You are on page 1of 5

BIOL 2131: Cell and Molecular Biology

Assignment 4 (Total: 100 Marks)


Please put your answers in the boxes shown. The boxes will expand as you type and
do NOT show the length of answer expected. You may also print the document if
necessary, then scan and save it as a .pdf to submit to your Open Learning Faculty
Member.

Section 4.1
1. In Figure 12.6, what structure is continuous with the outer membrane of the
nuclear envelope? (3 marks)

2. Refer to Figure 10.10a and 10.10b. How do the base pairing relationships of
DNA bases account for the uniform width of the double helix? (6 marks)

3. Look at Figure 13.13a-c. What enables the two DNA polymerase III molecules
to act on replication as a unit (i.e., simultaneously replicating the leading and
lagging strands) even though they are moving toward opposite ends of their
respective templates? (5 marks)

4. Histones are known to be largely basic proteins that are predominantly


positively charged. How does this explain their tight association with DNA?
(5 marks)

5. What are the two major reasons for the multiple initiation sites for eukaryotic
replication? (6 marks)

6. The sequences of a particular set of genes are found by in situ hybridization to


be heterochromatic in some cells and euchromatic in cells at different stages
of development. Briefly explain how this is possible. (5 marks)

TRU Open Learning

Assignment 4

7. Despite the numerous checks present in the cell to prevent the placement of
the wrong nucleotide in a replicating DNA, a few mistakes can be made. Why
is this beneficial in the long term? (5 marks)

Section 4.2
8. Figure 11.12 shows a transcriptional unit of rRNA with strands of nascent
rRNA getting progressively larger as they get closer to the end of the unit, a
structure that looks much like an arrowhead. What is the significance of the
space between the two arrowheads shown in the picture? (5 marks)

9.(6 marks)
a. According to Figure 11.46, what site on the ribosome does the first
charged tRNA occupy?

b. According to Figure 11.49, at what site do all subsequent charged tRNAs


enter the ribosome?

10. Look at Figure 11.43. Given that puromycin and phenylalanyl-tRNA are
structurally similar, and since puromycin prevents the elongation of a
growing polypeptide by entering the A site instead of phenylalanyl-tRNA, as
what kind of inhibitor would puromycin be most likely to be classified?
(5 marks)

11. Which step in Figure 11.2 is reversed by reverse transcriptase? (4 marks)

TRU Open Learning

BIOL 2131: Cell and Molecular Biology

12. It makes sense that DNA, the stable genetic material of most organisms,
should be sequestered in a specific area of the cell to protect it and prevent it
from potential damage. On the other hand, the mRNA, the working copy of
the genetic code, is relatively short-lived or unstable. Why is the latter
advantageous to the cell? (6 marks)

13. Research over the past 50 years has revealed that RNA has catalytic ability, in
addition to its role in protein synthesis. What does this discovery suggest in
terms of evolution? (6 marks)

14. You are studying protein synthesis in a cell. You have been able to determine
very little about the process but have been able to determine that
transcription and translation involving the same mRNA cannot occur at the
same time. What kind of cell are you studying? (3 marks)

Using your knowledge of the flow of genetic information and, more specifically,
the genetic code in Figure 11.40, answer the following questions (1517).
15. Assume that cancer results from a point mutation in DNA, which changes the
second nucleotide of the codon CGG. This results in a change of an amino acid
(or an amino acid substitution) in a key small protein. In this experiment you
will find out what the mutation is and address its consequences. (10 marks)
a. What amino acid(s) do the codons CGG, CGC, and CAG specify?

b. Which amino acid is incorporated into the protein in the cancer cell when
the codon CGG is mutated to CAG?

c. The following mRNA was translated from a person with cancer. Find the
same base mutation in the following sequence from a cancer cell. (Hint:

TRU Open Learning

Assignment 4

Find the start and stop codons and translate the mRNA into protein.)
Show your work.
CCCAAAUGGAACCGGGCAUUCAGGUAACCUAGCCC

d. Speculate about the consequences of this amino acid substitution in terms


of protein function?

16. A double-stranded DNA molecule with the sequence shown here produces,
in vivo, a polypeptide that is five amino acids long. (10 marks)
TACATGATCATTTCACGGAATTTCTAGCATGTA
ATGTACTAGTAAAGTGCCTTAAAGATCGTACAT1
a. Which strand of DNA is transcribed and in which direction? Show your
reasoning. (Hint: Since the 5 to 3 polarity of the strands is not given,
there are four possibilities: the top strand could be read [or transcribed]
from left to right; the top strand could be read from right to left; the
bottom strand could be read from left to right; or the bottom strand could
be read from right to left. Only one of the four RNA products encodes a
five-amino acid peptide.)

b. Draw the corresponding mRNA sequence and use the genetic code to
derive the amino acid sequence of the 5 amino-acid peptide that is
produced.

17. (10 marks)


a. Use the genetic code to complete the following table. Assume that reading
is from left to right and that the columns represent transcriptional and

From Question 32, p. 348, Griffiths, A., Wessler, S., Lewotin, R., and Carrol, S. 2008. Introduction
to Genetic Analysis, 9th ed. New York: W. H. Freeman and Company.
1

TRU Open Learning

BIOL 2131: Cell and Molecular Biology

translational alignments. (Hint: Note that the DNA coding strand has the
same sequence as the mRNA, except that it contains Ts instead of Us. The
coding strand also has the same 5 to 3 polarity as the mRNA.)

b. Label the 5 and 3 ends of the DNA and RNA, as well as the amino and
carboxyl ends of the peptide.2

DNA double helix


T
C

mRNA transcribed
G

Trp

Appropriate tRNA
anticodon
Amino acids
incorporated into
peptide

From Question 1, p. 346, Griffiths, A., Wessler, S., Lewotin, R., and Carrol, S. 2008. Introduction to
Genetic Analysis, 9th ed. W.H. Freeman and Company, New York.
2

TRU Open Learning

You might also like