by pipetting.
Co-denaturation
1-2 l of probe mixture was placed over the marked region on the slide. Covered with glass
cover slip and sealed using rubber glue. The samples and probes were denatured on a hot plate at
75C for 10 minutes.
Hybridization
The slides were incubated overnight at 37C in a humidified chamber.
Day 2
Post- Hybridization wash

Rubber glue removed and slide off coverslip by dipping in 2X SSC.

Dipped the slide in 0.4X SSC with 0.3% Tween 20 (pH 7) for 2 minutes at 72C (1C)
without agitation.

Washed the slides twice in 2X SSC with 0.1% Tween 20 for 2 minutes each at room
temperature without agitation.

Air dried at room temperature.

Counter Staining

10l DAPI was applied on the slide and covered with glass cover slip and sealed using
rubber glue.

Kept in dark for 30mins.

Proceed with fluorescent microscopy.

48

4.3. ANALYSIS OF MULTIDRUG RESISTANCE GENE (MDR1)

4.3.1. Mononuclear Cell (MNC) Isolation
Several techniques for the enrichment of mononuclear cells (MNC) from original BM have been
developed. Density gradient separation using Ficoll-Histopaque allows rapid and efficient
isolation of mononuclear cells from human peripheral blood and also bone marrow. Blood/ bone
marrow samples were collected in sterile EDTA bottles. Samples were centrifuged on FicollHistopaque gradient, a high density solution, to separate the mononuclear cells from erythrocytes
and granulocytes. In the gradient the red cell pellets settle, while the plasma and platelets remain
on the top and the mononuclear cells form discrete ring at the interphase.

Reagents: Ficoll-Histopaque, PBS

Procedure:

Diluted the peripheral blood or bone marrow with PBS in the ratio of 1:1.

Layered it on to 3 ml of histopaque.

Spinned the tube at 1500 rpm for 20 min.

Separated the mononuclear cells formed as a ring.

Washed the cell pellet twice with PBS.

Made pellets of 1*10^7 mononuclear cells for each extracts of RNA.

4.3.2. RNA Isolation

RNA Extraction by Trizol Method
The isolation of RNA with high quality is a crucial step required to perform various molecular
biology experiments. Trizol reagent (TRIzol) is ready to use reagent for the isolation of total
RNA from cells. This method is also known as Guanidinium thiocyanate-phenol-chloroform
extraction. The reagent is a monophasic solution of phenol and guanidine isothiocynate, which is
an improvement to the single step RNA isolation method developed by Chomczynski and Sacchi
(1987). During sample homogenization or lysis, trizol reagents maintain the integrity of RNA,
while disrupting cells and dissolving cell components. Addition of chloroform followed by
49

centrifugation separates the solution into an aqueous phase and an organic phase. RNA remains
exclusively in the aqueous phase. It is then recovered by precipitation with isopropyl alcohol.
Precaution for handling RNA
RNase, which is distributed widely in nature, poses a major problem in the extraction of RNA.
The enzyme is also present in all body tissues and body fluids. Use of disposable gloves is
mandatory for RNA extraction. Plastic wares and distilled water were treated with diethyl
pyrocarbonate (DEPC). DEPC is a powerful denaturant of proteins. It inhibits RNase thereby
preventing degradation of RNA during extraction. The DEPC was removed from plastic wares
and distilled water by autoclaving before use. Solutions like phosphate buffer saline (PBS) and
75% ethyl alcohol must also be prepared using DEPC water.
Reagents: Trizol reagent (TRIzol), chloroform, isopropyl alcohol, DEPC water.
Procedure:

Added 1 ml of Trizol to 1*10^7 MNC and homogenized the cells by repetitive pipetting (If
the cells were stored at -80C, they were brought to room temperature for 5 min, before
adding Trizol).

Added 200 l of chloroform for 1 ml of trizol and shook vigorously for 15 min.

Incubated at room temperature for 5-10 min.

Centrifuged at 12000 rpm for 15 min at 4C.

Transferred the aqueous phase to a fresh tube. Added 50 l of isopropyl alcohol and kept at
room temperature for 15 min.

Centrifuge at 12000 rpm for 15 min. Remove the supernatant and wash the pellet with 500 l
of 75% ethyl alcohol.

Centrifuged at 12000 rpm for 15 min at 4C.

Decanted and air dried the pellet for 5-10 min.

Dissolved in 20 l of DEPC treated water.

Checked the quality and quantity of RNA extracted.

50

RNA isolation kit (innuPREP Blood RNA Kit, analytikjena, Germany and Total RNA isolation
kit Nucleospin RNA, Macherey and Nagel, Germany) have also been used (based on
manufacturers instructions) for RNA extraction of samples for mutation analysis, sequencing,
with low or inadequate MNCs and for MNCs on long term storage, by maximizing the RNA
recovery by minimizing the loss in the processing steps.
Qualitative Estimation of RNA by agarose gel electrophoresis
The traditional method for assessing the quality of RNA is by agarose gel electrophoresis.
Agarose is a highly purified polysaccharide derived from agar. Agarose gel allows separating
nucleic acid molecules over a much greater size range. The horizontally positioned agarose gels
are completely submerged in electrolyte buffer. This facilitates reasonable dissipation of heat
when the gel is run at room temperature and sufficiently low voltage.
Reagents: Agarose (DNA grade), 10X Tris Borate EDTA (TBE)
Procedure:

1% agarose gel was prepared by adding 0.25 gm agarose in 25 ml TBE buffer. The agarose
was completely dissolved by boiling.

The solution was cooled down and the gel was stained with ethidium bromide.

The comb was placed and agarose solution was poured into electrophoresis apparatus.

Allowed the gel to set for 30 min and then the comb was removed.

Then the gel was immersed in 1X TBE buffer in electrophoresis tank in the apparatus.

For loading sample 1 l of RNA was mixed with 2 l distilled water and 3 l of loading dye
bromophenol blue.

The samples were loaded into the wells in the agarose gel and were run at 100V for 30min.

Obtained bands were visualized under UV transilluminator (BioRad).

4.3.3. c-DNA Synthesis by Reverse Transcriptase Polymerase Chain Reaction (RT PCR)
Complementary DNA is a DNA copy synthesized from mRNA. The enzyme used was reverse
transcriptase, an RNA dependent DNA polymerase. cDNA was synthesized using the High
51

Capacity c- DNA reverse transcription kit (Applied Biosystems). The components were used for
the experiment as per the manufacturers instructions.
Procedure:

Prepared 10 l of 2X RT master mix for each individual tube [Table 2].

Components

Volume (l)

10 X RT Buffer

2.0

25 X dNTP mix (100mM)

0.8

10 X RT Random Primers

2.0

Multiscribe Reverse Transcriptase 1.0

RNase Inhibitor

1.0

Nuclease Free water

3.2

Total volume per reaction

10

Table 2: RT PCR Master Mix composition (Applied Biosystems)

Pipetted 10 l RNA sample into each tube.

Sealed the tubes and briefly centrifuged the tubes to spin down the contents and to
eliminate any air bubble. Placed the tubes on ice until ready to be loaded to thermal cycler.

The cycler conditions were as follows [Table 3]:

Process

Temperature Treatment time

Denaturation

25C

10 min

Annealing

37C

120 min

Extension

85C

5 min

Table 3: RT PCR thermal cycling profile

The cDNA thus synthesized was run on 1.5% agarose gel and the bands obtained were
visualized under UV- transilluminator in a gel documentation system (BioRad).
52

Then cDNA was stored at 4C for immediate use and later transferred to - 20C for long
term storage.

4.3.4. Multiplex PCR to Analyze Multidrug Resistance Gene (MDR1)

Multiplex PCR consists of multiple primer sets within a single PCR mixture to produce
amplicons of varying sizes that are specific to different DNA sequences. By targeting multiple
genes at once, additional information may be gained from a single test run that otherwise would
require several times the reagents and more time to perform. Annealing temperatures for each of
the primer sets must be optimized to work correctly within a single reaction and amplicon size,
ie, their base pair length should be different enough to form distinct bands when visualized by
gel electrophoresis. Commercial multiplex kit for PCR is available and used by many forensic
laboratories to amplify degraded DNA samples.
PCR assay for MDR1 gene expression PCR was carried out by simultaneous amplification of the
MDR1 and 2- microglobulin (B2-M) RNA, as an internal control. Briefly 5 l of cDNA were
amplified in 45l medium, containing 10X PCR buffer with1.5mM MgCl2; 1mM each of
dNTPs; 3U Taq polymerase (Promega) and 10pM each of primers MDR1-TL9/ MDR1-TL10
(for MDR1); together with B2-M1/B2-M2 primers (for B2-M) (Sigma).
Primer Sequence for Multidrug resistance analysis
Primers for MDR1 (Multidrug Resistance 1)
MDR1-TL9 : 5 TTCAAACTTGTCACAATGCAGACAGCAGGA 3
MDR1-TL10: 5GGTTGCAGGCCTCCATTTATAATGGCACAA 3
Primers for 2- microglobulin (B2-M) control gene
B2-M1: 5 ACCCCCACTGAAAAAGATGA 3
B2-M2: 5 ATCTTCAAACCTCCATGATG 3

53

Procedure:

Multiplex PCR Master Mix was prepared for the required number of reactions. To prepare
reaction components for a single reaction, the following components were added [Table 4].
Components
10 X PCR buffer ( with 1.5 mM

Volume( l)
6

MgCl2 )
1mM Dntp

10

Primer [MDR1-TL9] (10 pM)

Primer [MDR1-TL10](10 pM)

Primer [B2-M1](10 pM)

Primer [B2-M2](10 pM)

Taq polymerase (3U/ml)

0.4

TDW

20.6

Table 4: Multiplex PCR Master Mix components.

To each individual tube, 45 l Master mix and 5 l cDNA was added and mixed well with
pipette.

Sealed the tubes and briefly centrifuged the tubes to spin down the contents and to eliminate
any air bubble. Placed the tubes on ice until ready to be loaded to thermal cycler.

Tubes were loaded into the PCR machine after setting program and conditions were
given[Table 5].

The obtained PCR product was run on a 2% agarose gel.

5l PCR product and 3l bromophenol blue was mixed and loaded in the wells.

100bp marker DNA was also loaded in the well.

The bands obtained were visualized under UV- transilluminator in a gel documentation
system (BioRad).

54

Temperature

Time

Process

No: of cycles

94C

5 min

Initial denaturation

94C

30 sec

Denaturation

57 C

30 sec

Annealing

72C

30 sec

Extension

72C

10 min

Final extension

4C

Cooling

Table 5: Multiplex PCR thermal cycling profile.

55

25

CHAPTER 5
RESULTS
A total of 25 clinico pathologically confirmed CML cases, registered at the medical oncology
clinic of the Regional Cancer Centre between 1st April and 20th June were included in the study.
The patients belong to the age range of 15-75 years. Male to female ratio was 1.77:1. The
patients included those who are newly diagnosed with CML and those who are under targeted
drug therapy with imatinib mesylate (IM) for more than 1 year.
5.1. CYTOGENETIC ANALYSIS
Conventional cytogenetic analysis was carried out by analyzing metaphase chromosomes in all
the 25 CML cases. Harvesting and GTG banding were performed as per the standard procedure.
Karyotypes were described according to ISCN 2013.Twenty metaphases were karyotyped using
Cytovision Software (Cytovision, USA).
Out of the 25 cases, good quality metaphases were observed in 22, of which 20 (80%) were Ph
positive and 2 (8%) were Ph negative [Fig 6 (D)]. In patients with Ph+ chromosome, the standard
Ph translocations t(9;22)(q34;q11)) were observed. Analysis could not be carried out in 2 (8%)
patients due to poor quality of metaphase spread and in 1(4%) patient no metaphase spread was
observed. Among the 25 samples, additional chromosomal abnormalities (ACAs) along with Ph
chromosome were identified in 8 (40%) cases. The ACAs include trisomy 8, trisomy 19, double
Ph with +12, loss of Y chromosome, Ph + hyperdiploid metaphases, 15 p+, 17 p+ and14q[Fig 10 ].

Among the 20 Ph positive CML cases, 12 patients were in CML-CP, 4 cases were in CML-AP
and rests of the 4 were in CML-BC. Among the 8 samples in advanced phases, 5 cases possess
additional chromosomal abnormalities (ACAs) along with Ph chromosome and these were found
to be trisomy 8, trisomy 19, double Ph with +12, loss of Y chromosome, and Ph + hyperdiploid
metaphases [Fig10 (E)].

56

5.2. MOLECULAR ANALYSIS

5.2.1. FISH
For further confirmation of the cytogenetic findings, FISH (Fluorescent In Situ Hybridization)
was performed on interphase cells from bone marrow samples of all the 25 cases using locus
specific probes for BCR and ABL genes (LSI-Vysis). Of this 23, (92%) cases were found to be
positive and 2 (8%) were negative for BCR- ABL fusion gene [Fig 6 (C)]. In Ph positive
patients, the FISH analysis detected one red signal, one green signal (chromosome no.9 and 22
respectively) and two red-yellow-green fusion signals (BCR-ABL fusion gene on der (22)
chromosome and ABL-BCR fusion gene on der (9) chromosome) on interphase cells and
metaphase cells which proved the cytogenetic diagnosis of Ph positive CML [Fig 12 (C) & (D)].
The FISH analysis in Ph negative patient showed two separate red and green signals on
chromosome 9 and 22 respectively [Fig 12 (A) & (B)]. The absence of BCR-ABL fusion gene
confirmed the cytogenetic diagnosis of Ph negative CML. FISH analysis showed positive signal
pattern in the all the 3 cases where cytogenetic analysis failed.
Additional chromosomal abnormalities (ACAs) like trisomy 8, double Ph and loss of Y
chromosome found in advanced phase cases were further confirmed by metaphase FISH [Fig
13(B), 14(B) and15(B)].

57

No: of the Age Sex

sample

Karyotype

FISH

Diagnostic
confirmation

Case 1

32

46, XY, Ph+

OGFF

CML-CP

Case 2

43

46, XX, Ph+

OGFF

CML-CP

Case 3
Case 4
Case 5
Case 6
Case 7
Case 8
Case 9
Case 10
Case 11

48
52
23
17
28
76
54
82
49

M
M
M
F
F
M
M
M
F

46,XY, Ph+, 17p+

46, XY, Ph+, 14 q46, XY, Ph+, 15p+
46, XX
46, XX
47, XY, Ph+, +8
48, XY, Ph+, Ph+, +12
45, X Y, Ph+
Hyperdiploid metaphase
with Ph+

OGFF
OGFF
OGFF
OOGG
OGGF
OGFF
OGFFF
OGFF
OGFF

CML-AP
CML-CP
CML-AP
Not CML
Not CML
CML-BC
CML-BC
CML-BC
CML-BC

Case 12
Case 13
Case 14
Case 15
Case 16
Case 17
Case 18
Case 19
Case 20
Case 21
Case 22
Case 23
Case 24
Case 25

62
64
68
38
42
36
56
20
58
59
50
60
53
31

M
F
M
F
M
M
F
F
M
M
F
M
M
M

47, XY, Ph+, +19

46, XX, Ph+
46, XY, Ph+
No division
Non- analyzable
Non- analyzable
46, XX, Ph+
46, XX, Ph+
46, XY, Ph+
46, XY, Ph+
46, XX, Ph+
46, XY, Ph+
46, XY, Ph+
46, XY, Ph+

OGFF
OGFF
OGFF
OGFF
OGFF
OGFF
OGFF
OGFF
OGFF
OGFF
OGFF
OGFF
OGFF
OGFF

CML-CP
CML-CP
CML-CP
CML-AP
CML-CP
CML-CP
CML-CP
CML-CP
CML-AP
CML-CP
CML-CP
CML-CP
CML-CP
CML-CP

Table 6: Karyotypic and bcr-abl fish signal pattern observed in 25 cml patients.

58

GRAPHICAL REPRESENTATION

(A)

(B)
12

No: of CML patients

10
36%
64%

8
6
4

Males

Females

0
15 - 35

35 - 55

55 - 75

75 - 95

Age (in years)

(D)

(C)

12%

8%

Ph +ve

8%

80%

Ph -ve

92%

bcr - abl +ve

Non analyzable
metaphases

bcr - abl -ve

59

(E)

CML-CP
CML-AP
CML-BC
Not CML

Fig 6: (A) Gender Distribution Pattern of 25 CML Patients (B) Age Distribution Pattern of 25 CML

Patients (C) Percentage Distribution of BCR-ABL Fusion Gene by FISH Analysis (D) Percentage
Distribution f Ph Chromosome by Cytogenetic Analysis (E) Percentage of different phases of CML.

60

METAPHASE SPREAD AND KARYOTYPE OF A NORMAL MALE

(A)

(B)

Fig 7: (A) Metaphase spread of a normal male (B) Normal G- banded

karyotype with 46, XY pattern.
61

KARYOTYPE OF A CML PATIENT SHOWING t(9;22)(q34;q11) TRANSLOCATION

Fig 8: G-banded karyotype of a CML patient with 46, XY, t(9;22)(q34;q11)

pattern. Arrows indicate der (9) and der (22).

62

KARYOTYPE OF A NORMAL FEMALE AND A FEMALE WITH t(9;22)(q34;q11)

TRANSLOCATION

(A)

(B)

Fig 9: G- banded karyotype of (A) a normal female with 46, XX pattern (B) a
CML patient with 46, XX, t(9;22)(q34;q11) pattern.
63

KARYOTYPES OF ADVANCED CML CASES WITH ADDITIONAL CHROMOSOMAL

ABNORMALITIES (ACA) BESIDES Ph.
(A)

Fig 10: (A) Karyotype of a CML patient with 47, XY, +8, t(9;22)(q34;q11) pattern
(B)

Fig 10: (B) Karyotype of a CML patient with 45, X,-Y, t(9;22)(q34;q11) pattern
64

(C)

Fig 10: (C) Karyotype of a CML patient with 48 ,XY ,+12 ,t(9;22)(q34;q11), der
(22) t(9;22)(q34;q11) pattern.

(D)

Fig 10: (D) Karyotype of a CML patient with 47, XY, +19, t(9;22)(q34;q11)
pattern.
65

(E)

Fig 10: (E) Hyperdiploid metaphase spread with Ph

chromosome
KARYOTYPES OF CML-CP CASES WITH ADDITIONAL CHROMOSOMAL
ABNORMALITIES (ACA) BESIDES Ph.

(A)

Fig 10: (E) Hyperdiploid metaphase with Ph chromosome

Fig 11: (A) Karyotype of a CML patient with 46, XY, 17 p+,t(9;22)(q34;q11)pattern.
66

(B)

Fig 11: (B) Karyoype of a CML with 46, XY, 14q-, t(9;22)(q34;q11) pattern.

(C)

Fig 11: (C) Karyotype of a CML patient with 46, XY, 15p+, t(9;22)(q34;q11) pattern.

67

FISH IMAGES OF A NORMAL CASE AND A CML PATIENT WITH BCR-ABL FUSION
GENE

[LSI PROBE FOR BCR-ABL (Vysis)]

(A)

(B)

Fig 12: FISH image showing (A) Interphase and (B) metaphase of a normal case with two red signals
(ABL gene on chromosome 9) and two green signals (BCR gene on chromosome 22).

(C)

(D)

Fig 12: FISH image showing (C) Interphase and (D) metaphase observed in a CML patient with one
red signal (ABL gene on chromosome 9), one green signal (BCR gene on chromosome 22) and two
yellow signals (BCR-ABL fusion gene on der (22) and ABL-BCR fusion gene on der (9).
68

FISH IMAGES SHOWING CML PATIENT WITH TRISOMY 8

(A)

(B)

Fig 13: (A) Interphase and (B) Metaphase FISH images of a CML patient with Trisomy 8
showing 3 red signals (ETO gene on chromosome 8) and 2 green signals (AML gene on
chromosome 21).

FISH IMAGES OF A CASE WITH DOUBLE Ph

(A)

(B)

Fig 14: (A) Interphase and (B) Metaphase FISH image of a CML patient with Double Ph showing one
red signal
(ABL
geneIMAGE
on chromosome
9), one
green signal
gene on chromosome 22) and three
FIG 15:
FISH
SHOWING
ABSENCE
OF(BCR
Y CHROMOSOME
yellow signals (two BCR-ABL fusion gene on der(22) and one ABL-BCR fusion gene on der(9).
69

FISH IMAGE SHOWING ABSENCE OF Y CHROMOSOME

( [SE X(DXZ1)/Y (DXZ3) CENTROMERIC PROBE- (POSEIDON)

(A)

(B)

Fig 15: (A) Interphase FISH image of a normal male showing one red signal (Y
chromosome) and one green signal (X chromosome) (B) Metaphase FISH image of a
male CML case showing only one green signal indicating X chromosome.
FISH IMAGE OF A CASE WITH HYPERDIPLOIDY

Fig 16: Interphase FISH image showing two red signals (ABL gene on chromosome 9),
two green signals (BCR gene on chromosome 22) and two yellow signals (one BCR-ABL
fusion gene and one ABL-BCR fusion gene) observed in a CML patient with hyperdiploidy
70

REPRESENTATIVE IMAGE OF ISOLATED RNA

Fig 17: Representative image of isolated RNA

MDR EXPRESSION ANALYSIS IN CML CASES BY MULTIPLEX PCR

M

Fig 18: Ethidium Bromide Agarose Gel picture showing bands of MDR 1 gene
(310 bp) and internal control 2-Microglobulin (114 bp) expression.
Lane M: 100 bp marker DNA
Lane 1: MDR 1 gene (310 bp) & 2-M gene(114 bp)
Lane 2: MDR 1 gene (310 bp) & 2-M gene(114 bp)
Lane 3: 2-M gene (114 bp)
Lane 4: 2-M gene (114 bp)
Lane 5: 2-M gene (114 bp)
Lane 6: 2-M gene (114 bp)
Lane 7: 2-M gene (114 bp)
71

CHAPTER 6
DISCUSSION

Chronic myeloid leukemia (CML) is a clonal myeloproliferative disorder resulting from

neoplastic transformation of hemopoietic stem cells. CML accounts for about 20% of all the
cases of leukemia, and the death rate is about 1.5 per 100,000 populations per year. It is the first
malignant disorder which is found to be associated with a chromosome abnormality. 90- 95% of
the CML cases is characterized by the presence of Philadelphia (Ph) chromosome, which results
from the t(9;22)(q34;q11) balanced reciprocal translocation [Nowell 1960; Rowley 1973]. The
molecular consequence of this translocation is the generation of the chimeric BCR-ABL1
oncogene that encodes a p210 kD protein with constitutive tyrosine kinase activity [Lugo et al.,
1990]. Currently, CML is one of the few diseases where treatment targeted against the
chromosomal abnormality is the sole frontline therapy for newly diagnosed patients. The advent
of tyrosine kinase inhibitor (TKI) imatinib mesylate (trade name Gleevec, formerly known as
STI571) as the first-line treatment has changed the rates of response and overall survival in CML
when compared to other conventional treatments like chemotherapy and interferon therapy.
Imatinib, a specific Abl kinase inhibitor, blocks the ATP-binding site of the Abl kinase and has
been shown to arrest growth and induce apoptosis in BCRABL-expressing hematopoietic cells
[Druker at al., 2001; Kantarjian et al., 2002]. So detection of Ph chromosome is the basis for the
targeted therapy using imatinib. Imatinib has shown activity in all phases of CML (chronic
phase, accelerated phase, and blast crisis) with Ph chromosome in clinical trials. Patients with
early phase (also known as chronic phase [CP] ) disease usually respond to imatinib treatment,
although some patients who respond initially later become resistant. Leukemia stem cells or their
progeny can acquire an additional genetic and epigenetic change that causes resistance to
targeted therapy and to transform from CP to more advanced phases, either accelerated phase or
blastic phase of the disease.

72

The discovery that a single chromosomal abnormality, the Philadelphia (Ph) chromosome, is
responsible for the etiology of this disease was a milestone for treating and understanding CML.
Diagnostic assays for the detection of Ph chromosome/ BCR-ABL fusion gene in CML patients
are based on the standard tests of conventional cytogenetics by G banding, fluorescence in situ
hybridization (FISH)and PCR.

The present study focused on the cytogenetic and molecular analysis of 25 clinicopathologically
confirmed CML patients during the time period from 1st April 2015 to 20th June 2015. The study
subjects included those who were under chronic phase (CP) of CML and advanced phases of
CML i.e. Accelerated phase (AP) or Blast crisis phase (BC). The greatest incidence of CML is in
the age range of 35-55 years with a slight male preponderance [Fig 6 (B)]. Conventional
cytogenetic analysis and molecular cytogenetic analysis by FISH was conducted on all the 25
samples to detect the presence of Ph chromosome/ BCR-ABL fusion gene. Relative expression
status of multidrug resistance gene (MDR-1 or ABCB-1) was evaluated by multiplex PCR in all
the study subjects to find out the mechanism of drug resistance in advanced phases of CML.

Conventional cytogenetics is considered as the gold standard method for the identification of Ph
chromosome, the diagnostic hallmark of CML. Cytogenetic analysis was carried out in 25 cases
and Ph chromosome was identified in 20 CML patients (80%). In 2 (8%) cases Ph chromosome
was absent and cytogenetic analysis failed in the identification of 3 (12%) cases due to poor
metaphase morphology [Fig 6 (D)]. These samples were confirmed by FISH analysis and were
found to be Ph positive.

Cytogenetic analysis also revealed the presence of additional chromosomal abnormalities in

40 % of Ph positive cases. These secondary abnormalities appeared exclusively in the Ph clone
in 8 of the patients, a sign of clonal evolution. These 8 cases with ACAs include the 5 cases
resistant to imatinib therapy and 3 newly diagnosed CML cases. The ACAs found in the resistant
cases include trisomy 8, trisomy 19, double Ph with trisomy 12, loss of Y chromosome, and Ph
positive hyperdiploid metaphases in addition to classic Ph chromosome [Fig 10]. Additional
cytogenetic abnormalities are generally considered to be an important step in the evolution of
73

CML from the chronic phase (CP) to the terminal blast crisis (BC). Cytogenetic clonal evolution
was originally described in patients with blastic phase CML, occurring in 50% to 80% of cases
[Anastasi et al., 1995] and was later described in 5% to 10% of patients presenting with chronic
phase CML [Sokal et al. 1988]. Kantarjian et al., detected additional chromosomal changes in
approximately 10% of Ph-positive CML in the CP at the time of the diagnosis and reported that
patients with karyotypic clonal evolution generally have a worse clinical outcome [Kantarjian et
al., 1987]. Otero et al considered additional chromosomal abnormalities as the sole prognostic
factor, regardless of the disease phase, and observed that these abnormalities were associated
with lower cytogenetic response rates and decreased overall survival [Otero et al., 2007].

The prognostic significance of the presence of clonal ACAs in CP CML at diagnosis and during
treatment has been discussed in many previous studies. The patients with double Ph showed a
higher risk of relapse and are associated with resistance. If the additional abnormality present is
double Ph, usually clinicians will recommend a dose escalation of imatinib.

Trisomy 8 is the most common type of abnormality found in Ph positive CML and is associated
with major and minor cytogenetic responses. C-myc is coded in chromosome 8. Jennings and
Mills have suggested a correlation between levels of c-myc and trisomy 8 among patients who
developed clonal evolution [Jennings BA, Mills KI., 1998].

The loss of Y chromosome is associated with a poor response to imatinib therapy [Lippert et al.
2010]. The loss of Y chromosome is frequently associated with older age, and might be in some
cases only a consequence of ageing. However, there are no univocal data on the significance of
the loss of the Y chromosome in CP-CML [Fabarius et al., 2011]. The mechanism of loss of the
Y chromosome in hematological disorders is unclear. Limited genes are known on the Y
chromosome and so far none of these genes has been identified to have a pathogenic role in the
development of neoplasm [Zhang Li-jun et al., 2007].
Hyperdiploidy with 50 chromosomes are not commonly reported in CML cases. In this study
hyperdiploidy was observed in one case with Ph chromosome. Chin et al. have conducted a
74

cytogenetic study in 75 CML patients and found hyperdiploid karyotype in two of their patients
[Chin et al., 1988]. Another study conducted in Malaysia on 256 patients of CML showed 15%
of Ph chromosome positive patients had additional chromosomal aberrations out of which only
one patient had a hyperdiploid karyotype showing 51 chromosomes with trisomy 6, 10, 13, 19,
and presence of two Ph chromosomes [Meng et al., 2001]. The exact influence of hyperdiploidy
on the course of the disease in CML is not known but it has been implicated that chromosomal
gain with hyperdiploidy is associated with increased risk for blast crisis particularly myeloblastic
crisis and it can precede the blastic phase by 24 months [Godley et al., 1995].

Trisomy 19 is frequently encountered in cases of chronic myeloid leukemia (CML) as a

secondary abnormality: however, trisomy 19 rarely occurs as a sole chromosomal abnormality
and, to date, it has only been reported in 48 hematopoietic malignancies. The presence of an
extra copy of chromosome 19 has been correlated with myeloid blast crisis of CML (Heim et al.,
1995). The biologic relevance of trisomy 19 may relate to a gene dosage effect but at present, it
is unclear which gene(s) on chromosome 19 is associated with tumorigenesis.

So from the results it can be summarized that cytogenetics can be considered as a gold standard
for the detection of Philadelphia chromosome in CML patients. And it can also reveal other
chromosomal abnormalities (ACAs) in addition to Ph. ACAs possess prognostic significance and
their occurrence can be the reason for resistance to imatinib therapy and progression of disease to
advanced stages. Though cytogenetic analysis can detect chromosomal abnormalities, there are
some limitations like decreased sensitivity, requirement of morphologically good metaphase,
highly skilled personnel and time consuming process. In cases where chromosomal diagnosis
could not be done due perhaps to poor metaphase morphology, interphase FISH can be used as
an important tool for the monitoring BCR-ABL gene rearrangements.

FISH (Fluorescent in situ hybridization) analysis was done on all the 25 samples in order to
confirm the cytogenetic findings. FISH analysis was done on the interphase cells from bone
marrow preparations of all 25 samples. Of the 25 cases, 23 (92%) were found to be Ph positive
and that include the 3 cases where cytogenetic analysis failed [Fig 6 (C)]. In Philadelphia
75

positive cells, the FISH analysis revealed the fusion of red and green signals (BCR-ABL fusion
gene) seen as a red-yellow-green signal on cells which confirms the diagnosis of Ph [Fig 12 (C)
& (D)]. The BCR-ABL fusion gene was absent in 2 cases and they were confirmed as Ph
chromosome negative. The FISH analysis in Philadelphia negative patients showed two separate
red and green signals on chromosome no.9 and 22 respectively [Fig 12 (A) & (B)]. Despite few
minor differences, a highly significant correlation was found between cytogenetic and FISH
results. Conventional cytogenetics is a useful method for detection of Ph chromosome in
metaphase stage of cell division but the limitation is that the Ph chromosome cannot be detected
in metaphases with poor morphology or in interphase cells. FISH can be used in interphase stage
of cell division for the same purpose and can be done when conventional cytogenetic analysis
has failed to yield results. Also the analysis time is much shorter with interphase FISH than with
conventional cytogenetics. Metaphase FISH can also be done for further confirmation. In the 5
cases of CML CP with ACAs, interphase FISH showed the presence of BCR- ABL fusion gene.
Metaphase FISH was also conducted to confirm the ACAs observed in the karyotypic pattern
[Fig 13-16].

Though imatinib mesylate is a selective inhibitor of BCR-ABL kinases, an emerging problem is

the development of resistance to imatinib and other novel inhibitors of tyrosine kinases, in
patients who are in the advanced phases of CML, which in turn results in failure of treatment. In
the most cases, resistance against imatinib results from kinase domain mutations and/or overexpression of the BCR-ABL gene. There are also some cases of resistance that occur through
mechanisms independent on BCR-ABL like over expression of -1-acid glycoprotein (AGP) and
multidrug- resistant P-glycoprotein (MDR-1 or ABCB-1). Multidrug resistance (MDR) is a wellknown phenomenon of cross-resistance of mammalian cells to a number of anticancer agents
following exposure to one such drug. A diverse range of agents involved in MDR include
alkaloid compounds and bacterial and fungal antibiotics, such as anthracyclines and etoposide.
Multidrug resistance is an important mechanism in imatinib resistance. MDR-1 or ABCB-1 gene,
located on chromosome 7q21 encodes a 170 kD membrane transporter P-glycoprotein [P-gp] that
acts as an energy dependent, efflux pump. Over-expression of MDR-1/P-gp confers resistance to
the cytotoxic effects of a broad range of structurally unrelated compounds. Imatinib is a substrate
76

for Pgp and therefore overexpression of Pgp may therefore result in excess transport of imatinib
out of the cells conferring intrinsic resistance to the treatment [Arceci et al., 1993].

In order to investigate on the mechanism of resistance in advanced phase (AP or BC) CML
samples, MDR-1 expression analysis by multiplex PCR was carried out. For this
2-microglobulin was selected as an internal control. Of the 23 samples, 2 samples (9%) in
BC-phase showed over expression of MDR-1 gene and the others (91%) were found to be
negative [Fig 18]. ABCB-1 orMDR-1is over expressed in cells from patients with BC-CML and
has been linked to the development of TKI resistance (Mahon et al., 2000). Galimberti et al., in
2005 showed that those patients who failed to attain a major cytogenetic response or progressed,
exhibited ABCB1 over expression. In the blast phase, all samples exhibited P-gp/ABCB1
positivity in contrast to other CML phases (Vasconceloset al., 2007).Cells from patients in blast
crisis have a higher expression of MDR-1 compared with those from patients in chronic phase,
and up regulation of MDR-1 was deemed a potential cause of the decreased sensitivity to
chemotherapy in patients with advanced-phase disease (Kuwazuru et al., 1990).

So here in this study, presence of MDR-1 gene in two of the BC-phase samples show that the
causal factor for imatinib resistance in advanced phases of the disease is due to over expression
of MDR-1 gene, in turn leads to reduced intracellular drug accumulation through P-gp-mediated
efflux. It is also shown that the PCR-based assay is the only assay that ensures reliable detection
of MDR-1 gene expression in samples from cells with a low level of drug resistance and requires
much less sample. Further studies have to be conducted on the other advanced and chronic phase
CML cases to find out the relative expression and mutation status of other genes involved in drug
resistant pathway.

77

CHAPTER 7
CONCLUSION
Chronic myeloid leukemia represents a unique model to understand the molecular mechanism
underlying the onset and progression of leukemic process. Philadelphia chromosome is a specific
cytogenetic marker, the detection of which is necessary for differential diagnosis and clinical
management of patients with the clinical diagnosis of CML. Bone marrow karyotyping is useful
for specific identification of the cytogenetic profile. Standard cytogenetics for CML is indicated
at the time of diagnosis and cytogenetic relapse, and it is reasonable to consider it during the
follow up bone marrow examination for any indication. The conventional cytogenetic analysis
remains the standard method for the purposes of diagnosis and monitoring of therapeutic
response of patients with chronic myeloid leukemia. The molecular cytogenetic method
fluorescent in situ hybridization (FISH) is a relatively inexpensive and rapid method. When this
method is used in conjunction with conventional chromosome analysis, the cytogeneticist can
combine the power of complete karyotype studies and the resolution of molecular techniques for
patients suspected of having a Ph chromosome. The unraveling of the biological causes and
mechanisms of disease progression is of paramount importance for defining effective therapeutic
approaches in advanced phases of CML.

78

CHAPTER 8
REFERENCE
1. Acacio de Barros, Bar-Eli M, Arlin Z, Advani S, Allen SL, Goldman J, Snyder D, Foti A,
Cline M. The spectrum of molecular alterations in the evolution of chronic myelocytic
leukemia. Journal of Clinical Investigation 1993; 87: 20422047.

2. Ackerman and del Rigato, (1985), Cancer-Diagnosis, Treatment and Prognosis, sixth
edition, the C V Mosby company, Princeton.
3. Anand, M. S., Varma, N., Varma, S., Rana, K. S., & Malhotra, P. (2012). Cytogenetic &
molecular analyses in adult chronic myelogenous leukaemia patients in north India. The
Indian journal of medical research, 135(1), 42.
4. Anastasi J, Feng J, Le Beau MM, Larson RA, Rowley JD, Vardiman JW. The
relationship between secondary chromosomal abnormalities and blast transformation in
chronic myelogenous leukemia. Leukemia. 1995 :628-33.
5. Apperley, J. F. (2007). Part I: mechanisms of resistance to imatinib in chronic myeloid
leukaemia. The lancet oncology, 8(11), 1018-1029.

6. Baer, M. R., George, S. L., Dodge, R. K., O'Loughlin, K. L., Minderman, H., Caligiuri,
M. A., & Larson, R. A. (2002). Phase 3 study of the multidrug resistance modulator PSC833 in previously untreated patients 60 years of age and older with acute myeloid
leukemia: Cancer and Leukemia Group B Study 9720. Blood, 100(4), 1224-1232.

7. Bixby, D., & Talpaz, M. (2009). Mechanisms of resistance to tyrosine kinase inhibitors in
chronic myeloid leukemia and recent therapeutic strategies to overcome resistance. ASH
Education Program Book, 2009(1), 461-476.

8. Boronova, I., Bernasovsky, I., Bernasovska, J., Sotak, M., Petrejcikova, E., Bozikova, A.,
& Seliga, P. (2006). Detection of Philadelphia chromosome in patients with chronic
myeloid leukemia from the Presov region in Slovakia (1995-2004). Bratislavske lekarske
listy, 108(10-11), 433-436.

79

9. Branford, S., Rudzki, Z., Walsh, S., Grigg, A., Arthur, C., Taylor, K., & Hughes, T. P.
(2002). High frequency of point mutations clustered within the adenosine triphosphate
binding region of BCR/ABL in patients with chronic myeloid leukemia or Ph-positive
acute lymphoblastic leukemia who develop imatinib (STI571) resistance. Blood, 99(9),
3472-3475.

10. Branford, S., Rudzki, Z., Walsh, S., Parkinson, I., Grigg, A., Szer, J., & Hughes, T.
(2003). Detection of BCR-ABL mutations in patients with CML treated with imatinib is
virtually always accompanied by clinical resistance, and mutations in the ATP phosphatebinding loop (P-loop) are associated with a poor prognosis. Blood, 102(1), 276-283.

11. Buno, I., Wyatt, W. A., Zinsmeister, A. R., Dietz-Band, J., Silver, R. T., & Dewald, G.
W. (1998). A special fluorescent in situ hybridization technique to study peripheral blood
and assess the effectiveness of interferon therapy in chronic myeloid leukemia. Blood,
92(7), 2315-2321.
12. Bustin, S. X., & Mueller, R. (2005). Real-time reverse transcription PCR (qRT-PCR) and
its potential use in clinical diagnosis. Clinical Science, 109, 365-379.

13. Buyukasik, Y., Haznedaroglu, I. C., & Ilhan, O. (2010). Chronic myeloid leukemia:
Practical issues in diagnosis, treatment and follow-up. UHODUluslararasi HematolojiOnkoloji Dergisi, 20(2), 1-12.

14. Chandra, J., Tracy, J., Loegering, D., Flatten, K., Verstovsek, S., Beran, M., &
Kaufmann, S. H. (2006). Adaphostin-induced oxidative stress overcomes BCR/ABL
mutation-dependent and-independent imatinib resistance. Blood, 107(6), 2501-2506.

15. Chauffaille, M. D. L. L. F., Oliveira, J. S. R., Romeo, M., & Kerbauy, J. (2001).
Fluorescent in-situ hybridization (FISH) for BCR/ABL in chronic myeloid leukemia after
bone marrow transplantation. Sao Paulo Medical Journal, 119(1), 16-18.

16. Cortes, J., Giles, F., O'Brien, S., Thomas, D., Garcia-Manero, G., Rios, M. B., &
Kantarjian, H. (2003). Result of high-dose imatinib mesylate in patients with Philadelphia
chromosome-positive chronic myeloid leukemia after failure of interferon-. Blood,
102(1), 83-86.

17. Craig A Almeida and Sheila A Barry(2010) , Cancer-Basic science and clinical aspect, A
John Wiley and sons Ltd, UK.
80

18. Dehainault, C., Lauge, A., Caux-Moncoutier, V., Pages-Berhouet, S., Doz, F., Desjardins,
L., & Houdayer, C. (2004). Multiplex PCR/liquid chromatography assay for detection of
gene rearrangements: application to RB1 gene. Nucleic acids research, 32(18), e139e139.

19. DeVita, Hellman and Rosenberg(2015), CANCER-Principles and practice of oncology,

Tenth edition, Wolters Kluwer, Philadelphia.

20. Dewald, G. W., Wyatt, W. A., & Silver, R. T. (1999). Atypical BCR and ABL D-FISH
patterns in chronic myeloid leukemia and their possible role in therapy. Leukemia &
lymphoma, 34(5-6), 481-491.

21. Dicker, F., Schnittger, S., Haferlach, T., Kern, W., & Schoch, C. (2006).
Immunostimulatory oligonucleotide-induced metaphase cytogenetics detect chromosomal
aberrations in 80% of CLL patients: a study of 132 CLL cases with correlation to FISH,
IgVH status, and CD38 expression. Blood, 108(9), 3152-3160.

22. Donato, N. J., Wu, J. Y., Stapley, J., Gallick, G., Lin, H., Arlinghaus, R., & Talpaz, M.
(2003). BCR-ABL independence and LYN kinase overexpression in chronic
myelogenous leukemia cells selected for resistance to STI571. Blood, 101(2), 690-698.

23. Douet-Guilbert, N., Morel, F., Le Charpentier, T., LE BRIS, M. J., HERRY, A.,
MORICE, P., & DE BRAEKELEER, M. A. R. C. (2004). Interphase FISH for follow-up
of Philadelphia chromosome-positive chronic myeloid leukemia treatment. Anticancer
research, 24(4), 2535-2540.

24. Dulucq, S., Bouchet, S., Turcq, B., Lippert, E., Etienne, G., Reiffers, J.,& Mahon, F. X.
(2008). Multidrug resistance gene (MDR1) polymorphisms are associated with major
molecular responses to standard-dose imatinib in chronic myeloid leukemia. Blood,
112(5), 2024-2027.

25. Frater, J. L., Tallman, M. S., Variakojis, D., Druker, B. J., Resta, D., Riley, M. B.,&
Peterson, L. C. (2003). Chronic myeloid leukemia following therapy with imatinib
mesylate (Gleevec) Bone marrow histopathology and correlation with genetic status.
American journal of clinical pathology, 119(6), 833-841.
81

26. Fugazza, G., Miglino, M., Bruzzone, R., Quintino, S., Gatti, A., Grasso, R., & Sessarego,
M. (2004). Cytogenetic and fluorescence in situ hybridization monitoring in Ph+ chronic
myeloid leukemia patients treated with imatinib mesylate. JOURNAL OF
EXPERIMENTAL AND CLINICAL CANCER RESEARCH, 23, 295-300.

27. Giglio, S., Monis, P. T., & Saint, C. P. (2003). Demonstration of preferential binding of
SYBR Green I to specific DNA fragments in realtime multiplex PCR. Nucleic Acids
Research, 31(22), e136-e136.

28. Giles, F. J., Kantarjian, H. M., Cortes, J., Thomas, D. A., Talpaz, M., Manshouri, T., &
Albitar, M. (1999). Multidrug resistance protein expression in chronic myeloid leukemia.
Cancer, 86(5), 805-813.
29. Godley J, Halpern J, ten Hoeve J, Rao X, Sawyers CL.Constitutive activation of STAT5
by the BCR-ABL oncogene in chronic myelogenous leukemia. Oncogene.1995; 13:247254.
30. Gorre, M. E., Mohammed, M., Ellwood, K., Hsu, N., Paquette, R., Rao, P. N., &
Sawyers, C. L. (2001). Clinical resistance to STI-571 cancer therapy caused by
BCR-ABL gene mutation or amplification. Science, 293(5531), 876-880.
31. Illmer, T., Schaich, M., Platzbecker, U., Freiberg-Richter, J., Oelschlagel, U., Von Bonin,
M., & Schleyer, E. (2004). P-glycoprotein-mediated drug efflux is a resistance
mechanism of chronic myelogenous leukemia cells to treatment with imatinib mesylate.
Leukemia, 18(3), 401-408.

32. Iqbal, Z., Manzoor, F., Iqbal, M., Ali, S., Sheikh, N., Khan, M.,& Akhtar, T. (2011).
Frequency of Bcr-Abl fusion oncogene splice variants associated with chronic myeloid
leukemia (CML). Journal of Cancer Therapy, 2(02), 176.
33. Jennings BA, Mills KI.C-myc locus amplification and the acquisition of trisomy 8
in the evolution of chronic myeloid leukemia. Leuk Res. 1998; 22:899-903.

34. Jones, Carol D., Cecilia Yeung, and James L. Zehnder. "Comprehensive validation of a
real-time quantitative bcr-abl assay for clinical laboratory use." American journal of
clinical pathology 120, no. 1 (2003): 42-48.

82

35. Juan A del Regato, Haian J Spjut, James D Con; Cancer-Diagnosis, Treatment,and
Prognosis, Cancer(1998); 1-50.

36. Kaeda, J., O'shea, D., Szydlo, R. M., Olavarria, E., Dazzi, F., Marin, D., & Apperley, J.
F. (2006). Serial measurement of BCR-ABL transcripts in the peripheral blood after
allogeneic stem cell transplantation for chronic myeloid leukemia: an attempt to define
patients who may not require further therapy. Blood, 107(10), 4171-4176.

37. Kantarjian, H., Giles, F., Wunderle, L., Bhalla, K., O'Brien, S., Wassmann, B., &
Ottmann, O. G. (2006). Nilotinib in imatinib-resistant CML and Philadelphia
chromosomepositive ALL. New England Journal of Medicine, 354(24), 2542-2551.

38. Kantarjian, H. M., Talpaz, M., O'Brien, S., Giles, F., Garcia-Manero, G., Faderl, S., &
Cortes, J. (2003). Dose escalation of imatinib mesylate can overcome resistance to
standard-dose therapy in patients with chronic myelogenous leukemia. Blood, 101(2),
473-475.
39. Kuwazuru Y, Yoshimura A, Hanada S, et al. Expression of the multidrug
transporter, P glycoprotein, in chronic myelogenous leukemia cells in blast crisis.
Br J Haematol. 1990; 74: 2429.

40. Landstrom A P, Tefferi A;Flourescent in situ hybridization in the diagnosis, prognosis,

and treatment monitoring of chronic myeloid leukemia, Leuk Lymphoma.(2006) 47:397402.

41. Le Coutre, P., Kreuzer, K. A., Na, I. K., Schwarz, M., Lupberger, J., Holdhoff, M., &
Schmidt, C. A. (2003). Imatinib in Philadelphia chromosomepositive chronic phase
CML patients: Molecular and cytogenetic response rates and prediction of clinical
outcome. American journal of hematology, 73(4), 249-255.

42. Le Gouill, S., Talmant, P., Milpied, N., Daviet, A., Ancelot, M., Moreau, P., & AvetLoiseau, H. (2000). Fluorescence in situ hybridization on peripheral-blood specimens is a
reliable method to evaluate cytogenetic response in chronic myeloid leukemia. Journal of
Clinical Oncology, 18(7), 1533-1538.

43. Lim, T. H., Tien, S. L., Lim, P., & Lim, A. S. T. (2005). The incidence and patterns of
BCR/ABL rearrangements in chronic myeloid leukaemia (CML) using fluorescence in
83

situ hybridisation (FISH). ANNALS-ACADEMY OF MEDICINE SINGAPORE, 34(9),

533.
44. Luize Otero, Maria Helena Ornellas, Alexandre Melo de Azevedo, Jane Dobbin, Eliana
Abdelhay, Luiz Fernando Bouzas, Teresa de Souza Fernandez; The impact of additional
chromosomal abnormalities in response to imatinib mesylate therapy for chronic myeloid
leukemia, Revista Brasileira de Cancerologia(2007) 53: 405-410.
45. Mahon, F. X., Hayette, S., Lagarde, V., Belloc, F., Turcq, B., Nicolini, F. & Pasquet, J.
M. (2008). Evidence that resistance to nilotinib may be due to BCR-ABL, Pgp, or Src
kinase overexpression. Cancer Research, 68(23), 9809-9816.

46. Marsh Samuel (2005), the essentials of clinical oncology, first edition , Jaypee brothers
medical publishers (P) Ltd, New Delhi.
47. Martin D Abeloff, et al.,(2004) clinical oncology, third edition, Elsevier Churchill
livingstone, Philadelphia.

48. Mauro, M. J., Druker, B. J., & Maziarz, R. T. (2004). Divergent clinical outcome in two
CML patients who discontinued imatinib therapy after achieving a molecular remission.
Leukemia research, 28, 71-73.

49. McLean, L. A., Gathmann, I., Capdeville, R., Polymeropoulos, M. H., & Dressman, M.
(2004). Pharmacogenomic analysis of cytogenetic response in chronic myeloid leukemia
patients treated with imatinib. Clinical Cancer Research, 10(1), 155-165.

50. Melo, J. V., Gordon, D. E., Cross, N. C. P., & Goldman, J. M. (1993). The ABL-BCR
fusion gene is expressed in chronic myeloid leukemia. BLOOD-NEW YORK-, 81, 158158.

51. Modi, H., McDonald, T., Chu, S., Yee, J. K., Forman, S. J., & Bhatia, R. (2007). Role of
BCR/ABL gene-expression levels in determining the phenotype and imatinib sensitivity
of transformed human hematopoietic cells. Blood, 109(12), 5411-5421.

52. O'Hare, T., Eide, C. A., & Deininger, M. W. (2007). Bcr-Abl kinase domain mutations,
drug resistance, and the road to a cure for chronic myeloid leukemia. Blood, 110(7),
2242-2249.
84

53. Palandri, F., Castagnetti, F., Testoni, N., Luatti, S., Marzocchi, G., Bassi, S., & Rosti, G.
(2008). Chronic myeloid leukemia in blast crisis treated with imatinib 600 mg: outcome
of the patients alive after a 6-year follow-up. Haematologica, 93(12), 1792-1796.

54. Paschka, P., Mller, M. C., Merx, K., Kreil, S., Schoch, C., Lahaye, T.,& Hochhaus, A.
(2003). Molecular monitoring of response to imatinib (Glivec) in CML patients
pretreated with interferon alpha. Low levels of residual disease are associated with
continuous remission. Leukemia, 17(9), 1687-1694.

55. Patel, B. P., Trivedi, P. J., Brahmbhatt, M. M., Gajjar, S. B., Iyer, R. R., Dalal, E. N.,&
Shah, P. M. (2010). Deletion of derivative ABL, BCR or ABL-BCR fusion gene is
associated with shorter disease free survival in CML patients. International Journal of
Genetics and Molecular Biology, 2(7), 158-164.

56. Perez-Caro, M., & Sanchez-Garcia, I. (2007). BCR-ABL and Human Cancer. In
Apoptosis, Cell Signaling, and Human Diseases (pp. 3-34). Humana Press.

57. Quintas-Cardama, Alfonso, Hagop M. Kantarjian, and Jorge E. Cortes. "Mechanisms of

primary and secondary resistance to imatinib in chronic myeloid leukemia." Cancer
control: journal of the Moffitt Cancer Center 16.2 (2009): 122.

58. Razmkhah, F., Razavi, M., Zaker, F., Kazemi, A., Negari, S., Rasighaemi, P., & Pazhakh,
V. (2010). Hematologic and molecular responses to generic imatinib in patients with
chronic myeloid leukemia. Lab Medicine, 41(9), 547-550.
59. Reinhold, U., Hennig, E., Leiblein, S., Niederwieser, D., & Deininger, M. W. N. (2003).
FISH for BCR-ABL on interphases of peripheral blood neutrophils but not of unselected
white cells correlates with bone marrow cytogenetics in CML patients treated with
imatinib. Leukemia, 17(10), 1925-1929.
60. Rowley J D; a new consistent chromosomal abnormality in chronic myelogenous
leukemia identified by quinacrine fluorescence and Giemsa staining, Nature(1973) 243:
290-293.
61. Sastre, D. A., Argarana, C. E., Heller, V. B., Gallo, M., Fernandez, E. N., & Rodriguez,
C. M. (2007). An analysis of multiplex-PCR in the detection of BCR-ABL transcripts in
hematological disorders. Genetics and Molecular Biology, 30(3), 520-523.
85

62. Savage D G, Antham K; Imatinib Mesylate; a new oral targeted therapy. N, Eng J
Med(2002) 346;683-693.
63. Schneider, K. 2001. Counseling about cancer: Strategies for genetic counseling. Second
edition. New York: John Wiley & Sons.

64. Serpa, M., Sanabani, S. S., Dorliac-Llacer, P. E., Conchon, M., Pereira, T. D., Nardinelli,
L., & Bendit, I. (2010). Molecular measurement of BCR-ABL transcript variations in
chronic myeloid leukemia patients in cytogenetic remission. BMC Hematology, 10(1), 7.

65. Stahlberg, A., Zoric, N., Aman, P., & Kubista, M. (2005). Quantitative real-time PCR for
cancer detection: the lymphoma case.

66. Sultana, T. A., Mottalib, M. A., Islam, M. S., Khan, M. A., & Choudhury, S. (2008).
rt-PCR method for diagnosis and follow-up of hematological malignancies: first approach
in Bangladesh. Bangladesh Medical Research Council Bulletin, 34(1), 1-11.
67. Testoni, N., Marzocchi, G., Luatti, S., Amabile, M., Baldazzi, C., Stacchini, M., &
Baccarani, M. (2009). Chronic myeloid leukemia: a prospective comparison of interphase
fluorescence in situ hybridization and chromosome banding analysis for the definition of
complete cytogenetic response: a study of the GIMEMA CML WP. Blood, 114(24),
4939-4943.

68. Thomas, J., Wang, L., Clark, R. E., & Pirmohamed, M. (2004). Active transport of
imatinib into and out of cells: implications for drug resistance. Blood, 104(12), 37393745.

69. Willis, S. G., Lange, T., Demehri, S., Otto, S., Crossman, L., Niederwieser, D., &
Deininger, M. W. (2005). High-sensitivity detection of BCR-ABL kinase domain
mutations in imatinib-naive patients: correlation with clonal cytogenetic evolution but not
response to therapy. Blood, 106(6), 2128-2137.

70. Yaghmaie, M., Ghaffari, S. H., Alimoghaddam, K., Ghavamzadeh, A., Mousavi, S. A.,
Irvani, M., & Jahani, M. (2005). Frequency of BCR-ABL Fusion Transcript in Iranian
Patients with Chronic Myeloid Leukemia. International Journal of HematologyOncology and Stem Cell Research, 2(3), 1-5.

86

71. Zhang Li-Jun, Cortes J, Rousselot P, Kim DW, et al. Dasatinib induces complete
hematologic and cytogenetic responses in patients with imatinib-resistant or -intolerant
chronic myeloid leukemia in blast crisis. Blood. 2007;109:3207-3213.

87

CHAPTER 9
APPENDIX

REAGENTS
CYTOGENETIC ANALYSIS

RPMI medium 1640

Growth medium RPMI 1640 (SIGMA)

1.04 gm

Pencillin

50l/100ml

Streptomycin

50l/100ml

Amphotericin

100l/100ml

Autoclaved TDW

80ml

The media solution was prepared by dissolving 1.04 gm of RPMI 1640 powder in sterile distilled
water. The sterilization of the media solution was done by passing it through the millipore
cellulose membrane filter with a pore size of 0.22 m generating a negative pressure with a
vacuum unit facilitated filtration. 20 ml (20%) of the fetal bovine serum was added into media
for additional nutritional supplement. In order to inhibit the growth of bacteria and other
microbes, penicillin, amphotericin and streptomycin were also added to the media. The media
was kept in the refrigerator for storage.
Fixative (100 ml) (3:1)
Absolute Methanol

75 ml

Glacial acetic acid

25 ml

Prepare fresh before use

88

Hypotonic Solution (0.075M KCl)

Potassium Chloride

5.6g

Distilled water

1 Litre

Sorensens Buffer
Sodium Phosphate dibasic (NaHPO)

2.37g

Potassium dihydrogren orthophosphate (KHPO)

2.28 g

Distilled water

500 ml

Colchicine
Colchicine

2 mg

Triple distilled water

1ml

Stock solution of colchicine was prepared with a concentration of 2 mg/ml and the working
solution contains a concentration of 40 g/ml.
Giemsa Stain (for staining)
Giemsa stain used 10% solution (commercially available)
Giemsa stain one part

5 ml

Sorensens buffer 9 parts

45ml

The staining solution was made fresh

Trypsin (0.1% in Normal Saline)
Trypsin

5 mg

Normal saline

50 ml
89

Freshly prepared and used at room temperature. The solution was discarded as soon as turbidity
developed or the slides showed an identification of contamination

Giemsa Staining Solution (5%)

Distilled water

42.5 ml

Buffer solution (Gurrs buffer pH 6.8)

5 ml

Giemsa stain

2.5 ml

The staining solution was made fresh and used within 2 to 3 hours. The buffer solution (Gurrs
buffer pH 6.8) was prepared by dissolving a Gurr buffer tablet in 1 litre of distilled water.

FLUORESCENCE IN SITU HYBRIDIZATION (FISH)

20 X Saline Sodium Citrate (SSC) (pH 5.6)

20X SSC powder

132 g

Triple Distilled Water (TDW)

500 ml

2 X SSC (pH 70.2)

5 ml 20X SSC made up to a volume of 50 ml with Triple Distilled Water
0.4 X SSC
1 ml 20X SSC made up to a volume of 50 ml with Triple Distilled Water.

90

Pepsin Solution
TDW

50 ml

HCl

40l

Pepsin

0.2 g

Kept at a temperature of 37C.

Neutral Buffered Formalin (NBF)

Formaldehyde

12.5 ml

1 X PBS

37 ml

2M MgCl2 (100 X)

500 l

1X Phosphate Buffer Saline (PBS)(pH 7.4)

NaCl

2g

KCl

0.05 g

Na2HPO4

0.36 g

KH2PO4

0.06 g

Autoclaved TDW

250 ml

91

AGAROSE GEL ELECTROPHORESIS

10X Tris Borate EDTA (TBE) buffer

0.89 M Tris Salt

108 g

0.89 M Boric acid

55 g

20 mM EDTA (pH 8)

7.44 g

Distilled water

100 ml

Staining dye (Ethidium bromide)

10 mg/ml

92