Agrobacterium Protocols

Methods in
Molecular Biology 1224
Kan Wang Editor
Agrobacterium
Protocols
Volume 2
Third Edition
METHODS
IN
M O L E C U L A R B I O LO G Y
Series Editor
John M. Walker
School of Life and Medical Sciences
University of Hertfordshire
Hatfield, Hertfordshire, AL10 9AB, UK
For further volumes:

http://www.springer.com/series/7651
Agrobacterium Protocols
Volume 2
Third Edition
Edited by
Kan Wang
Center for Plant Transformation, Plant Sciences Institute, and Department of Agronomy,
Iowa State University, Ames, IA, USA
Editor
Kan Wang
Center for Plant Transformation
Plant Sciences Institute
Department of Agronomy
Iowa State University
Ames, IA, USA
ISSN 1064-3745
ISSN 1940-6029 (electronic)
ISBN 978-1-4939-1657-3
ISBN 978-1-4939-1658-0 (eBook)
DOI 10.1007/978-1-4939-1658-0
Springer New York Heidelberg Dordrecht London
Library of Congress Control Number: 2014950243
Springer Science+Business Media New York 2015
This work is subject to copyright. All rights are reserved by the Publisher, whether the whole or part of the material is
concerned, specifically the rights of translation, reprinting, reuse of illustrations, recitation, broadcasting, reproduction
on microfilms or in any other physical way, and transmission or information storage and retrieval, electronic adaptation,
computer software, or by similar or dissimilar methodology now known or hereafter developed. Exempted from this
legal reservation are brief excerpts in connection with reviews or scholarly analysis or material supplied specifically for
the purpose of being entered and executed on a computer system, for exclusive use by the purchaser of the work.
Duplication of this publication or parts thereof is permitted only under the provisions of the Copyright Law of the
Publishers location, in its current version, and permission for use must always be obtained from Springer. Permissions
for use may be obtained through RightsLink at the Copyright Clearance Center. Violations are liable to prosecution
under the respective Copyright Law.
The use of general descriptive names, registered names, trademarks, service marks, etc. in this publication does not
imply, even in the absence of a specific statement, that such names are exempt from the relevant protective laws and
regulations and therefore free for general use.
While the advice and information in this book are believed to be true and accurate at the date of publication, neither
the authors nor the editors nor the publisher can accept any legal responsibility for any errors or omissions that may be
made. The publisher makes no warranty, express or implied, with respect to the material contained herein.
Printed on acid-free paper
Humana Press is a brand of Springer
Springer is part of Springer Science+Business Media (www.springer.com)
Dedication
To Marc Van Montagu and Jeff Schell (19352003), my Ph.D. mentors, for their inspiration and encouragement.
Preface
Agrobacterium tumefaciens is a soil bacterium that for more than a century has been known as
a pathogen causing the plant crown gall disease. Unlike many other pathogens, Agrobacterium
is able to deliver DNA to plant cells and permanently alter the plant genome. The discovery of
this unique feature has provided plant scientists with a powerful tool to genetically transform
plants for both basic research purposes and for agricultural advancement.
The first transgenic plants were reported a little over 30 years ago in 1983 by three
independent research groups. Using disarmed Agrobacterium vectors, these groups produced antibiotic-resistant transgenic tobacco Nicotiana tobaccum (Herrera-Estralla et al.,
1983, Nature 303: 209), Nicotiana plumbaginifolia (Bevan et al., 1983, Nature 304: 184),
and petunia (Petunia hybrid, Fraley et al., 1983, Proceedings of the National Academy of
Sciences 80: 4803). The three scientists who led the landmark work, Marc Van Montagu,
Mary-Dell Chilton, and Robert Fraley, were the laureates for the 2013 World Food Prize
(http://www.worldfoodprize.org/en/laureates/2013_laureates/#StatementAchievem
ent). As the statement of achievement of the World Food Prize says, each conducted
groundbreaking molecular research on how a plant bacterium could be adapted as a tool to
insert genes from another organism into plant cells, which could produce new genetic lines
with highly favorable traits.
While other methods such as biolistic gun, electroporation or polyethylene glycol can
also be used for introducing DNA molecules into plant cells, the Agrobacterium-mediated
transformation method remains the method of choices for most plant species in many laboratories due to its efficiency and its propensity to generate single or a low copy number of
integrated transgenes with defined ends.
When the first edition of Agrobacterium Protocols was published in 1995, exactly 20
years ago, only a handful of plants could be routinely transformed using Agrobacterium.
The second edition, which was published in 2006, collected transformation protocols for
59 plant species. In this third edition, we have updated protocols for 32 plant species from
the second edition and added protocols for 17 new species. Together with the first and
second editions, these two new volumes offer Agrobacterium-mediated genetic transformation protocols for a total of 76 plant species.
The third edition of Agrobacterium Protocols contains 57 chapters (two volumes)
divided into 9 parts. This edition emphasizes on agricultural crops or plant species with
economic values. For a number of important plants such as rice, barley, wheat, and citrus,
multiple protocols using different starting plant materials for transformation are included.
Like the second edition, plants are grouped according to their practical uses rather than
their botanical classifications.
Agrobacterium Protocols provides a benchtop manual for tested protocols involving
Agrobacterium-mediated transformation. All chapters are written in the same format as that
used in the Methods in Molecular Biology series. Each chapter is contributed by authors
who are leaders or veterans in their respective areas. The Abstract and Introduction
sections provide outlines of protocols, the rationale for selection of particular target tissues,
and information regarding overall transformation efficiency. The Materials section lists
the host materials, Agrobacterium strains and vectors, stock solutions, media, and other
vii
viii
Preface
supplies necessary for carrying out these transformation experiments. The Methods section
is the core of each chapter. It provides a step-by-step description of the entire transformation procedure from the preparation of starting materials to the harvest of transgenic plants.
To ensure the reproducibility of each protocol, the Notes section lists possible pitfalls in
the protocol and suggests alternative materials or methods for generating transgenic plants.
Typically, most laboratories only work on one or a few plant species. Each laboratory or
individual researcher has his or her own favorite variation or modification of any given plant
transformation protocol. The protocols presented in this edition represent the most efficient methods used in the laboratories of the contributors. They are by no means the only
methods for successful transformation of your plant of interest.
The broad range of target tissue selection and in vitro culture procedures indicate the
complexity in plant transformation. It is the intention of this book to facilitate the transfer
of this rapidly developing technology to all researchers for use in both fundamental and
applied biology. I take this opportunity to thank all my colleagues whose time and effort
made this edition possible. Special thanks go to my family for their unconditional love and
support during the process of editing this book.
Ames, IA, USA
Kan Wang
Contents
Preface. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
Contributors . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
PART I
INDUSTRIAL PLANTS
1 Brassica rapa. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
Tom Lawrenson, Cassandra Goldsack, Lars Ostergaard,
and Penny A.C. Hundleby ne Sparrow
2 Cotton (Gossypium hirsutum L.) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
Keerti S. Rathore, LeAnne M. Campbell, Shanna Sherwood,
and Eugenia Nunes
3 Jatropha (Jatropha curcas L.). . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
Devendra Kumar Maravi, Purabi Mazumdar, Shamsher Alam,
Vaibhav V. Goud, and Lingaraj Sahoo
4 Sesame (Sesamum indicum L.) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
Sonia Kapoor, Sanjay S. Parmar, Manju Yadav, Darshna Chaudhary,
Manish Sainger, Ranjana Jaiwal, and Pawan K. Jaiwal
5 Sunflower (Helianthus annuus L.). . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
Laura M. Radonic, Dalia M. Lewi, Nilda E. Lpez, H. Esteban Hopp,
Alejandro S. Escandn, and Marisa Lpez Bilbao
PART II
11
25
37
47
ROOT PLANTS
6 Carrot (Daucus carota L.) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

Owen S.D. Wally and Zamir K. Punja
7 Cassava (Manihot esculenta Crantz) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
Simon E. Bull
8 Potato (Solanum tuberosum L.) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
Venkateswari J. Chetty, Javier Narvez-Vsquez,
and Martha L. Orozco-Crdenas
9 Taro (Colocasia esculenta (L.) Schott) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
Xiaoling He, Susan C. Miyasaka, Maureen M.M. Fitch, and Yun J. Zhu
PART III
vii
xiii
59
67
85
97
NUTS AND FRUITS
10 Apricot (Prunus armeniaca L.) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

Csar Petri, Nuria Alburquerque, and Lorenzo Burgos
11 Blueberry (Vaccinium corymbosum L.). . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
Guo-Qing Song
ix
111
121
Contents
12 Cherry . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
Guo-Qing Song
13 Chestnut, American (Castanea dentata (Marsh.) Borkh.) . . . . . . . . . . . . . . . .
Charles A. Maynard, Linda D. McGuigan, Allison D. Oakes,
Bo Zhang, Andrew E. Newhouse, Lilibeth C. Northern,
Allison M. Chartrand, Logan R. Will, Kathleen M. Baier,
and William A. Powell
14 Chestnut, European (Castanea sativa) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
Elena Corredoira, Silvia Valladares, Ana M. Vieitez,
and Antonio Ballester
15 Grapevine (Vitis vinifera L.) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
Laurent Torregrosa, Sandrine Vialet, Anglique Adivze,
Pat Iocco-Corena, and Mark R. Thomas
16 Melon (Cucumis melo) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
Satoko Nonaka and Hiroshi Ezura
17 Peach (Prunus persica L.) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
Silvia Sabbadini, Tiziana Pandolfini, Luca Girolomini,
Barbara Molesini, and Oriano Navacchi
18 Strawberry (Fragaria ananassa) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
Roberto Cappelletti, Silvia Sabbadini, and Bruno Mezzetti
19 Walnut (Juglans) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
Charles A. Leslie, Sriema L. Walawage, Sandra L. Uratsu,
Gale McGranahan, and Abhaya M. Dandekar
PART IV
143
163
177
195
205
217
229
TROPIC PLANTS
20 Citrus Transformation Using Juvenile Tissue Explants. . . . . . . . . . . . . . . . . . .

Vladimir Orbovi and Jude W. Grosser
21 Citrus Transformation Using Mature Tissue Explants . . . . . . . . . . . . . . . . . . .
Vladimir Orbovi, Alka Shankar, Michael E. Peeples,
Calvin Hubbard, and Janice Zale
22 Coffee (Coffea arabica L.) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
Eveline Dchamp, Jean-Christophe Breitler, Thierry Leroy,
and Herv Etienne
23 Pineapple [Ananas comosus (L.) Merr.] . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
Gaurab Gangopadhyay and Kalyan K. Mukherjee
24 Sugarcane (Saccharum Spp. Hybrids) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
Hao Wu and Fredy Altpeter
PART V
133
245
259
275
293
307
OTHER IMPORTANT PLANTS
25 Hemp (Cannabis sativa L.). . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

Mistianne Feeney and Zamir K. Punja
26 Orchids (Oncidium and Phalaenopsis) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
Chia-Wen Li, Chia-Hui Liao, Xia Huang, and Ming-Tsair Chan
319
331
Contents
xi
27 Poinsettia (Euphorbia pulcherrima Willd. ex Klotzsch). . . . . . . . . . . . . . . . . . .

M. Ashraful Islam, Tage Thorstensen, and Jihong Liu Clarke
28 Populus trichocarpa . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
Quanzi Li, Ting-Feng Yeh, Chenmin Yang, Jingyuan Song,
Zenn-Zong Chen, Ronald R. Sederoff, and Vincent L. Chiang
29 Tall Fescue (Festuca arundinacea Schreb.). . . . . . . . . . . . . . . . . . . . . . . . . . . .
Yaxin Ge and Zeng-Yu Wang
347
Index . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
373
357
365
Contributors
ANGLIQUE ADIVZE Montpellier SupAgro-INRA, UMR AGAPGenetic Improvement
and Adaptation of Mediterranean and Tropical Plants, Montpellier Cedex, France
SHAMSHER ALAM Department of Biotechnology, Indian Institute of Technology Guwahati,
Guwahati, India
NURIA ALBURQUERQUE Grupo de Biotecnologa de Frutales, Departamento de Mejora,
CEBAS-CSIC, Murcia, Spain
FREDY ALTPETER Plant Molecular and Cellular Biology Program, Agronomy Department,
Genetics Institute, University of Florida, Gainesville, FL, USA
KATHLEEN M. BAIER Department of Environmental and Forest Biology, SUNY College
of Environmental Science and Forestry, Syracuse, NY, USA
ANTONIO BALLESTER Instituto de Investigaciones Agrobiolgicas de Galicia, IIAG, CSIC,
Santiago de Compostela, Spain
JEAN-CHRISTOPHE BREITLER Centre de Coopration Internationale en Recherche
Agronomique pour le Dveloppement, UMR RPB, Montpellier, France
SIMON E. BULL Plant Biotechnology Group, ETH Zurich, Universitaetstrasse,
Zurich, Switzerland
LORENZO BURGOS Grupo de Biotecnologa de Frutales, Departamento de Mejora,
LEANNE M. CAMPBELL Institute for Plant Genomics and Biotechnology, Texas A&M
University, College Station, TX, USA
ROBERTO CAPPELLETTI Department of Agriculture, Food and Environmental Sciences,
Universit Politecnica delle Marche, Ancona, Italy
MING-TSAIR CHAN Academia Sinica Biotechnology Center, Tannan, Taiwan; Academia
Sinica Agricultural Biotechnology Research Center, Taipei, Taiwan
ALLISON M. CHARTRAND Horn Performance and Environmental Science, Northwestern
University, Evanston, IL, USA
DARSHNA CHAUDHARY Centre for Biotechnology, M. D. University, Rohtak, India
ZENN-ZONG CHEN Division of Silviculture, Taiwan Forestry Research Institute,
Taipei, Taiwan
VENKATESWARI J. CHETTY Plant Transformation Research Center, University of California
Riverside, Riverside, CA, USA
VINCENT L. CHIANG Forest Biotechnology Group, Department of Forestry, North Carolina
State University, Raleigh, NC, USA
JIHONG LIU CLARKE Bioforsk- Norwegian Institute for Agricultural and Environmental
Research, s, Norway
ELENA CORREDOIRA Instituto de Investigaciones Agrobiolgicas de Galicia, IIAG,
CSIC, Santiago de Compostela, Spain
ABHAYA M. DANDEKAR Plant Science Department, University of California, Davis,
CA, USA
EVELINE DCHAMP Centre de Coopration Internationale en Recherche Agronomique
pour le Dveloppement, UMR RPB, Montpellier, France
xiii
xiv
Contributors
ALEJANDRO S. ESCANDN Instituto de Gentica Ewald A. Favret, Instituto Nacional

de Tecnologa Agropecuaria, Castelar, Buenos Aires, Argentina
HERV ETIENNE Centre de Coopration Internationale en Recherche Agronomique pour
le Dveloppement, UMR RPB, Montpellier, France
HIROSHI EZURA University of Tsukuba, Tsukuba, Ibaraki, Japan
MISTIANNE FEENEY School of Life Sciences, University of Warwick, Coventry, UK
MAUREEN M.M. FITCH Hawaii Agriculture Research Center, Kunia, HI, USA
GAURAB GANGOPADHYAY Division of Plant Biology, Bose Institute, Kolkata, India
YAXIN GE Forage Improvement Division, The Samuel Roberts Noble Foundation,
Ardmore, OK, USA
LUCA GIROLOMINI Scienze Agrarie, Alimentari ed Ambientali D3A, Universit
Politecnica delle Marche, Ancona, Italy
CASSANDRA GOLDSACK Department of Crop Genetics, John Innes Centre,
Norwich Research Park, Norwich, UK
VAIBHAV V. GOUD Center for Energy and Department of Chemical Engineering,
Indian Institute of Technology Guwahati, Guwahati, India
JUDE W. GROSSER Citrus Research and Education Center, University of Florida/IFAS,
Lake Alfred, FL, USA
XIAOLING HE Hawaii Agriculture Research Center, Kunia, HI, USA
H. ESTEBAN HOPP Instituto de Biotecnologa, Instituto Nacional de Tecnologa
Agropecuaria, Castelar, Buenos Aires, Argentina
XIA HUANG Sun Yat-sen University, Guangzhou, The Peoples Republic of China
CALVIN HUBBARD Citrus Research and Education Center, University of Florida/IFAS,
PENNY A.C. HUNDLEBY NE SPARROW Department of Crop Genetics, John Innes Centre,
Norwich Research Park, Norwich, UK
PAT IOCCO-CORENA Horticulture Unit, CSIRO Plant Industry, Glen Osmond,
SA, Australia
M. ASHRAFUL ISLAM Department of Horticulture, Bangladesh Agricultural University,
Mymensingh, Bangladesh
RANJANA JAIWAL Department of Zoology, M. D. University, Rohtak, India
PAWAN K. JAIWAL Centre for Biotechnology, M. D. University, Rohtak, India
SONIA KAPOOR Centre for Biotechnology, M. D. University, Rohtak, India; University
Institute of Engineering and Technology, M. D. University, Rohtak, India
TOM LAWRENSON Department of Crop Genetics, John Innes Centre, Norwich Research
Park, Norwich, UK
THIERRY LEROY Centre de Coopration Internationale en Recherche Agronomique pour
le Dveloppement, UMR AGAP, Montpellier, France
CHARLES A. LESLIE Plant Sciences Department, University of California Davis, Davis,
CA, USA
DALIA M. LEWI Instituto de Gentica Ewald A. Favret, Instituto Nacional de Tecnologa
CHIA-WEN LI Department of Biotechnology, TransWorld University, Douliu City,
Yunlin, Taiwan
QUANZI LI State Key Laboratory of Tree Genetics and Breeding, Chinese Academy of
Forestry, Beijing, China; College of Forestry, Shandong Agricultural University, Taian,
Shandong, China
CHIA-HUI LIAO Academia Sinica Biotechnology Center in Southern Taiwan, Tainan,
Taiwan; Academia Sinica Agricultural Biotechnology Research Center, Taipei, Taiwan
Contributors
xv
MARISA LPEZ BILBAO Instituto de Biotecnologa, Instituto Nacional de Tecnologa

NILDA E. LPEZ Instituto de Biotecnologa, Instituto Nacional de Tecnologa
DEVENDRA KUMAR MARAVI Center for Energy, Indian Institute of Technology Guwahati,
Guwahati, India
CHARLES A. MAYNARD Department of Forest and Natural Resources Management,
SUNY College of Environmental Science and Forestry, Syracuse, NY, USA
PURABI MAZUMDAR Center for Energy, Indian Institute of Technology Guwahati,
Guwahati, India
GALE MCGRANAHAN Plant Science Department, University of California, Davis, CA, USA
LINDA D. MCGUIGAN Department of Forest and Natural Resources Management,
BRUNO MEZZETTI Department of Agriculture, Food and Environmental Sciences,
Universit Politecnica delle Marche, Ancona, Italy
SUSAN C. MIYASAKA Department of Tropical Plant and Soil Sciences, University of Hawaii,
Hilo, HI, USA
BARBARA MOLESINI Dipartimento di Biotecnologie, Universit di Verona, Verona, Italy
KALYAN K. MUKHERJEE Division of Plant Biology, Bose Institute, Kolkata, India
JAVIER NARVEZ-VSQUEZ Plant Transformation Research Center, University of California
Riverside, Riverside, CA, USA
ORIANO NAVACCHI Vitroplant Italia, Cesena, Italy
ANDREW E. NEWHOUSE Department of Environmental and Forest Biology, SUNY College
SATOKO NONAKA University of Tsukuba, Tsukuba, Ibaraki, Japan
LILIBETH C. NORTHERN Department of Environmental and Forest Biology, SUNY College
EUGENIA NUNES Faculty of Science, The University of Porto, Porto, Portugal
ALLISON D. OAKES Department of Environmental and Forest Biology, SUNY College
VLADIMIR ORBOVI Citrus Research and Education Center, University of Florida/IFAS,
MARTHA L. OROZCO-CRDENAS Plant Transformation Research Center, University
of California Riverside, Riverside, CA, USA
LARS OSTERGAARD Department of Crop Genetics, John Innes Centre, Norwich Research
Park, Norwich, UK
TIZIANA PANDOLFINI Dipartimento di Biotecnologie, Universit di Verona, Verona, Italy
SANJAY S. PARMAR Centre for Biotechnology, M. D. University, Rohtak, India
MICHAEL E. PEEPLES Citrus Research and Education Center, University of Florida/IFAS,
CSAR PETRI Grupo de Biotecnologa de Frutales, Departamento de Mejora,
WILLIAM A. POWELL Department of Environmental and Forest Biology, SUNY College
ZAMIR K. PUNJA Department of Biological Sciences, Simon Fraser University, Burnaby,
BC, Canada
LAURA M. RADONIC Instituto de Biotecnologa, Instituto Nacional de Tecnologa
xvi
Contributors
KEERTI S. RATHORE Institute for Plant Genomics and Biotechnology, Texas A&M University,
College Station, TX, USA; Department of Soil and Crop Sciences, Texas A&M University,
College Station, TX, USA
SILVIA SABBADINI Scienze Agrarie, Alimentari ed Ambientali D3A, Universit Politecnica
delle Marche, Ancona, Italy
LINGARAJ SAHOO Center for Energy and Department of Biotechnology, Indian Institute
of Technology Guwahati, Guwahati, India
MANISH SAINGER Centre for Biotechnology, M. D. University, Rohtak, India
RONALD R. SEDEROFF Forest Biotechnology Group, Department of Forestry, North Carolina
ALKA SHANKAR Citrus Research and Education Center, University of Florida/IFAS,
SHANNA SHERWOOD Institute for Plant Genomics and Biotechnology, Texas A&M
University, College Station, TX, USA
GUO-QING SONG Department of Horticulture, Plant Biotechnology Resource
and Outreach Center, Michigan State University, East Lansing, MI, USA
JINGYUAN SONG Institute of Medicinal Plant Development, Chinese Academy of Medical
Sciences and Peking Union Medical College, Beijing, China
MARK R. THOMAS Horticulture Unit, CSIRO Plant Industry, Glen Osmond, SA, Australia
TAGE THORSTENSEN Bioforsk- Norwegian Institute for Agricultural and Environmental
Research, s, Norway
LAURENT TORREGROSA Montpellier SupAgro-INRA, UMR AGAPGenetic Improvement
and Adaptation of Mediterranean and Tropical Plants, Montpellier Cedex, France
SANDRA L. URATSU Plant Science Department, University of California, Davis, CA, USA
SILVIA VALLADARES Instituto de Investigaciones Agrobiolgicas de Galicia, IIAG, CSIC,
SANDRINE VIALET Unit Exprimentale de Pech-Rouge, INRA, UEPR, Gruissan, France
ANA M. VIEITEZ Instituto de Investigaciones Agrobiolgicas de Galicia, IIAG, CSIC,
SRIEMA L. WALAWAGE Plant Science Department, University of California, Davis,
CA, USA
OWEN S.D. WALLY Department of Plant Sciences, University of Manitoba, Winnipeg,
MB, Canada
ZENG-YU WANG Forage Improvement Division, The Samuel Roberts Noble Foundation,
Ardmore, OK, USA
LOGAN R. WILL The American Chestnut Research and Restoration Project,
HAO WU Agronomy Department, Plant Molecular and Cellular Biology Program,
Genetics Institute, University of Florida, Gainesville, FL, USA
MANJU YADAV Centre for Biotechnology, M. D. University, Rohtak, India
CHENMIN YANG Forest Biotechnology Group, Department of Forestry, North Carolina
TING-FENG YEH School of Forestry and Resource Conservation, National Taiwan
University, Taipei, Taiwan
JANICE ZALE Citrus Research and Education Center, University of Florida/IFAS,
BO ZHANG Therapeutic Proteins International, LLC, Chicago, IL, USA
YUN J. ZHU Hawaii Agriculture Research Center, Kunia, HI, USA
Part I
Industrial Plants
Chapter 1
Brassica rapa
Tom Lawrenson, Cassandra Goldsack, Lars Ostergaard,
and Penny A.C. Hundleby ne Sparrow
Abstract
Within this chapter we outline an A. tumefaciens-mediated transformation method for B. rapa using
4-day-old cotyledonary explants and the genotype R-o-18. Transformation efficiencies are typically
achieved in the region of 1 % (based on 2 PCR-positive independent shoots from 200 inoculated explants).
This system has been developed to work with gentamicin selection.
Key words Agrobacterium tumefaciens, Brassica rapa, Diploid, Gentamicin selection, Oilseed,
Transformation
Introduction
Brassica rapa has historically been the most recalcitrant of Brassica
species to transform, with published work focusing on Chiffu, the
genotype of the sequencing program, and other B. rapa pekinensis
genotypes (Chinese cabbage). However, one significant downside
to these genotypes is that they are vegetable types and also highly
self-incompatible. As a transformation resource, the economic cost
of generating enough seed for routine transformation, as well as
the time to hand-pollinate transgenic lines to obtain nextgeneration material, makes these undesirable candidates for routine transformation studies. The B. rapa variety R-o-18 was chosen
as the target genotype for studies in our laboratories as its plant
architecture is similar to B. napus oilseed rape. R-o-18 is derived
from a B. rapa oilseed crop grown in Pakistan and India and is
therefore already a crop in its own right. Moreover, the genotype
is rapid cycling and self-compatible, enabling the production of
large seed stocks to use in transformation studies, as well as generating next-generation transgenic material cost-effectively without
the need for laborious hand pollination. This genotype is also used
as a model B. rapa genotype by a number of research labs, in particular complementing the R-o-18 TILLING resource available via
Kan Wang (ed.), Agrobacterium Protocols: Volume 2, Methods in Molecular Biology, vol. 1224,
DOI 10.1007/978-1-4939-1658-0_1, Springer Science+Business Media New York 2015
Tom Lawrenson et al.
the John Innes Centre (http://revgenuk.jic.ac.uk). In the current

chapter, we describe our protocol for the routine transformation
of R-o-18 using a gentamicin-based selection system. Typically,
transformation efficiencies in the region of 1 % are achieved (based
on 2 PCR-positive independent rooted shoots from 200 inoculated explants).
Materials
2.1 Plant
Culture Media
and Components
1. Vitamins: 10 g/L thiamine-HCl, 1 g/L pyridoxine, 1 g/L

nicotinic acid, and 100 g/L myoinositol. All vitamins are
made up in sterile distilled water (SDW), filter sterilized, and
stored individually at 4 C, with the exception of myoinositol,
which is stored at room temperature.
2. 1-Naphthaleneacetic acid (NAA): 1 mg/mL stock solution.
Prepare by dissolving the powder in 1 M NaOH (50 mg in
100 L). Make to final volume with sterile distilled water
(SDW) and filter sterilize. Store at 4 C.
3. 6-Benzylaminopurine (BAP): 4 mg/mL stock solution.
Dissolve the powder in 1 M NaOH (100 mg in 200 L). Make
to final volume with SDW and filter sterilize. Store at 4 C.
4. Indole-3-butyric acid (IBA): 1 mg/mL stock solution. Prepare
by dissolving the powder in 1 M NaOH (50 mg in 100 L).
Make to final volume with SDW and filter sterilize. Store at 4 C.
5. Gentamicin: 50 mg/mL stock solution. Store at 48 C.
6. Timentin: 160 mg/mL stock solution. Dissolve in SDW, filter
sterilize, and store at 20 C.
7. AgNO3: 20 mg/mL stock solution. Filter sterilize and store
foil-wrapped at 4 C.
8. Germination medium: 4.3 g/L Murashige and Skoog [1]
(MS) basal salts only, 30 g/L Sucrose, pH 5.7, 8 g/L
phytagar. Autoclave at 120 C for 20 min. Prior to pouring
add 1 mL of each of the four vitamin stocks. One liter typically
pours 20 Magenta boxes with 50 mL/Magenta.
9. Callus induction media for cocultivation (CIM-C): As germination medium plus 500 mg/L 2-(N-morpholino)ethanesulfonic acid (MES). MES is a buffering agent, therefore ensure
the pH is adjusted after adding. After autoclaving and before
pouring, add 1 mL each of the four vitamin stocks, 4 mg/L
BAP (1 mL of BAP at 4 mg/mL), and 0.1 mg/L NAA (100 L
of 1 mg/mL NAA). One liter typically pours 20 petri dishes
(20 90 mm).
10. Callus induction medium for selection (CIM-S): As CIM-C
with the addition after autoclaving and before pouring of
160 mg/L Timentin (1 mL of 160 mg/mL stock), 4 mg/L
Brassica rapa
AgNO3 (200 L of the 20 mg/L AgNO3 stock), 10 mg/L

gentamicin (200 L of 50 mg/mL stock). One liter typically pours 20 petri dishes (20 90 mm). Selection is not
included in the control plates (a single control plate can be
poured before gentamicin is added to the medium for the
other plates).
11. Shoot induction selection media: 1 L MS basal medium plus
500 mg/L MES. After autoclaving and before pouring, add
4 mg/L BAP (1 mL of BAP stock at 4 mg/mL), 160 mg
Timentin (1 mL of 160 mg/mL stock), 4 mg/L AgNO3
(200 L of AgNO3 at 20 mg/mL), 10 mg/L gentamicin
(200 L gentamicin at 50 mg/mL), 1 mL each of the four
vitamin stocks. No gentamicin is added to control plates.
12. Shoot elongation selection medium: 3.05 g/L Gamborgs B5
salts, 30 g/L sucrose, pH 5.7, 8 g/L phytagar. Autoclave at
120 C for 20 min. Prior to pouring add 1 mL each of the four
vitamin stocks, 0.05 mg/L BAP (12.5 L of 4 mg/mL stock),
160 mg/L Timentin (1 mL of 160 mg/mL stock), 4 mg/L
AgNO3 (200 L of 20 mg/mL stock), and 10 mg/L gentamicin (200 L of 50 mg/mL stock). No gentamicin in control
plates.
13. Rooting media based on Gamborgs B5 medium [2]: 3.05 g/L
Gamborgs B5 salts, 10 g/L sucrose, pH5.7, 8 g/L phytagar.
Autoclave at 120 C for 20 min. Prior to pouring add 1 mg/L
IBA (1 mL of 1 mg/mL stock), gentamicin 10 mg/L (200 L
of 50 mg/mL stock), and Timentin 160 mg/L (1 mL of
160 mg/mL stock). No gentamicin is added to control jars.
2.2 Agrobacterium
Culture Media
1. LB medium: 5 g/L yeast extract, 10 g/L NaCl, 10 g/L peptone 15 g/L Bacto agar (for solid/liquid medium); autoclave at 120 C for 20 min.
2. 20 AB salts: To prepare 1 L, add 20 g NH4Cl, 6 g
MgSO4 7H2O, 3 g KCl, 0.26 g CaCl2 H2O, and 0.05 g
FeSO4 7H2O in SDW. Store at 20 oC in 50 mL aliquots.
3. Induction media: To prepare 200 mL, add 10 mL 20 AB
salts, 4 g glucose, 1.18 g MES, 0.06 g NaH2PO4, and 0.06 g
Na2HPO4 in SDW. Adjust pH to 5.6 with 1 M NaOH. Filter
sterilize and store at 4 C for up to 1 month.
4. Acetosyringone (20 mg/mL in dimethyl sulfoxide). Aliquot
into 20 L volumes and store at 20 C.
2.3
Seed Source
R-o-18 is an inbred line of the Brassica rapa subsp. trilocularis

(yellow sarson) with transparent seed coat [3] closely related to B.
rapa oilseed crops grown in Pakistan [4]. Seeds can be obtained by
contacting Lars stergaard on email: lars.ostergaard@jic.ac.uk.
2.4 Other Supplies

and Reagents
1. Sterilizing solution: 15 % sodium hypochlorite (BDH

Chemicals), plus 0.1 % of surfactant Tween 20.
2. Soil: John Innes No. 2 commercial compost.
3. Perforated bread bags: supplied by Cryovac (UK) Ltd.
4. Phytagar: supplied by Duchefa (P1003).
5. Timentin: sold as ticarcillin disodium/clavulanate potassium
(Duchefa T0190).
6. Sterile peat pots: Sterile peat pots (Jiffy No. 7) are placed into
Magenta pots (Sigma), and soaked in water until fully
expanded. Excess water is poured off and Magentas autoclaved at 120 C for 20 min.
Methods
The protocol described below is applicable to B. rapa genotype
R-o-18. Transformation is based on a previously reported method
for B. napus [5].
3.1 Seed
Sterilization
and Germination
1. Seeds are sterilized by immersion in 70 % ethanol for 2 min

prior to treating with 15 % sodium hypochlorite commercial
bleach/0.01 % Tween 20 for 15 min, and washed in SDW
three times.
2. Seeds are transferred to the surface of germination medium
in Magentas at a density of 25 seeds per Magenta pot.
Magentas are then maintained in a 23 C growth room
with 16/24 light hours regime at 40 mol/m2/s for 4 days
(see Note 1).
3.2 Agrobacterium
Preparation
1. Agrobacterium strain AGL1 is transformed by electroporation

with the construct of interest using a suitable bacterial selectable marker (see Notes 2 and 3).
2. Single colonies are used to inoculate liquid cultures which are
subsequently used to make glycerol stocks for use as inoculum
(standard inoculum) and to confirm integrity of the construct
of interest. The latter is done via plasmid miniprep of the
Agrobacterium suspension and transformation into E. coli in
order to obtain a sufficient quantity of DNA to confirm by
restriction digest.
3. Glycerol stocks are composed of 20 % glycerol and 80 % LB
Agrobacterium culture. Sterility during all stages of preparation as well as subsequent inoculation is of utmost importance
to avoid contamination of tissue culture material.
4. The standard inoculum is stored at 70 C and used to initiate
fresh 10 mL LB cultures 48 h prior to explant isolation/
inoculation.
Brassica rapa
5. Twenty-four hours after inoculation with standard inoculum,

the LB should be visibly turbid and ready to induce.
6. 5 mL of the resulting suspension is pelleted in a microfuge at
full speed for 10 s, and then resuspended in 5 mL of induction
medium (pre-warmed to room temperature). A fresh aliquot
of acetosyringone (at 20 mg/mL) is defrosted, and 5 L of
this is added to give a concentration of 20 mg/L.
7. The suspension is then incubated in a shaker at 22 C for
1620 h in darkness.
8. Directly before the inoculation is made, cells are diluted to
OD650 = 0.3 using induction media.
3.3 Explant
Isolation, Inoculation,
and Cocultivation
1. Cotyledonary petioles are isolated from 4-day-old seedlings.

Cotyledons are cut with a sharp scalpel at the point indicated
in Fig. 1ac maximizing the length of the petiole extending
from the cotyledons, but not so much as to prevent the separation of the two cotyledons with a single cut. If the cut is made
too far from the cotyledons and they do not cleanly separate,
then apical meristem tissue will be included in the explant
leading to regeneration of escape shoots.
2. The explants are immediately moved to CIM-C plates with
just the cut end of the petiole imbedded. Ten explants are held
on each plate.
3. When all explants are held on CIM-C plates, inoculation with
the Agrobacterium harboring the construct of interest is carried out by dipping the cut end of the petiole into an
Agrobacterium suspension.
4. One plate should remain without inoculation to be used as a
regeneration control. Explants are then returned to the same
CIM-C plates which are then sealed with Micropore tape and
moved to a growth room at 23 C with 16/8 light hours
regime at 40 mol/m2/s for 72 h.
3.4
Selection
1. After 72 h explants are moved to CIM-S plates with the exception of the two control plates (one inoculated and the other
not exposed to Agrobacterium) which are moved to fresh
CIM-C plates.
2. Plates are returned to the same growth conditions for a further
48 h, before being transferred to shoot induction medium
(with the two controls moved to shoot induction with no
selection). At this point the shallow lid of the tissue culture
dish is replaced with a deeper base of a fresh dish, and the two
are joined with Micropore tape (see Note 4).
3. On day 11 (after explant isolation), explants are moved to shoot
elongation selection media, retaining the base-lid format.
Explants are moved to fresh shoot elongation selection media
Fig. 1 Stages in Agrobacterium-mediated Brassica rapa transformation. Four-day-old R-o-18 seedlings ready
for explant isolation, showing (a) excision line, (b) scalpel about to make cut, and (c) explant with correct petiole length. Explant cultures 14 days after isolation/inoculation seen from the basal side of plate showing (d)
control explants; no Agrobacterium inoculation and no gentamicin selection, (e) control explants; inoculated
but maintained in the absence of selection and (f) inoculated explants maintained on gentamicin selection.
Explant cultures 3 weeks after isolation/inoculation seen from the top side of plate showing (g) proliferation of
shoots in control explants where no inoculation or gentamicin selection was used; (h) proliferation of shoots in
control explants inoculated but where no gentamicin selection has been applied; and (i) inoculated explants on
gentamicin selection with one putative transgenic shoot (circled); (j) an enlarged view of the marked shoot in
(i). Shoots isolated and moved to rooting media at approximately 4 weeks postinoculation (k) and root development after a further 2 weeks (l)
Brassica rapa
after a further 1014 days (maximum). There is a gradual

increase in the size of the petiole base around the cut surface,
from the time of isolation, as callus begins to form.
4. Two weeks after isolation, inoculated petioles will be in the
region of 5 mm in diameter when on selection media (larger
and more developed on nonselective controls). Typically,
viewing from the base, inoculated petioles have a green center
with a white surround under selection conditions and in the
nonselective controls will be all green (Fig. 1df). A small
amount of browning is normal between 14 and 21 days.
3.5
Shoot Isolation
1. When using R-o-18, the emergence of green shoots on control plates (no selection) occurs between 14 and 21 days after
explant isolation (Fig. 1g, h), with 90100 % of explants producing shoots. Transgenic (green) shoots can be seen from 3
weeks onward on selection plates (Fig. 1i, j). From 3 weeks
transgenic shoots can be isolated to rooting media (Fig. 1k).
The period when most transgenic shoots are likely to appear is
between 21 days and 1 month after inoculation.
2. Putative transgenic (green) shoots are excised and transferred
to 100 mL jars containing 25 mL of rooting medium using the
base of 50 mm petri dishes (Sterilin 124) as lids and maintained
at 23 C under 16-h day length of 40 mol/m2/s (see Note 5).
3. After root elongation (Fig. 1l) (to approximately 20 mm in
length), plantlets are transferred to sterile peat pots to allow
further root growth (approx. 2 weeks) before being transferred to the glasshouse (see Note 6).
3.6 Transfer of
Plants to Greenhouse
1. Plants are transferred to soil in 9 cm pots (John Innes No. 2)

and maintained under shade within a propagator for the first
week. This ensures that plants gradually adjust to reduced
humidity and increased light intensity. Glasshouse light conditions; day/night temperatures of 18/12 2 C, 16-h day
length, with supplementary lighting (high pressure sodium
lamps with an average bench reading of 200 mol/m2/s).
Plants are fed weekly with a 2:1:1 NPK fertilizer.
2. After 3 weeks, plants are potted up into 2 L containers under
long day conditions (16 h light, 8 h dark) and 1820 C. R-o18 will flower after 68 weeks, and seeds can be harvested after
2025 weeks. The time can be shortened if grown in smaller
pots but the seed yield is often reduced.
3. When in bud, plants are covered with clear, perforated bread
bags to prevent cross-pollination and shaken daily once in
flower to encourage seed set. Pods are allowed to dry on the
plant, before being threshed.
10
Notes
1. Typically, 1.2 g of seed is enough for a 300 explant transformation. Seed should be placed onto the surface of the medium
and not embedded.
2. AGL1 is the Agrobacterium tumefaciens strain routinely used
in our lab.
3. We used a plant selection cassette consisting of a double 35S
promoter driving the aacC1 coding region with a CaMV terminator to provide gentamicin resistance.
4. Using large petri dishes (20 90 mm) and the deeper base as a
lid gives a larger vessel volume which helps prevent the accumulation of ethylene and water vapor. Sealing with Micropore
tape also helps with better gas exchange. We have found that
these changes result in a less stressful environment, leading to
healthier shoots.
5. It may be possible to omit the inclusion of gentamicin at the
root induction stage, as the number of escapes making it
through to this stage will be few; however, we recommend
that you confirm transgene presence by PCR.
6. R-o-18 plants are often on the verge of flowering during the
rooting period in peat pots. To reduce the risk of flowering,
the time spent in vitro once roots are established and moving
to the greenhouse should be kept as short as possible. Once
established in greenhouse pots, early flowers may fail to set,
but plants should gather vigor to produce fruit.
Acknowledgments
The authors acknowledge the support of the Biotechnology and
Biological Science Research Council (BBSRC) Strategic Tools and
Resources Grant BB/I023763/1 Development of an efficient B.
rapa transformation system to facilitate studies on fruit development in a diploid Brassica oilseed crop and further support by
BBSRC Strategic Programme Grant B/J004588/1 (GRO) and
the John Innes Foundation.
References
1. Murashige T, Skoog F (1962) A revised medium
for rapid growth and bioassays and tobacco tissue
culture. Physiol Plant 15:437497
2. Gamborg OL, Miller RB, Ojima K (1968)
Nutrient requirements of suspension cultures of
soybean root cells. Exp Cell Res 50:151158
3. Rusholme RL, Higgins EE, Walsh JA, Lydiate
DJ (2007) Genetic control of broad-spectrum
resistance to turnip mosaic virus in Brassica rapa
(Chinese cabbage). J Gen Virol 88:31773186
4. Rana D, van den Boogaart T, ONeill C,

Hynes L, Bent E, Macpherson L, Park JY, Lim
YP, Bancroft I (2004) Conservation of the
microstructure of genome segments in Brassica
napus and its diploid relatives. Plant J 40:
725733
5. Moloney MM, Walker JM, Sharma KK (1989)
High-efficiency transformation of Brassica
napus using Agrobacterium vectors. Plant Cell
Rep 8:238242
Chapter 2
Cotton (Gossypium hirsutum L.)
Keerti S. Rathore, LeAnne M. Campbell, Shanna Sherwood,
and Eugenia Nunes
Abstract
Cotton continues to be a crop of great economic importance in many developing and some developed
countries. Cotton plants expressing the Bt gene to deter some of the major pests have been enthusiastically
and widely accepted by the farmers in three of the major producing countries, i.e., China, India, and the
USA. Considering the constraints related to its production and the wide variety of products derived from
the cotton plant, it offers several target traits that can be improved through genetic engineering. Thus,
there is a great need to accelerate the application of biotechnological tools for cotton improvement. This
requires a simple, yet robust gene delivery/transformant recovery system. Recently, a protocol, involving
large-scale, mechanical isolation of embryonic axes from germinating cottonseeds followed by direct transformation of the meristematic cells has been developed by an industrial laboratory. However, complexity
of the mechanical device and the patent restrictions are likely to keep this method out of reach of most
academic laboratories. In this chapter, we describe the method developed in our laboratory that has undergone further refinements and involves Agrobacterium-mediated transformation of cotton cells, selection of
stable transgenic callus lines, and recovery of plants via somatic embryogenesis.
Key words Agrobacterium, Regeneration, Somatic embryogenesis, Transformation, Transgenic
cotton
Introduction
Cotton, the most important source of natural fiber worldwide, is
grown in more than 80 countries across five continents. Compared
to the synthetic fibers, cotton provides some major environmental/societal benefits. Firstly, unlike the petroleum-based synthetics,
it is a renewable resource. Secondly, its cultivation, processing, and
use in textile manufacturing provide for the livelihoods of a much
higher number of people compared to the synthetic fibers.
Of course, the superiority of cotton clothing in terms of its comfort level cannot be matched by the synthetic versions. With an
unrelenting growth in global population and the resulting demand
for food and feed, cottonseed is also becoming an increasingly
precious commodity. A major by-product, it is used as cattle feed,
11
12
Keerti S. Rathore et al.
either as seed or as meal following the extraction of edible oil.

Biotechnology-based solutions are playing a major role in improving cotton yields in most cotton-growing regions. Genetically engineered cotton developed to confer resistance against a class of
insects through the expression of the Bt gene represents the first
successful application of genetic engineering for commercial purposes [1, 2]. Bt-cotton has lowered production costs by reducing
the use of chemical pesticides, fuel, and labor input [3, 4]. In addition, this biotechnology product has had a positive impact on the
environment and health of farmers in poor countries by reducing
pesticide use. In future, genetic engineering (GE) is likely to play a
major role not only in increasing the production but also in improving the quality of fiber and the seed. One of the major hurdles in the
application of GE for cotton improvement is our ability to generate
transgenic cotton plants in a reliable, rapid, and efficient manner.
The first two reports on the generation of transgenic cotton
were both published in 1987 [5, 6], only 4 years following the successful transformation of the model species, tobacco. Despite these
early successes, few reports on successful transformation of cotton
followed for the next 15 years. This was because the production of
transgenic cotton plants was extremely difficult and highly inefficient and required a high degree of tissue culture skills. There are
two critical steps in the production of transgenic plants in any species. The first step entails transfer and stable integration of the
transgene into the plant genome. The second step involves regeneration of a transgenic plant from the stably transformed cell.
Considering the difficulties involved in the production of transgenic cotton, our laboratory conducted a comprehensive study to
investigate both of these aspects of transgenic cotton production
[7]. Although it is possible to transform cotton with a gene gun [8,
9] as well as with the Agrobacterium method [5, 6], our study [7]
focused on the latter since it does not require specialized equipment, is relatively inexpensive, and is more likely to result in singlecopy transgenic events.
The choice of explant is critical in successfully obtaining transgenic plants since the cells within these tissues must be susceptible
to Agrobacterium infection and be able to regenerate into healthy,
fertile plants. Most published studies had used either hypocotyl
segments [1, 5, 1013] or cotyledon pieces [6, 10] derived from a
young seedling as tissue explants for transformation. However, the
use of these explants necessitates passage of transformed cells
through either a callus phase or a combination of callus and suspension cultures prior to the induction of somatic embryogenesis
for recovering transgenic plants. In addition to these tissue culturebased approaches, there are a few reports that claim the transformation of cells within shoot apices in cotton [1418]. Direct
transformation of the germline progenitor cells within the shoot
apex has the obvious advantages of avoiding laborious tissue
13
culture passages and reducing the length of time for the recovery
of transformants and, therefore, somaclonal variations. Another
major advantage of this system is that regeneration from shoot apices is genotype independent.
Various systems for obtaining transgenic cotton were thoroughly evaluated in our laboratory [7, 19] using a reporter gene
encoding the green fluorescent protein (GFP) [20]. GFP expression provided an excellent tool to measure the efficiency of T-DNA
transfer to cotton cells and was also useful in revealing the timing
and localization of transient transgene expression [7]. Cells at the
cut edge of the cotyledon segments proved to be the most susceptible to Agrobacterium-mediated transformation as indicated by
the transient GFP activity. This was followed by conversion of
some of these transiently transformed cells to stable transformation
events. Fewer cells at the cut surface of the hypocotyl showed transient GFP activity as compared to the cotyledonary tissue. The cells
that showed GFP expression were seen as a ring of fluorescent cells
in the middle of the cut surface that appeared to be part of the
vascular tissue; however, their true identity was masked by the
hypersensitive response displayed by cells around them. Despite
the lower rate of transient transformation, hypocotyl segments
gave rise to several stable transgenic events that grew as small fluorescent clusters at the cut surface of hypocotyls during the selection on kanamycin-supplemented medium over 34 weeks. Thus,
although hypocotyl segments showed a low level of transient activity as compared to the cotyledons, these explants were still capable
of producing several stable transgenic events [7, 19]. Cotyledonary
petiole segments are also as efficient as the hypocotyl segments in
terms of producing stable transformation events. Thus, the use of
GFP as the reporter gene in combination with neomycin phosphotransferase II (npt II) gene as a selectable marker showed that
cotyledons, hypocotyls, and cotyledonary petioles are highly
competent explants for Agrobacterium-mediated transformation
[7, 19]. A single experiment involving 50 donor seedlings can yield
several hundred independent transgenic events in the form of
kanamycin-resistant calli. Although most of the experiments with
GFP were conducted with cv. Coker 312, we have shown previously that cotyledon segments of several Texas cultivars are also
competent for Agrobacterium-mediated T-DNA transfer and are
capable of yielding stable transgenic callus [7].
As mentioned earlier, there are a few studies that have reported
transformation of cells within the shoot apical meristem via the
Agrobacterium method [1518]. However, these investigations
relied heavily on the ability of explants to survive selection pressure
as a measure of their transgenic status and/or did not provide convincing molecular and genetics data to support their claims. In our
laboratory, the competence of shoot apices for Agrobacteriummediated transformation was evaluated by cocultivating these with
14
Agrobacterium under conditions that were found to be optimal for

the infection of the other three tissue explants. Both GFP and gusA
reporter genes were used in these experiments. However, neither
transient nor stable reporter gene expression in the germline progenitor cells within these tissues was observed in any of the experiments, each involving several hundred shoot apices. The results
indicated that the efficiency of Agrobacterium-mediated transformation of apical meristems may be extremely low in cotton.
Limitations and weaknesses of this method and some other alternative methods have been described previously [21]. A recent
patent issued to Monsanto [22] describes a mechanical device that
can be used to isolate several thousand embryonic axes from
germinating cottonseeds in a few hours. The investigators have
used these explants to recover germline transformants following
Agrobacterium-mediated transgene delivery. The patent further
describes optimization of various experimental conditions to obtain
transgenic regenerants. Thus, the low efficiencies for direct transformation of germline cells appear to have been overcome by using
brute force. However, patent restrictions on the device and the
method will prevent most public sector laboratories to utilize this
method to generate transgenic cotton plants.
There are a few reports in the literature that claim to obtain
regeneration via adventitious organogenesis in cotton [23, 24].
Over the past 18 years, a number of attempts have been made in
our laboratory to obtain adventitious shoot organogenesis in cotton without success. In a majority of the laboratories involved in
the generation of transgenic cotton, the mode of regeneration
from callus or suspension cultures is via somatic embryogenesis
[2530]. However, embryogenesis in the cultured tissue occurs at
a very low frequency and is highly genotype dependent (Table 1).
In addition, only a small number of genotypes have been identified
that are competent for regeneration [10, 3035]. Even with genotypes that exhibit the best response, regeneration requires 68 subcultures on various media and can take as long as 69 months to
Table 1
Screening of five different genotypes of G. hirsutum for their embryogenic response using the tissue
culture protocol described in this chapter (# of lines undergoing somatic embryogenesis 8 months
following culture initiation/# of cultured lines)
Coker 312
TM-1
Tamcot 22
Tamcot 73
DP50
Hypocotyl
67/86
1/16
0/7
0/7
0/5
Petiole
45/52
0/14
0/3
0/6
0/8
Cotyledon
5/6
0/9
0/6
0/11
0/14
Root
37/45
0/8
0/6
0/2
0/4
Combined total
154/189
1/47
0/22
0/26
0/31
15
obtain plants following transformation. Problems are encountered

at every step during regeneration. These include (1) survival of
transgenic events following excision from the hypocotyl, petiole,
or cotyledon segments; (2) low efficiencies of the excised events
forming embryogenic calli, somatic embryogenesis, and germination of the somatic embryo into a normal plantlet with a proper
shoot and root; and (3) extreme fragility of the plantlets during the
transition from culture to soil. Thus, while the production of stably
transformed calli is an efficient process in cotton as mentioned earlier, the recovery of healthy transgenic cotton plants from transformed cells was found to be highly inefficient.
We conducted a thorough examination of the factors impacting both transformation and regeneration and developed an efficient protocol for the production of transgenic cotton plants [7].
The percentage of transgenic events obtained from hypocotyl and
cotyledonary petiole explants (number of kanamycin-resistant,
transgenic events obtained/number of explants cocultivated with
Agrobacterium strain 100) ranged from 97 to 384 % in various
experiments. Although regeneration is possible through suspension
cultures in cotton, we prefer to recover plants from callus cultures
because this culture system requires less labor and equipment, and
the possibility of contamination is lower. By using the protocol
described in this chapter, regeneration efficiencies (number of transgenic callus lines regenerating into healthy plants/number of kanamycin-resistant culture lines 100) have ranged from 0 to 24 %.
The method refined over the last 12 years for producing transgenic
cotton (cv. Coker 312) is presented in detail in this chapter.
Materials
All media are autoclaved at 121 C for 20 min after adjusting the
pH and after the addition of the gelling agent. Autoclaved media
(with the gelling agent) should be cooled to <60 C before adding
filter-sterilized antibiotics or acetosyringone.
2.1 Agrobacterium
Media
1. YEP: 10 g/L Bacto peptone, 5 g/L NaCl, 10 g/L Bacto

yeast extract, pH 7.0, 1.5 % Bacto agar. Aliquot in small
batches in bottles, autoclave, and store at room temperature.
When required, melt in microwave, add necessary antibiotics,
and pour into Petri dishes.
2. YEP liquid: 10 g/L Bacto peptone, 5 g/L NaCl, 10 g/L
Bacto yeast extract, pH 7.0. Autoclave and store at room
temperature.
3. PIM (preinduction medium): 10 g/L glucose, 14.62 g/L
morpholinoethanesulfonic acid (MES), 20 mL/L sodium
phosphate buffer (0.1 M, pH 5.6), 50 mL/L AB salts stock
(20), pH 5.6. Filter-sterilize, aliquot in 10 mL portions, and
store at 4 C.
16
4. AB salts stock (20): 20 g/L NH4Cl, 6 g/L MgSO4 7H2O,

3 g/L KCl, 0.264 g/L CaCl2 2H2O, 0.05 g/L
FeSO4 7H2O. Autoclave and store at 4 C.
5. Sodium phosphate buffer (0.1 M, pH 5.6): 2.759
NaH2PO4 H2O/200 mL water (solution A). 2.839
Na2HPO4/200 mL water (solution B). Add solution B
solution A in a stepwise manner until the pH is brought
5.6, autoclave, and store at room temperature.
2.2 Cotton Tissue
Culture
g
g
to
to
1. Cotton seeds (Gossypium hirsutum L., cv. Coker 312).

2. MSO: 4.31 g/L Murashige and Skoog (MS) salts [36] (MS
basal salts mixture), 2 % glucose, pH 5.8, 0.2 % Phytagel.
3. P1-AS: 4.31 g/L MS salts, 100 mg/L myoinositol, 0.4 mg/L
thiamine HCl, 5 mg/L N6-(2-isopentenyl)adenine (2iP),
0.1 mg/L -naphthaleneacetic acid (NAA), 3 % glucose,
1 g/L MgCl2 6H2O, pH 5.8, 0.2 % Phytagel, 50 M acetosyringone (AS) (Sigma-Aldrich, Cat. #D134406; AS stock is
made at 10 mg/mL in 70 % ethanol and stored at 20 C; add
1 mL of AS stock to 1 L of P1).
4. P1-c4k50: 4.31 g/L MS salts, 100 mg/L myoinositol,
0.4 mg/L thiamine HCl, 5 mg/L 2iP, 0.1 mg/L NAA, 3 %
glucose, 1 g/L MgCl2 6H2O, pH 5.8, 0.2 % Phytagel,
400 mg/L carbenicillin, 50 mg/L kanamycin.
5. P7-c4k50: 4.31 g/L MS salts, 100 mg/L myoinositol,
0.4 mg/L thiamine HCl, 0.1 mg/L 2iP, 5 mg/L NAA, 3 %
glucose, 1 g/L MgCl2 6H2O, pH 5.8, 0.2 % Phytagel,
400 mg/L carbenicillin, 50 mg/L kanamycin.
6. MSEm-c4k50: 2.68 g/L modified MS salts (Phytotechnology,
#M571), 100 mg/L myoinositol, 1 mg/L nicotinic acid,
10 mg/L thiamine HCl, 1 mg/L pyridoxine HCl, 1.9 g/L
KNO3, 825 mg/L NH4NO3, 2 g/L glutamine, 500 mg/L
asparagine, 3 % glucose, 1 g/L MgCl2 6H2O, pH 5.8, 0.24 %
Phytagel, 400 mg/L carbenicillin, 50 mg/L kanamycin.
7. MSEm: same as above but without the antibiotics.
8. EG3: 2.16 g/L MS salts, 0.5 % glucose, 100 mg/L myoinositol, 0.4 mg/L thiamine HCl, 0.01 mg/L NAA, pH 6.5, 0.2 %
Phytagel.
9. MS3: 2.16 g/L MS salts, 0.5 % glucose, 0.14 mg/L thiamine
HCl, 0.1 mg/L pyridoxine HCl, 0.1 mg/L nicotinic acid,
pH 5.8, 0.08 % Phytagel, 0.6 % Bacto agar.
10. Sunshine LP5 soil mix: 7080 % Canadian sphagnum peat
moss + fine perlite + dolomite limestone + gypsum + wetting
agent (Sun Grow Horticulture Canada Ltd.).
11. Metro-Mix 900 soil mix: 5060 % bark + Canadian sphagnum
peat moss + horticulture grade vermiculite + dolomite lime
stone + wetting agent (Sun Grow Horticulture Canada Ltd.).
17
Methods
3.1 Preparation
of Agrobacterium
Inoculant
1. Streak the Agrobacterium tumefaciens strain, harboring a

binary vector with the gene of interest, on antibiotic-supplemented YEP plates and incubate for 23 days at 28oC
(see Note 1).
2. Inoculate five colonies into five different test tubes each containing 2 mL of YEP liquid medium (supplemented with
appropriate antibiotics). Grow cells at 28 C for about 30 h on
a shaker (200 rpm) in dark.
3. Pool bacterial cultures in a 15 mL centrifuge tube. Centrifuge
at 2,060 g for 20 min. Remove as much supernatant as possible with a sterile pipette, and resuspend the bacterial pellet in
10 mL of PIM with 100 M acetosyringone (add 20 L of
10 mg/mL AS stock to 10 mL of PIM just before use). Be
sure to break up bacterial clumps by gentle vortexing. Transfer
the suspension to a 125-mL flask. Grow cells at 28 C overnight on a shaker (200 rpm) in the dark.
4. Use 1 mL of suspension to check OD at 600 nm and adjust to
~0.6. Add 2 L of acetosyringone stock for each milliliter of
the final suspension before using the Agrobacterium culture
for cocultivation (see Note 2).
3.2 Aseptic Seed

Germination
1. Rinse 50 fuzzy cottonseeds under running tap water

overnight.
2. Sterilize the seeds by shaking them in a flask containing
100 mL of 40 % commercial bleach (+2 drops of Tween 20)
for 40 min under vacuum on a shaker. Rinse four times with
sterile distilled or deionized water (DW) (see Note 3).
3. Germinate one seed per jar (Phytotechnology, #C1770) or
Magenta box on MSO (25 mL/jar; 50 mL/Magenta box)
at 25 C, under fluorescent light (70 mol/m2/s, 16-h photoperiod) for 10 days.
3.3
Transformation
1. Cut 3- to 4-mm-long segments from either hypocotyl or cotyledonary petiole. Place 1012 segments horizontally on sterile
filter paper over P1-AS medium in a Petri dish (100 15 mm).
2. Apply 5 L of acetosyringone-induced Agrobacterium suspension to each cut surface. Keep the plates under light (70 mol/
m2/s, 16-h photoperiod) at 25 C for 3 days for cocultivation
(see Note 4).
3. Transfer hypocotyl/petiole pieces to the P1-c4k50 medium.
Keep the plates under light (70 mol/m2/s, 16-h photoperiod) at 28 C for 34 weeks without subculture (see Note 5).
18
3.4 Selection/
Proliferation
1. Carefully excise individual calli, representing individual transgenic

events, growing at the cut surface of the explant (see Note 6).
2. If the calli are 3 mm or larger, place these on P7-c4k50 plates
and grow for 4 weeks at 28 C but under a reduced light
intensity of ~10 mol/m2/s (16-h photoperiod) (see Note 7).
3. If callus growth is slow, subculture again on the P7-c4k50
medium, and grow the callus cultures under the same conditions for additional 4 weeks.
3.5 Regeneration
(Somatic
Embryogenesis),
Embryo Germination,
and Plantlet
Development
1. After one or two subcultures on P7-c4k50, transfer the callus

to MSEm-c4K50 medium and culture at 28 C under a light
intensity of ~10 mol/m2/s (16-h photoperiod) for 4 weeks
(see Note 8). Maintain cultures with monthly transfer to fresh
MSEm medium until somatic embryos appear (see Note 9).
2. As somatic embryos appear on MSEm-c4K50 or MSEm, select
those that are at least 78 mm long and place on filter paper
over EG3 medium in deep Petri dishes (25 mm 100 mm) (see
Note 10). Do not transfer more than eight embryos per dish.
3. Maintain embryos for ~4 weeks under mixed (incandescent
and fluorescent) lighting (160 mol/m2/s, 16-h photoperiod) at 25 C (see Note 11).
4. After 4 weeks, evaluate embryos for the presence of shoot apices.
Discard the embryos that have failed to develop shoot apices.
5. Transfer plantlets (having well-defined shoot apices and roots)
that are smaller than 1/2 in. to fresh EG3 medium without
the filter paper and maintain under mixed lighting
(160 mol/m2/s, 16-h photoperiod) at 25 C.
6. Select plantlets with ~1/2- to 1-in.-long shoots, a few visible
true leaves, and some roots. Transfer these to jars containing
MS3 medium and maintain under mixed lighting
(160 mol/m2/s, 16-h photoperiod) at 25 C for further
growth and root establishment.
3.6
Transfer to Soil
1. Transfer plants to Sunshine LP5 soil mix (steam-sterilized) in

500-mL-sized pots when the shoots are 2.53 in. in length
and show significant root development. Keep plants under
low-level lighting (1820 mol/m2/s) and high humidity
under a clear plastic dome (see Note 12). After 2 weeks,
remove the dome and maintain plants under the same lighting
conditions for an additional week.
2. Transfer healthy plants to a greenhouse. Following 12 weeks
of acclimatization, transfer the plants that have grown to a
height of 56 in. to Metro-Mix 900 soil mix in 20-L-sized
pots and grow the plants to maturity (900 mol/m2/s, 14-h
photoperiod) (see Notes 1317).
3. Isolate DNA from a young leaf for molecular analysis to confirm the transgenic status of the plant.
19
Notes
1. Agrobacterium tumefaciens strain LBA4404 provides higher
transformation efficiencies in cotton as compared to the strain
EHA105 [7].
2. Alternatively, it is possible to simply grow Agrobacterium on
YEP plates under appropriate antibiotic selection, harvest the
cells with a loop, and resuspend in PIM + AS before cocultivation. This simpler procedure eliminates the need for a shaker.
3. We have also used acid-delinted seeds following a modified
sterilization protocol. Seeds, soaked for 3 h under running tap
water, are treated with 70 % ethanol for 1 min and washed
twice with sterile DW. This is followed by sterilization with
20 % commercial bleach (+two drops of Tween 20) under
vacuum for 5 min and then 15 min without vacuum. After
rinsing three times, the seeds are germinated on MSO medium
in jars at 25 C, under fluorescent light (70 mol/m2/s, 16-h
photoperiod) for 10 days. For uniform germination, the seeds
should be soaked overnight, and the seed coat should be
removed before placing the kernel in the jar.
4. We use Parafilm to wrap the Petri dishes. Nescofilm and
Millipore tape were also tested as substitutes but offered no
advantage over Parafilm.
5. Although the transformation/regeneration protocol described
is for hypocotyl and cotyledonary petiole segments, it can be
used also for cotyledon segments. Individual transgenic events
arising at the edges of the cotyledon segments can be used to
obtain transgenic plants by following the method described in
this chapter.
6. Often, more than one transgenic events are observed growing
at the cut surface of the hypocotyl or the petiole segments.
The longer these are permitted to grow on the explant, the
greater the likelihood that two or more transgenic events will
converge with each other. In this situation, the possibility
remains that the two plants obtained from the same excised
callus tissue may have arisen from separate transgenic events.
As is the case with the transformation efficiency of any species,
experiment-to-experiment variability is also observed with
cotton. This necessitates performing several small-scale experiments for a given construct rather than a few large-scale ones.
7. If the excised calli are smaller than 3 mm, culture these for 7
days on P1-c4k50 plates at 28 C under a light intensity of
~10 mol/m2/s (16-h photoperiod) prior to transferring
them to P7-c4k50 plates. The additional week of culture on
P1-c4k50 medium improves the survival of small-sized transgenic events; however, this may delay embryogenesis.
20
Table 2
Effect of two types of lighting conditions on the efficiency of conversion of
somatic embryos to healthy plantlets (# of somatic embryos transferred
from MSEm medium to EG3 medium/# of healthy plantlets obtained)
Experiment no.
Fluorescent lighting
Fluorescent +
incandescent lighting
5/124 (4.0 %)
24/148 (16.2 %)
5/124 (4.0 %)
8/124 (6.4 %)
3/250 (1.2 %)
22/250 (8.8 %)
6/113 (5.3 %)
22/250 (8.8 %)
8. In our earlier protocol [7, 19], we were selecting lines that

were producing friable and pale-cream-colored calli (potentially embryogenic) and transferring it to MSBOK-c2 medium
to induce embryogenesis. This type of strict selection does not
appear to be that critical when using the MSEm medium.
9. Kanamycin selection pressure is used only for the first three
months of culture (either P1P7P7 or P1P7MSEm).
Continue to subculture monthly on MSEm medium to obtain
a steady supply of somatic embryos until at least two healthy
plants from an individual line have been moved to soil.
10. The growth of and differentiation in individual transgenic
culture lines is highly asynchronous necessitating regular monitoring of the cultures. Transfer appropriate-sized somatic
embryos, developing at any point during the regeneration
phase, to EG3 medium for embryo germination.
11. Conversion of somatic embryos to normal, healthy plantlets
that are able to survive transfer to soil has been a big bottleneck. We have found that a mixture of incandescent bulbs with
fluorescent lighting improves significantly the conversion of
somatic embryos to healthy plantlets compared to fluorescent
lighting alone (Table 2).
12. Mild growth conditions to acclimatize the transgenic plants
following the transfer to soil can be attained by maintaining
the plants on the laboratory bench under normal, room lighting (fluorescent with some supplemental incandescent bulbs;
1820 mol/m2/s) under a clear plastic dome to maintain
high humidity.
13. In addition to the commercial soil mixtures described here,
cotton plants may be grown in other suitable soil mixtures. In
the greenhouse, cotton plants are fertilized once a week with
20-20-20 NPK mix (Peters Professional Fertilizer, Scotts Co.)
21
until flowering and then with 8-45-14 NPK mix (Peters

Professional Fertilizer, Scotts Co.). The plants are also fertilized
every 2 weeks with a micronutrient mix (Peters Professional
Soluble Trace Elements Mix, Scotts Co.). Both wild-type and
transgenic plants are equally prone to various insect pests in the
greenhouse. Appropriate insecticide treatment can be used to
control the pests. We use Marathon II [active ingredient
(AI): 21.4 % imidacloprid, Olympic Horticultural Products
Co.] to control whiteflies, Flagship (AI: 0.22 % thiamethoxam, Syngenta Crop Protection) to control aphids, Avid
(AI: 1.8 % abamectin, Syngenta Crop Protection, Inc.) + Judo
(AI: 45.2 % sapiromesifen; Olympic Horticultural Products
Co.) to control spider mites, and Conserve (AI: 11.6 % spinosad, Dow AgroSciences LLC) to control thrips.
14. On average, ~5 % of the transgenic plants obtained using the
protocol described here exhibit abnormal morphology due to
somaclonal variation. Under greenhouse conditions, we have
been able to obtain seeds in 45 months, and 6075 % of the
transgenic plants obtained in various experiments have been
fertile.
15. It may be possible to use the protocol described here for cultivars other than Coker 312.
16. We have also examined indole-3-butyric acid + kinetin and
indole-3-butyric acid + kinetin + 2,4-dichlorophenoxyacetic
acid combinations instead of the 2ip + NAA hormone
combinations described in this chapter to initiate and maintain
cotton callus cultures. Although we were able to obtain transgenic cotton plants using the alternative hormone combinations used by some other laboratories [12, 13, 35], neither the
culture period was shortened nor the regeneration efficiencies
were improved.
17. The npt II gene in combination with kanamycin provided a
highly effective selection system to produce transgenic cotton
plants. Molecular analyses (Southern and PCR) suggested that
no untransformed plants (escapes) were recovered using the
selection scheme described in this chapter. The use of the hpt
gene in combination with selection on hygromycin is possible
in cotton; however, prolonged culture on this antibiotic inhibits the regeneration process. To avoid this problem, the use of
hygromycin in the selection medium should be limited to the
first three months following transformation. The highest
transformation efficiency obtained in our laboratory using the
hpt/hygromycin system was 5.5 %.
Monsantos patented method for meristem transformation has been published recently [37].
22
Acknowledgments
The authors wish to thank Ms. Lauren Tollack for excellent technical assistance. Experimental work in our laboratory has been supported by Cotton Inc., Texas Cotton Biotechnology Initiative
(TxCOT), and Texas AgriLife Research.
References
1. Perlak FJ, Deaton RW, Armstrong TA et al
(1990) Insect resistant cotton plants.
BioTechnology 8:939943
2. Perlak FJ, Oppenhuizen M, Gustafson K et al
(2001) Development and commercial use of
Bollgard cotton in the USA early promises
versus todays reality. Plant J 27:489501
3. Johnson SR, Strom S, Grillo K (2007)
Quantification of the impacts on US agriculture of biotechnology-derived crops planted in
2006. National Center for Food and
Agricultural Policy. www.ncfap.org. http://
www.ncfap.org/documents/2007biotech_
report/Quantification_of_the_Impacts_on_
US_Agriculture_of_Biotechnology.pdf .
Accessed 15 Sept 2013
4. Brookes G, Barfoot P (2012) GM crops: global
socio-economic and environmental impacts
19962010. PG Economics Ltd., UK. https://
www.landesbioscience.com/journals/gmcrops/
article/20061/. Accessed 15 Sept 2013
5. Umbeck P, Johnson G, Barton K et al (1987)
Genetically transformed cotton (Gossypium hirsutum L.) plants. BioTechnology 5:263266
6. Firoozabady E, DeBoer DL, Merlo DJ et al
(1987) Transformation of cotton (Gossypium
hirsutum L.) by Agrobacterium tumefaciens
and regeneration of transgenic plants. Plant
Mol Biol 10:105116
7. Sunilkumar G, Rathore KS (2001) Transgenic
cotton: factors influencing Agrobacteriummediated transformation and regeneration.
Mol Breeding 8:3752
8. Finer JJ, McMullen MD (1990) Transformation
of cotton (Gossypium hirsutum L.) via particle
bombardment. Plant Cell Rep 8:586589
9. Rajasekaran K, Hudspeth RL, Cary JW et al
(2000) High-frequency stable transformation
of cotton (Gossypium hirsutum L.) by particle
bombardment of embryogenic cell suspension
cultures. Plant Cell Rep 19:539545
10. Cousins YL, Lyon BR, Llewellyn DJ (1991)
Transformation of an Australian cotton cultivar: prospects for cotton improvement through
genetic engineering. Aust J Plant Physiol 18:
481494
11. Bayley C, Trolinder N, Ray C et al (1992)

Engineering 2,4-D resistance into cotton.
Theor Appl Genet 83:645649
12. Jin S, Zhang X, Nie Y et al (2006) Identification
of a novel elite genotype for in vitro culture
and genetic transformation of cotton. Biol
Plant 50:519524
13. Guo X, Huang C, Jin S et al (2007)
Agrobacterium-mediated transformation of
Cry1C, Cry2A and Cry9C genes into
Gossypium hirsutum and plant regeneration.
Biol Plant 51:242248
14. McCabe
DE,
Martinell
BJ
(1993)
Transformation of elite cotton cultivars via
particle
bombardment
of
meristems.
BioTechnology 11:596598
15. Gould JH, Magllanes-Cedeno M (1998)
Adaptation of cotton shoot apex culture to
Agrobacterium-mediated
transformation.
Plant Mol Biol Rep 16:283
16. Zapata C, Park SH, El-Zik KM et al (1999)
Transformation of a Texas cotton cultivar by
using Agrobacterium and the shoot apex.
17. Satyavathi VV, Prasad V, Gita Lakshmi B et al
(2002) High efficiency transformation protocol
for three Indian cotton varieties via Agrobacterium
tumefaciens. Plant Sci 162: 215223
18. Yuceer SU, Koc NK (2006) Agrobacteriummediated transformation and regeneration of
cotton plants. Russ J Plant Physiol 53:413417
19. Rathore KS, Sunilkumar G, Campbell LM
(2006) Cotton (Gossypium hirsutum L.). In:
Wang K (ed) Methods in molecular biology,
vol 343: Agrobacterium protocols, vol 1.
Humana Press, Totowa, NJ, pp 267279
20. Haseloff J, Siemering KR, Prasher DC et al
(1997) Removal of a cryptic intron and subcellular localization of green fluorescent protein
are required to mark transgenic Arabidopsis
plants brightly. Proc Natl Acad Sci U S A 94:
21222127
21. Rathore KS, Sunilkumar G, Cantrell RG et al
(2008) Cotton. In: Kole C, Hall TC (eds)
Compendium of transgenic crop plants:
22.
23.
24.
25.
26.
27.
28.
29.
transgenic sugar, tuber and fiber crops. Wiley,

Oxford, pp 199238
Dersch E, Heinzen RJ, Martinell B et al
(2011) Methods of meristem excision and
transformation. U. S. Patent 8,044,260
Ouma JP, Young MM, Reichert NA (2004)
Optimization of in vitro regeneration of multiple shoots from hypocotyl sections of cotton
(Gossypium hirsutum L.). Afr J Biotechnol 3:
169173
Divya K, Anuradha TS, Jami SK et al (2008)
Efficient regeneration from hypocotyl explants
in three cotton cultivars. Biol Plant 52:
201208
Davidonis GH, Hamilton RH (1983) Plant
regeneration from callus tissue of Gossypium
hirsutum L. Plant Sci Lett 32:8993
Gawel NJ, Rao AP, Robacker CD (1986)
Somatic embryogenesis from leaf and petiole
callus cultures of Gossypium hirsutum L. Plant
Cell Rep 5:457459
Shoemaker RC, Couche LJ, Galbraith DW
(1986) Characterization of somatic embryogenesis and plant regeneration in cotton (Gossypium
hirsutum L.). Plant Cell Rep 3:178181
Trolinder NL, Goodin JR (1987) Somatic
embryogenesis and plant regeneration in cotton (Gossypium hirsutum L.). Plant Cell Rep
6:231234
Finer JJ (1988) Plant regeneration from
somatic embryogenic suspension cultures of
cotton (Gossypium hirsutum L.). Plant Cell
Rep 7:399402
23
30. Firoozabady E, DeBoer DL (1993) Plant regeneration via somatic embryogenesis in many cultivars of cotton (Gossypium hirsutum L.). In Vitro
Cell Dev Biol 29P:166173
31. Rajasekaran K, Grula JW, Hudspeth RL et al
(1996) Herbicide-resistant Acala and Coker cottons transformed with a native gene encoding
mutant forms of acetohydroxyacid synthase. Mol
Breeding 2:307319
32. Trolinder NL, Xhixian C (1989) Genotype
specificity of the somatic embryogenesis
response in cotton. Plant Cell Rep 8:133136
33. Sakhanokho H, Zipf A, Rajasekaran K et al
(2001) Induction of highly embryogenic calli
and plant regeneration in upland (Gossypium
hirsutum L.) and Pima (Gossypium barbadense
L.) cottons. Crop Sci 41:12351240
34. Sakhanokho H, Zipf A, Rajasekaran K et al
(2004) Somatic embryo initiation and germination in diploid cotton (Gossypium arboreum
L.). In Vitro Cell Dev Biol 40P:177181
35. Han GY, Wang XF, Zhang GY et al (2009)
Somatic embryogenesis and plant regeneration
of recalcitrant cottons (Gossypium hirsutum).
Afr J Biotechnol 8:432437
for rapid growth and bioassays with tobacco
tissue cultures. Physiol Plant 15:473497
37. Chen Y, Rivlin A, Lange A et al (2014) High
throughput Agrobacterium tumefaciens-mediated
germline transformation of mechanically isolated
meristem explants of cotton (Gossypium hirsutum
L.). Plant Cell Rep 33:153164
Chapter 3
Jatropha (Jatropha curcas L.)
Devendra Kumar Maravi, Purabi Mazumdar, Shamsher Alam,
Vaibhav V. Goud, and Lingaraj Sahoo
Abstract
The seed oil of Jatropha (Jatropha curcas L.) as a source of biodiesel fuel is gaining worldwide importance.
Commercial-scale exploration of Jatropha has not succeeded due to low and unstable seed yield in semiarid
lands unsuitable for the food production and infestation to diseases. Genetic engineering is promising to
improve various agronomic traits in Jatropha and to understand the molecular functions of key Jatropha
genes for molecular breeding. We describe a protocol routinely followed in our laboratory for stable and
efficient Agrobacterium tumefaciens-mediated transformation of Jatropha using cotyledonary leaf as
explants. The 4-day-old explants are infected with Agrobacterium tumefaciens strain EHA105 harboring
pBI121 plant binary vector, which contains nptII as plant selectable marker and gus as reporter. The putative transformed plants are selected on kanamycin, and stable integration of transgene(s) is confirmed by
histochemical GUS assay, polymerase chain reaction, and Southern hybridization.
Key words Agrobacterium tumefaciens, Cotyledonary leaf, Jatropha curcas, Kanamycin resistance,
Plant binary vector, Stable transformation
Introduction
Jatropha (Jatropha curcas L.) is an important nonedible oilseed
crop receiving worldwide attention as a biodiesel feedstock. The
seeds contain 4050 % of oil, which can be blended directly with
petro-diesel or transesterified for use as biodiesel. The short gestation period, drought endurance, low cost of seeds, high oil content, and easy adaptation on degraded soil unsuitable for food
crops make Jatropha as the most sought oil seed crop among the
nonedible oil-yielding crops for biodiesel production [1, 2]. The
huge demand of Jatropha seeds is expected to be met through its
large-scale cultivation and increasing its productivity. However,
several undesirable traits of Jatropha such as low and unstable
seed yield, dependent on the growth conditions and environment,
limit its commercial use [3]. Furthermore, large-scale cultivation of Jatropha through monocrop plantation especially under
25
26
Devendra Kumar Maravi et al.
humid conditions encounters devastation by insects [46] and

begomoviruses epidemics [79]. Conventional breeding for the
development of superior genotype of Jatropha with high and stable
seed yields in degraded and marginal lands and resistant to insect
pest and virus has not progressed due to the narrow genetic base
and failure in wide hybridization. Genetic engineering offers
immense opportunity to complement conventional breeding for
the improvement of Jatropha for enhanced fatty acid biosynthesis,
tolerance to biotic and abiotic stress, regulation of secondary
metabolites and phorbol esters, and manipulation of female to
male flower ratio. A reproducible and efficient protocol for the
genetic manipulation of Jatropha will assist in its targeted improvement besides unraveling the functions of genes identified in this
plant. Stable transformation of Jatropha has been reported by few
laboratories including ours [1014]. Agrobacterium-mediated
transformation is preferred as it offers several advantages, such as
the defined integration of transgenes, preferential integration into
transcriptionally active regions of the chromosomes, and potentially single or low copy number with rearrangement being relatively rare [15, 16].
In this chapter, we provide details of an efficient protocol for
Agrobacterium tumefaciens-mediated Jatropha transformation
using cotyledonary leaf as explants. Agrobacterium tumefaciens
strain EHA105 harboring plant binary vector, pBI121, containing
nptII as a plant selectable marker and gus as reporter is used to
infect the cotyledonary leaves followed by regeneration of stable
transformed plants under kanamycin selection. The entire process
of explant infection to transgenic plant establishment in greenhouse requires approximately 90 days (Fig. 1). The average transformation efficiency of our system is 1.5 % (defined as number of
plants positive for plant selectable marker gene by polymerase chain
reaction recovered from the total number of explants infected).
Materials
Plant Materials
Seeds of an elite accession of Jatropha curcas, IITGJC-19, were

used for plant transformation. Jatropha seeds are collected from
the shade house-grown plants (see Note 1).
2.2 Agrobacterium
tumefaciens Strain
and Vector
Agrobacterium tumefaciens strain EHA105 harboring the binary

vector pBI121 is used for Jatropha transformation. The T-DNA of
pBI121 includes nptII (neomycin phosphotransferase) driven by
nopaline synthase (NOS) promoter and gus (-glucuronidase)
gene driven by CaMV35S promoter (see Note 2).
2.1
27

Day of Action
Infect four days old cotyledonary leaf segment with
A. tumefaciens EHA105 harboring pBI121
Day
Co-cultivate explants on liquid co-cultivation medium containing

100M acetosyringone
Day
Wash the explants with sterile distilled water containing

75mg/L meropenem
Day
Transfer the explantson callus induction medium containing

25mg/L meropenem
Transfer the callus to shoot regeneration and selection medium

containing 15mg/L kanamycin and 25mg/L meropenem
Day
Transfer the regenerated shoots to shoot elongationand selection

medium containing 15mg/L kanamycinand 25mg/L meropenem
Day
Transfer the elongated shoots on root induction medium
Day 6
Transfer rooted plants to pots and acclimatize
Day
Maintain transgenic plants in green house
Day
Fig. 1 Schematic representation of Agrobacterium-mediated transformation of

Jatropha curcas
2.3
Stock Solutions
2.3.1 Plant Growth

Hormones
1. 6-Benzylaminopurine (BAP): Prepare the stock solution of

1 mM by dissolving 22.52 mg of BAP salt in a few drops of
1 N NaOH and then make up the volume to 100 ml with
dH2O, filter sterilize (see Note 3), and store at 20 C.
2. Indole-3-butyric acid (IBA): Prepare the stock of 1 mM by
dissolving 20.04 mg of IBA salt in few drops of 1 N NaOH
and then make up the volume to 100 ml with dH2O, filter
3. Gibberellic acid (GA3): Prepare the stock of 1 mM by dissolving 34.6 mg of GA3 salt in few drops of 1 N NaOH and then
make up the volume to 100 ml with distilled water, filter sterilize, and store at 20 C.
28
2.3.2 Antibiotics
1. Kanamycin sulfate: Prepare the stock of 100 mg/ml by dissolving 500 mg of kanamycin powder in 5 ml of sterile dH2O,
filter sterilize, and store at 20 C (see Note 4).
2. Rifampicin: Prepare the stock of 10 mg/ml by dissolving
10 mg of rifampicin in few drops of dimethyl sulfoxide
(DMSO) and then make up the volume by adding sterile
dH2O, filter sterilize, and store at 20 C.
3. Meropenem: Prepare the stock of 50 mg/ml by dissolving 1 g
of meropenem salt in 20-ml sterile distilled water, filter sterilize, and store at 4 C.
2.3.3 Other Solution
1. Sterilization solution: 70 % (v/v) ethanol and 0.1 % (v/v)

sodium hypochlorite, Tween 20 and 0.2 % (w/v) mercuric
chloride (see Note 5).
2. Acetosyringone: Prepare the stock solution of 100-mM acetosyringone (3,5-dimethoxy-4-hydroxyacetophenone) by dissolving 0.392-g acetosyringone salt in 10-ml DMSO, filter
3. -Glucuronidase: GUS assay buffer (50100 g/ml X-glcA in
20 mM NaPO4, pH = 7.0).
4. DNA extraction buffer: 20-M TrisHCl, pH 7.5, 250-M
NaCl, 25-M EDTA, pH 8.0, and 0.5 % sodium dodecyl
sulfate (SDS).
5. High-salt TE buffer: 10-mM TrisHCl, pH 8.0, and 1-mM
EDTA, pH 8.0, 1 M NaCl.
6. Polymerase chain reaction (PCR) components: 10 Taq buffer, 10-mM dNTPs, 50 pmol/l each of forward and reverse
primer, 3 U/l Taq polymerase, ~100-ng DNA template, and
sterile Milli-Q water to make up the volume up to 25 l.
2.3.4 Culture
Medium Stock
All stock solutions are freshly prepared on a monthly basis and

stored at 4 C.
1. Murashige and Skoog (MS) major salts (10): Dissolve
19.0 g/l KNO3, 16.5 g/l NH4NO3, 3.7 g/l, MgSO4 7H2O,
4.4 g/l CaCl2 2H2O, and 1.7 g/l KH2PO4 [17].
2. MS minor salts (100): Dissolve 2.2 g/l MnSO4 4H2O,
83 mg/l KI, 620 mg/l H3BO4, 860 mg/l ZnSO4 7H2O,
2.5 mg/l CuSO4 5H2O, 25 mg/l NaMoO4 2H2O, and
2.5 mg/l CoCl2 6H2O [17].
3. MS vitamin stock (200): Dissolve 100 mg/l niacin, 100 mg/l
pyridoxine HCl, 400 mg/l glycine, and 20 mg/l thiamine
HCl [17].
4. Iron stock (200): Dissolve 7.45 g/l of Na2EDTA (ethylenediaminetetraacetic acid, disodium salt) in 500-ml dH2O and
5.57 g/l of FeSO4 7H2O in 500-ml dH2O separately. Boil the
29
Na2EDTA solution and add FeSO4 solution to it, gently by

stirring [17].
5. All culture medium stock is stored in amber-colored bottle at
4 C.
6. Agrobacterium minimal medium (AB) buffer (20): Dissolve
60 g/l K2HPO4 and 20 g/l NaH2PO4 in dH2O, adjust pH to
7.0 with 1 N NaOH or 1 N HCl, as required, then autoclave
(see Note 6) [18].
7. AB salts (20): Dissolve 20 g/l NH4Cl, 6 g/l MgSO4 7H2O,
3 g/l KCl, 0.2 g/l CaCl2, 50 mg/l FeSO4 7H2O in dH2O
then autoclave (see Note 7) [18].
8. D-glucose (0.5 %): Dissolve 5-g D-glucose in 1 l of dH2O then
autoclave [18].
2.3.5 Plant
Culture Media
1. Murashige and Skoog medium (MS): MS medium (major salt

50 ml, minor salt 5 ml, vitamin 5 ml, iron 5 ml, and myoinositol 100 mg) supplemented with 3 % (w/v) sucrose, adjust
pH 5.84 with 1 N NaOH or 1 N HCl. Add agar-agar (3.2 g/l)
prior to autoclaving (Subheading 2.3.4).
2. Liquid cocultivation media (LCM): MS liquid medium containing 6.66-M BAP and 0.24-M IBA, adjust pH to 5.7,
and supplement with 100-M acetosyringone (see Note 8).
3. Callus induction medium (CI): MS medium supplemented with
6.66-M BAP, 0.24-M IBA, 3 % (w/v) sucrose, adjust pH to
5.84 with 1 N NaOH or 1 N HCl and solidified with 0.8 %
(w/v) agar-agar, autoclave and add 25 mg/l meropenem, mix
thoroughly, and dispense 25 ml into 90-mm sterile Petri dishes.
4. Shoot regeneration and selection medium (SR): MS medium
supplemented with 6.66 M BAP, 0.24 M IBA, 1.5 M
GA3, 3 % (w/v) sucrose, adjust pH to 5.84 with 1 N NaOH
or 1 N HCl, and solidified with 0.8 % (w/v) agar-agar.
Autoclave and add 15 mg/l kanamycin and 25 mg/l meropenem during explant inoculation (see Note 9).
5. Shoot elongation and selection medium (SE): MS medium
supplemented with 1-M GA3, 3 % (w/v) sucrose, adjust pH
to 5.84 with 1 N NaOH or 1 N HCl and solidify with 0.8 %
(w/v) agar-agar, autoclave, and add 15 mg/l kanamycin and
25 mg/l meropenem during explant inoculation.
6. Root induction medium (RI): MS medium consisting of half
strength of MS major and MS minor elements, full strength of
vitamin, and 2 % (w/v) sucrose; adjust pH to 5.84 with 1 N
NaOH or 1 N HCl, solidify with 0.6 % (w/v) agar, autoclave,
and add 5-M IBA and 25 mg/l meropenem during shoot
transfer.
7. Sterilize all tissue culture media by autoclaving for 20 min at
121 C and 15 psi.
30
2.3.6 Culture Media

for A. tumefaciens
1. Luria-Bertani (LB) agar medium: Dissolve 25 g of LB powder

in 1 l of dH2O. Add 15 g/l agar-agar, autoclave, cool to about
55 C, and add 50 mg/l kanamycin, 10 mg/l rifampicin for
the selection of Agrobacterium tumefaciens strain EHA105
harboring plant binary vector pBI121.
2. AB minimal media: Combine 5-ml sterile 20 AB buffer and
5-ml 20 AB salts in 90-ml sterile D-glucose (final concentration
of D-glucose is 0.5 %).
Methods
3.1 Preparation
of Explant for
Inoculation
1. Remove the seed coat and soak in distilled water for overnight
at room temperature.
2. Surface-sterilize the de-coated seeds with 0.1 % sodium hypochlorite solution supplemented with few drops of Tween 20
for 15 min and rinse with distilled water several times.
3. Surface-sterilize the seeds with 70 % ethanol for 5 min and
rinse three times with sterilized distilled water.
4. Finally, sterilize with 0.2 % mercuric chloride for 2 min and
rinse with sterile distilled water 34 times under the laminar
air flow cabinet.
5. Blot dry the seeds using sterile filter paper.
6. Carefully dissect the endosperm to expose out embryos with
papery cotyledonary leaves using forceps and scalpel.
7. Separate out the papery cotyledonary leaves and germinate on
MS basal medium.
8. Cut the papery cotyledonary leaves into four segments (8 mm)
with their edges removed and use as explant for Agrobacteriummediated transformation.
3.2 Agrobacterium
Culture for Infection
1. Streak Agrobacterium tumefaciens strain EHA105 on solid LB

medium supplemented with 50 mg/l kanamycin and 10 mg/l
rifampicin for 2 days at 28 C (see Note 10).
2. Inoculate a single bacterial colony into 25 ml of liquid AB minimal medium with appropriate antibiotics to select the binary
plasmid and agitate overnight at 28 C on a rotary shaker at
180 rpm, until optical density at 600 nm reaches to 0.8.
3. Transfer the liquid culture to a centrifuge tube, and pellet the
cells by spinning for 1015 min at 4 C for 4,025 g. Decant
the supernatant and resuspend the cell pellet in liquid cocultivation media (pH 5.7) supplemented with 100-M acetosyringone and 0.24-M IBA. Adjust the bacterial cell density,
if necessary, by further dilution to achieve OD600 = 0.60.8.
Agrobacterium suspension cultures are then ready to use for
transformation experiment.
3.3 Infection,
Cocultivation,
and Regeneration
31
1. Inoculate the explants in Agrobacterium suspension for 30 min

with occasional shaking in the dark at 22 C.
2. Decant the Agrobacterium suspension and blot dry the
explants gently on sterile filter paper to remove excess
Agrobacterium.
3. Cocultivate the explants in 90-mm sterile Petri dishes lined
with filter paper, moistened with LCM, supplemented with
100-M acetosyringone and 0.24-M IBA. Seal the Petri dish
with Parafilm and incubate at 22 C for 3 days in dark condition (see Note 11).
4. After 3 days of cocultivation, wash the explants 45 times with
sterile distilled water containing 75 mg/l meropenem.
5. Blot dry the explants on sterile filter paper and transfer to the
callus induction medium containing 25 mg/l meropenem;
incubate in dark condition for callus induction.
6. Transfer the cultures to fresh CI medium containing 25 mg/l
meropenem at an interval of 12 days (see Note 12).
7. After 3 week of culture, transfer the calli to SR and selection
medium containing 15 mg/l kanamycin and 25 mg/l meropenem, and incubate at 16-h photoperiod with a photosynthetic
photon flux density of 35 mol/m2/s provided by cool white
fluorescent tubes.
8. Transfer the cultures periodically onto fresh selection medium
at an interval of 12 days.
9. After 3 week of culture on selection, detach the proliferating
kanamycin-resistant shoots and transfer to SE medium containing 15-mg/l kanamycin and 25-mg/l meropenem.
3.4 Root Induction

and Acclimatization
1. Transfer the elongated shoots after a week to the RI medium

containing 25-mg/l meropenem (see Note 13).
2. Wash the well-rooted putative transformed plantlets to remove
excess agar under running tap water.
3. Establish the plantlets into pots containing soil and vermicompost (1:1), and cover the pots with transparent plastic bags to
maintain adequate moisture for 12 weeks (see Note 14).
4. Remove the plastic bags after 12 weeks and maintain the
plants in greenhouse (see Note 15) plastic pots containing
normal garden soil.
5. Seeds are ready for harvesting around 90 days after flowering
when the fruits have changed color from green to yellow
brown (see Note 16).
32
3.5 GUS
Histochemical Assay
1. In order to verify stable expression of gus gene in transgenic

shoots [18], dip the callus and leaf into X-Gluc solution and
incubate at 37 C in the dark for 1824 h.
2. After incubation, transfer the callus and leaf to 95 % ethanol,
and incubate overnight to bleach the chlorophyll out from
tissues (see Note 17).
3. The intensity of the blue color in the tissue should indicate
stable expression of gus (see Note 18).
3.6 Genomic DNA

Isolation and PCR
Analysis
1. Take 100-mg leaf tissue, wash with sterile distilled water, and
blot dry with tissue paper to remove water.
2. Place the tissue in a prechilled mortar and pestle and homogenate to powder with liquid nitrogen; transfer the powder to
sterile microcentrifuge tube.
3. Add 700 l of extraction buffer (preheated at 60 C for
15 min) to homogenate, mix gently to avoid shearing of DNA,
and incubate in water bath at 65 C for 45 min.
4. Bring down the sample temperature to room temperature,
add 700-l chloroform-isoamyl alcohol (24:1), and mix gently
by inverting for a period of 5 min.
5. Spin at 7,155 g for 10 min at 25 C; transfer the supernatant
to a fresh microcentrifuge tube.
6. Add 150 l of 5 M NaCl and mix properly.
7. Add 0.6 volume of cold isopropanol. Mix gently and allow the
mixture to stand at 4 C for 45 min (see Note 19).
8. After 60 min, spin the samples at 11,180 g for 10 min at
25 C, discard the supernatant, and wash the pellet with 80 %
ethanol.
9. Dry the pellet in vacuum for 15 min and dissolve in 200 l of
high-salt TE buffer.
10. Add 5 l of RNase and incubate at 37 C for 45 min.
11. Extract with equal volume of chloroform-isoamyl alcohol
(24:1), mix gently, and spin at 10,000 rpm for 10 min.
12. Transfer the aqueous layer to a fresh 1.5-ml centrifuge tube,
and add 2 volume of cold ethanol; keep in 20 C for 1 h.
13. Spin at 10,000 rpm at 4 C for 10 min, perform ethanol (80 %)
wash, and spin for 10 min at 10,000 rpm.
14. Dry the pellet and suspend in sterile double distilled water
(see Note 20).
15. Measure the DNA concentration by running the sample on
0.8 % agarose gel or taking the absorbance at 260 nm
(see Note 21).
16. PCR reaction mixture: in an Eppendorf tube, add 2.5-l 10
Taq buffer, 0.5-l 10-mM dNTPs, 1-l forward primer
33
(50 pmol/l), 1-l reverse primer (50 pmol/l) for nptII and
gus gene, respectively (see Note 22), 0.5-l Taq polymerase
(5 U/l), ~100-ng DNA template, then make up the final
volume up to 25 l.
17. PCR condition: 95 C for 5 min (1 cycle), 95 C for 1 min
(denaturation), 58 C for 1 min (annealing), 72 C for 1 min
(extension) for 35 cycles, followed by the final extension at
72 C for 5 min (1 cycle).
18. Resolve the PCR-amplified product by electrophoresis on 1 %
agarose gel and visualize with ethidium bromide staining
under UV transilluminator and document in gel documentation system (Bio-Rad Laboratories).
Notes
1. The seeds are collected from the shade house-grown Jatropha
curcas of Indian Institute of Technology Guwahati.
2. Selectable marker neomycin phosphotransferase encoding
gene II (nptII) confers kanamycin resistance to transformed
plant cells.
3. Antibiotic stocks are aliquots in 1.5-ml sterile Eppendorf tubes
and stored at 20 C.
4. All filter sterilization is carried out with 0.22-mm syringe
filter.
5. Mercuric chloride (HgCl2) is a highly effective surface sterilant
and extremely toxic and must be disposed off according to safety
regulations in the laboratory. It may be necessary to use a specially designated sink for toxic chemicals for the washing step.
6. Prepare KH2PO4 and NaH2PO4 2H2O separately and then
mix and bring the final volume up to 100 ml with distilled
water.
7. AB salt solution may show yellow precipitates after autoclaving
which is dissolved by shaking vigorously just before use.
8. Increased concentration of acetosyringone up to 100 M
enhances the transient transformation efficiency and decreases
with further increases in concentration.
9. The 15-mg/l kanamycin is the optimal concentration to select
transformed explants, and 25-mg/l meropenem is used to
eliminate the growth of Agrobacterium.
10. Agrobacterium culture lose their viability when kept in
LB + Rif + Kan plate at 4 C for more than 3 weeks; therefore,
subculture the plate in regular intervals.
11. A 3-day cocultivation period is optimum for transient transformation experiment. Cocultivation period longer than 3-day
34
reduces the transformation efficiency and results in

Agrobacterium overgrowth which causes detrimental effect on
regeneration of explants.
12. The subculture is performed at the interval of 12 days in fresh
medium of the same compositions to avoid drying of the
tissues.
13. Kanamycin inhibits the root formation; therefore, elongated
shoots are transferred to kanamycin-free rooting medium.
14. Plastic bags are used to maintain adequate moisture and to
prevent wilting of plantlets.
15. Green house is maintained at 25 2 C, relative humidity
60 5 %, and 16-h photoperiod. The light intensity is maintained at a photosynthetic photon flux density (PPFD) of
240 M/m2/s provided by 40 W cool white fluorescent
lamps.
16. Gestation period of Jatropha curcas is 23 years, and each
fruiting body contains three seeds.
17. Bleaching of explants is performed with 99.5 % ethanol to
remove the chlorophyll content and explants are observed
under the microscope.
18. GUS-positive plantlets are used for the molecular analysis to
confirm the gus and nptII transgenes.
19. After 45-min incubation, slow and careful mixing results in
floating of fibrous nucleic acid, which can be scooped off into
fresh microcentrifuge tube.
20. Pellet may be air-dried for 10 min.
21. The nptII and gus are amplified using respective 20 mers
primers (nptII Fw, CCACCATGATATTCGGCAAC; Rv,
GTGGAGAGGCTATTCGGCTA) and 24 mers (gus Fw,
TAACCTTCACCCGGTTGCCAGAGG; Rv, CCTTAACTA
AGCCGGAATCCATCG).
22. To ensure the isolated DNA is of high quality, the DNA sample
is examined by running 1 % agarose gel electrophoresis.
References
1. Fairless D (2007) Biofuel: the little shrub that
could may be. Nature 449:652655
2. Tatikonda L, Wani SP, Kannan S, Beerelli N,
Sreedevi TK, Hoisington DA, Devi P, Varshney
RK (2009) AFLP-based molecular characterization of an elite germplasm collection of Jatropha
curcas L. a biofuel plant. Plant Sci 176:505513
3. Kajikawa M, Morikawa K, Inoue M, Widyastuti
U, Suharsono S, Yokota A, Akashi K (2012)
Establishment of bispyribac selection protocols for Agrobacterium tumefaciens- and
Agrobacterium rhizogenes-mediated transformation of the oil seed plant Jatropha curcas

L. Plant Biotechnol 29:145153
4. Akbar E, Yaakob Z, Kamarudin SK, Ismail M,
Salimon J (2009) Characteristic and composition of Jatropha curcas oil seed from Malaysia
and its potential as biodiesel feedstock. Eur
J Sci Res 29:396403
5. Shanker C, Dhyani SK (2006) Insect pests of
Jatropha curcas L. and the potential for their
management. Curr Sci 91:162163

6. Herbison ED, Crossley S (2006) Spodoptera
litura (Fabricius, 1775) (updated December
2006). www.usyd.edu.au/museums/larvae/
acro/litura.html
7. Narayana DSA, Shakarappa KS, Govindappa
MR, Pameela HA, Rao MRG, Rangaswamy KT
(2006) Natural occurrence of Jatropha mosaic
virus disease in India. Curr Sci 95: 584586
8. Raj SK, Snehi SK, Kumar S, Khan MS, Pathre
U (2008) First molecular identification of
begomovirus in India that is closely related to
Cassava mosaic virus and causes mosaic and
stunting of Jatropha curcas L. Aust Plant Dis
Notes 3:6972
9. Ramkat RC, Calari A, Maghuly F, Laimer M
(2011) Biotechnological approaches to determine the impact of viruses in the energy crop
plant Jatropha curcas. Virol J 8:386
10. Li M, Li H, Jiang H, Pan X, Wu G (2007)
Establishment of an Agrobacterium mediated
cotyledon disc transformation method for J.
curcas. Plant Cell Tiss Org Cult 92:173181
11. Purkayashta J, Sugla T, Paul A, Mazumdar P,
Basu A, Solleti SK, Mohommad A, Ahmed Z,
Sahoo L (2010) Efficient in vitro plant regeneration from shoot apices and gene transfer by
particle bombardment in Jatropha curcas. Biol
Plant 54:1320
12. Pan J, Fu Q, Xu ZF (2010) Agrobacterium
tumefaciens-mediated transformation of bio-
13.
14.
15.
16.
17.
18.
35
fuel plant Jatropha curcas using kanamycin

selection. Afr J Biotechnol 39:64776481
Kumar N, Anand KGV, Pamidimarri DVNS,
Sarkar T, Reddy MP, Radhakrishnan T, Kaul T,
Reddy MK, Sopori SK (2010) Stable genetic
transformation of Jatropha curcas via
Agrobacterium tumefaciens-mediated gene
transfer using leaf explants. Ind Crop Prod
32:4147
Mazumdar P, Basu A, Paul A, Mahanta C,
Sahoo L (2010) Age and orientation of the
cotyledonary leaf explant determine the efficiency of de novo plant regeneration and
Agrobacterium tumefaciens mediated transformation in Jatropha curcas L. Afr J Biotechnol
76:337344
Birch RG (1997) Plant transformation: problems and strategies for practical application.
Plant Physiol Plant Mol Biol 48:297326
Hiei Y, Komari T (2006) Improved protocols
for transformation of Indica rice mediated by
Agrobacterium tumefaciens. Plant Cell Tiss
Org Cult 85:271283
Murashige T, Skoog S (1962) A revised medium
for rapid growth and bioassay with tobacco
Jefferson RA, Kavanagh TA, Bevan MW
(1987) GUS fusions: -glucuronidase as a
sensitive and versatile gene fusion marker in
higher plants. EMBO J 6:39013907
Chapter 4
Sesame (Sesamum indicum L.)
Sonia Kapoor, Sanjay S. Parmar, Manju Yadav, Darshna Chaudhary,
Manish Sainger, Ranjana Jaiwal, and Pawan K. Jaiwal
Abstract
Sesame (Sesamum indicum L.) is an important oilseed crop grown in India, China, Korea, Russia, Turkey,
Mexico, South America, and several countries of Africa. Sesame seeds are rich in oil, proteins, unsaturated
fatty acids, vitamins, minerals, and folic acid. Nearly 70 % of the worlds sesame is processed into oil and
meal, while the remainder is channeled to food and confectionery industries. Production of sesame is limited by several fungal diseases, water logging, salinity, and shattering of seed capsules during harvest.
Introgression of useful genes from wild species into cultigens by conventional breeding has not been successful due to postfertilization barriers. The only alternative for the improvement of S. indicum is to transfer genes from other sources through genetic transformation techniques. Here, we describe a simple, fast,
and reproducible method for the Agrobacterium-mediated genetic transformation of S. indicum which
may be employed for the transfer of desirable traits into this economically important oilseed crop.
Key words Agrobacterium tumefaciens, Genetic transformation, nptII, Sesame, Sesamum indicum, uidA
Introduction
Sesame (Sesamum indicum L.), an oilseed crop of the family
Pedaliaceae, is one of the oldest cultivated crops of the world with
total production of 3.3 million tons (FAOSTAT data 2008). Sesame
seeds are rich in oil (5060 %), protein (25 %), unsaturated fatty
acids, vitamins, minerals, and folic acid. They are used in baking,
candy making, health-care products, and biomedicine. Nearly 70 %
of sesame seeds are processed into oil [1]. Sesame oil has numerous
health benefits as it contains potent natural antioxidants such as sesamolin, sesamin, and sesamol [2] and is also a source of linoleic acid.
It has low levels of saturated fatty acids (15 %) and recently found to
be beneficial in lowering cholesterol levels and hypertension [3, 4]
and in reducing incidence of certain cancers [5, 6]. Production of
sesame is severely affected by biotic as well as abiotic constraints
which mainly include fungal diseases, photosensitivity, and early
senescence resulting in losses ranging from 10 to 90 % of the yield.
37
38
Sonia Kapoor et al.
In addition to these, considerable loss in yield occurs due to

shattering of seed capsule, particularly during machine harvest.
Introgression of desirable gene from wild relatives to cultigens via
conventional breeding has not been possible due to postfertilization barriers [7]. Genetic transformation is a versatile technique
which offers an opportunity for the improvement of S. indicum in
a precise, speedy, and reliable manner.
An efficient in vitro regeneration system remains a prerequisite
for the improvement of any plant species via genetic transformation
procedures. Owing to the recalcitrant nature of sesame, direct
shoot organogenesis has been attempted with some success from
different explants of sesame including mature embryos, immature
embryos, cotyledons, hypocotyls, shoot tips, and root segments as
well as via somatic embryogenesis [819]. Agrobacterium
tumefaciens-mediated genetic transformation of sesame was first of
all reported by us [16] and subsequently by Al-Shafeay et al. [20]
using cotyledons as explants. Here, we describe a simple, fast, and
efficient protocol for Agrobacterium tumefaciens-mediated genetic
transformation of sesame achieved through development of an efficient plant regeneration method via direct multiple shoot organogenesis with average transformation frequency of 1.01 % [16].
Cotyledon explants excised from 2-day-old seedlings were cocultivated with Agrobacterium tumefaciens strain EHA105 harboring
binary vector pCAMBIA2301 carrying the genes encoding for
neomycin phosphotransferase (nptII) and beta-glucuronidase
(uidA), both driven by the CaMV35S promoter. Inoculated
explants are cultured on kanamycin selection medium, and the
shoots recovered are then subjected to the second round of selection at the rooting stage. Putative transformed plantlets are transferred to pots containing soil, manure, and sand in 1:1:1. Integration
and expression of transgenes is analyzed by PCR, Southern hybridization, and GUS assay [21]. The average transformation efficiency
of sesame was 1.01 %, and 2024 weeks was required for the generation of transgenic seeds. This is a very simple transformation
protocol that can be used for transferring new traits into sesame.
2
2.1
Materials
Tissue Culture
1. Healthy seeds of Sesamum indicum variety HT-1 were

obtained from CCS Haryana Agriculture University, Hisar.
2. 70 % (v/v) ethanol.
3. 25 % (v/v) commercial bleach containing few drops of Tween 20.
4. MS vitamin stock (200, [22]): For 1 L stock, weigh 0.02 g
glycine, 0.1 g nicotinic acid, 0.4 g thiamine HCl, 0.1 g pyridoxine HCl; dissolve in 1,000 mL distilled water and store in
amber-colored bottle at 4 C.
39
5. N6-benzyladenine (BA): 1 mM stock. Dissolve 22.5 mg of BA

in few drops of 1 N NaOH, add autoclaved distilled water to
100 ml, and store at 4 C in aliquots.
6. Indole-3-butyric acid (IBA): 1 mM stock. Dissolve 20.4 mg of
IBA in few drops of ethanol, add autoclaved distilled water to
make 100 mL, filter sterilize, and store at 4 C in aliquots.
7. Cefotaxime: 125 mg/mL stock. Dissolve 125 mg of cefotaxime
in 1 mL distilled water, and filter sterilize the stock prior to use.
8. Kanamycin monosulfate: 100 mg/mL stock. Weigh 100 mg
of kanamycin and dissolve in 1 mL of distilled water, filter sterilize, and store at 20 C.
9. MS medium: 4.3 g/L Murashige and Skoog salts supplied
without vitamins + 5 mL MS vitamin stock + 100 mg myoinositol + 30 g/L sucrose + 8 g/L agar (plant tissue culture grade).
Adjust the pH of the medium to 5.8 with 1 N NaOH prior to
autoclaving.
10. Shoot regeneration medium (SRM): 4.3 g/L MS salts, 5 mL
vitamin stock, 100 mg myoinositol, 30 g/L sucrose, and
25 mL/L BA; adjust pH to 5.8 by using 1 N NaOH and add
8 g/L agar. Autoclave the medium, cool to ~55 C, and add
3.2 mL of 125 mg/mL cefotaxime stock (final concentration
400 mg/L) and 0.25 mL of 100 mg/mL kanamycin stock
(final concentration 25 mg/L).
11. Rooting medium (RM): 4.3 g/L MS salts, 5 mL vitamin
stock, 100 mg myoinositol, and 30 g/L sucrose; adjust pH to
5.8 by using 1 N NaOH and add 8 g/L agar. Filter-sterilized
2 mL/L IBA and 5 mg/L kanamycin are added after autoclaving when the medium is cooled.
12. GUS solution: For 25 mL, add 5 mL of 0.5 M sodium phosphate buffer (pH 7.0), 2.5 mL of 10 mM EDTA (pH 8.0),
2.5 mL of 50 mM potassium ferricyanide, 2.5 mL of 50 mM
potassium ferrocyanide, 2.5 mL of 1 % Triton-X-100, and
10 mL distilled water. Dissolve 25 mg 5-bromo-4-chloro-3indolyl--D-glucuronide (X-gluc) in 23 drops of dimethylformamide in a glass vessel, by pipetting up and down until the
liquid looks clear. Pour the buffer solution in the X-gluc solution, mix well, filter sterilize, and store at 20 C.
2.2 Agrobacterium
tumefaciens Strains
and Selectable
Markers
The disarmed Agrobacterium strain EHA105 harboring a binary

vector pCAMBIA2301, which contains npt II and uidA genes,
under the control of CaMV35S promoter, as selectable and
scorable markers, was used for transformation.
2.3 Culture Media

for Agrobacterium
tumefaciens
1. Yeast extract-mannitol medium (YEM): For 1 L, weigh and

dissolve 1 g of yeast extract, 10 g of mannitol, 0.1 g NaCl,
0.2 g MgSO47H2O, and 0.5 g K2HPO4 in 800 mL of distilled
40
Sonia Kapoor et al.
water. Adjust pH to 7.2 with 1 N NaOH, make volume to

1,000 mL, and autoclave prior to use. Then, cool to 50 C
before adding the selective agent kanamycin 50 mg/L and
rifampicin 50 mg/L.
2.4 Culture Medium
for Cocultivation
1. Cocultivation medium (CM): 4.3 g/L MS salts, 5 mL vitamin

stock, 30 g/L sucrose, and 25 mL/L BA; adjust pH to 5.8 by
using 1 N NaOH. Then filter-sterilized 1 mL/L acetosyringone, 4 mL/L L-cysteine, and 1 mL/L dithiothreitol are
added after autoclaving when the medium is cooled.
2. Dithiothreitol (DTT): 1 M stock solution. Dissolve 0.077 g
DTT in 0.5 mL distilled water and store at 20 C.
3. L-Cysteine: 100 mg/L stock. Weigh 100 mg of L-cysteine and
dissolve in 1 mL of distilled water, filter sterilize, and store at 4 C.
4. Acetosyringone: 20 mM stock. Weigh 19.62 mg of acetosyringone and dissolve in 12 mL and dissolve by gentle shaking.
Make volume to 5 mL by adding distilled water and filter
sterilize and store in aliquots at 20 C.
Methods
3.1 Explant
Preparation and
Culture Conditions
1. Surface sterilize healthy and uniform sesame seeds with 70 %

ethanol for 2 min and then with commercial bleach solution
containing Tween 20 for 15 min under aseptic conditions (in
a laminar airflow).
2. Wash the seeds five to six times with sterile distilled water and
transfer to a sterile Petri dish lined with sterile filter paper
moistened with autoclaved distilled water. Wrap the Petri dish
with aluminum foil and keep in the dark for 2 days at 25 2 C.
3. Prepare the entire cotyledon (1 cm 0.5 cm) explants (Fig. 1a)
from 2-day-old germinated seedlings by cutting close to the
embryonic axis with care to avoid shoot apices and cocultivate
with Agrobacterium culture.
3.2 Agrobacterium
Inoculum Preparation
and Cocultivation
1. Inoculate a single colony of Agrobacterium tumefaciens strain

EHA105 harboring the binary plasmid pCAMBIA2301 in
20 mL of YEM medium containing 50 mg/L kanamycin and
50 mg/L rifampicin and incubate at 28 C on orbital shaker
at 200 rpm for 1618 h, till the OD600 of bacterial culture
reaches 0.7.
2. Centrifuge the culture at 3,783 g for 5 min, discard the
supernatant, and resuspend the pellet liquid cocultivation
medium (CM).
3. Immerse the cotyledon explants excised from 2-day-old seedlings in bacterial suspension in a Petri dish for 2025 min with
occasional shaking.
41
Fig. 1 In vitro regeneration of multiple shoots and Agrobacterium-mediated transformation of Sesamum indicum cv. HT-1. (a) Cotyledon explants excised from 2-day-old seedlings. (b) Direct shoot regeneration from
cotyledon explants on MS medium supplemented with 25.0 M BA after 4 weeks of culture. (c) Induction of
roots from in vitro regenerated shoot cultured on MS basal medium supplemented with 2.0 M IBA. (d) In vitro
regeneration of shoots from non-transformed control explants cultured on MS + 25.0 M BA medium without
kanamycin (i), non-transformed control explants cultured on MS + 25.0 M BA medium containing 25.0 mg/L
kanamycin showing regeneration of completely bleached shoots (ii), and explants inoculated with Agrobacterium
tumefaciens strain EHA105 (pCAMBIA2301) and cultured on MS + 25.0 M BA medium containing 25.0 mg/L
kanamycin showing regeneration of green shoots (iii). (e) Fertile transgenic plant growing in pot. Scale bars:
1 mm (a), 2.5 mm (b), 7.5 mm (c), 5 mm (d), 2 mm (e) (Reproduced from Yadav et al. 2010 [16], with permission from Springer)
4. Blot the inoculated explants on sterile filter paper and coculture in Petri dish lined with sterile filter paper moistened with
liquid cocultivation medium (CM) for 3 days under a 16-h
photoperiod with light intensity of 80 mol/m2/s at 25 2 C
(see Notes 1 and 2).
3.3 Shoot
Regeneration
and Selection
1. After cocultivation for 3 days, wash the explants thoroughly

with sterile distilled water with vigorous stirring and then blot
dry on sterile filter paper.
42
Sonia Kapoor et al.
2. Culture the explants on semisolid shoot regeneration medium

(SRM) containing 25 mg/L kanamycin and 400 mg/L
cefotaxime. Maintain the cultures in single layer on the shelf of
a tissue culture rack at 25 2 C under cool white fluorescent
lights with light intensity of 80 mol/m2/s.
3. Subculture the explants on fresh medium with the same level
of antibiotics every 2 weeks for 46 weeks to recover green
shoots (Fig. 1diii). On an average, 25 % of explants regenerate
green shoots on the selection medium.
3.4
Rooting
1. Transfer the green shoots longer than 3 cm to the rooting

medium MS + 2.0 M IBA containing 5 mg/L kanamycin.
2. Nearly 40 % of the putative transgenic shoots develop roots
directly from the base in 1015 days of culture (see Note 3).
3.5 Hardening
and Acclimatization
of the Plants
1. Gently remove the well-rooted plants from culture tubes and

wash under running tap water to remove the media attached
to the roots.
2. Transfer the regenerated plantlets with well-developed roots
to 5-in. pots containing soil-manure-sand in 1:1:1 ratio and
label the plants.
3. Cover the plants with polythene bags to maintain high humidity for the first few days.
4. After 7 days, gradually reduce the humidity by making holes in
the polythene bag to harden the plants.
5. The hardened plants are grown to maturity in the greenhouse
at 28 2 C with 60 % relative humidity under 16-h photoperiod with light intensity of 80 mol/m2/s to collect seeds
(see Note 4).
6. On an average, each plant produces 810 pods with 5070
seeds (Fig. 1e).
3.6 Screening
of Transgenics
Independent transgenic lines transferred to the greenhouse are subjected to molecular analysis to check the presence, integration, and
expression of transgenes (see Notes 6 and 7). Transient and stable
histochemical GUS analysis can be performed on various tissues.
1. Transient GUS activity is determined immediately after cocultivation. Explants thoroughly washed with sterile distilled
water are analyzed.
2. Stable expression of the uidA gene is determined by performing GUS assay for all plants in all generations. Various tissues
like leaves, stem, roots, and pollen of putative plants established in soil can be used for assay.
3. Immerse the tissues in freshly prepared GUS assay solution
and incubate overnight at 37 C (see Note 5).
43
4. On the following day, remove the assay solution and decolor

the tissue in 70100 % ethanol.
5. Observe under the light microscope and photograph
(Fig. 2al).
Fig. 2 Transient and stable GUS activities in various tissues of transgenic plants. Transient GUS assay in
(a) non-transformed (control) explants not showing GUS activity and (b) cotyledon explants showing GUS activity after 2 days of cocultivation with Agrobacterium tumefaciens EHA105 (pCAMBIA2301). Stable GUS assay in
roots from non-transformed (c) and transformed (d) plants; shoots from non-transformed (e) and transformed
(f) plant; anthers from non-transformed (g) and transformed (h) plant; pollen grains from non-transformed
(i) and transformed (j) plant; and germinating seeds from non-transformed (k) and transformed (l) plant.
Transgenic plants were recovered and rooted on kanamycin-containing medium and germinated T1 seeds
(Reproduced from Yadav et al. 2010 [16], with permission from Springer)
44
Sonia Kapoor et al.
Notes
1. Inoculation and cocultivation steps are crucial for the success
of any transformation experiment. Bacterial concentration at
106 cells/mL, bacterial inoculation time for 20 min, and
cocultivation for 2 days in the presence of BAP 25.0 M and
acetosyringone 20.0 M at pH 5.5 under light conditions
were effective in improving transformation efficiency.
2. Inclusion of a combination of thiol compounds, L-cysteine
(400 mg/L), and DTT (1.0 mM) in the cocultivation medium
completely inhibited the browning and necrosis of explants. It
increased the percentage of explants showing intense transient
GUS activity and also improved the survival of explants on the
selection medium.
3. Kanamycin at a concentration of 5 mg/L completely inhibited
rooting in non-transformed control plants indicating that root
induction is more sensitive to kanamycin than shoot organogenesis which is inhibited at 25 mg/L.
4. At the onset of pod maturation, the pods should be covered
with polythene bags to prevent seed loss due to pod
shattering.
5. GUS assay solution should be stored at 20 C in small aliquots of 1 mL to avoid repeated freezing and thawing. Before
use, thaw at room temperature since the components degrade
in heat immediately.
6. To check presence and integration of transgenes, extract total
genomic DNA from young leaves of putative transgenic and
non-transformed (control) plants by GenElute Plant Genomic
DNA Miniprep Kit (Sigma). Perform PCR for presence of
nptII and uidA genes using specific primers. To analyze the
putative transformants by Southern blotting, digest the
genomic DNA with restriction enzyme that has a single recognition site in the plasmid, resolve on 0.8 % agarose gel, transfer
onto nylon membrane (Hybond N+, Amersham) using standard protocol, and probe the blot with labeled (radioactive or
nonradioactive) PCR-amplified fragment of the nptII gene.
7. Analyze the progeny of self-pollinated transformants for the
presence of uidA gene by PCR and RT-PCR. For RT-PCR,
isolate total RNA from leaves of T1 transformed (positive for
uidA gene) and non-transformed control plants using RNeasy
Plant Mini Kit (Qiagen, USA). Use 100 ng of total RNA and
perform RT-PCR as per the instructions of the manufacturer
using the Single-Step RT-PCR Kit (Qiagen, USA). Separate
the amplified products on 1 % agarose gel and stain with ethidium bromide to visualize the bands.
45
References
1. Morris JB (2002) Food, industrial, nutraceutical and pharmaceutical uses of sesame genetic
resources. In: Janick J, Whipkey A (eds) Trends
in new crops and new uses. ASHS, Alexandria,
VA, pp 153156
2. Brar GS, Ahuja L (1997) Sesame: its culture,
genetics, breeding and biochemistry. Ann Rev
Plant Sci 1:245313
3. Sankar D, Sambandam G, Rao MR, Pugalendi
KV (2004) Impact of sesame oil on nifedipine
in modulating oxidative stress and electrolytes
in hypersensitive patients. Asia Pac J Clin Nutr
13:107
4. Frank J (2005) Beyond vitamin E supplementation: an alternative strategy to improve vitamin status. J Plant Physiol 162:834843
5. Hibasami H, Fujikawa T, Takeda H, Nishibe
S, Sato T, Fujisawa T, Nakashima K (2000)
Induction of apoptosis by Acanthopanax senticosus harms and its component, sesamin in
human stomach cancer KATO III cells. Oncol
Rep 7:12131216
6. Miyahara Y, Hibasami H, Katsuzaki H, Imai
K, Komiya T (2001) Sesamolin from sesame
seeds inhibits proliferation by inducing apoptosis in human lymphoid leukemia Molt4B
cells. Int J Mol Med 7:369371
7. Rao KR, Kishore PBK, Vaidyanath K (2002)
Biotechnology of sesamean oilseed crop.
Plant Cell Biotechnol Mol Biol 3:101110
8. Saravanan S, Nadarajan N (2005) Effects of
media supplements on in vitro response of sesame (Sesamum indicum L.) genotypes. Res J
Agric Biol Sci 1:98100
9. Ram R, Catlin D, Romero J, Cowley C (1990)
Sesame: new approaches for crop improvement. In: Janick J, Simon JE (eds) Advances in
new crops. Timber, Portland, pp 225228
10. Baskaran P, Jayabalan N (2006) In vitro mass
propagation and diverse callus orientation on
(Sesamum indicum L.) an important oil plant.
J Agric Technol 2:259269
11. Chakaborti P, Ghosh A (2010) Variation in
callus induction and root-shoot bud formation
depend on seed coat of sesame genotypes.
Russ J Bot 5:1419
12. Kwon TH, Abe T, Sasahara T (1993) Efficient
callus induction and plant regeneration in
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
Sesamum species. Plant Tiss Cult Lett 10:

260266
Seo HY, Kim YJ, Park TI, Kim HS, Yun HS
(2007) High frequency plant regeneration via
adventitious shoot formation from deembryonated cotyledon explants of Sesamum
indicum L. In Vitro Cell Dev Biol Plant
43:209214
Taskin KM, Ercan AG, Turgut A (1999)
Agrobacterium tumefaciens mediated transformation of sesame (Sesamum indicum L.). Turk
J Bot 21:1518
Were BG, Onkware AO, Carlsson AS,
Welander W (2006) In vitro regeneration of
sesame (Sesamum indicum L.) from seedling
cotyledon and hypocotyl explants. Plant Tiss
Org Cult 85:235239
Yadav M, Chaudhary D, Sainger M, Jaiwal PK
(2010) Agrobacterium tumefaciens-mediated
genetic transformation of sesame (Sesamum
indicum L.). Plant Tiss Org Cult 103:
377386
Ahmed MM, Abdellatef E, Khalfallah MM
(2008) In vitro multiple shoot regeneration in
elite Sudanese sesame cultivars (Sesamum indicum L.). Am Eurasian J Sustain Agric 2:
308314
Abdellatef E, Ahmed MM, Daffalla HM,
Khalfallah MM (2010) Enhancement of
adventitious shoot regeneration in sesame
(Sesamum indicum L.) cultivar Promoky using
ethylene inhibitors. J Phytol 2:6167
Mary RJ, Jayabalan N (1997) Influence of
growth regulators on somatic embryogenesis
in sesame. Plant Cell Tiss Org Cult 49:6770
Al-Shafeay AM, Ibrahim AS, Nesiem MR,
Tawfik MS (2011) Establishment of regeneration and transformation system in Egyptian
sesame (Sesamum indicum L.) cv Sohag 1. GM
Crops 2:182192
Jefferson RA, Kavanagh TA, Bevan M (1987)
GUS fusion: betaglucuronidase as a sensitive
and versatile gene fusion marker in higher
plants. EMBO J 6:39013907
Murashige T, Skoog F (1962) A revised
medium for rapid growth and bioassays with
tobacco tissue culture. Physiol Plant 15:
473497
Chapter 5
Sunflower (Helianthus annuus L.)
Laura M. Radonic, Dalia M. Lewi, Nilda E. Lpez,
H. Esteban Hopp, Alejandro S. Escandn,
and Marisa Lpez Bilbao
Abstract
Sunflower (Helianthus annuus L.) is still considered as a recalcitrant species to in vitro culture and
transformation in spite of the publication of different protocols. Here we describe a routine transformation
system of this crop which requires mature HA89 genotype seeds and Agrobacterium tumefaciens EHA105
strain for gene delivery, being both easily available. Selection of transformed shoots depends on root development in kanamycin-selective media, instead of shoot color, avoiding selection of escapes. The establishment of this protocol proved successful for the incorporation of both reporter and agronomic important
genes and also for the evaluation of the specific expression patterns of different promoters in transgenic
sunflower plants. Stable expression of the incorporated transgenes was confirmed by RT-PCR and GUS
reporter gene visualization. Stable inheritance of transgenes was successfully followed until T2 generation
in several independent lines.
Key words Agrobacterium tumefaciens EHA105 strain, HA89 mature seeds, Helianthus annuus L,
Kanamycin selection, Sunflower transformation, Transgenic plants
Introduction
Sunflower (Helianthus annuus L.) is one of the most important
sources of edible oil and is becoming important for biofuel production. Total world sunflower seed production is approximately
25.8 million tons which goes almost exclusively to oil extraction,
providing 8.2 % of total world volume. Sunflower oil is considered
a good-quality oil for its light taste and appearance but especially
because it supplies more vitamin E than any other vegetable oil.
Sunflower and peanut are the only major vegetable oil-yielding
crops that have no GM varieties authorized for commercial use.
Sunflower biotechnological improvement is limited to molecular
markers as a result of the lack of an available routine and efficient
transformation protocol, which is one of the main reasons why it is
still described as a recalcitrant species [1].
47
48
Laura M. Radonic et al.
Published transformation systems for sunflower are based on

Agrobacterium-mediated transformation of embryonic axes [24]
and are modifications of the scheme shown by Molinier et al. [5]:
imbibition of seeds, excision of embryonic axes, coculture with
Agrobacterium tumefaciens, induction of shoots, recovery of transformed shoots, selection on kanamycin, shoot elongation, graft
transfer to the greenhouse, and acclimatization. All published protocols suffer from low overall transformation efficiencies [69].
The efficient selection of transgenic plants is an important
aspect of any transformation protocol. Previous research of our
group showed that kanamycin incorporation in well-defined steps
of morphogenesis, including rooting-inducing medium, allowed a
clear-cut discrimination between transformed and non-transformed
shoots, as only transformed shoots were able to develop roots. At
the same time, it was shown that there was no association between
shoot color and the presence of the transgene; therefore, this
physiological condition must not be considered as a selection criterion in sunflower transformation [10]. Until now, this protocol is
the only one in which the selection criterion is the in vitro root
development in the presence of kanamycin.
The protocol described in this chapter uses A. tumefaciens
EHA105 strain, split mature seeds from HA89 sunflower genotype, and kanamycin selection. Application of this procedure produced no selection escapes and allowed the efficient production of
transgenic sunflower plants carrying either reporter or agronomic
important genes [11]. Moreover, it demonstrated to be useful for
evaluating the specific control exerted by different promoters in
sunflower transformed T0 plants [12] and in T2 plants [13].
Depending on the genetic construction used, mean transformation
efficiency varied from 2.23 to 7.06 % (measured as PCR-positive
plants/total plants that reached the rooting medium).
2
2.1
Materials
Genotypes
Helianthus annuus L. public inbred line HA89 seeds were provided

by EEA INTA Balcarce (see Note 1).
2.2 Agrobacterium
tumefaciens Strain
and Plasmid
1. A. tumefaciens EHA105 strain [14].
2.3 A. tumefaciens
Culture Media
1. Minimum A medium (Min A): 10.5 g/L KH2PO4, 4.5 g/L

K2HPO4, 1 g/L (NH4)2SO4, 0.5 g/L sodium citrate2H2O,
0.2 g/L MgSO47H2O, 2 g/L glucose, pH 7. For solid
medium, add 10 g/L type A agar. Sterilize by autoclaving.
Adequate filter-sterilized antibiotics are added just before starting bacterial culture.
2. Plasmid pGUS-INT [15]: contains the uidA gene with an

intron under the control of the CaMV35S promoter and the
nptII gene under the control of the nos promoter.
49
2. Agroinfection induction medium (AIM): 10.5 g/L K2HPO4,

4.5 g/L KH2PO4, 1 g/L (NH4)2SO4, 5 mg/L sodium
citrate2H2O, 0.26 g/L MgSO47H2O, 2 g/L glucose,
5 mL/L glycerol, pH 6.57. Store in the dark. Acetosyringone
in a final concentration of 58.8 mg/L is added before starting
bacterial culture.
3. Kanamycin monosulfate: 50 mg/mL stock solution in water,
filter-sterilized (0.22-m syringe filter) and stored in 1-mL aliquots at -20 C. Working concentration is 50 mg/L for
bacteria-growing media.
4. Rifampicin: 100 mg/mL stock solution in methanol,
filter-sterilized and stored in 1-mL aliquots at 20 C. Light
sensitive. Working concentration is 100 mg/L.
5. Acetosyringone: 40 mg/mL stock solution in dimethyl sulfoxide (DMSO) stored in 1-mL aliquots at 20 C.
2.4 Sunflower
Explant Culture Media
All media are sterilized by autoclaving in 500-mL flasks at 121 C,

1.2 bars for 15 min, and stored at room temperature. Growth regulators, antibiotics, and vitamins are added to the medium after
autoclaving. Solid culture media are aliquoted as 20 mL/Petri dish
or 8 mL/tube under the flow hood. Store at 48 C. Glass culture
tubes (12-cm height and 2.5-cm width) are covered with cotton
cups and autoclaved.
1. Half-strength Murashige and Skoog (MS1/2) [16]: 2.15 g/L
MS salts, 10 g/L sucrose, 8 g/L type A agar, pH 5.7.
2. Coculture medium: 4.3 g/L MS salts, 2 mL/L MS vitamins,
3.1 g/L KNO3, 200 mg/L myoinositol; 500 mg/L casein,
30 g/L sucrose, 10 g/L glucose, 0.5 g/L
4-morpholineethanesulfonic acid (MES) buffer, pH 5.7, 8 g/L
type A agar, 0.5 mg/L benzylaminopurine (BAP), 0.2 mg/L
naphthaleneacetic acid (NAA), 20 mg/L acetosyringone.
3. Base regeneration medium (Re): 4.3 g/L MS salts, 2 mL/L
MS vitamins, 3.1 g/L KNO3, 200 mg/L myoinositol, 30 g/L
sucrose, 8 g/L type A agar, pH 5.7.
4. Re1 medium: Re medium plus 0.3 g/L ticarcillin disodium/
clavulanate potassium, 0.2 mg/L BAP, 0.01 mg/L NAA,
0.82 mg/L AgNO3, 1 mg/L kanamycin.
5. Re2 medium: Re medium plus 0.3 g/L ticarcillin disodium/
clavulanate potassium, 0.2 mg/L BAP, 0.82 mg/L AgNO3,
10 mg/L kanamycin.
6. Re3 medium: 0.3 g/L ticarcillin disodium/clavulanate potassium, 0.1 mg/L BAP, 0.82 mg/L AgNO3, 50 mg/L
kanamycin.
7. Re4 medium: 0.3 g/L ticarcillin disodium/clavulanate potassium, 0.82 mg/L AgNO3, 50 mg/L kanamycin.
50
8. Rooting medium (RA): 2.1 mg/L MS salts, 5 g/L thiamine

HCl, 50 mg/L myoinositol, 10 g/L sucrose, 0.5 mg/L ancymidol, 8 g/L type A agar. pH 5.7. 0.3 g/L ticarcillin disodium/clavulanate potassium, 0.1 g/L NAA, 50 mg/L
kanamycin.
9. MS vitamins: 2 mg/L glycine, 100 mg/L myoinositol,
0.5 mg/L nicotinic acid, 0.5 mg/L pyridoxine HCl, 0.1 mg/L
thiamine HCl.
10. 1 mg/mL BAP stock: dissolve 50 mg of BAP in 10 mL 1 N
NaOH and make to 50 mL with water. Filter sterilize and store
in 1 mL aliquots at 20 C.
11. 1 mg/mL NAA stock: dissolve 50 mg of ANA in 10 mL 1 N
NaOH and make to 50 mL with water. Filter sterilize and store
in 1 mL aliquots at 20 C.
12. Ticarcillin disodium/clavulanate potassium: 150 mg/mL
stock solution in water and stored in 1-mL aliquots at 20 C.
13. AgNO3: 10 mg/mL stock solution in water, filter-sterilized
and stored in 1-mL aliquots at 20 C. Light sensitive.
14. Soil mix: 40 % soil, 30 % peat, 20 % manure, and 10 % perlite.
15. GA3 (gibberellic acid): dissolve 50 mg of gibberellic acid in
10-mL absolute ethanol and make to 50 mL with water. Filter
sterilize and store at 20 C.
Methods
3.1 Seed
Disinfection
1. Place 50 seeds in 100-mL flasks, rinse for 30 s in ethanol 70 %.

The following steps must be carried out under the flow hood.
2. Wash in 20 mL/L Plant Preservative Mixture (PPM, Plant
Cell Technology Inc., EUA) plus 0.05 mg/mL MgCl2 with
gentle stirring at 22 C overnight.
3.2 Explant
Preparation
1. Place the disinfected seeds in a glass Petri dish under the flow
hood.
2. Dehull seeds with the help of a scalpel and place ten seeds per
Petri dish containing 20-mL MS1/2.
3. Culture in the dark for 24 h. Seeds that do not develop a growing radicle are discarded.
3.3 A. tumefaciens
Culture
1. Streak Agrobacterium tumefaciens from glycerol stock on

Min A plates (with antibiotics) and culture at 28 C for
2 days (see Note 2).
2. Transfer complete culture with a spatula to 100 mL of AIM
liquid medium and culture on an orbital shaker at 60 rpm at
28 C until OD660 is 0.20.5 (approximately 2 h) (see Note 3).
3.4
Cocultivation
51
1. Subject seeds to a 45 C heat shock for 15 min and then

submerge 20 seeds in Petri dishes containing 15 mL of the
bacterial culture. As a control, ten seeds are submerged in the
AIM medium without bacteria.
2. Cut and discard the radicle and the internal thin membrane with
the help of a scalpel and forceps under a binocular microscope.
3. Cut through the middle of the meristem and the cotyledons.
Each piece contains half of the apical meristem and one cotyledon (Fig. 1).
4. Vacuum-infiltrate for 10 min at 2025 psi to improve explantbacteria contact.
5. Incubate at room temperature for 2 h in half-light with occasional manual stirring.
6. Remove explants from the bacterial culture and dry explants
on filter paper for 5 min. Transfer with the cut side up into the
coculture medium (ten explants per Petri dish).
7. Coculture with A. tumefaciens for 4 days in the dark at 22 C.
8. At this point it is possible to perform GUS histochemical analysis [17] of a few explants to evaluate if transformation was
successful. GUS-positive areas should be observed in the meristematic tissue.
Fig. 1 Sunflower explant preparation scheme. (a) Germinated seed; lines

represent the corresponding cuts performed to remove the radicle and to separate both cotyledons. (b) Obtained explant carrying half of the meristem and a
cotyledon
52
3.5 Selection
and Regeneration
of Transgenic Plants
Regeneration steps are carried out in a culture chamber under a

16-h photoperiod at 22 C (day) and 18 C (night). Light condition: 70 mol/m2/s provided by fluorescent tubes.
1. Transfer explants to Re1 medium in 90 mm 10 mm Petri
dishes for 1014 days.
2. Transfer explants to Re2 medium in 90 mm 25 mm Petri
dishes for 710 days. At this time shoots can be observed
emerging from the meristematic zone.
3. Detach shoots from the originating cotyledon and transfer to
Re3 medium culture tubes for 710 days. If shoots are smaller
than 1 cm, a small part of the originating cotyledon is
maintained.
4. Transfer shoots to Re4 medium culture tubes for 1014 days.
At this point, all shoots are detached from the remaining originating cotyledon. Some agroinfected shoots develop a small
root in this step; in this case, go to step 6.
5. Transfer to RA medium culture tubes for 2025 days. If necessary a second passage in the RA medium is done until roots are
developed. Control and non-transformed shoots will not
develop a root in kanamycin-containing media.
6. Rooted shoots are transferred to the greenhouse.
3.6 Transfer
to the Greenhouse
1. Primary transformant plants from shoots that survive and root

in kanamycin are transferred to the greenhouse to be acclimated. Greenhouse conditions: 16-h/8-h photoperiod,
24 C 3 C, 140 mol/m2/s light intensity.
2. Acclimatizing: keep shoots in the culture tubes for 48 h before
transferring to soil or grafting.
3. Shoots larger than 2 cm with a vigorous root can be directly
transferred into soil for rustication (see Subheading 3.6.1).
Otherwise, they are grafted (see Subheading 3.6.2).
3.6.1 Transfer to Soil
1. Plantlets with a well-developed root are transferred to 8-L pots

and covered with a nylon bag to prevent dehydration (see Note 4).
2. During the next 5 days, the bag must be progressively opened
by making a 1-cm hole once a day.
3.6.2 Grafting
1. Shoots that survive in kanamycin and develop a weak or short

root are grafted.
2. Rootstock plants (HA89 plants) that developed six to eight
leaves are cut obliquely on the apical portion.
3. Immediately, each shoot is cut obliquely at the base and placed
on the rootstock, making sure that conducting tissues of both
parts are in close contact. The grafting area is tied up with a
53
Fig. 2 Transfer to greenhouse by grafting. Each shoot (a) is cut obliquely at the base (b) and placed on the
rootstock (c). Rootstock tip was previously removed (d) and prepared by performing a longitudinal cut of the
same size as the shoot oblique cut (e, f). Shoot is placed on the rootstock making sure that conduction tissues
of both parts are in close contact, and grafting area is tied up with a cotton ribbon (g), fixed with a clothespin
(h). The whole plant is covered with a nylon bag to prevent dehydration
cotton ribbon, fixed with a small clothespin, and then covered

with a nylon bag to prevent dehydration (Fig. 2).
4. During the next 5 days, the bag must be progressively opened
by making a 1-cm hole once a day.
3.7 Flowering and T1
Seed Harvesting
1. Each T0 plant, transferred to soil or grafted, generally develops

more than one flower head. The heads of these plants, compared with seed-borne plants, are considerably smaller, but
they usually have fertile disk flowers.
2. Auto-pollination is desirable to give rise to achene development. Cover flower heads with a fabric bag to avoid crosspollination.
54
3. Collect T1 seeds from completely mature plants.

4. T1 seeds usually are fertile and they are germinated in sterile
sand wetted with a 5 mg/L solution of GA3.
3.8 Molecular
Analysis
Molecular analysis, such as PCR and Southern, of transgenic plants

can be carried out using leaf discs from T1 plants (see Note 5). T0
shoots can be analyzed by PCR, but it must be taken into account
that they are chimeras; thus, positive transgene amplification in
some leaves does not imply a transgenic offspring.
Notes
1. Complete healthy seeds, with unbroken and undamaged hull,
from field-grown plants.
2. Plates should not be older than 5 days.
3. Culture time depends on the initial inoculum and shaker speed.
4. Smaller pot usage is not recommended, as it may impair root
development and prevent full-length aerial growth.
5. We strongly suggest using CTAB genomic DNA extraction
method [18] including a posterior phenol extraction step.
Acknowledgments
This study was developed at the Instituto de Biotecnologa,
Instituto Nacional de Tecnologa Agropecuaria (INTA),
Argentina, and was supported by grants of ANPCyT (PICTO
ASAGIR N08-13164, PICTO INTA N08-12925) and INTA
(PE AEGR3425, PE AEGR3426).
The authors would like to thank Valeria Peralta and Agustn
Montenegro for greenhouse technical support.
References
1. Mayor ML, Nestares G, Vega T, Zorzoli R,
Picardi LA (2010) Sunflower propagation. In:
Jain SM, Ochatt SJ (eds.) Protocols for in vitro
propagation of ornamental plants, vol. 589.
Methods in molecular biology. Humana,
New York. pp 271280
2. Hahne G (2001) Sunflower. In: Hui Y,
Khatchtourians G, McHughen A, Nip W,
Scorza R (eds) Handbook of transgenic plants.
Marcel Dekker, New York, pp 813883
3. Lewi D, Esteban Hopp H, Escandn A (2006)
Sunflower (Helianthus annuus L.). In: Wang K
(ed.) Agrobacterium protocols, vol. 343.
Methods in molecular biology. Humana Press,
New York. pp 291298
4. Davey MR, Jan M (2010) Sunflower

(Helianthus annuus L.): genetic improvement
using conventional and in vitro technologies. J
Crop Improv 24(4):349391
5. Molinier J, Thomas C, Brignou M, Hahne G
(2002) Transient expression of ipt gene
enhances regeneration and transformation
rates of sunflower shoot apices (Helianthus
annuus L.). Plant Cell Rep 21(3):251256
6. Bidney D, Scelonge C, Martich J, Burrus M,
Sims L, Huffman G (1992) Microprojectile
bombardment of plant tissues increases
transformation frequency by Agrobacterium
tumefaciens.
Plant
Mol
Biol
18(2):
301313

7. Knittel N, Gruber V, Hahne G, Lne P (1994)
Transformation of sunflower (Helianthus annuus L.): a reliable protocol. Plant Cell Rep
14(23):8186
8. Malone-Schoneberg J, Scelonge CJ, Burrus M,
Bidney DL (1994) Stable transformation of
sunflower using Agrobacterium and split
embryonic
axis
explants.
Plant
Sci
103(2):199207
9. Burrus M, Molinier J, Himber C, Hunold R,
Bronner R, Rousselin P, Hahne G (1996)
Agrobacterium-mediated transformation of sunflower (Helianthus annuus L.) shoot apices: transformation patterns. Mol Breed 2(4):329338
10. Radonic LM, Zimmermann JM, Zavallo D,
Lpez N, Lpez Bilbao M (2006) Rooting in
Km selective media as efficient in vitro selection method for sunflower genetic transformation. Electron J Biotechnol 9(3):315319
11. Radonic LM, Zimmermann JM, Zavallo D,
Lpez N, Lpez Bilbao M (2008) Introduction
of antifungal genes in sunflower via
Agrobacterium. Electron J Biotechnol 11(5)
12. Radonic LM (2010) Nuevas estrategias para la
transformacin y expresin de genes de inters
en girasol. PhD thesis, Universidad de Buenos
Aires, Buenos Aires
13. Radonic LM, Lpez NE, Hopp E (2012)
Bilbao ML Analysis of T2 sunflower transgenic
14.
15.
16.
17.
18.
55
plants: high expression level and stability

achieved by the rbcS1 promoter regulation. In:
18th international sunflower conference proceedings, Mar del Plata, Buenos Aires,
Argentina. pp 10151018
Hood E, Gelvin S, Melchers L, Hoekema A
(1993) New Agrobacterium helper plasmids
for gene transfer to plants. Transgenic Res
2(4):208218
Vancanneyt G, Schmidt R, OConnor-Sanchez
A, Willmitzer L, Rocha-Sosa M (1990)
Construction of an intron-containing marker
gene: splicing of the intron in transgenic plants
and its use in monitoring early events in
Agrobacterium-mediated plant transformation.
Mol Gen Genet 220(2):245250
Murashige T, Skoog F (1962) A revised medium
for rapid growth and bio assays with tobacco tissue cultures. Physiol Plant 15(3):473497
(1987) GUS fusions: -glucuronidase as a sensitive and versatile gene fusion marker in higher
plants. EMBO J 6(13):39013907
Saghai-Maroof MA, Soliman KM, Jorgensen
RA, Allard RW (1984) Ribosomal DNA
spacer-length polymorphisms in barley:
Mendelian inheritance, chromosomal location,
and population dynamics. Proc Natl Acad Sci
81(24):80148018
Part II
Root Plants
Chapter 6
Carrot (Daucus carota L.)
Abstract
Plants are susceptible to infection by a broad range of fungal pathogens. A range of proteins have been
evaluated that can enhance tolerance to these pathogens by heterologous expression in transgenic carrot
tissues. The protocols for carrot transformation with Arabidopsis NPR1 (Non-Expressor of PathogenesisRelated Proteins 1) are described in this chapter, using the herbicide resistance gene bar, which encodes
phosphinothricin acetyltransferase, as a selectable marker. In this protocol, petiole segments (0.51.0 cm
long) from aseptically grown carrot seedlings are exposed to Agrobacterium tumefaciens strain LBA4404
for 1030 min and cocultivated for 23 days. Herbicide selection is then imposed for 812 weeks on a
series of different tissue culture media until embryogenic calli are produced. The transfer of the embryogenic calli to hormone-free medium results in embryo development which eventually gives rise to transgenic plantlets. Embryogenic calli can also be propagated in suspension cultures. This protocol has yielded
transgenic carrot plants with defined T-DNA inserts at the rate of between 1 and 3 Southern-positive
independent events out of 100.
Key words Carrot, Disease resistance, Genetic engineering, Pathogenesis-related proteins, Herbicide
resistance
Introduction
Carrot (Daucus carota L. subsp. sativus), a member of the family
Apiaceae, is grown worldwide for its edible taproot, which provides a source of vitamin A and fiber in the diet. Carrot is readily
amenable to tissue culture and transformation, with the production of transgenic plants possible within 6 months. Numerous
transformation methods are available for carrot; however,
Agrobacterium tumefaciens-based methods are by far the most
common, and numerous strains of A. tumefaciens have been shown
to be successful [1]. Additionally, the ability of carrot tissue cultures to rapidly produce somatic embryos makes it a logical target
for molecular pharming of transgenic health products, such as antigens [2, 3], interferons [4], and vaccines [5].
One of the greatest challenges to carrot crop production is the
management of fungal diseases. There are a number of widespread
59
60
pathogens that destroy the foliage and roots, thereby reducing

quality and yield. Genetic resistance to fungal pathogens is lacking
in many commercially grown carrot cultivars in use today. The use
of various genetic engineering approaches to enhance resistance of
plants to fungal pathogens has been reviewed [6]. Currently, our
research focuses on the expression of a number of genes that stimulate the endogenous defense pathways in carrot when challenged
with pathogens, including peroxidases [7] and transcriptional regulators [8]. Here, we describe the protocols for engineering carrot
plants to express the Arabidopsis Non-Expressor of PathogenesisRelated Proteins 1 (AtNPR1), using the bar gene as a selectable
marker, which encodes for phosphinothricin acetyltransferase and
provides herbicide resistance [9]. The methods used for assessing
transgenic plants for resistance to fungal pathogens are described
elsewhere [8].
Materials
Plant Materials
Carrot seed: This protocol is optimized for the open-pollinated

variety Nantes Coreless; however, numerous other openpollinated varieties are easily substituted including Danvers Half
Long, Nanco, Golden State, Scarlet Nantes, and the
experimental high-beta-carotene-producing HCM line. HCM
seeds were donated by Dr. Phil Simon (USDA, University of
Wisconsin, Madison, WI), while the other lines were purchased at
a local wholesale seed supplier.
2.2 Agrobacterium
Strains and Binary
Vector
1. A. tumefaciens strain: This protocol is optimized using the

A. tumefaciens strain LBA4404 (Invitrogen, Carlsbad, CA,
USA 18313-015) (see Note 1).
2.1
2. Plasmid pCambia1300::bar::NPR1 [8]: This binary vector has

the bar selectable marker driven by the CaMV 35S promoter.
However, similar results were obtained with any vector including Gateway vectors with 35S-driven bar genes.
2.3 Culture Media
and Stock Solutions
1. Antibiotic stock solutions: Kanamycin sulfate (50 mg/ml),

streptomycin sulfate (200 mg/ml), and Timentin (30:1
ticarcillin-clavulanic acid 300 mg/ml, SmithKline Beecham).
All antibiotics are dissolved in 18 H2O and filter-sterilized
through 0.22 m filters, and stored at 20 C.
2. Yeast extract-mannitol (YM) medium (for growth of A. tumefaciens): 400 mg/l yeast extract, 10 g/l mannitol, 1.7 mM
NaCl, 0.8 mM MgSO4 and 2.2 mM K2HPO4. The pH is
adjusted to 7.2 with 1 M NaOH prior to autoclaving. Used as
a liquid or agar medium (15 g/l Bacto agar).
61
When culturing Agrobacterium strain LBA4404, YM media is

prepared with 25 mg/l rifampicin, 100 mg/l streptomycin,
and the antibiotic specific for the transformation vector.
Typically, we use 50 mg/l kanamycin for the selection of transformation vectors.
3. 2,4-Dichlorophenoxyacetic acid (2,4-D) stock solution
(0.5 mg/ml): 50 mg of 2,4-D dissolved in 5 ml ethanol and
gradually diluted to 100 ml with H2O and stored at 4 C in the
dark for up to 3 months. 2,4-D is added to the media prior to
autoclaving.
4. Acetosyringone stock solution (0.1 M): 1 g acetosyringone is
dissolved into 50 ml dimethyl sulfoxide (DMSO) and stored at
4 C in foil-wrapped containers. It crystallizes at this temperature but will turn to liquid again once returned to room temperature; 2 l of this stock added to 1 ml of bacterial medium
or 2 ml stock to l l of cocultivation medium would give a final
concentration of 200 M.
5.
DL-Phosphinothricin
(PPT) stock solution (10 mg/ml): DLphosphinothricin/glufosinate ammonia (Phytotechnology

Labs, Lenexa, KS, USA) was dissolved in H2O (10 mg/ml),
filter-sterilized through 0.22 m filters, and stored at 20 C
(see Note 2).
6. Liberty solution: The herbicide Liberty 150 (Bayer Crop

Science, Saskatoon, SK, Canada) was diluted in H2O to 0.4 %
(w/v) and used as an aerosol or painted on the leaf surface
using a cotton swab.
7. Germination and growth of sterile tissue (MSO): Half-strength
Murashige and Skoog (MS) basal media with vitamins [10]
(Phytotechnology Labs, Shawnee, KS, USA cat M524), 10 g/l
sucrose. Adjust pH to 5.8 with 0.5 N KOH. Add 15 g/l agar
and autoclave in 500-ml aliquots for 15 min.
8. Inoculation medium (1/10 MS): One-tenth-strength
Murashige and Skoog basal media, 20 g/l sucrose, 10 g/l glucose. Adjust pH to 5.8 with 0.5 N KOH and autoclave in 500ml aliquots for 15 min.
9. Cocultivation medium (MS1D): Full-strength Murashige and
Skoog basal media with vitamins, 0.1 g/l myoinositol, 30 g/l
sucrose. Increase pH to 5.8 with 0.5 N KOH, add 3.0 g/l
Phytagel (Sigma), and autoclave in 500-ml aliquots for 15 min.
10. Callus initiation medium (MS1D1P): MS1D media with filtersterilized PPT (1 mg/l) and Timentin (300 mg/l). PPT and
Timentin were added once the media cools to 60 C.
11. Callus proliferation medium (MS1/2D10P): MS1D with
0.5 mg/l 2,4-D. Add 10 mg/l PPT and 300 mg/l Timentin
after autoclave.
62
12. Embryo development medium (MS10P): MS1/2D10P media

with the addition of 0.1 g/l myoinositol, lacking the 2,4-D.
13. Somatic embryo propagation in suspension culture
(MS1/4D5P): Liquid MS basal media with vitamins, 0.1 g/l
myoinositol, 30 g/l sucrose, 0.25 mg/l 2,4-D, pH 5.8.
Autoclave in 50-ml aliquots within 250 Erlenmeyer flasks. Add
5 mg/l PPT and 150 mg/l Timentin after sterilization.
2.4 Tissue and Plant
Culture
1. 100 15-mm sterile Petri plates.

2. Autoclaved 3 MM Whatman filter papers.
3. Laboratory sealing film.
4. Magenta GA7 vessels and couplers (Sigma C0667).
5. Six-pack plastic planting containers and 6-in. clear seed starting dome for conditioning plants.
6. Eight-inch plastic pots.
7. Potting medium: Soil mix 4 (Sunshine, Surrey, British
Columbia), containing 5560 % Canadian sphagnum peat
moss, perlite, dolomitic limestone (for pH adjustment), and
gypsum.
Methods
3.1 Sterile
Carrot Tissue
1. Seeds should be soaked overnight in H2O at 4 C and then

washed twice with H2O and once for 5 min with 70 % ethanol.
The seeds are then soaked in 1 % (v/v) NaOCl with a drop of
Tween 20 for 15 min and washed four times with sterile H2O.
2. Sterilized seeds are blotted dry on sterile filter paper, and
approximately 1015 seeds are placed in coupled Magenta
boxes containing 50 ml of MSO media and incubated for 46
weeks at room temperature (22 C) under cool white fluorescent lights (450 mol/m2/s, 16:8-h photoperiod). Once the
plants reach a size of 1520 cm (6 weeks), they are used as
source material for transformations.
3.2 Agrobacterium
Cultures
1. LBA4404 electro-competent cells are thawed on ice and

20 l is added to 100 ng of pCambia-bar-NPR1 binary vector and mixed by swirling with the pipette tip. The mixture
is added to a 0.1-cm cuvette and electroporated at 2 kV,
200 , and 25 F.
2. Following electroporation, 1 ml of YM broth is added, and the
mixture is removed from the cuvette and transferred to a
round-bottomed 15-ml Falcon tube.
3. The contents are agitated on a rotary shaker at 225 rpm and
30 C for 3 h; the cells are then diluted 1:10 with fresh YM
63
and are plated on solid YM medium containing 100 mg/l

streptomycin and 50 mg/l kanamycin, about 100 l of culture
per plate.
4. Plates are incubated for 23 days at 30 C. Single colonies are
isolated and inoculated to fresh YM media. Confirmation of
the transformation vector can be done by either direct colony
PCR using gene-specific primers or plasmid mini-preparation
of Agrobacterium followed by restriction enzyme digestion
and gel electrophoresis.
5. For carrot transformation, a single colony of LBA4404
containing the plasmid pCambia1300::bar::NPR1 is used to
inoculate 50-ml liquid YM supplemented with 100 mg/l
streptomycin and 50 mg/l kanamycin and is grown for ~16 h
on a rotary shaker (250 rpm) at 30 C.
6. Cultures are centrifuged at 3,000 g at room temperature for
15 min. The supernatant is removed and the pellet is resuspended to a density of OD600 = 0.3 (corresponding to approximately 1 108 cells/ml) in 1/10 MS supplemented with
200-M acetosyringone (see Note 3).
3.3
Transformation
1. Sterile petioles are cut into 510-mm-long segments using a

scalpel and incubated in the Agrobacterium suspension in a
plastic Petri plate for 1030 min with gentle shaking. The suspension is then drained and the carrot explants are blotted on
a sterile filter paper and placed onto MS1D. Approximately
2030 explants are placed on a 9-cm Petri plate and cocultivated in the dark for 23 days (see Note 4).
2. Infected explants are subsequently rinsed in sterile H2O, blotted dry, and placed on MS1DP. Positive and negative controls
are included. Positive controls are placed on the medium lacking PPT, while negative controls are noninfected with bacteria
and placed on the selective medium. Incubate at room temperature (22 C) under cool white fluorescent lights
(450 mol/m2/s, 16 h a day). All subsequent steps are incubated under these same conditions.
3. After 2 weeks, explants are transferred to the MS1/2D10P
medium and maintained on this medium, with transfers made
every 4 weeks, until calli develop. Somatic embryos typically
begin to appear 812 weeks following infection. Nonembryogenic calli are maintained for up to 20 weeks and discarded at that time if embryos have not developed. Typically,
about 12 % of the petiole explants will form callus, with
approximately 75 % of the calli formed leading to the development of somatic embryos.
4. Somatic embryos are transferred to MS10P for regeneration.
Alternatively, the embryogenic calli are transferred into conical
64
flasks (250 ml) containing 50 ml of liquid MS1/4D5P (50 ml)

for initiating suspension cultures. Suspension embryos should
be transferred to fresh medium every 23 weeks and maintained under constant shaking on a rotary shaker at 200 rpm.
5. Washing the somatic embryos with sterile water and plating
them on MSO medium will result in the formation of new
plantlets within 34 weeks. The plantlets should be subcultured on MS10P, resulting in ~75 % germination of somatic
embryos.
6. The tiny plantlets or small shoots are transferred to Magenta
boxes containing MS10P. Roots are induced quickly after the
transfer of shoots to larger containers; if they are not present
prior to the initial transfer, rooting frequency is typically close
to 100 %.
7. The fully rooted plantlets are transferred to the potting medium
in 6-pack planting containers, covered with clear 6-in. highseed-starting domes to maintain humidity, and placed in a
growth chamber maintained at 24 C, 85 % relative humidity,
and a 16-h photoperiod (450 mol/m2/s) where they grow
into full plants. The domes are removed after 57 days.
8. Once the plants reach a size greater than 15 cm, they are tested
for resistance to the herbicide Liberty. Leaves of carrot plants
are painted with a 0.2 or 0.4 % (w/v) Liberty solution and
visually assessed for resistance (see Note 5). Visually healthy
leaf tissue was collected from plants at this stage for PCR,
Southern, Northern, and Western analysis (see Note 6).
9. Effect of carrot cultivar on transformation frequency was measured as a proportion of infected explants that developed into
individual Southern-positive plants that grew on herbicide
selection medium (see Note 7).
10. Once the transgenic carrots are larger than 20 cm in height,
they are transferred to 6-in.-diameter pots and grown to maturity under the same conditions. The plants are watered two
times weekly (or as needed) and fertilized once a week with a
20:20:20 fertilizer (500 mg/l). Pest problems that can occur
are primarily western flower thrips (Frankliniella occidentalis
(Perg.)), which are difficult to control (see Note 8).
11. Carrots are a biennial plant and flower after their second growing season. To induce vernalization, the carrot plants at the
78-leaf stage are placed at 8 C for 10 weeks. The dead and
dying foliage is removed, and the plants are transferred back to
the previous growing conditions. When flowering shoots are
produced, the individual heads are encased in a glassine bag
with blow flies and tied off to prevent insect escape [11].
Seeds are then removed after 36 weeks and stored desiccated
at room temperature (see Note 9).
65
Notes
1. Agrobacterium tumefaciens LBA4404 was used in our experiments; however, other more aggressive strains have also proven
successful by other groups [1]. Typically, less callus development will be observed with more aggressive strains of
Agrobacterium and can result in the direct formation of somatic
embryos from the necrotic explants.
2. DL-PPT was used for selection in our experiments; however,
glufosinate ammonia can be substituted at identical concentrations, and Basta can be used at 0.75 the PPT concentration.
Alternatively, for cost saving, Liberty herbicide can be used
directly in the medium following filter sterilization to provide
the appropriate glufosinate ammonia concentration; however,
there are some surfactants within the solution that could lead
to enzymatic inhibition of sensitive assays performed from tissue culture-grown plants.
3. When LBA4404 cultures are resuspended in 1/10 MS solution, they will often form clumps; this is completely normal
and does not affect the transformation.
4. Carrot petioles are dissected on top of sterile filter paper and
cut into appropriate sizes. This alleviated some of the difficulties associated with the petioles dehydrating and sticking to
smooth surfaces, such as a Petri plate. Following dissection of
each petiole (1025 explants), they are immersed in the
Agrobacterium solution. This caused some explants to have
longer exposure to the inoculum; however, it was necessary to
avoid the suberization of wound sites.
5. Some of the PPT-resistant plants still show some susceptibility
to the 0.4 % Liberty application; however, it was much less
than the control plants. The minimum lethal concentration of
Liberty to each plant needs to be ascertained by a preliminary
experiment. The concentrations range between 0.1 and 0.4 %.
Cotton swabs are used to gently paint the herbicide solution
over the leaf surface pre-marked with a waterproof ink or marker
pen. Typical phytotoxicity symptoms develop after 7 days.
6. All of the somatic embryos that arise from an individual callus
are typically a unique transformation event; however, careful
tracking and Southern blot confirmation are required to identify events. Typically, we reinitiate the callus from individual
sterile plant lines in order to propagate clonal populations.
7. There are significant differences in the transformation frequency depending on the cultivar selected. Danvers Half Long
and Nantes Coreless have efficiencies greater than 3 %; Nanco
and HCM cultivars have efficiencies of less than 1 % [4]. These
efficiencies are the number of independent Southern-positive
events from 100 explants.
66
8. Insect pests on carrot plants can be minimized with weekly

applications of safer insecticidal soap, according to manufacturers instructions. In severe cases where thrips are visually
detected, applications of active Amblyseius cucumeris, a predatory
mite grown on a bran flake medium and purchased from a local
supplier, are applied directly to infested carrot plants.
9. For seed production if space is an issue, one alternative is to
remove the taproot from soil, carefully wash the root, and rinse in
a 0.5 % NaOCl solution. Subsequently, pat the root dry, dust
lightly with fungicidal sulfur powder, and wrap in a moistened
paper towel. The roots can then be placed in a resealable plastic
container and incubated at 4 C for 8 weeks and subsequently
replanted in potting mix. The roots should be checked periodically to ensure that there is no fungal or bacterial contamination.
Acknowledgment
Funding for this research was provided by the Natural Sciences and
Engineering Research Council of Canada (NSERC), Discovery
Grants Program.
References
1. Baranski R (2008) Genetic transformation of
carrot (Daucus carota) and other apiaceae species. Trans Plant J 2:1838
2. Kalbina I, Wallin A, Lindh I, Engstrom P,
Andersson S, Strid A (2011) A novel chimeric
MOMP antigen expressed in Escherichia coli,
Arabidopsis thaliana, and Daucus carota as a
potential Chlamydia trachomatis vaccine candidate. Prot Express Purif 80:194202
3. Rosales-Mendoza S, Soria-Guerra RE,
Moreno-Fierros L, Han YP, Alpuche-Solis AG,
Korban SS (2011) Transgenic carrot tap roots
expressing an immunogenic F1-V fusion protein from Yersinia pestis are immunogenic in
mice. J Plant Physiol 168:174180
4. Luchakivskaya Y, Kishchenko O, Gerasymenko
I, Olevinskaya Z, Simonenko Y, Spivak M,
Kuchuk M (2011) High-level expression of
human interferon alpha-2b in transgenic carrot (Daucus carota L.) plants. Plant Cell Rep
30:407415
5. Zhang HX, Liu M, Li YJ, Zhao YH, He H,
Yang GD, Zheng CC (2010) Oral immunogenicity and protective efficacy in mice of a
carrot-derived vaccine candidate expressing
6.
7.
8.
9.
10.
11.
UreB subunit against Helicobacter pylori. Prot

Express Purif 69:127131
Wally O, Jayaraj J, Punja ZK (2009) Comparative
resistance to foliar fungal pathogens in transgenic carrot plants expressing genes encoding
for chitinase, 1,3-glucanase and peroxidase.
Eur J Plant Pathol 123:331334
Wally O, Punja ZK (2010) Enhanced disease
resistance in transgenic carrot (Daucus carota
L.) plants over-expressing a rice cationic peroxidase. Planta 232:12291239
Wally O, Jayaraj J, Punja ZK (2009) Broadspectrum disease resistance to necrotrophic
and biotrophic pathogens in transgenic carrots
(Daucus carota L.) expressing an Arabidopsis
NPR1 gene. Planta 231:131141
Deblock M, Botterman J, Vandewiele M et al
(1987) Engineering herbicide resistance in
plants by expression of a detoxifying enzyme.
EMBO J 6:25132518
Simon PW, Peterson CE (1984) Controlled pollinations of carrot. Plant Mol Biol Rep 2:4344
Chapter 7
Cassava (Manihot esculenta Crantz)
Simon E. Bull
Abstract
Genetic transformation of plants is an indispensable technique used for fundamental research and crop
improvement. Recent advances in cassava (Manihot esculenta Crantz) transformation have facilitated the
effective generation of stably transformed cassava plants with favorable traits. Agrobacterium-mediated
transformation of friable, embryogenic callus has evolved to become the most widely used approach and
has been adopted by research laboratories in Africa. This procedure utilizes axillary meristem tissue (buds)
to produce primary and secondary somatic embryos and subsequently friable, embryogenic callus.
Agrobacterium harboring a binary expression cassette is used to transform this tissue, which is regenerated
via cotyledons and shoot organogenesis to produce rooted in vitro plantlets. This chapter details each step
of the procedure using the model cultivar 60444 and provides supplementary notes to successfully produce transgenic cassava.
Key words Agrobacterium tumefaciens, Axillary meristems, Buds, Cassava, Cultivar 60444, Friable
embryogenic callus, Manihot esculenta Crantz, Somatic embryogenesis, Tissue culture, Transformation
Introduction
Cassava is an ancient plant that is gaining prominence in crop
biotechnology programs. The domesticated species (Manihot esculenta Crantz) is grown for its starch-rich storage roots, providing
food and energy security in tropical and subtropical countries
[16]. Traditional breeding has contributed significantly towards
improving the cassava germplasm [711]. However, this approach
is hampered by poor flowering and seed development, heterozygosity, and allopolyploidy, meaning that introgression of desirable
trait(s) into farmer-preferred cultivars is difficult and considerably
time-consuming [1214]. Advances in cassava biotechnology offer
an additional strategy to expedite research [15] and has led to the
generation of lines with improved traits, for example, virus resistance [16, 17], reduced cyanide content [18, 19], delayed postharvest physiological deterioration [20, 21], and waxy starch [22].
During the 1990s, electroporation, particle bombardment,
and Agrobacterium-mediated transformation techniques were
67
68
Simon E. Bull
investigated using a variety of cassava tissues, including leaves,

roots, embryogenic callus, and somatic cotyledons [2330]. More
recently, Agrobacterium-mediated transformation of friable,
embryogenic callus (FEC) has been successfully optimized and is
now the favored system [3135]. This approach carries a reduced
risk of generating chimeras since non-differentiated tissue is used,
and unlike particle bombardment, it increases the likelihood of
single-insert lines [29, 3638]. Interestingly, cassava transformation and regeneration is genotype dependent, and 60444 originating from Nigeria has emerged as the model cultivar. Other
farmer-preferred cultivars have been used (e.g., the commercially
important Adira4) [22] but which are generally more recalcitrant
to transformation and regeneration [3942].
Agrobacterium-mediated transformation of FEC (described in
this chapter) utilizes somatic embryogenesis to produce
FEC. Primary somatic embryos, derived from axillary meristems,
for example (Fig. 1), are cultured on Murashige and Skoog (MS)based medium [43] supplemented with auxin (e.g., picloram)
[44]. This induces division of morphogenetically competent cells
in adaxial tissue and the development of embryogenetic protrusions (torpedo structures) [45]. Subculturing gives rise to successive cycles of secondary somatic embryos [46] that can mature to
produce cotyledons and regenerate into plantlets via shoot organogenesis (Fig. 1) [47, 48]. Importantly, these processes test both
Fig. 1 Simplified schematic representation of somatic embryogenesis and

regeneration of cassava. Figure adapted from [32, 28]
69
the viability of embryos/cotyledons to germinate and serve as a

conduit in the multiplication of pathogen-free plantlets for distribution to researchers, breeders, and farmers [49, 50]. For transformation experiments, secondary somatic embryos are cultured on
Gresshoff and Doy (GD)-based medium [51] supplemented with
picloram to produce FEC [28]. These morphogenic, totipotent
cells rapidly proliferate and are suitable for the isolation of protoplasts (Fig. 1) [52]. Inoculation of FEC with Agrobacterium harboring a binary expression cassette, followed by incremental
increases in (antibiotic) selection on GD and MS-based medium,
provides an environment to efficiently recover, screen, and regenerate transgenic material. Usually, although not exclusively, the antibiotic resistance genes hptII [53] and nptII [54], or the phosphomannose
isomerase (pmi) gene, are used in the T -DNA for tissue selection
[31, 34, 35, 38]. Frequent transfer of developing cotyledonous tissue
to MS-based medium containing 6-benzylaminopurine (BAP, a synthetic cytokinin) induces shoot development that can be used to
establish fully rooted plantlets in vitro (Fig. 1). The described protocol
[34] takes six months and has proven to be highly efficient and robust,
which has led to its implementation in African laboratories [5557];
typically, more than 50 plantlets can be generated from approximately 100 clusters of FEC. Putative transgenic material should be
analyzed using techniques (e.g., PCR amplification and Southern
blot) to determine the presence and integration of the T-DNA in
the plant genome.
2
2.1
Materials
Stock Solutions
Prepare all solutions using distilled, sterilized water and molecular

biology or analytical grade chemicals. Store in sterile tubes or bottles and, where stated, filter sterilize using 0.22 m syringe filters.
Solutions stored at 4 C should be replaced after three months,
whereas those at 20 C can be retained for up to six months.
Diligently follow chemical handling advice and local health and
safety codes of practice.
1. 1-Naphthaleneacetic acid (NAA; 1 mg/mL): Dissolve 50 mg
in 1 mL of 1 M NaOH and adjust volume to 50 mL with
water. Store at 4 C.
2. 3,5-Dimethoxy-4-hydroxyacetophenone (acetosyringone;
200 mM): Dissolve 1.962 g in 50 mL dimethyl sulfoxide
(DMSO). Store aliquots in 1.5 mL microfuge tubes at 20 C.
3. 6-Benzylaminopurine (BAP; 1 mg/mL): Dissolve 20 mg in
3 mL of 1 M NaOH. Adjust volume to 20 mL with water and
filter sterilize. Aliquot into 1.5 mL microfuge tubes and store
at 20 C.
70
Simon E. Bull
4. Carbenicillin disodium (500 mg/mL): Dissolve 25 g in 50 mL

water and filter sterilize. Aliquot into 1.5 mL microfuge tubes
and store at 20 C (see Note 1).
5. Copper (II) sulfate pentahydrate (CuSO45H2O; 2 mM):
Dissolve 2.49 g in 50 mL water to produce a 0.2 M stock solution. Dilute 1 mL of this solution in a final volume of
100 mL. Store both stock solutions at 4 C.
6. Hydrochloric acid (HCl; 0.1 N): Add 820 L of 37 % (w/w)
HCl to 99.18 mL of water. Mix gently.
7. Kanamycin monosulfate (50 mg/mL): Dissolve 2.5 g in 50 mL
of water. Filter sterilize and aliquot into 1.5 mL microfuge
tubes. Store at 20 C.
8. Magnesium sulfate heptahydrate (MgSO47H2O; 1 M):
Dissolve 24.6 g in 100 mL water. Filter sterilize and store
at 4 C.
9. 4-Amino-3,5,6-trichloropyridine-2-carboxylic acid (picloram;
12 mg/mL): Dissolve 0.6 g in 5 mL of 1 M NaOH. Adjust
volume to 50 mL with water, filter sterilize, and aliquot into
1.5 mL microfuge tubes. Store at 20 C.
10. Rifampicin (25 mg/mL): Dissolve 625 mg in 25 mL of 0.1 N
HCl. Filter sterilize and aliquot into 1.5 mL microfuge tubes.
Store at 20 C.
11. Geneticin (50 mg/mL): Dissolve 1.25 g in 25 mL of water.
Filter sterilize and aliquot into 1.5 mL microfuge tubes. Store
at 4 C.
12. Hygromycin B (50 mg/mL): Dissolve 1.25 g in 25 mL of
water. Filter sterilize and aliquot into 1.5 mL microfuge tubes.
Store at 4 C.
13. Streptomycin sulfate (100 mg/mL): Dissolve 5 g in 50 mL of
water and filter sterilize. Aliquot into 1.5 mL microfuge tubes
and store at 20 C.
14. Tris-HCl/NaCl buffer: Add 1.21 g Tris and 2.92 g NaCl to
approximately 700 mL water and adjust pH to 7.2 using concentrated Tris-HCl. Prepare final volume of 1 L and autoclave.
Store at room temperature.
15. 5-Bromo-4-chloro-3-indolyl -D-glucuronide sodium salt
(X-Gluc; 10 mg/mL): Dissolve 100 mg in 10 mL of N,Ndimethylformamide (DMF). Store at 20 C in a lightprotected bottle.
16. Triton X-100 (10 % v/v): Add 5 mL Triton to 45 mL
water and mix until in solution. Store at room temperature.
17. GUS assay solution [58, 59]: Add 890 L Tris-HCl/NaCl
buffer (see step 14 above), 100 L X-Gluc (see step 15 above),
and 10 L Triton X-100 (see step 16 above) and mix.
2.2
Plant Material
2.3 Cassava Tissue

Culture Media
71
Cassava transformation typically uses the model cultivar 60444. In

vitro stocks can be established via sterilizing and propagating shoot
cultures of glasshouse-grown plants.
All media should be prepared with distilled water and sterilized by
autoclaving (15 min at 121 C). After cooling to room temperature, liquid medium can be stored at 4 C. Medium containing a
setting agent (Gelrite or Noble agar; see Note 2) should be plated
before storage at 4 C in sealed bags (see Note 3). Media should be
used within 12 weeks from preparation and allowed to acclimatize
to room temperature before use. All storage containers/Petri dishes
must be sterile and autoclaved medium aliquoted in a laminar flow
hood.
1. Propagation of in vitro plantlets (CBM): Dissolve 4.4 g of MS
medium (including vitamins) and 20 g sucrose in approximately 700 mL of water. Add 1 mL CuSO4 (2 mM). Adjust
final volume to 1 L and pH to 5.8. Add 3 g Gelrite and
autoclave. Allow media to cool and pour approximately 35 mL
into 53 mm 100 mm jars (or equivalent).
2. Axillary bud medium (CAM): Dissolve 4.4 g of MS medium
(including vitamins) and 20 g sucrose in approximately 700 mL
of water. Add 1 mL of CuSO4 (2 mM) and 10 mL BAP (1 mg/
mL). Adjust final volume to 1 L and the pH to 5.8. Add 8 g
Noble agar and autoclave. Pipette 25 mL into 90 mm Petri
dishes.
3. Somatic embryo induction medium (CIM): Dissolve 4.4 g of
MS medium (including vitamins) and 20 g sucrose in approximately 700 mL water, and then add 1 mL CuSO4 (2 mM) and
1 mL picloram (12 mg/mL). Adjust final volume to 1 L and
pH to 5.8, add 8 g Noble agar, and autoclave. Pipette 25 mL
into 90 mm Petri dishes.
4. FEC induction and propagation (GD): Dissolve 2.7 g of GD
medium (including vitamins) and 20 g sucrose in approximately 700 mL water. Add 1 mL picloram (12 mg/mL) and
adjust final volume to 1 L. Adjust pH to 5.8, add 8 g Noble
agar, and autoclave. Pipette 25 mL into 90 mm Petri dishes.
5. Postinoculation FEC wash (GDS + C500): Dissolve 2.7 g of
GD medium (including vitamins) and 20 g sucrose in approximately 700 mL of water. Add 1 mL picloram (12 mg/mL) and
adjust final volume to 1 L. Adjust pH to 5.8 and autoclave.
Cool to room temperature, add 1 mL carbenicillin (500 mg/
mL), and mix.
6. Recovery of cocultivated FEC (GD + C250): Dissolve 2.7 g of
GD medium (including vitamins) and 20 g sucrose in approximately 700 mL of water. Add 1 mL picloram (12 mg/mL) and
adjust final volume to 1 L. Adjust pH to 5.8, add 8 g Noble
72
Simon E. Bull
agar and autoclave. Once media has cooled, add 500 L

carbenicillin (500 mg/mL), mix, and pipette 25 mL into
90 mm Petri dishes (see Note 4).
7. Maturation of transgenic FEC (GD + C250 + H/Ge): Dissolve
2.7 g of GD medium (including vitamins) and 20 g sucrose in
approximately 700 mL water. Add 1 mL picloram (12 mg/
mL) and adjust final volume to 1 L with water. Adjust pH to
5.8, add 8 g Noble agar and autoclave. Once media has cooled,
add 500 L carbenicillin (500 mg/mL) and the appropriate
amount of antibiotic (hygromycin or geneticin) for plant selection to produce GD + C250 + H5/Ge8, GD + C250 + H8/
Ge12.5, and GD + C250 + H15/Ge25. Pipette 25 mL into
90 mm Petri dishes.
8. Regeneration of wild-type FEC (MSN + C250): Dissolve 4.4 g
of MS medium (including vitamins) and 20 g sucrose in
approximately 700 mL of water. Add 1 mL NAA (1 mg/mL)
and adjust final volume to 1 L. Adjust pH to 5.8, add 8 g
Noble agar, and autoclave. Once media has cooled, add 500 L
carbenicillin (500 mg/mL) and pipette 25 mL into 90 mm
Petri dishes.
9. Regeneration of transgenic embryos (MSN + C250 + H15/
Ge25): Dissolve 4.4 g of MS medium (including vitamins) and
20 g sucrose in approximately 700 mL water. Add 1 mL NAA
(1 mg/mL) and adjust final volume to 1 L. Adjust pH to 5.8,
add 8 g Noble agar, and autoclave. Once media has cooled,
add 500 L carbenicillin (500 mg/mL) and appropriate
amount of antibiotic (hygromycin or geneticin) for plant selection. Pipette 25 mL into 90 mm Petri dishes.
10. Generation of shoots (CEM + C100): Dissolve 4.4 g of MS
medium (including vitamins) and 20 g sucrose in approximately 700 mL of water. Add 0.4 mL BAP (1 mg/mL) and
1 mL CuSO4 (2 mM). Adjust final volume to 1 L and pH to
5.8. Add 8 g Noble agar and autoclave. Once the media is
cool, add 200 L carbenicillin (500 mg/mL) and pipette
25 mL into 90 mm Petri dishes.
11. Propagation of shoots (CBM + C50): Dissolve 4.4 g of MS
medium (including vitamins) and 20 g sucrose in approximately 700 mL of water. Add 1 mL CuSO4 (2 mM); adjust
final volume to 1 L and pH to 5.8. Add 3 g Gelrite and autoclave. After cooling, add 100 L carbenicillin (500 mg/mL)
and pour approximately 35 mL into sterile 53 mm x 100 mm
plastic jars (or equivalent).
12. Screening of transgenic in vitro plantlets (CBM + C50 + H10/
Ge25): Dissolve 4.4 g of MS medium (including vitamins) and
20 g sucrose in approximately 700 mL of water. Add 1 mL
CuSO4 (2 mM); adjust to a final volume of 1 L and pH to 5.8.
73
Add 3 g Gelrite and autoclave. Allow media to cool, add

100 L carbenicillin (500 mg/mL), and then add the appropriate antibiotic (hygromycin or geneticin) for selection. Mix
gently and pour approximately 20 mL into 50 mL tubes.
2.4 Agrobacterium
Strain and Culture
Media
Agrobacterium strain LBA4404 [60] is used predominantly in cassava transformation and carries resistance to rifampicin and streptomycin. To visualize transformation success, it is advisable to use
a CaMV35S:uidA containing plasmid in parallel to the experimental expression construct(s) that can be used in GUS assays [58].
1. Agrobacterium medium (YEBA and YEB): Dissolve 1 g Bacto
yeast extract, 5 g Bacto beef extract, 5 g Bacto peptone,
and 5 g sucrose in approximately 700 mL of water and then
adjust to 1 L (final volume), adjust pH to 7.2, add 15 g Bacto
agar, and autoclave. Allow the media to cool before adding
2 mL rifampicin (25 mg/mL) and 1 mL streptomycin
(100 mg/mL) required for bacterial selection. Also add appropriate antibiotic for selection of expression cassette. Pipette
25 mL into 90 mm Petri dishes. For liquid medium, omit the
addition of Bacto agar and add 2 mL of MgSO4 (1 M) with
the antibiotics after sterilization. Store at 4 C.
2. Agrobacterium solution for transformation (GDS): Dissolve
2.7 g of GD medium (including vitamins) and 20 g sucrose in
approximately 700 mL water. Add 1 mL picloram (12 mg/mL);
adjust to a final volume of 1 L and pH to 5.8. Autoclave and
store at 4 C.
Methods
To avoid/minimize contamination, it is imperative that all steps
are performed using sterile tools and media in a biological safety
cabinet. Where otherwise indicated, light intensity in growth cabinets was 4050 mol/m2/s. Handle all genetically modified material according to local regulations and good laboratory practice.
3.1 Enlargement
of Axillary Buds
from Stem Cuttings
1. Use a scalpel to remove leaves and shoots from in vitro 60444

plantlets. Cut the stem into sections, ensuring each section contains a node. Place the cuttings horizontally on CAM (it is not
necessary to submerge the tissue in the medium). Seal the plates
with Parafilm, wrap in aluminum foil, and incubate at 28 C for
12 days (see Note 5). To replenish the in vitro stocks of the
cultivar, propagate the apical shoots in fresh CBM and incubate
at 28 C, 16 h light and 8 h dark (see Notes 6 and 7).
2. Use a binocular light microscope and sterile syringe needles to
gently remove the axillary buds (Fig. 2a) and culture them on
CIM. If a bud has started to develop, remove the leaf
74
Simon E. Bull
Fig. 2 Procedure for producing transgenic cassava plants. (a) Swollen axillary bud on CAM. (b) Immature
primary somatic embryos (indicated by arrows) developing on a cushion of NEFC on CIM. (c) Maturing somatic
embryos on CIM. White line indicates approximate suggested division for further propagation. (d) Cluster of
FEC on GD appropriate for Agrobacterium inoculation. (e) FEC following cocultivation spread onto mesh on
GD + C250. (f) Developing embryo/cotyledon on MSN + C250 + H15 (indicated by arrow). Putative transformed
FEC seen as swollen, yellowish structures. Non-transformed are smaller, white clusters. (g) Developing
embryo/cotyledon transferred to CEM + C100. (h) Appearance of immature shoots following several weeks on
CEM + C100. (i) In vitro transgenic cassava plantlet. (j) Developing embryos/cotyledons from MSN + C250 + H15
used for GUS assay. Blue precipitate clearly visible throughout all tissue. (k) GUS-stained leaves. (l) Rooting
assay of transgenic plantlets (left and center ) and wild-type 60444 (right ) on CBM + C50 + H10. Examples
showing regeneration of cassava harboring the hptII antibiotic selection gene. Figure reproduced with kind
permission from [34]
75
primordia before transfer to CIM. Seal the plates with Parafilm,

wrap in aluminum foil, and incubate at 28 C for 2 weeks.
3. Between 1 and 2 weeks after transfer to CIM, primary somatic
embryos will emerge (Fig. 2b). These need to be transferred to
fresh CIM, leaving behind tissue debris and non-embryogenic
friable callus (NEFC; rapidly growing translucent callus). Seal
the plates with Parafilm, wrap in aluminum foil, and incubate
at 28 C for another 2 weeks.
4. Repeat step 3 above. At this stage, the somatic embryos will be
developing and need to be split (syringe needles are sufficient to
cut the embryos) into smaller pieces (Fig. 2c). Aim to culture
about ten clusters of embryos per plate of CIM (see Note 8).
5. After 68 weeks of cycling tissue on CIM, the majority of
embryos should be developing torpedo structures. If most
remain compact and coral-like, cycle again on CIM (see Note 9).
3.2 Generation
of Friable,
Embryogenic Callus
from Secondary
Somatic Embryos
1. Divide the embryo clusters, gently removing NEFC, and transfer to GD. Seal the plates with Parafilm, wrap in aluminum foil,
and incubate at 28 C. After 2 weeks, use a binocular light
microscope to check for FEC growth. FEC are clusters of offwhite/yellowish spherical units 1 mm in diameter (Fig. 2d).
Incubation for a further 2 weeks should aid development and
thus identification of FEC.
2. Using sterile syringe needles, gently transfer the FEC to GD
(see Note 10). Aim to have approximately ten clusters per Petri
dish. Seal the plates with Parafilm, wrap in aluminum foil, and
incubate at 28 C for 2 weeks. After this incubation, the clusters should have approximately doubled in size and any that do
not should be discarded.
3. Every 2 weeks, divide the clusters and culture (as described
above) on fresh GD medium (Fig. 2d). The aim of this process
is to multiply and maintain healthy FEC material (see Notes 11
and 12). A sample of FEC should be plated on MSN + C250
and incubated (approximately 4 weeks at 28 C, 16 h light and
8 h dark) to determine regeneration efficiency.
3.3 Preparation
of Agrobacterium
tumefaciens Inoculum
1. Streak Agrobacterium (LBA4404) harboring the expression

cassette onto YEBA containing antibiotics for both bacterial
(rifampicin and streptomycin) and vector selection. Invert
plate and incubate at 28 C for 2 days in the dark.
2. Use a loop to isolate a bacterial colony and inoculate 5 mL of
YEB (containing the appropriate antibiotics) in a 15 mL tube.
Culture overnight in an incubator shaker at 28 C and 200 rpm.
3. Incubate the culture until the optical density (OD; = 600 nm) is
0.71.0. Transfer approximately 0.5 mL of culture to 25 mL of
YEB (containing antibiotics) in a 250 mL flask. Grow overnight
in an incubator shaker at 28 C and 200 rpm (see Note 13).
76
Simon E. Bull
4. When the OD600 is 0.71.0, decant the culture into a 50 mL

tube and centrifuge at 4,000 g at room temperature for
10 min. Discard the supernatant and gently resuspend the pellet in 25 mL of GDS. Centrifuge again (4,000 g for 10 min),
remove the supernatant, and invert the tube on sterile tissue or
filter paper for approximately 1 min to remove excess liquid.
5. Resuspend the pellet in GDS and dilute to OD600 = 0.5. Add
acetosyringone to a final concentration of 200 M and incubate at room temperature for 45 min on a horizontal shaker
(approximately 50 rpm).
3.4 Cocultivation
of FEC and
Agrobacterium
1. Use a 1 mL pipette to gently disrupt and cover the FEC clusters

with bacterial suspension. Leave the material for approximately
5 min before sealing the plates with Parafilm and incubate at
24 C for 4 days (16 h light and 8 h dark) (see Note 14).
2. Gently scrape the FEC from the plate using forceps and transfer to a 50 mL tube containing 25 mL of GDS + C500. Vortex
for 510 s, allow the material to settle, and then remove the
supernatant using a pipette. Repeat this step until the supernatant is clear, which usually requires 34 washes (see Note 15).
Resuspend in a final 25 mL volume of GDS + C500.
3. Using a 25 mL pipette, spread the FEC thinly and evenly on
sterile plastic mesh (contained in a 90 mm Petri dish) removing excess liquid (see Note 16).
4. Transfer the mesh/FEC onto three pieces of 90 mm sterile
filter paper and leave for approximately 10 s to absorb excess
liquid.
3.5 Recovery
and Maturation
of Transformed FEC
1. Gently transfer the mesh/FEC to GD + C250 and seal the

plates with Parafilm. Incubate at 28 C for 4 days (16 h light
and 8 h dark) (see Note 17; Fig. 2e).
2. Transfer the mesh/FEC to GD + C250 + H5/Ge8, seal with
Parafilm, and incubate at 28 C (16 h light and 8 h dark) for 1
week.
3. Transfer the mesh/FEC to GD + C250 + H8/Ge12.5, seal
with Parafilm, and incubate at 28 C (16 h light and 8 h dark)
for 1 week.
4. Transfer the mesh/FEC to GD + C250 + H15/Ge25, seal with
Parafilm, and incubate at 28 C (16 h light and 8 h dark) for 1
week (see Note 18).
3.6 Regeneration
of Putative Transgenic
FEC
1. Place the mesh/FEC on MSN + C250 + H15/Ge25, seal the

plates with Parafilm, and incubate at 28 C for 1 week (16 h
light and 8 h dark). Repeat this step for several weeks and
eventually small, green/white tube-like protrusions will develop
(see Note 19).
77
2. Small green cotyledons will appear after a few weeks (Fig. 2f).
Transfer them to CEM + C100 using sterile syringe needles,
gently removing FEC or NEFC stuck to their surface (see Note
20; Fig. 2g). Seal the plates with Parafilm and incubate at
28 C (16 h light and 8 h dark).
3. Every 1014 days, transfer the developing tissue to fresh
CEM + C100 (see Note 21). Callus may develop and should be
removed using a scalpel during transfer (see Note 22). Continue
to propagate material until juvenile shoots and leaves appear
(usually 23 weeks onwards; Fig. 2h).
4. Remove and culture in CBM + C50 juvenile shoots (usually
approximately 23 cm in length), seal the pot with Parafilm or
Micropore tape, and incubate at 28 C (16 h light and 8 h
dark). Roots should appear within 12 weeks (see Note 23;
Fig. 2i).
3.7 Rooting
Experiment to Screen
for Transgenic
Plantlets
This effective and simple assay allows easy identification of putative

transgenic plantlets [27].
3.8 Transfer
of In Vitro Plantlets
to Soil and Glasshouse
Environment
The approach to transfer in vitro plantlets to soil and the maintenance of mature cassava plants will vary between different facilities/research centers. Ergo, the following steps should be regarded
as suggested guidelines.
1. Transplant 23 cm of the apical shoot of an in vitro plantlet in

CBM + C50 + H10/Ge25 contained in a 50 mL tube. Incubate
at 28 C (16 h light and 8 h dark) and roots will be clearly visible within 2 weeks if the cutting is transgenic. Plant apical
shoots of wild-type 60444 to provide a negative control
(Fig. 2l).
1. Isolate the apical shoots of established in vitro plantlets and

propagate in CBM prepared with only 2.5 g/L of Gelrite (see
Note 24). Seal the pots with Parafilm and incubate at 28 C
(16 h light and 8 h dark) for approximately 23 weeks.
2. Tap the culture pot to loosen the medium and gently pull out
the plantlet. Wash the roots in tepid water for approximately
1 min.
3. Remove all leaves retaining only the smaller, uppermost two or
three leaves (see Note 25).
4. Prepare a 3:1 mix of compost (e.g., Levingtons M2) and perlite and partially fill a 9 cm2 pot (with drainage holes). Carefully
deposit the plant, lightly compress soil, and fill the pot with the
compost/perlite mix. Place the pots in a tray (without drainage holes) containing a pool of tepid water and water spray the
foliage to keep moist. After approximately 1 h, pour off the
excess water and cover the plants with a transparent lid.
78
Simon E. Bull
5. Juvenile plants should be retained in a climate-controlled room

(28 C, 16 h light (100 mol/m2/s) and 8 h dark) for 1 month
prior to transfer to the glasshouse where high humidity (>50 %)
is required. Fertilize plants (e.g., 1 g/L Vitax fertilizer) twice
weekly. Water daily allowing the soil to become dry between
watering.
Notes
1. Carbenicillin disodium forms a viscous solution in water at this
concentration. Therefore, add the powder gradually and stir
continuously to dissolve. A gelatinous lump will form if the
powder is added too quickly.
2. Experiments have been conducted to assess the impact of
Noble agar (high-grade agar from red algae) and Gelrite
(a gellan gum derived from Pseudomonas elodea) on cassava
tissue development [61]. Hyperhydricity of somatic cassava tissue appeared to occur on Gelrite-containing medium,
whereas high-quality tissue was generated on medium containing Noble agar. Gelrite (which is usually cheaper than Noble
agar) is still used for in vitro plantlet stock propagation where
it had no discernible negative impact on growth.
3. Following sterilization via autoclaving, tissue culture medium
should be plated; do not reheat because this may affect chemical/
nutrient content and caramelize the sucrose.
4. To prevent heat-induced degradation of antibiotics, the media
should be allowed to cool to approximately 50 C before
carbenicillin is added.
5. Wrapping the Petri dishes in aluminum foil creates a dark environment that aids bud enlargement and slows development.
Additionally, it will be easier to handle the stem cuttings in this
and subsequent steps if they are approximately 510 mm in
length on either side of the node. To minimize tissue multiplication in subsequent steps, it is advisable to use stem cuttings
from approximately 75 in vitro plantlets.
6. Leaves larger than approximately 1 cm in diameter should be
removed from the propagated apical shoot to reduce risk of
leaf senescence before the plantlet is established. Additionally,
to encourage root growth, ensure the cutting has a node in the
medium.
7. The incubator used for cassava tissue culture can affect tissue
quality [61]. Most prominent is the accumulation of moisture
on Petri dish lids that may be detrimental to light penetration
79
and media properties. Ergo, it is advisable to use precise climatecontrolled chambers (e.g., Sanyo/Panasonic MLR Plant
Growth Chamber). Culture plates can be stacked 23 high with
no discernible compromise to tissue growth or quality.
8. Clusters of embryogenic tissue should be no smaller than
approximately 5 mm in diameter; otherwise their growth may
be attenuated.
9. At this stage, you should aim to have more than 20 CIM plates
of tissue to ensure enough material is available for transfer and
FEC production.
10. It is important not to disrupt or spread the clusters of FEC as
this will attenuate their growth.
11. The extent to which FEC material can be subcultured repeatedly is somewhat dependent on experience and growth conditions. However, it is advisable that a batch of FEC is maintained
for no more than six months to minimize the risk of somaclonal variation [37].
12. It is imperative that the FEC clusters are not completely disassociated as this will negatively affect development. Using
syringe needles, gently scoop clumps of FEC avoiding where
possible NEFC and other unwanted tissue.
13. The rate of bacterial growth can be variable. Therefore, it is
recommended that two or three cultures are inoculated at various times during the day to improve the probability that one
of them will be at the optimal OD when required by the
researcher.
14. Try to avoid flooding the plate with the Agrobacterium suspension as this will likely result in overaccumulation of bacterial growth.
15. Use material from approximately six culture plates per 25 mL
of GDS + C500 for washing. Too much material makes resuspension more difficult and the washing is less effective.
16. It is important that the FEC are spread thinly on the mesh;
regeneration is compromised if too thickly layered and may
also exacerbate Agrobacterium growth. As a general guide,
1218 pieces of mesh would be prepared for FEC from six
cocultivation plates.
17. This step provides the FEC with a period of recovery and
the carbenicillin in the medium suppresses Agrobacterium
growth.
18. The stepwise increase in antibiotic concentration and weekly
transfer to fresh medium allow transformed material to
acclimatize while minimizing changes in culturing/media
conditions. A sample of material transformed with a
CaMV35S:uidA construct may be used at this stage for a
80
Simon E. Bull
GUS assay (add a sample of tissue to GUS buffer and incubate

at 37 C for 12 h. A blue-black precipitate will appear if
successfully transformed. Destain tissue with 70 % (v/v)
ethanol).
19. Ordinarily, these structures will appear after approximately
three weeks and should be retained on the mesh/medium
until cotyledons appear. Material may be cycled on this medium
for as long as regeneration is occurring.
20. Although the green cotyledons are clearly visible to the naked
eye, it is advisable to use a binocular light microscope when
isolating the material to minimize damage and aid the identification of unwanted tissue. A sample of material transformed
with a CaMV35S:uidA construct may be used at this stage for
a GUS assay (see Note 18; Fig. 2j).
21. The inclusion of carbenicillin in CEM is crucial to suppress
Agrobacterium that may be transferred with the plant tissue.
A surprisingly small amount of bacterial growth can prevent
plant regeneration.
22. The accumulation of callus at the base of the developing plant
material presumably hinders uptake of nutrients/hormones
and therefore should be removed during transfer to the fresh
medium.
23. It is advisable that only shoots 2 cm or more in length are
transferred to CBM + C50 to improve their chances of survival.
Additionally, the inclusion of carbenicillin in CBM is crucial to
suppress Agrobacterium growth. A sample of material transformed with a CaMV35S:uidA construct may be used at this
stage for a GUS assay (see Note 18; Fig. 2k).
24. The reduced concentration of Gelrite provides a softer
medium that facilitates removal of the plantlet, minimizing risk
of damage.
25. The larger leaves (if retained on the transferred plantlet) tend
to wilt and die before the plant is established, resulting in accumulation of diseased material in the pot. Necrotic leaves should
be removed from juvenile plants if they develop.
Acknowledgments
This protocol was developed by the author at the University of
Bath (UK) and ETH Zrich (Switzerland) and partially funded by
the Bill & Melinda Gates Foundation (BioCassava Plus Program
Phase I). The author thanks Herv Vanderschuren (ETH Zrich,
Switzerland) for helpful comments and discussion.
81
References
1. Burns A, Gleadow R, Cliff J, Zacarias A,
Cavagnaro T (2010) Cassava: the drought, war
and famine crop in a changing world.
Sustainability 2:35723607
2. FAO (2008) Cassava for food and energy
security. http://www.fao.org/newsroom/en/
news/2008/1000899/index.html.
FAO
Media Centre. October 2010
3. Jansson C, Westerbergh A, Zhang J, Hu X, Sun
C (2009) Cassava, a potential biofuel crop in
(the) Peoples Republic of China. Appl Energy
86:S95S99
4. Balat M, Balat H (2009) Recent trends in
global production and utilization of bioethanol fuel. Appl Energy 86:22732282
5. Rosenthal DM, Slattery RA, Miller RE,
Grennan AK, Cavagnaro TR, Fauquet CM,
Gleadow RM, Ort DR (2012) Cassava aboutFACE: Greater than expected yield stimulation
of cassava (Manihot esculenta) by future CO2
levels. Glob Chang Biol 18:26612675
6. Sayre R, Beeching JR, Cahoon EB, Egesi C,
Fauquet C, Fellman J, Fregene M, Gruissem
W, Mallowa S, Manary M, Maziya-Dixon B,
Mbanaso A, Schachtman DP, Siritunga D,
Taylor N, Vanderschuren H, Zhang P (2011)
The BioCassava Plus program: biofortification
of cassava for sub-Saharan Africa. Annu Rev
Plant Biol 62:251272
7. Hahn SK, Terry ER, Leuschner K (1980)
Breeding cassava for resistance to cassava
mosaic disease. Euphytica 29:673683
8. Okogbenin E, Porto MCM, Egesi C, Mba C,
Espinosa E, Santos LG, Ospina C, Marn J,
Barrera E, Gutirrez J, Ekanayake I, Iglesias
C, Fregene MA (2007) Marker-assisted introgression of resistance to cassava mosaic disease
into Latin American germplasm for the
genetic improvement of cassava in Africa.
Crop Sci 47(5):18951904
9. Chavez AL, Sanchez T, Jaramillo G, Bedoya
JM, Echeverry J, Bolanos EA, Ceballos H,
Iglesias CA (2005) Variation of quality traits in
cassava roots evaluated in landraces and
improved clones. Euphytica 143(12):125133
10. Ceballos H, Sanchez T, Morante N, Fregene M,
Dufour D, Smith AM, Denyer K, Perez JC, Calle
F, Mestres C (2007) Discovery of an amylosefree starch mutant in cassava (Manihot esculenta
Crantz). J Agric Food Chem 55:74697476
11. Morante N, Snchez T, Ceballos H, Calle F,
Prez JC, Egesi C, Cuambe CE, Escobar AF,
Ortiz D, Chvez AL, Fregene M (2010)
Tolerance to postharvest physiological deterioration in cassava roots. Crop Sci 50:13331338
12. Ceballos H, Iglesias CA, Perez JC, Dixon AGO

(2004) Cassava breeding: opportunities and
challenges. Plant Mol Biol 56(4):503516
13. Kawano K (2003) Thirty years of cassava breeding for productivitybiological and social factors for success. Crop Sci 43(4):13251335
14. Nassar N, Ortiz R (2010) Breeding cassava to
feed the poor. Sci Am 302(5):7884
15. Liu J, Zheng Q, Ma Q, Gadidasu KK, Zhang P
(2011) Cassava genetic transformation and
its application in breeding. J Integr Plant Biol
53(7):552569
16. Vanderschuren H, Alder A, Zhang P, Gruissem
W (2009) Dose-dependent RNAi-mediated
geminivirus resistance in the tropical root crop
cassava. Plant Mol Biol 70(3):265272
17. Vanderschuren H, Moreno I, Anjanappa RB,
Zainuddin IM, Gruissem W (2012) Exploiting
the combination of natural and genetically
engineered resistance to cassava mosaic and
cassava brown streak viruses impacting cassava
production in Africa. PLoS One 7(9):e45277
18. Siritunga D, Arias-Garzon D, White W, Sayre
RT (2004) Over-expression of hydroxynitrile
lyase in transgenic cassava roots accelerates cyanogenesis and food detoxification. Plant
Biotechnol J 2(1):3743
19. Jrgensen K, Bak S, Busk PK, Srensen C, Olsen
CE, Puonti-Kaerlas J, Mller BL (2005) Cassava
plants with a depleted cyanogenic glucoside content in leaves and tubers. Distribution of cyanogenic glucosides, their site of synthesis and
transport, and blockage of the biosynthesis by
RNA interference technology. Plant Physiol
139(1):363374
20. Xu J, Duan X, Yang J, Beeching JR, Zhang P
(2013) Enhanced reactive oxygen species scavenging by overproduction of superoxide dismutase and catalase delays postharvest
physiological deterioration of cassava storage
roots. Plant Physiol 161(3):15171528
21. Zidenga T, Leyva-Guerrero E, Moon H,
Siritunga D, Sayre R (2012) Extending cassava
root shelf life via reduction of reactive oxygen
species
production.
Plant
Physiol
159(4):13961407
22. Koehorst-van Putten HJ, Sudarmonowati E,
Herman M, Pereira-Bertram IJ, Wolters AM,
Meima H, de Vetten N, Raemakers CJ, Visser
RG (2012) Field testing and exploitation of
genetically modified cassava with low-amylose or
amylose-free starch in Indonesia. Transgenic Res
21(1):3950
23. Li HQ, Sautter C, Potrykus I, Puonti-Kaerlas J
(1996) Genetic transformation of cassava
82
24.
25.
26.
27.
28.
29.
30.
31.
32.
33.
34.
35.
Simon E. Bull
(Manihot esculenta Crantz). Nat Biotechnol
14(6):736740
Arias-Garzon DI, Sayre RT (1993) Tissue specific inhibition of transient gene expression in
cassava (Manihot esculenta Crantz). Plant Sci
93(12):121130
Franche C, Bogusz D, Schpke C, Fauquet C,
Beachy RN (1991) Transient gene expression
in cassava using high-velocity microprojectiles.
Plant Mol Biol 17(3):493498
Luong HT, Shewry PR, Lazzeri PA (1995)
Transient gene expression in cassava somatic
embryos by tissue electroporation. Plant Sci
107:105115
Zhang P, Legris G, Coulin P, Puonti-Kaerlas J
(2000) Production of stably transformed cassava plants via particle bombardment. Plant
Cell Rep 19:939945
Taylor NJ, Edwards M, Kiernan RJ, Davey
CD, Blakesley D, Henshaw GG (1996)
Development of friable embryogenic callus and
embryogenic suspension culture systems in cassava (Manihot esculenta Crantz). Nat
Biotechnol 14(6):726730
Raemakers CJJM, Sofiari E, Jacobsen E, Visser
RGF (1997) Regeneration and transformation
of cassava. Euphytica 96(1):153161
Raemakers CJJM, Sofiari E, Taylor N, Henshaw
G, Jacobsen E, Visser RGF (1996) Production
of transgenic cassava (Manihot esculenta
Crantz) plants by particle bombardment using
luciferase activity as selection marker. Mol
Breed 2(4):339349
Niklaus M, Gruissem W, Vanderschuren H
(2011) Efficient transformation and regeneration
of transgenic cassava using the neomycin phosphotransferase gene as aminoglycoside resistance
marker gene. GM Crops 2(3):193200
Zhang P, Gruissem W (2004) Production of
transgenic cassava (Manihot esculenta Crantz).
In: Curtis IS (ed) Transgenic crops of the
worldessential protocols. Kluwer Academic
Publishers, Boston, pp 301319
Zhang
P,
Puonti-Kaerlas
J
(2004)
Regeneration of transgenic cassava from transformed embryonic tissues. In: Pea L (ed)
Methods in molecular biology, vol 286.
Humana, Totowa, pp 165176
Bull SE, Owiti JA, Niklaus M, Beeching JR,
Gruissem W, Vanderschuren H (2009)
Agrobacterium-mediated transformation of friable embryogenic calli and regeneration of transgenic cassava. Nat Protoc 4(12):18451854
Schreuder MM, Raemakers CJJM, Jacobsen E,
Visser RGF (2001) Efficient production of
transgenic plants by Agrobacterium-mediated
transformation of cassava (Manihot esculenta
Crantz). Euphytica 120:3545
36. Gonzalez AE, Schopke C, Taylor NJ, Beachy

RN, Fauquet CM (1998) Regeneration of
transgenic cassava plants (Manihot esculenta
Crantz) through Agrobacterium-mediated
transformation of embryogenic suspension cultures. Plant Cell Rep 17(11):827831
37. Raemakers K, Schreuder M, Pereira I,
Munyikwa T, Jacobsen E, Visser R (2001)
Progress made in FEC transformation of cassava. Euphytica 120:1524
38. Zhang P, Potrykus I, Puonti-Kaerlas J (2000)
Efficient production of transgenic cassava using
negative and positive selection. Transgenic Res
9(6):405415
39. Ibrahim AB, Heredia FF, Pinheiro CB, Aragao
FJL, Campos FAP (2008) Optimization of
somatic embryogenesis and selection regimes
for particle bombardment of friable embryogenic callus and somatic cotyledons of cassava
(Manihot esculenta Crantz). Afr J Biotechnol
7(16):27902797
40. Hankoua BB, Ng SYC, Fawole I, PuontiKaerlas J, Pillay M, Dixon AGO (2005)
Regeneration of a wide range of African cassava
genotypes via shoot organogenesis from cotyledons of maturing somatic embryos and conformity of the field-established regenerants.
Plant Cell Tiss Org Cult 82:221231
41. Zainuddin IM, Schlegel K, Gruissem W,
Vanderschuren H (2012) Robust transformation procedure for the production of transgenic farmer-preferred cassava landraces. Plant
Methods 8(24):18
42. Rossin CB, Rey MEC (2011) Effect of explant
source and auxins on somatic embryogenesis of
selected cassava (Manihot esculenta Crantz)
cultivars. S Afr J Bot 7(1):5965
tissue cultures. Physiol Plant 15(3):473497
44. George EF, Hall MA, Klerk G-JD (2008) Plant
growth regulators I: introduction; auxins, their
analogues and inhibitors. In: Hall MA, Klerk
G-JD, George EF (eds) Plant propagation by tissue culture. Springer, Netherlands, pp 175204
45. Stamp JA (1987) Somatic embryogenesis in
cassava: the anatomy and morphology of the
regeneration process. Ann Bot 59(4):451459
46. George EF, Hall MA, Klerk G-JD (2008)
Somatic embryogenesis. In: Hall MA, Klerk
G-JD, George EF (eds) Plant propagation
by tissue culture. Springer, Netherlands,
pp 335354
47. Stamp JA, Henshaw GG (1986) Adventitious
regeneration in cassava. In: Withers LA,
Alderson PG (eds) Plant tissue culture and its
agricultural
applications.
Butterworths,
London, pp 147157

48. Stamp JA, Henshaw GG (1987) Secondary
somatic embryogenesis and plant regeneration
in cassava. Plant Cell Tiss Org Cult 10(3):
227233
49. Raemakers KJ, Jacobsen E, Visser RG (1999)
Direct cyclic somatic embryogenesis of cassava
for mass production purposes. Methods Mol
Biol 111:6170
50. Raemakers K, Jacobsen E, Visser R (2000) The
use of somatic embryogenesis for plant propagation in cassava. Mol Biotechnol 14(3):215221
51. Gresshoff P, Doy C (1974) Derivation of a haploid cell line from Vitis vinifera and the importance of the stage of meiotic development of
the anthers for haploid culture of this and other
genera. Z Pflanzenphysiol 73:132141
52. Sofiari E, Raemakers CJJM, Bergervoet JEM,
Jacobsen E, Visser RGF (1998) Plant regeneration from protoplasts isolated from friable
embryogenic callus of cassava. Plant Cell Rep
18(1):159165
53. Waldron C, Murphy EB, Roberts JL, Gustafson
GD, Armour SL, Malcolm SK (1985)
Resistance to hygromycin B. Plant Mol Biol
5(2):103108
54. Fraley RT, Rogers SG, Horsch RB, Sanders
PR, Flick JS, Adams SP, Bittner ML, Brand LA,
Fink CL, Fry JS, Galluppi GR, Goldberg SB,
Hoffmann NL, Woo SC (1983) Expression of
bacterial genes in plant cells. Proc Natl Acad
Sci U S A 80(15):48034807
83
55. Bull SE, Ndunguru J, Gruissem W, Beeching JR,

Vanderschuren H (2011) Cassava: constraints to
production and the transfer of biotechnology to
African laboratories. Plant Cell Rep 30(5):
779787
56. Chetty CC, Rossin CB, Gruissem W,
Vanderschuren
H,
Rey
ME
(2013)
Empowering biotechnology in southern Africa:
establishment of a robust transformation
platform for the production of transgenic
industry-preferred cassava. N Biotechnol 30(2):
136143
57. Vanderschuren H (2012) Strengthening
African R&D through effective transfer of tropical crop biotech to African institutions. Nat
Biotechnol 30(12):11701172
58. Jefferson RA (1987) Assaying chimeric genes
in plants: the GUS gene fusion system. Plant
Mol Biol Rep 5(4):387405
59. Jefferson RA, Kavanagh TA, Bevan MW
plants. EMBO J 6(13):39013907
60. Hoekema A, Hirsch PR, Hooykaas PJJ,
Schilperoort RA (1983) A binary plant vector
strategy based on separation of vir- and
T-region of the Agrobacterium tumefaciens
Ti-plasmid. Nature 303(5913):179180
61. Bull SE (2011) Study of post-harvest physiological deterioration in transgenic cassava.
University of Bath, Bath
Chapter 8
Potato (Solanum tuberosum L.)
Venkateswari J. Chetty, Javier Narvez-Vsquez,
and Martha L. Orozco-Crdenas
Abstract
Agrobacterium-mediated transformation is the most common method for the incorporation of foreign
genes into the genome of potato as well as many other species in the Solanaceae family. This chapter
describes protocols for the genetic transformation of three species of potato: Solanum tuberosum subsp.
tuberosum (Desir), S. tuberosum subsp. andigenum (Blue potato), and S. tuberosum subsp. andigena
using internodal segments as explants.
Key words Agrobacterium tumefaciens, Andigena, -Glucuronidase (uidA), Blue potato, Desir,
Neomycin phosphotransferase II (npt II), Plant transformation, Solanum tuberosum
Introduction
Potato (Solanum tuberosum L.) is the worlds third most important
food crop next to rice and wheat in terms of human consumption
with its production exceeding 300 million metric tons as reported
by International Potato Center [1]. Potato is a critical crop in
terms of food security. More than one billion population around
the globe consume potato. Potato is vegetatively propagated,
meaning that a whole plant can be grown from a potato tuber or a
piece of it. The new plant can produce 520 new tubers, which will
be genetic clones of the mother plant. Potato enjoys a long history
of improvement through traditional breeding. Breeders target
multiple traits, including resistance to biotic and abiotic stresses,
and tuber quality [2].
Recently, the full sequence of the potato genome has been
completed [3], opening a broad spectrum of possibilities to understand gene function and the genetic manipulation through plant
transformation for the improvement of this important crop.
Agrobacterium-mediated transformation is the most common
technique used for functional genomic studies in potato, and for
the introduction of novel traits into commercial potato varieties,
85
86
Venkateswari J. Chetty et al.
while preserving combinations of desirable traits. Even though

well-developed transformation protocols are available for common
potato varieties, potato transformation is genotype dependent,
limiting their usage and making practical applications not easily
adaptable to all genotypes [416]. In this chapter we describe the
Agrobacterium-mediated transformation protocols routinely used
in our laboratory for three different potato cultivars, namely,
Andigena, blue potato, and Desir. A. tumefaciens strain AGL1
harboring the binary vector pBI121 is used to infect the precultured internodal explants and deliver transgenes into plant cells.
After cocultivation the infected internodal explants are selected on
kanamycin-containing callus induction medium (CIM). Putative
transgenic plants are regenerated on shoot induction medium
(SIM) from selected calli. The process from explants preparation to
getting a transgenic plant takes about 90 days (Fig. 1). The average
transformation frequency (defined as the number of PCR-positive
transgenic plants/total number of explants used) for Andigena,
blue potato, and Desir is 35, 22, and 65 % respectively.
Fig. 1 Steps in the transformation of potato with Agrobacterium tumefaciens strain AGL1 harboring plasmid
pBI121. (a) Four-week-old in vitro plants used as source of inter nodal explants. (b) Pre-culture of internodal
explants on CIM for 2 days. (c) Callus formation on CIM with antibiotic selection in 23 weeks. (d) Shoot regeneration on SIM with antibiotic selection (4 weeks). (e) Shoot elongation on SIM with antibiotic selection
(2 weeks). (f) Rooting on RIM with antibiotic selection (3 weeks). (g) Histochemical detection of GUS expression
in transgenic shoots
2
2.1
Materials
Plant Material
2.2 Bacterial Strain

and the Binary Vector
2.3
87
Stock Solutions
In vitro micropropagated plants are used as source of stem internodal explants for transformation. Solanum tuberosum subsp.
tuberosum cv Desir and S. tuberosum subsp. andigenum (blue
potato) plants were originally established in vitro from tuber
sprouts. The plants are grown at 25 C under 16 h light/8 h dark
cycle with fluorescent light (irradiance of 60 mol/m2/s). Fourweek-old plantlets are used for the transformation studies.
1. Agrobacterium tumefaciens strain AGL1.
2. Binary vector: The binary vector pBI121 (Clontech, Palo
Alto, CA, USA) contains -glucuronidase (uidA) and neomycin phosphotransferase II (npt II) genes under the regulation of
the CaMV 35S promoter [17, 18]. The binary vector pBI121
is transformed into AGL1 using electroporation. Transformed
cells are selected on YEP plates with kanamycin (100 mg/L).
Kanamycin-resistant colonies are screened by colony PCR
using npt II primers. A PCR-positive colony is grown in 5 mL
of YEP with kanamycin, and Agrobacterium glycerol stocks
are prepared by mixing equal volumes of glycerol and the
Agrobacterium culture (1:1 ratio v/v). Glycerol stocks are
stored at 80 C.
All chemicals for stock solutions and culture media can be
obtained from different vendors including Sigma-Aldrich (www.
sigmaaldrich.com), Plantmedia (www.plantmedia.com), PhytoTechnology Laboratories (www.phytotechlab.com), and Caisson
Laboratories (www.caissonlabs.com). Unless otherwise specified,
all stock solutions are filter sterilized and stored at 20 C:
1. Gamborgs B5 vitamin solution (1,000): Dissolve 200 mg
nicotinic acid, 200 mg pyridoxine hydrochloride, and
2,000 mg of thiamine hydrochloride in 180 mL of ddH2O
[19]. Bring the volume up to 200 mL with ddH2O.
2. MS vitamin solution (1,000): Dissolve 100 mg thiamine
HCl, 50 mg pyridoxine HCl, 50 mg nicotinic acid, and
200 mg glycine in 100 mL of ddH2O [20].
3. Indole-3 butyric acid (IBA) solution (1 mg/mL): Dissolve
20 mg of IBA in 2 mL of 95 % ethanol. Bring the volume up
to 20 mL with ddH2O.
4. Naphthalene acetic acid (NAA) solution (1 mg/mL): Dissolve
20 mg of NAA in 1 mL of 1 M NaOH. Bring the volume up
to 20 mL with ddH2O.
5. Zeatin solution (1 mg/mL): Dissolve 50 mg zeatin in 1 mL of
1 M NaOH. Bring up the volume to 50 mL with ddH2O. Filter
sterilize, dispense into1 mL aliquots, and store at 20 C.
88
6. Benzyl amino purine (BAP) solution (1 mg/mL): Dissolve

50 mg BAP in a few drops of 1 N NaOH; bring the volume to
50 mL with ddH2O. Store at 4 C.
7. Acetosyringone solution (74 mM): Dissolve 145 mg acetosyringone (3,5-dimethoxy-4-hydroxyacetophenone) in
10 mL of 95 % ethanol, and store at 20 C.
8. Kanamycin sulfate solution (100 mg/mL): Dissolve 1 g of
kanamycin sulfate in 5 mL ddH2O, vortex, and bring the volume up to 10 mL with ddH2O. Filter sterilize, dispense into
1 mL aliquots, and store at 20 C.
9. Cefotaxime sodium salt solution (250 mg/mL): Dissolve
2.5 g of cefotaxime in 5 mL ddH2O, vortex, and bring the
volume up to 10 mL with ddH2O. Filter sterilize, dispense
into 1 mL aliquots, and store at 20 C.
10. Carbenicillin disodium salt solution (500 mg/mL): Dissolve
5 g of carbenicillin in 5 mL ddH2O, vortex, and bring the
volume up to 10 mL with ddH2O. Filter sterilize, dispense
into 1 mL aliquots, and store at 20 C.
11. Rifampicin solution (25 mg/mL): Dissolve 25 mg of rifampicin in 1 mL DMSO, vortex, and store at 20 C.
2.4
Culture Media
1. YEP-Agrobacterium medium: 10 g/L yeast extract, 10 g/L

peptone, 5 g/L NaCl; adjust pH to 7.2 with 1 M NaOH. For
solid medium, add Bacto agar (15 g/L) before autoclaving.
2. Agrobacterium infection medium (AIM): 4.3 g/L MS salts,
30 g/L sucrose, 1 mL MS vitamin stock solution (1,000).
3. Clonal propagation medium (CPM): Murashige and Skoog
(MS) salts [20] with sucrose 30 g/L, B5 vitamins (1), myoinositol 100 mg/L, naphthalene acetic acid 0.02 mg/L, agar
8 g/L, and pH 5.8.
4. Callusing, shoot regeneration, and rooting media. The composition of the medium for callus induction (callus induction
medium, CIM), shoot regeneration (shoot induction medium,
SIM), and rooting of shoots (root induction medium, RIM)
for the three potato genotypes is presented in Table 1. The pH
of all plant culture media is adjusted to pH 5.8 with 1 M KOH
and sterilized by autoclaving. The hormones are added prior
to autoclaving, but zeatin and all antibiotics are added after
autoclaving, when the temperature of the medium has dropped
to 55 C. Sterile medium is poured into 100 15 mm petri
dishes or magenta vessels in a laminar flow hood. All media
(liquid or solid) can be stored for several weeks at 4 C, but
media with the antibiotics must be fresh.
89
Table 1
Composition of medium for the induction of callus, shoots, and roots from stem internode
segments in three different genotypes of potato
Desir
Media components (L)
CIM
SIM
RIM
Blue potato
S. andigena
CIM/SIM RIM
CIM
SIM
RIM
MS salts (g)
4.33
4.33
4.33
4.33
4.33
4.33
4.33
4.33
B5 vitamins (1,000) (mL)
MS vitamins (1,000) (mL)
Sucrose (g)
20
20
20
30
20
Glucose (g)
16
16
16
100
100
100
100
100
100
100
100
IAA (mg)
0.5
0.05
BAP (mg)
0.1
NAA (mg)
0.2
0.02
0.02
Zeatin (mg)
2.5
2.2
GA3 (mg)
0.02
0.02
0.15
pH
5.8
5.8
5.8
5.8
5.8
5.8
5.8
5.8
Gelrite (g)
Agar (g)
Myoinositol (mg)
CIM callus induction medium, SIM shoot induction medium, RIM root induction medium
2.5 Stock Solutions

for DNA Isolation,
PCR Reaction, and
Electrophoresis [21]
1. 1 M TrisHCl (pH 7.5): Dissolve 121.1 g Tris base in 800 mL

of ddH2O. Adjust the pH to 7.5 by adding approximately
70 mL of concentrated HCl. Adjust the volume of the solution to 1 L with ddH2O. Store into aliquots and sterilize by
autoclaving.
2. 5 M NaCl: Dissolve 146.1 g NaCl in 350 mL ddH2O. Bring
the volume up to 500 mL with ddH2O.
3. 0.5 M ethylenediaminetetraacetic acid (EDTA, pH 8.0): Add
186.1 g of disodium EDTA to 800 mL of ddH2O. Stir vigorously on a magnetic stirrer. Adjust the pH to 8.0 with NaOH
(~20 g of NaOH pellets). Bring the volume up to 1 L with
ddH2O. Dispense into aliquots and sterilize by autoclaving
(see Note 1).
4. 10 % sodium dodecyl sulfate (SDS): Dissolve 10 g SDS in
80 mL H2O. Place in 250 mL bottle on a shaker until dissolved. Bring the volume up to 100 mL with ddH2O. Sterilize
by autoclaving.
90
5. DNA extraction buffer: Mix 10 mL 1 M Tris pH 7.5, 2.5 mL

5 M NaCl, 2.5 mL 0.5 M EDTA, and 2.5 mL 10 % SDS in a
50 mL Falcon tube. Bring the volume up to 50 mL with sterile
ddH2O. This buffer is stable at room temperature (RT).
6. TAE buffer (50): Dissolve 242 g of Tris base in 700 mL
ddH2O. Add 57 mL of glacial acetic acid and 100 mL 0.5 M
EDTA (pH 8.0). Bring the final volume of the mixture to 1 L
with ddH2O. Dispense in to 250 mL aliquots in 500 mL glass
bottles. Sterilize by autoclaving and store at RT.
7. TE buffer: Mix 5 mL 1 M TrisHCl pH 7.5 and 1 mL 0.5 M
EDTA pH 8.0 in about 100 mL ddH2O, and bring the volume up to 500 mL with ddH2O. Sterilize by autoclaving.
Make 25 mL aliquots and store at 4 C.
8. Loading buffer (6): Dissolve 25 mg of bromophenol blue in
3 mL sterile ddH2O, add 3 mL of glycerol, and bring the volume up to 10 mL with sterile ddH2O. Store at 4 C.
9. Ethidium bromide: Dissolve 10 mg in 1 mL of ddH2O. Bring
the volume up to 10 mL with sterile ddH2O. Store in a darkbrown glass bottle at RT (see Note 2).
10. 1 kb plus DNA ladder (Invitrogen): Mix 67 L of 6 loading
buffer, 100 L of DNA ladder, and 733 L of TE. Store at
20 C.
2.6 Histochemical
Analyses
Gus staining is a convenient way to analyze the expression of uidA

gene, which encodes the -glucuronidase (GUS). After staining for
GUS expression, the tissue can be either examined as whole preparation or processed further to observe activity patterns in tissue
sections using a microscope [17]:
1. Chloramphenicol (25 mg/mL): Dissolve 25 mg of chloramphenicol in 1 mL 100 % ethanol. Store at 20 C.
2. Phosphate buffer pH 7.0: Dissolve 2.76 g NaH2PO4 H2O in
20 mL of ddH2O. In a different beaker, dissolve 9.38 g
Na2HPO4 2H2O dibasic in 35 mL ddH2O (dissolves at
37 C). Combine 20 mL monobasic solution with 15 mL
dibasic solution. Adjust the pH to 7 with dibasic solution.
3. K3(FeCN6) 0.5 M: Dissolve 82.5 mg in 500 L ddH2O.
4. K4(FeCN6) 0.5 M: Dissolve 105.5 mg in 500 L ddH2O.
5. Triton X-100 (10 %): Dissolve 10 g of Triton X-100 in 80 mL
of ddH2O. Bring the volume up to 100 mL and stir until well
mixed. Sterilize by autoclaving and store at 4 C.
6. X-gluc staining solution: Dissolve 100 mg of X-gluc in 200 L
N,N-dimethylformamide (DMF). Add more DMF until the
solution is transparent.
91
7. GUS solution: Combine all the following components: 800 L

chloramphenicol (25 mg/mL), 200 L 0.5 M K3(FeCN6),
200 L 0.5 M K4(FeCN6), 4 mL 0.5 M EDTA pH 8.0, 200 L
100 % Triton X-100, and 200 L X-gluc solution. Bring the
volume up to 200 mL with ddH2O. Filter the solution with a
0.2 m Millipore filter. Aliquot in 50 mL Falcon tubes (covered with aluminum foil) and store at 20 C.
2.7 Other Solutions
and Supplies
1. Sterilization solution: 20 % commercial bleach (5.25 % sodium

hypochlorite) plus few drops of Tween-20.
2. Sunshine Universal Mix soil: Fosters (Waterloo, IA).
3. Sterile paper plates and towels.
4. Greenhouse standard open flat with drainage hole: McConkey,
Cat # EJPFONH.
5. Clear Humi-dome 7 (plastic, transparent): McConkey, Cat #
HYFCKDOME-50. Jiffy Peat Pellets 42 mm: McConkey, Cat
# JPA703.
6. Round Euro Pot 16 cm (diameter 6.25, height 6.75, Volume
2.5 qt/2.37 L McConkey, Cat # JMCATRI100B).
Methods
3.1 Growth
of In Vitro Plants
from Tuber Sprouts
1. Excise sprout tips (35 cm long) from germinating tubers

under storage or tubers planted in sterile soil.
2. Rinse cut sprouts with running tap water for 5 min.
3. Place sprouts in a 50 mL sterile Falcon tube, add 50 mL of
70 % ethanol, and shake for 5 min at 50 rpm at RT.
4. Remove the ethanol and rinse sprouts once with sterile deionized distilled water.
5. Add 50 mL of sterilization solution, and shake the tube for
20 min in a shaker at 100 rpm.
6. Remove the sterilization solution and wash the sprout tips five
times with sterile ddH2O. In a laminar flow hood, place the
sterilized sprouts on sterile paper towels on a paper plate to
remove the excess water.
7. Sprout tips are cultured on potato clonal propagation medium.
8. Incubate the shoot tips at 25 C under fluorescent light at
60 mol/m2/s with a photoperiod of 16/8 h light/dark.
3.2 In Vitro Plant

Propagation Using
Internodal Explants
1. Fully developed plants can be obtained from sprout tips in

about 4 weeks.
2. Stem node cuttings about 5 mm long are dissected from developed plants and placed onto CPM for plant micropropagation.
92
3. The explants are incubated under the same conditions as the

sprouts (step 8 in Subheading 3.1).
4. Four-week-old plantlets are used as source of internodal
explants for the transformation.
3.3 Preparation
of Agrobacterium
Culture
1. Follow standard techniques to transform Agrobacterium

strains with a binary vector that carries the gene or genes of
interest. The Agrobacterium strain AGL1 is stored as glycerol
stocks at 80 C.
2. To initiate the transformation take a loop full of culture from
a glycerol stock of Agrobacterium and streak it on YEP solid
medium containing the appropriate antibiotics (see Note 3).
Incubate the plate at 28 C for 2 days.
3. Inoculate a freshly grown single colony of Agrobacterium in
2 mL YEP with specific antibiotics. Incubate the culture in a
shaker (250 rpm) for two days at 28 C.
4. Add 100 L of liquid Agrobacterium culture to 50 mL YEP
with specific antibiotics, and incubate overnight at 28 C with
shaking.
5. Spin down the culture at 5,000 rpm (5,152 g) for 10 min
and resuspend the pellet in 10 mL of AIM.
6. Determine the OD600 of the Agrobacterium culture, and adjust
the OD to 0.6 with AIM (see Note 4).
7. Add 20 L of acetosyringone stock (74 mM) to 40 mL AIMdiluted Agrobacterium culture to be used for transformation.
3.4 Preparation
of Explants
for Agrobacterium
Inoculation
1. Excise internodal explants of 5 mm length from 4-week-old

propagated in vitro plants, by removing the nodal segments
with a sterile sharp scalpel blade on a sterile paper plate with
humid paper towels.
2. Transfer the internodal explants onto Whatman filter paper
placed over CIM medium in 100 15 mm petri dishes.
3. Seal the plates using plastic wrap, and incubate them for 2 days in
a growth room at 25 C, under fluorescent light (60 mol/m2/s)
with a photoperiod of 16/8 h light/dark.
3.5 Agrobacterium
Infection and
Cocultivation
1. Transfer the internodal explants into a Falcon tube with 40 mL

of the Agrobacterium suspension in AIM previously prepared
(see Subheading 3.3).
2. Incubate the explants with Agrobacterium cells for 20 min.
Shake the tubes gently during the incubation time in a rotatory or horizontal shaker at 50 rpm.
3. Remove the Agrobacterium suspension and transfer the
explants onto sterile paper towels. Blot dry the explants
between two sterile filter papers or sterile paper towels.
93
This step is very critical to avoid overgrowth of Agrobacterium

and obtain good transformation efficiencies.
4. Transfer the explants onto a new 100 20 mm petri dish containing a Whatman filter paper placed on CIM.
5. Seal the plates using plastic wrap, and incubate the explants for
2 days as described in step 8 of Subheading 3.1.
3.6 Selection
of Transgenic Callus
and Shoot Induction
1. After 2 days of cocultivation, collect the explants in Falcon

tubes and rinse them for 5 min with 40 mL of sterile ddH2O
with 250 mg/L of cefotaxime.
2. Blot dry the tissue explants between sterile filter paper and
sterile paper towels and transfer them to CIM containing
500 mg/L carbenicillin, 250 mg/mL cefotaxime, and
100 mg/L kanamycin (without filter paper).
3. Seal the plates with plastic wrap and incubate them as described
in step 8 of Subheading 3.1.
4. Transfer the explants on to fresh CIM plates once every 2 weeks.
5. If Agrobacterium overgrowth is observed, the explants should
be washed again 3 with 250 mg/L cefotaxime and 500 mg/L
carbenicillin, blot dry, and continue culturing on CIM.
6. Shoot primordia start to appear after the first 4 weeks.
3.7 Shoot Elongation

and Root Induction
1. Transfer explants with callus and shoot primordia to shoot

induction medium (SIM) supplemented with the same antibiotics (see step 2 of Subheading 3.5) in magenta boxes, and
incubate as before (see Note 5).
2. After 4 weeks on SIM, transfer elongated shoots that are at
least 2 cm long to test tubes containing 10 mL of RIM supplemented with 250 mg/L carbenicillin, 125 mg/L cefotaxime,
50 mg/L kanamycin, and incubate them as before.
3.8 Transplanting
and Acclimation
of Rooted Shoots
1. Gently remove the shoots with well-formed root systems

from the test tubes. Wash off the agar medium from the roots
using ddH2O (see Note 6).
2. Transfer each in vitro plantlet to a Jiffy peat pellet and place
them in a flat tray with water in the greenhouse. Use a transparent dome to cover the flat to maintain a high relative
humidity for acclimation during the first 3 days.
3.9 Greenhouse Care

1. After 1 week of acclimation, when roots are coming out of the

Jiffy pellet, transfer the established potato plantlet to 2 pots
with Sunshine Universal soil mix, wet with regular water, and
then move them to the greenhouse. Ensure that plants are
accurately labeled. The ideal greenhouse environmental conditions for all the three potato cultivars are temperature 22 C,
relative humidity (~70 %), and natural light.
94
2. After 3 weeks in small pots, transfer the potato plants to 6.5

pots with Sunshine Universal soil mix; water and fertilize them
regularly using a half-strength Hoaglands solution [22].
3. Keep plants growing in the greenhouse for around 3 months
for tuber production.
3.10 DNA Extraction
and PCR Analysis
1. Grind 100 mg of leaves from putative transgenic plants (i.e.,

kanamycin resistant) in an Eppendorf tube with 450 L of
extraction buffer (200 mM TrisHCl (pH 7.5), 250 mM NaCl,
25 mM EDTA (pH 8.0), 0.5 % SDS), followed by chloroform
extraction, and isopropanol precipitation of nucleic acids.
2. Wash the DNA pellet with 70 % ethanol two times, and resuspend in 50 L of TE buffer.
3. Dilute the DNA to a final concentration of 100 ng/L using
nuclease free water.
4. For regular end-PCR analysis, 100 ng of DNA is added to a
20 L of PCR reaction mix.
5. PCR reaction mix contains 0.25 mM dNTPs, 2 mM MgCl2,
0.5 U Ex Taq DNA polymerase (Life Technologies, NY, USA),
and 0.5 M of each primer pair for the amplification of the nptII
gene (forward primer: 5-GGATTGCACGCAGGTTCTCC-3,
and reverse primer: 5-AACTCGTCAAGAAGGCGATA-3).
6. Reaction conditions for end-PCR are 94 C for 5 min, followed by 29 cycles of 94 C for 30 s, 57 C for 30 s, 72 C for
1 min, and a final extension at 72 C for 10 min. The PCR
products are visualized after electrophoresis on 0.8 % agarose
gels. The gel is scored for the presence or absence of the nptII
product (773 bp).
3.11 Histochemical
Analyses for GUS
Assay
1. Submerge tissue samples in GUS solution.

2. Place the tissue under vacuum for 10 min. Close the valve and
let it stay for another 20 min in the dark.
3. Slowly open the valve and release the vacuum. Cover the container with Parafilm and then wrap it in aluminum foil and
incubate at 37 C for 816 h. Incubation time depends on the
tissue and the promoter fusion being used.
4. Remove the container from the incubator, and replace the
GUS solution with 50 % ethanol and incubate at 37 C for
1 h. Repeat the process with 70100 % ethanol until the tissue
is cleared. Tissue can remain in 70100 % ethanol indefinitely
at 4 C.
5. Look at the tissue samples under a microscope and take
pictures.
95
Notes
1. The EDTA disodium salt will not go into solution until the
pH of the solution is adjusted to ~8.0 by the addition of
NaOH.
2. Ethidium bromide is a strong mutagen and a possible carcinogen or teratogen. Its hazardous properties require the use
gloves for handling and safety disposal.
3. Rifampicin (25 mg/L) and kanamycin (50 mg/L) are added
to grow Agrobacterium strain AGL1 transformed with pBI121.
4. To calculate the final dilution volume of Agrobacterium (V1),
use the equation C1V1 = C2V2, where C1 and C2 are respectively
the initial and final OD and V2 the final volume. Use AIM to
dilute the Agrobacterium cells. Diluted Agrobacterium culture
has to be used immediately to avoid aggregation.
5. Shoots regenerated from the two cut ends of the explants can
be considered independent events. It is important to cut off
the calli at the base from the shoot.
6. Transgenic shoots start rooting after 35 days.
References
1. Potato (2013) Retrieved from http://cipotato.
org/potato
2. Facts and figures about potato (2013)
Retrieved from http://cipotato.org/potato/
publications/pdf/005449.pdf
3. Xu X, Pan S, Cheng S, Zhang B, Mu D, Ni P,
Visser RG (2011) Genome sequence and analysis of the tuber crop potato. Nature
475:189195
4. Bradeen JM, Carputo D, Douches D (2009)
Part 7 Transgenic sugar, tuber and fiber crops.
doi:10.1002/9781405181099. k0704 in
compendium of transgenic crop plants
5. De Block M (1998) Genotype-independent
leaf disc transformation of potato (Solanum
tuberosum) using Agrobacterium tumefaciens.
6. Stiekema WJ, Heidekamp F, Louwerse JD,
Verhoeven
HA,
Dijkhuis
P
(1998)
Introduction of foreign genes into potato
cultivars Bintje and Desiree using an
Agrobacterium tumefaciens binary vector.
Plant Cell Rep 7:4750
7. Sheerman S, Bevan MW (1988) A rapid transformation method for Solanum tuberosum
using binary Agrobacterium tumefaciens vectors. Plant Cell Rep 7:1315
8. Tavazza R, Tavazza M, Ordas RJ, Ancora G,
Benvenuto E (1988) Genetic transformation
9.
10.
11.
12.
13.
14.
of potato (Solanum tuberosum): an efficient

method to obtain transgenic plants. Plant Sci
59:175181
Wenzler H, Mignery G, May G, Park A (1989)
A rapid and efficient transformation method
for the production of large numbers of transgenic potato plants. Plant Sci 63:7985
Mitten DH, Horn M, Burrel MM, Blundy KS
(1990) Strategies for potato transformation and
regeneration. In: Vayda ME, Park WD (eds)
The molecular and cellular biology of the potato.
CAB International, Wallingford, pp 181191
Beaujean A, Sangwan RS, Lecardonnel A,
Sangwan-Norreel BS (1998) Agrobacteriummediated transformation of three economically important potato cultivars using sliced
internodal explants: an efficient protocol of
transformation. J Exp Bot 49:15891595
Millam S (2006) Potato (Solanum tuberosum
L.). In: Wang K (ed) Agrobacterium protocols,
vol 2, 2nd edn. Humana, Totowa, NJ, pp 2535
Chakravarty B, Wang-Pruski G (2010) Rapid
regeneration of stable transformants in cultures of potato by improving factors influencing Agrobacterium-mediated transformation.
Adv Biosci Biotechnol 1:409416
Trujillo C, Rodriguez-Arango E, Jaramillo S,
Hoyos R, Orduz S, Arango R (2001) One step
transformation of two Andean potato cultivars
96
15.
16.
17.
18.

(Solanum tuberosum L. subsp. andigena).
Banerjee AK, Prat S, Hannapel DJ (2006)
Efficient production of transgenic potato (S.
tuberosum L. ssp. andigena) plants via
Agrobacterium tumefaciens-mediated transformation. Plant Sci 170:732738
Narvez-Vsquez J, Ryan AC (2002) The systemin precursor gene regulates both defensive
and developmental genes in Solanum tuberosum.
Proc Natl Acad Sci U S A 99:1581815821
(1987) GUS fusion: glucuronidase as a sensitive and versatile gene fusion marker in higher
Po-Yen C, Chen-Kuen W, Shaw-Ching S, KinYing T (2003) Complete sequence of the
binary vector pBI121 and its application in
19.
20.
21.
22.
cloning T-DNA insertion from transgenic

plants. Mol Breeding 11:287293
Gamborg OL, Miller RA, Ojima K (1968)
Nutrient requirements of suspension cultures
of soybean root cells. Exp Cell Res 50:
151158
Murashige T, Skoog F (1962) A revised
medium for rapid growth and bio-assays with
tobacco tissue cultures. Physiol Plant 15:
473497
Sambrook J, Russell DW (2001) Molecular
cloning: a laboratory manual (3rd ed), CSHL
Press, New York, NY 3:11453
Hoagland DR, Arnon DI (1950) The water
culture method for growing plants without
soil. University of California. Agric. Exp.
Station, Berkeley
Chapter 9
Taro (Colocasia esculenta (L.) Schott)
Xiaoling He, Susan C. Miyasaka, Maureen M.M. Fitch, and Yun J. Zhu
Abstract
Genetic engineering of taro is an effective method to improve taro quality and the resistance to various
diseases of taro. Agrobacterium tumefaciens-mediated transformation of taro is more efficient than the
particle bombardment transformation method based on current research. The development of a regeneration system starting from taro shoot tip explants could produce dasheen mosaic virus (DsMV)-free plantlets.
Highly regenerative calluses could be developed from DsMV-free, in vitro plantlets on the Murashige and
Skoog (MS) medium with 2 mg/L BA and 1 mg/L NAA (M5 medium). The Agrobacterium tumefaciensmediated transformation method is reported in this chapter. The highly regenerative calluses were selected
and cocultivated with the Agrobacterium strain EHA105 harboring the binary vector PBI121 with either
a rice chitinase gene chi11 or a wheat oxalate oxidase gene gf2.8. After cocultivation for 34 days, these
calluses were transferred to selection medium (M5 medium) containing 50 mg/L Geneticin G418 and
grown for 3 months in the dark. Transgenic shoot lines could be induced and selected on the MS medium
containing 4 mg/L BA (M15 medium) and 50 mg/L Geneticin G418 for 3 months further in the light.
Molecular analyses are used to confirm the stable transformation and expression of the disease resistance
gene chi11 or gf2.8. Pathologic bioassays could be used to demonstrate whether the transgenic plants had
increased disease resistance to taro pathogens Sclerotium rolfsii or Phytophthora colocasiae.
Key words Agrobacterium tumefaciens, Colocasia esculenta, Dasheen mosaic-free plantlets, Genetic
engineering, Shoot tip explants, Taro, Transformation
Introduction
Taro (Colocasia esculenta (L.) Schott) is an important tropical
root crop which is cultivated worldwide especially in Southeast
Asia and the Pacific Islands [1, 2]. Traditionally, taro is propagated vegetatively using underground stems from sucker plants
(i.e., cormels) [3]. Approximately 10 % of the previous crops
cormels need to be used for propagation [3]. Several tissue culture protocols for various taro cultivars have been developed. The
development of an efficient taro tissue culture system could
reduce the usage of the cormels for propagating materials and
increase the speed and production of the taro propagation. For
example, Chand et al. in 1999 [4], Fukino et al. in 2000 [5],
97
98
Xiaoling He et al.
Hartman in 1974 [6], and He et al. in 2008, 2010, and 2013

[79] have reported that efficient tissue culture systems could be
developed using taro shoot tips as explants. Murakami et al. in
1995 [10] developed a regeneration system via protoplasts. In
addition, Deo et al. in 2009 [11] reported a protocol of the somatic
embryogenesis, organogenesis, and plant regeneration in taro.
In this chapter, we describe a protocol of establishment of
in vitro stock culture using taro shoot tips as explants and a protocol of inducing calluses and multiple shoots using in vitro shoot
tips [79]. The protocols we used are easy to conduct and only
need 12 cormels as propagating materials. Also, the regeneration efficiency is relatively high with an average of 12 multiple
shoots developed from each callus within 1 month [8]. In addition, this regeneration method using shoot tip explants could
eliminate the taro pathogen dasheen mosaic virus (DsMV) from
infected taro [8].
Major limiting factors in taro production are various taro
diseases that can severely decrease taro yields [12]. These taro diseases include: (1) taro leaf blight (TLB) caused by the oomycete
pathogen Phytophthora colocasiae, (2) taro pocket rot (TPR) caused
by a new species of Phytophthora, and (3) and southern blight
caused by the fungal pathogen Sclerotium rolfsii [12].
Conventional breeding is ongoing to increase resistance to
these diseases. However, one commercial taro cultivar that originated in China (cv. Bun Long) rarely flowers under natural
environmental conditions in Hawaii. Cultivar Bun Long as well as
several other cultivars does not respond to gibberellic acid (GA)
which is applied to induce flowering [13]. Lack of flowering makes
it impossible to improve taro quality and disease resistance by conventional breeding.
Genetic engineering of taro is an alternative to conventional
breeding to improve disease resistance. To date, four journal articles have reported transformation protocols of taro by either
particle bombardment method or Agrobacterium-mediated
method [5, 79]. Fukino et al. in 2000 [5] first reported transformation of taro cultivar Eguimo using a marker gene glucuronidase
(gus) gene. They used a particle bombardment method with a very
low efficiency (less than 0.5 %). He et al. in 2010 [8] also reported
a successful particle bombardment transformation method to insert
a disease resistance gene, rice chitinase gene chi11 with the same
low efficiency (less than 0.5 %). In addition, the Southern blot analysis showed a high-copy insertion of the transgene (13 copies) that
indicated a high risk of transgene silencing and rearrangement [8].
He et al. in 2008 [7] transformed a commercial taro cultivar Bun
Long with the rice chitinase gene chi11 via Agrobacterium-mediated
transformation, and transgenic plants showed increased disease
resistance to the pathogen Sclerotium rolfsii. Also, He et al. in 2013 [9]
99
used the same Agrobacterium-mediated transformation protocol to

insert a wheat oxalate oxidase gene gf2.8 into taro cv. Bun Long,
and the transgenic plants showed increased disease resistance to the
pathogen Phytophthora colocasiae. Agrobacterium-mediated transformation method had a higher transformation efficiency (13 %)
and lower-copy insertion of transgene (single copy or 23 copies)
than the particle bombardment transformation method [5, 79].
In this chapter, we describe this Agrobacterium-mediated transformation protocol in step-by-step laboratory procedures.
2
2.1
Materials
Plant Material
2.2 Growth
Regulator Stock
Solutions
Taro cv. Bun Long cormels were obtained from the University of
Hawaiis Waiakea Experiment Station. In vitro plantlets in culture
were established from primary shoot apices and axillary buds on
taro cormels. Highly regenerative calluses were induced from the
DsMV-free in vitro plantlets. These calluses were the targets of
Agrobacterium tumefaciens-mediated transformation.
1. -Naphthalene acetic acid (NAA): 100 ml 0.5 mg/mL stock is
prepared by dissolving 50 mg of NAA in 2 mL 1 N NaOH and
making up to volume with 98 mL of sterile distilled water.
Stock solution can be stored at 4 C for 6 months.
2. 6-Benzylaminopurine (BA): 100 ml 0.5 mg/mL stock is prepared by dissolving 50 mg of BA in 2 mL 1 N NaOH and making up to volume with 98 mL of sterile distilled water. Stock
solution can be stored at 4 C for 6 months.
2.3 Antibiotics
Stock Solutions
1. Cefotaxime sodium salt: Prepare as 250 mg/mL stock solution

in sterile distilled water, filter-sterilize through 0.2 m membrane, aliquot 1 mL into 1.5 mL sterile Eppendorf tubes, and
store at 20 C for 6 months.
2. G418 Sulfate: Prepare as 50 mg/mL stock solution in sterile
distilled water, filter-sterilize through 0.2 m membrane, aliquot 1 mL into 1.5 mL sterile Eppendorf tubes, and store at
20 C for 6 months.
3. Kanamycin monosulfate: Prepare as 50 mg/mL stock solution
in sterile distilled water, filter-sterilize through 0.2 m membrane, aliquot 1 mL into 1.5 mL sterile Eppendorf tubes, and
store at 20 C for 6 months.
4. Rifampicin: Prepare as 25 mg/mL stock solution in dimethyl
sulfoxide (DMSO), filter-sterilize through 0.2 m membrane,
aliquot 1 mL into 1.5 mL sterile Eppendorf tubes, wrap
Eppendorf tubes using foil paper to protect from light, and
store at 20 C for 1 year.
100
Xiaoling He et al.
2.4 Other Stock

Solutions
1. MS vitamin stock (1,000): 0.5 g/L thiamine HCl, 0.5 g/L

pyridoxine HCl, 0.05 g/L nicotinic acid, 2.0 g/L glycine.
Store 50 mL aliquots in Falcon tubes at 4 C for 6 months.
2. Acetosyringone (AS): 300 mM of stock solution is prepared by
dissolving 0.588 g of AS in 10 mL of DMSO, filter-sterilize
through 0.2 m membrane, aliquot 1 mL into 1.5 mL sterile
Eppendorf tubes, and store at 20 C for 6 months.
2.5
Culture Media
2.5.1 Plant
Culture Medium
The liquid medium for plant culture is prepared as either 3 mL

aliquots in test tubes or 30 mL aliquots in Magenta boxes, pH
adjusted with NaOH (1 N) to 5.8, and autoclaved for 30 min at
121 C.
All solid medium for plant culture is prepared as 500 mL aliquots in 1,000 mL Erlenmeyer flasks and pH adjusted with NaOH
(1 N) to 5.8 before adding gellan gum (Caisson). After adding
3 g/L gellan gum, the medium is autoclaved for 30 min at 121 C
and poured into 25 petri dishes (9 cm) when medium is cooled
down to about 55 C.
The liquid medium for Agrobacterium culture is prepared as
30 mL aliquots in 125 mL Erlenmeyer flasks, pH adjusted with
1 N NaOH to 7.07.2, and autoclaved for 30 min at 121 C. For
tube culture, aliquots of 3 mL autoclaved medium are added to
sterile 14 mL round bottom tubes (Thermo Scientific Nalgene).
The solid medium for Agrobacterium culture is prepared as
100 mL aliquots in 300 mL Erlenmeyer flasks and pH adjusted
with 1 N NaOH to 7.07.2 before adding agar. After adding
15 g/L agar, the medium is autoclaved for 30 min at 121 C and
poured into five 9 cm diameter petri dishes when medium is cooled
down to about 55 C.
1. Cocultivation medium: Murashige and Skoog (MS) medium
[14]4.3 g/L 1 MS basal salts, 30 g/L sucrose, 0.1 g/L
myoinositol, and 1 ml/L MS stock vitamin.
2. Callus induction medium (M5) [7]: MS medium plus 2 mg/L
BA and 1 mg/L NAA.
3. Shoot induction and multiplication medium (M15) [7]: MS
medium plus 4 mg/L BA.
4. Callus stage selection medium (CSM) [7]: M5 medium plus
250 mg/L of cefotaxime and 50 mg/L of G418.
5. Stage one shoot selection medium (SSM1) [7]: M15 medium
plus 250 mg/L of cefotaxime and 50 mg/L of G418.
6. Stage two shoot selection medium (SSM2) [7]: M15 medium
plus 125 mg/L of cefotaxime and 25 mg/L of G418.
7. Stage three shoot selection medium (SSM3) [7]: M15 medium
plus 25 mg/L of G418.
101
2.5.2 Agrobacterium
Culture Medium
1. YEB media: 5 g/L of tryptone; 1 g/L of yeast extract; 5 g/L

beef extract, 0.24 g/L MgSO4, and 5 g/L of sucrose.
2.6 Bacterial Strains

and Vector
1. Disarmed Agrobacterium tumefaciens strain EHA105 [15] containing the binary vector pBI121/ricchi11 or pBI121/gf2.8.
All EHA105 culture stocks are maintained in 30 % sterile
glycerol (v/v), 1 mL aliquots in 2 mL Eppendorf tubes stored
at -80 C.
2. Both vectors pBI121/ricchi11 [7] and pBI121/gf2.8 [9]
contain the selectable marker gene neomycin phosphotransferase II (nptII) for kanamycin and G418 resistance under the
NOS promoter and the reporter gene -glucuronidase (gus)
driven by the cauliflower mosaic virus (CaMV) 35S promoter.
In addition to these two genes, pBI121/ricchi11 contains the
rice chitinase gene chi11 driven by the CaMV 35S promoter.
In a separate construct, pBI121/gf2.8 contains the wheat oxalate oxidase gene gf2.8 driven by the gf2.8 promoter.
2.7 Other Supplies

and Solutions
1. Sterilizing solution: 20 % commercial bleach (Clorox) which

contains 1.25 % sodium hypochlorite as the active ingredient
and one drop of detergent Tween-80.
2. Planting medium: Sunshine Mix 4 (Aggregate Plus): perlite
mixture (2:1 v/v).
3. 2, 4, 8, and 14 in. diameter pots and plastic bags.
4. Fertilizer: Osmocote Classic (14:14:14) (Scotts), Professional
Horticulture.
Methods
3.1 Establishment
of In Vitro Plantlets
In vitro shoot or plantlet cultures are maintained under environmental conditions of 25 2 C, 16 h photoperiod at light intensity
of 15 mol/m2/s. In vitro shoot or plantlet cultures in liquid
medium are placed on a shaker with shaking at 95 rpm under the
same environmental conditions. In vitro callus cultures are maintained in the dark at 25 2 C:
1. Wash the cormels in running tap water for 5 min.
2. Excise approximately 1 cm3 cormel sections containing one
primary shoot apex or axillary bud each section.
3. Immerse cormel cubes in 70 % ethanol with 1 drop of
Tween-80 for 5 min.
4. Peel and remove cormel section outer layer tissues and pick
and excise the 0.51.5 mm shoot tips from the center of shoot
apices or axillary buds using a sterile needle. Microscope can be
used to help find the shoot tips (see Note 1).
102
Xiaoling He et al.
5. Place shoot tips into a sterile petri dish containing surfacesterilizing solution (1.25 % sodium hypochlorite plus 1 drop of
Tween-80) for 16 s (see Note 1).
6. Transfer shoot tips to another sterile petri dish containing sterile distilled H2O; lightly shake the petri dish by hand for 2 min
to rinse the shoot tips.
7. Transfer the shoot tips to the test tubes containing 3 mL M15
liquid media, with one shoot tip per test tube. Shake culture
for 2 months. Multiple shoots could be induced after 2 months
(see Fig. 1a). ELISA assay for DsMV can be conducted at this
stage (see Note 1).
8. Excise multiple DsMV-free shoots (approximately 10 mm in
length) and transfer them to M5 petri dish plate for inducing
calluses. Place these culture plates in the dark for 34 months.
Subculture every month to remove brown and dead tissues.
Fig. 1 (a) The multiple shoots induced from one shoot tip explant in the M15 liquid media. (b) The calluses
induced after transferring the DsMV-free shoots onto the M5 plate for 34 months. (c) The multiple shoots and
plantlets induced after transferring the callus onto the M15 plate for 34 months. (d) The cocultivated calluses
selected on the callus selection medium CSM. (e) The PCR-positive multiple shoots of the independent line C6
with the rice chitinase gene chi11 further selected on the stage two shoot selection medium SSM2. (f) The
plantlets of the independent line g5 with the wheat oxalate oxidase gene gf2.8 further selected on the stage
three shoot selection medium SSM3
103
Calluses should be induced after 34 months and can be

maintained on the M5 plates for 2 years with subculturing
every month (see Fig. 1b and Note 2).
9. Transfer calluses onto M15 petri dish plates for inducing
shoots. Place these culture plates in the light for 34 months.
Subculture every month to remove brown and dead tissues.
Multiple shoots and plantlets can be induced after 34 months
and can be maintained on the M15 plates for 7 years with subculturing every month (see Fig. 1c and Note 3).
3.2 Preparation
of Agrobacterium
Culture
1. Thaw the frozen Agrobacterium culture glycerol stocks

EHA105/ricchi11 or EHA105/gf2.8 on ice and mix by gently
tapping the Eppendorf tubes (see Note 4).
2. Streak a portion of the Agrobacterium EHA105/ricchi11 or
EHA105/gf2.8 on the YEB media plate supplemented with
25 g/mL rifampicin and 50 g/mL kanamycin.
3. Incubate the inoculated plates at 28 C for 4872 h. These
Agrobacterium culture plates can be used immediately or
maintained at 4 C within 1 month for future use.
4. Pick a single colony from the Agrobacterium culture plate and
inoculate it into the 3 mL YEB medium containing 25 g/mL
rifampicin and 50 g/mL kanamycin. Culture in an incubator
shaker at 250 rpm, 28 C for 48 h until the Agrobacterium
suspension becomes turbid (check the OD600 = 0.81 by using
a spectrophotometer).
5. Add 2 l of 0.3 M acetosyringone (AS) to the Agrobacterium
culture and mix well. Incubate in 28 C, 95 rpm for 30 min (see
Notes 5 and 7). Pour this 3 mL Agrobacterium + AS culture into
30 mL YEB medium in an Erlenmeyer flask for a dilution of
tenfold. Stand in a bio-safe hood for 10 min (see Notes 6 and 7).
3.3 Infection
and Cocultivation
1. Pour the 10 mL Agrobacterium + AS culture into a 9 cm sterile

petri dish for infection. For control (no Agrobacterium) treatment, retain 10 mL of YEB media in a separate sterile petri dish.
2. Pick white soft calluses of taro and chop them into small pieces
as infection targets (0.20.5 cm/callus) (see Note 7). Drop the
calluses immediately in the Agrobacterium + AS culture.
Immerse treatment calluses into the Agrobacterium + AS culture using sterile forceps. Immerse control calluses in YEB
media similarly. Immerse 3040 calluses in one petri dish at the
same time. Immersion time in the Agrobacterium + AS culture
is approximately 20 min for 3040 calluses (see Note 7).
3. Transfer all infected calluses of the same treatment side by side
onto a solid MS medium petri dish plate. Seal plates with
Parafilm and cocultivate at 25 2 C in the dark for 4 days
104
Xiaoling He et al.
3.4 Selection
and Regeneration
for Independent
Transgenic Lines
1. Transfer 3040 cocultivated calluses of the same treatment to

a 15 cm sterile petri dish containing sterile tissue paper. Blot
and dry the calluses with the sterile tissue paper to remove
excess Agrobacterium.
2. Transfer the calluses onto a callus selection medium (CSM)
(see Note 8). Place 910 calluses side by side for each plate (see
Fig 1d).
3. Incubate the plates in the dark at 25 2 C for 3 months.
Subculture monthly onto fresh CSM plates. Examine at least
once a week for any regrowth of Agrobacterium and subculture if necessary (see Note 9). After 3 months of selection,
histochemical -glucuronidase (GUS) assay and polymerase
chain reaction (PCR) analysis can be conducted on approximately 1/3 of the surviving calluses to screen putative transgenic callus lines.
4. Transfer the PCR-positive callus lines to stage one shootinducing selection medium SSM1 (see Note 8). Place the
selection plates under environmental conditions of 25 2 C,
16 h photoperiod at light intensity of 15 mol/m2/s for
3 months. Subculture monthly onto fresh SSM1 plates.
5. After 3 months of selection, GUS assay and PCR analysis can
be conducted using induced shoot tissue to screen the independent shoot lines.
6. Transfer PCR-positive multiple shoots of each independent
shoot line onto separated stage two shoot selection medium
SSM2. Place the selection plates under the same environmental
conditions for 1 month (see Fig. 1e).
7. Transfer the healthy plantlets with normal morphology of each
independent shoot line onto separate stage three shoot selection medium SSM3. Place the selection plates under the same
environmental conditions for another month (see Fig. 1f).
8. Transfer the healthy plantlets of each independent line with
normal morphology onto separate M15 medium plates. Place
the plates under the same environmental conditions for another
month.
9. Transfer the plantlets of each independent line into separate
Magenta boxes with liquid M15 medium. Shake at 95 rpm
under the same environmental conditions. Subculture the
multiple plantlets by cutting and placing the roots and leaves
monthly into fresh liquid M15 medium (see Note 10).
10. Molecular analyses including PCR, reverse transcription-PCR
(RT-PCR), and Southern blot can be conducted using plantlet
leaves of this stage to confirm the independent transgenic lines
(see Note 11).
3.5
Transplanting
105
1. Transgenic plantlets confirmed by Southern blot can be

transplanted to the pots containing nursery medium. In the
month before transplanting, do not cut roots for subculturing,
ensure roots of plantlets are immersed in the medium, and ensure
that other parts of plantlets are floating on the medium without
rafts. It is ready for transplanting when the size of plantlet is
57 cm in height and it has at least three roots (see Note 12).
2. Wash the plantlets in tap water to remove the M15 media and
brownish, dead tissues. Separate the twisted roots carefully.
3. Transplant the individual plantlet into one 2 in. plastic pot
filled with pre-watered planting medium described in
Subheading 2.7. Gently press the plantlet roots in to the planting medium. Cover each pot using one plastic bag and seal it
to maintain a high-moisture environment.
4. Place the pots in the growth room under environmental conditions of 25 2 C, 16 h photoperiod at light intensity of
15 mol/m2/s for 1 month. Open the plastic bag after 2 weeks
and remove the bag after 4 weeks. Water the individual plant
every other day (see Note 13).
5. Move the entire plant and nursery medium from the 2 in. pot
to the 4 in. pot. Fill the pots with the same pre-watered
plant medium and gently press it. Culture the plants for
another 1 month under the same environmental conditions
as described in step 4. Water the individual plant every
other day (see Note 13).
6. Move the entire plant and nursery medium from the 4 in. pot
to 8 in. pot using the same method as described in step 5. Add
approximately 2 g of slow-release fertilizer on the top of the
planting medium around the plant. Water the individual plant
every other day (see Note 13). Culture the plants for another
month.
7. Move entire plant and the nursery medium from the 8 in. pot
to 14 in. pot using the same method as described in step 5.
Use the same fertilizing and watering method as described in
step 6.
8. Bioassay of transgenic plants by taro pathogen Phytophthora
colocasiae can be conducted using the leaves or whole plants at
this stage, and the bioassay for pathogen Sclerotium rolfsii can
be conducted using the whole plants.
Notes
1. Unlike other protocols of in vitro shoot tip culture, this protocol describes directly surface-sterilizing the 0.51.5 mm shoot
tips for a very short time of 16 s. Using this protocol, contamination can be easily controlled and most explants remain
106
Xiaoling He et al.
healthy after surface sterilization. In addition, all ELISA tests

for DsMV conducted in our shoot tip culture experiment were
negative, indicating that this protocol is very efficient in eliminating DsMV. Most other protocols involve surface-sterilizing
11.5 cm corm sections first and then excising the 0.51.5 mm
shoot tips under microscope, making it difficult to prevent
microbial contamination.
2. Various protocols of inducing regenerative calluses for different taro cultivars have been reported. We also tested over 40
combinations of auxin (NAA or 2, 4-D) and cytokine (BA or
kinetin), taro extract, or sucrose in media for inducing regenerative calluses of taro cultivars Bun Long and Maui Lehua
[8, 16]. We found that the M5 medium is the best one among
the 40 media for inducing highly regenerative calluses of Bun
Long. However, regenerative calluses could not be produced
from Maui Lehua on all media tested.
3. Various protocols of shoot regeneration for different taro cultivars have been reported [46, 8, 16]. We also tested [8, 16]
several media with different plant hormones for inducing multiple shoots from Bun Long, and we found M15 medium was
the best for multiple shoot production.
4. In another experiment [16], we tested the effect of
Agrobacterium strains on Agrobacterium-mediated transformation of taro cv. Bun Long using Agrobacterium strains
EHA105 and LBA4404 harboring same binary vector pCNL65
containing GUS gene. EHA105 showed high GUS expression
level, but LBA4404 showed no GUS activity at all, indicating
LBA4404 is ineffective for transformation of taro using this
protocol.
5. In another experiment [16], we tested the effect of acetosyringone and cocultivation time on transformation of Bun Long
using EHA105/pCNL65 by evaluating the GUS expression
efficiency. Based on our results, 20 M acetosyringone and 4
days of cocultivation showed the highest transformation
efficiency.
6. Many other protocols use original Agrobacterium suspensions
(approximately OD600 = 0.81) to infect and cocultivate with
target explants. We found that it was very difficult to remove
the overgrowth Agrobacterium if we used such high concentrations of EHA105. Therefore, in this protocol, we diluted
the EHA105 tenfold to prevent the Agrobacterium overgrowth
problem.
7. To ensure effective infection of Bun Long with EHA105, we
made cutting wounds by slicing the calluses (0.20.5 cm/callus)
and extended the time of EHA105 and AS mixing, the time of
immersion of calluses and EHA105, and cocultivation from
the original protocol.
107
8. The selection gene nptII confers resistance to kanamycin or

Geneticin G418. Many other protocols use kanamycin as the
selection antibiotic. In this protocol, we use Geneticin G418 as
the selection antibiotic, because we found that non-transformed
Bun Long calluses and shoots could be grown on a high concentration of kanamycin (200 mg/L), indicating that the
selection stress of kanamycin is low for taro cv. Bun Long. We
found that the 50 mg/L of Geneticin G418 was an optimal
concentration to select transgenic lines of taro [16].
9. Normally, there is very little Agrobacterium regrowth due to
the low concentration of the Agrobacterium suspension used.
If there is Agrobacterium overgrowing on calluses, these calluses should be washed using 250 mg/L cefotaxime solution
and blotted on sterile tissue paper before transferring to fresh
CSM medium.
10. Both solid and liquid M15 medium can be used for fast micropropagation of multiple shoots. Normally, liquid M15 medium
produces more multiple shoots, but it is more susceptible to
microbial contamination than solid M15 medium.
11. Chimeric transformed calluses and shoots can occur and some
non-transformed events can escape the selection stress.
Therefore, molecular analyses PCR and Southern blot should
be conducted to confirm the successful transformation of lines
and copy numbers of the transgene.
12. Roots and leaves will grow if multiple shoots are cultured in
M15 medium. There is no need to transfer to a specific rooting
medium. Normally, roots grow faster and healthier in liquid
M15 medium than in solid M15 medium.
13. Normally, no watering is needed before opening the plastic
bag, but you will need to check the planting media moisture
every other day by observing if there are water drops in the
bag. After the plastic bag is removed, more watering is needed.
Typically, plants can be watered every other day, but you
should check the planting media every day to ensure that moisture is adequate.
References
1. Kreike CM, Van Eck HJ, Lebot V (2004)
Genetic diversity of taro, Colocasia esculenta
(L.) Schott, in Southeast Asia and the Pacific.
2. Food and Agriculture Organization of the United
Nations (FAO) (2010) http://faostat.fao.org/
3. Cho JJ, Yamakawa RA, Hollyer J (2007)
Hawaiian Kalo, past and future. Univ. of
Hawaii, College of Trop. Agr. and Human
Resources. SA-1
4. Chand H, Pearson MN, Lovell PH (1999)
Rapid vegetative multiplication in Colocasia
esculenta (L) Schott (taro). Plant Cell Tiss Org

Cult 55:223226
5. Fukino N, Hanada K, Ajisaka H (2000)
Transformation of taro (Colocasia esculenta
Schott) using particle bombardment. JARQ
34(3):159165
6. Hartman RD (1974) Dasheen mosaic virus
and other phytopathogens eliminated from
caladium, taro, and cocoyam by culture of
shoot tips. Phytopathology 64:237240
7. He X, Miyasaka SC, Fitch MM, Zhu YJ, Moore
P (2008) Agrobacterium tumefaciens-mediated
108
8.
9.
10.
11.
Xiaoling He et al.
transformation of taro (Colocasia esculenta (L.)
Schott) with a rice chitinase gene for improved
tolerance to a fungal pathogen Sclerotium rolfsii. Plant Cell Rep 27:903909
He X, Miyasaka SC, Fitch MM, Zhu YJ (2010)
Regeneration and transformation of taro
(Colocasia esculenta) with a rice chitinase gene
enhances resistance to Sclerotium rolfsii.
HortScience 45:10141020
He X, Miyasaka SC, Fitch MM, Khuri S, Zhu YJ
(2013) Taro (Colocasia esculenta) transformed
with a wheat oxalate oxidase gene for improved
resistance to taro pathogen Phytophthora colocasiae. HortScience 48(1):2227
Murakami K, Kimura M, Matsubara S (1995)
Plant regeneration from protoplasts isolated
from callus of taro. J Jpn Soc Hortic Sci
63(4):773778
Deo PC, Harding RM, Taylor M, Tyagi AP,
Becker DK (2009) Somatic embryogenesis,
organogenesis and plant regeneration in taro
12.
13.
14.
15.
16.
(Colocasia esculenta var. esculenta). Plant Cell

Tiss Org Cult 99:6171
Ooka JJ (1994) Taro diseases, a guide for
field identification. Univ of Hawaii, Hawaii Inst
Trop Agr Human Res, Res. Ext. Ser. 148. pp 13
Ivancic A, Lebot V, Roupsard O, QueroGarcia J, Okpul T (2004) Thermogenic flowering of taro (Colocasia esculenta, Araceae).
Can J Bot 82:15571565
for rapid growth and bioassays with tobacco tissue cultures. Physiol Plant 15:473497
Hood EE, Gelvin SB, Melchers S, Hoekema A
(1993) New Agrobacterium helper plasmids
for gene transfer to plants (EHA105). Trans
Res 2:208218
He X (2006) Transformation and regeneration
of taro with two plant disease resistance genes:
a rice chitinase gene and a wheat oxalate oxidase gene. Ph D dissertation. University of
Hawaii. ProQuest, UMI number: 3251049
Part III
Nuts and Fruits
Chapter 10
Apricot (Prunus armeniaca L.)
Csar Petri, Nuria Alburquerque, and Lorenzo Burgos
Abstract
A protocol for Agrobacterium-mediated stable transformation of whole leaf explants of the apricot (Prunus
armeniaca) cultivars Helena and Canino is described. Regenerated buds were selected using a two-step
selection strategy with paromomycin sulfate and transferred to bud multiplication medium 1 week after
they were detected for optimal survival. After buds were transferred to bud multiplication medium, antibiotic was changed to kanamycin and concentration increased gradually at each transfer to fresh medium
in order to eliminate possible escapes and chimeras. Transformation efficiency, based on PCR analysis of
individual putative transformed shoots from independent lines, was 5.6 %. Green and healthy buds,
surviving high kanamycin concentration, were transferred to shoot multiplication medium where they
elongated in shoots and proliferated. Elongated transgenic shoots were rooted in a medium containing
70 M kanamycin. Rooted plants were acclimatized following standard procedures. This constitutes the
only transformation protocol described for apricot clonal tissues and one of the few of Prunus.
Key words Agrobacterium tumefaciens, Apricot, Fruit trees, Prunus armeniaca, Rosaceae
Introduction
Fruit trees are among the most recalcitrant of plants to regenerate
adventitious shoots from cultured explants. In most woody fruit
species, transformation and regeneration are generally difficult and
often limited to a few genotypes or to seedlings [1]. This feature is
the major limiting factor preventing the development of gene
transfer technologies for fruit trees. Apricot (Prunus armeniaca
L.) is not an exception. For many years our research group at
CEBAS-CSIC in Murcia (Spain) has been working in the development of a reproducible and efficient procedure of apricot transgenic shoots regeneration by using clonal tissues as the source of
the explants.
Back in the late 1990s, some commercial cultivars were established in vitro and successfully micropropagated, as the first
requirement for regeneration and transformation protocols [2, 3].
At this point, an adventitious shoot regeneration protocol from
clonal mature tissues (leaves) was developed and later optimized
111
112
Csar Petri et al.
reaching regeneration rates of around 80 and 60 % for the cultivars

Helena and Canino, respectively [4, 5]. Several factors affecting
gene transfer mediated by Agrobacterium tumefaciens were studied
[6, 7], and different antibiotics for nptII-based selection (aminoglycoside antibiotics) were tested in apricot [8]. With these previous studies, we observed and demonstrated stable transformation
and expression of foreign genes in apricot, but no transformed
shoot was obtained. Selection strategy and bud recovery resulted
as key factors for transgenic shoot regeneration, and only when
selection was gradually increased transformed shoots were obtained
[9, 10]. More recently this protocol, or modifications, has been
used combined with MAT or Cre-loxP system for marker-free
transformed apricot shoot regeneration [11, 12]. With the protocol
we described in this chapter, transformation efficiencies up to 5.6 %
were reached for the Helena apricot cultivar, comparable to those
described for other woody species when mature tissues were used
as the source of explants [1].
Materials
2.1 Agrobacterium
tumefaciens Strain
and Vector
Agrobacterium tumefaciens strain EHA105, derivative of A281,

carrying the binary plasmid pBin19-sgfp [13] or p35SGusint [14]
has been used. The T-DNA of both plasmids contains the nptII
gene (the selectable marker gene, conferring aminoglycoside
antibiotics resistance to transformed cells) under control of the
nopaline synthase promoter and terminator (NOS) and the
reporter gene (sgfp or uidA) under control of the 35S promoter
and the NOS terminator (see Note 1).
2.2
Plant Material
First four expanded leaves from in vitro apricot shoots of Helena

or Canino cultivars.
2.3
Stock Solutions
2.3.1 Basal Salt Stock

Solutions
1. QL macronutrients [15] solution (10): Dissolve 4 g of

NH4NO3 and 12 g of Ca(NO3)24H2O in 300 mL ddH2O. In
a separate container, dissolve 3.6 g of MgSO47H2O, 18 g of
KNO3, and 2.7 g of KH2PO4 in 300 mL. When everything is
dissolved, mix together and add water to a final volume of 1 L
(see Note 2). Store at 4 C for several months.
2. DKW micronutrient and vitamin [16] solution (100): Dissolve
in 200 mL ddH2O 120 mg of H3BO3, 6.25 mg of CuSO45H2O,
837.5 mg of MnSO4H2O, 9.75 mg of Na2MoO42H2O,
425 mg of ZnSO47H2O, 845 mg of FeSO47H2O, 1,256.5 mg
of Na2-EDTA2H2O, 50 mg of glycine, 2,500 mg of myoinositol, 25 mg of nicotinic acid, and 50 mg of thiamine. When
everything is dissolved, add ddH2O to a final volume of
250 mL. Store at 4 C and protect from light. Keep for a maximum of 2 months.

2.3.2 Vitamins
and Phytohormones
113
1. 6-Benzylaminopurine riboside (BA-riboside, 0.56 mM):

Dissolve 20 mg BA in 1 mL 1 N NaOH. Add ddH2O to
100 mL final volume. Store at 4 C up to 4 weeks (see Note 3).
2. 3-Indolebutyric acid (IBA, 1.23 mM): Dissolve 25 mg IBA in
1 mL 1 N NaOH. Add ddH2O up to 100 mL final volume.
Store at 4 C.
3. 6-(3-Hydroxybenzylamino) purine (meta-topolin, 0.84 mM):
Dissolve 20 mg meta-topolin in 1 mL 1 N NaOH. Add ddH2O
to 100 mL final volume. Store at 4 C.
4. Adenine (3.7 mM): Dissolve 50 mg adenine in hot water. Add
ddH2O to 100 mL final volume. Store at 4 C.
5. Thidiazuron (TDZ, 23 mM): Dissolve 25 mg TDZ in 5 mL
dimethyl sulfoxide (DMSO). Store at 4 C up to 4 weeks.
6. -Naphthaleneacetic acid (NAA, 34 mM). Dissolve 25 mg
NAA in 1 mL 1 N NaOH. Add ddH2O up to 100 mL final
volume. Store at 4 C.
7. 2,4-Dichlorophenoxyacetic acid (2,4-D, 2.26 mM). Dissolve
50 mg 2,4-D in 3 mL 96 % ethanol. Add ddH2O up to 100 mL
final volume. Store at 4 C.
2.3.3 Antibiotics
1. Nalidixic acid (10 mg/mL): Dissolve in 0.1 N NaOH, filter

sterilize, and store at 20 C in aliquots.
2. Rifampicin (50 mg/mL): Dissolve in DMSO, filter sterilize,
and store at 20 C in aliquots.
3. Kanamycin sulfate (KAN, 50 mg/mL): Dissolve 500 mg in
10 mL ddH2O, filter sterilize, and store at 20 C in aliquots.
4. Paromomycin sulfate (PAR, 50 mg/mL): Dissolve 500 mg in
10 mL ddH2O, filter sterilize, and store at 20 C in aliquots.
5. Cefotaxime (CEF, 50 mg/mL): Dissolve 500 mg in 10 mL
ddH2O, filter sterilize, and store at 20 C in aliquots.
6. Vancomycin (VAN, 50 mg/mL): Dissolve 500 mg in 10 mL
ddH2O, filter sterilize, and store at 20 C in aliquots.
2.3.4 Others
1. Acetosyringone (AS, 0.1 mM): Dissolve 0.0981 g AS in 5 mL

DMSO and store at 4 C for 1 week.
2. Silver thiosulfate [Ag(S2O3)2]3 (STS, 4.65 mM): Dissolve
295 mg de Na2S2O3 in 50 mL ddH2O. Dissolve 79 mg AgNO3
in 50 mL ddH2O. Add the second solution on the first one
mixing continuously, and store at 4 C.
2.4
Culture Media
2.4.1 For Agrobacterium
1. Liquid Luria-Bertani medium (LB): Dissolve 20 g of LB broth

powder (Reference 1231.00, Conda Laboratories) in 800 mL
ddH2O. Adjust pH to 7.0 with NaOH, and make up to
1,000 mL final volume with ddH2O sterilizing by autoclaving.
Store at room temperature and add antibiotics as necessary to
culture Agrobacterium strains containing plasmids of interest.
114
Csar Petri et al.
2. Solid LB medium: Add 15 g/L Plant Propagation Agar

(Conda Laboratories) to LB. Cool down the medium to
4550 C. Add antibiotics as necessary.
3. Bacterial simplified induction medium (SIM) [17]: 20 mM
sodium citrate, 2 % (w/v) sucrose (pH 5.5) and 500 M
AS. Dissolve in ddH2O sodium citrate and sucrose. Adjust pH
to 5.5 with KOH. Sterilize the induction medium by autoclaving.
Cool down the medium to 4550 C. Add filter-sterilized AS
after autoclaving.
2.4.2 For Apricot
1. Shoot multiplication medium (SMM): Mix QL macronutrients

and DKW micronutrients, vitamins and organic compounds,
3 % sucrose, and 0.7 % (w/v) Plant Propagation Agar (Conda
Laboratories). SMM is supplemented with 3 mM CaCl2,
1.12 M BA-riboside, 0.05 M IBA, 2.1 M meta-topolin,
and 29.6 M adenine.
2. Rooting medium (RM): Consists of the same basal salts than
SMM supplemented with 2 % sucrose and 0.7 % (w/v) Plant
Propagation Agar (Conda Laboratories). Additionally, the
medium is supplemented with 1.5 mM CaCl2, 0.8 mM phloroglucinol, 20 mM IBA, and 29.6 M adenine.
3. Shoot regeneration medium (SRM): Mix QL macronutrients,
DKW micronutrients and vitamins, 3 % (w/v) sucrose, 9 M
TDZ, 4 M NAA, and 0.7 % (w/v) Plant Propagation Agar
(Conda Laboratories), and sterilize by autoclaving.
4. Cocultivation medium: SRM supplemented with 9.05 M of
2,4-D. Add filter-sterilized 100 M AS.
5. Selection medium (SM): SRM supplemented with filtersterilized 60 M STS, 0.63 mM CEF, 0.13 mM VAN, and
20 M PAR.
6. Bud multiplication medium (BMM): Mix QL salt medium
(Duchefa, Haarlem, the Netherlands. Reference Q0251 powder), 3 % (w/v) sucrose, 6.65 M BA, 0.05 M IBA, and 0.7 %
(w/v) Plant Propagation Agar (Conda Laboratories).
Autoclave to sterilize. Cool down the medium to 4550 C.
Add filter-sterilized 0.63 mM CEF, 0.13 mM VAN, and 40 M
PAR. The pH of all media was adjusted to 5.7 before adding
the agar and autoclaving (see Note 4).
Methods
3.1 Growing Donor

Plants for Leaf
Regeneration
1. In vitro apricot shoots from cvs. Helena or Canino are

maintained by subculturing at 3-week intervals on a shoot
multiplication medium (SMM), at 22 1 C under cool white
fluorescent tubes (55 mol/m2/s) with a 16 h photoperiod
(Fig. 1a) (see Note 5).
115
Fig. 1 Apricot leaf transformation. The four younger, expanded leaves from apricot micro shoots (a) are
detached and cut two or three times perpendicular to the midrib but without fully separating the segments (b).
After Agrobacterium infection, coculture and transfer to regeneration medium adventitious buds regenerated
from the reactive leaves (c). Regenerated buds have to be rescued as soon as possible for optimal survival and
transferred to bud multiplication medium where selection is increased gradually until 100140 M kanamycin
is reached. Only surviving, green, and healthy buds (d) are then transferred to selective shoot multiplication
medium where they elongate in shoots and proliferate (e). Finally elongated shoots can be rooted in selective
medium (f) and acclimatized (g). Bar represents 1 cm
3.2 Explants
Preparation
1. Collect the first four apical expanding leaves from 3-week-old

proliferating shoots, place them in liquid SRM (SRM without
agar), and swirl to randomize.
2. Place explants on a sterile filter paper (Fig. 1b) and cut each
leaf transversely three or four times across the midrib without
fully separating the segments (see Note 6).
3.3 Agrobacterium
Culture and
Preparation
1. Culture the bacterium overnight in 25 mL LB with the proper

antibiotics on a 100 rpm shaker at 28 C. For EHA105
chromosomal resistance selection we used 100 mg/L rifampicin or 25 mg/L nalidixic acid. For pBin-sgfp or p35SGusint
plasmid selection 50 mg/L kanamycin was used.
2. Spin down the bacterium culture (986 g; 15 min at room
temperature).
3. Resuspend the bacteria in 25 mL bacterial SIM.
4. Dilute the bacterial suspension in SIM, containing 500 M AS,
to OD600 = 0.2.
5. Incubate the bacterium from 5 h to overnight in SIM plus AS
on a 100 rpm shaker at 25 C.
116
Csar Petri et al.
6. Spin down the bacterium (3,000 rpm; 15 min at room

temperature).
7. Resuspend the bacterium in liquid SRM and dilute to
OD600 = 0.02.
3.4
Coculture
1. Place the leaf explants in the bacterium suspension for 10 min.

2. Dry the explants on a sterile filter paper and place them on the
cocultivation medium.
3. Transfer the explants to SRM supplemented with 100 M AS
and 9.05 M of 2,4-D. Seal the petri dishes and incubate them
in the dark at 22 1 C for 4 days.
3.5 Washing
(See Note 7)
1. After coculture, rinse the explants briefly in liquid SRM supplemented with 1.26 mM CEF and 0.26 mM VAN.
2. Dry the explants on sterile filter paper.
3.6 Transgenic
Shoot Regeneration
1. Transfer explants on SRM supplemented with 60 M STS,

0.63 mM CEF, 0.13 mM VAN, and 20 M PAR in petri plates
(see Note 8).
2. After 10 days transfer the explants to the same medium with
40 M PAR for the remainder of the experiment.
3. Explants are cultivated for 2 weeks in the dark and then they
are transferred to light with a 16 h photoperiod and 55 mol/
m2/s light intensity.
4. Subculture of leaf explants to fresh medium must be done
every 4 weeks.
5. After 56 weeks, buds start appearing (Fig. 1c).
6. Rescue all regenerated buds the week after they are detected,
transferring them onto BMM supplemented with 40 M KAN
(see Note 9), 0.63 mM CEF, and 0.13 mM VAN.
7. All regenerated buds are subcultured every 4 weeks to BMM
medium with increasing antibiotic concentration. Every cycle
the kanamycin concentration is increased in 20 M up to the
final concentration of 100140 M (see Note 10).
3.7 Transgenic
Shoot Elongation
and Multiplication
1. Transfer only green and healthy buds or meristem aggregates

to SMM (Fig. 1d) supplemented with 100140 M KAN,
0.63 mM CEF, and 0.13 mM VAN for transgenic shoot elongation and multiplication (see Note 11).
3.8
1. Shoots of 24 cm in length, growing in selective SMM

(Fig. 1e), are transferred to RM supplemented with 70 M
KAN (see Note 12).
Rooting
3.9
Acclimatization
117
1. Transgenic plants are acclimated following standard procedures.

In optimal conditions high-frequency acclimatization (7080 %)
can be obtained.
2. Transfer rooted explants (Fig. 1f) to a 200 cc pots containing
a mixture of peat and perlite (2:1). Acclimatization of plants
occurs within a tunnel with >85 % relative humidity, achieved
by means of intermittent mist. For hardening plants, the plastic
covering the tunnel is opened gradually for a few minutes a day
until normal greenhouse conditions can be maintained without desiccation of the plants.
3. The acclimatization period is 15 days, and then acclimated
plants are transferred to a 2.5 L pot and maintained in the
greenhouse (Fig. 1g).
Notes
1. As an example in this protocol, sgfp or uidA reporter genes
have been used for monitoring the transgenic shoot regeneration. These genes may be substituted for the gene of interest in
each case.
2. Dissolving all salts in the same recipient may lead to some salts
precipitation.
3. We recommend making fresh stock solution after 4 weeks for
all growth regulator stock solutions.
4. Autoclave all media at 121 C for 20 min.
5. Shoot multiplication medium composition is a key factor for
the subsequent successful adventitious bud regeneration [5].
Different apricot cultivars may need a different multiplication
medium.
6. Proceed to this step with a few explants at a time to avoid
explant dehydration.
7. This step is only necessary if overgrowth of Agrobacterium is
observed after coculture; otherwise go to Subheading 3.6.
8. Culture a maximum of seven leaves per petri dish.
9. Paromomycin was the only aminoglycoside antibiotic tested
that allowed the production of transgenic buds at the early
regeneration stages [10]. However, this antibiotic did not
effectively kill the escaped buds once they regenerated and did
not produce bleaching. We have found that kanamycin is much
more aggressive, producing bleaching and killing nontransgenic buds (Fig. 2).
118
Csar Petri et al.
Fig. 2 Elimination of escapes and chimeras by culturing buds in multiplication medium with increasing kanamycin concentrations. The differential effect of the antibiotic eliminating escapes and chimeras can be
observed in a petri dish (a) but also within a developed bud, where green and healthy meristems are appearing
in a bud with bleached leaves and necrotic areas (b)
10. In our experience most of the regenerated buds are chimeras.

Maintaining them in a medium that stimulate the production
of new meristems and progressively increasing the selection
allow the elimination of escapes and chimeras.
11. Still in this step it is possible to detect chimeras, but only uniformly transgenic buds will be able to elongate and proliferate
in this antibiotic concentration. Collect only the green and
vigorous shoots able to proliferate, and discard chlorotic or
non-vigorous shoots; they probably are escapes or chimeras.
12. Rooting of all shoots is not to be expected since it does not
happen even in standard conditions. However, rooted shoots
should develop a good rooting system with secondary roots
(Fig. 1f).
References
1. Petri C, Burgos L (2005) Transformation of
fruit trees. Useful breeding tool or continued
future prospect? Transgenic Res 14:1526
2. Prez-Tornero O, Burgos L (2000) Different
media requirements for micropropagation of
apricot cultivars. Plant Cell Tiss Organ Cult
63:133141
3. Prez-Tornero O, Burgos L, Egea J (1999)
Introduction and establishment of apricot in
vitro through the regeneration of shoots from
meristem tips. In Vitro Cell Dev Biol Plant
35:249253
4. Prez-Tornero O, Egea J, Vanoostende A,
Burgos L (2000) Assessment of factors affecting adventitious shoot regeneration from in
vitro cultured leaves of apricot. Plant Sci 158:

6170
5. Burgos L, Alburquerque N (2003) Low kanamycin concentration and ethylene inhibitors
improve adventitious regeneration from apricot leaves. Plant Cell Rep 21:11671174
6. Petri C, Alburquerque N, Garca-Castillo S,
Egea J, Burgos L (2004) Factors affecting
gene transfer efficiency to apricot leaves during
early Agrobacterium-mediated transformation
steps. J Hortic Sci Biotechnol 79:704712
7. Petri C, Alburquerque N, Prez-Tornero O,
Burgos L (2005) Auxin pulses and a synergistic
interaction between polyamines and ethylene
inhibitors improve adventitious regeneration
8.
9.
10.
11.
12.
from apricot leaves and Agrobacteriummediated transformation of leaf tissues. Plant

Cell Tiss Organ Cult 82:105111
Petri C, Alburquerque N, Burgos L (2005)
The effect of aminoglycoside antibiotics on the
adventitious regeneration from apricot leaves
and selection of nptII-transformed leaf tissues.
Plant Cell Tiss Organ Cult 80:271276
Petri C, Wang H, Alburquerque N, Faize M,
Burgos L (2008) Agrobacterium-mediated
transformation of apricot (Prunus armeniaca L.) leaf explants. Plant Cell Rep 27:
13171324
Petri C, Lpez-Noguera S, Alburquerque N,
Egea J, Burgos L (2008) An antibiotic-based
selection strategy to regenerate transformed
plants from apricot leaves with high efficiency.
Plant Sci 175:777783
Petri C et al (2012) A chemical-inducible CreLoxP system allows for elimination of selection
marker genes in transgenic apricot. Plant Cell
Tiss Organ Cult 110:337346
Lpez-Noguera S, Petri C, Burgos L (2009)
Combining a regeneration-promoting gene
13.
14.
15.
16.
17.
119
and site-specific recombination allows a more

efficient apricot transformation and the elimination of marker genes. Plant Cell Rep 28:
17811790
Chiu C et al (1996) Engineered GFP as a vital
reporter in plants. Curr Biol 6:325330
Vancanneyt G, Schmidt R, OConnor-Sanchez
A, Willmitzer L, Rocha-Sosa M (1990)
Construction of an intron-containing marker
gene: Splicing of the intron in transgenic plants
and its use in monitoring early events in
Agrobacterium-mediated plant transformation.
Mol Gen Genet 220:245250
Quoirin M, Lepoivre P (1977) Etude de
milieux adaptes aux cultures in vitro de Prunus.
Acta Hortic 78:437442
Driver JA, Kuniyuki AH (1984) In vitro propagation of Paradox walnut rootstock.
HortScience 19:507509
Alt-Mrbe J, Khlmann H, Schrder J (1989)
Differences in induction of Ti plasmid virulence
genes virG and virD and continued control of
virD expression by four external factors. Mol
Plant-Microbe Interact 2:301308
Chapter 11
Blueberry (Vaccinium corymbosum L.)
Guo-Qing Song
Abstract
Vaccinium consists of approximately 450 species, of which highbush blueberry (Vaccinium corymbosum) is
one of the three major Vaccinium fruit crops (i.e., blueberry, cranberry, and lingonberry) domesticated in
the twentieth century. In blueberry the adventitious shoot regeneration using leaf explants has been the
most desirable regeneration system to date; Agrobacterium tumefaciens-mediated transformation is
the major gene delivery method and effective selection has been reported using either the neomycin
phosphotransferase II gene (nptII) or the bialaphos resistance (bar) gene as selectable markers. The
A. tumefaciens-mediated transformation protocol described in this chapter is based on combining
the optimal conditions for efficient plant regeneration, reliable gene delivery, and effective selection. The
protocol has led to successful regeneration of transgenic plants from leaf explants of four commercially
important highbush blueberry cultivars for multiple purposes, providing a powerful approach to
supplement conventional breeding methods for blueberry by introducing genes of interest.
Key words Agrobacterium tumefaciens, Genetic transformation, Leaf explant, plant regeneration,
Transgenic plant
Introduction
Vaccinium is a genus of terrestrial shrubs in the family Ericaceae
(Syn. Heath) [1]. It consists of approximately 450 species, of which
three Vaccinium fruit crops (blueberry, cranberry, and lingonberry) have been domesticated since the twentieth century [2].
Vaccinium crops are economically important fruit crops due in
part to their exceptional nutritional value and high amounts of
antioxidants and anti-inflammatory capacities that benefit human
health [3].
Highbush blueberry (Vaccinium corymbosum L.) is by far the
most important commercial blueberry (Vaccinium sp.), a highly
heterozygous, polyploid crop [4]. To date, all blueberry cultivars
have been generated exclusively through the traditional breeding
approaches (i.e., controlled hybridization and deliberate selection).
In general, it takes over 10 years to produce a finished cultivar
through these approaches. A major limitation is that not every
121
122
Guo-Qing Song
desirable trait can be easily found in the natural germplasm pool.

In addition, the multiple gene exchanges involved in intra- or
interspecific hybridizations lead to uncontrollable transfer of both
desirable and undesirable genes to progeny; thus, the unique traits
that make a variety special can be hard to regain after hybridization
without the simultaneous inclusion of negative traits from the
other parent.
Genetic transformation can supplement and extend traditional
breeding methods through direct and precise manipulation of individual genes of interest for blueberry improvement [5]. To date, we
have developed a reliable transformation protocol for blueberry cultivars [6, 7] through which we obtained transgenic blueberry plants
and conducted the first field trial of transgenic blueberry with herbicide resistance in 2006 [8, 9]. In 2009, we transformed a blueberry C-repeat binding factor (CBF) gene (GenBank AF234316)
into a southern highbush blueberry cultivar Legacy (a more coldsensitive cultivar); transgenic blueberry plants overexpressing the
endogenous CBF gene showed promise for increasing freezing tolerance [10]. More recently, we isolated a blueberry FLOWERING
LOCUS T (FT)-like gene (VcFT) from the cDNA of a tetraploid
northern highbush blueberry cv. Bluecrop. Overexpression of the
VcFT is able to reverse the photoperiodic and chilling requirements
and drive early and continuous flowering [11]. So far, there was no
evidence that the transgenes were unstable in transgenic blueberry
plants [12]. These results demonstrate the unique value of genetic
transformation for blueberry breeding.
As the genome of blueberry has been sequenced and become
available, more genes of interest will be identified and isolated.
Genetic transformation will be a power tool that allows us to evaluate these genes as to their functions. We established a protocol for
transformation of highbush blueberry cultivars by Agrobacterium
tumefaciens [6]. Briefly, leaf explants of the cultivars Aurora,
Bluecrop, Brigitta, and Legacy are inoculated with strain EHA105
containing the binary vector pBISN1 with the neomycin phosphotransferase gene (nptII) and an intron-interrupted GUS reporter
gene (gusA). Cocultivation is for 6 days on modified McCowns
Woody Plant Medium (WPM) [13] containing 100 M acetosyringone in the dark. Explants are then placed on selection medium
[modified WPM plus 1.0 mg/L thidiazuron (TDZ), 0.5 mg/L
-naphthaleneacetic acid (NAA), 10 mg/L kanamycin monosulfate
(Km), and 250 mg/L cefotaxime] in the dark for 2 weeks, followed
by culture in the light at 30 E/m2/s at 25 C. Proliferation of
Km-resistant shoots is performed on WPM containing 1.0 mg/L
zeatin, 20 mg/L Km, and 250 mg/L cefotaxime. The transformation protocol yields Km-resistant GUS-positive shoots that are also
polymerase chain reaction (PCR) positive at frequencies, defined as
the percentage of inoculated explants that produced GUS- and
PCR-positive shoots, of 15.3 % for Aurora, 5.0 % for Bluecrop,
10.0 % for Brigitta, and 5.6 % for Legacy. Stable integration of gusA
123
was confirmed by Southern hybridization [6]. The A. tumefaciensmediated transformation protocol described in this chapter is routinely used in our laboratory.
2
2.1
Materials
Plant Material
1. Starting plant materials: 1-year-old softwood branches of highbush blueberry cvs. Aurora (Michigan State University cv.),
Bluecrop, Brigitta, and Legacy, preferably taken from
greenhouse-grown plants.
2. Leaf explants are taken from in vitro cultured stock shoots.

and Binary Vector
1. Leaf explants of blueberry cultivars are susceptible to all three

A. tumefaciens strains EHA105 [14], LBA4404 [15], and
GV3101 [16]. These A. tumefaciens strains are stored in 20 %
sterile glycerol (v/v) at 80 C (see Note 1).
2. Binary vectors contain either the nptII gene conferring Km
resistance or the bialaphos resistance (bar) gene (see Note 2).
2.3 Culture Medium

and Stock Solutions
Media pH is adjusted with 1 N NaOH or 1 N HCl before adding

the agar and autoclaving (see Note 3). Double-distilled water
(ddH2O) is used unless otherwise mentioned. All media are autoclaved at 121 C for 20 min at 105 kPa. Kept at room temperature,
the media can be used in a week; otherwise, stored at 4 C up to
2 weeks. Sterile stock solutions of zeatin, Km, cefotaxime, timentin, and acetosyringone are added to liquid medium with agar
cooled to 5060 C or to liquid medium at room temperature after
autoclaving:
1. Stock culture medium (WPMZ) [17]: 2.3 g/L WPM Basal
Salt Mixture, 1 mL 1,000 Murashige and Skoog (MS) [18]
vitamin solution, 556 mg/L Ca(NO3)24H2O, 4 mg/L zeatin
or zeatin riboside, 20 g/L sucrose, 6 g/L Bacto agar,
pH 5.2. Magenta GA7/GA7-3 boxes, or 40 mm 110 mm
glass jars with caps are used for shoot cultures.
2. WPM4Z: WPMZ containing 4 mg/L zeatin or zeatin riboside
(see Note 4).
3. WPM2Z: WPMZ containing 2 mg/L zeatin or zeatin riboside
(see Note 5).
4. McCowns Woody Plant Medium salts (100): (A) 40 g
NH4NO3, 68.4 g Ca(NO3)24H2O; (B) 17 g KH2PO4, 0.62 g
H3BO3, 0.025 g Na2MoO42H2O; (C) 19 g KNO3; (D) 37 g
MgSO47H2O, 2.23 g MnSO4H2O, 0.86 g ZnSO47H2O,
0.025 g CuSO45H2O; (E) 7.34 g C10H13FeN2NaO8 (ethylenedinitrilotetraacetic acid (EDTA) ferric sodium salt). Make
up to 1 L with ddH2O. Store at 4 C after autoclaving.
124
Guo-Qing Song
5. Modified McCowns Woody Plant Medium (MWPM): 10 mL

100 McCowns Woody Plant Medium salts, 1 mL 1,000 MS
vitamins, 20 g/L sucrose, 6 g/L Bacto agar.
6. Regeneration medium (RM): MWPM containing 1 mg/L
TDZ, 0.5 mg/L NAA, pH 5.2 (see Note 6). Alternatively, use
commercial WPM Basal Salt Mixture, MS vitamins, 556 mg/L
Ca(NO3)24H2O, 20 g/L sucrose, 6 g/L Bacto agar, pH 5.2
(herein WPMC), 1 mg/L TDZ , and 0.5 mg/L NAA [19]
(see Note 7).
7. Cocultivation medium: RM plus 100 M acetosyringone,
20 g/L sucrose, 6 g/L Bacto agar (for solidified medium),
pH 5.2.
8. Selection medium: RM containing 250 mg/L cefotaxime
(or timentin), 10 mg/L Km (see Note 8) when the nptII gene
is the selectable marker, or 0.1 mg/L glufosinate ammonium
when the bar gene is the selectable marker.
9. Shoot proliferation medium for transformants: WPM4Z
containing 250 mg/L cefotaxime (or timentin), 20 mg/L Km
(see Note 9) when the nptII gene is the selectable marker, or
0.5 mg/L glufosinate ammonium when the bar gene is the
selectable marker.
10. Agrobacterium culture medium (YEB [20]): 1 g/L Bacto
Yeast Extract, 5 g/L beef extract, 5 g/L peptone, 0.5 g/L
MgSO47H2O, 5 g/L sucrose, 15 g/L Bacto agar (for
solidified medium), pH 7.0 (see Note 10).
11. Stock solution of plant growth regulators: 1 mg/mL TDZ in
dimethyl sulfoxide (DMSO) and 1 mg/mL NAA store at 4 C
up to 6 months. Zeatin in solvent 1 N NaOH is diluted to
1 mg/mL with ddH2O, filter-sterilized through 0.22 m
Millex-GV filters, and stored in aliquots at 20 C.
12. Antibiotic stock solution: 50 mg/mL Km; 250 mg/mL cefotaxime; 250 mg/mL timentin; the stocks are all dissolved in
ddH2O, filter-sterilized through 0.22 m Millex-GV filters,
and stored in aliquots at 20 C.
13. Acetosyringone (100 mM): Dissolve 196.2 mg of acetosyringone in 10 mL DMSO, filter-sterilized through 0.22 m
Millex-LG filters, and stored in aliquots at 4 C.
14. Planting medium in plastic flats (12 packs 6 cells/pack):
Sphagnum peat moss fully soaked with tap water by autoclaving
for 5 min.
15. Nutrient solution for planting medium-grown plants: 0.2 g/L
fertilizer (nitrogen/phosphorus/potassium = 21:7: 7) dissolved in tap water.
16. Sterilizing solution: 30 % Clorox (v/v) containing 1.85 %
(w/v) sodium hypochlorite and 0.02 % (v/v) Tween 20.
125
Method
3.1 Establishment
of Stock Cultures
1. Collect newly formed softwood branches, preferably from

greenhouse-grown, healthy plants.
2. Cut off the leaves, wash the branches under running tap water
for 1020 min, and trim the branches to 510 cm in length.
3. Soak the branch segments in 70 % ethanol for 1 min in a 50 mL
Corning tube and pour off the ethanol.
4. Surface sterilize the segments in sterilizing solution for 20 min.
5. Rinse the branches five times (2 min per time) with sterile distilled water.
6. Cut the branches into 12 cm pieces each with a single bud.
7. Insert branch pieces, three for each dish, into 60 mm 15 mm
Petri dishes each containing about 10 mL WPM4Z.
8. Incubate explants for 2 weeks at 25 C, 30 E/m2/s of 16 h/
day from cool white fluorescent tubes.
9. Transfer sterile explants onto 30 mL WPM4Z in
40 mm 110 mm glass jars and incubate for 4 weeks at 25 C,
30 E/m2/s of 16 h/day.
10. Excise 15 cm long shoots, place 46 shoots horizontally on
30 mL WPM4Z in each 40 mm 110 mm glass jar for subculture at 6-week intervals.
3.2 Preparation
of Leaf Explants
1. Leaves from 4 to 8 cm long newly formed in vitro shoots,

excluding the three youngest leaves near the tip for each shoot,
are the source of explants.
2. Leaf explants are excised from the distal 2/3 of the blade using
stainless steel dissecting scissors (see Note 11).
3. The excised explants are placed on two sheets of liquid
RM-soaked sterile filter paper in a Petri dish to keep them moist.
3.3 Infection
and Cocultivation
1. Using a sterile inoculating loop, streak the A. tumefaciens

strain EHA105 stock culture to a YEB plate containing
50 mg/L Km and 25 mg/L rifampicin.
2. Culture the plate for 3 days at 28 C.
3. Culture single colonies of the strain EHA105 in 10 mL of liquid YEB containing 50 mg/L Km and 25 mg/L rifampicin in
a 50 mL Corning tube with constant shaking (300 rpm) in an
incubator shaker at 28 C for 48 h. Do not overtighten the cap.
4. Measure the optical density (OD) of the bacterial culture at
600 nm.
5. Collect the bacterial cells by a 2 min centrifugation at 2,500 g
126
Guo-Qing Song
Fig. 1 Agrobacterium tumefaciens (strain EHA105)-mediated transformation of blueberry cultivar Legacy using
a pCAMBIA-derived vector that contains a blueberry C-repeat binding factor (CBF) gene. (a) Leaf explants
inoculated with A. tumefaciens strain EHA105 containing the CBF. (b) Leaf explants after 6-day cocultivation.
(c) Kanamycin-resistant shoots produced from inoculated leaf disks after 10-week selection. (d) Proliferation
of kanamycin-resistant shoots. (e) Transgenic shoots rooting in planting medium. Bars: 1 cm
6. Discard the supernatant and suspend the pellet to an OD600 of

0.5 in liquid cocultivation medium (see Note 12).
7. Transfer the leaf explants to a new 50 mL Corning tube and
pour the Agrobacterium suspension into the tube (Fig. 1a).
8. Inoculate leaf explants at room temperature for 510 min.
9. Pour off the bacterial suspension and blot dry the explants on
two sheets of sterile Whatman filter paper in a 100 mm 15 mm
Petri dish.
10. Place the explants (80100/dish) on the sterile filter paper
(see Note 13) overlaid on 25 mL cocultivation medium in a
100 mm 15 mm dish (Fig. 1b). The dishes are sealed using truncated food wrap (2 cm in width) unless otherwise mentioned.
11. Cocultivate leaf explants with Agrobacterium cells at 25 C for
6 days in the dark (see Note 14).
3.4 Selection
and Regeneration
127
1. After cocultivation, transfer the explants to a 50 mL Corning

tube.
2. Wash the explants three times in 50 mL liquid RM with constant shaking by hand.
3. Rinse one time in 50 mL liquid RM containing 500 mg/L
cefotaxime (or timentin) (see Note 15).
4. Blot dry the explants on sterile filter paper in a 100 mm 15 mm
Petri dish.
5. Place the leaf explants (20/dish) on selection medium
(see Note 16). Ensure that explants are in a good contact with
the medium.
6. Culture at 25 C for 2 weeks in the dark.
7. Transfer the plates to a 30 E/m2/s of 16 h/day at 25 C.
8. Subculture the leaf explants on fresh selection medium at
3-week intervals at 25 C, 30 E/m2/s of 16 h/day, and
discard any dead explants during subcultures (Fig. 1c).
3.5
Regrowth
1. All cultures are maintained at 25 C, 30 E/m2/s of 16 h/day

from cool white fluorescent tubes.
2. During subcultures, transfer selected Km-resistant shoot clusters individually onto 30 mL of WPM4Z containing 250 mg/L
cefotaxime (or timentin) and 50 mg/L Km in a 40 100 mm
glass jar.
3. After 4 weeks, excise the elongated shoots, place an individual
shoot horizontally on 30 mL WPM4Z containing 250 mg/L
cefotaxime (or timentin) and 50 mg/L Km in a 40 100 mm
glass jar, and culture for 46 weeks.
4. Subculture the shoots from each jar on WPM4Z or
WPM2Z containing 250 mg/L cefotaxime (or timentin) and
50 mg/L Km.
5. Km-resistant shoots from separate leaf explants are labeled as
independent transgenic events (Fig. 1d). Different shoots derived
from a single transformed leaf explant are also labeled separately,
although they could be from the same transgenic event.
3.6
Rooting
1. Autoclave sphagnum peat moss plus tap water at 121 C for

5 min at 105 kPa to soak the moss.
2. Fill cell trays made of 12 individual 6 packs with the soaked
sphagnum moss; thoroughly water the sphagnum peat moss.
3. Excise the shoots (35 cm in length).
4. Insert individual shoots directly in sphagnum moss in six packs.
5. Cover the flats with transparent plastic covers, culture for 48
weeks at 25 C and 30 E/m2/s of 16 h/day, and water the
plants at about 4-day intervals. At this stage plants are grown
in a plant culture room (Fig. 1e).
128
Guo-Qing Song
6. Progressively open and remove the plastic covers in the first

7 days, water the plants at 2-day intervals, and apply nutrient
solution three times per week. The young plants continue
growth 34 weeks after removing the cover.
3.7
Greenhouse Care
1. Fill 4 inch plastic pots with water-soaked sphagnum peat moss

(Fafard Peat Moss Co., Ltd.) and Suremix Perlite planting
medium (Michigan Grower Products Inc., Galesburg, MI, USA)
(v/v = 1:1).
2. Transplant the plants (1015 cm in height) from the cell packs
into 4 in. pots.
3. Transfer the plants to the greenhouse (2132 C/1021 C
(day/night), 2565 E/m2/s on a 1014 h/day).
4. Water the plants as needed and fertilize weekly using a nutrient
solution of 0.2 g/L 21-7-7 fertilizer.
5. Plants can be planted in the field in May in Michigan.
Notes
1. Although EHA105 seems more efficient than the other two
strains in transient transformation studies [6, 21], leaf explants
of blueberry cultivars are also found susceptible to octopine
strain LBA4404 and nopaline strain GV3101, and both
A. tumefaciens strains may be used for stable transformation.
2. For both selectable marker genes, either the cauliflower mosaic
virus 35S (CaMV 35S) promoter or the nopaline synthase
(nos) promoter is able to drive an effective selection [911].
3. The change of pH caused by the addition of Km, cefotaxime,
and acetosyringone to media is usually not considered.
However, addition of zeatin or zeatin riboside to the stock
culture medium after autoclaving will increase the pH of the
medium due to the solvent (1 N NaOH) in the zeatin stock
solution. Thus, to get a final pH = 5.2 for stock culture medium,
preliminary experiments should be performed to work out
how much (X) the pH will increase after the addition of a certain amount of zeatin or zeatin riboside; then adjust the pH for
stock culture medium to 5.2-X prior to autoclaving. X is variable to different stock solutions of zeatin or zeatin riboside.
4. Either zeatin or zeatin riboside works for blueberry proliferation. The difference is that we include the zeatin riboside to
our medium prior to autoclaving.
5. WPM2Z is used when you see your blueberry cultures (e.g.,
cvs. Aurora and Brigitta) give a high shoot-proliferation rate
but the tiny leaves on the shoots. The reduced zeatin (or zeatin
riboside) amount from 4 to 2 mg/L promotes shoot elongation and leaf expanding.
129
Table 1
Regeneration medium for different blueberry cultivars
Regeneration medium
Cultivar
Basal medium (1 L): 10 mL 100 MWPM salts, 1 mL 1,000 MS

vitamins, 20 g/L sucrose, 6 g/L Bacto agar, pH 5.2
(herein MWPM)
Plant growth regulators: 1 mg/L TDZ and 0.5 mg/L NAA
Aurora, Brigitta, Elliott,

Legacy, Duke, Bluecrop
Basal medium: MWPM

Plant growth regulators: 5.0 mg/L 2ip and 2.0 mg/L zeatin
Bluecrop, Elliott, Legacy
Basal medium: MWPM

Plant growth regulators: 4.0 mg/L and 0.5 mg/L NAA
Brigitta, Aurora, Duke,

Legacy
Basal medium: MWPM

Plant growth regulators: 0.22 mg/L TDZ
Duke
Basal medium (1 L): 2.3 g/L WPM salts, 1 mL 1,000 MS vitamins,

556 mg/L Ca(NO3)24H2O, 20 g/L sucrose, 6 g/L Bacto agar,
pH 5.2 (herein WPMC)
Plant growth regulators: 1 mg/L TDZ and 0.5 mg/L NAA
Jewel, Jubilee, Aurora,

Legacy
Basal medium: WPMC

Plant growth regulators: 4 mg/L zeatin riboside
Biloxi, Emerald
6. Regeneration medium (RM) that enables efficient shoot

regeneration from leaf explants is the key for successful transformation of blueberry. The optimal RM for blueberry regeneration is genotype dependent (Table 1) [6, 10]. The RM used
here has led to efficient regeneration of several highbush blueberry cultivars tested although the shoot regeneration efficiencies and patterns vary among the cultivars [6].
7. This medium has been tested and worked for cvs. Aurora and
Legacy and could work for other cultivars (Table 1).
8. 20 mg/L Km enables more effective selection.
9. 50 mg/L Km also works at this stage.
10. Alternatively, yeast extract peptone (YEP) medium and LuriaBertani (LB) medium work as well as the YEB.
11. Using small dissecting scissors was found to be very effective
for excising leaf explants; a quick cutting, thus, can shorten the
exposure of the leaf explants in the airflow of the sterile
cabinet.
12. This step is used to remove the liquid YEB. The Km 50 mg/L
in YEB is toxic to leaf explants.
13. The filter paper is used to prevent Agrobacterium overgrowth.
14. Blueberry leaf explants are not hypersensitive to A. tumefaciens. After 6-day cocultivation, there is little tissue necrosis.
130
Guo-Qing Song
15. After washes, most of the agrobacterial cells on the explant

surfaces are removed; thus, these washes make it possible to
use a lower concentration (250 mg/L) of cefotaxime or timentin for successful inhibition of bacterial growth in the following selection steps.
16. Leaf explants of blueberry cultivars are very sensitive not only
to Km [6, 22] but also to glufosinate ammonium. In our
recent transformation studies using the bar gene as selectable
marker, 0.1 mg/L glufosinate ammonium in RM was found to
inhibit shoot regeneration from non-transformed leaf explants,
and transgenic plants have been obtained after selection with
0.1 mg/L glufosinate ammonium plus 250 mg/L timentin.
The high level of sensitivity of leaf explants of blueberry indicates that dose experiments should be performed when other
selectable markers are proposed. Compared with cefotaxime,
timentin is less expensive. When timentin is used for stable
transformation in our recent researches, transgenic plants can
also be regenerated.
References
1. Vander Kloet SP (1988) The genus Vaccinium
in North America. Canadian Govt Publ
Centre, Ottawa, ON
2. Luby JJ, Ballington JR, Draper AD et al (1991)
Blueberries and cranberries (Vaccinium). In:
Moore JN, Ballington JR (eds) Genetic
resources of temperate fruit and nut crops.
International Society for Horticultural Science,
Wageningen, Netherlands, pp 391456
3. Prior RL, Cao G, Martin A et al (1998)
Antioxidant capacity is influenced by total phenolic and anthocyanin content, maturity, and
variety of vaccinium species. J Agric Food
Chem 46:26862693
4. Song G-Q, Hancock JF (2011) Vaccinium. In:
Kole C (ed) Wealth of wild crop relatives:
genetic, genomic & breeding resource.
Springer, Berlin, pp 197222
5. Song G-Q, Hancock JF (2012) Recent
advances in blueberry transformation. Int J
Fruit Sci 12:316332
6. Song G-Q, Sink KC (2004) Agrobacterium
tumefaciens-mediated transformation of blueberry (Vaccinium corymbosum L.). Plant Cell
Rep 23:475484
7. Song G-Q, Sink KC (2006) Blueberry
(Vaccinium corymbosum L.). In: Wang K (ed)
Agrobacterium protocols: methods in molecular biology 344, 2nd edn. Humana, Totowa,
pp 3744
8. Song G-Q, Roggers RA, Sink KC et al (2007)

Production of herbicide-resistant highbush
blueberry Legacy by Agrobacteriummediated transformation of the Bar gene. Acta
Hortic 738:397407
9. Song G-Q, Sink KC, Callow PW et al (2008)
Evaluation of different promoters for production of herbicide-resistant blueberry plants.
J Am Soc Hortic Sci 133:605611
10. Walworth AE, Rowland LJ, Polashock JJ et al
(2012) Overexpression of a blueberry-derived
CBF enhances cold tolerance in a southern
highbush blueberry cultivar. Mol Breed 30:
13131323
11. Song G-Q, Walworth AE, Zhao D et al (2013)
The Vaccinium corymbosum FLOWERING
LOCUS T-like gene (VcFT): a flowering activator
reverses the photoperiodic and chilling requirements and enables early and continuous flowering in blueberry. Plant Cell Rep 32:17591769
12. Song G-Q, Walworth AE, Hancock JF (2012)
Stability of transgenes in blueberry. Int J Fruit
Sci 12:333341
13. Lloyd G, McCain B (1980) Commercially feasible micropropagation of mountain laurel,
Kalmia latifolia, by use of shoot tip culture.
Proc Int Plant Prop Soc 30:421427
14. Hood EE, Gelvin SB, Melchers LS et al (1993)
New Agrobacterium helper plasmids for gene
transfer to plants. Transgenic Res 2:208218

15. Hoekema A, Hirsch PR, Hooykaas PJJ et al
(1983) A binary plant vector strategy based on
separation of Vir- and T-region of the
Agrobacterium tumefaciens Ti-plasmid. Nature
303:179180
16. Koncz C, Schell J (1986) The promoter of
Ti-DNA gene controls the tissue-specific
expression of chimeric genes by a novel type of
Agrobacterium binary vector. Mol Gen Genet
204:383396
17. Reed BM, Abdelnour-Esquivel A (1991) The
use of zeatin to initiate in vitro cultures of
Vaccinium species and cvs. HortiScience 26:
13201322
131
19. Liu C, Callow P, Rowland LJ et al (2010)

Adventitious shoot regeneration from leaf
explants of southern highbush blueberry
cultivars. Plant Cell Tiss Org Cult 103:
137144
20. Vervliet G, Holsters M, Teuchy H et al (1975)
Characterization of different plaque-forming
and
defective
temperate
phages
in
Agrobacterium strains. J Gen Virol 26:3348
21. Cao X, Liu Q, Rowland LJ et al (1998) GUS
expression in blueberry (Vaccinium spp.): factors influencing Agrobacterium-mediated
gene transfer efficiency. Plant Cell Rep 18:
266270
22. Graham J, Greig K, McNicol RJ (1996)
Transformation of blueberry without antibiotic selection. Ann Appl Biol 128:557564
Chapter 12
Cherry
Guo-Qing Song
Abstract
Agrobacterium tumefaciens-mediated transformation of sour cherry (Prunus cerasus L.) Montmorency
and sweet cherry rootstocks Gisela 6 and Gisela 7 (P. cerasus P. canescens) is described. Briefly, leaf
explants from in vitro shoots are cocultivated with A. tumefaciens either directly (for Gisela 6 and
Gisela 7) or after pretreatment (for Montmorency) on cocultivation medium; selection and regeneration of transformed shoots are carried out on selection medium containing 50 mg/L kanamycin (Km) and
250 mg/L timentin (or cefotaxime) for 35 months. In this protocol, the optimal media for shoot proliferation and shoot regeneration from leaf explants are genotype dependent.
Key words Agrobacterium tumefaciens, Cherry, genetic transformation, Leaf explant, plant regeneration, Transgenic plant
Introduction
Stone fruits (i.e., almonds, apricots, cherries, nectarines, peaches,
and plums) are a group of fruits in the genus Prunus. The true
cherries are derived from the genus Prunus, subgenus Cerasus,
family Rosaceae [1]. Sweet cherry (Prunus avium) and sour cherry
(Prunus cerasus) are the major eating cherries that have become
recognized for potential benefits to human health and are favorite
fruits of many people.
Traditional approaches for cherry breeding, such as hybridization, clone selection, and mutagenesis, are generally difficult and
long-term processes due to heterozygosity, polyploidy, length of
field trials, and the interval between generations [2]. Thus, transformation of cherries offers an attractive approach to complement
these breeding methods by efficiently introducing single or multiple desired traits such as improved fruit quality and resistance to
insects and diseases.
Prunus spp. are not amenable for plant tissue culture and
genetic transformation. To date, genetic transformation has been
reported only for a few commercially important cherry species,
133
134
Guo-Qing Song
including sour cherry (P. cerasus L.), chokecherry (P. virginiana L.),
black cherry (Prunus serotina Ehrh.), and the cherry rootstocks
Rosa (P. subhirtella autumno), Gisela 6 (P. cerasus P. canescens),
Colt (P. avium P. pseudocerasus), Inmil (P. incisa P. serrula),
and Damil (P. dawyckensis) [311].
In general, a reliable transformation system depends on an efficient plant regeneration system, which is usually genotype dependent. The Agrobacterium tumefaciens-mediated transformation
protocol described here is based on our optimized conditions for
shoot regeneration from leaf explants, gene delivery using A. tumefaciens, and selection of transgenic shoots using the neomycin
phosphotransferase II (nptII) as the selectable marker gene [810].
This protocol has resulted in successful transformation of a major
sour cherry Montmorency and two sweet cherry rootstocks
Gisela 6 and Gisela 7 [9, 12].
2
2.1
Materials
Plant Material
1. Starting plant materials: The newly formed softwood branches

of sour cherry Montmorency and two sweet cherry rootstocks Gisela 6 and Gisela 7, preferably taken from
greenhouse-grown plants. Alternatively, 1-year-old twigs with
fully chilled leaf buds.
2. Sterilizing solution: 30 % Clorox (v/v) containing 1.85 %
(w/v) sodium hypochlorite and 0.02 % (v/v) Tween 20 for
newly formed softwood branches. 50 % Clorox (v/v) containing 3 % (w/v) sodium hypochlorite and 0.02 % (v/v) Tween
20 for 1-year-old bud woods with dormant leaf buds.
3. Leaf explants are taken from in vitro cultured stock shoots cultured on shoot proliferation medium at 25 C under a 16 h
photoperiod of 3040 mol/m2/s from cool white fluorescent
tubes.

and Binary Vector
1. Leaf explants of cherry cultivars are susceptible to all three

A. tumefaciens strains EHA105 [13], LBA4404 [14], and
GV3101 [15] (see Note 1). These A. tumefaciens strains are
stored in 20 % sterile glycerol (v/v) at 80 C.
2. Binary vectors contain the nptII gene conferring kanamycin
(Km) resistance.
2.3 Culture Medium

and Stock Solutions
Media pH is adjusted with 1 N NaOH or 1 N HCl before adding

the agar and autoclaving. Double-distilled water (ddH2O) is used
unless otherwise mentioned. All media are autoclaved at 121 C for
20 min at 105 kPa and kept at room temperature if they can be used
in a week; otherwise, stored at 4 C up to 2 weeks. Stock sterile
solutions of thidiazuron (TDZ), Km, cefotaxime, timentin, and
acetosyringone are added to liquid medium with agar cooled to
Cherry
135
5060 C or to liquid medium at room temperature after

autoclaving:
1. Shoot culture medium 1 (SCM1) for sweet cherry rootstock:
Murashige and Skoog (MS) medium [16] containing 20 g/L
sucrose, 6 g/L Bacto agar, 1.0 mg/L benzylaminopurine
(BAP), 0.1 mg/L indole-3-butyric acid (IBA), and pH 5.6.
This medium is for sweet cherry rootstocks Gisela 6 and
Gisela 7 (see Note 2).
2. Shoot culture medium 2 (SCM2) for sour cherry: Quoirin and
Lepoivre (QL) salts [17], vitamins (1 mg/L nicotinic acid,
1 mg/L pyridoxine HCl, 1 mg/L thiamine HCl, and
100 mg/L myo-inositol) (see Note 3), 20 g/L sucrose, 6 g/L
Bacto agar, 0.5 mg/L BAP, 0.05 mg/L IBA, and pH 5.2.
This medium is for sour cherry Montmorency (see Note 2).
3. Regeneration medium for cherry rootstocks Gisela 6 and
Gisela 7 (RM-G): Lloyd and McCown medium (WPM)
[18] salts and MS vitamins supplemented with 30 g/L sucrose,
6 g/L Bacto agar, 2.0 mg/L BAP, 1.0 mg/L IBA, pH 5.6.
4. Pretreatment medium for sour cherry Montmorency (MST):
MS medium containing 30 g/L sucrose, 6 g/L Bacto agar,
0.1 mg/L thidiazuron (TDZ), pH 5.2.
5. Regeneration medium for Montmorency (RM-M): QL
salts, vitamins (1 mg/L nicotinic acid, 1 mg/L pyridoxine
HCl, 1 mg/L thiamine HCl, and 100 mg/L myo-inositol),
40 g/L sucrose, 6 g/L Bacto agar, 3.0 mg/L BAP, 0.5 mg/L
naphthaleneacetic acid (NAA), pH 5.2.
6. Cocultivation medium: RM-G for Gisela 6 and Gisela 7
and MST for Montmorency, each supplemented with
100 M acetosyringone.
7. Selection medium: RM-G for Gisela 6 and Gisela 7 and
MST for Montmorency, each supplemented with 250 mg/L
timentin (or cefotaxime) and 50 mg/L Km when the neomycin phosphotransferase II gene (nptII) is the selectable marker.
8. Agrobacterium culture medium (yeast extract peptone (YEP)
medium): 10 g/L Bacto peptone, 10 g/L yeast extract,
5 g/L NaCl, pH 7.0. After autoclave, add 25 mg/L rifampicin
(for A. tumefaciens strains EHA105, LBA4404, and GV3101)
and 50 mg/L Km (see Note 4).
9. Stock solution of plant growth regulators: 1 mg/mL TDZ in
dimethyl sulfoxide (DMSO), filter-sterilize through 0.22 m
Millex-LG filters (Millipore Corporation), and store in aliquots at 4 C. 1 mg/mL BAP, 1 mg/L IBA, and 1 mg/L
NAA dissolved in 23 mL 1 N NaOH, diluted to 1 mg/mL
with ddH2O, and stored at 4 C.
10. Antibiotic stock solution: 50 mg/mL Km; 250 mg/mL timentin;
250 mg/mL cefotaxime; the stocks are all dissolved in ddH2O,
136
Guo-Qing Song
filter-sterilized through 0.22 m Millex-GV filters (Millipore

Corporation), and stored in aliquots at 20 C.
11. 100 mM acetosyringone: 1.96 g acetosyringone in 100 mL
DMSO is filter-sterilized through 0.22 m Millex-LG filters
(Millipore Corporation) and stored in aliquots at 4 C.
12. Planting medium in plastic flats (12 packs 6 cells/pack):
Suremix Perlite planting medium (Michigan Grower Products
Inc.) fully soaked with tap water by autoclaving for 5 min.
13. Nutrient solution for planting medium grown plants: 0.62 g/L
fertilizer (nitrogen/phosphorus/potassium = 20:20:20) dissolved in tap water.
Method
All cultures are maintained at 25 C, 3040 mol/m2/s of 16 h/day
from cool white fluorescent tubes unless as otherwise mentioned.
3.1 Establishment
of Stock Cultures
1. Collect the newly formed branches,

greenhouse-grown, healthy plants.
preferably
from
3.1.1 Newly Formed,

Year-Old Softwood
Branches
2. Cut off the leaves, wash the branches under running tap water
for 20 min, and then trim the branches to 510 cm in length.
3. Soak the branch segments in 70 % ethanol for 1 min in a 50 mL
Corning tube (Corning Inc.) and then pour off the ethanol.
4. Surface sterilize the segments in sterilizing solution for 20 min.
5. Rinse the branches five times (2 min per time) with sterile distilled water.
6. Cut the branches into 12 cm pieces each with a single bud
using sterile dissecting scissors.
7. Place branch pieces horizontally, three for each dish, onto
10 mL SCM in 60 mm 15 mm Petri dishes.
8. Check the dishes every other day. If any visible contamination
buds are observed, transfer the sterile ones to fresh medium in
Petri dishes.
9. After incubating explants for 2 weeks, excise sterile shoots and
insert them into fresh SCM in Magenta GA7 boxes.
10. Subculture the shoots and stem nodes, ten per glass jars, every
46 weeks.
3.1.2 One-Year-Old Bud

Woods with Dormant
Leaf Buds
1. Twigs with non-breaking buds are collected in plastic bags in

March or April in Michigan.
2. Store the collected twigs at 4 C in a refrigerator.
3. Prior to surface sterilization, immerse one end of the twigs in
water and incubate them at room temperature (about 25 C)
Cherry
137
for 13 days. The buds showing green tips (about 510 % of

bud size) are ready for surface sterilizing and bud dissecting.
4. Trim the twigs to 510 cm in length using a pruner.
5. Wash the trimmed twigs with liquid soap followed by thorough
washing for 20 min under running tap water.
6. Make single bud cuts, 12 cm in length, slightly below and
above the buds, using a pruner.
7. Soak the buds in 70 % ethanol for 1 min in a 50 mL Corning
tube (Corning Inc.) and pour off the ethanol.
8. Surface sterilize the buds in sterilizing solution (50 % Clorox
and 0.02 % Tween 20) for 20 min and pour off the solution.
9. Rinse the buds five times (2 min per time) with sterile distilled
water.
10. Transfer the buds to sterile Petri dishes.
11. Three sets of forceps and two scalpel handles, one with a #10
blade and another with a #11 blades, are sterilized using flame.
12. With forceps #1 transfer a node into a Petri dish.
13. Hold bud near the base with forceps #1 and peel off the bud
scales and the outer leaves using blade #10. Leave a small green
cluster of leaves that join at the bottom with the meristem
inside (see Note 5).
14. Move the bud to a new unused area of the Petri dish using
forceps #1.
15. Hold the bud with forceps # 2 and with blade #11 cut near the
base to release the meristem.
16. Using forceps #3, move the meristem to a Petri dish
(60 15 mm) with about 10 mL SCM medium (see the
attached recipe). Place three meristems per dish and space
them out in the dish.
17. Dip instruments in 70 % ethanol and flame for the next bud.
18. Put the dishes under a 16 h photoperiod of 40 mol/m2/s at
25 C.
19. Check the dishes every other day. If any visible contamination
buds are observed, transfer the sterile ones to fresh medium.
20. After incubating explants for 2 weeks, excise sterile shoots and
insert them into fresh SCM in Magenta GA7 boxes.
21. Subculture the shoots or stem nodes, ten per glass gars, every
46 weeks.
3.2 Preparation
of Leaf Explants
1. Leaves from 6-week-old stock cultures.

2. Expanding leaves with the midribs 1.02.5 cm in length are
excised from the distal 3/4 of the blade using dissecting
scissors.
138
Guo-Qing Song
3. The explants are cut partially transverse and equidistant two

times through the midrib from the leaf tip using a scalpel with
a #10 blade.
4. For cherry rootstocks Gisela 6 and Gisela 7, the excised
explants are placed on two sheets of liquid RM-soaked sterile
filter paper in a Petri dish to keep them moist; alternatively,
transfer the explants to a 50 mL Corning tube (Corning Inc.)
containing about 0.5 mL (see Note 6) cocultivation medium
and put the lid on to keep the moisture inside the tube.
5. For the excised explants of sour cherry Montmorency, 20
explants per Petri dish are placed on 25 mL pretreatment
medium MST. The pretreatment is conducted at 25 C in the
dark for 4 days.
3.3 Infection
and Cocultivation
1. Using a sterile inoculating loop, streak the A. tumefaciens

strain EHA105 stock culture to a YEP plate (see Note 7) containing 50 mg/L Km and 25 mg/L rifampicin.
2. Culture the plate for 3 days at 28 C.
3. Culture single colonies of the strain EHA105 in 10 mL of liquid YEP containing 50 mg/L Km and 25 mg/L rifampicin in
a 50 mL Corning tube with constant shaking (300 rpm) in an
incubator shaker at 28 C for 48 h. Do not overtighten the
cap.
4. Measure the optical density (OD) of the bacterial culture at
600 nm.
5. Collect the bacterial cells by a 2 min centrifugation at 2,500 g
6. Discard the supernatant and suspend the pellet to an OD600 of
0.5 in liquid cocultivation medium (see Note 8).
7. Pour the Agrobacterium suspension into 50 mL Corning
tubes containing either newly prepared or pretreated leaf
explants.
8. Inoculate leaf explants at room temperature for 5 min
(see Note 9).
9. Pour off the bacterial suspension and blot dry the explants on
two sheets of sterile filter paper in a 100 mm 15 mm Petri
dish.
10. Place the explants (3040/dish) on the sterile filter paper
(see Note 10) overlaid on 25 mL cocultivation medium in a
100 mm 15 mm dish. The dishes are sealed using truncated
food wrap (3 cm in width) or Parafilm.
11. Cocultivate leaf explants with Agrobacterium cells at 25 C for
4 days in the dark.
Cherry
3.4 Selection
and Regeneration
139
1. After cocultivation, transfer the explants to a 50 mL Corning

tube.
2. Wash the explants three times (12 min/time) in 50 mL liquid
RM with constant shaking by hand.
3. Rinse one time in 50 mL liquid RM containing 500 mg/L
timentin (or cefotaxime) (see Note 11).
4. Blot dry the explants on sterile filter paper in a Petri dish.
5. Place the leaf explants (10/dish) abaxial side up on selection
medium containing 50 mg/L Km (see Note 12) and 250 mg/L
timentin (or cefotaxime). Ensure that explants are in a good
contact with the medium.
6. Culture at 25 C for 2 weeks in the dark.
7. Transfer the plates to a 40 mol/m2/s of 16 h/day at 25 C.
8. Subculture the leaf explants on fresh selection medium every 3
weeks and discard any dead explants during subcultures (Fig. 1a).
3.5
Regrowth
1. During selection and subcultures, transfer Km-resistant shoot

clusters individually onto 50 mL of selection medium in
Magenta GA7-3 boxes.
2. After 4 weeks, excise the elongated shoots and place an individual shoot on 50 mL of selection (50 mg/L Km plus
250 mg/L timentin or cefotaxime) SCM1 (for Gisela 6 and
Gisela 7) or selection SCM2 (for Montmorency) in
Magenta GA7-3 boxes.
3. Km-resistant shoots from separate leaf explants are labeled as
independent transgenic events (Fig. 1b). Different shoots
derived from a single transformed leaf explants are also labeled
separately, although they could be from the same transgenic
event.
4. Subculture the Km-resistant shoots of each transgenic event
on selection SCM to increase the shoot number.
3.6
Rooting
1. Excise the shoots (35 cm in length) and remove the leaves at

the basal end.
2. Insert individual shoots directly in water-soaked planting
medium in plastic flats (12 packs 6 cells/pack).
3. Cover the flats with transparent plastic covers, culture for 48
weeks at 25 C and 40 mol/m2/s of 16 h/day, and water the
plants at about 4-day intervals. At this stage plants are grown
in a plant culture room.
4. Progressively open and remove the plastic covers in the first
7 days, water the plants at 2-day intervals. The young plants
continue growth 34 weeks after removing the cover (Fig. 1c).
5. Apply nutrient solution once a week.
140
Guo-Qing Song
Fig. 1 Agrobacterium tumefaciens (strain EHA105)-mediated transformation of sweet cherry rootstock Gisela
6 using a pART27-derived RNAi vector for silencing Prunus necrotic ring spot virus. (a) Kanamycin-resistant
shoots produced from inoculated leaf disks after 10-week selection. (b) Proliferation of kanamycin-resistant
shoots. (c) Transgenic shoots rooting in planting medium. (d) Transgenic plants growing in the greenhouse
3.7
Greenhouse Care
1. Fill 1 gallon plastic pots with water-soaked Suremix Perlite

planting medium.
2. Transplant the plants (about 10 cm in height) from the cell
packs into 1 gallon pots.
3. Transfer the plants to the greenhouse (2132 C/1021 C
(day/night), 2565 mol/m2/s on a 1014 h/day) (Fig. 1d).
4. Water the plants as needed and fertilize weekly using a nutrient
solution of 0.62 g/L fertilizer.
Notes
1. In our transient transformation studies, three opine-type
strains EHA105, GV3101, and LBA4404 showed no significant difference in gene delivery [8].
Cherry
141
2. All in vitro cherry shoot cultures are maintained in either

85 100 mm glass jars containing 100 mL medium or
Magenta GA7 boxes each containing 50 mL medium. The
bottom parts of glass Petri dishes (100 mm 20 mm) are used
as the lids of the glass jars. The lids of the containers are sealed
with either plastic food wrap (about 3 cm in width) or Parafilm.
3. We make 1 mg/mL stock solutions for nicotinic acid, pyridoxine HCl, and thiamine HCl, separately.
4. GV3101 has resistance to rifampicin (chromosomal marker)
and gentamicin (Ti plasmid marker); EHA105 is resistant to
rifampicin and chloramphenicol (both are chromosomal
marker); LBA4404 has resistance to rifampicin, chloramphenicol, streptomycin, and pectinomycin [17].
5. If the bud is cut too low, it will fall apart and must be discarded.
6. Do not soak the explants by using too much medium.
7. Alternatively, Luria-Bertani (LB) medium and yeast extract
broth (YEB) medium work as well.
8. This step is used to remove the liquid YEP. The Km 50 mg/L
in YEP is toxic to leaf explants.
9. Do not soak the explants in cocultivation medium for more
than 5 min to prevent reduced shoot regeneration from inoculated explants.
10. The filter paper is used to prevent Agrobacterium overgrowth.
11. After washes, most of the agrobacterial cells on the explant
surfaces are removed; thus, these washes make it possible to
use a lower concentration (250 mg/L) of timentin or cefotaxime for successful inhibition of bacterial growth in the following selection steps.
12. Alternatively, use 25 mg/L Km for the first 3 weeks followed
by using 50 mg/L Km. This helps to improve transformation
frequency by minimizing necrosis of inoculated explants [10].
References
1. Webster AD (1996) The taxonomic classification of sweet and sour cherries and a brief history of their cultivation. In: Webster AD,
Looney NE (eds) Cherries: crop physiology,
production and uses. CAB International
Wallingford, UK, pp 324
2. Song G-Q, Lang G, Dolgov SV et al (2008)
Cherries. In: Kole C, Hall TC (eds) A compendium of transgenic crop plants. WileyBlackwell, London, pp 161188
3. Da Cmara Machado A, Puschmann M,
Phringer H et al (1995) Somatic embryogenesis of Prunus subhirtella autumno rosa and
regeneration of transgenic plants after
Agrobacterium-mediated transformation. Plant

Cell Rep 14:335340
4. Druart PH, Delporte F, Brazda M et al (1998)
Genetic transformation of cherry trees. Acta
Hortic 468:7176
5. Gutirrez-Pesce P, Taylor K, Muleo R et al
(1998) Somatic embryogenesis and shoot
regeneration from transgenic roots of cherry
rootstock Colt (Prunus avium x P. pseudocerasus) mediated by pRi1855 T-DNA of
Agrobacterium rhizogenes. Plant Cell Rep 17:
574580
6. Gutirrez-Pesce P, Rugini E (2004) Influence
of plant growth regulators, carbon sources and
142
7.
8.
9.
10.
11.
Guo-Qing Song
iron on the cyclic secondary somatic embryogenesis and plant regeneration of transgenic
cherry rootstock Colt (Prunus avium x P.
pseudocerasus). Plant Cell Tiss Org Cult 79:
223232
Dai W, Magnusson V, Johnson C (2007)
chokecherry (Prunus virginiana L.). HortScience
41:140142
Song G-Q, Sink KC (2005) Optimizing shoot
regeneration and transient expression factors
for Agrobacterium tumefaciens transformation
of sour cherry (Prunus cerasus L.) cultivar
Montmorency. Sci Hortic 106:6069
Song G-Q, Sink KC (2006) Transformation of
Montmorency sour cherry (Prunus cerasus L.)
and Gisela 6 (P. cerasus P. canescens) cherry
rootstock mediated by Agrobacterium tumefaciens. Plant Cell Rep 25:117123
Song G-Q, Sink KC (2007) Transformation of
cherry: Prunus cerasus L. Montmorency and
Prunus cerasus x P. canescen Gisela 6 mediated
by Agrobacterium tumefaciens and a two-step
selection system. Acta Hortic 738:683689
Liu X, Pijut PM (2008) Plant regeneration
from in vitro leaves of mature black cherry
(Prunus serotina). Plant Cell Tiss Org Cult 94:
113123
12. Song G-Q, Sink KC, Walworth AE et al (2013)

Engineering cherry rootstocks with resistance
to Prunus necrotic ring spot virus through
RNAi-mediated silencing. Plant Biotechnol J
11:702708
14. Hoekema A, Hirsch PR, Hooykaas PJJ et al
(1983) A binary plant vector strategy based on
separation of Vir- and T-region of the
Agrobacterium tumefaciens Ti-plasmid. Nature
303:179180
Ti-DNA gene controls the tissue-specific
expression of chimaric genes by a novel type of
Agrobacterium binary vector. Mol Gen Genet
204:383396
17. Quoirin M, Lepoivre P (1977) Improved
media for in vitro culture of Prunus sp. Acta
Hortic 78:437442
18. Lloyd G, McCain B (1980) Commercially feasible micropropagation of mountain laurel,
Kalmia latifolia, by use of shoot tip culture.
Proc Int Plant Prop Soc 30:421427
Chapter 13
Chestnut, American (Castanea dentata (Marsh.) Borkh.)
Charles A. Maynard, Linda D. McGuigan, Allison D. Oakes, Bo Zhang,
Andrew E. Newhouse, Lilibeth C. Northern, Allison M. Chartrand,
Logan R. Will, Kathleen M. Baier, and William A. Powell
Abstract
The key to successful transformation of American chestnut is having the correct combination of explant
tissue, selectable markers, a very robust DNA delivery system, and a reliable regeneration system. The most
important components of this transformation protocol for American chestnut are the following: starting
out with rapidly dividing somatic embryos, treating the embryos gently throughout the Agrobacterium
inoculation and cocultivation steps, doing the cocultivation step in desiccation plates, and finally transferring the embryos into temporary-immersion bioreactors for selection. None of these departures from
standard Agrobacterium transformation protocols is sufficient by itself to achieve transgenic American
chestnut, but each component makes a difference, resulting in a highly robust protocol.
The average transformation efficiency that can be expected using the described protocol is approximately 170 stable embryogenic transformation events per gram of somatic embryo tissue, a considerable
improvement over the 20 transformation events per gram we reported in 2006 (Maynard et al. American
chestnut (Castanea dentata (Marsh.) Borkh.) Agrobacterium protocols, 2nd ed., 2006). We have regenerated nearly 100 of these events, containing 23 different gene constructs, into whole plants. As of the fall
of 2013, we had a total of 1,275 transgenic chestnut trees planted at eight locations in New York State and
one in Virginia. Based on a combination of field-trial inoculations, greenhouse small-stem inoculations,
and detached-leaf assays, we have identified three transgenes that produce stronger resistance to chestnut
blight than non-transgenic American chestnut. Depending on the transgene and the event, this resistance
can be either intermediate between American chestnut and Chinese chestnut, approximately equal to or
even higher than the resistance naturally found in Chinese chestnut.
Key words bar, Bioreactor, Cocultivation, Desiccation, nptII, Oxalate oxidase, Paromomycin,
Periodic immersion, Somatic embryogenesis
Introduction
The American chestnut was one of the most important deciduous
tree species in the eastern United States. Towering over most other
trees, it often made up 25 % or more of the overstory [1]. In 1904,
the disease that later became known as chestnut blight was discovered
in the Bronx Zoological Park [2] by the zoos chief forester,
143
144
Charles A. Maynard et al.
Hermann Merkel. Caused by the fungal pathogen Cryphonectria

parasitica (Murr.) Barr, chestnut blight has reduced this once
magnificent species to little more than an understory shrub [3].
One means of restoring the American chestnut would be to
transform putative resistance-enhancing genes into the chestnuts
genome. Supporting research needed for a transformation system
was carried out with both American and European chestnut
(Castanea sativa Mill) throughout the 1980s and 1990s.
Publications have been written about somatic embryogenesis [47],
detecting transformation events using polymerase chain reaction
(PCR) [8], testing marker genes [9, 10], and micropropagation
[1119]. Further refinements were made to somatic embryo
regeneration procedures for American chestnut by adding powdered activated charcoal to the medium and including a chilling
step [20]. Asparagine was also found to improve embryo conversion efficiency [21, 22].
The first report of successful Agrobacterium-mediated transformation of a Castanea species described the regeneration of
transgenic shoots from European chestnut cotyledons in 1998
[23]. This was followed in 2004 by a report of the transformation
of somatic embryos of European chestnut that were subsequently
regenerated into whole plants through a combination of germination and micropropagation [24].
Using the version of the protocol described in Chapter 22 of
the second edition of this book [25], we were able to transform
somatic American chestnut embryos and regenerate them into
whole plants [26]. On June 7, 2006, we collaborated with the
New York chapter of The American Chestnut Foundation to
plant two transgenic American chestnut trees in Syracuse, New York
(Fig. 1). One promptly died, but as of the spring of 2014, the
other is still alive. To the best of our knowledge, this was the first
time any transgenic American chestnut tree had been planted outside the laboratory. This tiny planting was followed in subsequent
years by plantings of several hundred more trees on eight different
sites within NY State, including the New York Botanical Garden in
the Bronx, NY. This site was symbolic because The Garden, as it
is called, is directly across the street from the Bronx Zoo where the
blight was discovered in 1904.
Dr. Scott Merkle at the University of Georgia has also been
working on somatic embryo culture transformation and regeneration for many years and has shared his knowledge freely with us.
The explanting of immature zygotic embryos is based on a protocol he developed and the regeneration media (E1E4) were
adapted from his publications and personal communication. His
lab group has also successfully transformed American chestnut
somatic embryos [27] and regenerated whole plants. He likewise
uses Agrobacterium-mediated transformation of somatic embryos,
but his system differs in many details from the protocol described
145
Fig. 1 The first of two transgenic American chestnut trees were planted in the
field on June 7, 2006, by Charles Maynard (left) and Linda McGuigan (right)
in this chapter [28]. We recommend that anyone interested in

transforming American chestnut should contact Dr. Merkle and
inquire about his protocol.
The development of a reliable Agrobacterium-mediated transformation system allowed us to introduce an oxalate oxidase (OxO)
gene from wheat (Triticum aestivum) into the American chestnut
[29]. Based on small-stem inoculation assays [30] and excised-leaf
assays [31], this gene, when driven by a tissue-specific promoter,
can convey blight resistance intermediate between wild-type
American chestnut and Chinese chestnut [32]. When driven by the
stronger CaMV 35S constitutive promoter, the expression of OxO
is many times higher, and some of these high-expressing lines may
be even more blight resistant than the Chinese chestnut we use as
a control [33].
Since the earlier description of a chestnut transformation protocol [25], we have made several major changes and even more
minor ones. In addition to transformation with a single vector,
which is still our preferred technique and the method detailed in
Subheading 3, we adapted a process called co-transformation [34].
This process makes use of two plasmids, one with selectable and/or
scorable marker genes and the second with the gene(s) of interest
(GOI) and a separate selectable marker. The original description of
co-transformation used a single strain of Agrobacterium containing
both plasmids to transform tobacco (Nicotiana tabacum L.) and
146
Fig. 2 (a) Periodic immersion bioreactors (RITA) used to select transformed somatic embryos of American
chestnut; (b) a closer view of American chestnut somatic embryos being selected for the bar marker gene
rice (Oryza sativa L.) [34]. We have found that co-transformation

also works in chestnut if the plasmids are carried in separate
Agrobacterium strains. The two strains are grown separately and
mixed together in a 5:1 ratio (GOI plasmid/marker plasmid)
immediately before use [29, 32]. Another change that made a
major difference in transformation efficiency (fewer non-transgenic
escapes, shorter time to obtain completely transgenic events, and
a higher number of transformed events per gram of embryo tissue)
is the use of periodic immersion bioreactors for the selection stage
(Fig. 2) [35]. Bioreactors are typically used to grow plant tissue by
temporarily flooding the culture with a nutrient solution. During
transformation, they are used to temporarily flood the tissue with a
nutrient solution containing an antibiotic that will kill any nontransformed cells. These bioreactors also result in more efficient
antibiotic selection of transformed tissue, which has allowed us to
forgo the visual scorable marker (GFP) we had been using (Fig. 3).
Without the need for a scorable marker, we went back to using a
single Agrobacterium strain.
One key factor described in the 2006 version of the transformation protocol for American chestnut and is still an important part of
this protocol is the use of desiccation plates [36] rather than semisolid medium during the cocultivation step. Desiccation is not a
common part of most Agrobacterium transformation protocols,
but we found that a 2- or 3-day desiccation treatment increased the
recovery of transgenic events by at least tenfold in chestnut [26].
In the plantlet acclimatization phase, we found that a small
plastic bag placed over the plant and fastened with a rubber band
will maintain nearly 100 % relative humidity (Fig. 4). The bag can
147
Fig. 3 (a) A GFP-positive root emerging from a transgenic American chestnut shoot; (b) the same shoot under
white light; (c) a GFP-positive radical emerging from a nut from a F1 cross between a transgenic a wild-type
American chestnut; (d) the same radical under white light. The scale bars are 1.0 mm
be cut open gradually, allowing the plants to adjust to ambient

relative humidity.
The protocol described here has been used successfully by at
least 50 people, including three undergraduate plant tissue culture
classes; therefore, we consider it to be quite robust. Optimizations
since our previous publication have also made the process much
faster and more efficient, reducing the total procedure (embryo to
whole plant) from nearly 3 years to just over 1 year. However, a
researcher attempting this protocol should still expect to spend
6 months to a year establishing suitable embryogenic cell lines in
culture; approximately 6 months transforming, recovering, and
testing transformation events; and an additional 24 months
regenerating whole plants from the transformed cell lines. This
protocol assumes that the user is familiar with somatic embryogenesis, has experience in Agrobacterium-mediated transformation
with a model species such as petunia or hybrid poplar, and has suitable Agrobacterium strains.
148
Fig. 4 American chestnut plantlets transplanted to potting mix and topped with
small plastic bags to maintain high relative humidity (a). The pots are maintained
in a specially modified high-humidity growth chamber (b)
Materials
2.1 Specialized
Equipment
and Supplies
1. Spectrophotometer (equipped for sidearm flasks, below).

2. Nephelo Flasks (VWR Scientific, Rochester, NY) (see Note 1).
3. Desiccation plates: This can be made from 60 15 mm sterile
disposable Petri plates along with autoclaved and dried 55 mm
filter paper discs. Immediately before use, aseptically place one
disc in a sterile Petri plate and moisten with 200 L of sterile
distilled water.
4. Bioreactors: Plant tissue culture system periodic immersion
vessels (RITA) (Sigma-Aldrich, St. Louis, MO).
5. Microshoot stand: A workable stand that will hold up to ten
shoots can be made from the plastic inner part of a 200 L
pipette tip box, cut to approximately 3 4 cm by 0.5 cm high.
Autoclave, cool, and store until needed.
2.2 Solutions
and Media
All solutions should be made with sterile distilled water unless otherwise noted. Media containing Phytagel are dispensed into three
149
different containers, Magenta GA-7 vessels (polycarbonate cubes

with polypropylene lids) and two sizes of presterilized plastic disposable Petri plates, small 60 15 mm and large 100 15 mm.
Media that will go into cubes can be dispensed before autoclaving.
Media destined for Petri plates should be autoclaved in bulk in
glass bottles and then cooled in a water bath to approximately
55 C. The media should be brought into a hood, where antibiotics and any other heat-labile ingredients can be added, then poured
into sterile Petri plates, and cooled until the media solidifies. If the
plates will be stored, they should be sealed individually with sealing
cling film or Parafilm, returned to the plastic sleeve they came
from, and refrigerated:
1. Tween 20 solution: 1 % (v/v) Tween 20. Make fresh, do not
autoclave.
2. Bleach solution: 50 % (v/v) unscented household bleach
(56 % sodium hypochlorite) in distilled water, two drops
Tween 20 per 100 mL. Make fresh, do not autoclave.
3. Agrobacterium growth medium Luria-Bertani broth (LB),
Miller modification with antibiotics): LBA 37 g/L LBA,
100 mg/L kanamycin, pH 7.5. Autoclave, cool to 55 C, add
heat-sensitive components, and pour into large Petri plates in a
hood.
4. Agrobacterium growth medium Luria-Bertani broth (LB),
Miller modification with antibiotics): 25 g/L LB broth, pH 7.5.
Pour into Nephelo sidearm flasks (50 mL each), autoclave,
cool, and add 50 mg/L kanamycin.
5. Virulence (Vir) induction medium: 2.3 g/L Woody Plant
Medium (WPM) (full-strength basal salts), 10 g/L sucrose,
and 9.75 g/L 2-(N-morpholino)ethanesulfonic acid (MES),
pH 5.5. Autoclave, cool, add 50 L of a 19.6 g/L (100 mM)
filter-sterilized acetosyringone stock solution per 50 mL immediately before use.
6. Embryo initiation medium (E1): 2.3 g/L WPM salts,
109 mg/L Nitsch and Nitsch vitamins, 1 g/L casein hydrolysate, 1.8 mg/L 2,4-dichlorophenoxyacetic acid (2,4-D)
(1.0 M), 1.1 mg/L 6-benzylaminopurine (BA) (1.0 M),
30 g/L sucrose, pH 5.5, 3 g/L Phytagel. Autoclave, cool to
55 C, and pour into small Petri plates in hood.
7. Agrobacterium kill medium (Agro Kill): E1 with 50 mg/L
cefotaxime and 333 mg/L (~500 M) timentin. Autoclave,
cool to ~55 C, add antibiotics, and pour into small Petri plates
in hood.
8. Solid selection medium: E1 with 50 mg/L cefotaxime,
333 mg/L (~500 M) timentin, and 143 mg/L paromomycin. Autoclave, cool to ~55 C, and pour into small Petri plates
in hood.
150
9. Liquid selection medium: E1 (without Phytagel) with

50 mg/L cefotaxime, 200 mg/L cefotaxime, and 143 mg/L
paromomycin. Autoclave, cool, add antibiotics, and dispense
into RITA bioreactors (150 mL each).
10. Embryo initiation medium with paromomycin (E1-P): E1
with 143 mg/L paromomycin. Autoclave, cool to 55 C, add
antibiotics, and pour into small Petri plates in hood.
11. Embryo development medium (E2): 2.3 g/L WPM salts,
1 g/L casein hydrolysate, 0.5 g/L L-glutamine, 60 g/L
sucrose, pH 5.5, 3.5 g/L Phytagel. Autoclave, cool to 55 C,
and pour into small Petri plates in hood.
12. Embryo maturation medium (E3): 3.08 g/L Gamborg Basal
Salt Mixture (B-5 salts), 2.2 mg/L (0.5 M) BA, 2.6 mg/L
(0.5 M) -naphthaleneacetic acid (NAA), 60 g/L sucrose,
pH 5.5, 3.5 g/L Phytagel. Autoclave, cool to ~55 C, and
pour into small Petri plates in hood.
13. Embryo germination medium (E4): 2.3 g/L WPM salts,
500 mg/L MES, 500 mg/L polyvinylpyrrolidone (PVP-40),
30 g/L sucrose, pH 5.5, 3.5 g/L Phytagel. Dispense into
Magenta cubes, autoclave, and cool.
14. Pre-rooting medium (PR low BA): 2.3 g/L WPM salts,
109 mg/L Nitsch and Nitsch vitamins, 500 mg/L MES,
500 mg/L PVP-40, 1.0 mg/L (0.22 M) BA, 30 g/L sucrose,
pH 5.5, 3.5 g/L Phytagel. Dispense into Magenta cubes,
autoclave, and cool.
15. IBA quick-dip solution: 2.03 g/L (10 mM) indole-3-butyric
acid (IBA). Autoclave the water, cool to ~55 C, and filtersterilized immediately before use.
16. Rooting medium: 2.15 g/L Murashige and Skoog (MS) salts,
30 g/L sucrose, pH 5.5, 3.5 g/L Phytage. Dispense into
Magenta cubes, autoclave, and cool (see Note 2).
17. Bt soil drench: 4.9 cc (1.0 tsp.) Bacillus thuringiensis (Bt)
granules (Gnatrol, Water Dispersible Granules (WDG)
Biological Larvicide, Valent BioSciences Corporation,
Libertyville, IL) per liter of room temperature tap water. Make
immediately before use. Do not autoclave.
18. Hoagland solution (modified) [37]: 5.09 g/L KNO3,
5.94 g/L Ca(NO3)2, 2.4 g/L MgSO4, 0.68 g/L KH2PO4,
0.8 g/L NH4NO3, 1.125 g/L Sequestrene 330, 28.6 mg/L
H3BO3, 1.81 mg/L MnCl2, 0.22 mg/L ZnSO4, 0.06 mg/L
CuSO4, 0.12 mg/L NaMoO4. Do not autoclave.
2.3
Plant Material
Immature burs of American chestnut collected approximately

1 month post-anthesis (see Note 3).
2.4 Agrobacterium
Strains and Vectors
151
Agrobacterium strain EHA105 [38] carrying the binary vector

pVspB-OxO [26] (see Note 4) was used for all initial transformation studies until 2011 when we switched to Agrobacterium strain
AGL1. The AGL1 gave us higher numbers of transformants per
gram of tissue than EHA105.
Methods
3.1 Somatic Embryo

Establishment
1. Collect immature burs approximately 1 month post-anthesis

(see Note 3).
2. Wearing heavy gloves and using a scalpel, remove the spines
from the burs.
3. Cut a slice of bur tissue from the top to expose the seed
chamber.
4. Using a combination of scalpel cuts and hand peeling, remove
the sides of the bur until the nuts (usually 3 per bur) are fully
exposed. Then, break or cut them from the base of the bur (see
Note 5) and place 1520 nuts in a 100 mL wide-mouth bottle
with a screw cap.
5. In a laminar flow hood, cover the nuts with 70 % ethanol, cap
the bottle, and shake for 20 s. Decant the alcohol into a waste
beaker.
6. Pour enough of the 1 % Tween 20 solution to cover the nuts,
recap the bottle, and shake vigorously for a few seconds. Shake
the bottle every 2030 s for 3 min. Decant the Tween 20
solution.
7. Add sufficient 50 % bleach solution (~30 to 50 mL) to cover
the nuts and allow them to float freely. Shake vigorously for
approximately 10 s and then every 2030 s for 5 min. Decant
the bleach solution.
8. Pour in sterile distilled water and shake for approximately 10 s
and then every 2030 s for 5 min. Decant the water.
9. Repeat the sterile water rinses two additional times for a total
of three 5-min rinses.
10. Place one nut in a sterile Petri plate.
11. Holding the nut by the pointy end with sterile fine-point forceps, use a sterile scalpel to cut off the base of the nut approximately 1/4 to 1/3 of the way up the nut (see Note 6) from
where its attached to the bur.
12. Set the nut on the cut end and then slice vertically down both
sides.
13. Holding the nut with the scalpel, use the forceps to break the
nut into two halves along the suture line between the two
cotyledons.
152
14. Examine the ovules (see Note 7).

15. Using the forceps, pin one of the nut halves to the Petri plate,
and using the side of the scalpel as a scoop, transfer the whiteor cream-colored ovules to Petri plates containing E1 medium.
Cover and incubate in the dark at approximately 2223 C.
16. For the first 2 or 3 weeks, check the plates every other day for
contamination. Rescue the clean ovules from a contaminated
plate by moving them to fresh E1 Medium (see Note 8).
17. After discarding the ovules with fast-growing contaminants,
decrease the frequency of checking to once every 710 days
(see Note 9).
18. After all contaminated ovules have been eliminated, decrease
the transfer frequency to once every 23 weeks.
19. Usually after 46 weeks (two or three transfers), enough tissue
will have emerged from the ovules to require subdividing. For
the first few subculture cycles, keep all healthy tissues. Place all of
the clumps from one ovule in a single Petri plate (see Note 10).
20. After two or three subculture cycles, there should be 1012
pieces of tissue from each cell line to choose from. Discard all
cell lines that are producing only non-embryogenic callus.
Even in the cell lines that are producing somatic embryos,
many of the clumps will be callus. Discard these clumps. Many
of the remaining clumps will contain both callus and embryos,
gently cut off, and transfer only the somatic embryo clumps,
discarding the callus.
21. After three or four more subculture cycles, the remaining cell
lines will have developed identifiable characteristics. Some
will produce over 90 % callus in each clump with very few
new embryos. Discard these cell lines; in our experience they
will not get any better. Some cell lines will produce mostly
embryos with 50 % or less of each clump becoming callus.
Keep subculturing these lines, retaining only the best embryos
from the best clumps for each cycle. A small fraction of the
cell lines will produce clumps that appear to be all embryos.
These cell lines are ready to multiply for transformation
3.2 Agrobacterium
Inoculum Preparation
1. Streak the Agrobacterium strain containing the plasmid with

the gene(s) of interest (from a previous plate or from 80 C
freezer stocks) onto a fresh Petri plate of semisolid
Agrobacterium growth medium with antibiotics. Incubate for
4872 h in the dark at 28 C.
2. Prepare fresh Agrobacterium growth medium (broth) and dispense 50 mL into sidearm flasks (one flask for each
Agrobacterium strain and one extra to be used as a blank to
zero the spectrophotometer).
153
3. Autoclave, cool, and add antibiotics.

4. Inoculate one sidearm flask with each Agrobacterium strain
you will be using.
5. Incubate flask(s) overnight at 28 C on a shaker at 200 RPM.
6. When the OD650 reading is between 0.8 and 1.2, transfer the
Agrobacterium to sterile 50 mL centrifuge tubes.
7. Centrifuge at 1,699 g for 15 min.
8. Gently pour out the supernatant (do not pour out the pellet).
9. Add 15 mL of Vir induction medium and vortex until the pellet disappears. Transfer to a dry sterile flask (sidearm is not
necessary).
10. Add an additional 35 mL of Vir induction medium to the
Agrobacterium in each flask.
11. Incubate at 2022 C on the shaker (approximately 75 RPM
just enough to form a wave) for 34 h (see Note 13).
3.3 Somatic Embryo
Transformation
1. Starting with vigorously growing embryo clumps, 12 weeks

since their last subculture, transfer approximately 20 clumps to
a sterile empty 14 mL Falcon tube.
2. Add enough Agrobacterium inoculum from step 11 of
Subheading 3.2 to the tube to cover the clumps (45 mL).
Make sure the clumps are completely wet with inoculum and
that the cap is on tight.
3. Incubate for 1 h at room temperature on a 360 rotating
shaker (Labquake or equivalent, approx. 3040 RPM).
4. Remove the inoculum with a pipettor or transfer pipette until
the embryos are mostly dry.
5. Prepare desiccation plates by adding 200 L of sterile distilled
water to the center of the filter paper just before use.
6. Transfer the embryo clumps to desiccation plates. They should
be placed in ~5 mm diameter piles with approximately 1 cm
between the piles. Incubate in the dark at 2325 C for 2 days.
7. Transfer the embryo clumps to Agro Kill Medium (in large
Petri plates). The clumps should be spread out over the surface
in a thin layer so that each clump makes contact with the
medium. Incubate in the dark at 2325 C for 1 week.
8. After 1 week, add liquid selection medium to a sterile bioreactor. Transfer the embryo clumps to the bioreactor (the air
pump timer should be set to go on for 2 min every 4 h).
Incubate in the dark at 2325 C.
9. Change the medium every 2 weeks by pouring out the old
liquid selection medium and adding the new liquid selection
medium.
154
10. After 68 weeks, transfer living tissue to solid selection

medium. Keep all events separate. Incubate in the dark at
2325 C.
11. Multiply each transformation event on selection medium,
transferring to fresh medium every 2 weeks. After 4 weeks,
begin using E1-P instead of solid selection medium. Incubate
in the dark at 2325 C.
12. Once there is enough tissue (with three or four extra clumps),
use PCR to check [33] for the gene(s) of interest (see Note 14).
3.4 Conversion
of Somatic Embryos
into Multiplying Shoot
Cultures
1. Starting with healthy, vigorously growing (a maximum of 3

weeks since the last transfer) antibiotic-resistant chestnut
somatic embryo cultures on E1 medium with 143 mg/L paromomycin, transfer clumps onto Petri plates containing E2
medium. Incubate the embryo clumps in the dark at 2325 C
for 3 weeks.
2. Transfer all of the embryo clumps to Petri plates containing E3
medium (see Note 15). Incubate the embryos in the dark at
2325 C for 7 days.
3. Transfer all of the embryo clumps to a Magenta cube containing E4 medium. Incubate in the light (75 mol/m2/s, 16 h
photoperiod) at 2325 C.
4. Subculture the embryos to fresh E4 medium every 2 weeks
(see Note 16).
5. Watch the embryo masses for new shoot formation (the shoots
should begin to develop in 46 weeks). Transfer shoots to PR
low BA medium as they appear (see Note 17).
6. Multiply the transgenic shoots by cutting off the callus at the
bottom of the shoot, removing the leaves, and cutting the
shoots at their internodes in approximately 5 mm segments
(see Note 18).
7. Place the new cuttings in PR low BA medium. Incubate in the
light (75 mol/m2/s, 16 h photoperiod) at 2325 C.
3.5 Rooting
and Acclimatization
of Chestnut
Microshoots
1. Starting with healthy and vigorously growing chestnut shoot

cultures, transfer the shoots to fresh PR low BA medium every
3 weeks until the majority of the shoots are between 3 and
5 cm in length with at least six well-formed leaves.
2. Cut off any callus that may have formed on the base of the
elongating shoots. Carefully make a slice up the basal end of
the shoots between 1 and 2 mm long or cut the basal end at a
45 angle to increase surface area (move quickly so shoot tips
dont desiccate).
3. Dip the cut end in a freshly prepared IBA quick-dip solution.
Approximately 10 mL in a 60 mm Petri plate will provide the
appropriate depth (see Note 19).
155
4. Immediately after dipping the shoots, transfer them to

Magenta cubes containing rooting medium and culture for 4
days in complete darkness.
5. Transfer the shoots to PR low BA medium and culture until
roots are visible (2 weeks maximum). Incubate in the light
(75 mol/m2/s, 16 h photoperiod) at 2325 C (see Note 20).
Once roots begin to form, it is time to pot the plantlets.
6. Prepare a slightly moistened fine potting mixture (such as
Fafard Super-Fine Germinating Mix) (see Note 21). Fill 7
cylindrical pots to within 2 cm of the top. Using a dibble or a
finger, poke a hole in the center of the potting mix approximately 3 cm deep.
7. Rooted plantlets should be removed carefully from the gelled
medium, to minimize damage to newly formed roots. Take
care to wash the roots free of all gelled medium (see Note 22).
Remove and plant one plantlet at a time to reduce transpiration stress.
8. Place one plant in each pot, gently spreading out the root system so that none of the roots are wrapped around the stem or
bent at odd angles, and tamp down the potting mix around
the roots.
9. Water the plantlet with 30 mL of room temperature tap water.
10. Place a 1-pint sandwich bag over the plantlet and attach it to
the pot with a rubber band.
11. Place the plants in a controlled-environment growth chamber
with a 16-h photoperiod at 90150 mol/m2/s light intensity
and 25 C day temperature. Relative humidity inside the
growth chamber should be maintained at a minimum of 85 %.
Inside the plastic tent, the relative humidity will be very
close to 100 % (see Note 23).
12. After 2 weeks, begin acclimatizing the plantlets to ambient
humidity by cutting a small (12 cm) corner off of the tent.
If wilting occurs, tape the corner shut and wait a day or two
until plants regain turgidity and then cut another corner or
remove the tape. After the tents are completely open, plants
should be watered approximately twice a week (or as necessary
to keep potting mix uniformly damp). Alternate watering with
Hoagland liquid fertilizer solution [37] and Bt soil drench
(see Note 24). Monitor the plants for wilting.
13. After another 48 weeks of exposure to ambient relative
humidity in the growth chamber, the acclimatized plantlets
can be moved to a shaded greenhouse (see Note 25).
14. In the greenhouse, the developing plants will begin forming
larger leaves and should grow rapidly (see Note 26).
156
Notes
1. Nephelo sidearm flasks can be inserted directly into a spectrophotometer equipped with a suitable adapter, allowing for a
quick nondestructive determination of optical density. The
attached flask sticks up too far to close the spectrophotometer
lid but a thick, dark-colored cloth can be draped over the flask
to prevent ambient light from interfering with spectrophotometer readings.
2. As an option, 2 g/L of activated charcoal can be added to the
rooting medium instead of the 4-day dark treatment. If charcoal is to be used, it should be autoclaved separately with 1/2
the final volume of distilled water. The autoclaved and partially
cooled (~55 C) rooting medium made up at 2 the final volume should then be added to the containers in a laminar flow
hood, swirled briefly to mix, and allowed to cool. Alternatively,
when we have several hundred shoots to root, we use sterile
disposable plastic clamshell fast-food containers. Purchased
by the case (500/case), these cost ~7 cents each. They will hold
~200 mL of rooting medium with ~20 to 30 shoots per case.
3. Collect only from chestnut trees in flowering groups. Castanea
is almost completely self-sterile so ovules from isolated trees
will abort. Expect to see large tree-to-tree differences in contamination rates and ease of establishment of cell lines; therefore, it is better to collect a few burs (perhaps 1015) from
many different trees rather than a lot of burs from a few trees.
Burs can be kept at 4 C in sealed plastic bags for a week or
longer, but if the spines turn brown, the ovules inside are probably brown too, meaning they are dying.
4. The original pVspB-OxO vector carries three genes: a selectable
marker (bar), a scorable marker (gfp), and a putative blight resistance gene (OxO). The bar gene codes for a phosphinothricin
acetyltransferase [39] and is controlled by a potato ubiquitin
(Ubi3) promoter and terminator [40]. This gene conveys resistance to glufosinate-ammonium. The gfp gene codes for a modified green fluorescent protein (mgfp5-ER). It is driven by a
CaMV 35S promoter and terminator [41]. The OxO gene codes
for a wheat germin-like oxalate oxidase gene [42]. It is driven by
a soybean vegetative storage protein (VspB4) promoter [43]
and has an actin 2 (Act2) terminator. Details of the construction
of pVspB-OxO are in [26]. When we used this vector alone, we
included 30.27 M glufosinate-ammonium in the selection
medium. When we did co-transformations with two plasmids,
one plasmid had the gfp and bar genes while the second had an
nptII gene and the gene of interest. We included both glufosinate-ammonium and Paromomycin in the original three
selection media (Solid, Liquid and Embryo Initiation + Par).
157
In 2013, when we stopped doing co-transformations, we eliminated the plasmid containing the bar gene and with it the need
to include glufosinate-ammonium.
5. Be careful not to cut into the nut or else the bleach solution
will kill the ovules. Treat only as many nuts as can be processed
in 1 day. With practice, it is possible to extract and plate out
ovules from approximately 15 to 20 nuts in 1 h, but it is tiring
because of the tough seed coats. We found that one person
could work for approximately 3 h at a sitting.
6. In immature chestnuts, all the ovules are in a little cluster at the
pointy end of the nut.
7. Castanea nuts are polyembryonic with 12 or more ovules in
each nut. Soon after fertilization, all the ovules begin to grow,
but within 6 weeks, one will have expanded to fill the nut while
the rest will have aborted. The optimum stage of development
for establishing somatic embryo cell lines is when the cluster of
ovules has begun to develop, but the dominant ovule is still
less than three times the size of the other ovules in the group.
If the largest ovule in the cluster is too big and the others are
brown or black, discard the nut.
8. Expect a high contamination rate. Also expect some trees to
have higher contamination than others.
9. There is usually a burst of initial contamination from fastgrowing fungi and bacteria, but slow-growing bacteria can
show up after a month or more. If apparently clean ovules
are repeatedly rescued, these slow-growing contaminants
may not be discovered for many weeks.
10. A broad range of tissue types will emerge from the ovules. The
key is being able to distinguish between callus and somatic
embryos. Somatic embryos look like clusters of balloons or
grapes. They are smooth and regular in shape. Callus is more
rough-surfaced and irregular in shape than the somatic embryos.
11. It requires a large number of nuts, preferably collected from a
number of different trees, to eventually end up with a small number of vigorous somatic cell lines. In 2004, our lab received burs
from 18 trees, explanted more than 3,000 ovules, and 6 months
later had five cell lines suitable for transformation studies.
12. If cell cultures are stressed due to infrequent transfers to fresh
medium, transformation efficiency will plummet.
13. The purpose of this step is to induce the VIR genes, not to
grow more bacteria.
14. Screening transformation events for correct DNA integration
is an important follow-up for the transformation process, but
requires equipment and expertise well beyond that available in
most tissue culture laboratories. The simplest screen is to use
158
PCR; however, this technique cannot be used to determine

gene copy number in a transformation event. Southern hybridization assays require considerably more time, expertise, and
tissue for extracting DNA but can be used to distinguish
unique events and determine copy number. Quantitative (realtime) PCR (qPCR) is a recent alternative that is quicker and
easier than Southern hybridization, yet can still be used to estimate copy number.
15. Many of the embryos may be abnormal (normal embryos will
have two cotyledons). They may have only one cotyledon,
the cotyledons may be fused, or there may be more than two
cotyledons. Transfer all of them, as this does not seem to affect
the subsequent regeneration process.
16. The embryos will grow into unrecognizable lumpy green
masses, 12 cm in size. Dont be overly concerned. Some will
eventually form morphologically normal shoots.
17. Agrobacterium transforms hundreds of cells in each clump of
embryos. The gene(s) of interest will incorporate in a different
place on different chromosomes in each cell, so they often have
a wide range of expression. It is necessary to sort out all of the
events so that each cell line can be traced back to a single cell.
Sometimes what appears to be a single transformation event is
actually a mixture of two or more events. In theory, it is possible to have an embryo form from several cells rather than just
one. All embryogenic tissue would be chimeric from that point
on. In practice we have never observed chimeric events in
somatic embryo cultures of American chestnut, but we have
observed a modest percentage of mixed events. Where several
embryos located close together were isolated from the rest of
the untransformed tissues but were multiplied as mixed cultures and even regenerated into mixed shoot cultures. One
way to make sure that each cell line traces back to a single event
is to transfer one and only one shoot from each putative event
to PR low BA medium. That way even if the embryo culture
was actually a mix of several events, only one will move forward as a shoot culture.
18. Once a transgenic cell line has been regenerated into a stable
shoot culture, it can be maintained for years by subculturing
every 46 weeks onto fresh PR low BA medium in Magenta
cubes.
19. A microshoot stand will allow the operator to dip a batch of
shoots together. Keep the shoots moist by placing the stand in
a sterile Petri plate with approximately 5 mm of sterile water.
Place up to ten shoots in a presterilized rack and then transfer
the whole stand to a Petri plate containing the IBA quick-dip
solution.
159
20. Transfer all shoots, even those not rooted, to the PR low
BA. More shoots will produce roots during this step. Shoots
that are still not rooted at the end of this step can also be potted; they may produce ex vitro roots. This will also allow time
for shoots with tip dieback to begin elongating an axillary bud.
During this stage, it is normal to witness shoot-tip dieback. In
some cases, it can be as severe as 50 % of the total shoot height.
21. Even though the soil mix is not sterile, it is important to maintain a high degree of cleanliness in this step. Estimate 500 mL
of potting mixture per 7 tube. Many potting mixes have fertilizer incorporated in the mix; however, Fafard Super-Fine
Germinating Mix does not. We add Scotts Micromax Granular
Micronutrients at the rate of 1.0 g/L of dry potting mix. After
thoroughly incorporating the dry components, we add ~1 L of
tap water per liter of potting soil and then mix again until uniformly moistened.
22. The roots will be very fragile. It is helpful to break up the solid
medium with forceps before removing the plantlets. This stage
is the beginning of non-sterile conditions, which is why all of
the tissue culture medium must be removed from the roots.
Any medium left on the roots will promote fungal growth. As
an additional precaution, plantlets can be dipped in a fungicide
solution.
23. The plastic bag functions much like the sweat tent used in
horticulture to propagate cuttings. It is important to begin
increasing the light level at this stage.
24. The Bt treatments start 2 weeks after the bags are clipped and
alternate with the fertilization of Hoagland solution.
25. Many commercial potting mixes that contain peat moss also
harbor viable fungus gnat eggs. These hatch into fungus gnat
larvae, which have insatiable appetites for plant roots. We routinely treat all acclimatizing plantlets every 2 weeks with a Bt
soil drench.
26. For the combined rooting and acclimatization process, expect
to see an overall survival rate of 50 %. In the greenhouse and
subsequent field planting, we have found that micropropagated plantlets lag behind seedlings of the same age for the first
growing season.
Acknowledgments
Financial support was provided by the Forest Health Initiative, the
Monsanto Fund, the American Chestnut Foundation (New York
chapter and National), USDA-Biotechnology Risk Assessment
Grant program (BRAG), the Consortium for Plant Biotechnology
Research (CPBR), and ArborGen LLC.
160
Photography: Greg Boyd Fig. 1; Linda McGuigan Figs. 2, 3a, b;

Andy Newhouse Figs. 3c, d; William Powell Fig. 4.
The following individuals have also contributed biological
materials, time, and financial support or, in some other way, have
contributed to this publication and to the American Chestnut
Research and Restoration Project: Stanley and Arlene Wirsig,
Herbert and Jane Darling, Dick Radel, Dale Travis, Bryan Burhans,
John Dougherty, Joyce Fry, Mary Lou Rath, Dawn Parks, Maud
Hinchee, James Donowick, John Ellis, Scott Merkle, Zizhuo Xing,
Sharon and Seth LaPierre, Mike Satchwell, Haiying Liang, Katie
Damico, and Kristen Russell.
References
1. Russell EWB (1987) Pre-blight distribution of
Castanea dentata (Marsh.) Borkh. Bull Torrey
Bot Club 114(2):183190
2. Murrill WA (1906) A serious chestnut disease.
J NY Bot Garden 7(8):143153
3. Diller JD, Clapper RB (1965) A progress
report on attempts to bring back the chestnut
tree in the eastern United States, 1954-1964.
J Forestry 63(3):186188
4. Gonzales ML, Vieitez AM, Vieitez E (1985)
Somatic embryogenesis from chestnut cotyledon
tissue cultured in vitro. Sci Hortic 27:97103
5. Piagnani C, Eccher T (1990) Somatic embryogenesis in chestnut. Acta Hortic 280:159161
6. Vieitez FJ, San Jose MC, Ballester A, Vieitez
AM (1990) Somatic embryogenesis in cultured
immature zygotic embryos in chestnut. J Plant
Physiol 136:253256
7. Merkle SA, Wiecko AT, Watson-Pauley BA
(1991) Somatic embryogenesis in American
chestnut. Can J For Res 21:16981701
8. Maynard CA (1991) Using PCR to confirm
Agrobacterium transformation of American
chestnut (Castanea dentata). Abstract No. 927.
In: Program and abstracts of the third international congress of plant molecular biology:
molecular biology of plant growth and development. Tucson, Arizona. 611 Oct 1991
9. Merkle S, Carraway DT, Watson-Pauley BA,
Wilde HD (1992) Somatic embryogenesis and
gene transfer in American chestnut.
Proceedings of the international chestnut conference, Morgantown, West Virginia, 1014
July 1992. West Virginal University Press,
Morgantown, W.Va
10. Carraway DT, Wilde HD, Merkle SA (1994)
Somatic embryogenesis and gene transfer in
American chestnut. J Am Chest Found 8(1):
2933
11. Vieitez AM, Ballester A, Vieitez ML, Vieitez E

(1983) In vitro plantlet regeneration of mature
chestnut. J Hortic Sci 58:457463
12. Vieitez AM, Vieitez ML (1983) Castanea
sativa plantlets proliferated from axillary buds
cultivated in vitro. Sci Hortic 18:343351
13. Chauvin JE, Salesses G (1988) Advances in
chestnut micropropagation (Castanea sp.).
Acta Hortic 227:340345
14. Chevre AM, Salesses G (1987) Choice of
explants for chestnut micropropagation. Acta
Hortic 212:517523
15. Mullins KV (1987) Micropropagation of
chestnut (Castanea sativa Mill.). Acta Hortic
212:525530
16. Piagnani C, Eccher T (1988) Factors affecting
the proliferation and rooting of chestnut
in vitro. Acta Hortic 227:384386
17. Strullu DG, Grellier B, Marciniak D, Letouze
R (1986) Micropropagation of chestnut and
conditions of mycorrhizal synthesis in vitro.
New Phytol 102:95101
18. Vieitez AM, Ballester A, Vieitez E (1987)
Vitrification in chestnut shoots regenerated in
vitro. Acta Hortic 212:231234
19. Maynard C, Satchwell M, Rieckermann H
(1993) Micropropagation of American chestnut (Castanea dentata (Marsh.) Borkh.):
rooting and acclimatization. In: Proceedings
of the second northern forest genetics association conference, 2930 July 1993, St. Paul,
Minnesota. pp 161170
20. Merkle S, Andrade G, Pettis S, Johnson S,
Kormanik T, Le H, Maner L (2008) Recent
advances in American chestnut in vitro propagation. J Am Chest Found 22:2330
21. Carraway DT, Merkle SA (1997) Plantlet
regeneration from somatic embryos of American
chestnut. Can J For Res 27:18051812

22. Robichaud RL, Lessard VC, Merkle SA (2004)
Treatments affecting maturation and germination of American chestnut somatic embryos.
J Plant Physiol 161:957969
23. Seabra RC, Pais MS (1998) Genetic transformation of European chestnut. Plant Cell Rep
17:177182
24. Corredoira E, Montenegro D, San-Jose MC,
Vieitez AM, Ballester A (2004) Agrobacteriummediated transformation of European chestnut
embryogenic cultures. Plant Cell Rep 23:
311318
25. Maynard CA, Polin LD, LaPierre S, Rothrock
RE, Powell WA (2006) American chestnut
(Castanea dentata (Marsh.) Borkh.) (Chapter
22). In: Wang K (ed) Agrobacterium protocols,
2nd edn. Humana, Totowa, pp 239251
26. Polin LD, Liang H, Rothrock R, Nishii M,
Diehl D, Newhouse A, Nairn J, Powell WA,
Maynard CA (2006) Transformation of
American chestnut (Castanea dentata (Marsh.)
Borkh.) somatic embryos. Plant Cell Tiss Org
Cult 84:6978
27. Gisele M, Campbell A, Nairn J, Huong TL,
Merkle SA (2009) Sexually mature transgenic
American chestnut trees via embryogenic
suspension-based transformation. Plant Cell
Rep 28:13851397
28. Kong L, Holtz CT, Nairn CJ, Houke H, Powell
WA, Baier K, Merkle SA (2013) Application of
airlift bioreactors to accelerate genetic transformation in American chestnut. Plant Cell Tiss
Org Cult (PCTOC) 117:3950
29. Zhang B, Newhouse AE, McGuigan LD,
Maynard
CA,
Powell
WA
(2011)
Agrobacterium-mediated co-transformation
of American chestnut (Castanea dentata)
somatic embryos with a wheat oxalate oxidase
gene. (Extended abstract for the IUFRO
meeting in 2011). BioMed Central (BMC)
Proc 5(Suppl 7):43
30. Powell WA, Morley P, King M, Maynard CA
(2007) Small stem chestnut blight resistance
assay. J Am Chest Found 21(2):3438
31. Newhouse AE, Spitzer JE, Maynard CA,
Powell WA (2014) Leaf inoculation assay as a
rapid predictor of chestnut blight susceptibility.
Plant Dis 98(1)
32. Zhang B, Oakes AD, Newhouse AE, Baier
KM, Maynard CA, Powell WA (2013) A
threshold level of oxalate oxidase transgene
expression reduces Cryphonectria parasitica
induced necrosis in a transgenic American
chestnut (Castanea dentata) leaf bioassay.
Transgenic Res 22(5):973982, http://link.
33.
34.
35.
36.
37.
38.
39.
40.
41.
42.
43.
161
springer.com/article/10.1007%2Fs11248013-9708-5#
Newhouse AE, Zhang B, Northern L, Maynard
CA, Powell WA (2010) Analysis of transgenic
American chestnut. Phytopathology 100:S89
Komari T, Hiei Y, Saito Y, Murai N, Kumashiro
T (1996) Vectors carrying two separate
T-DNAs for co-transformation of higher plants
mediated by Agrobacterium tumefaciens and
segregation of transformants free from selection markers. Plant J 10:165174
McGuigan L, Northern LC, Stewart KE,
Powell WA, Maynard CA (2012) Transforming
American chestnut somatic embryos using a
temporary-immersion
bioreactor
system.
Poster presented at the Fifth International
Chestnut Symposium, 48 Sep 2012, National
Conservation Training Center, Shepherdstown,
WV
Cheng M, Hu T, Layton J, Liu C, Fry JE
(2003) Desiccation of plant tissues postAgrobacterium infection enhances T-DNA
delivery and increases stable transformation
efficiency in wheat. In Vitro Cell Dev Biol
Plant 39:595604
Hoagland DR, Arnon DI (1950) The waterculture method for growing plants without
soil, vol Circ. 347. Univ. of Calif. Agric. Exp.
Station, Berkley
Hood EE, Gelvin SB, Melchers LS, Hoekema
A (1993) New Agrobacterium helper plasmids
for gene transfer to plants. Transgenic Res 2:
208218
White J, Chang SY, Bibb MJ (1990) A cassette
containing the bar gene of Streptomyces hygroscopicus: a selectable marker for plant transformation. Nucleic Acids Res 18:1062
Garbino JE, Belknap WR (1994) Isolation of a
ubiquitin-ribosomal protein gene (ubi3) from
potato and expression of its promoter in transgenic plants. Plant Mol Biol 24:119127
Haseloff J, Siemering KR (1998) The uses of
GFP in plants. In: Chalfie M, Kain S (eds)
Green fluorescent protein: properties, applications, and protocols. Wiley-Liss, New York,
pp 191220
Dratewka-Kos E, Rahman S, Grzekzak ZF,
Kennedy TD, Murray RK, Lane G (1989) The
polypeptide structure of germin as deduced
from cDNA sequencing. J Biol Chem 264:
48964900
Mason HS, DeWald DB, Mullet JE (1993)
Identification of a methyl jasmonate-responsive
domain in the soybean vspB promoter. Plant
Cell 5:241251
Chapter 14
Chestnut, European (Castanea sativa)
Elena Corredoira, Silvia Valladares, Ana M. Vieitez, and Antonio Ballester
Abstract
Development of a system for direct transfer of antifungal candidate genes into European chestnut (Castanea
sativa) would provide an alternative approach to conventional breeding for production of chestnut trees
that are tolerant to ink disease caused by Phytophthora spp. Overexpression of genes encoding PR proteins
(such as thaumatin-like proteins), which display antifungal activity, may represent an important advance in
control of the disease. We have used a chestnut thaumatin-like protein gene (CsTL1) isolated from
European chestnut cotyledons and have achieved overexpression of the gene in chestnut somatic embryogenic lines used as target material. We have also acclimatized the transgenic plants and grown them on in
the greenhouse. Here, we describe the various steps of the process, from the induction of somatic embryogenesis to the production of transgenic plants.
Key words Agrobacterium tumefaciens, Castanea sativa, Forest biotechnology, Genetic transformation, gfp, Somatic embryogenesis, Thaumatin-like protein
Introduction
European chestnut (Castanea sativa Mill.) is a tree of great historical,
ecological, and economic significance, and it is distributed within
25 European countries, covering an area of over two million hectares [1]. Chestnuts, which have been cultivated for centuries, were
used as a staple food [2], and chestnut wood was used to make
house frames and furniture, for tannin production and as source of
renewable energy.
Ink disease, mainly caused by Phytophthora cinnamomi Rand
and P. cambivora (Petri) Buis, is one of the most destructive diseases
affecting European chestnut [3]. The species is also threatened by
the ascomycete fungus Cryphonectria parasitica (Murr.), which
causes blight or canker disease. However, the trees partially recover
from this disease as a result of the natural occurrence of hypovirulence [4], which causes nonlethal, superficial (healing) cankers that
are restricted to the outer parts of the bark.
163
164
Elena Corredoira et al.
Production of ink-resistant trees by conventional breeding is

based on the Asian species C. mollissima Blume and C. crenata
Sieb. and Zucc., both of which exhibit natural tolerance/resistance
to the disease. Programs have been designed to produce interspecific hybrids with European chestnut [5], and a large number of
first-generation hybrids that are tolerant to ink disease have been
selected and used in Europe. Conventional breeding approaches
have been hampered by the long reproduction cycle of the species,
which extends the backcross processes used to diminish the Asian
genetic background in the hybrids. Selection of trees exhibiting
natural resistance is a complementary approach used in the
European chestnut tree improvement program [6]. To maintain
the resistance, the selected trees should by propagated vegetatively,
which makes chestnut an ideal target for genetic improvement via
transgenic approaches involving clonal propagation. Specific genes
for resistance to chestnut diseases have not yet been identified, but
the use of pathogenesis-related (PR) proteins, which play a major
role in natural defense against pests and pathogens, is of interest.
Both biolistic and Agrobacterium-mediated transformation
were initially evaluated to transform European chestnut and
American chestnut (C. dentata (Marsh.) Borkh), but no stable
transformation events were achieved. The main causes of the failure, as extensively reviewed [7], may be ascribed to the target
material used in the experiments: hypocotyl segments from in vitro
germinated seedlings, stem segments from in vitro grown shoots,
leaf discs, and axillary nodes of cotyledons. In our experience, plant
regeneration systems based on adventitious bud induction have
not proved reliable in chestnut, and this is probably the cause of
the failure to achieve genetic transformation with the above mentioned types of target material. In all these cases, transgenic events
were observed, but no transgenic plants were recovered. The first
report of successful Agrobacterium-mediated transformation of a
species of the genus Castanea described regeneration of transgenic
plants from European chestnut by using somatic embryos as the
target material [8, 9]. In these studies, marker genes were used and
an improved protocol was defined after evaluation of the different
parameters involved in the process: effect of the genotype, type
(size) of initial explants, coculture period, effect of antibiotics and
of antioxidants, etc. As the ultimate goal for the genetic transformation of chestnut should be the production of plants that are
resistant/tolerant to certain fungal diseases, we have recently
developed a new protocol to overexpress a native thaumatin-like
protein gene in embryogenic cultures of European chestnut [10].
Overexpression of this protein, isolated from seeds of European
chestnut, provides a means of producing cisgenic plants [11],
which should be linked to the regulatory systems designed to manage the risks of genetic modified organisms and to respond to public concern. To develop a protocol for genetic transformation of
165
chestnut, a consistent and reproducible somatic embryogenesis

(SE) system is essential. In European chestnut, immature zygotic
embryos or leaves collected from in vitro axillary shoot cultures
can be used as initial explants to induce SE [12]. The use of leaf
explants offers the following advantages over the use of zygotic
embryo tissues: clonal material is a suitable source of explants for
inducing somatic embryogenesis from selected mature genotypes,
no sterilization procedure is required, and experiments can be programmed all year around. Moreover, in vitro establishment of
chestnut axillary shoot cultures, multiplication, rooting, and plantlet regeneration are well-defined processes [13].
In this chapter, we describe the Agrobacterium-mediated
European chestnut transformation protocol routinely used in our
laboratory [10]. In this protocol, A. tumefaciens strain EHA 105
containing a plasmid construct with an nptII gene is used as selectable marker and a gfp gene as a scorable marker. The chestnut gene
encoding a thaumatin-like protein, designated CsTL1, is also
cloned in the vector under the CaMV35S promoter. The efficiency
of transformation varied from 7.1 to 32.1 % and was clearly genotype dependent. Currently, the conversion of somatic embryos
into plantlets is a limiting step for chestnut embryogenic systems
[12, 14]; the same applies to transgenic embryos, for which low
conversion frequencies are obtained (3.320 %, depending on the
genotype) [10]. However, all the embryogenic lines tested also
produced a number of embryos that developed only shoots during
culture on germination medium, while root growth remained
blocked. These shoots may be excised and used to establish axillary
shoot cultures that can be multiplied by axillary branching and
then rooted using established protocols [13], allowing the production of a large number of transgenic plants.
2
2.1
Materials
Plant Material
1. Immature nuts of European chestnut collected during the

1011 weeks post-anthesis (approx. last week of August and
the first week of September in Santiago de Compostela, NW
Spain, 425250N, 83240W).
2. Leaf and shoot apex explants from stock shoot multiplication
cultures (see Note 1). The protocols for induction of somatic
embryos are described in Subheadings 3.1 and 3.2, according
to Corredoira et al. [12].
2.2 Agrobacterium
tumefaciens Strain
and Vector
1. A. tumefaciens strain EHA 105 [15] carrying the vector

pK7WG2D-TAU [10] is used (see Note 2 and Fig. 1). This
vector contains the CsTL1 gene [16], encoding a thaumatinlike protein, under the CaMV35S promoter. The vector also
includes a green fluorescence protein (gfp) reporter gene
166

RB
LB
T-nos
npt II
Pro-nos
T-S
CsTL1
Pro-S Pro-rolD
egfpER
T-S
Fig. 1 Structure of T-DNA region of the binary vector pK7WG2D-TAU [10]. T-nos, Pro-nos, terminator, and promoter of nopaline synthase gene, respectively; nptII, neomycin phosphotransferase marker gene; T-35S,
Pro-35S, terminator, and promoter of CaMV 35S RNA gene, respectively; CsTL1 gene encoding a thaumatinlike protein, Pro-rolD the rol root loci D (rolD) promoter, egfpER enhanced green fluorescence protein gene with
endoplasmic reticulum-targeting signal, RB, LB T-DNA right and left border, respectively
driven by the rol root loci D (rolD) promoter (see Note 3) and
a neomycin phosphotransferase (nptII) selectable marker gene
driven by the nopaline synthase (nos) promoter.
2.3
Stock Solutions
1. For surface sterilization of nuts: 70 % ethanol and sterilizing

solution defined as sodium hypochlorite in distilled water
(Millipore Chlorine Tablets, 4 % active chlorine) with two or
three drops Tween 80 per liter. Make fresh.
2. For plant acclimatization: Hoaglands solution [17].
3. Stock solution of N6-benzyladenine (BA): weigh 10 mg BA
and dissolve in water on heat. When dissolved, bring up to
100 mL final volume with water. Stock solution in aliquots is
stored at 20 C.
4. Stock solutions of auxins: naphthaleneacetic acid (NAA),
3-indole-butyric acid (IBA), and 2,4-dichlorophenoxyacetic
acid (2,4-D); weigh 10 mg auxin and dissolve in 0.8 mL
ethanol. When dissolved, bring up to 100 mL final volume
with water. Stock solutions are stored at 4 C for 1 month.
5. Stock solutions of antibiotics: kanamycin and nalidixic acid,
10 mg/mL, prepared by dissolving the antibiotics in water,
filtered through 0.22 m sterile filters, and stored at 20 C.
2.4
Culture Media
2.4.1 For
Agrobacterium
2.4.2 For Chestnut
1. Agrobacterium growth medium (Luria Bertani (LB) [18] + antibiotics): 10 g/L Bacto-tryptone, 5 g/L Bacto yeast extract,
10 g/L NaCl, kanamycin (50 mg/L), nalidixic acid (50 mg/L),
and pH 7. Add Bacto Agar (1.5 %) to prepare solid LB medium.
Antibiotics are added after autoclaving when medium is cooled.
1. Axillary shoot proliferation medium: Gresshoff and Doy (GD)
medium [19] (Duchefa, Netherlands), BA (0.44 M), sucrose
(3 %) and Bacto Agar (0.7 %) (Table 1).
2. Somatic embryo induction medium for zygotic embryos (M1Z): Murashige and Skoog (MS) medium [20], sucrose (3 %),
agar (0.6 %), casein hydrolysate (500 mg/L), 2,4-D (4.52 M),
and BA (0.88 M) (Table 1).
MS
500
2.22 or 4.44
5.37 or 21.48
30
Basal medium
Glutamine (mg/L)
Casein hydrolysate (mg/L)
BA (M)
NAA (M)
IBA (M)
2,4-D (M)
Sucrose (g/L)
Maltose (g/L)
Bacto agar (g/L)
Sigma agar (g/L)
30
4.52
0.88
500
MS
SE induction
in ZE (M1-Z)
30
0.54
0.44
438
MS
SE proliferation
30
MS
SE maturation
30
0.49
0.44
200
MS
SE germination
30
0.44
GD
Axillary shoot
proliferation
6.5
30
122.5
1/3GD
Shoot
rootinga
BA 6-benzyladenine, 2,4-D 2,4-dichlorophenoxyacetic acid, GD Gresshoff and Doy, 1/3 GD GD with 1/3 macronutrients, IBA indole-3-butyric acid, MS Murashige and
Skoog, MS MS half-strength macronutrients, NAA naphthaleneacetic acid, SE somatic embryos, ZE zygotic embryos
a
After 2448 h in rooting medium, shoots were transferred to the same medium without AIB for 4 weeks
SE induction in
leaves/apex (M1-L)
Components
Table 1
Culture media used in the different steps of somatic embryogenesis in European chestnut

167
168
3. Somatic embryo induction medium for leaf and apex explants

(M1-L): MS medium supplemented with sucrose (3 %), agar
(0.6 %), casein hydrolysate (500 mg/L), 5.37 M NAA and
4.44 M BA or 21.48 M NAA and 2.22 M BA (Table 1).
4. Expression medium I (M2): MS medium supplemented with
sucrose (3 %), agar (0.6 %), casein hydrolysate (500 mg/L),
NAA (0.54 M), and BA (0.44 M).
5. Expression medium II (M3): MS medium supplemented with
sucrose (3 %), agar (0.6 %), and casein hydrolysate (500 mg/L).
6. Proliferation medium: MS medium, glutamine (438 mg/L;
Sigma), NAA (0.54 M), BA (0.44 M), sucrose (3 %), and
Sigma agar (0.7 %) (Table 1).
7. Infection medium: MS liquid medium plus sucrose (5 %).
8. Isolation medium: proliferation medium (Table 1) without
plant growth regulators (PGR).
9. Selection medium: proliferation medium (Table 1) supplemented with 300 mg/L carbenicillin, 200 mg/L cefotaxime,
and 150 mg/L kanamycin. Antibiotics are added after autoclaving when medium is cooled.
10. Maturation medium: consisting of MS (half-strength macronutrients) medium supplemented with maltose (3 %) and
Sigma agar (0.7 %) (Table 1).
11. Pregermination medium: MS (half-strength macronutrients)
medium with sucrose (3 %) and Sigma agar (0.8 %).
12. Germination medium: MS medium (half-strength macronutrients), glutamine (200 mg/L), BA (0.44 M), IBA (0.49 M),
sucrose (3 %), and Sigma agar (0.7 %) (Table 1).
13. Shoot rooting medium: GD (1/3 strength macronutrients)
medium supplemented with IBA (122.5 M) (Table 1).
The above mentioned media were adjusted to pH 5.65.7
prior to autoclaving at 115 C for 20 min.
2.5 Specialized
Equipment
and Supplies
1. Incubator and environmentally controlled shaker for A. tumefaciens growth.

2. Spectrophotometer to determine the bacterial optical density
at 600 nm (OD600).
3. Horizontal and vertical laminar flow cabinet, stereomicroscope, centrifuge, autoclave, and pH meter.
4. Epi-fluorescence stereomicroscope (Zeiss SV11) equipped
with a light source consisting of a 100 W mercury bulb and an
FITC/GFP filter set with a 480 nm excitation filter and a
515 nm long-pass emission filter (Chroma Technology Corp.,
USA, or equivalent) (see Note 3).
169
5. For Agrobacterium culture: Eppendorf tubes, plastic tubes

(18 12 mm, 15 mL), micropipettes, pipette tips, Bunsen
burner, inoculating loops, racks, beakers (50 mL), Erlenmeyer
flasks (0.5 and 2 L), sterile disposable Petri dishes (90 mm,
25 mL), and Parafilm.
6. For chestnut culture: forceps, scalpel, glass bed sterilizer, test
tubes (20 150 mm, 16.5 mL/tube), glass jars (85 80 mm,
300 mL), sterile filter paper, sterile disposable Petri dishes
(90 mm, 25 mL), and Parafilm.
7. For plantlet acclimatization: plastic pots (90 100 mm, 0.5 L)
and sterile peat to perlite (3:1, v/v).
Methods
3.1 Induction
of Somatic
Embryogenesis
from Zygotic Embryos
1. Ideally, harvest immature burs during the 1011 weeks

post-anthesis.
2. Remove the spines from the burs with the aid of a scalpel, open
the burs, and isolate the nuts (usually 3 nuts/bur).
3. Remove the external seed coat of the nuts, leaving the inner
coat intact, and surface sterilize by successive immersion in
70 % (v/v) ethanol for 30 s and a sterilizing solution for 10 min
(stir gently).
4. Drain off the chlorine solution and rinse the de-coated seeds
three times in sterile distilled water; the first rinse should last a
few seconds and the other two rinses, 10 min each. The seeds
are then transferred to a water bath pending the next step.
5. Place a nut on sterile filter paper, excise the zygotic embryo
with the aid of a scalpel, and dissect into cotyledon segment
and embryonic axis explants.
6. Place the explants in tubes filled with 16.5 mL of M1-Z
medium (Table 1).
7. Maintain the cultures in darkness at 25 C for 6 weeks and
then transfer the explants to M2 medium; maintain in darkness
for further 30 days.
8. At the end of this period, transfer the zygotic embryo explants,
at monthly intervals, to glass jar containing 50 mL of M3
medium and kept them under a 16-h photoperiod (50
60 mol/m2/s) at 25 C light/20 C darkness (standard
conditions).
9. Calculate the somatic embryogenesis induction frequency by
counting the number of explants producing somatic embryos
in relation to the total number of explants used. Generally,
somatic embryos appeared in this medium on the surface of a
callus 35 months after initiation of the culture (see Note 4).
170
3.2 Induction
of Somatic
Embryogenesis
from Leaf and Shoot
Apex Explants
1. Isolate the 13 uppermost unfurled expanding leaves and shoot

apex (1.01.5 mm in length) from shoot cultures following
4 weeks of the last subculture cycle (see Note 5, Fig. 2a, b).
2. Place the leaves (abaxial side down) on sterile Petri dishes filled
with 25 mL of M1-L medium (Table 1).
Fig. 2 Different steps in the production of transgenic plants of European chestnut. (a) Chestnut shoot multiplication cultures from which apex and leaf explants (b) are isolated for induction of somatic embryogenesis.
(c) Somatic embryos initiated from leaf explant. (d) Cluster of putatively transformed somatic embryos isolated
after 8 weeks in selection medium. (e) Transformed cluster of somatic embryos observed under white light.
(f) The same cluster of somatic embryos observed under blue light showing green fluorescence. (g) The gfp
expression on shoot apex of transgenic plant visualized with an epi-fluorescence stereomicroscope.
(h) Transgenic plants after 6 weeks acclimatization in the growth chamber. Scale bars in ce, 1 mm
171
3. Maintain the cultures in darkness at 25 C for 6 weeks and

then transfer the explants to the M2 medium and maintain in
darkness for further 30 days.
4. Transfer the explants, at monthly intervals, to M3 medium and
maintain them under standard conditions.
5. Calculate the somatic embryogenesis induction frequency by
counting the number of explants producing somatic embryos
in relation to the total number of explants used (Fig. 2c).
Somatic embryos usually appear in this medium on the surface
of a callus 36 months after culture initiation (see Note 6).
3.3 Proliferation
and Maintenance
of Somatic Embryos
1. Isolate somatic embryos initiated from both zygotic embryos

and leaf/apex explants, and multiply them by secondary
embryogenesis (see Note 7).
2. For embryo proliferation, place groups of 35 somatic on
embryo proliferation medium (Table 1) with subculture at
6-week intervals under standard conditions.
3.4 Preparation
of Agrobacterium
Inoculum for Infection
1. Store Agrobacterium tumefaciens strain EHA105 transformed

with the vector pK7WG2D-TAU in 80 C glycerol stocks.
2. To initiate a chestnut transformation experiment, scratch the
surface of the glycerol stock using a cooled inoculating loop
and streak cells across the Agrobacterium growth solid medium.
3. Incubate the inoculated plate upside down for 23 days at
28 C in darkness until single colonies are developed.
4. Pick up an isolate single colony from the plate with a sterile
inoculating loop and place it in 2 mL of Agrobacterium growth
liquid medium. Incubate this culture overnight at 28 C with
shaking (200 rpm) in darkness.
5. Pipette 1 mL of this bacterial suspension and inoculate it into
Erlenmeyer flasks (2 L) containing 600 mL of Agrobacterium
growth liquid medium, and then incubate this bacterial suspension at 28 C in darkness with shaking (100 rpm) until an
OD600 = 0.6 is reached.
6. Centrifuge the bacterial culture at 6,250 g for 10 min at
10 C.
7. Discard the supernatant and resuspend the pellet in 200 mL of
infection medium. Incubate this culture 10 min at 28 C with
shaking (100 rpm) in darkness.
3.5 Infection
and Cocultivation
of Somatic Embryos
1. Use embryogenic cultures 4 weeks after the last subculture and

dissect, under stereomicroscope, explants consisting of small
clumps (47 mg) of 23 somatic embryos, at globular or earlytorpedo stages.
172
2. Use at least 100 embryogenic clumps for each embryogenic

line and transformation experiment (see Note 8). Also use at
least 20 non-inoculated embryo clumps (wild type) and culture
them on proliferation medium with and without antibiotics
(negative and positive controls).
3. Preculture the clumps in Petri dishes containing 25 mL
isolation medium for 1 day.
4. Immerse the precultured clumps into beakers with 20 mL of
A. tumefaciens suspension, as obtained in step 7 of subheading 3.4 for 30 min.
5. Remove the inoculum with the aid of sterile forceps, blot-dry
the clumps on sterile filter paper, and transfer them to Petri
dishes (ten explants per dish) with 25 mL of proliferation
medium (see Table 1).
6. Cocultivate the embryo clumps for 5 days in the dark at 25 C
(see Note 9).
7. Wash the explants in beakers containing 25 mL sterilized water
plus 500 mg/L cefotaxime for 30 min, blot-dry them on
sterile filter paper, and then transfer them to Petri dishes
(ten explants per dish) containing selection medium. Incubate
the cultures under standard conditions (see Note 10).
8. Determine the number of kanamycin-resistant explants per
Petri dish after culture for 2, 4, 6, and 8 weeks in selection
medium.
9. At the end of this 8-week culture period, transfer the kanamycinresistant embryos to fresh selection medium for a further
4-week period (Fig. 2d, e).
10. At the end of the 12-week period, evaluate putative transformants by using gfp-specific fluorescence (gfp+) and calculate
the transformation efficiency (Fig. 2f). The transformation
efficiency is defined as the percentage of initial explants that
developed gfp+ embryogenic cultures.
11. Isolate cotyledonary-stage embryos from gfp+ explants and
subculture them on selection medium to proliferate and to
establish different embryogenic transgenic lines (see Note 11).
Maintain the cultures under standard growth conditions.
Maintain the cultures by secondary embryogenesis with sequential subcultures at 6-week intervals according to the conditions
previously defined in steps 1 and 2, Subheading 3.3 [8, 9].
12. Evaluate the proliferation ability of different embryogenic lines
by determining the number of somatic embryos produced per
explant. Compare these results with those of the corresponding
nontransformed (control) embryogenic line.
3.6 Plantlet
Regeneration
173
1. Isolate cotyledonary somatic embryos (46 mm) from transgenic cultures and transfer them to Petri dishes containing
25 mL maturation medium for 4 weeks.
2. At the end of this culture period, transfer the somatic embryos
to Petri dishes containing 25 mL pregermination medium and
store the Petri dishes at 4 C for 2 months.
3. The transgenic somatic embryos must then be cultured for
8 weeks on Petri dishes containing 25 mL germination medium
(Table 1).
4. At the end of this period, determine both the number of germinating embryos showing signs of plant conversion (with
development of both root and shoot) as well as those embryos
exhibiting only shoot development (see Note 12).
5. Excise the shoots from germinating embryos showing only
shoot development and subculture them on shoot proliferation
medium, according to the previously defined procedure [13].
6. Elongated shoots (1520 mm) were cultured in glass jars containing 30 mL shoot rooting medium for 2448 h and subsequently transfer to an auxin-free medium (Table 1) [13].
7. After 4 weeks under standard growth conditions, record the
percentage of rooting obtained in both transgenic and control
(wild-type) shoots.
8. Confirm the transgenic nature of the regenerated plantlets by
molecular analyses. Fluorescence in different tissues (shoots,
leaves, roots) should also be observed (Fig. 2g).
9. Isolate the rooted shoots from the glass jars, avoiding damage
to the roots, which should be washed with tap water. Transplant
the rooted plantlets in pots (with drainage holes) containing
sterilized peat to perlite (3:1) and acclimatize them in a phytotron or growth chamber at 25 1 C and 90 % relative humidity under a 16-h photoperiod (100 mol/m2/s) for 68 weeks
or until resumption of shoot growth is evident (Fig. 2h).
10. Transfer the plants to a greenhouse for further growth. Irrigate
the plants once a week with Hoaglands solution and then with
tap water when necessary.
Notes
1. Currently European chestnut can be micropropagated from
both juvenile and mature material through axillary shoot
proliferation method. Efforts have focused on regeneration
systems that enable clonal propagation of selected mature
chestnut trees. Large-scale propagation is often challenging,
as the protocols require optimization for a specific cultivar.
174
Commercial production of European chestnuts is now possible.

Protocols for the different micropropagation steps from
in vitro establishment up to plantlet regeneration of European
chestnut are defined [13].
2. Specific genes for resistance to European chestnut ink disease
have not yet been identified, but the use of pathogenesisrelated (PR) proteins such as thaumatin-like proteins would be
an interesting alternative approach when the production of ink
disease-tolerant/disease-resistant plants is the final objective.
Specific details for the construction of pK7WG2D-TAU used
in this work are reported elsewhere [10]. Any other binary
vector containing antifungal genes can also be used with the
protocol defined in the present work.
3. When possible, the gfp should be used as a visual marker gene
in the vector, as this simplifies and improves evaluation of
transformation events in real time. Selection of whole fluorescent embryos facilitates the proliferation of transgenic
embryos, limiting the subculturing of possible escape tissues,
as occurs when GUS expression is used as a selection marker.
Although there is some evidence that gfp may occasionally be
cytotoxic to plant cells, the data obtained to date suggest that
gfp is not cytotoxic for European chestnut material [10].
4. The frequency of SE induction from immature zygotic embryo
explants is higher than that obtained from leaf explants, ranging from 2.2 to 10 %. The induction rate was clearly affected
by both genotype and year of seed collection. Between 1 and
20 somatic embryos at different stages of development can be
obtained from a single explant [12].
5. Stock shoot multiplication cultures of C. sativa should be
maintained by sequential subculture of shoot tips and nodal
segments every 45 weeks [13]. Only apical leaves from healthy
and vigorous shoots should be used as explants to initiate the
embryogenic process.
6. When somatic embryos are originated from leaf tissues of
C. sativa, the explants initially respond by enlargement followed by a small callus formation, which is mainly differentiated
on the cut leaf surfaces. A greenish callus subsequently arises
from the midvein, spreading to the rest of the explant. In some
cases, translucent globular structures and somatic embryos
begin to grow from this callus tissue. The process is not synchronized, and embryos at various developmental stages will be
present in the embryogenic explants. The SE induction frequency in leaf explants is generally lower (around 1 %) than that
obtained when zygotic embryos are used as initial explants.
Furthermore, the time required for the appearance of the first
somatic embryos is longer (36 months) in leaf explants [12].
175
7. In chestnut, the multiplication and maintenance of embryogenic capacity can be carried out by either of two methods:
(1) secondary or repetitive embryogenesis from isolated
somatic embryos at torpedo-cotyledonary stages which develop
secondary embryos from the root-hypocotyl zone and (2) subculture of nodular embryogenic masses or proembryogenic
masses (PEMs) [21]. PEMs are produced from the surface of
somatic embryos. Despite the low induction rates from original explants, chestnut embryogenic cultures show a high
capacity for secondary embryogenesis, which ensures the
maintenance of embryogenic competence.
8. As the induction of somatic embryogenesis, the transformation
efficiency is clearly genotype dependent [9, 10], and the use of
different genotypes is highly recommended for these purposes.
9. The coculture period is clearly genotype dependent and should
be evaluated with the specific target material used, although in
our experience with European chestnut, 45 days of coculture
is sufficient for all the genotypes tested [810].
10. The concentration of kanamycin was selected on the basis of
previous results, but should be reevaluated for a specific chestnut material. The original creamy-yellowish color of the
embryo clumps became brownish/blackish after 23 weeks of
culture in selection medium. However, the addition of antioxidants such as cysteine, ascorbic acid, or acetosyringone in
either cocultivation or selective media is not necessary in
European chestnut and even may be detrimental for the transformation efficiency [8, 10].
11. Each transformation event should be taken as the start of a
putative transgenic line. Each transgenic embryogenic line
should be derived from one somatic embryo to confirm that
the line is the consequence of a unique transformation event.
The line should be routinely maintained by secondary embryogenesis separated from the other transgenic lines produced.
12. Regardless of the genotype, the rate of embryo conversion
(shoot + root development) is very low for both European and
American chestnut. The limited number of plantlets produced
makes subsequent analyses that should be carried out with
these plants difficult. However, some of the embryos cultured
on germination medium develop only a shoot as a partial
germination response, and this provides an opportunity to
multiply and root these shoots to obtain an unlimited number
of transgenic European chestnut plants by proliferation of axillary shoot cultures. Efforts should obviously be made to
increase plantlet conversion from transgenic somatic embryos;
however, at present this method (axillary shoot proliferation) is
the only realistic alternative. At this stage, the plants may be
used for both molecular analyses and/or for testing the resistance to fungal attacks.
176
References
1. Conedera M, Manetti MC, Giudici F et al
(2004) Distribution and economic potential of
the sweet chestnut (Castanea sativa Mill.) in
Europe. Ecol Mediter 30:4761
2. Bellini E (2005) The chestnut and its resources:
images and considerations. Acta Hort 693:
8596
3. Vannini A, Natili G, Anselmi NA et al (2010)
Distribution and gradient analysis of ink disease in chestnut forests. For Pathol 40:7386
4. Heiniger U, Rigling D (1994) Biological control of chestnut blight in Europe. Annu Rev
Phytopathol 32:581599
5. Vieitez E, Vieitez ML, Vieitez FJ (1996) El
castao. Edilesa, Len
6. Rodrguez L, Cuenca B, Lpez CA et al
(2005) Selection of Castanea sativa Mill. genotypes resistant to ink disease in Galicia
(Spain). Acta Hort 693:645651
7. Maynard CA, Powell WA, Polin-McGuigan
LD et al (2008) Chestnut. In: Kole C, Hall TC
(eds) Compendium of transgenic crop plants:
transgenic forest tree species. Blackwell,
Chichester, pp 169192
8. Corredoira E, Montenegro D, San-Jos MC
et al (2004) Agrobacterium-mediated transformation of European chestnut embryogenic
cultures. Plant Cell Rep 23:311318
9. Corredoira E, San-Jos MC, Vieitez AM et al
(2007) Improving genetic transformation of
European chestnut and cryopreservation of
transgenic lines. Plant Cell Tiss Org Cult 91:
281288
10. Corredoira E, Valladares S, Allona I et al (2012)
Genetic transformation of European chestnut
somatic embryos with a native thaumatin-like
protein (CsTL1) gene isolated from Castanea
sativa seeds. Tree Physiol 32:13891402
11. Vanblaere T, Szankowski I, Schaart J (2011)
The development of a cisgenic apple plant.
J Biotechnol 154:304311
12. Corredoira E, Ballester A, Vieitez FJ et al

(2006) Somatic embryogenesis in chestnut.
In: Mujib A, Samaj J (eds) Plant cell monographs, vol 2, Somatic Embryogenesis.
Springer, Berlin, pp 177199
13. Vieitez AM, Snchez C, Garca-Nimo ML et al
(2007) Protocol for micropropagation of
Castanea sativa. In: Jain SM, Hggaman H
(eds) Protocols for micropropagation of
woody trees and fruits. Springer, Heidelberg,
pp 299312
14. Corredoira E, Valladares S, Vieitez AM et al
(2008) Improved germination of somatic
embryos and plant recovery of European chestnut. In Vitro Cell Dev Biol Plant 44:307315
16. Garca-Casado G, Collada C, Allona I et al
(2000) Characterization of an apoplastic basic
thaumatin-like protein from recalcitrant chestnut seeds. Physiol Plant 110:172180
17. Hoagland DR, Arnon DI (1941) The water
culture method for growing plants without
soil. Miscellaneous publications N 3514.
Circular of the California Agricultural
Experimental Station
18. Sambrook J, Russell D (2001) Molecular cloning: a laboratory manual, 3rd edn. Cold Spring
Harbor Laboratory, Cold Spring Harbor, NY
19. Gresshoff PM, Doy CH (1972) Development
and differentiation of haploid Lycopersicon
esculentum. Planta 107:161170
20. Murashige T, Skoog F (1962) A revised
medium for rapid growth and bioassays with
tobacco tissue culture. Physiol Plant 15:
473497
21. Vieitez FJ, Merkle SA (2005) Castanea spp.
chestnut. In: Litz RE (ed) Biotechnology of
fruit and nut crops. CAB International,
Wallingford, pp 265296
Chapter 15
Grapevine (Vitis vinifera L.)
Laurent Torregrosa, Sandrine Vialet, Anglique Adivze,
Pat Iocco-Corena, and Mark R. Thomas
Abstract
Grapevine (Vitis) is considered to be one of the major fruit crops in the world based on hectares cultivated
and economic value. Grapes are used not only for wine but also for fresh fruit, dried fruit, and juice production. Wine is by far the major product of grapes, and the focus of this chapter is on wine grape cultivars.
Grapevine cultivars of Vitis vinifera L. have a reputation for producing premium quality wines. These
premium quality wines are produced from a small number of cultivars that enjoy a high level of consumer
acceptance and are firmly entrenched in the market place because of varietal name branding and the association of certain wine styles and regions with specific cultivars. In light of this situation, grapevine improvement by a transgenic approach is attractive when compared to a classical breeding approach. The transfer
of individual traits as single genes with a minimum disruption to the original genome would leave the
traditional characteristics of the cultivar intact. However, a reliable transformation system is required for a
successful transgenic approach to grapevine improvement. There are three criteria for achieving an efficient
Agrobacterium-mediated transformation system: (1) the production of highly regenerative transformable
tissue, (2) optimal cocultivation conditions for both grapevine tissue and Agrobacterium, and (3) an efficient
selection regime for transgenic plant regeneration. In this chapter, we describe a grapevine transformation
system that meets these criteria. We also describe a protocol for the production of transformed roots
suitable for functional gene studies and for the production of semi-transgenic grafted plants.
Key words Agrobacterium, Antibiotic sensitivity, Embryogenic callus, Grapevine, Hairy roots,
Reporter genes, Plant regeneration, Semi-transgenic grafted plants, Selectable markers, Transformation
efficiency, Transgenic, Vitis
Introduction
Most of the known grapevine wine varieties have been vegetatively
propagated for several centuries. The reasons for the persistence of
traditional European grapevine (Vitis vinifera L.) cultivars for wine
production are many with both plant and human factors involved
[1]. All V. vinifera cultivars are highly heterozygous and do not
breed true from seed. The combination of genes in a heterozygous
genome responsible for wine quality is conserved by vegetative
propagation. Thus, classical breeding programs, particularly those
177
178
Laurent Torregrosa et al.
that have attempted to improve disease resistance and maintain wine

quality, have had limited success in the past. Consumer pressure for
the same cultivars and the species lack of amenability to classical
breeding has focused research attention on producing improved
transgenic plants of established cultivars as the approach causes
minimum disturbance to the original heterozygous genome [2].
Moreover, the ability to produce transgenic plants is also an invaluable tool for understanding gene function and biological processes
in grapevine [3]. A reliable transformation system is required for a
successful transgenic approach to grapevine improvement especially for disease and stress resistance or tolerance [4]. There are
several prerequisites for achieving an efficient Agrobacteriummediated transformation system.
First, the production of highly regenerative transformable tissue is critical. Since the first report of successful grapevine
transformation [5], the methods for the production of transgenic
grape plants have been based on the use of embryogenic cultures
[6]. Previously, the lack of success in combining Agrobacteriummediated transformation with direct shoot organogenesis from leaf
explants was explained by the fact that the cells competent for
regeneration were not competent for transformation [7]. However,
recent work indicates that techniques based on regeneration by
organogenesis can be efficient [8]. The explant source, type, and
quality of embryogenic cultures are a key factor in successful transformation, and improved conditions for initiation and maintenance
of cultures suitable for genetic transformation have been defined
[9]. Second, it is important to optimize cocultivation conditions
for both Agrobacterium strains and grapevine tissue. The infection
of cells with any given Agrobacterium strain and successful T-DNA
integration is affected by several factors, such as strain, bacterial
culture conditions, bacterial density, cocultivation time, and media
used. Finally, one needs an efficient selection regime for transgenic
plant regeneration. The use of the selectable marker gene nptII
that induces resistance to kanamycin has been widely reported in
transformation experiments in Vitis. As an alternative to the nptII
gene, the hpt gene has also been used efficiently with hygromycin
as the selective agent [1013]. The bar (pat) gene encoding phosphinothricin acetyltransferase (PAT) has also been used with the
herbicide Basta as the selective agent [11], but its efficiency is
debated [14, 15]. In addition initial attempts to use the phosphomannose isomerase (pmi) gene as an alternate selectable marker
have been reported as disappointing [14, 16].
The transformation procedure described below uses embryogenic
cultures obtained from immature anthers. This tissue type is widely
used to induce somatic embryogenesis in grapevine [11, 17, 18].
Transformation can also be used with embryogenic cultures
obtained from other tissues such as ovaries, nucelli, embryos,
hypocotyls, or young leaves from in vitro plantlets. Maintenance of
embryogenic cultures in a state suitable for transformation appears
179
dependent on the interaction of genotype and culture medium and

in many cases represents a greater challenge than the initiation step
[2]. Most importantly, two distinct types of embryogenic cultures
are usually obtained on semisolid media: a culture designated type
I which consists mostly of small globular embryos and undifferentiated calli and a type II culture which often develops from type I
calli and consists entirely of somatic embryos at various stages of
development from heart shape to torpedo stage, which proliferate
by secondary embryogenesis [12].
When the response of different culture types to Agrobacterium
tumefaciens transformation was examined, it was found that culture
type did not have a major effect on initial rates of transformation.
This can be determined by the level of green fluorescent protein
(GFP) in cell clusters after cocultivation (Fig. 1c) and measured by
Fig. 1 Successive stages of the plant transformation procedure in grapevine. (a) Inflorescence with immature
flower buds produced on cutting and ready for anther culture (bar = 5 mm). (b) Embryogenic calli grown on
GS1CA prior to cocultivation (bar = 1 mm). (c) Bright clusters of gfp-expressing cells observed 5 weeks after
cocultivation (bar = 50 m). (d) Clusters of kanamycin-resistant embryogenic cells visually selected among
dead tissue 2 months after cocultivation (bar = 1 mm). (e) Germination of a kanamycin-resistant embryo on
MG1 medium (bar = 5 mm). (f) Well-developed embryo before trimming of cotyledons and roots (bar = 5 mm).
(g) Growth and axillary branching of the embryo apical meristem on BFe2 medium with 50 g/mL kanamycin
(bar = 5 mm). (h) Rooted transformed plantlets on micropropagation medium. Both plants from the left are
transformed by VlmybA1-2 gene that activates anthocyanidin pigmentation in all vegetative organs, both
plants from the right being untransformed controls
180
the number of positive units recorded per plate [19]. However,

different culture types have a significant effect on the recovery of
transgenic plants, with more plants recovered from type I cultures
[12]. The reasons for the difference in recovery rate are complex.
In V. vinifera, the data for optimal transformation and selection
conditions are conflicting as they may not only result from differences in genotypes and selection strategies, but also from the
embryogenic state of the cultures at the time of transformation.
The number of transgenic plants that can be recovered from an
experiment is important when evaluating transgene expression.
Aberrant expression patterns of a transgene under the control of a
constitutive promoter such as CAMV35S can reach a frequency of
35 % in transgenic plants evaluated [18] and need to be taken into
account when seeking to introduce a trait which has commercial
potential or for gene function analysis.
With the procedure described below, the number of embryos
growing and rooting on germination medium under kanamycin
selection and showing uidA or gfp expression is variable, depending
on the cultivar and the A. tumefaciens strain. From 1 g of cocultivated embryogenic calli, it may range from 10 to 100 or more
embryos. A bottleneck in the transformation procedure still remains
at the stage of shoot and plantlet development. The percentage of
transgenic plantlets regenerated from transgenic embryos using this
procedure ranges from 10 to 33 %, depending on the cultivar.
Among these transgenic plants, those regenerated from independent
transformation events, as determined by Southern blot analysis,
range from 77 to 100 %. The final transformation efficiency obtained
with the procedure described below can range from 1 to 33 or
more independent transgenic lines obtained from 1 g of embryogenic calli. For wine grape cultivars, some of them such as
Chardonnay are easy to transform [18]. Others such as Pinot Noir
are more recalcitrant despite it being a parent of Chardonnay [20].
More recently, this protocol has been successfully applied to the
microvine model using hygromycin for selection of transformed
plantlets suitable for rapid forward and reverse genetic studies in
small controlled environments due to the plants small stature and
rapid flowering phenotypes [13].
An alternative to stable grapevine transformation for gene
function analysis is the production of transformed hairy root cultures by co-transformation with A. tumefaciens and A. rhizogenes.
Transgenic hairy roots are quicker and easier to regenerate from
stems and petioles than transgenic plantlets from embryogenic callus and therefore a more suitable system when the regeneration of
transgenic plants or a reproductive organ evaluation is not
necessary.
Hairy roots are obtained by the inoculation of in vitro plantlets
with non-disarmed A. rhizogenes strains. The oncogenes are located
on the pRI plasmid inducing the formation of adventitious root,
181
which can be propagated in axenic cultures [21]. To avoid the

tedious construction of co-integrated vectors, a system based on the
co-inoculation with A. rhizogenes and A. tumefaciens was proposed
[21]. Recombinant binary plasmids can also be introduced into
wild-type A. rhizogenes strains where pRi virulence genes act in
trans with T-DNA binary plasmid. A large number of genotypes of
Vitis vinifera cultivars were found suitable for hairy root induction,
with the cultivar Maccabeu being one of the most appropriate.
Microvines were also found suitable for hairy root experiments,
with some lines such as 04C023V0002 and 04C023V0007
obtained from the cross Picovine 00C001V008 Grenache, being
found the most suitable [13].
Thus, the use of A. rhizogenes as part of the grapevine root
transformation system provides an easy and efficient way to generate large amounts of transformed roots within a few weeks. This
approach has proved very useful for gene function studies with the
grapevine [22]. Furthermore, gene function studies involving the
grafting of transgenic hairy roots onto scions of choice is now a
possibility [21].
2
2.1
Materials
Plant Material
Somatic embryogenic cultures are initiated from immature anthers

from many grapevine cultivars including Sultana, Portan, Shiraz,
Chardonnay, Cabernet Sauvignon, Riesling, and Sauvignon Blanc.
2.2 Agrobacterium
Strains
The A. tumefaciens strain EHA101 [23] and its derivative EHA105

that contain a binary plasmid are used for transformation. They are
more efficient for grapevine transformation than the widely used
strain LBA4404 and other strains [19]. The A. rhizogenes strain A4
is very efficient for hairy root induction [24]. No antibiotic selection
is required because pRi from the strain is co-transformed with the
T-DNA from the binary vector [21, 25].
2.3 Culture Media

for A. tumefaciens
and A. rhizogenes
Media are sterilized by autoclaving for 30 min at 110 C.

1. Modified MG/L medium [26]: 5 g/L of mannitol, 1 g/L of
L-glutamate, 5 g/L of tryptone, 2.5 mL/L of Fe-ethylenediamine tetracetic acid (EDTA) stock solution, 5 g/L of NaCl,
150 mg/L of KH2PO4, 100 mg/L of MgSO4 7H2O, 2.5 g/L
yeast extract, 20 g/L of biotin, and antibiotics depending on
the bacterial strain and binary vector (100 g/mL kanamycin
and 25 g/mL rifampicin for EHA105/ pBINm-gfp5-ER).
Adjust to pH 7.0 with NaOH.
2. Induction medium for A. tumefaciens: ABB salts [27] (20 g/L
of NH4Cl, 12.3 g/L of MgSO4 7H2O, 3.0 g/L of KCl,
0.265 g/L of CaCl2 2H2O, 0.5 g/L of FeSO4 7H2O, 5 g/L
182
of biotin), 2 mM NaH2PO4 at pH 5.6, 40 mM 2-(N-morpholino)

ethanesulfonic acid (MES), 0.5 % glucose, and 100 M
acetosyringone.
2.4 Stock Solutions
and Other Supplies
All stock solutions were sterilized through a 0.2 m filter and

stored at 4 C unless otherwise stated.
1. Half-strength Murashige and Skoog (MS) macroelements
(10, [28]): 16.5 g/L of NH4NO3, 4.4 g/L of CaCl2 2H2O,
3.7 g/L of MgSO4 7H2O, 19.7 g/L of KNO3, and 1.7 g/L
of KH2PO4.
2. NN macroelements (10, [29]): 7.2 g/L of NH4NO3, 9.5 g/L
of KNO3, 4.4 g/L of CaCl2 2H2O, 3.7 g/ L of MgSO4 7H2O,
and 1.7 g/L of KH2PO4.
3. GNBC macroelements (10, [30]): 10 g/L of KNO3, 5 g/L
of Ca(NO3)2 4H2O, 1.6 g/L of NH4NO3, 1.25 g/L of
MgSO4 7H2O, and 1.25 g/L of KH2PO4.
4. MS microelements (1,000, [28]): 6.2 g/L of H3BO3,
22.3 g/L of MnSO4 4H2O, 8.6 g/L of ZnSO4 7H2O,
0.83 g/L of KI, 0.25 g/L of Na2MoO4 2H2O, 25 mg/L of
CuSO4 5H2O, and 25 mg/L of CoCl2 6H2O.
5. GNBC microelements (1,000, [30]): 460 mg/L of
MnSO4 4H2O, 250 mg/L of KI, 58 mg/L of ZnSO4 7H2O,
25 mg/L of H3BO3, 25 mg/L of CuSO4 5H2O, 25 mg/L of
NiCl2 6H2O, 25 mg/L of CoCl2 6H2O, and 25 mg/L of
Na2MoO4 2H2O.
6. LG0 macroelements [21]: 1.5 g/L KNO3, 150 mg/L (NH4)
SO4, 150 mg/L CaCl2 2H2O, 250 mg/L MgSO4 7H20,
250 mg/L NaH2PO4 2H2O.
7. MS/2 macroelements [21]: 950 mg/L KNO3, 825 mg/L
NH4NO3, 220 mg/L CaCl2 2H2O, 185 mg/L MgSO4 7H2O,
85 mg/L KH2PO4.
8. Fe-EDTA (200, [28]): Dissolve 7.44 g of Na2EDTA 2H2O
in 900 mL of nanopure water. Heat the solution to almost
boiling point and gradually add 1.86 g of FeSO4 7H2O. Make
up to 1 L with nanopure water.
9. Ferric citrate (200, [30]): Dissolve 4 g ammonium ferric
citrate in 1,000 mL nanopure water.
10. Vitamins T (1,000, [31]): 50 g/L of mesoinositol, 1 g/L of
nicotinic acid, 1 g/L of thiamine HCl, 1 g/L of pyridoxine
HCl, 1 g/L of calcium pantothenate, and 0.01 g/L of
biotin.
11. Vitamins B5 (1,000, [32]): 100 g/L of mesoinositol, 10 g/L
of thiamine HCl, 10 g/L of nicotinic acid, 1 g/L of pyridoxine
HCl.
183
12. Amino acid mix (1,000, [17]): 100 g/L of glutamine, 10 g/L
of phenylalanine, and 2 g/L of glycine.
13. 2,4-Dichlorophenoxyacetic acid (2,4-D, 1 mM): Dissolve
44.2 mg in 1 mL 10 N NaOH. Add nanopure water and heat
until completely dissolved. Make up the volume to 200 mL in
nanopure water.
14. 6-Benzylaminopurine (BAP, 1 mM): Dissolve 45.04 mg in
1 mL of 10 N NaOH. Add nanopure water to make a volume
of 200 mL.
15. Thidiazuron (TDZ, 500 M): Dissolve 22 mg in 1 mL
Dimethyl sulfoxide (DMSO). Add nanopure water to make a
volume of 200 mL.
16. 3-Naphthoxyacetic acid (NOA, 1 mM): Dissolve 40.44 mg in
1 mL 10 N NaOH. Add nanopure water to make a volume of
200 mL.
17. Indole-3-acetic acid (IAA, 1 mM): Dissolve 35.0 mg in 1 mL
10 N NaOH. Add nanopure water to make a volume of
200 mL.
18. -Naphthaleneacetic acid (NAA, 1 mM): Dissolve 37.2 mg in
1 mL 10 N NaOH. Add nanopure water to make a volume of
200 mL.
19. Timentin (Smith-Kline Beecham, Boronia, Australia).
20. Augmentin: Dissolve in nanopure water at a concentration of
250 mg/mL. Store as aliquots at 20 C.
21. Claforan or cefotaxime stock solution: Dissolve in nanopure
water at a concentration of 250 mg/mL. Store as aliquots at
20 C.
22. Kanamycin monosulfate: Dissolve in nanopure water at a concentration of 100 mg/mL. Store as aliquots at 20 C.
23. Hygromycin B: Dissolve in nanopure water at a concentration
of 25 mg/mL.
24. Rifampicin: Dissolve in dimethyl sulfoxide (DMSO) at a concentration of 25 mg/mL. Store as aliquots at 20 C.
25. Acetosyringone: Dissolve in absolute ethanol at a concentration
of 100 mM. Store as aliquots at 20 C.
2.5 Plant Material
and Tissue Culture
All the media are sterilized by autoclaving for 30 min at 110 C.

1. Culture medium for initiation of embryogenic calli from
anthers depending on genotype. For PIV medium [12]: NN
macroelements, MS microelements, Fe-EDTA, vitamins B5,
4.5 M 2,4-dichlorophenoxyacetic acid (2,4-D), 8.9 M BAP,
60 g/L sucrose, and 3 g/L Phytagel (Sigma) as the gelling
agent; adjust pH to 5.7 with 1 M KOH. For Harst medium [18]:
NN macroelements, MS microelements, Fe-EDTA, vitamins
184
B5, 10 M 2,4-dichlorophenoxyacetic acid (2,4-D), 5 M

TDZ, 30 g/L sucrose, and 3 g/L Phytagel as the gelling
agent; adjust pH to 5.7 with 1 M KOH.
2. Culture medium for maintenance of embryogenic calli from
anthers (C1P, [17]): Half-strength MS macroelements, MS
microelements, Fe-EDTA, vitamins T, amino acid mix with
1 g/L casein hydrolysate, 5 M 2,4-D, 1 M BAP; 30 g/L
sucrose; and 5 g/L Phytagel; adjust pH to 6.0 with 1 M
KOH (see Note 1).
3. Culture medium to stimulate the formation of somatic embryos
(GS1CA, [12]): NN macroelements, MS microelements,
Fe-EDTA, vitamins B5, 10 M NOA, 20 M IAA (can be left
out), 1 M BAP, 60 g/L sucrose, 2.5 g/L activated charcoal,
and 10 g/L Bacto Agar; adjust pH to 5.7 with 1 M KOH.
4. Liquid cocultivation medium (LCM): GS1CA medium without growth hormones, Bacto Agar, and activated charcoal with
or without 100 M acetosyringone.
5. Cocultivation medium for A. tumefaciens (CM): GS1CA
medium added with 100 M acetosyringone.
6. Culture medium for the germination of embryos (MG1, [18]:
NN macroelements, MS microelements, Fe-EDTA, vitamins
B5, 30 g/L sucrose, and 7 g/L Bacto Agar and 2.5 g/L activated charcoal.
7. Culture medium to stimulate the further development and
greening of embryos (MG2): MG1 with 2 M, 5 M BAP [18]
or 10 M BAP (depending on genotype).
8. Medium to stimulate the axillary branching from caulinar meristems of germinating embryos (BFe2, [33]: Half-strength MS
macroelements, MS microelements, Fe-EDTA increased twofold, vitamins T, 4.4 M or 5 M BAP, 20 g/L sucrose, and
7 g/L agar; adjust pH to 6.0 with 1 M KOH.
9. Medium to induce and stimulate the rooting of shoots (RIM):
Half-strength MS macroelements, MS microelements,
Fe-EDTA, vitamins T, 5 M IAA or 0.5 M NAA [18], 30 g/L
sucrose, and 7 g/L Bacto Agar; adjust pH to 6.0 with 1 M
KOH.
10. Medium to micropropagate grapevines by nodal bud culture
(GNBC): Macroelements and microelements [30], ferric
citrate, vitamins T, 15 g/L sucrose, and 7 g/L Bacto Agar;
adjust to pH 6.5.
11. Medium for grafting (MS/2, [21]): MS/2 macroelements,
MS microelements, 25 g/L sucrose, 5 g/L Difco Agar.
12. Liquid inoculation medium for A. rhizogenes: MS/2 liquid
medium with 100 M acetosyringone.
185
13. Culture medium to isolate and maintain hairy roots (LG0,

[21]): LG0 macroelements, MS microelements, Fe-EDTA,
0.25 g/L casein, 500 mg/L sucrose, vitamins, 5 g/L Phytagel,
250 mg/L Augmentin, 250 mg/L cefotaxime, pH adjusted to
6 with 1 N KOH.
2.6 Other Reagents,
Solutions,
and Supplies
1. Flower and stem surface disinfectant: 7 % (w/v) calcium hypochlorite filtered solution, corresponding to 5 % active chlorine, and containing 0.1 % (v/v) Tween 20 as wetting agent
(see Note 2).
2. 70 % (v/v) ethanol.
3. Soil mixture for the growth of transgenic plants: Peat moss,
compost, and sand with a ratio of 1:1:1 (v/v/v).
4. Millipore 100 m nylon net filter (St. Quentin-Yveline,
France).
5. Corning 50 mL centrifuge tube (Corning Incorporated, NY).
6. Whatman No. 1 filter paper (Whatman, Springfield Milland, UK).
7. Magenta GA7-3 vessels (Life Technologies).
8. Parafilm M.
9. Tween 20.
10. 55 and 90 mm Petri dishes.
11. Stone wool substrate (4 cm diameter) (http://www.cultilene.nl).
Methods
3.1 Plant
Transformation
3.1.1 Initiation
and Maintenance
of Embryogenic Cultures
1. Hardwood cuttings from certified virus-free mother vines are

stored at 4 C until required. Plant cuttings are placed in pots
containing perlite in a controlled environment chamber
(25 C, 16 h photoperiod with 50 E/m2/s) or greenhouse.
2. Immediately after bud burst, gently remove the basal leaves of
the primary shoots with small forceps to promote the retention
and growth of the inflorescences [34]. Collect these inflorescences when they bear small (23 mm) unpollinated flower
buds (Fig. 1a, see Note 3).
3. Store the inflorescences in Petri dishes with moist cotton wool
for 3 days at 4 C in the dark (see Note 4).
4. Immerse flower buds for 30 s in 70 % ethanol and further for
10 min in surface disinfectant. Rinse three times with sterile
distilled water.
5. Dissect the flower buds under a stereo microscope in a laminar
flow hood. Separate the calyptra from the peduncle with sharp
glass rods or forceps and needles. Gently remove the anthers
with their filaments (see Note 5).
186
6. Place about 30 anthers (six flower buds) in 55 mm Petri dish

containing PIV or Harst media, taking care to put the anther
with the filament in contact with the medium (see Note 6).
Incubate at 28 C in the dark for 4 weeks.
7. Transfer yellow-white emerging calli to fresh C1P medium.
Subculture every 4 weeks selecting visually for friable, off-white
calli containing proembryogenic clusters.
8. One month before the transformation experiment, transfer the
proembryogenic calli to GS1CA medium (Fig. 1b).
3.1.2 Agrobacterium
Culture Preparation
1. Incubate a single colony of Agrobacterium containing a binary

vector with a plant selectable marker gene for kanamycin resistance overnight at 28 C with shaking in 50 mL of modified
MG/L medium with rifampicin 25 g/mL and kanamycin
100 g/mL, or other appropriate antibiotics according to the
plasmid properties.
2. Centrifuge the culture at 2,600 g for 5 min, resuspend the
pellet in 100 mL induction medium, and incubate for a further
2 h, with shaking at 100 rpm.
3. Centrifuge the culture as above and resuspend the pellet in
LCM medium and adjust the concentration of the bacterial
suspension to an OD550 of 0.4 (approximately 106 cfu/mL).
3.1.3 Cocultivation
of Embryogenic Callus
with Agrobacterium
1. Add 20 mL of the bacterial suspension to each gram of embryogenic calli in a 50 mL Corning centrifuge tube and then shake
vigorously for 12 s.
2. After a 10-min incubation at 25 C, separate the calli with
gentle shaking from the liquid phase with a 100 m 3 M nylon
net filter.
3. Briefly blot on sterile Whatman filter paper and transfer onto a
90 mm Petri dish containing CM medium (see Note 7). Seal
the Petri dishes with Parafilm to prevent the culture from
drying out and incubate in the dark at 22 C for 48 h.
4. After cocultivation, wash the embryogenic calli in a 50 mL
Corning tube with 20 mL LCM medium plus 1,000 g/mL
Timentin.
5. Retrieve the calli with a 100 m nylon net and blot briefly on
filter paper. Gently fragment the calli with forceps and distribute evenly onto 55 mm Petri dishes containing GS1CA
medium with 1,000 g/mL Timentin. Incubate cultures in
the dark at 28 C for 2 weeks (see Note 8).
3.1.4 Selection
of Transgenic Embryos
and Regeneration
1. Transfer calli onto 55 mm Petri dishes containing GS1CA

medium with 1,000 g/mL Timentin and 100 g/mL kanamycin (see Note 9). Transformation efficiency can be evaluated by
examining the callus for GFP reporter gene expression (Fig. 1c).
187
2. Subculture the calli onto fresh selective medium every 4 weeks

and gradually increase the kanamycin concentration to 150 g/
mL (see Note 10). Take care to remove dead tissue from the
live clusters of kanamycin-resistant embryogenic cells while
subculturing (Fig. 1d).
3. After 30 days post inoculation, spread the calli thinly onto
90 mm plates containing MG1 medium plus 150 g/mL kanamycin and 1,000 g/mL Timentin. Incubate plates at 28 C in
the dark.
4. Transfer torpedo stage rooting embryos (Fig. 1e) to MG2
medium and incubate under light (4560 E/m2/s) for further root and shoot development.
5. Remove any roots from embryos to encourage the caulogenesis
after 4 weeks. Laterally excise cotyledons 35 mm from their
base and the shoot apical meristem. Place this trimmed embryo
onto BFe2 medium plus 50 g/mL kanamycin to stimulate
growth of the shoot from the shoot meristem. Incubate at
25 C under attenuated light (approximately 15 E/m2/s)
(Fig. 1f).
6. Subculture emerging shoots 23 times on the same medium
and the same conditions to encourage axillary branching of the
caulinar meristem (Fig. 1g).
7. Regenerate whole plants by transferring shoots onto root
induction medium (RIM) in Magenta GA7-3 vessels.
8. Select against chimeric plantlets by transferring nodal bud micro
cuttings of putative transformants onto GNBC medium with
50 g/mL kanamycin (Fig. 1h). Generally, two subcultures are
enough to discard any chimeric plantlets.
9. Test for the presence of the transgene by polymerase chain
reaction (PCR) in well-rooted kanamycin-resistant plantlets.
10. Subculture transgenic plantlets onto GNBC medium without
kanamycin for in vitro conservation (5 plants/line) and
acclimatization.
3.1.5 Transplanting
and Greenhouse Care
1. Transfer the resulting healthy well-rooted plantlets into individual, water-saturated 4 cm diameter stone wool blocks. Place
the blocks in a plastic box containing few mm of water at the
bottom. Cover the boxes with plastic film and maintain under
in vitro culture conditions.
2. During this period, maintain water saturation of the blocks
irrigating with MS/2 liquid medium without sugar until and
progressively open plastic film.
3. After 24 weeks, when the roots arise from the blocks, transfer
the block and the plant in 10 cm diameter plastic containing
compost and incubate in same culture conditions for 2 or 3
188
weeks (irrigating with the same solution as mentioned above).

Transfer to the greenhouse and progressively open to acclimatize the plants to low hygrometric conditions. Transfer to stone
wool substrate (see Note 11).
4. Transfer the pots to the greenhouse and progressively for further acclimatization. The average rate for successful transplanting and acclimatization depends on the variety but is generally
higher than 90 %.
5. When the transgenic plants are successfully transplanted and
well growing in the greenhouse, confirm the integration of the
gene of interest in the plant genome by Southern blot analysis
and its expression of the gene RT-qPCR or other assays.
3.2 Hairy Root
Transformation
3.2.1 Production
of In Vitro Plantlets for
A. rhizogenes Inoculation
1. Young stem sections (1050 cm from the tip) are taken from
actively growing plants from the greenhouse or the field.
Leaves and tendrils are sectioned 1 cm from their base and
maintained in a cold room (24 C) until use.
2. Stem explants are sectioned into short fragments composed of
a node with 1 cm of internode above and 5 cm below and
immediately sterilized by immersion for 15 min into a solution
of filtered 70 g/L calcium hypochlorite with a few drops of
Tween 20 (see Note 12).
3. Explants are rinsed three times with sterile distilled water and
trimmed with a scalpel (5 mm) to remove injured tissues
(see Note 13). The cuttings are then inserted in 200 mm long
culture tubes containing 20 mL of MS/2 solid medium and
transferred under lower light (approximately 45 E/m2/s).
4. After 58 weeks, shoots arising from axillary buds are extracted
and cut into single-node micro cuttings and propagated on the
same medium.
5. When plantlets are 810 cm high (approx. 3 months time),
the stem is sectioned at 1 cm above a node and the two last
leaves removed by sectioning 23 mm from blade in order to
let 0.51 cm of petiole attached to the stem (see Note 14).
A typical experiment being is based on 12 vitro plantlets (36
inoculation ends).
3.2.2 Agrobacterium
Culture Preparation
and Inoculation
1. Two or three days prior to the start of the experiment, prepare

a streak plate of A. rhizogenes onto modified MG/L medium
with rifampicin 25 g/mL and binary vector-specific bacterial
selection antibiotic.
2. In a 50 mL Corning tube containing 10 mL of MS/2 liquid
medium, suspend some bacteria cream and shake vigorously
for few seconds to homogenize the solution. Then adjust the
concentration of the bacterial suspension to an OD550 of 0.3
(106 cfu/mL).
189
3. Immerge forceps in the inoculation solution to keep 510 m

of bacteria solution between the ends of the forceps and then
gently crush the stem and petiole stubs.
4. Close culture tube and seal the cap with Parafilm M. Incubate
inoculated in vitro plantlets in the same environment as for
micropropagation.
3.2.3 Calli and Hairy
Root Recovery
1. After 2 weeks, check cultures to ensure that calli are growing

from inoculation points. When the calli reach 5 mm in size
(Fig. 2a), subculture by sectioning 13 mm below and transfer
it onto 90 mm Petri dishes containing LG0 medium with
200 g/mL Timentin (or Augmentin) and 200 g/mL
Claforan (or Cefotaxime) (see Note 15). Incubate at 25 C
under attenuated light (approximately 15 E/m2/s).
2. Subculture the calli onto fresh medium every 34 weeks.
Generally two subcultures are enough to recover all the hairy
root single events from an experiment. Subculture when roots
are 0.5 cm long onto the same medium (Fig. 2e, see Note 16).
3. Approximately 550 hairy roots are recovered from 12 to 36
calli that are obtained from 12 in vitro plantlets for each experiment. Isolated hairy roots grow quite easily and can be subcultured each 46 weeks on LG0 medium (Fig. 2f, see Note 17).
Transgene presence is confirmed by PCR of established hairy
root cultures. The rate for successful insertion of the gene of
interest varies with the experiment from 4 % [21] to 70 % [25].
4. Select 35 cm long single roots without hyperhydricity for
grafting. Refresh basal end and do a 1 cm long cleft section.
Explant a 1 cm long shoot tip from an actively growing in vitro
plantlet, quickly remove all leaves, and section the base diagonally. Rapidly, insert the scion into the rootstock cleft section,
and insert the grafted plant into MS/2 solid medium in a way
that the medium surface is at the graft level. Seal culture tube
or Magenta box and cultivate in the same conditions as micropropagation (Fig. 2g, see Note 18).
Notes
1. The medium used to induce and maintain embryogenic calli
cultures initiated from anthers can be successfully applied to
induce and maintain embryogenic calli from leaf explants [31].
2. Sodium hypochlorite solution with the same percentage of active
chlorine can be used in place of calcium hypochlorite. Solutions
can be stored overnight but for a maximum of 2 days.
3. This technique can be applied throughout the year with greenhouse material. Alternatively, inflorescences can be collected in
the vineyard at about 1214 days before anthesis.
190
Fig. 2 Successive stages of the root transformation procedure in grapevine. (a) Formation of calli from stem
and petiole stub 2 weeks after inoculation, ready to be explanted (bar = 5 mm). (b) Induction of non-transformed
adventitious roots below the point of inoculation (right). Plant on left has most roots only from callus at site of
inoculation (bar = 5 mm). (c) Browning of the callus 3 weeks after inoculation (bar = 2 mm). (d) Hairy roots (big
roots) arising from the callus 1 week after callus extraction (red hairy roots expressing the transgene
VlmybA1-2, white hairy roots only transformed by pRi oncogenes) (bar = 5 mm). (e) Hairy roots growing on LG0
medium with 200 g/mL Claforan and Augmentin, 2 weeks after extraction (bar = 10 mm). (f) Well-developed
hairy roots culture ready for a second round of propagation (bar = 10 mm). (g) Chimeric grapevine plant associating a non-transformed scion grafted on a root system deriving from a hairy root (bar = 10 mm)
4. Chilling the inflorescences was found to improve the formation

of embryogenic calli, but the efficiency depends greatly on the
genotype of the cultivar.
5. Embryogenic calli develop from anther filament tissue that is
attached to the anther and will also develop from the filament
191
scar on the anther if the filament is removed, and this region of

the anther is placed in contact with the medium. The developmental stage of the anther has a major effect on embryogenic
response. Generally, the higher level of somatic embryogenesis
occurs when the anther is at the tetrad or the uninucleate
pollen stage, which corresponds to an opalescent color of the
anther. Anthers that are translucent or have become yellow
should not be used as they are less likely to produce embryogenic calli.
6. Most varieties will initiate embryogenic callus on PIV; however,
some like Chardonnay will respond better to Harst medium by
producing more proliferating embryogenic calli after subculture [18].
7. It can be useful to put a disk of Whatman filter paper on CM
medium during cocultivation to avoid overgrowth of the
bacteria, particularly with the super virulent EHA105 strain.
8. The use of an appropriate antibiotic, which can kill or suppress
the growth of Agrobacterium, is very important. Other antibiotics, such as cefotaxime at concentrations varying from 200 to
500 g/mL [8, 10, 35] or carbenicillin at 500 g/mL [14, 36,
37], can be used to kill the bacteria after cocultivation. The
optimum dose not only varies with the bacterial strain but also
with the cultivar and should be such that it inhibits
Agrobacterium growth but allows for the normal regeneration
of putative transgenic tissue.
9. Paromomycin sulfate (Sigma) can also be used as a selective agent
with the nptII gene, at an initial concentration of 5 g/mL,
after cocultivation, and then increased gradually to 30 g/mL
[11, 38]. If the hpt gene is used as the selectable marker, then
hygromycin B can be used after cocultivation at a concentration of 7.5, 15, or 25 g/mL depending on genotype. Frequent
subculturing to selective medium is an important step to maintain an optimum concentration of fresh antibiotic and the
removal of compounds excreted by the dead cells.
10. This step represents an effective screen for identifying transgenic
plantlets prior to potting out. An MS-based medium or any other
medium without growth hormones is suitable for the micropropagation of grapevine by nodal bud culture. The GNBC
medium is currently used in France to maintain in vitro cultures
of several hundreds of cultivars, species, and hybrids in a germplasm repository [39]. This demonstrates its versatility across a
large range of grapevine genotypes.
11. A limited amount of information is available on the biological
behavior of grapevine plantlets that are extremely sensitive to
environmental stress during acclimatization [40]. Acclimatization
methods can vary from laboratory to laboratory.
192
12. The penetration of calcium hypochlorite depends on the age

of stem organs. To prevent further tissue necrosis, it is recommended to either eliminate the major part of the petiole and
tendril or to section stem and petiole ends, 23 mm beyond
necrosis.
13. Both stems and petioles are suitable explants for hairy root
induction providing three areas for inoculation. It is important
to keep a distance of 0.5 cm between the last node or petiole
insertion and inoculation point to facilitate further isolation of
the calli formed by A. rhizogenes.
14. For most V. vinifera cultivars, young plantlets (less than 2 months
old) are not suitable for A. rhizogenes transformation. It is better
to use 3-month-old plantlets or older (up to 5 months old if the
medium is not too dry).
15. Callus growth depends on the cultivar, bacterial strain, and
associated binary plasmid. In general, after 2 weeks, the callus
reaches to appropriate stage for extraction, but in some cases, it
can take up to 4 weeks. As soon as the callus is big enough,
subculture and transfer onto antibiotic containing LG0 medium
to avoid further necrosis (Fig. 2c). To stop bacteria development, callus needs to be inserted in the medium up to half of
their volume.
16. Roots emerging directly from the petiole and the stem (Fig. 2b)
are not transformed as there result from the diffusion of plant
growth regulators. The critical phenotypes to select hairy root
are the diameter and the growing rate of the roots. As soon as
there emerge from the callus, hairy roots are big (23 mm
diameter, Fig. 2d), while non-transformed roots are generally
thin (less than 1.5 mm diameter). Also, non-transformed roots
show a higher diameter decrease from the base to the tip than
hairy roots.
17. Cases of tissue chimerism were rarely observed in hairy roots but
it is recommended to subculture twice to ensure complete transformation of tissue. It is also recommended to check the presence of transgene after two subcultures. Antibiotic can also be
omitted from LG0 medium at this stage, but it is recommended
to maintain the same level to avoid bacterial contamination.
18. One to two months after grafting, plants can be acclimatized
through standard methods. However, because hairy root systems
are not strong enough to support big scions, grafted plants must
be attached carefully.
References
1. Mullins MG, Bouquet A, Williams LE (1992)
Biology of grapevine. Cambridge University
Press, Cambridge
2. Kikkert JR, Thomas MR, Reisch BI (2001)

Grapevine genetic engineering. In: RoubelakisAngelakis KA (ed) Molecular biology and
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
biotechnology of the grapevine. Kluwer,

Dordrecht, pp 393410
Bouquet A, Chatelet P, Torregrosa L (2003)
Grapevine genetic engineering: tool for
genome analysis or plant breeding method?
Which
future
for
transgenic
vines?
AgBiotechNet 5 ABN 116:110
Colova-Tsolova V, Perl A, Krastanova S,
Tsvetkov I, Atanassov A (2001) Genetically
engineered grape for disease and stress tolerance. In: Roubelakis-Angelakis KA (ed)
Molecular biology and biotechnology of the
grapevine. Kluwer, Dordrecht, pp 411432
Mullins MG, Tang FCA, Facciotti D (1990)
Agrobacterium-mediated genetic transformation of grapevines. Transgenic plants of Vitis
rupestris Scheele and buds of Vitis vinifera
L. Nat Biotechnol 8:10411045
Perl A, Colova-Tsolova V, Eshdat Y (2004)
grape embryogenic calli. In: Curtis IS (ed)
Transgenic crops of the world. Kluwer,
Dordrecht, pp 114
Colby SM, Juncosa AM, Meredith CP (1991)
Cellular differences in Agrobacterium susceptibility and regenerative capacity restrict the
development of transgenic grapevines. J Am
Soc Hort Sci 116:356361
Mezzetti B, Pandolfini T, Navacchi O, Landi L
(2002) Genetic transformation of Vitis vinifera
via organogenesis. BMC Biotechnol 2:1828
Martinelli L, Gribaudo I (2001) Somatic
embryogenesis in grapevine. In: RoubelakisAngelakis KA (ed) Molecular biology and biotechnology of the grapevine. Kluwer,
Dordrecht, pp 327351
Le Gall O, Torregrosa L, Danglot Y, Candresse
T, Bouquet A (1994) Agrobacterium-mediated
genetic transformation of grapevine somatic
embryos and regeneration of transgenic plants
expressing the coat protein of grapevine
chrome mosaic nepovirus (GCMV). Plant Sci
102:161170
Perl A, Lotan O, Abu-Abied M, Holland D
(1996) Establishment of an Agrobacteriummediated transformation system for grape
(Vitis vinifera L.): the role of antioxidants
during grape-Agrobacterium interactions. Nat
Biotechnol 14:624628
Franks T, Gang He D, Thomas M (1998)
Regeneration of transgenic Vitis vinifera
L. Sultana plants: genotypic and phenotypic
analysis. Mol Breeding 4:321333
Chaib J, Torregrosa L, Mackenzie D, Corena
P, Bouquet A, Thomas MR (2010) The
microvine a model system for rapid forward
and reverse genetics of grapevines. Plant J
61:10831092
193
14. Reustle GM, Wallbraun M, Zwiebel M et al

(2002) Experience with different selectable
marker systems for the genetic engineering of
grapevine. Acta Hort 603:485490
15. Torregrosa L, Pros J-P, Lopez G, Bouquet A
(2000) Effect of hygromycin, kanamycin and
phosphinothricin on the embryogenic development and axillary micropropagation of Vitis
vinifera L. Acta Hort 528:401406
16. Kieffer F, Triouleyre C, Bertsch C, Farine S,
Leva Y, Walter B (2004) Mannose and xylose
cannot be used as selectable agents for Vitis
vinifera L. Vitis 43:3539
17. Torregrosa L (1998) A simple and efficient
method to obtain stable embryogenic cultures
from anthers of Vitis vinifera L. Vitis 37:9192
18. Iocco P, Franks T, Thomas MR (2001) Genetic
transformation of major wine grape cultivars of
Vitis vinifera L. Transgenic Res 10:105112
19. Torregrosa L, Iocco P, Thomas MR (2002)
Influence of Agrobacterium strain, culture
medium, and cultivar on the transformation
efficiency of Vitis vinifera L. Am J Enol Vitic
53:183190
20. Bowers J, Boursiquot J-M, This P, Chu K,
Johansson H, Meredith C (1999) Historical
genetics: the parentage of Chardonnay, Gamay
and other wine grapes of Northeastern France.
Science 285:15621565
21. Torregrosa
L,
Bouquet
A
(1997)
Agrobacterium tumefaciens and A. rhizogenes
co-transformation to obtain grapevine hairy
roots producing the coat protein of grapevine
chrome mosaic nepovirus. Plant Cell Tiss Org
Cult 49:5362
22. Vidal JR, Gomez C, Cutanda MC, Shrestha B,
Bouquet A, Thomas MR, Torregrosa L (2010)
Use of gene transfer technology for functional
studies in grapevine. Aust J Grape Wine Res
16:138151
23. Hood EE, Gelvin SB, Melchers LS, Hoekema
2:208218
24. Tepfer D (1984) Transformation of several
species of higher plants by Agrobacterium rhizogenes: sexual transmission of the transformed
genotype and phenotype. Cell 37:959967
25. Cutanda-Perez MC, Ageorges A, Gomez C,
Vialet S, Romieu C, Torregrosa L (2009)
Ectopic expression of the VlmybA1 in grapevine activates a narrow set of genes involved in
anthocyanin synthesis and transport. Plant Mol
Biol 69:633648
26. Garfinkel DJ, Nester EW (1980) Agrobacterium
mutants affected in crown gall tumorigenesis
and octopine catabolism. J Bacteriol 144:
732743
194
27. Chilton MD, Currier TC, Farrand SK, Bendish

AJ, Gordon MP, Nester EW (1974)
Agrobacterium tumefaciens DNA and PS8 bacteriophage DNA not detected in crown gall
tumors. Proc Natl Acad Sci U S A 71:
36723676
29. Nitsch J-P, Nitsch C (1969) Haploid plants
from pollen grains. Science 165:8587
30. Galzy R, Haffner V, Compan D (1990)
Influence of three factors on the growth and
nutrition of grapevine microcuttings. J Exp
Bot 41:295301
31. Torregrosa L, Torres-Vials M, Bouquet A
(1995) Somatic embryogenesis from leaves of
Vitis x Muscadinia hybrids. Vitis 34:239240
32. Gamborg OL, Miller RA, Ojima K (1968)
Nutrient requirements of suspension cultures
of soybean root cells. Exp Cell Res 50:
15151518
33. Torregrosa L, Bouquet A (1996) Adventitious
bud formation and shoot development from
in vitro leaves of Vitis x Muscadinia hybrids.
34. Mullins MG (1966) Test-plants for investigations
of physiology of fruiting in Vitis vinifera L.
Nature 209:419420
35. Martinelli L, Mandolino G (2001) Transgenic

grapes (Vitis species). In: Bajaj YPS (ed)
Biotechnology in agriculture and forestry,
vol 47, transgenic crops II. Springer, Berlin,
pp 325338
36. Legrand V, Dalmayrac S, Latch A et al (2003)
Constitutive expression of Vr-ERE gene in
transformed grapevines confers enhanced resistance to eutypine, a toxin from Eutypa lata.
37. Motoike SY, Skirvin RM, Norton MA,
Otterbacher AG (2002) Development of
methods to genetically transform American
grape (Vitis labruscana L.H. Bailey). J Hort
Sci Biotechnol 77:691696
38. Mauro M-C, Toutain S, Walter B et al (1995)
High efficiency regeneration of grapevine
plants transformed with the GFLV coat protein
gene. Plant Sci 112:97106
39. Bouquet
A,
Torregrosa
L
(2003)
Micropropagation of the grapevine. In: Jain
SM, Ishii K (eds) Micropropagation of woody
trees and fruits. Kluwer, Dordrecht,
pp 319352
40. Torregrosa L, Bouquet A, Goussard PG (2001)
In vitro culture and propagation of grapevine.
In: Roubelakis-Angelakis KA (ed) Molecular
biology and biotechnology of the grapevine.
Kluwer, Dordrecht, pp 281326
Chapter 16
Melon (Cucumis melo)
Abstract
Genetic transformation is an important technique used in plant breeding and to functionally characterize
genes of interest. The earliest reports of Agrobacterium-mediated transformation in the melon (Cucumis
melo) were from the early 1990s (Fang and Grumet, Plant Cell Rep, 9: 160164, 1990; Dong et al., Nat
Biotechnol 9: 858863, 1991; Valles and Lasa, Plant Cell Rep 13: 145148, 1994). These early studies
described three problems that decreased the efficiency of transformation: tetraploidy, chimeras, and escape.
Using a liquid culture system for somatic embryogenesis, Akasaka-Kenedy et al. (Plant Sci 166: 763769,
2004) overcame these problems and established an efficient transformation system; the protocol introduced in this chapter is based on this method.
Key words Agrobacterium-mediated transformation, Chimera, Escape, Liquid culture, Somatic
embryo, Tetraploidy
Introduction
In addition to being an important horticultural crop, the melon
(Cucumis melo L.) is also a useful experimental organism for understanding fruit ripening, as physiological and biochemical changes
in flavor development and texture occur during the ripening of the
fruit [1]. An understanding of the molecular mechanism underlying melon fruit ripening will require the isolation and functional
verification of genes contributing to this trait.
Transformation is a technique used to characterize the functions of genes of interest. In the last two decades, several types of
genetic transformation techniques have been developed in the
melon. Agrobacterium-mediated techniques reported in the early
1990s [24] identified three major problems affecting transformation in the melon: the induction of tetraploidy, chimeras, and
escape. Embryogenesis via cotyledon explants was later found to
reduce the occurrence of tetraploidy [5]. Embryogenesis is a useful
regeneration system because the embryos originate from a single
cell and the number of chimeric plants regenerated is therefore
195
196
reduced. Problems with escape appear to be caused by the inefficient selection of transformed cells. Because the whole explant is
exposed to antibiotics when suspended in liquid media but not
when cultured on solid media, the liquid culture system achieves a
more effective selection of transformed cells. Akasaka-Kenedy et al.
[6] demonstrated that the use of a liquid culture system for
Agrobacterium-mediated melon transformation reduced the occurrence of tetraploidy, chimeras, and escape. The protocol introduced in this chapter is based on the method of Akasaka-Kenedy
et al. [6]. One mature melon seed was chopped into 1220 segments for the preparation of explants for genetic transformation.
These explants were cultured in liquid embryo induction (EI)
medium containing MS salts, MS vitamins, 3 % sucrose, 2 mg/l
2,4-D, and 0.1 mg/l BA for 2 days. After this 2-day pre-culture
period, the segments were inoculated with Agrobacterium
tumefaciens containing the desired transgene and cocultured on
solid EI medium with 0.8 % agar for 4 days in the dark. To select
transformed calli and embryos, the inoculated segments were
transferred to liquid EI medium containing 25 mg/l kanamycin
and 375 mg/l Augmentin and subcultured every 2 weeks.
Antibiotic-resistant embryos appeared on the surface of the
explants 34 months after A. tumefaciens transfection. For regeneration and plant development, the embryos were cultured on
solid MS medium containing 50 mg/l kanamycin and 375 mg/l
Augmentin without plant growth regulators (PGRs) for 1 month.
The transgenic melon plants were acclimated and grown in a
greenhouse. Three transgenic lines were obtained from 130
explants that, in theory, could have been derived from 6.5 seeds.
Thus, the transformation efficiency of this method was 2.3 % per
explant and 46.1 % per seed.
Materials
2.1 Agrobacterium
tumefaciens Strain
and Vector
Agrobacterium tumefaciens GV2260 [7] carrying pIG121-Hm [8]

was used in this protocol. This binary vector contains the neomycin
phosphotransferase gene (nptII), beta-glucuronidase gene (GUS),
and hygromycin phosphotransferase gene (hpt) cassette in T-DNA
region. The expression of nptII gene is under control of Nos
promoter, and the terminator is Nos terminator. Kanamycin is
suitable for selection of transformed cells for melon transformation,
so in this protocol, nptII gene and kanamycin were used for
selection.
2.2
This protocol is optimized for Cucumis melo L. var cantalupensis

Vedrantais (Fig. 1). This cultivar was kindly provided by M. Pitrat
Inra, Avignon, France, and it has been bred to homozygosity in
laboratory and fields (see Note 1).
Plant Material
197
Fig. 1 Cucumis melo L. var. cantalupensis cv. Vedrantais
2.3
Stock Solutions
2.3.1 MS salt
1. Stock 1 (50): 82.5 g of NH4NO3, 95 g of KNO3, 8.5 g of

KH2PO4, 310 mg of H3BO3, 1,115 mg of MnSO4H2O, 430 mg
of ZnSO47H2O, 41.5 mg of KI, 12.5 mg of Na2MoO42H2O,
1.25 mg of CuSO45H2O, 1.25 mg of CoCl26H2O, per
1,000 ml of distilled water. Store this solution at 4 C.
2. Stock 2 (100): 44 g of CaCl2H2O per 1,000 ml of distilled
water. Store this solution at 4 C.
3. Stock 3 (100): 37 g of MgSO47H2O per 1,000 ml of
distilled water. Store this solution at 4 C.
4. Stock 4 (100): 2.78 g of FeSO47H2O and 3.73 g of Na2EDTA per 1,000 ml of distilled water. Store this solution
at 4 C.
2.3.2 Vitamins
and Phytohormones
1. MS Vitamin (200): Dissolve 10 g of myo-inositol, 50 mg of

nicotinic acid 50 mg of pyridoxine hydrochloride, 10 mg
of thiamine hydrochloride, and 200 mg of glycine in 900 ml of
distilled water and adjust the volume to 1,000 ml. Dispense
the solution to 5 ml and store it at 30 C.
2. 2,4-Dichlorophenozy acetic acid (2,4-D, 10 mg/ml): Dissolve
1 g of 2,4-D in 100 ml of dimethyl sulfoxide (DMSO).
Dispense the solution to 1 ml and store it at 30 C.
3. 6-Benzylaminopurine (BA, 1 mg/ml): Dissolve 0.1 g of BA in
100 ml of DMSO. Dispense the solution to 1 ml and store it
at 30 C.
2.3.3 Antibiotics
and Selective Agents
1. Kanamycin (50 mg/ml): Dissolve 2 g of kanamycin in 40 ml

of distilled water. And sterilize with a 0.22 m cellulose acetate
filter and store it at 30 C.
2. Augmentin: Dissolve 1 tablet of Augmentin (GlaxoSmithKline
K.K., Uxbridge, UK) in 5 ml of stilled water before using.
198
2.4
Culture Media
2.4.1 For Agrobacterium
1. LB medium (liquid): Dissolve 10 g of sodium chloride, 10 g of

Bacto-tryptone, 5 g of yeast extract in 800 ml of distilled water.
And adjust the volume to 1,000 ml with distilled water. The
adjusted medium was autoclaved at 121 C for 15 min. After
autoclaved, it is cooled less than 60 C and then antibiotics are
added in LB medium.
2. LB medium (solid): 20 g of Bacto Agar were added to LB liquid medium before autoclaved. After autoclave, the medium
was cooled at 60 C and then antibiotics are added.
2.4.2 For Melon
1. Embryo induction (EI) medium: 30 g of sucrose was dissolved

in 800 ml of distilled water, and add 20 ml of MS salt stock 1,
10 ml of MS salt stock 2, 10 ml of MS salt stock 3, 10 ml of
MS salt stock 4, 5 ml of MS vitamin, 200 l of 2,4-D (final
concentration was 2 mg/l), and 100 l of BA (final concentration was 0.1 mg/l) mixed well. After the sucrose was dissolved
completely, pH was adjusted to 5.8 by sodium hydroxide, and
then the volume was 1,000 ml total. The medium was autoclaved at 121 C for 15 min. After autoclave, the medium was
cooler than 60 C; kanamycin and augmentin were added as
necessary.
2. Cocultivation medium: 8 g of agar were added to EI medium
just before autoclave.
3. Germination medium: 30 g of sucrose was dissolved in 800 ml
of distilled water, and 20 ml of MS salt stock 1, 10 ml of MS
salt stock 2, 10 ml of MS salt stock 3, 10 ml of MS salt stock 4,
5 ml of MS vitamin, and 8 g of agar were added to EI medium
just before autoclave. The medium was autoclaved at 121 C
for 15 min. After autoclave, the medium was cooler than
60 C; kanamycin and augmentin were added as necessary.
Methods
The various steps of the protocol are summarized in Fig. 2 and
described in further detail below.
3.1 Growing Donor

Plants in Green House
1. Seeds were wrapped with moisten paper towel for 1 week for
germination.
2. Germinated seedlings were in soil in 10 cm pot with molding.
The seedlings were grown in the greenhouse. The photoperiod and light intensity are natural condition in Tsukuba, Japan
(36.0 N, 140.0 E). Lowest temperature is 15 C, and highest
temperature is 25 C (see Note 2).
3. After the three leaves appearance, transplant each plant into a
40 cm pot with molding (one plant per pot).
199
Fig. 2 Schematic of Agrobacterium-mediated transformation via somatic

embryogenesis. The time schedule is indicated on the left. EI: MS medium containing 3 % sucrose, 2 mg/l 2,4-D, and 0.1 mg/l BA. Km and Aug indicate kanamycin and Augmentin, respectively
4. One week after transplant, melons were bending brunch by

strings hanged by the beam of ceiling. Water was supplied,
when the soil is dry.
5. Under ten nodes, axillary buds were cut off. Top pinched after
24 nodes appearance.
6. One month after planting, flowering was started. The female
flowers were covered on the evening 1 day before flowering to
avoid closing another plant.
7. In early morning (before 8:00 am), the female flowers were
uncovered. Removing the petals on the flower, the flower was
closed with the male flower on the same plant. If a few melons
were fruited on one plant, remove all fruit leaving the best one.
8. About 50 days after pollination, melon fruits were harvested
and incubated on dark and cool place for 1 week. Then the
seeds were harvested.
9. Seeds were incubated at room temperature, for a week to dry
up completely. The seeds were stored at 4 C until using.
200
3.2
Plant Preparation
1. The seed coats were removed.

2. Seeds were sterilized with 70 % EtOH for 10 s and with 0.02 %
hypochlorite with 0.01 % Tween 20 for 15 min (Fig. 3a).
3. Seeds were rinsed three times in distilled water for 5 min.
4. The seeds were soaked in sterile distilled water for 6 h.
5. The sterilized seeds were cut in half lengthwise and sectioned
crosswised, producing explants approximately 14 mm2 in size
(Fig. 3b). Twelve to twenty explants were prepared from each
segment.
6. The segments were cultured for 2 days in 10 ml of liquid EI
medium with 100 ml volume of Erlenmeyer flask on a rotary
incubator shaker (100 rpm) at 25 C under a 16 h photoperiod
(50 mol/m2/s).
Fig. 3 Plant regeneration and transformation in the melon (C. melo L. var. cantalupensis cv. Vedrantais).
(a) Sterilized melon seeds without seed coats. (b) Sterilized seeds are cut into 14 mm2 pieces. (c) Calli formed
at the cut surfaces of explants after 3 weeks of culture (bar = 2 mm). (d) Embryos developed in liquid EI
medium after 4 weeks of culture (bar = 4 mm). (e) Regenerated plants exhibited severe vitrification in liquid MS
medium after 8 weeks of culture. (f) Healthy plantlets growing in 1.0 % agar-solidified MS medium after
8 weeks of culture (bar = 6 mm). (g) A regenerated plant obtained from a somatic embryo after 12 weeks of
culture. (h) Blue spots were observed at the cut surfaces of explants 4 days after infection. (i) Strong GUS
expression was observed on proliferated calli on the explants grown in liquid EI selection medium 6 weeks
after infection. (j) Stable GUS expression was observed throughout the embryo 9 weeks after infection (color
figure online)
3.3 Preparation
of Agrobacterium
Culture for Infection
201
1. A. tumefaciens was cultured on solid LB medium at 28 C for

2 days.
2. A single colony was selected and cultured in 2 ml of LB
medium at 28 C and 200 rpm for 2 days until the culture
reached the stationary phase.
3. A 15 l volume of this culture was added to 15 ml of fresh
LB medium; this mix was then cultured at 28 C and 200 rpm
for 20 h.
4. When the optical density of the culture reached 0.81.0, the
cells were centrifuged and the pelleted bacterial cells were
resuspended in 30 ml of liquid EI medium. The optical density
(OD600) was adjusted to 0.40.5.
3.4 AgrobacteriumMediated
Transformation
1. Melon explants pre-cultured for 2 days in liquid EI medium

were inoculated with A. tumefaciens as described above and
incubated for 20 min.
2. The inoculated explants were wiped with distilled filter paper
to remove excess bacterial suspension.
3. Inoculated segments were cultured on EI medium with 0.8 %
agar (Wako Pure Chemical Industries, Japan) for 4 days in the
dark at 25 C.
4. Melon explants inoculated with A. tumefaciens harboring
pIG121-Hm showed GUS staining, indicating successful
transformation (Fig. 3hj).
3.5 Selection
for Putative
Transgenic Embryos
and Calli
1. After cocultivation, the explants were cultured in 10 ml of liquid EI medium containing 25 mg/l kanamycin and 375 mg/l
Augmentin with 100 ml volume of Erlenmeyer flask on a
rotary incubator shaker (100 rpm) at 25 C under a 16 h photoperiod with light intensity of 50 mol/m2/s (see Note 3).
2. The explants were subcultured and washed in water every
2 weeks (see Note 4).
3. After 34 months of culture, somatic embryos and calli were
observed at the cut surfaces of the explants (Fig. 3c, d, i, and j).
3.6 Regeneration
1. To induce embryo germination and plant development, the

explants were transferred to 1.0 % agar-solidified germination
medium containing 50 mg/l kanamycin and 375 mg/l
Augmentin at 25 C under a 16 h photoperiod (50 mol/
m2/s) for 4 weeks (Fig. 3f and g) (see Note 5).
2. The transformation efficiency was approximately 2.3 %, with
three transgenic plants obtained from 130 explants that, in
theory, could have been derived from 6.5 seeds [6]. Escape
was very low with this protocol: only 16.7 % of the
kanamycin-resistant embryos were escapes. This protocol
202
also yielded an efficient regeneration of diploids in

Vedrantais: approximately 75.9 % germinated from somatic
embryos and greater than 60 % of the plants regenerated
from the embryos were diploid.
3.7 Transplanting
and Acclimation
1. Rooting shoots were checked polyploidy and select diploid

plants.
2. Plants were planted in soil in 10 cm pots and covered over
plastic filter for 1 week in culture room.
3. Make the tiny holes on the cover, for acclimation, and grow
the plant for 12 weeks in culture room.
4. The pots were uncovered and plants were grown in a greenhouse as describe in Subheading 3.1.
Notes
1. Melon cultivars: The protocol described is applicable to other
melon varieties such as C. melo L. var. reticulatus cv. Earls
Favourite.
2. The suitable temperature for melon cultivation is between 15
and 25 C. And melon grows well in low humidity condition.
3. Escape and chimeras: In this protocol, a liquid culture system
was used to select transgenic embryos derived from explants.
Because somatic embryos derive from a single cell and because
whole embryos are exposed to kanamycin, the occurrence of
escape and chimeras was reduced, even though a lower concentration of kanamycin was used than in the standard melon protocol. This result indicates that a liquid culture system is
effective for the selection of transformed embryos in the melon.
4. Overgrowth of Agrobacterium: When using a liquid culture
selection system, it is difficult to eliminate A. tumefaciens from
liquid medium containing sugar during the selection of transgenic embryos. Particular care must therefore be taken to
change the liquid EI medium when using this protocol. During
the subculture, the explants must be washed in sterilized water
and new culture vessels must be used.
5. Vitrification: Melon tissues are sensitive to vitrification. Somatic
embryos derived from liquid culture have often been found to
exhibit typical vitrification and fail to develop into plantlets
[5]. To avoid vitrification, 1.0 % agar-solidified G medium was
used for germination in this protocol. Embryos did not grow
in 0.4 % Gelrite-solidified medium. Using surgical tape to seal,
the culture vessels were also important for keeping the humidity low during plant regeneration.
203
References
1. Ezura H, Owino WO (2008) Melon, an alternative model plant for elucidating fruit ripening.
2. Fang G, Grumet R (1990) Agrobacterium tumefaciens mediated transformation and regeneration of muskmelon plants. Plant Cell Rep
9:160164
3. Dong JZ, Yang MZ et al (1991) Transformation
of melon (Cucumis melo L.) and expression from
the cauliflower mosaic virus 35S promoter in
transgenic melon plants. Nat Biotechnol
9:858863
4. Valles MP, Lasa JM (1994) Agrobacteriummediated transformation of commercial melon
(Cucumis melo L., cv. Amarillo Oro). Plant Cell
Rep 13:145148
5. Guis M, Amor MB et al (2000) A reliable system
for the transformation of cantaloupe charentais
melon (Cucumis melo L. va. Cantalupensis) leading to a majority of diploid regenerants. Sci
Hortic 84:9199
6. Akasaka-Kenedy Y, Tomita K et al (2004)
Efficient plant regeneration and Agrobacteriummediated transformation via somatic embryogenesis in melon (Cucumis melo L.). Plant Sci
166:763769
7. Deblaere R, Bytebier B, De Greve H, Deboeck
F, Schell J, van Montagu M, Leemans J (1985)
Efficient octopine Ti plasmid-derived vectors for
Agrobacterium-mediated gene transfer to plants.
Nucleic Acids Res 13:47774788
8. Hiei Y, Ohta S, Komari T, Kumashiro T (1994)
Efficient transformation of rice (Oryza sativa L.)
mediated by Agrobacterium and sequence analysis of the boundaries of the T-DNA. Plant J
6:271282
Chapter 17
Peach (Prunus persica L.)
Silvia Sabbadini, Tiziana Pandolfini, Luca Girolomini,
Barbara Molesini, and Oriano Navacchi
Abstract
Until now, the application of genetic transformation techniques in peach has been limited by the difficulties
in developing efficient regeneration and transformation protocols. Here we describe an efficient regeneration protocol for the commercial micropropagation of GF677 rootstock (Prunus persica Prunus
amygdalus). The method is based on the production, via organogenesis, of meristematic bulk tissues characterized by a high competence for shoot regeneration.
This protocol has also been used to obtain GF677 plants genetically engineered with an empty hairpin
cassette (hereafter indicated as hp-pBin19), through Agrobacterium tumefaciens-mediated transformation.
After 78 months of selection on media containing kanamycin, we obtained two genetically modified
GF677 lines. PCR and Southern blot analyses were performed to confirm the genetic status.
Key words Agrobacterium tumefaciens, Fruit trees transformation, GF677 rootstock, Peach,
Regeneration via organogenesis
Introduction
Stone fruits, especially peach (Prunus persica), are among the most
important tree species of the Mediterranean basin. Viral diseases
represent one of the major problems affecting stone fruit trees and
causing significant agronomic and economic losses. Many viruses
are difficult to eradicate because antiviral treatments are either not
available or not effective; thus, preventing diseases from entering
and spreading in the fields is the most efficient and cost-effective
method for controlling infections. However, prevention and control tactics are often not effective and associated to environmental
sustainability issues and excessive costs for farmers. The genetic
transformation of these fruit species provides huge potentiality for
the obtainment of cultivars with increased resistance to pathogens
and also for the improvement of fruit production and quality. Until
now, the main problem in the genetic transformation of peach
has been the lack of an efficient in vitro regeneration protocol.
205
206
Silvia Sabbadini et al.
The majority of methods for in vitro regeneration of peach

employed juvenile tissues and immature seeds as starting material
[16]. These protocols are useful for scientific but not agronomic
purposes, especially because peach is as highly heterozygous
species [7, 8].
Few reports exist, describing regeneration from mature tissues
of stone fruit trees. One method, which is based on the regeneration of organogenic calli obtained from the base of stem explants,
has been developed and successfully applied for the induction of
shoot formation on different peach cultivars and rootstock [8].
A similar regeneration protocol was already developed and
exploited for the genetic transformation of Vitis vinifera [9]. This
system consists in the formation of a meristematic bulk tissue,
obtained from proliferating in vitro shoots, and induction of
adventitious shoot regeneration by a gradual increase of benzyl
adenine (BA) content in the regeneration medium. In both these
organogenetic methods [8, 9], the hormonal treatment, together
with endogenous and exogenous cell regulators, induced the formation of new adventitious shoots.
In the literature, few examples are present reporting peach
genetic transformation principally due to difficulties in the obtainment of stable transformants. There are only two examples of
peach stable transformation. In one case, Smigocki and
Hammerschlag [10] described the obtainment of several transgenic plants that express the bacterial cytokinin biosynthesis gene
(ipt), starting from in vitro regeneration of immature embryo. In
the second one, Prez-Clemente et al. [11] developed several
transgenic peach plants stably expressing the GFP reporter gene,
starting from in vitro cultured embryo sections.
Here we describe a method for in vitro peach regeneration/
transformation of GF677 rootstock via organogenesis, adapted
from one previously developed for grape [9]. The regeneration
and transformation protocol can be divided into two principal
phases: (1) Production of meristematic bulk tissues then used as
starting material for the Agrobacterium-mediated genetic transformation and (2) selection procedure for the identification of putative transgenic lines.
A. tumefaciens strain GV2260, harboring an empty hairpin
cassette (hp-pBin19), was used to genetic engineer meristematic
tissues of GF677, and then kanamycin selection was applied for the
isolation of putative transgenic lines. The first stable transformed
transgenic lines can be obtained 78 months after genetic transformation. The selection procedure is the key factor for the achievement of new stable transgenic lines.
The transformation trials have been performed on 600
meristematic slices obtained from meristematic bulks of GF677 rootstock. After kanamycin selection and subsequent PCR and Southern
blot analysis screening, we identified two stable T0 transgenic lines,
which correspond to a transformation efficiency of 0.33 %.
207
This protocol represents one of the few examples of in vitro

peach regeneration via organogenesis starting from adult tissues,
which can be transferred for the regeneration and genetic transformation of other peach rootstocks and cultivars. The use of this
protocol permits the production of genetically modified peach
plants, and to our knowledge, this is the first example of a successful peach rootstock genetic transformation.
The innovative approach and strategy described in this study
represent a suitable tool to introduce in peach antiviral hairpin
constructs in order to confer resistance to specific virus infections
via RNA silencing.
2
2.1
Materials
Plant Material
In vitro proliferating explants of the peach rootstock GF677

(P. persica P. amygdalus) were provided by Vitroplant Italia S.r.l.,
Cesena, Italy, and used as starting plant material for the genetic
transformation trials.
2.3 Stock Solutions

and Supplies
1. 6-Benzylaminopurine (BAP, 1 mg/mL): Prepare stock by adding 50 mg of BAP to a 50-mL tube and add a few drops of 1 M
KOH until dissolved by stirring. Bring to volume with ultrapure water (Milli-Q system water). Stirring the solution while
adding water may be required to keep the material in solution.
Store at 20 C for up to 6 months.
LB
Pro-S
InLAX
HindIII
KpnI
BamHI
The hairpin cassette (hp-pBin19) (Fig. 1) used to genetically transform the rootstock GF677 plants contains the 543-base-long constitutive promoter 35S of the CaMV (Cauliflower mosaic virus),
followed by the 115-base-long intron of the LAX1 (InLAX) gene of
Medicago truncatula and the 253-base-long terminator sequence of
the nopaline synthase (NOS) gene of A. tumefaciens. The hairpin
cassette was subcloned in the T-DNA region of a derivative of pBin19
binary vector [12], containing the 984-base-long sequence of the
neomycin phosphotransferase II gene (npt II) and its regulatory
regions (i.e., the 307-base-long promoter sequence and the 256-baselong terminator sequence of NOS gene) (see Note 1). The recombinant plasmid was inserted into A. tumefaciens strain GV2260.
EcoRI
2.2 Gene Construct,

Plasmid Vector,
and Agrobacterium
Strain
NOS-ter
NOS-Ter/npt II/Pro-NOS RB
Fig. 1 Schematic drawing of the T-DNA region of the hairpin cassette (hp-pBin19). Pro-35S, CaMV 35S promoter; InLax, the intron of the LAX1 (InLAX) gene of Medicago truncatula; NOS-ter, the terminator sequence of
the nopaline synthase (NOS) gene of A. tumefaciens; NOS ter/npt II/Pro-NOS, the plant selectable marker gene
cassette, neomycin phosphotransferase II gene (npt II ) controlled by the NOS promoter and terminator
208
2. Indole-3-butyric acid (IBA, 1 mg/mL): Prepare stock by

adding 50 mg of IBA powder to a 50-mL tube and add a few
drops of 1 N NaOH to dissolve it by stirring. Once completely
dissolved, bring to volume with ultrapure water. Store at
20 C for up to 6 months.
3. 1-Naphthaleneacetic acid (NAA, 1 mg/mL): Prepare stock by
adding 50 mg of NAA powder to a 50-mL tube and add a few
drops of 1 N NaOH to dissolve it by stirring. Once completely
dissolved, bring to volume with ultrapure water. Store at
4. Rifampicin (33.3 mg/mL): To prepare, place 330 mg rifampicin powder in 10 mL of dimethyl sulfoxide (DMSO) and allow
rifampicin to dissolve by stirring. Filter-sterilize and divide in
1.5-mL Eppendorf tubes. Store at 20 C for up to 6 months.
5. Streptomycin (100 mg/mL): To prepare stock solution, place
1 g of streptomycin powder in 10 mL of ultrapure water and
allow streptomycin to dissolve by stirring. Filter-sterilize and
divide into 1.5-mL Eppendorf tubes. Store at 20 C for up to
6 months.
6. Kanamycin monosulfate (50 mg/mL): To prepare, place
500 mg of kanamycin monosulfate powder in 10 mL of ultrapure water, and allow kanamycin to dissolve by stirring. Filtersterilize and divide into 1.5-mL Eppendorf tubes. Store at
7. Cefotaxime (100 mg/mL): The commercial product consists
of 1 g of cefotaxime powder that has to be dissolved in 10 mL
of ultrapure water. Store at 20 C for up to 6 months.
8. Acetosyringone (20 mg/L): To prepare stock solution, place
100 mg of acetosyringone powder in 5 mL of ethanol absolute, and allow acetosyringone to dissolve by stirring. Filtersterilize and store at 20 C for up to 6 months.
9. Proline (200 mg/mL): To prepare, place 1 g of proline powder in 5 mL of ultrapure water, and allow proline to dissolve by
stirring. Filter-sterilize and store at 20 C for up to 6 months.
2.4
Media
After pH adjustment, all media should be autoclaved at the temperature of 121 C and 1 bar for 20 min (see Note 2).
1. YEB medium for A. tumefaciens culture: 5 g/L of yeast extract,
1 g/L of peptone, 5 g/L sucrose, 480 mg MgSO4, 50 mg/L
kanamycin, 100 mg/L streptomycin, 100 mg/L rifampicin,
and 7.2 g/L agar (for solid medium) adjusted to pH 7.2 with
NaOH.
2. Meristematic bulk initiation medium (IM): 1,050 mg/L
KNO3, 400 mg/L NH4NO3, 200 mg/L KH2PO4, 400 mg/L
MgSO47H2O, 750 mg/L CaNO3, 200 mg/L NaH2PO4, MS
209
microelements and vitamins [13], 3 % sucrose, 0.7 % commercial agar, and 0.01 mg/L NAA. IM medium was supplemented
with increasing concentration of BAP during subsequent subcultures (from 1 mg/L up to 3 mg/L). The medium is adjusted
to pH 5.65.7 with KOH.
3. Meristematic bulk selection medium (SM): IM medium
enriched with 3 mg/L of BAP, increasing concentration of
kanamycin monosulfate (from 25 mg/L up to 70 mg/L) and
200 mg/L cefotaxime (see Note 3).
4. Meristematic bulk rooting medium: IM medium supplemented
with 1.5 mg/L IBA adjusted to pH 5.65.7 with KOH.
5. MS20 medium meristematic bulk infection solution: 4.4 g of
MS salts including vitamins, 20 g/L sucrose, adjusted to pH
5.2 with KOH.
6. MSH0 Agrobacterium-plant co-culturing medium: 4.4 g of
MS salts including vitamins, 30 g/L sucrose, 7 g/L plant agar,
adjusted to pH 5.2 with KOH, 1 L/mL of proline (200 mg/
mL stock solution), and 1 L/mL of acetosyringone (20 mg/L
stock solution). These last two components are added after
sterilization, as they are heat sensitive. The infection solution
has to be prepared fresh as required.
2.5 Transgenic Plant
Analysis
1. DNA extraction was performed using the commercial kit

Nucleon Phytopure (Amersham Bioscience).
2. Polymerase chain reaction (PCR)-related solution and buffers.
3. Primers: 35S promoter forward primer (5CTTCGTCA
ACATGGTGGAGCACGACA 3) and reverse primer
(5TGGAGATATCACATCAATCCACTTG 3).
4. Southern blot analysis-related solutions and buffer: (a) 1 TBE
buffer: 0.089 M Tris base, 0.089 M boric acid, 2 mM EDTA,
pH 8.0; (b) depurination solution: 0.2 M HCl; (c) denaturation solution: 1.5 M NaCl, 0.5 M NaOH; (d) neutralization
solution: 1.5 M NaCl, 0.5 M TrisHCl, adjusted to pH 7.4;
(e) SCC 20 solution: 3 M NaCl, 0.3 M Sodium Citrate; (f)
ULTRA hyb hybridization buffer (Ambion).
Methods
3.1 Initiation
and Regeneration
of Meristematic Bulks
Meristematic bulks (MBs) of the peach rootstock GF677 (P. persica P. amygdalus) are initiated from shoot tips that are mechanically and chemically treated in order to induce the formation of
MBs, which consist of organogenic calli able to efficiently differentiate and regenerate new adventitious shoots.
210
Fig. 2 Main steps of the rootstock GF677 regeneration and in vitro propagation: (a) Meristematic bulk obtained
after the four subcultures, after the elimination of the apical domes; (b) slice from a meristematic bulk able to
regenerate many adventitious shoots; (c) slices obtained from MB (approx. 1 cm2, 2 mm thick) and used for
in vitro micropropagation or genetic transformation
1. The production of MBs starts with the elimination of the apical dome from in vitro proliferating shoots, placed on a standard proliferation medium used for GF677 commercial
propagation (Fig. 2a).
2. The remaining basal cluster is subcultured on an initiation
medium (IM) supplemented with increasing concentrations of
BAP (from 1 up to 3 mg/L) for a total of four subcultures
(every 4 weeks for the first and second phases, and every 60
and 90 days, for the third and fourth phases). At the beginning
of each subculture, the apical domes of the initial proliferating
shoots originated from the MBs (Fig. 2b) are eliminated, and
the remaining meristematic tissues are cut in small slices
(1 cm2, 2 mm thick) that are used to repropagate MBs and also
used as starting plant material for the transformation experiments (Fig. 2c).
3. During the first two subcultures, the regenerated MBs are
transferred to new media every 4 weeks. The concentration of
BAP is increased from 1 mg/L (first subculture) to 2 mg/L
(second subculture).
4. During the last two subcultures, the regenerated MBs are
transferred to new media, after 60 days for the first one, and
after 90 days for the second one. The concentration of BAP is
raised from 2 to 3 mg/L.
5. MBs, when initiated, can be maintained on IM medium added
with 3 mg/L of BAP for a long period by keeping them proliferating and transplanted, at 24 C under a photoperiod of
16-h light (70 mol/m2/s) provided by white fluorescent
tubes.
3.2 A. tumefaciens
Preparation and Plant
Tissue Infection
211
1. A. tumefaciens strain GV2260 was transformed with the

pBin19 derivative vector containing the hairpin cassette hppBin19 (Fig. 1) through electroporation (see Note 4). Bacteria
are grown in YEB solid medium containing 50 mg/L kanamycin, 100 mg/L rifampicin, and 100 mg/L streptomycin for
48 h at 28 C. For each transformation experiment, one colony
is inoculated to a 50-mL Falcon tube containing 10 mL of
YEB liquid medium supplemented with 50 mg/L kanamycin,
100 mg/L rifampicin, and 100 mg/L streptomycin and grown
overnight at a temperature of 28 C with shaking (150 rpm).
2. The next morning 1 mL of the Agrobacterium suspension is
taken and added to 9 mL of YEB liquid medium (with antibiotics) in a new 50-mL Falcon sterile tube. The suspension is
grown at 28 C with shaking (150 rpm) until OD600 = 0.51.0.
3. The bacterial culture is then centrifuged for 15 min at 1,600 g
and resuspended in MS20 liquid medium, a total final resuspension solution of 50 mL is normally sufficient for infecting
25 meristematic slices (1 cm2, 2 mm thick) obtained from
MB. MS20 liquid medium is supplemented with 1 M acetosyringone, 1 M proline, to induce the virulence (vir) genes of
Agrobacterium. When the tubes are prepared, close them with
Parafilm and mix the solution, and then put the tubes at 28 C
with shaking (150 rpm), for 5 h.
4. Before infection, plant tissues are prepared by removing the
apical domes of the proliferating shoots grown on the MBs
(Fig. 1b) and cutting the remaining meristematic tissues in
small slices (1 cm2, 2 mm thick).
5. Slices obtained from meristematic bulks are dipped into the
bacterial suspension for 15 min, then dried on filter paper, subsequently transferred on MSH0 solid medium where they are
incubated at 24 C in dark for 24 h.
6. Finally the infected plant material is washed with a decontamination solution (sterile water + cefotaxime 500 mg/L) for 5 h
at 24 C with shaking (150 rpm) and then placed in Petri plates
containing solid SM medium, enriched with 25 mg/L of
kanamycin.
3.3 Regeneration/
Selection
and Acclimatization
of Putative
Transformed Lines
1. The infected plant material is subcultured every 15 days (for a

total of 14 subcultures in 7 months) on fresh media containing
increasing concentration of kanamycin (Fig. 3a) (from 25 to
50 mg/L and up to 70 mg/L) following the scheme represented in Table 1 (see Notes 5 and 6). The cultures kept at
24 C under a photoperiod of 16-h light (70 mol/m2/s) provided by white fluorescent tubes.
212
Fig. 3 Main steps of the selective process: (a) regeneration and selection of GF677 at kanamycin concentration
of 25 mg/L; (b) rooting of GF677 selected lines; (c) acclimatization of putative transgenic lines
Table 1
Regeneration/selection scheme
Kanamycin concentration
Period of regeneration/selection (each

subculture is made every 15 days)
25 mg/L (Petri dish)
2 subcultures-1 month
25 mg/L (pot)
50 mg/L (pot)
70 mg/L (pot)
50 mg/L (pot) rooting
Total period of 7 months
2. After four subcultures at the final kanamycin concentration of

70 mg/L, regenerated and selected explants are isolated and
transferred on the rooting medium supplemented with
50 mg/L of kanamycin for a period of 30 days (Fig. 3b)
(see Note 7).
3. In vitro rooted lines are finally transferred to in vivo system and
grown in greenhouse (at 25 C under a photoperiod of 16-h
light, 701,400 mol/m2/s light intensity) for the acclimatization in a medium composed of 10 % perlite and 90 % peat
(Fig. 3c). Selected lines are then analyzed through molecular
tools (PCR and Southern blot) to verify their transgenic state
213
Notes
1. The neomycin phosphotransferase II gene (npt II), which confers resistance against kanamycin, has been used as selectable
marker gene, which is the most commonly used, and it is recommended for the highest efficiency in cleaning transgenic
regenerants at the chimeric state and finally in selecting stable
transgenic clones.
2. The antibiotics are added to the culture media after sterilization, as they are heat sensitive.
3. Cefotaxime is used to avoid A. tumefaciens contamination in
the regeneration/selection medium.
4. The electroporation protocol exploits the use of an electroporator (Bio-Rad) set up on 2.5 kW/cm. Immediately after
electroporation, 1 mL of liquid YEB medium is added to the
bacterial cells, and then the bacterial suspension is incubated at
28 C for 1 h and subsequently plated on solid YEB medium
containing the selective antibiotics rifampicin (100 mg/L),
kanamycin (50 mg/L), and streptomycin (100 mg/L), for
2 days at 28 C. Finally, the transformation reactions are verified by PCR analysis.
5. At the beginning of each subculture, the regenerating shoots
originated from the slices are eliminated, and then the proliferated MBs are fragmented again to expose new regenerating
cells to the selective agent.
6. The first two subcultures, at 25 mg/L of kanamycin, which
follow the transformation protocol, are made in Petri dishes,
while the regenerants are transferred on solid medium contained in glass pots for the all subsequent steps.
7. The regenerants are kept in a plant growth chamber at 24 C
under a 16-h photoperiod for all the selective process and following proliferating and rooting steps.
8. The transformation trials have been performed on a total of
600 meristematic sections of the rootstock GF677 that showed
a percentage of bulk regeneration of about 94 % during the
first phases of the selective process, which decreased to 86 %
during the last steps, with a maximum number of ten adventitious shoots regenerated per slice. After 78 months, we
obtained the first stable transgenic lines, which correspond to
a transformation efficiency of 0.33 %. The regeneration efficiency was very high even on media with increased kanamycin
concentration, but the fact that at the end of the selection procedure most of such regenerants were not transformed can be
explained by the fact that the cell regeneration events are rarely
originated by a single cell but mostly by a larger number of
214
initials cells, as generally happens in the organogenesis processes [14], creating as a consequence a high number of chimeric adventitious shoots, then difficult to bring at stable and
homogenous transgenic line. As a consequence, they perform
as escapes or unstable chimeric lines. Therefore, the selection
procedure remains the key factor for the achievement of new
stable transgenic lines.
9. For the analysis of putative transgenic lines, the genomic DNA
isolation is performed using the commercial kit Nucleon
Phytopure (GE Healthcare) starting from 1 g of leaves. PCR
analysis is performed using a couple of primers specifically
designed onto 35S promoter of the genetic construct, placed
next to the left border of the T-DNA. For Southern blot analysis, 15 g of genomic DNA was digested with Hind III, electrophoresed on a 0.7 % agarose gel in 1 TBE buffer, and
transferred for capillarity to a nylon membrane (Hybond-N+,
GE Healthcare). The DNA probe, corresponding to 540-bp
sequence of the NPTII gene, was labelled with [32P] dCTP
using Ready to go DNA labelling beads (-dCTP) (GE
Healthcare). Unincorporated nucleotides were removed with
ProbeQuant G-50 micro columns (GE Healthcare). The
membrane was hybridized overnight at 42 C in ULTRAhyb
buffer (Ambion). Labelled probe (106 cpm/mL) was added to
the hybridization buffer. The membrane was washed twice in
2 SSC containing 0.1 % SDS for 5 min and twice in 0.1 SSC
containing 0.1 % SDS for 15 min at 42 C. Autoradiography
was then performed using Kodak X-AR5 film (Fig. 4).
Fig. 4 Southern analysis of GF677 transgenic lines hybridized with a probe

designed on NPTII gene: lane 1. line GF1, lane 2. line GF2
215
References
1. Meng X, Zhou W (1981) Induction of embryoid ad production of plantlets in vitro from
endosperm of peach. Acta Agric Univ Peking
7:9598
2. Hammerschlag FA, Bauchan G, Scorza R
(1985) Regeneration of peach plants from callus derived from immature embryos. Theor
Appl Genet 70:248251
3. Mante S, Scorza R, Cordts JM (1989) Plant
regeneration from cotyledons of Prunus persica. Prunus domestica and Prunus cerasus.
4. Scorza R, Morgens PH, Cordts JM, Mante S,
Callahan AM (1990) Agrobacterium-mediated
transformation of peach Prunus persica
L. Batsch leaf segments, immature embryos
and long term embryogenic callus. In Vitro
Cell Dev Biol 26:829834
5. Bhansali RR, Driver JA, Durzan DJ (1990)
Rapid multiplication of adventitious somatic
embryos in peach and nectarine by secondary
embryogenesis. Plant Cell Rep 9:280284
6. Pooler MR, Scorza R (1995) Regeneration of
peach Prunus persica L. Batsch rootstock cultivars from cotyledons of mature stored seed.
HortSci 30:355356
7. Zhou HC, Li M, Zhao X, Fan XC, Guo AG
(2010) Plant regeneration from in vitro leaves
of the peach rootstock Nemaguard (Prunus
persica x P. davidiana). Plant Cell Tiss Org
Cult 101:7987
8. Prez-Jimnez M, Carrillo-Navarro A, CosTerrer J (2012) Regeneration of peach (Prunus

persica L. Batsch) cultivars and Prunus persica x
Prunus dulcis rootstocks via organogenesis.
Plant Cell Tissue Organ Cult 108:5562
9. Mezzetti B, Pandolfini T, Navacchi O, Landi L
(2002) Genetic transformation of Vitis vinifera via organogenesis. BMC Biotechnol 2:18
10. Smigocki AC, Freddi A, Hammerschlag A
(1991) Regeneration of plants from peach
embryo cells infected with a shooty mutant
strain of Agrobacterium. J Am Soc HorticSci
116:10921097
11. Prez-Clemente R, Prez-Sanjun A, GarcaFrriz L, Beltrn J-P, Caas LA (2004)
Transgenic peach plants (Prunus persica L.)
produced by genetic transformation of embryo
sections using the green fluorescent protein
(GFP) as an in vivo marker. Mol. Breed
14:419427
12. Bevan M (1984) Binary Agrobacterium vectors for plant transformation. Nucleic Acids
Res 12:87118721
13. Murashige T, Skoog F (1962) A revised
medium for rapid growth and bioassay with
tobacco tissue cultures. Physiol Plant
15:473497
14. Compton ME, Gray DJ (1993) Shoot organogenesis and plant regeneration from cotyledons of diploid, triploid, and tetraploid
watermelon. J Am Soc HortSci 118:151157
Chapter 18
Strawberry (Fragaria ananassa)
Roberto Cappelletti, Silvia Sabbadini, and Bruno Mezzetti
Abstract
Genetic transformation in strawberry (Fragaria spp.) can be achieved by using the Agrobacterium-mediated
procedure on leaves from in vitro proliferated shoots. Regardless of the sufficient regeneration levels
achieved from leaf explants of some commercial strawberry genotypes, the regeneration of transformed
strawberry plants remains difficult and seems to be strongly genotype dependent. In fact, the main factors
that play an important role in the success of strawberry genetic transformation are the availability of an
efficient regeneration protocol and of an appropriate selection procedure of the putative transgenic shoots.
The strawberry genetic transformation protocol herein described relates to three genotypes resulted
from our experience with the highest regeneration and transformation efficiency. The study includes two
octoploid Fragaria ananassa cultivars, Sveva and Calypso, and a diploid F. vesca cultivar (Alpina W.O.).
All the different steps related to the leaf tissue Agrobacterium infection, coculture, and selection of regenerating adventitious shoots, as well as the following identification of selected lines able to proliferate and
root on the selective agent (kanamycin), will be described.
Key words Agrobacterium infection, Kanamycin selection, Leaf tissue regeneration, Strawberry
Introduction
The Agrobacterium tumefaciens-mediated transformation represents
one of the most common techniques of recombinant DNA, and it
is largely employed to obtain genetically modified plants. Efficient
transformation and regeneration methods are a priority for successful application of recombinant DNA technology to vegetative propagated plants such as strawberry.
To date, the most resourceful plant differentiation process for
recombinant DNA technology in strawberry remains adventitious
shoot organogenesis directly from somatic tissue or a previous callus
formation. However, detailed developmental and physiological characterization of the whole sequence of the organogenic processes in
strawberry somatic tissues is still mainly lacking [1]. The genotype and
type of explants represent important factors affecting the regeneration process and consequently the genetic transformation efficiency.
For several Fragaria ananassa genotypes, efficient regeneration
217
218
Roberto Cappelletti et al.
protocols have been identified by using different types of somatic

tissues [26], although leaf tissue has been the most studied in several
regeneration experiments [3, 7, 8] and in most cases it has displayed
the highest regeneration efficiency [6]. Leaf explants have also been
particularly useful for shoot regeneration and genetic transformation
of wild strawberry (F. vesca) [916]. The shoot regeneration response
of leaf tissue has mainly been related to the genotype and the cultivation factors, mainly in terms of the media composition (phytohormones and the type of nutrient medium). Cultivated strawberry
varieties have shown large variability in the cell differentiation competence of their somatic tissues, and the effects of plant growth regulator
(PGR) treatments in the induction of this process appear to be related
to specific genetic factors [6].
The regeneration media that have generally produced the
greatest shoot regeneration include the Murashige and Skoog
(MS) medium [17], supplemented with 6-benzylaminopurine
(benzyl adenine) and indole-3-butyric acid (IBA) [6, 18]. The
ability of 1-phenyl-3-(1,2,3-thiadiazol-5-yl) urea (thidiazuron
[TDZ]) to induce high shoot regeneration efficiency, in particular
in woody plant tissues, has also been reported [1921], while in
strawberry the effect of TDZ has been explored recently in a
restricted number of Fragaria ananassa cultivars. With this
cytokine-like plant growth regulator (PGR), strawberry regeneration showed specific responses that were dependent on the genotype and the type of tissue [6]. Among the auxins, 3-benzo[b]
selenienyl acetic acid (BSAA) is a new highly active molecule that
has already been tested in some crops, where it has shown a highly
effective activity for the induction of somatic embryogenesis [22];
although it has not yet been tested for its capability to control
organogenesis in woody plants, we recently achieved interesting
results particularly in strawberry genotypes. A medium with a combination of TDZ and BSAA was found as a good regeneration
medium for different genotypes [23]. Nowadays, due to the difficulty in finding BSAA on the market, new regeneration trials were
carried out in order to find new combinations of plant growth
regulators able to induce high strawberry leaf tissue regeneration
efficiency.
Good results were obtained using a medium supplemented
with 0.5 mg/L TDZ in combination with 0.01 mg/L
2,4-dichlorophenoxyacetic acid (2,4-D) in Calypso octoploid
cultivar, while for Sveva a growing medium supplemented with
1 mg/L TDZ and 0.1 mg/L 2,4-D. Further investigations are in
progress to test the activity of a growing medium supplemented
with 3 mg/L BA and 0.2 mg/L IBA in order to improve regeneration efficiency of other cultivars such as Sveva, a new short-day
variety.
Among several strawberry genotypes tested in our trials, the
regeneration and transformation response varied mainly depending
on the genotype. The highest efficiency in genetic transformation
219
(about 5 %) was observed from the genotypes with the highest leaf
tissue regeneration efficiency (100 % of leaf tissue regeneration),
such as Sveva, a newly released octoploid cultivar (F. ananassa),
and the diploid F. vesca cv. Alpina W.O. Genotypes such as cv.
Onda and cv. Paros, performing with an intermediate leaf tissue
regeneration efficiency (about 80 % of leaves with adventitious
shoots), showed a reduced Agrobacterium transformation efficiency (13 %). Strawberry genotypes showing much lower percentages of leaf tissue regeneration (lower then 40 %) can be quite
more difficult to be transformed [23].
The achievement of stable genetically transformed plants is also
strictly related to the antibiotic (kanamycin) selection protocol,
starting from the early stage of leaf tissue regeneration, immediately after the Agrobacterium infection and coculture, and including
the in vitro proliferation and rooting of newly selected shoots.
Depending on the efficiency of the regeneration and transformation protocol, the first stable newly produced transgenic line can be
available after 56 months from the first transformation experiment. Selection of trasgenic plants using antibiotics must be optimize depending of genotype used through toxicity threshold tests
[24] and evaluating the possibility to use iterative or non iterative
method of selection [25]. GFP fluorescence technique nowadays
seems to be an alternative approach in order to help and in some
case replace antibiotics in strawberry selection protocols [26].
Materials
2.1 Agrobacterium
tumefaciens Strains,
Vector, and Plant
Selectable Markers
1. The LB4404 and EHA105 A. tumefaciens strains are the most

commonly used and probably the most efficient, for strawberry
genetic transformation.
2. The pBI121 binary plasmid was also successfully used [27].
The neomycin phosphotransferase II (nptII) gene is also the
selectable marker most commonly used, and it is recommended for the highest efficiency in cleaning transgenic
regenerants at the chimeric state and finally in selecting stable
transgenic clones.
Explant Material
Newly expanded entire leaves, from in vitro proliferating shoots,

cut transversally and cultured with the abaxial surface in contact
with the regeneration medium.
2.3 Stock Solutions

and Supplies
1. Thidiazuron (TDZ, 1 mg/mL): To prepare, place 100 mg of

TDZ in a tube with a magnetic stir bar; add one drop of
dimethyl sulfoxide (DMSO) and 100 mL of deionized sterile
water. Allow TDZ to dissolve by stirring. Store in a bottle and
at 20 C for up to 6 months.
2.2
220
2. 6-Benzylaminopurine (6-BAP, 1 mg/mL): Prepare stock by

adding 50 mg of 6-BAP to a 50-mL centrifuge tube and add
few drops of 1 M KOH until dissolved by stirring. Bring to
volume with ultrapure water (Milli-Q system water). Stirring
the solution while adding water may be required to keep the
material in solution. Store at 20 C for up to 6 months.
3. 2,4-Dichlorophenoxyacetic acid (2,4-D, 1 mg/mL): To
prepare, place 100 mg of 2,4-D in a tube with a magnetic stir
bar; add one drop of ethanol or 1 N NaOH and 100 mL of
deionized sterile water. Allow 2,4-D to dissolve by stirring.
Store in a bottle and store at 28 C for up to 6 months.
4. Indole-3-butyric acid (IBA, 1 mg/mL): Prepare stock by adding 50 mg of IBA powder to a 50-mL centrifuge tube and add
a few drops of 1 N NaOH to dissolve it by stirring. Once completely dissolved, bring to volume with ultrapure water. Store
5. Rifampicin (33.3 mg/mL): To prepare, place 330 mg rifampicin powder in 10 mL of DMSO and allow rifampicin to dissolve by stirring. Filter-sterilize and divide in 1.5-mL Eppendorf
tubes. Store at 20 C for up to 6 months.
6. Streptomycin (100 mg/mL): To prepare, place 1 g of streptomycin powder in 10 mL of ultrapure water and allow
streptomycin to dissolve by stirring. Filter-sterilize and divide
into 1.5-mL Eppendorf tubes. Store at 20 C for up to 6
months.
7. Kanamycin monosulfate (50 mg/mL): To prepare, place
500 mg of kanamycin monosulfate powder in 10 mL of ultrapure water, and allow kanamycin to dissolve by stirring. Filtersterilize and divide into 1.5-mL Eppendorf tubes. Store at
8. Cefotaxime (100 mg/mL): The commercial product consists
of 1 g of powder that has to be dissolved in 10 mL of ultrapure
water and mixed vigorously. Store at 20 C for up to 6 months
(see Note 2).
9. Acetosyringone (20 mg/L): To prepare, place 100 mg of acetosyringone powder in 5 mL of ethanol absolute, and allow
acetosyringone to dissolve by stirring. Filter-sterilize and store
10. Proline (200 mg/mL): To prepare, place 1 g of proline powder in 5 mL of ultrapure water, and allow proline to dissolve by
stirring. Filter-sterilize and store at 20 C for up to 6 months.
2.4
Media
After pH adjustment, all media should be autoclaved at the temperature of 121 C and 1 bar pressure for 20 min.
1. Shoot-proliferating medium: 4.3 g/L of MS [17] micro- and
macroelements, 5 mg/L of pyridoxine, 5 mg/L of nicotinic
221
acid, 20 mg/L of glycine, 1,000 mg/L of myoinositol,

10 mg/L of thiamine, 30 g/L of sucrose, 0.5 mg/L 6-BAP,
7.5 g/L of agar, pH 5.7. This medium can stand at room temperature for 2 weeks or store at 28 C.
2. LB medium liquid and solid for Agrobacterium: 2.5 g/L of
yeast extract, 5 g/L of tryptone, 5 g/L NaCl, 7.5 g/L Bacto
agar (only for solid media), pH 7 (adjusted with NaOH). This
medium can be stored at 4 C for no more than 2 weeks.
Antibiotics must be added after sterilization, as they are heat
sensitive. Generally, kanamycin is added at a concentration of
50 mg/L, rifampicin 10 mg/L, and chloramphenicol 10 mg/L
although concentration or type of selective antibiotics used
depend on the type of genetic construct.
3. Leaf infection solution: 4.3 g/L of MS micro- and macroelements, 5 mg/L of pyridoxine, 5 mg/L of nicotinic acid,
20 mg/L of glycine, 1,000 mg/L of myoinositol, 10 mg/L of
thiamine, 20 g/L of sucrose, pH 5.2. Add proline and acetosyringone with a 1 L/mL ratio depending on the amount of
leaf infection solution required. These two last components are
added after sterilization, as they are heat sensitive. The infection solution should be prepared fresh as required.
4. Agrobacterium-plant coculturing medium: Prepare solid
medium containing 4.3 g/L of MS micro- and macroelements,
5 mg/L of pyridoxine, 5 mg/L of nicotinic acid, 20 mg/L of
glycine, 1,000 mg/L of myoinositol, 10 mg/L of thiamine,
30 g/L of sucrose, pH 5.7. Prepare a liquid solution with MS
micro- and macroelements, 5 mg/L of pyridoxine, 5 mg/L of
nicotinic acid, 20 mg/L of glycine, 1,000 mg/L of myoinositol, 10 mg/L of thiamine, 20 g/L of sucrose, and after autoclaving, add proline and acetosyringone with a 1 L/mL ratio.
Add 500 L of this liquid solution in a surface of solid medium
previously poured in petri dishes.
5. Leaf tissue washing solution: Sterile H2O added with 500 mg/L
cefotaxime. Prepare fresh as required.
6. Leaf explant regeneration and selection medium: 4.3 g/L of
MS micro- and macroelements, 5 mg/L of pyridoxine, 5 mg/L
of nicotinic acid, 20 mg/L of glycine, 1,000 mg/L of myoinositol, 10 mg/L of thiamine, 30 g/L of sucrose, pH 5.7,
7.5 g/L plant agar, 200 mg/L of cefotaxime, 25 mg/L of
kanamycin monosulfate (50 mg/mL stock). For Calypso cultivar, supplement this basal medium with 0.5 mg/L of TDZ and
0.01 mg/L of 2,4-D; for Sveva cultivar, 1 mg/L of TDZ and
0.1 mg/L of 2,4-D.
7. Rooting medium: 4.3 g/L of MS micro- and macroelements,
5 mg/L of pyridoxine, 5 mg/L of nicotinic acid, 20 mg/L of
222
glycine, 1,000 mg/L of myoinositol, 10 mg/L of thiamine,

30 g/L of sucrose, pH 5.7, 7.5 g/L of agar, 0.5 mg/L of
IBA, 200 mg/L of cefotaxime, 25 mg/L of kanamycin
monosulfate.
Methods
The protocol includes three main steps: (1) the supply of plant
material (in vitro proliferating shoots), (2) the Agrobacterium
infection, and (3) the regeneration and selection of stable transformed plantlets.
3.1 Preparation
of Strawberry Leaf
Tissue
1. For each genotype start in vitro proliferating shoots by sterilizing lateral buds collected from runners (vegetative parts of
the mother plant) and treating them with 2 % (v/v) chlorideactive solution for 20 min.
2. After rinsing 45 times with sterile distilled water, transfer the
meristematic tissues to sterile glass tubes (length 11 cm) containing the shoot-proliferating medium, to let meristematic tissues develop and to generate shoots.
3. Incubate the proliferating shoots in growth chambers under
16 h at 70 mol/m2/s and 8 h dark, at 24 2 C, and subculture regularly at 4-week intervals.
4. The transformation and regeneration experiments are carried
out by using young expanded leaves detached from 4-weekold in vitro proliferating shoots, after a minimum of 45 subcultures from the initial explants. When detached, incise the
leaf laminar on transversal rib and keep in distilled sterile water
until starting the transformation experiment (see Notes 13).
3.2 Agrobacterium
tumefaciens
Preparation and Plant
Tissue Infection
1. Agrobacterium tumefaciens strain is grown in LB solid medium

containing kanamycin 50 mg/L, rifampicin 10 mg/L, and
chloramphenicol 10 mg/L, in 90-mm-diameter petri dish,
cultured at 4 C and transferred every 12 months to a new LB
solid medium.
2. Agrobacterium inoculation suspension can be prepared by
using LB liquid medium added with the selecting and cleaning
antibiotics: 50 mg/L kanamycin, 10 mg/L rifampicin, and
10 mg/L chloramphenicol.
3. Inoculate a small amount (one full handle) of Agrobacterium
colonies from LB solid medium to a 50-mL Falcon tube containing 10 mL of LB liquid medium supplemented with
50 mg/L kanamycin, 10 mg/L rifampicin, and 10 mg/L
chloramphenicol.
4. Seal the tubes with Parafilm and incubate the culture overnight
at 28 C on a shaker (100150 rpm).
223
5. On the day of transformation experiment, quantify bacteria

growth at the spectrophotometer. Take an amount of 100 L
of bacteria culture and 900 L of LB liquid medium and put in
1 mL cuvette. The desired optical density (OD) value is
approximately 0.8 at 600 nm, corresponding to an inoculum
density of 108 bacterial cells per mL [28].
6. To prepare the inoculum suspensions with the desired cell density (OD600 = 0.8), centrifuge bacteria suspension culture at
2,500 g for 15 min, discard the supernatant, and resuspend
the pellet in the infection solution (about 100 mL for each 1
OD value) to have a final resuspension solution of 50 mL
which is normally sufficient for infecting 100300 leaves.
7. To induce the virulence (vir) genes of Agrobacterium, use liquid leaf infected solution supplemented with proline and acetosyringone as described before, close the tubes with Parafilm
and mix vigorously, and then put the tubes at 28 C on a shaker
(100150 rpm) for 5 h in order to activate Agrobacterium cell
division and virulence.
3.3 Explant Tissue
Infection
1. Infection and cocultivation is the main step of leaf tissue transformation. When the detached and cut leaves are ready and
maintained in sterile H2O to prevent drying, gently wash the
leaves in 30 mL infection solution containing the Agrobacterium
tumefaciens strain for 15 min at 100150 rpm.
2. After infection the leaves are blotted with sterile filter paper
and transferred to the Agrobacterium-plant coculturing
medium for 48 h at 25 C in dark condition. It is necessary to
put the leaves with their inferior-abaxial side in contact with
the medium.
3. At the end of the coculturing period, stop the infection by
transferring the leaves to the washing solution for 5 h at 25 C
with shaking at 100150 rpm.
3.4 Leaf Tissue

Regeneration
and Selection
1. The washed leaves are then blotted with sterile filter paper and
placed on leaf explant regeneration and selection medium,
always by keeping in contact with the medium the abaxial side
of the leaf.
2. For strawberry, the highest leaf tissue regeneration response is
promoted by a first period of incubation (2 weeks) at continuous dark and then under 16 h at 70 mol/m2/s and 8 h dark,
at 24 2 C. Leaf tissue has to be subcultured regularly at
2-week intervals on freshly prepared media.
3. At each subculture, the type of morphogenic activity that
occurs for each explant should be monitored. Generally, yellow
pale callus will form at the cut leaf edge around the end of the
first subculture. After moved to light (16/8 photoperiod),
224
some callus cultures start to form green dot nodules, while the
remaining parts display progressive necrosis.
4. The leaves bearing callus and green dot nodules are subcultured every 2 weeks on a freshly prepared regeneration and
selection medium. Keep subculturing the leaf and callus tissues
as long as it remains a proliferation and differentiation activity
(up to 6 months).
5. When transplanting, detach the selectable green and elongated
regenerated shoots (about 24 cm in size) from the callus tissues and transfer in glass tube (12-mm diameter) containing
the shoot-proliferating medium supplemented with the selective agent (kanamycin 25 mg/L) and the decontaminant
(cefotaxime 200 mg/L) antibiotic used in the regeneration
medium. A larger number of isolatable regenerants generally
occur at the second and third subculture (see Note 4).
6. The proliferation stage of the isolated shoots is another critical
stage for the identification of stable homogenous transgenic
lines. Again, 23 subcultures on the same proliferation medium
supplemented with antibiotics are generally useful to identify
the regenerated lines showing the more homogenous green
tissues (see Note 5). The type of agar (plant agar or Gelrite)
and their concentration inside the medium (from 7.5 to 7 g/L)
could help to expose regenerating plant to the antibiotics in
order to make the selection more efficient.
3.5 Rooting
and Transplanting
to Soil
1. Transfer the green stable proliferating lines on a rooting

medium. A first proof of new stable putative transgenic lines is
their ability to root in the presence of kanamycin. Usually
plantlets start rooting after 3 weeks. Only regenerated shoots
that are able to root on medium with kanamycin are considered new putative transgenic plants. A polymerase chain reaction (PCR) analysis can be performed for a first molecular
confirmation of the transgenic event.
2. Before acclimatization, plants should be elongated both in epigeic and ipogeic part; the first step of acclimatization is generally
critical, and only plants with a balanced development and an
accurate humidity management can prevent shoot mortality and
ensure an acclimatization rate of up to 80 %. An elongated phase
in a medium without plant growth regulators could help to this
purpose. Once plants have a balanced development, rooted
shoots are transplanted into small pots, containing soil mix
(Substrate 2, Klasmann-Deilmann GmbH; see Note 6) for
plant acclimatization, covered by a transparent cap allowing light
to pass through and maintain the plants in the growth room in a
high relative humidity condition (up to 90 %), temperature of
24 C, 16-h photoperiod, and light intensity of 300 mol/m2/s,
in order to produce new roots and acclimatize plant.
225
3. After the first week, humidity should be reduced by removing

the cover daily for 1 h, and gradually increase the time of acclimation to ex vitro conditions in the successive 4 weeks.
4. Acclimation and hardening of the plants should be performed
either in a climatic box that provides temperature and humidity control or in the greenhouse. Generally, start the molecular
characterization using PCR and Southern blot analysis of the
transgenic events at this stage (see Note 7).
5. Transgenic clones are cultured in a greenhouse and/or
transferred to open field trials depending on agronomic interest and with respect of the laws about genetically modified
organism (GMO) experimental trials. Our greenhouse conditions are 2530 C, 1618-h photoperiod, and an increasing
light intensity from 500 to 1,400 mol/m2/s.
6. At each cultivation cycle and for each clone, new plants are
produced by vegetative propagation (runners) and used for
starting the risk and benefit assessment at open field conditions, as requested for transgenic plants.
Notes
1. Experiment planning: Each experiment has to be carried out
using young trifoliate strawberry leaves.
2. Experiment repetition: Plan at least three subsequent transformation experiments, with at least 50 or 100 leaf explants each,
depending on the efficiency of the regeneration protocol.
3. It is of extreme importance to ensure sterile conditions for all
experiment processes.
4. Each newly selected regenerant has to be identified with the
corresponding leaf tissue origin. This leaf tissue can be maintained for other subsequent subcultures, but if other regenerating shoots will occur later, they can be isolated, but it is
better to identify them as a subclone of the first regenerated
shoot already isolated from the same explant. If both will grow
stably on proliferation/selection medium, only the molecular
characterization (Southern blot) can confirm their origin from
different transformation events. If the regeneration and transformation protocols are really efficient, as soon as a regenerated shoot is isolated, the leaf explant can be discarded.
5. The identification and selection of greener stably proliferating
and rooting shoots are fundamental aspects of the in vitro procedure to avoid the risk of selecting chimeric clones.
6. Blend of white and frozen through black sphagnum peat.
Structure medium grade, optimum air to water ratio. pH 6
226
(H2O). Electrical conductivity 0.55 dS/m. Amount of added

fertilizer (NPK14:16:18) 2 kg/m3.
7. To have a first molecular proof of the transformation event, a
PCR analyses can be performed on isolated lines able to root
on kanamycin. Southern blot molecular characterization can
be performed on tissue of acclimatization plants.
References
1. Mezzetti B (2003) Genetic transformation in
strawberry and raspberry. In: Jaiwal PK, Singh
RP (eds) Plant genetic engineering improvement of fruit crops, vol. 6. SCI Tech Publishing
LLC, USA
2. Foucault C, Letouze R (1987) In vitro: regeneration des plant de Fraisier a partir de fragmentes de petiole et de bourgeons floraux. Biol
Planta 29:409414
3. Liu ZR, Sanford JC (1988) Plant regeneration
by organogenesis from strawberry leaf and runner tissue. HortScience 23:10571059
4. Rugini E, Orlando R (1992) High efficiency
shoot regeneration from calluses of strawberry
(Fragaria x ananassa Duch.) stipules of in
vitro shoot cultures. J Hortic Sci 67:577582
5. Graham J, McNicol RJ, Greig K (1995)
Transgenic apples and strawberries: advances in
transformation, introduction of genes for
insect resistance and field studies of tissue cultured plants. Ann Appl Biol 127:163173
6. Passey AJ, Barrett KJ, James DJ (2003)
Adventitious shoot regeneration from seven
commercial strawberry cultivars (Fragaria x
ananassa Duch.) using a range of explant
types. Plant Cell Rep 21:397401
7. Nehra NS, Chibbar RN, Kartha KK, Datla
RSS, Crosby WL, Stushnoff C (1990) Genetic
transformation of strawberry by Agrobacterium
tumefaciens using a leaf disk regeneration system. Plant Cell Rep 9:293298
8. Sorvari S, Ulvinen S, Hietarante T, Hiirsalmi H
(1993) Pre-culture medium promotes direct
shoot regeneration from micropropagated
strawberry leaf disks. HortScience 28:5557
9. El Mansouri L, Mercadi JA, Valpuesta V,
Lopez-Aranda JM, Pliegi-Alfaro F, Quesada
MA (1996) Shoot regeneration and
Fragaria vesca L. Plant Cell Rep 15:642646
10. Haymes KM, Davis TM (1997) Agrobacteriummediated transformation of Alpine Fragaria
vesca and transmission of transgenes to R1
progeny. Plant Cell Rep 17:279283
11. Balokhina NV, Kaliayeva MA, BuryanovYa I
(2000) The elaboration of a shoot regenera-
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
tion system for the genetic transformation of

the wild strawberry (Fragaria vesca L.).
Biotekhnologiya 16:4651
Jimenez-Bermudez S, Redondo NJ, MunozBlanco J, Caballero JL, Lopez-Aranda JM,
Valpuesta V, Pliego-Alfaro F, Quesada MA,
Mercado JA (2002) Manipulation of strawberry fruit softening by antisense expression of
a pectate lyase gene. Plant Physiol 128:
751759
Agius F, Gonzalez-Lamothe R, Caballero JL,
Munoz-Blanco J, Botella MA, Valpuesta V
(2003) Engineering increased vitamin C levels
in plants by overexpression of a D-galacturonic
acid reductase. Nat Biotechnol 21:177181
Mezzetti B, Landi L, Pandolfini T, Spena A
(2004) The DefH9-iaaMauxin-synthesizing
gene increases plant fecundity and fruit production in strawberry and raspberry. BMC
Biotechnol 4:4. http://www.biomedcentral.
com/1472-6750/4/4
Qin Y, Jaime A, da Silva T, Zhang L, Zhang S
(2008) Transgenic strawberry: state of art for
improved traits. Biotechnol Adv 26:219232
Oosumi T, Gruszewski HA, Blischak LA, Baxter
AJ, Wadl PA, Shuman JL, Veilleux RE, Shulaev
V (2006) High-efficiency transformation of the
diploid strawberry (Fragaria vesca) for functional genomics. Planta 223:12191230
Barclo M, El Mansouri I, Mercado JA,
Quesada MA, Alfaro FP (1998) Regeneration
and transformation via Agrobacterium tumefaciens of the strawberry cultivar Chandler. Plant
Cell Tiss Org Cult 54:2936
Huetteman CA, Preece JE (1993) Thidiazuron:
a potent cytokinin for woody plant tissue culture. Plant Cell Tiss Org Cult 33:105119
Bhagwat B, Lane WD (2004) In vitro shoot
regenerations from leaves of sweet cherry
(Prunus avium) Lapins and Sweetheart.
Meng RG, Chen THN, Finn CE, Li YH
(2004) Improving in vitro plant regeneration
22.
23.
24.
25.
from leaf and petiole explants of Marion

blackberry. HortScience 39:316320
Lamproye A, Hofinger M, Berthon JY, Gaspar
T (1990) 3-(Benzo(b)selenienyl)acetic acid, a
potent synthetic auxin in somatic embryogenesis. Comptes rendus Acad Sci Paris 311 (srie
III) 39:127132
Landi L, Mezzetti B (2006) TDZ, auxin and
genotype effects on leaf organogenesis in
Fragaria. Plant Cell Rep 25:281288
Qin YH, Teixeira da Silva JA, Bi JH, Zhang SL,
Hu GB (2011) Response of in vitro strawberry to
antibiotics. Plant Growth Regulator 65:183193
Husaini AM (2010) Pre- and post-agroinfection
strategies for efficient leaf disk transformation
227
and regeneration of trasgenic strawberry plants.

26. Zhang Q, Folta KM, Davis TM (2014) Somatic
embryogenesis, tetraploidy, and variant leaf
morphology in trasgenic diploid strawberry
(Fragaria vesca subspecies vesca Hawaii 4.
BMC Plant Biol 14:23
27. Bevan MW (1984) Binary Agrobacterium
vectors for plant transformation. Nucleic Acids
Res 12:87118721
28. James D, Passey AJ, Barbara DJ (1990)
the cultivated strawberry (Fragaria x ananassa
Duch.) using disarmed binary vectors. Plant
Sci 69:7994
Chapter 19
Walnut (Juglans)
Charles A. Leslie, Sriema L. Walawage, Sandra L. Uratsu,
Gale McGranahan, and Abhaya M. Dandekar
Abstract
Walnut species are important nut and timber producers in temperate regions of Europe, Asia, South
America, and North America. Trees can be impacted by Phytophthora, crown gall, nematodes, Armillaria,
and cherry leaf roll virus; nuts can be severely damaged by codling moth, husk fly, and Xanthomonas
blight. The long generation time of walnuts and an absence of identified natural resistance for most of
these problems suggest biotechnological approaches to crop improvement. Described here is a somatic
embryo-based transformation protocol that has been used to successfully insert horticulturally useful traits
into walnut. Selection is based on the combined use of the selectable neomycin phosphotransferase (nptII)
gene and the scorable uidA gene. Transformed embryos can be germinated or micropropagated and
rooted for plant production. The method described has been used to establish field trials of mature trees.
Key words Agrobacterium tumefaciens, California black walnut, Eastern black walnut, Gene transfer,
Juglans hindsii, Juglans nigra, Juglans regia, Paradox, Persian walnut, Somatic embryo
Introduction
There are approx 20 species of walnut worldwide, many of which
are valued for their nut production and timber quality. The principal species used for commercial walnut production, the Persian
walnut (Juglans regia L.), is native to the mountain ranges of central Asia. It is now cultivated in many temperate regions including
much of the Mediterranean, Central Asia, northern India, China,
South Africa, Argentina, Chile, and Australia. In the United States,
this crop is produced almost entirely in California, where orchard
trees are grafted onto rootstock of either the native California black
walnut (Juglans hindsii) or J. hindsii J. regia hybrids known as
Paradox. The eastern black walnut (Juglans nigra), native to the
eastern United States, is highly valued for its timber quality and has
been introduced into Europe and China for this purpose.
Walnuts are susceptible to a number of insect, disease, and
nematode problems. The key insect pest is codling moth (Cydia
229
230
Charles A. Leslie et al.
pomonella L.), and Xanthomonas bacterial blight can cause substantial

nut loss. Cherry leaf roll virus (blackline disease) is pollen disseminated and can kill grafted trees at full production. Rootstock diseases
seriously impacting both nurseries and growers include crown gall
disease (Agrobacterium tumefaciens), Phytophthora crown and root
rots, and oak root fungus (Armillaria mellea). Nematodes are an
increasingly serious problem in nurseries and in orchard establishment due to loss of available fumigants. Genetic resistance for most
of these problems has not been clearly identified in walnut, and walnut breeding is a very lengthy process. Embryo rescue [1] and
Agrobacterium-mediated transformation have both been used in
attempting to address these pest problems. Walnut hybrids can be
micropropagated for rootstock production [2], or Persian walnut
cultivars can be produced on their own roots [3] to avoid graft costs
and blackline disease. Repetitively embryogenic somatic embryo
cultures can be produced easily from immature zygotic embryos [4]
and with difficulty from immature catkins (unpublished data).
Triploid walnuts have been produced from endosperm [5].
Agrobacterium-mediated transformation of walnut somatic embryos
was first reported using marker genes [6, 7]. Subsequent work
showed these methods could be applied to generate transgenic walnuts expressing a modified Bacillus thuringiensis gene for insect
resistance [8, 9], the rolABC genes from A. rhizogenes for short
internodes and altered root architecture [10], and RNAi constructs
to inhibit crown gall formation [11]. More recently walnut plants
with resistance to both nematodes and crown gall were developed
by a co-transformation procedure employing two vectors simultaneously [12]. A number of additional genes that were successfully
transformed into and expressed in walnut did not produce useful
phenotypes including the LFY gene from Arabidopsis, the GNA
snowdrop lectin gene, and the Xa21 Xanthomonas resistance gene
from rice (McGranahan and Dandekar, unpublished data).
The protocol detailed here is based on our experience using
repetitively embryogenic walnut somatic embryo cultures. New
somatic embryos develop from single epidermal cells on existing
embryos [13]. This process automatically eliminates any chimeras
so non-chimeral transformants can be selected by picking from
second-generation embryos. We used both the neomycin phosphotransferase (nptII) as a selectable marker and the uidA gene as
a scorable marker. Nontransformed embryos multiply poorly and
generally develop bad form and a yellowish color on kanamycincontaining medium. Embryos which multiply well and appear
healthy on kanamycin can be checked for -glucuronidase (GUS)
activity using X-glucuronidase staining [14] or green fluorescent
protein (GFP) fluorescence [15]. Transformed embryos can be
germinated following desiccation [16]. This method has also been
used to transform eastern black walnut [17] and pecan [18].
Walnut (Juglans)
231
Transformation efficiency (the percent of initially treated

embryos [E0] that produce one or more non-chimeric transformed
second-generation [E2] embryos which continue to be embryogenic) is approx. 2025 % [7, 9]. Bacterial overgrowth can sometimes be a problem and embryo germination rates are relatively
low. The latter may be circumvented by micropropagating transformed epicotyls and either rooting the resulting microshoots or
budding them to seedling rootstocks [19].
2
2.1
Materials
Plant Material
2.2 Transformation
Vectors
and A. tumefaciens
Strains
Immature walnuts of the variety or species of interest, preferably

harvested 6- to 10-week post anthesis, or previously established
walnut somatic embryo cultures.
1. A. tumefaciens strains that work efficiently for walnut are the
disarmed derivatives like EHA101 [20, 21] of the tumorigenic
A281 strain that harbors the Ti plasmid pTiBo542 and the nonpathogenic strain C58C1 [21, 22] which contains a disarmed
version of the tumorigenic Ti plasmid pTiC58 (see Note 1).
2. The binary system for walnut transformation is completed with
the introduction of broad host range binary plasmids that contained the desired T-DNA region. For this we use derivatives
of binary plasmids described by McBride and Summerfelt [23].
These derivatives have been exclusively used for the
Agrobacterium-mediated transformation protocol described
here. This binary contains the selectable marker gene APH(3)
II for kanamycin resistance and has been modified to contain
the scorable marker gene uidA encoding GUS (see Note 1).
Binary vectors can be introduced into Agrobacterium strains
by a number of methods such as electroporation or freeze/
thaw (see Note 2).
2.3
Stock Solutions
1. Kanamycin sulfate (50 mg/mL): Dissolve 5 g kanamycin sulfate powder in 100 mL of water, filter-sterilize, and freeze in
1015 mL aliquots in 25 mL screw-cap vials.
2. Gentamicin sulfate (25 mg/mL): Dissolve 250 mg gentamicin
sulfate powder in 10 mL of water, filter-sterilize, and store
frozen.
3. Timentin (100 mg/mL): Dissolve 6.2 g (two 3.1 g bottles) of
timentin powder in 62 mL of water, filter-sterilize, and freeze
in 1015 mL aliquots in 25 mL screw-cap vials.
4. Hygromycin B (12.5 mg/mL): Dissolve 125 mg hygromycin
B powder in 10 mL of water, filter-sterilize, and store frozen
(see Note 3).
232
5. Acetosyringone: Dissolve acetosyringone (3,5-dimethoxy-4hydroxyacetophenone) in ethanol to make a 100 mM

(19.6 mg/mL) solution. Do this in a capped centrifuge tube
and vortex so the ethanol does not evaporate. Seal the top well
with Parafilm or plastic wrap to prevent evaporation and store
6. Proline (100 mg/mL): Dissolve the powder in water,
filter-sterilize, and store at 4 C.
7. X-Gluc staining solution: Dissolve 5-bromo-4-chloro-3indolyl glucuronide (X-Gluc) in dimethylformamide to make a
0.3 % (w/v) solution. Dilute with 100 mM sodium phosphate
buffer (pH 7.0) containing 0.006 % Triton X-100 and 0.5 mM
K + Fe cyanide to make a 1 mM X-Gluc working solution.
Filter-sterilize and store refrigerated. Keep for at least 1 year.
8. Indole-3-butyric acid (IBA): Dissolve IBA potassium salt
(K-IBA) in water to give a 0.1 mg/mL stock solution.
9. 6-Benzylaminopurine (BAP): Dissolve BAP powder in a few
drops of 1 N KOH and dilute to volume with water to give a
1 mg/mL BAP stock solution.
2.4
Media
1. DriverKuniyuki walnut (DKW) basal medium (Sigma; cat.

no. D6162; PhytoTechnology Laboratories cat. no. D2470):
Dissolve DKW powder in 30 g/L sucrose in water, dilute to
volume, adjust pH to 5.5, add 2.1 g/L Gelzan (Caisson
Labs), Gelrite (Merck), Phytagel (Sigma), or other brand of
gellan gum to solidify, autoclave, and pour in 100 15 mm
Petri plates.
2. Agrobacterium liquid growth medium: Use either 523 [24]
medium or LuriaBertani (LB) [25] medium:
(a) 523 medium: 10 g/L sucrose, 8 g/L casein hydrolysate,
4 g/L yeast extract, 2.0 g/L K2HPO43H2O, and 0.15 g/L
MgSO4 in distilled water. Adjust pH to 7.1 and autoclave.
(b) LB medium: 10 g/L tryptone, 5 g/L yeast extract, and
10 g/L NaCl in distilled water. Adjust pH to between 6.8
and 7.2 and autoclave.
3. Agrobacterium growth plates (523 or LB): Prepare medium as
described above adding appropriate antibiotics for the vector
used and 15 g/L Bacto agar to solidify. Autoclave and pour in
100 15 mm Petri plates.
4. Virulence induction medium (IM): Prepare 100 mL or more
liquid DKW basal medium containing 30 g/L sucrose, 100 M
acetosyringone, and 1 mM proline. Adjust pH to 5.2 and
filter-sterilize. Store in refrigerator in sterile 50 mL capped
centrifuge tubes.
Walnut (Juglans)
233
5. Acetosyringone medium (AS) plates: Prepare DKW basal

medium containing 30 g/L sucrose and 100 M acetosyringone. Adjust pH to 5.5, add 2.1 g/L Gelrite, autoclave, and
pour in 100 15 mm Petri plates (see Note 4).
6. KAN/TIM selection medium: Prepare basal DKW with
30 g/L sucrose, adjust pH to 5.5, dispense into 1 L screw-cap
bottles (500 mL/bottle), add 1.05 g Gelrite to each bottle,
autoclave, and cool to 60 C in a water bath. Then add
200 mg/L pH adjusted (see Note 5), filter-sterilized kanamycin and 200 mg/L filter-sterilized timentin (see Note 6). Mix
thoroughly and pour into sterile 100 15 mm Petri plates.
When solidified, store refrigerated in the original plastic sleeves
until ready for use.
7. KAN only selection medium: The same medium as KAN/TIM
selection medium but without the timentin.
8. DKW shoot medium: Dissolve DKW basal medium powder
and 30 g/L sucrose in water and add 1 mg/L BAP and .01
mg/L IBA, dilute to volume, adjust pH to 5.5, and add 2.1
g/L Gelzan (Caisson Labs), Gelrite (Merck), Phytagel
(Sigma), or other brand of gellan gum to solidify. Microwave
until the medium boils, mix thoroughly on a stir plate, dispense into Magenta Corporation GA7 vessels (approx 30 mL
of medium each), and autoclave.
2.5 Other Supplies
and Chemicals
1. Sterile empty 100 15 mm Petri plates.

2. Sterile disposable 50 mL screw-cap centrifuge tubes.
3. Sterile disposable cotton-plugged 10 mL pipette.
4. Pipettors with sterile 1 mL and 200 L tips.
5. Sterile disposable 6-well Multiwell plates.
6. Sterile disposable 96-well Multiwell plates.
7. Filter paper or paper toweling disks cut to fit in 100 15 mm
Petri plates and autoclaved.
8. Filter paper or paper toweling disks cut to the diameter of the
wells of a 6-well plate and autoclaved.
9. 150 mm diameter desiccator (Nalgene; cat. no. 53150150).
10. Saturated ZnSO4 or NH4NO3 solution.
11. Driver Kuniyuki walnut (DKW) basal medium with vitamins
(PhytoTechnology Laboratories cat. no. D2470).
12. Magenta GA-7 vessels (Magenta Corp., Chicago, IL).
13. Ray Leach Cone-tainer SC-10 Super Cells (Hummert Corp).
234
Methods
3.1 Initiate or Obtain

Actively Multiplying
Walnut Somatic
Embryo Cultures
1. Surface-sterilize immature intact walnuts in 15 % Clorox (6 %

sodium hypochlorite) for 1015 min and rinse in sterile water.
2. Remove the zygotic embryos from the walnuts. To do this for
Persian walnuts, hold the nut with the blossom end up. Cut 1
or 2 mm into the issue with a scalpel several mm above the
midpoint (equator) and continue this cut all the way around
the nut. Twist the blade slightly to flip the blossom end off.
The embryo will be exposed in the center and can be excised
with a scalpel. For other species of walnut, shell hardening will
normally occur before the embryo is visible, but embryos can
be extracted by cracking the nuts in a vice. Embryos can be
most easily located and extracted if nuts are placed in the vice
with the blossom end up, the suture perpendicular to the face
of the vice, and then cracked using gentle pressure.
3. Culture zygotic embryos on basal DKW medium. Culture 15
embryos per plate, depending on the embryo size. Leave
12 cm of space between embryos to facilitate rescue of clean
embryos if one is contaminated during excision. Place the
embryos on the surface, not in the medium. The orientation is
not critical, but once established transfer embryos in the same
orientation so the same surface is always on the medium. Place
in the dark at room temperature.
4. If discoloration due to phenolic leakage occurs, transfer to
fresh medium daily until it stops and then weekly until somatic
embryogenesis is observed. Continue to transfer every
12 weeks, allowing embryos to multiply until enough material is available to proceed.
3.2 Agrobacterium
Preparation
1. Streak Agrobacterium from glycerol stock onto a 523 or LB

plate with appropriate antibiotics for the vector used. Incubate
at 2830 C for 2 days or until good bacterial growth occurs.
Then store refrigerated if a longer time period is required
before use.
2. For each construct to be used, inoculate liquid cultures (one or
two 50 mL conical tubes with approx 20 mL each liquid 523
or LB medium) with a loop of bacteria from the plates and
place the capped tubes on a rotary shaker at moderate speed
(200 rpm) at room temperature (about 25 C).
3. After approx 2 h, add the appropriate selective antibiotics for
the vector used and return to shaker.
4. After shaking overnight the bacterial cultures should be turbid.
Determine the A600 by reading a 1:10 diluted sample in a
spectrophotometer.
235
Walnut (Juglans)
5. Calculate the amount of Agrobacterium culture to be used to

obtain the desired volume of cocultivation suspension at the
desired bacterial concentration (an A600 reading of 0.5 is equivalent to 2.5 108 bacteria/mL) using the following formula:
( Amount
of suspension wanted ) ( A600 of desired conc.)
( A600
reading you get ) dilution factor
Example: You want to make 25 mL of cocultivation solution at

a concentration of 2.5 108 bacteria/mL. You used a 1:10
dilution in the spectrophotometer and got a reading of 0.371.
How much of the original culture do you need?
( 25 mL ) ( 0.5)
= 3.36 mL.
( 0.371) 10
6. If performing co-transformation, mix the two bacterial cultures
in a 1:1 ratio before preparing the final volume (see Note 7).
7. Using a sterile pipette, place the calculated volume of culture
solution into a sterile plastic-capped 50 mL centrifuge tube
and centrifuge sufficiently to lightly pellet the bacteria (e.g.,
10 min at 4,000 g).
8. Pour or pipette the supernatant into an autoclavable waste container and resuspend the pellet in the cocultivation medium.
The pellet is easier to resuspend in a small volume (0.5 mL first)
using a pipette tip. Then add the full volume. If needed, set up
a tube for a no-bacteria control using only cocultivation medium.
9. Return the tubes to the shaker until ready to use.
3.3
Cocultivation
1. Based on the number of genotypes to be transformed and the

number of vectors employed, determine the number of total
treatments.
2. Put sterile filter paper or paper towel disks in the bottom of the
appropriate number of wells in 6-well Multiwell plates. This will
make it easier to remove small embryos after cocultivation.
3. Select actively growing somatic embryos of the genotypes to
be used and for each vector to be used with that genotype, fill
a well to 2/3 full of embryos (see Note 8).
4. Dispense the appropriate Agrobacterium cocultivation suspension into each well using sterile 10 mL pipettes with cottonplugged ends (see Note 9). Allow to sit for at least 1015 min
or longer until ready for the next step (see Note 10).
5. Place sterile filter paper or paper towel disks in empty sterile
Petri platesone for each treatmentand label them.
236
6. Remove as much excess cocultivation liquid as possible from

each well to an autoclavable waste container. Pipetting with
a 1 mL sterile tip works well. Keep the tip against the side to
avoid plugging with small embryos. To avoid any cross contamination from splashing, a sterile waste containersuch as
a Magenta container or small sterile jarfor each construct
is useful.
7. Transfer the embryos from the wells to the Petri plates. The
larger embryos can be picked up with sterile forceps. Then
carefully pick up the filter paper in the well with two forceps
and set the whole thing on the dry paper in the Petri plate.
This blots off additional excess liquid.
8. Transfer the embryos (about 10/platekeep them well spread
out) to plates of AS medium and place in the dark for 48 h
at 2022 C.
3.4 Selection
on Kanamycin
or Hygromycin
1. After cocultivating for 48 h, transfer the embryos to plates of

KAN/TIM or HYG/TIM selection medium containing
200 mg/L kanamycin or 25 mg/L hygromycin (see Note 11)
combined with 200 mg/L timentin (see Note 12). Incubate
the culture plates in the dark at room temperature.
2. Transfer embryos to fresh KAN/TIM medium after another
48 h and again after the first wk. This helps to reduce bacterial
overgrowth. Then transfer weekly for 812 weeks.
3. As new somatic embryos begin to emerge, separate them from
the parent (E0) embryos. Label these as E1 embryos. Repeat
this process for one more generation (E2 embryos).
4. After 68 weeks of selection, embryos can be moved to selection medium containing only the kanamycin or hygromycin.
Removing the timentin at this point ensures that the embryos
no longer have any residual Agrobacterium and avoids unnecessary expense for timentin.
3.5 Scoring for GUS

Expression
1. As E2 embryos emerge, test them for GUS (uidA) activity.

2. Pipette 40 L of X-Gluc working solution into wells of a sterile
96-well Multiwell plate.
3. Using a fine-point scalpel or by twisting off with a pair of forceps, remove a small piece of tissue (cotyledon tips work well)
from each well-formed and healthy E2 embryo of interest. Put
the tissue piece in the X-Gluc and label and mark the location
of the embryo from which it was excised.
4. Watch for blue color. Color change should be apparent in
10 min2 h.
5. If tissue turns blue, propagate more somatic embryos from the
tested E2 embryo (see Note 13).
Walnut (Juglans)
3.6 PCR
Confirmation
of Gene Insertion
237
1. Select GUS-positive, actively proliferating E2 embryos from

each embryo line for DNA isolation.
2. Isolate total DNA using a DNeasy Plant Mini Kit (Qiagen,
Valencia, CA) according to the manufacturers protocols.
3. Perform PCR using 2.5 L 10 PCR buffer containing 1.5 mM
MgCl2 (Applied Biosystems, Foster City, CA), 1.25 L of each
primer, 0.5 L dNTPs, and 0.2 L Taq DNA polymerase
(Applied Biosystems).
4. Primers for detection of nptII are (5 3):
(a) Aph3: ATGATTGAACAAGATGGATTGCACGCA
(b) Aph4: GAAGAACTCGTCAAGAAGGCGATAGA
5. Carry out amplifications in a GeneAmp PCR System 9700
(Applied Biosystems, Foster City, CA), pre-cycling for 2 min at
94 C, followed by 40 cycles of 1 min at 94 C, 1 min at 60 C,
and 1 min at 68 C.
6. Electrophorese PCR products using 0.8 % agarose gel, stained
with SYBR safe DNA gel stain, and visualize with a UV
illuminator.
7. Bands showing at 790 bp are indicative of nptII gene
insertion.
3.7 Germination
and Plant Production
After sufficient additional somatic embryos have developed, desiccate some to initiate germination. Choose well-formed somatic
embryos and place them in 35 10 mm sterile Petri plates with no
medium. Cover the plates but leave unsealed (do not wrap with
Parafilm) and place them in the dark at room temperature on the
rack of a well-sealed desiccator containing 1015 mL of saturated
ZnSO4 or NH4NO3 in the bottom.
1. After 27 days, when the embryos become opaque white with
the consistency of popcorn but before they brown, remove the
embryos from the desiccator and place them on DKW shoot
medium in Magenta GA-7 vessels or glass jars with similar
headspace. Culture at room temperature under cool white fluorescent lights (16 h/day photoperiod, approx 100 mol/
m2/s) for 28 weeks.
2. Most embryos will produce roots, but typically fewer than
10 % of embryos develop shoots. Roots will usually emerge
from embryos in a week to 10 days. A few shoot buds may also
begin to push quickly. In this case, the plants should be
removed from the medium as soon as possible and planted in
potting soil. If the embryos are left on the shoot medium, the
roots begin to deteriorate but more shoot buds will push.
These can be excised and micropropagated. Alternatively
embryos can be placed on shoot medium for 1 week to initiate
238
germination and then transferred to DKW basal medium. This

will not push as many shoots but will give more intact plants.
3. Embryos that develop both shoots and roots can be transplanted to any well-drained potting soil, for example, UC Mix
(25:42:33 % sandfir barkpeat moss). Plant in a container that
drains well, for example, Super Cell (8.5 1.5 in.) containers
from Hummert. Plastic cups with holes punched in the
bottoms work for small numbers.
4. To acclimatize, keep plants at 100 % humidity for 2 weeks and
then gradually reduce the humidity. Covering small pots with
plastic bags works well for small numbers. Then gradually open
the bags over a 2-week period by creating small holes and then
enlarging them, until the plants are fully acclimated. For larger
numbers, place potted plants in a fog (not mist) chamber for
2 weeks and then keep moist (fog if possible) on an open bench
and reduce humidity gradually over the next 2 weeks. Water
and fertilize daily with half-strength Hoaglands solution,
Miracle-Gro, or other commercially available complete fertilizer. Keep plants under 16 h photoperiod at 2528 C.
If under artificial light, provide as much light as possible. If in
the greenhouse, whitewash the glass or provide shade cloth
during the summer.
5. Established plants can be repotted to larger containers as
needed and maintained in a greenhouse or lath house.
Notes
1. Walnut is susceptible to wide variety of Agrobacterium strains.
This was discussed in an earlier publication [23] where we
showed the susceptibility of walnut vegetative tissues to a variety of strains. Among the strains that are particularly infective
are the derivatives of A281, A6, and C58. We have used mainly
the disarmed versions of A281 and C58 in all of our transformation experiments. With the exception of apical meristems,
we found most vegetative tissues quite susceptible to the infection with Agrobacterium including somatic embryos; the latter
was noted in our earlier publication [6]. The nptII gene works
when higher concentrations of kanamycin are used, typically
100 g and above. Lower concentrations do not work particularly well. Because of the weak selection with kanamycin and
the variability in the efficiency of transformation this may produce, we used GUS to confirm the transformants. Among the
GUS constructs, the gene that contains an intron has the least
background, but the others work as well too.
2. We use electroporation to introduce DNA into Agrobacterium.
Briefly, 1 L of plasmid DNA (10100 ng) is added to
Walnut (Juglans)
239
Agrobacterium competent cells. The mixture is placed on ice

for 2 min before being transferred to a precooled 0.2 cm electroporation cuvette (Bio-Rad). Apply voltage with settings at
2.5 kV (field strength), 25 F (capacitance), and 400 (resistance) at time constants of 812 m/s. One milliliter of YEPrich media is added to the electroporated cell/DNA mixture.
Incubate it with shaking at room temperature for 45 min and
then plate on selective media.
3. Hygromycin B can serve as an alternative selectable marker in
place of kanamycin or as a second selectable marker if performing co-transformation to insert two genes simultaneously.
4. The 100 mM acetosyringone stock should be at room temperature. Be sure it is in suspension. If it has been cold, you
may need to warm it in warm water and vortex briefly to resuspend. To make 100 M acetosyringone medium (AS medium),
add this stock to DKW basal medium before autoclaving.
5. Kanamycin sulfate in solution has a very high pH. If used at a
concentration greater than 100 mg/L for selection, the kanamycin begins to raise the pH of the medium, altering the salt
solubility and gelling properties. For this reason, one may prefer to adjust the pH of the kanamycin stock solution to 5.5. To
do so, dissolve the kanamycin powder in water to about half
the desired final volume, adjust to pH 5.5 using 1 N HCL, and
dilute with water to final volume.
6. Both cefotaxime and carbenicillin were tried initially.
Carbenicillin showed an auxin-like effect that reduced embryo
quality and its use was abandoned. Cefotaxime actually
improves both the quality and the multiplication rate of nontransformed embryos but is not used for routine culture
because of expense. Subsequently timentin has proven more
effective in suppressing Agrobacterium and is now the preferred antibiotic for this purpose when transforming walnut
somatic embryos.
7. When using co-transformation to simultaneously insert two
genes, follow the procedures in Subheading 3.2 to prepare
each bacterial culture separately. Then mix the two cultures in
a 1:1 ratio based on bacterial concentration. We tried mixing in
a 3:1 ratio, but the 1:1 ratio gave higher transformation efficiency. Co-transformation requires a different selectable
marker in each vector used (e.g., kanamycin in one vector and
hygromycin in the other) or a selectable marker in one vector
and selection by PCR for the second trait. If both vectors carry
the same selectable marker, it is not possible to use that marker
to identify embryos with both genes of interest.
8. It is helpful to pick out embryos to use ahead of time and place
them on plates of DKW basal medium. This will give you an
240
idea of how many you will have to work with before you get
too far into the rest of the work. If you need more, wait another
wk or lower your selection standards. To achieve the best transformation efficiency, it is important to use rapidly multiplying
embryos. Embryos multiply continuously and a culture will
have a mixture of all sizes, ages, and qualities of embryos.
If you want to measure transformation rates and timing or otherwise need uniform initial material for experimental purpose,
choose small, white (25 mm) embryos of good somatic
embryo form (two visible cotyledons) and semitranslucent
rather than ivory white opaque appearance. This gives starting
material that is distinct and can be counted easily, and these
embryos will continue to multiply well. Opaque white embryos
often move toward germination and produce fewer new
embryos. Once you have selected the embryos, distribute them
equally across treatments. Mark one or more plates for each
treatment and then select similar sets of embryos to be used for
each treatment. Continue this process until all the embryos are
assigned to a treatment. Be very careful with your sterile technique because you can contaminate everything during this
process. If the goal is only to obtain some transformants, use
any rapidly multiplying embryo culture material except browning older embryos.
9. Do this soon after placing embryos in the wells so they dont
dry out. Use enough medium to cover the embryos (approx
8 mL/well) if you have enough; otherwise, distribute the
medium over the embryos so they all get wet. Label carefully
and be sure to avoid cross contamination. You may want to use
a different plate for each vector.
10. Physical wounding is not necessary and is, in fact, detrimental
to successful transformation. Wound sites develop callus rather
than new somatic embryos.
11. We tested the efficiency of applying kanamycin immediately
after cocultivation vs applying at a later stage. Early application
gave a better yield of transformants. Appropriate kanamycin
and hygromycin concentrations were determined by performing kill curves on untransformed embryos (unpublished data).
12. Transfer embryos in a consistent pattern on each plate so that
if resistant bacteria begin to multiply, they are not moved to all
the embryos on the plate.
13. The X-Gluc is not always toxic. If you use a filter-sterilized
X-Gluc solution, dispense it into sterile wells, and return the
tissue to selection medium as soon as the blue color becomes
apparent, then tissue pieces that turn blue can sometimes
themselves develop embryogenic cultures in addition to using
the embryo from which it was excised.
Walnut (Juglans)
241
References
1. McGranahan GH, Tulecke W, Arulsekar S,
Hansen JJ (1986) Intergeneric hybridization in
the Juglandaceae: Pterocarya sp. x Juglans
regia. J Am Soc HortSci 111:627630
2. Driver JA, Kuniyuki AH (1984) In vitro propagation of Paradox walnut (Juglans hindsii x
Juglans regia) rootstock. HortSci 19:507509
3. McGranahan GH, Leslie CA, Driver JA (1988)
In vitro propagation of mature persian walnut
cultivars. HortSci 23:220
4. Tulecke W, McGranahan GH (1985) Somatic
embryogenesis and plant regeneration from
cotyledons of walnut, Juglans regia L. Plant Sci
(Limerick) 40:5764
5. Tulecke W, McGranahan GH, Ahmadi H
(1988) Regeneration by somatic embryogenesis of triploid plants from endosperm of walnut,
Juglans regia L. cultivar Manregian.. Plant
Cell Rep 7:301304
6. McGranahan GH, Leslie CA, Uratsu SL,
Martin
LA,
Dandekar
AM
(1988)
Agrobacterium mediated transformation of
walnut somatic embryos and regeneration of
transgenic plants. Nat Biotechnol 6:800804
7. McGranahan GH, Leslie CA, Uratsu SL,
Dandekar AM (1990) Improved efficiency of
the walnut somatic embryo gene transfer system. Plant Cell Rep 8:512516
8. Dandekar AM, McGranahan GH, Vail PV,
Uratsu SL, Leslie C, Tebbets JS (1994) Low
levels of expression of wild type Bacillus
thuringiensis var. Kurstaki cryIA(c) sequences
in transgenic walnut somatic embryos. Plant
Sci 96:151162
9. Dandekar AM, McGranahan GH, Vail PV,
Uratsu SL, Leslie CA, Tebbets JS (1998)
High levels of expression of full-length
cryIA(c) gene from Bacillus thuringiensis in
transgenic somatic walnut embryos. Plant Sci
131:181193
10. Vahdati K, McKenna JR, Dandekar AM et al
(2002) Rooting and other characteristics of a
transgenic walnut hybrid (Juglans hindsii x J.
regia) rootstock expressing rolABC. J Am Soc
HortSci 127:724728
11. Escobar MA, Leslie CA, McGranahan GH,
Dandekar AM (2002) Silencing crown gall disease in walnut (Juglans regia L.). Plant Sci
163:591597
12. Walawage SL, Britton MT, Leslie CA, Uratsu
SL, Li Y (2013) Stacking resistance to crown
gall and nematodes in walnut rootstocks. BMC
Genomics 14:668
13. Polito VS, McGranahan GH, Pinney K,
Leslie C (1989) Origin of somatic embryos
14.
15.
16.
17.
18.
19.
20.
21.
22.
23.
24.
25.
from repetitively embryogenic cultures of

walnut (Juglans regia L.)implications for
Agrobacterium-mediated
transformation.
Jefferson RA (1987) Assaying chimeric genes
Mol Biol Rep 5:387405
Escobar MA, Park J-I, Polito VS et al (2000)
Using GFP as a scorable marker in walnut
somatic embryo transformation. Annal Bot
(London) 85:831835
Leslie C, McGranahan G, Mendum ML (1997)
Genetic engineering of walnut (Juglans regia
L.). In: Gomes Pereira JA (ed) Acta horticulturae. ISHS, Alcobaca, Portugal, pp 3341
Bosela MJ, Smagh GS, Michler CH (2004)
Genetic transformation of black walnut
(Juglans nigra). In: Michler CH (ed) Black
walnut in a new century: proceedings of the
6th walnut council research symposium. North
Central Research Station, Forest Service,
USDA, Lafayette, IN, pp 4558
McGranahan G, Leslie CA, Dandekar AM,
Uratsu SL, Yates IE (1993) Transformation of
pecan and regeneration of transgenic plants.
Reil WO, Leslie CA, Forde HI, McKenna JR
(1998) Propagation. In: Ramos DE (ed)
Walnut production manual. Division of
Agriculture and Natural Resources, University
of California, Oakland, CA, pp 7183
Hood EA, Helmer GL, Fraley RT, Chilton
MD
(1986)
The
hypervirulence
of
Agrobacterium tumefaciens A281 is encoded in
a region of pTiBo542 outside the T-DNA.
J Bacteriol 168:12911301
Dandekar AM, Martin LA, McGranahan GH
(1988) Genetic transformation and foreign
gene expression in walnut tissue. J Am Soc
HortSci 113:945949
Van Larebeke N, Engler G, Holsters M, den
Elsacker V, Zaenen I, Schilperoort RA, Schell J
(1974) Large plasmid in Agrobacterium tumefaciens essential for crown gall-inducing ability.
Nature 252:169170
McBride KE, Summerfelt KR (1990) Improved
binary vectors for Agrobacterium-mediated
plant transformation. Plant Mol Biol 14:
269276
Rodriguez RL, Tait RC (1983) Recombinant
DNA techniques: an introduction. Benjamin
Cummings, Menlo Park, CA
Sambrook J, Fritsch EF, Maniatis T (1989)
Molecular cloninga laboratory manual. Cold
Spring Harbor Press, Cold Spring Harbor, NY
Part IV
Tropic Plants
Chapter 20
Citrus Transformation Using Juvenile Tissue Explants
Abstract
The most frequently used method for production of citrus transgenic plants is via Agrobacterium-mediated
transformation of tissues found on explants obtained from juvenile seedlings. Within the last decade and
especially within the last 56 years, this robust method was employed to produce thousands of transgenic
plants. With the newly applied screening methods that allow easier and faster detection of transgenic
shoots, estimates of transformation rate for some cultivars have gone up making this approach even more
attractive. Although adjustments have to be made regarding the (varietal) source of the starting material
and Agrobacterium strain used in each experiment preformed, the major steps of this procedure have not
changed significantly if at all. Transgenic citrus plants produced this way belong to cultivars of rootstocks,
sweet oranges, grapefruits, mandarins, limes, and lemons.
Key words Agrobacterium tumefaciens, Citrus, Genetic transformation, Juvenile tissue
Introduction
Researchers have found many applications for Agrobacteriummediated transformation of citrus. Out of two methods of transformation using stem explants as a starting material, the one based
on juvenile tissue is far more prevalent and efficient than the
method based on mature tissue. The latter will be discussed in
details in Chapter 21. As a reflection of the present state of citrus
industry worldwide, most of the efforts invested in production of
genetically modified citrus are directed toward improvements of
tolerance to citrus diseases [18]. However, a plethora of genes
were introduced into citrus plants for the purpose of improvement
of tolerance to environmental stress [911], manipulation of hormonal balance [12, 13], alteration in development [14, 15], and
even changes in fruit flavor [16, 17].
In the previous edition of this chapter [18], the availability of
starting material was stated as a major advantage for this method
over the use of mature tissue explants. That statement still stands
firm. Extraction of seeds from fruit, seed processing, and their
245
246
successful germination under sterile conditions result in production

of ample quantities of explants for co-incubation with Agrobacterium.
Correct preparation of needed media and Agrobacterium culture(s)
accompanied with the proper handling of explants will yield a crop
of transgenic citrus shoots, and the success rate will mostly be determined by the genetic background of the cultivar used. Until
recently, -glucuronidase (GUS) assays [19] were used frequently
to screen for transgenic shoots. In our facility, for the last 4 years we
did not use GUS assay. Most of the shoots produced had either
green fluorescent protein (GFP; [20]) as a reporter gene or no
reporter gene at all. Shoots carrying the active gfp gene are selected
by visual inspection under the fluorescent microscope. For the
experiments where shoots without any reporter gene were being
produced, they were screened with the PCR-based method. Minute
amount of shoot tissue is used as a source of template in the PCR
reaction representing the first round of selection. Shoots selected as
putatively positive are grafted and grown until enough tissue can be
harvested from leaves for genomic DNA (gDNA) extraction so that
second round of PCR selection can be performed. Only plants that
provide a source of template resulting in positive PCR in both
rounds are considered transgenic. PCR-based screening allows
detection of inserted sequences within the hosts genome without
interference of expression controlling factors that can sometimes
hinder function of reporter genes that are used for selection of
transformed shoots. For that reason, we have seen the increase in
transformation success rate compared to period when we used only
reporter gene-based screening.
Transgenic citrus plants produced with this method take
56 years to flower and fruit due to the juvenile nature of explants
used as starting material. A trait improvement in any citrus plant
due to introduction of transgene can be approved/accepted only if
it does not interfere with the fruit and juice quality. A protracted
period of time needed before evaluation of commercial traits of
transgenic citrus fruit calls for acceleration of this process through
definition of new method that will make these plants flower earlier.
Despite this drawback, production of transgenic citrus plants with
the use of juvenile stem explants remains a very popular way of getting relatively quickly high number of transgenic plants to be tested
in the proof-of-concept experiments for different trait improvements. It is an efficient and non-expensive method that can be
adopted by most laboratories in the world without substantial
financial and labor investment.
2
2.1
Materials
Plant Material
1. Seeds are obtained by extraction from harvested fruit.

Extraction can be facilitated with the use of a citrus juicer
(see Note 1). Seeds of rootstocks are also available for sale from
247
specialized nurseries. For these experiments, seeds from

Duncan grapefruit (Citrus paradisi) were used.
2. Stems of etiolated plants germinated from seeds are cut into
segments that are 1520 mm in length and represent material
that will be used for incubation with Agrobacterium.
2.2 Agrobacterium
Strain and Plasmid
1. Multiple strains of Agrobacterium are used in our facility. For

the experiment described in this chapter, EHA105 [21] was
used.
2. The binary vector called pX20 was mobilized into EHA105
strain (see Note 2). Information about the gene within the vector is proprietary and the vector itself is the derivative of
pBI121 (originally available from Clontech Laboratories,
Mountain View, CA).
2.3 Media and Stock

Solutions
1. 1 Murashige and Skoog (MS) [22] basal medium.

2. 1 MS basal salt mixture.
3. 100 Murashige and Tucker (MT) [23] vitamin stock: 10 g/L
of myoinositol, 1 g/L of thiamine HCl, 1 g/L of pyridoxine
HCl, 0.5 g/L of nicotinic acid, and 0.2 g/L of glycine.
Dissolve in water and store at 4 C.
4. Seed germination medium: 1 MS basal medium with 25 g/L
of sucrose and 8 g/L of agar, pH 5.8. Glass tubes
(25 mm 150 mm) with this medium are stored at room temperature and used within 23 days after preparation.
5. Stock solutions of growth substances: 1 mg/mL of
6-benzylaminopurine (BA), 1 mg/mL of -naphthaleneacetic
acid (NAA), and 1 mg/mL of 2,4-dichlorophenoxyacetic acid
(2,4-D). Prepare by dissolving the powder in couple of drops of
5 M NaOH and bring to final volume with water. Store at 4 C.
6. Acetosyringone stock solution: 9.8 mg/mL. Dissolve 196 mg
of acetosyringone powder in 20 mL of 50 % ethanol. Store
at 20 C.
7. Cocultivation medium (CCM): MS medium plus 3 mg/L of
BA (3 mL of BA stock solution), 0.1 mg/L of NAA (0.1 mL
of NAA stock solution), 0.5 mg/L of 2,4-D (0.5 mL of 2,4-D
stock solution), 19.6 mg/L of acetosyringone (2 mL of acetosyringone stock solution), and 8 g/L of agar, pH 6. Petri
dishes (15 mm 100 mm) with this medium are kept at room
temperature for a maximum of 3 weeks (see Note 3).
8. Regeneration medium (RM): MS medium plus 3 mg/L of BA
(3 mL of BA stock solution), 0.5 mg/L of NAA (0.5 mL of
NAA stock solution), 333 mg/L of cefotaxime (1.33 mL
of cefotaxime stock solution), 8 g/L of agar, and a choice of
other appropriate antibiotics, pH 6. For the experiments
described herein, we supplemented RM with 70 mg/L of
248
kanamycin (1.4 mL of kanamycin stock solution). Petri dishes

(20 mm 100 mm) with this medium are stored at room temperature for a maximum of 7 days.
9. Growth medium (GM): MS medium plus 50 mg/L of cefotaxime (0.2 mL of cefotaxime stock solution), 20 mg/L of
kanamycin (0.4 mL of kanamycin stock solution), and 8 g/L
of agar, pH 5.8. Petri dishes (20 mm 100 mm) with this
medium are kept at room temperature for up to 4 weeks.
10. Grafting medium: MS salts, Murashige and Tucker [23] vitamins, 70 g/L sucrose, and 8 g/L of agar, pH 5.8. Glass tubes
(25 mm 150 mm) with this medium are kept at room temperature for up to 4 weeks.
11. YEP-Agrobacterium cultivation medium [24]: 10 g/L of bacteriological peptone, 10 g/L of yeast extract, and 5 g/L of
NaCl, pH 7. For solid medium add 15 g/L of agar. For the
Agrobacterium strains used in experiments, YEP was supplemented with 50 mg/L of rifampicin (1 mL of rifampicin stock
solution) and 50 mg/L of kanamycin (1 mL of kanamycin
stock solution). Plates (15 mm 100 mm) with this medium
are kept at 4 C for up to 4 weeks.
12. Stock solutions of antibiotics: cefotaxime stock of 250 mg/mL
made by dissolving cefotaxime in water, filter-sterilized and kept
at 20 C. Rifampicin (Rif) stock of 50 mg/mL made by dissolving rifampicin in dimethyl sulfoxide; kept at 20 C. Kanamycin
(Kan) stock of 50 mg/mL made by dissolving kanamycin sulfate
in water; filter-sterilized and kept at 20 C.
13. Phire hot start DNA polymerase: Thermo Scientific, catalog
number F-122L (see Note 4).
14. Primers for the virG gene PCR reaction: forward CTGGC
GGCAAAGTCTGAT (Tm = 55.5 C); reverse TGTCGTAA
ACCTCCTCGT (Tm = 52.9 C).
All media are autoclaved at 116 C and 1.5 bar for 20 min.
Growth substances are added to the medium before autoclaving.
Acetosyringone and antibiotics are added to the medium after it
was autoclaved and cooled down to 55 C.
Methods
3.1 Preparation
of Plant Material
1. Extracted (or purchased) seeds are peeled and surface-sterilized

by shaking for 15 min in 20 % solution of commercial bleach.
These seeds are then rinsed with sterile water three times
(20 min each rinse).
2. Place two seeds per glass tube containing Seed Germination
medium (see Fig. 1a). Cap the tubes containing seeds, seal
them with Nescofilm, and incubate them in the dark at room
249
Fig. 1 Photographs of materials used in different phases of citrus transformation. (a) Processed seeds 4 days
after planting; (b) 37-day-old seedlings ready for cutting; (c) explants after incubation with Agrobacterium;
(d) explants with sprouted shoots 35 days after cocultivation with Agrobacterium; (e) plate with harvested
shoots; (f) transgenic shoot 14 days after grafting in vitro
250
temperature (25 4 C) for 5 weeks. During this period,

seedlings will germinate from the seeds and grow to be about
1012 cm long (see Fig. 1b).
3. On the day of the experiment, take seedlings out of the tube
using sterile forceps and place them on sterilized paper plates.
4. Using a sterile surgical blade mounted on a scalpel handle,
remove root, a portion of the stem carrying cotyledons, and
apical hook.
5. Cut the remaining seedling into pieces (about 15 mm long, see
Fig. 1c) so that both ends of each explant are slanted (see Note 5).
6. Place explants (no more than 250 pieces) in a Petri dish
(20 mm 100 mm) containing liquid CCM (about 30 mL)
and leave them there (usually 13 h) until the time of transfer
to the Agrobacterium suspension.
3.2 Preparation
of Agrobacterium
Cultures
1. Two days before the experiment (see Note 6), start liquid cultures of Agrobacterium by inoculating 50 mL of YEP + Rif + Kan
medium with one colony in 125 mL Erlenmeyer flask. These
cultures are placed in an incubator that maintains the temperature at 28 C and shaking speed at 220 rpm.
2. One day before the experiment, examine the culture, and if it
appears dense and opaque (optical density OD600 higher than
1), replenish the medium and antibiotics in the bacterial culture. Take 2 mL of growing culture using a sterile pipette and
discard the rest. Use the culture from the pipette as an inoculum for the new 50 mL culture with fresh YEP and antibiotics.
If the culture is growing slowly and is translucent, leave it in
the incubator without changing the medium or incubation
conditions.
3. On the day of the transformation experiment, examine
Agrobacterium culture. It should be growing vigorously at this
time. Replenish the medium in the same flask by using 3 mL
from growing culture and add 50 mL of fresh YEP (as described
in step 2) supplemented with antibiotics to obtain actively
growing bacteria for maximum effect at the desired time.
Allow this culture to grow for additional 45 h.
4. Harvest 35 mL of Agrobacterium culture by centrifuging it at
3,000 g for 10 min then resuspend the pelleted bacteria in
35 mL of liquid CCM medium.
5. The optical density (OD600) of resuspended culture is measured and adjusted to the desired level with additional amounts
of CCM. Choice of citrus cultivar affects the optical density of
bacterial suspension used in the experiment (see Note 7). For
the series of experiments presented herein, we have adjusted
OD600 to 0.7.
3.3 Co-incubation
of Explants
with Bacteria
251
1. Take a group of explants (about 50) out of the plate with CCM
and place them on sterilized paper towel to remove most of
CCM liquid. This step (takes about 1 min) is necessary to
avoid further dilution of bacterial suspension by each consecutive group of explants carrying some CCM.
2. Transfer the explants to the Petri dish (20 mm 100 mm) with
30 mL of Agrobacterium suspension where they should be
soaked for 12 min.
3. Following co-incubation with bacteria, place the explants on
sterilized paper towels again to remove the excess of bacterial
suspension. Since in the next step explants are placed on solid
CCM medium that does not contain any antibiotics, getting
rid of excess of bacteria is needed to prevent their overgrowth
that may cause loss of the explants.
4. Place 16 infected explants on plate with solid CCM. Seal plates
containing the explants with Nescofilm and place them in the
incubator for 2 days. Temperature in the incubator is maintained at 26.1 C for 16 h photoperiod (35 mol/m2/s) and
at 24.5 C during 8 h of dark period.
5. Transfer explants from plates with CCM to RM medium, seal
plates, and leave them in the incubator for about 5 weeks.
Incubation conditions same as in step 4. Shoots should be easy
to count and harvest at this time as they are 47 mm in length
(see Fig 1d).
3.4 Detection
of Reporter Gene
in Transgenic Shoots
(Green Fluorescent
Protein, GFP)
1. For detection of GFP [20] as a reporter gene for transformation, observe shoots under the fluorescent microscope.
This is a binocular microscope that has a source of blue light
attached to it. When blue light hits molecules of GFP, it
excites them to emit green light. As a result of the presence
of GFP in transgenic tissue, shoots appear completely green,
light pink, or red with green patches of different sizes. Under
the same conditions, wild-type shoots appear red because
chlorophyll emits red light after excitation with blue light.
The pink color of shoots indicates presence of low levels of
GFP in the tissue and the concomitant emission of light by
both GFP and chlorophyll.
2. Following selection, excise transgenic shoots from the explants
and place them on GM medium (see Note 8).
3.5 Primary PCRBased Screen

for the Presence
of Transgene
in the Tissue of Shoots
1. The shoots used in this test are harvested by excising them

from the explants and culturing them on GM medium (see
Fig. 1e). Depending on the size of shoots and workers ability
to manipulate small material, shoots can be used immediately
or left on this plate for 34 weeks.
252
Fig. 2 Photograph of the shoot with the corked-out circular piece of tissue that
will be used for the PCR-based primary screen for transgenic shoots. Diameter
of the cork borer is 0.5 mm
2. Carefully cork out (see Fig. 2) a piece of leaf and plunge it into
already prepared PCR mix. This test is based on the activity of
Phire hot start II DNA polymerase (see Fig. 3 and Note 9).
Cork borers used for removal of small explants from leaves of
shoots have a diameter of the cutting tube of 0.5 mm (Harris
Uni-Core 0.5 mm multipurpose sampling tool, see Note 10).
3.6 Micrografting
of Transgenic Shoots
In Vitro
1. Plants that are used as a rootstock are grown the same way as
the plants that are used to obtain explants (see Subheading 3.1),
meaning they should be fully etiolated on the day of grafting.
For rootstock, select only plants which have at least 5 cm
of straight shoot and root when measured from cotyledons
(see Note 11).
2. Pull the plant out of the tube with sterile forceps, make a transverse cut about 2 cm above cotyledons with a sterile surgical
blade mounted on scalpel handle, and discard the stem.
3. Cut the root about 45 cm below cotyledons and remove root
hairs if there are any. At this point, everything should be done
as quickly as possible to prevent the drying of cut surfaces of
plant tissue.
4. Take the putative transgenic shoot and carefully cut it at the
bottom so that lowest portion of the stem appears as a letter V.
5. Make a 23 mm deep longitudinal cut along the center of the
cut surface of rootstock with a surgical blade. While the blade
is in the rootstock, wiggle it to the left and right so that the slit
widens a little and is ready to accept the graft.
6. Insert the wedged part of the shoot into the slit of rootstock,
and transfer this plant into the tube with grafting medium.
253
Fig. 3 Photographs of two agarose gels with products of PCR reactions performed as a part of primary screen
for transgenic shoots. All seven shoots that provided corked-out explants for positive PCR reactions shown
on the photo were tested in additional PCR for the native Agrobacterium gene. Especially suspicious were PCR
products in lanes 7 and 25, and indeed it turned out that the shoot number 7 was not transgenic (see Note 9).
Numbers associated with lanes designate the number of shoots tested. Lane labeled H2O was loaded with the
products of PCR reaction where water was added instead of DNA sample. Lane labeled (+) was loaded with
the products of PCR reaction where the DNA of binary vector that was mobilized into Agrobacterium was used
as a template
We micrograft almost all of our transgenic shoots on Carrizo

rootstock. Tubes with grafted plants are left in the incubator
for 34 weeks. During this time, scions that have been successfully grafted develop into young plants, and roots of the rootstock increase in size and grow secondary roots and root hairs.
Temperature in the incubator where tubes with these plants
are kept is maintained at 26.1 C for 16 h photoperiod
(35 mol/m2/s) and at 24.5 C during 8 h of dark period.
Our typical rate of grafting success is about 75 % (see Fig. 1f).
7. Grafted plantlets that have grown in vitro to the size of 34 cm
in height should be transferred to soil (see Note 12) and
grown in the laboratory on the light bench at room temperature (25 4 C) and under constant white light (55 mol/
m2/s) for 23 months.
8. During this time, plants are fertilized three times a week with
a fertilizer solution (1 g/L of 15:30:15 NPK). The plastic pots
(6.5 cm 6.5 cm 6.5 cm) with grafted plants are kept in the
254
tray, and fertilizer solution leaching through the soil gets

collected at the bottom. Most of this solution should be poured
out of tray (twice a week) except the volume sufficient enough
to cover the bottom (a few millimeters deep) (see Note 12).
Notes
1. If you are extracting larger numbers of seeds from freshly harvested fruit on a regular basis, buy a commercial grade juicer as
those marketed for household use have motors that burn out
easily.
2. Binary vectors were mobilized into Agrobacterium by a freezeand-thaw method [25]. Once the binary vector of interest has
been mobilized into an appropriate strain, two stocks of newly
created strains are made. Glycerol stock is kept at 80 C and
working stock is kept at 4 C on plates of YEP medium supplemented with appropriate antibiotics.
3. Liquid CCM is used for temporary incubation of cut explants
before they get infected in Agrobacterium suspension. Solid
CCM is used for incubation of explants following incubation
with Agrobacterium.
4. Phire hot start DNA polymerase is an enzyme with very high
activity due to the presence of special DNA-binding domain.
Because of high potency, this enzyme can multiply DNA molecules from a small number of templates and is therefore useful
for our application where small piece of leaf tissue and not
isolated DNA serves as a source of template. The use and storage of both an enzyme and a buffer are done according to
manufacturers suggestions.
5. There is a report stating that transformation efficiency increases
if explants are cut longitudinally as a result of higher surface of
cambial tissue being exposed to action of Agrobacterium [26].
We confirmed these results (data not shown) but also noticed
that stems of many citrus cultivars are not sturdy enough to
sustain longitudinal cuts. For that reason, as well as for labor
efficiency, we chose not to cut explants longitudinally but
made slanted instead of transversal cuts on ends of explants,
thereby increasing the surface area of internal tissues that came
in contact with Agrobacterium.
6. Cultures of Agrobacterium start to lose their viability when
kept on YEP + Rif + Kan plates at 4 C for more than 3 weeks.
Because of that, it is prudent to start the cultures for experiments 2 days earlier to allow bacteria to attain vigorous growth;
a 24-h period may not be enough.
7. Although we never made exact calculations, we have noticed
that different cultivars of citrus go through co-incubation with
255
Agrobacterium differently. Carrizo citrange and all grapefruit

cultivars stand up well to treatment by EHA101 ([27], the
most virulent) strain of Agrobacterium. On the other hand,
cultivars of sweet orange and lemons do not stand coincubation with EHA101 well, and some explants (1020 %)
turn brown and shrivel within 23 weeks. For transformation
of these citrus cultivars, we use either EHA105 or AGL-1 [28]
strains. Also, for the latter, more sensitive cultivars, OD600 of
Agrobacterium suspension is usually set to 0.40.6 when using
EHA105 and at 0.6 with AGL-1. EHA101 suspension is used
with its OD600 set between 0.5 and 0.8.
8. GM medium is used for 23 week incubation of smaller shoots
harvested from the explants. This allows them to grow to a size
of 56 mm when they are easy to manipulate and be used in
primary PCR screen.
9. When running PCR reaction catalyzed by the Phire enzyme,
the PCR machine should be programmed according to manufacturers instructions as Phire has slightly different requirements regarding temperature and duration of annealing time
in comparison to other DNA polymerases used for PCR reactions. Activity of Phire is so high that it can amplify the
sequences present in just a few Agrobacterium cells that may
still be present on the leaf of shoot. In that case shoots that are
not transgenic may be counted as transgenic (see Fig. 2). All of
the shoots that appear positive in this test should be subjected to additional PCR for one of Agrobacterium genes not
residing on the binary vector (our choice was the VirG gene).
Sometimes the intensity of the band corresponding to the
amplicons in agarose gel of false-positive shoots can be as
bright as the intensity of bands of real positives.
10. Because PCR is a very sensitive detection method, it is important to clean the cork borers thoroughly before each sampling.
Between two samplings, submerge metal tips of cork borers
into the 3 % bleach for 2 h. After that, tap their tips against the
sterilized paper towel to remove any leftover of the bleach
solution. Turn the cork borers upside down and leave to dry in
the laminar flow hood until next use.
11. Tubes used for growth of grafted plants have special floaters
made out of circular, 9 cm in diameter filter paper. Liquid
medium should be poured into the tubes before the floaters
are installed as floaters need to stay dry. These floaters are made
as follows: paper is put over the top of the tube (the center of
the paper should overlap the center of the tube opening) and
pushed downwards so it wrinkles and folds around the tube,
and only a small platform covering the tube opening stays flat.
At this time, the paper looks like a makeshift cover for the
tube. The next step is to take a sharp object and make a hole
256
(23 mm) in the center platform part of the paper cover of

the tube. Paper is removed from the tube and pushed carefully
into the tube so the platform with the hole stays at the top and
is a few millimeters below the opening of the tube. Floater
prepared like this is ready to receive the rootstock with grafted
shoot and to be pushed to the bottom of the tube. Tubes are
capped and autoclaved after both medium and the floaters
have been put in. Because of this setup, it is necessary to have
the root of the rootstock plant straight so it can easily go
through the wrinkled part of the floater. Also, it is beneficial if
the stem of the rootstock is straight because the grafted shoot
stays in the center of the tube once the floater carrying the
rootstock is pushed down the tube and plunged into the
medium.
12. The word soil in the first sentence of Subheading 3.6, step 7 is
placed under quotations as we do not use soil but instead use
foam product that serves the role of artificial soil (Oasis
Rootcubes; Smithers-Oasis, Kent, OH). Drill the hole in the
center of foam cube and insert the root into it. Chip off small
chunks of foam from the other cube and push them into the
hole with the root so that root is in touch with the foam as
much as possible. The foam used for growth of plants in the
laboratory is devoid of any organic matter. For that reason,
frequency of fertilizing has to be high, but at the same time,
roots of grafted plants should not be kept in the environment
heavily saturated with water.
References
1. Soler N, Plomer M, Fagoaga C, Moreno P,
Navarro L, Flores R, Pea L (2012)
Transformation of Mexican lime with an
intron-hairpin construct expressing untranslatable versions of the genes coding for the three
silencing suppressors of Citrus tristeza virus
confers complete resistance to the virus. Plant
Biotech J 10:597608
2. Febres VJ, Lee RF, Moore GA (2008)
Transgenic resistance to Citrus tristeza virus in
grapefruit. Plant Cell Rep 27:93104
3. Reyes CA, Zanek MC, Velazquez K, Costa N,
Plata MI, Garcia ML (2011) Generation of
sweet orange transgenic lines and evaluation of
Citrus psorosis virus-derived resistance against
Psorosis A and Psorosis B. J Phytopath 159:
531537
4. Zhang X, Francis MI, Dawson WO, Graham
JH, Orbovi V, Triplett EW, Mou Z (2010)
Over-expression of the Arabidopsis NPR1 gene
in citrus increases resistance to citrus canker.
Eur J Plant Pathol 128:91100
5. Sendin LN, Filippone MP, Orce IG, Rigano L,

Enrique R, Pea L, Vojnov AA, Marano MR,
Castagnaro AP (2012) Transient expression of
pepper Bs2 gene in Citrus limon as an approach
to evaluate its utility for management of citrus
canker disease. Plant Pathol 61:648657
6. Mendes BMJ, Cardoso SC, Boscariol-Camargo
RL, Cruz RB, Mourao FAA, Bergamin A
(2010) Reduction in susceptibility to
Xanthomonas axonopodis pv. citri in transgenic
Citrus sinensis expressing the rice Xa21 gene.
Plant Pathol 59:6875
7. Barbosa-Mendes JM, Mourao FDA, Bergamin
A, Harakava R, Beer SV, Mendes BMJ (2009)
Genetic transformation of Citrus sinensis cv.
Hamlin with hrpN gene from Erwinia amylovora and evaluation of the transgenic lines
for resistance to citrus canker. Sci Hort 122:
109115
8. Mondal SN, Dutt M, Grosser JW, Dewdney
MM (2012) Transgenic citrus expressing the
antimicrobial gene Attacin E (attE) reduces
9.
10.
11.
12.
13.
14.
15.
16.
17.
the susceptibility of Duncan grapefruit to the

citrus scab caused by Elsinoe fawcettii. Eur J
Plant Pathol 133:391404
Molinari HBC, Marur CJ, Bespalhok JC,
Kobayashi AK, Pileggi M, Leite RP, Pereira
LFP, Vierira LGE (2004) Osmotic adjustment
in transgenic citrus rootstock Carrizo citrange
(Citrus sinensis Osb. x Poncirus trifoliata
L. Raf.) overproducing proline. Plant Sci
167:13751381
de Campos MKF, de Carvalho K, de Souza FS,
Marur CJ, Pereira LFP, Bespalhok JC, Vieira
LGE (2011) Drought tolerance and antioxidant enzymatic activity in transgenic Swingle
citrumelo plants over-accumulating proline.
Environ Exp Bot 72:242250
Fu X, Khan EU, Hu S, Fan Q, Liu J (2011)
Overexpression of the betaine aldehyde dehydrogenase gene from Atriplex hortensis
enhances salt tolerance in the transgenic trifoliate orange (Poncirus trifoliata L. Raf.). Environ
Exp Bot 74:106113
Fagoaga C, Tadeo FR, Iglesias DJ, Huerta L,
Lliso I, Vidal AM, Talon M, Navarro L, GarciaMartinez JL, Pea L (2007) Engineering of gibberellin levels in citrus by sense and antisense
overexpression of a GA 20-oxidase gene modifies plant architecture. J Exp Bot 58:14071420
Pasquali G, Orbovi V, Grosser JW (2009)
Transgenic grapefruit plants expressing the
PAPETALA3-IPTgp gene exhibit altered expression
of PR genes. PCTOC 97:215223
Pea L, Martin-Trillo M, Juarez J, Pina JA,
Navarro L, Martinez-Zapater JM (2001)
Constitutive expression of Arabidopsis LEAFY
or APETALA1 genes in citrus reduces their
generation time. Nature Biotech 19:263267
Endo T, Shimada T, Fujii H, Kobayashi Y,
Araki T, Omura M (2005) Ectopic expression
of an FT homolog from Citrus confers an early
flowering phenotype on trifoliate orange
(Poncirus trifoliata L. Raf.). Transgenic Res
14:703712
Koca U, Berhow MA, Febres VJ, Champ KI,
Carrillo-Mendoza O, Moore GA (2009)
Decreasing unpalatable flavonoid components
in Citrus: the effect of transformation construct. Physiol Plantarum 137:101114
Al Bachchu MA, Jin SB, Park JW, Boo KH,
Sun HJ, Kim YW, Lee HY, Riu KZ, Kim JH
(2011) Functional expression of Miraculin, a
18.
19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
257
taste-modifying
protein,
in
transgenic
Miyagawa Wase Satsuma mandarin (Citrus
unshiu Marc.). J Korean Soc Appl Biol Chem
54:2429
Orbovi V, Grosser JW (2006) Citrus: sweet
orange (Citrus sinensis L. Osbeck Valencia)
and Carrizo citrange [Citrus sinensis (L.)
Osbeck x Poncirus trifoliata (L.) Raf.]. In:
Wang K (ed) Agrobacterium protocol, Methods
in molecular biology. Humana Press Inc,
Totowa, NJ, pp 177189
Mankin SL, Thompson WL (2001) New green
fluorescent protein genes for plant transformation: intron-containing, ER-localized, and
soluble-modified. Plant Mol Biol Rep 19:
1326
2:208213
for rapid growth and bioassays and tobacco
tissue culture. Physiol Plant 15:473497
Murashige T, Tucker DPH (1969) Growth
factor requirements of Citrus tissue culture.
Proc 1st Int Citrus Simp 3:11551161
Sambrook J, Russell DW (2001) Molecular cloning - a laboratory manual. Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, NY
Walkerpeach
CR,
Velten
J
(1994)
Agrobacterium-mediated gene transfer to plant
cells: cointegrate and binary vector systems. In:
Plant molecular biology manual, vol B1. Kluwer
Academic Publishers, Belgium, pp 119
Yu C, Shu H, Chen C, Deng Z, Ling P, Gmitter
FG (2002) Factors affecting the efficiency of
Agrobacterium-mediated transformation in
sweet orange and citrange. Plant Cell Tissue
Organ Cult 71:147155
Hood EE, Helmer GL, Fraley RT, Chilton
M-D (1986) The hypervirulence of
region of pTiBo542 outside of T-DNA. J
Bacteriol 168:12831290
Lazo GR, Stein PA, Ludwig RA (1991) A
DNA transformation-competent Arabidopsis
library in Agrobacterium. Nat Biotechnol
9:963967
Chapter 21
Citrus Transformation Using Mature Tissue Explants
Vladimir Orbovic, Alka Shankar, Michael E. Peeples,
Calvin Hubbard, and Janice Zale
Abstract
Mature tissue protocol for production of transgenic Citrus plants via Agrobacterium-mediated transformation
uses explants derived from branches of mature, fruit-bearing trees. Through the multiple cleaning steps consisting of grafting of apical tip meristems on rootstock plants grown under sanitary conditions, mother
plants are produced that will serve as a source of budding material. These buds are grafted onto rootstock
plants grown under the same, highly sanitary conditions. Newly obtained, one meter tall, young grafted plants
serve as a source of explants for co-incubation experiments with Agrobacterium. Following successful
transformation with Agrobacterium, selected transgenic shoots are micrografted onto rootstock plants in vitro
where they are allowed to grow for a couple of months. Grafted transgenic plantlet together with the
associated rootstock plant is taken out of culture tubes, severed from the root, and regrafted in terra on a
1-year-old rootstock plant. With the application of proper horticultural techniques, such a plant will yield first
fruit about 1215 months later.
Key words Agrobacterium tumefaciens, Citrus, Genetic transformation, Mature tissue
Introduction
The method of using mature tissue explants for production of
Citrus transgenic plants via Agrobacterium-mediated transformation was described almost 15 years ago [1]. Despite the fact that it
cannot be considered as new, only a few laboratories have
attempted to employ this protocol with varying levels of success
[2, 3]. The most important advantage of this approach to producing genetically modified Citrus plants is that they will be fruiting
within short period of time of about 18 months (see Note 1).
Compared to the method of using juvenile tissue explants as a
starting material ([4], see associated chapter) in transformation
experiments, mature tissue transformation yields fruiting plants
34 times faster. Having transgenic plants that are true to type and
capable of producing fruit allows for rapid evaluation of commercially important traits of transgenic plants associated with fruit and
259
260
Vladimir Orbovic et al.
juice quality together with the trait that was being improved via
the introduction of transgene.
Production of starting material for co-incubation with
Agrobacterium in this protocol requires highly organized plantgrowing facility manned with skilled personnel. Uninterrupted
production of rootstock plants is a major part of this operation.
Rootstocks need to be available for grafting in batches that can
number up to 100 plants, which upon grafting will yield high
number of scion plants that will be cut into explants two times over
seven to eight months. Also, additional rootstock plants need to be
ready whenever there is a positively identified transgenic plant that
should be grafted in terra. Figure 1 depicts the phases of production and the growth of plants that will be cut into explants for coincubation experiments.
Having sufficient amounts of starting material for co-incubation
experiments will lead to success in transformation only if the quality of explants is at the most satisfactory level. The absence of any
microorganisms in the tissue of the plants to be cut into explants is
the crucial parameter of quality. As much as following good horticultural practices in growing these plants to be vigorous and of
proper size is important, it fades in comparison to making sure that
these plants, both rootstocks and scions, do not contract any infection before they get used in transformation protocol. From the
time of seed planting and germination of rootstock, and all phases
of growth, extreme care has to be exercised in keeping these plants
away from outside pests which could carry bacterial and/or fungal
infection. In our facility, plants are grown in walk-in chambers that
are contained within another building. Entrances to the building
and to all the rooms where different activities associated with the
maintenance of plants are performed are equipped with an air
curtain to prevent insects from entering. Growth rooms themselves do not have air curtains installed. All personnel working
within the facility wear protective/disposable coats and footwear
that is used only on those premises. A special system is in place to
purify water which is used for irrigation and fertigation and to feed
humidifiers that are operational within the growth chamber.
Because many pieces of equipment used for proper maintenance of
plants are technical in nature, support for this type of the facility
has to include a crew of maintenance personnel as well.
Although this methodology holds the promise of yielding fruiting Citrus plants within 1824 months, the relatively large initial
financial investment and low output have made its adoption rare.
Table 1 contains the data from two experiments that differ in choice
of binary vector. The vector named pTLAB21 carries a gene for green
fluorescent protein (GFP) between T-DNA borders [5], and pCAMBIA2301 binary vector is available commercially. High percentage
transformation rate recorded in the experiment where pTLAB21 vector was used is highly unusual and is most probably due to the small
number of shoots that were regenerated from explants.
261
Fig. 1 Different stages of production of plants that will be used as source of

explants for cocultivation with Agrobacterium. (a) Unwrapped grafted bud from
mother plant 3 weeks after grafting; (b) shoot sprouted from grafted bud
7 days after unwrapping; (c) same as (b) but 14 days after unwrapping; (d)
4-week-old branch; (e) 3-month-old plant ready to be cut into explants; (f) inset
from the photo in panel (e); (g) same as (f) but without leaves and thorns; (h)
explants on the SM plate. Scale lines: a, b, and c, 1 cm; d, f, g, and h, 5 cm; e,
15 cm
262
Table 1
Transformation rate recorded in two experiments with Hamlin sweet orange cultivar
Bin. vector
Number
of explants
Number
of sprouted
Number
of (+) shoots
Transformation
efficiency (%)
pCAMBIA2301
490
236
0.8
pTLAB21
530
16
12.8
Mature tissue transformation can complement juvenile tissue

methodology by quickly producing fruiting Citrus plants transformed with the gene proven to be of great value in the transgenic
plants obtained from seedling explants.
2
2.1
Materials
Plant Material
1. Seeds for the rootstock plants used for bud grafting to produce
plants that will be cut into explants are obtained from commercial nursery. For this purpose, we use Swingle citrumelo
[Citrus paradisi Poncirus trifoliata] and Citrus macrophylla
and obtain the seeds from Willits and Newcomb company
(Bakersfield, CA).
2. Seeds of Carrizo [Citrus sinensis (L.) Osbeck Poncirus trifoliata (L.) Raf.] rootstock used for micrografting of transgenic
shoots are obtained either from the nursery or by extraction
from harvested fruit. Plants propagated in the growth room by
bud grafting from clean mother plants came from the following clone of sweet orange (Citrus sinensis. L.) cultivars:
Hamlin 1-4-1. Although we presented here the data from
experiments with Hamlin, we also use different clones of
sweet orange cultivar Valencia and grapefruit (Citrus paradisi) cultivar Ray Ruby.
2.2 Agrobacterium
Strain and Plasmid
1. For the experiments described in this chapter, EHA101 [6]

and EHA105 [7] strains of Agrobacterium were used.
2. The binary vector called pTLAB21 [5] carries gfp and nptII
genes on T-DNA and a streptomycin-resistance gene for bacterial selection and was mobilized into EHA101 strain. The vector called pCAMBIA2301 (Cambia, Canberra, Australia)
carries gus and nptII genes on T-DNA and a kanamycinresistance gene for bacterial selection and was mobilized into
EHA105 strain (see Note 2).
2.3 Plant Tissue

Culture Media
and Stock Solutions
263
1. Seed germination medium (SGM): 4.3 g/L of Murashige

and Skoog (MS, [8]) basal salts mixture 8 g/L of agar,
pH 5.75.8.
2. Inoculation medium (IM): 4.3 g/L of MS salts, 10 mL/L of
White vitamin stock solution,10 mL/L of myoinositol, 30 g/L
of sucrose, pH 5.75.8.
3. Cocultivation medium (CCM): 4.3 g/L of MS salts, 10 mL/L
of White vitamin stock solution, 10 mL/L of myoinositol,
30 g/L of sucrose, 20 mL/L of 2,4-dichlorophenoxyacetic
acid (2,4-D; see Note 3), 20 mL/L of indole-3-acetic acid
(IAA), 10 mL/L of 2-isopentenyl-adenine (2,i-P), 8 g/L of
agar, pH 5.75.8.
4. Selection medium (SM): 4.3 g/L of MS salts, 10 mL/L of
White vitamin stock solution, 10 mL/L of myoinositol,
30 g/L of sucrose, 3 mg/L of 6-benzylaminopurine (BAP),
8 g/L of agar at pH 5.75.8, supplemented with 100 mg/L of
kanamycin sulfate, 250 mg/L of cefotaxime, and 250 mg/L of
vancomycin. Include Meropenem (10 mg/L) in the selection
medium only during the first 2 weeks of selection.
5. Grafting medium (in vitro): 4.3 g/L of MS salts, 10 mL/L of
White vitamin stock, 10 mL/L of myoinositol, 75 g/L of
sucrose, pH 5.75.8.
6. White vitamin stock [9]: 20 mg/L of thiamine HCl, 100 mg/L
pyridoxine HCl, 100 mg/L of nicotinic acid. Store at 4 C.
7. Myoinositol stock: 10 mg/L dissolved in deionized water.
Store at 4 C.
8. 2,4-D stock solution: 10 mg/100 mL. Prepare by dissolving
the powder in a few drops alcohol. Adjust volume with deionized water. Store at 4 C.
9. IAA stock solution: 10 mg/100 mL. Prepare by dissolving the
powder in a few drops 95 % ethyl alcohol. Adjust volume with
deionized water. Store at 4 C.
10. 2,i-P stock solution: 10 mg/100 mL. Prepare by dissolving in
few drops of 1 N NaOH and store at 4 C.
11. BAP stock solution: 10 mg/100 mL. Prepare by dissolving the
powder in a few drops of 1 N NaOH. Complete final volume
with deionized water. Store at 4 C.
12. Kanamycin sulfate stock solution: 100 mg/mL. Prepare by
dissolving 1 g of powder in 10 mL of sterile deionized water.
Sterilize by filtration through a 0.45 m membrane, make
1 mL aliquots in sterile Eppendorf tubes, and store at 20 C.
13. Cefotaxime stock solution: 250 mg/mL. Prepare by dissolving
1 g of powder in 4 mL of deionized distilled water. Sterilize by
264
filtration through a 0.45 m membrane, make 1 mL aliquots

in sterile Eppendorf tubes, and store at 20 C.
14. Vancomycin stock solution: 250 mg/mL. Prepare by using the
same method used for cefotaxime, aliquot, and store at 20 C.
15. Meropenem (USP, Rockville, MD): Prepare by dissolving
10 mg for 1 L of selection medium. Filter sterilize through
0.45 m membrane. Prepare as needed because it cannot be
stored.
All media are sterilized by autoclaving at 121 C for 20 min.
Antibiotics and temperature-sensitive plant growth regulators are
added to the autoclaved medium after reaching 40 C.
2.4 Culture Media
for A. tumefaciens
1. Liquid Luria broth (LB) medium: 20 g/L LB broth Vegitone.

2. Liquid Agrobacterium culture medium: LB medium containing 25 mg/L of kanamycin sulfate and 25 mg/L of nalidixic
acid (see Note 4). For solid LB culture medium, add 10 g/L
of agar, pH 7.5.
3. LB agar solid medium: 35 g/L LB agar Vegitone.
4. Liquid Leifert and Waites (LW) medium: 45.22 g/L of LW
mix.
5. Nalidixic acid stock solution: 25 mg/mL. Prepare by dissolving 250 mg of powder in a few drops of 1 N NaOH and then
add water to complete 10 mL. Sterilize by filtration, make
1 mL aliquots in sterile Eppendorf tubes, and store at 20 C.
All media are sterilized by autoclaving at 121 C for 20 min.
Antibiotics are added to the medium after autoclaving.
2.5 GUS Substrate

Solution
2.6 Growth Chamber

Care Supplies
To make 10 mL of GUS substrate solution, add 10.41 mg X-Gluc

(5-bromo-4-chloro-3-indolyl glucuronic acid cycloheximide salt),
400 L formamide (X-Gluc is dissolved in formamide), 1 mL Tris
(stock concentration 1 M), pH 7.0, 100 L NaCl (stock concentration 5 M), 100 L Triton X-100, 6.5 mg potassium hexacyanoferrate, sterile deionized water 8.4 mL. GUS solution is light
sensitive. Store in dark-walled vessel in the refrigerator.
1. Sunshine Pro Just Coir, 100 % organic coconut fiber.
2. Metro-Mix 930, 35 % composted pine bark, 30 % vermiculite,
25 % Canadian sphagnum peat moss, 10 % perlite, with dolomitic limestone, wetting agent, and a starter nutrient charge
added.
3. Harrells Slow Release, 16-5-10 (NPK), 1.735 % Ca,
0.65 % Mg, 0.13 % Cu, 1.56 % Fe, 0.13 % Mn, 0.003 % Mo,
0.13 % Zn.
265
4. Harrells MAX Minors, 1.00 % soluble Mg, 3.50 % combined

S, 0.02 % B, 0.25 % chelated Cu, 4.00 % chelated Fe, 1.00 %
chelated Mn, 0.0005 % Mo, 0.60 % chelated Zn.
5. Harrells MAX Non-Staining Iron, 6.00 % chelated Fe.
6. Pestrong Pro-Select Prill Dolomitic Limestone.
7. Aliette WDG (Bayer CropScience, Research Triangle, NC).
8. Crystal Blue Copper Sulfate, algaecide, 99.0 % copper sulfate
pentahydrate, 1.0 % other ingredients.
9. Ridomil Gold EC, fungicide, 47.6 % (R)-2-[(2,6dimethylphenyl)-methoxyacetylamino]-propionic acid methyl
ester, 1.4 % related compounds, 51.0 % inert ingredients.
10. Bed Bug Spray (JT Eaton & Co., Twinsburg, OH), 0.13 %
pyrethrins, 1.27 % piperonyl butoxide, 98.6 % other ingredients (see Note 5).
Methods
3.1 Preparation
and Growth of Plant
Material
3.1.1 Germination
of Seeds for Production
of Rootstock Plants
for Bud Grafting
1. Seeds of either Citrus macrophylla or Swingle citrumelo are

placed in a beaker with slightly soapy water and stirred for
3 min to clean the exterior and moisten the seed coat for easy
removal. The first seed coat is removed from the seeds using
forceps. Seeds are then sterilized in 10 % bleach for 10 min and
then rinsed five times with sterilized DI water.
2. One seed is placed in each cone-tainer containing sterilized
100 % coconut fiber (coir). Beforehand, the coir is soaked in
water until the electrical conductivity (EC) is approximately
0.5 mS/cm, strained, and sterilized twice in a soil sterilizer set
at 180200 F for 34 h. Rinsing the coir until the EC reaches
0.5 mS/cm ensures the substrate salinity is low enough for
healthy plant growth. After the coir has cooled, it is used to fill
plastic cone-tainers with a height of 15 cm, diameter of 3 cm,
and volume of 160 cm3.
3. Seeds are watered two or three times per week with approximately 2030 mL of UV-sterilized water containing 23 ppm
of chlorine. When the first true leaves develop, 2 g of Harrells
Slow Release is placed in the coir.
3.1.2 Transplanting
Rootstock Seedlings
to Be Used as Plants
for Bud Grafting
1. When seedlings are 1015 cm tall (34 months after starting

seeds in coir), they are transplanted to 1 gallon pots.
2. Metro-Mix 930 soil is sterilized twice in a soil sterilizer set at
82.293.3 C for 34 h. After the soil has cooled, it is mixed
with Harrells Slow Release (16-5-10 with Minors) and
Pestrong Dolomitic Limestone. For approximately 65 L soil,
266
204 g of Harrells Slow Release and 150 g of Pestrong

Dolomitic Limestone are added and mixed thoroughly.
3. Each seedling is placed in the middle of a 1 gallon pot containing the soil preparation described in the previous step.
Immediately after planting, seedlings are watered and a stake
and clip are used to keep the plant straight.
4. Following transplanting, seedlings are watered 3 days a week
with approximately 250500 mL of UV-sterilized water containing 23 ppm of chlorine.
3.1.3 Fertilizer
Application
1. Every 3 months two fertilizer solutions are alternately applied

to prevent nutrient deficiencies. If nutrient deficiencies appear
between applications, the particular deficiency is diagnosed
and the appropriate fertilizer solution is applied.
2. Harrells MAX Non-Staining Iron is mixed in UV-sterilized
water at a ratio of 10 mL of fertilizer per 1 L of water. After
mixing, the solution is used to drench the soil. For plants in 1
gallon pots, 100 mL of solution is added, and for plants in 4
gallon pots, 200300 mL of solution is added.
3. Harrells MAX Minors is mixed in UV-sterilized water at a
ratio of 10 mL of fertilizer per 1 L of water. Application volumes are the same as listed above for Harrells MAX NonStaining Iron.
3.1.4 Pesticide
Application
1. Once a month three pesticide solutions are cyclically applied to

prevent the growth of fungus and algae. One pesticide is applied
at a time, and any plant batches within 1 or 2 weeks of experimental transformation are not included in the application.
2. Aliette WDG is mixed in UV-sterilized water at a ratio of 2.5 g
per 1 L of water. After mixing, the solution is used to drench the
soil. For plants in 1 gallon pots, 250 mL of solution is added,
and for plants in 4 gallon pots, 500 mL of solution is added.
3. Crystal Blue Copper Sulfate is mixed in UV-sterilized water at
a ratio of 2.0 g per 1 L of water. Application method and volumes are the same as listed above for Aliette WDG.
4. Ridomil Gold EC is mixed in UV-sterilized water at a ratio of
0.08 mL per 1 L of water. Application method and volumes
are the same as listed above for Aliette WDG.
3.1.5 Bud Grafting

Rootstock and Growth
of Scions into Plants
to Be Used as a Source
of Explants
for Co-incubation
with Agrobacterium
1. When the rootstock has attained a width of approximately

1 cm (67 months after starting seeds in coir), they are grafted
using the buds from mother plants.
2. Leaves and thorns are removed from the rootstock up to 30 cm
above the soil level. Then an inverted-T incision is made
1015 cm above the soil.
267
3. A bud stick from the selected mother plant(s) is clipped, leaving

12 nodes to allow shoot regeneration, and buds are sliced off
forming an oval shape with the bud in the center. Young and
old buds should not be used if possible. The bud must be sliced
very straight so that the cambial layers of the rootstock
and bud come into close, even contact.
4. The doors of the T incision are opened slightly, and the bud is
slipped up until the epidermis is able to begin closing under
the bud.
5. Grafting plastic is firmly wrapped around the budded area. The
wrap should be tight enough to keep excess moisture out of
the grafted area but not so tight as to harm the bud.
6. The rootstock is then bent down and tied perpendicularly
across the base of the rootstock to allow more light to reach
the bud through the wrap.
7. After 21 days, the plastic wrap is removed and a 1 mm wide
strip is girdled out 1 cm above the bud to direct water and
nutrients to the bud (see Fig. 1a). Girdling is done only on the
side of the rootstock with the bud.
8. When the bud has produced a shoot, the rootstock is clipped
at the place where the 1 mm strip of epidermis was removed
(see Fig. 1c), leaving a 1015 cm rootstock with grafted scion
emerging near the top. This scion is allowed to grow for next
23 months into ~1 m long plant that will be used as a source
of explant material (see Fig. 1 e).
3.1.6 Germination
of Seeds for Production
of Rootstock Plants
for Grafting of Transgenic
Shoots (Primary
Micrografting In Vitro)
3.1.7 Primary
Micrografting
1. Both seed coats are peeled from Carrizo citrange seeds that are
surface-sterilized by shaking for 10 min in 5 % solution of commercial bleach. These seeds are rinsed 56 times with sterile water.
2. Sow individual seeds into 25 150 mm glass tubes filled with
25 mL of SGM and incubate at 26 C in the dark for 2 weeks.
1. Decapitate Carrizo seedlings leaving 11.5 cm of the epicotyls.
Shorten the roots to 46 cm and remove the cotyledons and
their axillary buds. Place the regenerated shoot onto the apical
end of the cut surface of the decapitated epicotyl, in such a way
to establish a contact between the vascular tissues of both scion
and the rootstock (see Fig. 2a).
2. Culture grafted plants in grafting medium and maintain under
conditions of 25 C, 16 h light/8 h dark photoperiod, and
45 E/m2s of illumination. Scions develop 24 expanded
leaves within about 34 weeks after grafting.
3.1.8 Secondary Grafting
1. When the transgenic scion begins producing new leaves and is

looking healthy, the in vitro-grown plant is taken to be grafted
on 6- to 9-month rootstock grown in the clean growth room.
268
Fig. 2 Photographs depicting: (a) primary micrografting, (b) secondary grafting, (c) initial stages of growth of
transgenic plant, and (d) 19-month-old plant (the inset shows developing flowers)
The plant is removed from the test tube; deionized water is

used to rinse any remaining liquid media from the shoot
portion of the plant.
2. Leaves and thorns are removed from the rootstock up to 30 cm
above the soil level. Then a T incision is made 1015 cm above
the soil.
3. The surgical scalpel is used to slice off the root portion of the
in vitro plant. Next a smooth slice is made down and inward to
the center of the pith, and the slice is continued downward,
exposing the cambium of the in vitro plant.
4. The doors of the T incision are opened slightly, and the prepared in vitro plant is slipped downward, bringing the cambial
layers of the two plants together (see Fig. 2b).
269
5. Grafting plastic is firmly wrapped around the graft, being

careful not to damage the in vitro plant. The rootstock is bent
down and tied perpendicularly across the base of the rootstock,
and the grafted plant is placed inside a clear plastic bag.
6. A stake is placed in the soil in front of the grafted in vitro plant
to prevent injury. A twist tie is then used to close the bag
around the stake to maintain a high-humidity environment.
7. After 21 days, the plastic wrap is removed and a 1 mm wide
strip of epidermis is removed on the side above the graft. Over
a period of 23 weeks, the clear plastic bag is slowly opened to
allow the plant to acclimate to a less humid environment.
8. When the grafted in vitro plant is observed to be growing well,
the rootstock is clipped above the graft and the plant is removed
from the bag.
3.2 Cocultivation
of Explants with
Agrobacterium
3.2.1 Preparation
of Agrobacterium Cultures
1. The first day: streak Agrobacterium on the plate with LB agar

medium (containing antibiotics) at 28 C for 2 days.
2. Two days later: pick a single colony of bacteria and inoculate
5 mL of LB liquid culture medium (containing antibiotics)
and grow overnight at 28 C on an orbital shaker at 200 rpm.
3. On the fourth day (also the day of experiment): check the OD
of overnight culture. Take 13 mL of culture (depending on
absorbance at 600 nm), inoculate 100 mL of LB liquid medium,
and grow 45 h at 28 C. Check the OD at 600 nm. OD should
be between 0.5 and 0.8. Centrifuge the bacterial culture for
10 min at 148 g and resuspend in IM to obtain final concentration of bacteria 4 108 cells/mL. Keep in 4 C until use.
3.2.2 Preparation
of Explants
and Cocultivation
with Agrobacterium
1. Cut the bud stick (see Note 6) into pieces (about 4050 cm
long; see Fig. 1g) from first flushes of propagated plants leaving
two nodes for regeneration of the second flush. Remove the
leaves and thorns, and collect them in plastic bag. Move this
material to the laboratory. Next steps are all done in the
laboratory.
2. Done outside of laminar flow hood: place the bud sticks in a
tub containing tap water and soap. Scrub them carefully with a
soft brush. Rinse the bud sticks with distilled water. Collect the
clean bud sticks in graduated cylinder that will accommodate
length of bud sticks. Add 20 % bleach solution with 56 drops
of Tween-20 and wash bud sticks for 10 min while inverting
the cylinder. The cylinder should be sealed with Parafilm.
Transfer to laminar flow hood.
3. Done inside laminar flow hood: rinse all bud sticks five times
with sterile deionized water. Cut bud stick internodes transversely into 15 mm long explants with the help of forceps and
sterile clippers on the autoclaved Whatman filter paper. Collect
270
40 explants in individual sterile humid glass petri dishes until

all stem pieces have been processed.
4. Transfer explants into petri dishes with bacterial suspension.
Just before inoculation, bacterial suspension prepared earlier is
diluted ten times with the IM. Inoculation should last for
15 min with occasional gentle swirling by hand.
5. Blot-dry the explants on sterile Whatman filter paper and place
horizontally on plates containing CCM (approx 2030 explants
per plate). Incubate for 3 days at 28 C at a low light intensity
(2 mol/m2/s, 16 h light/8 h dark photoperiod).
3.3 Selection
of Transgenic Shoots
3.3.1 Incubation
on Selection Medium
1. After 3 days of incubation of explants on cocultivation

medium without antibiotics, transfer the explants to SM
but only ten per plate keeping a wide distance between them
(see Fig 1h).
2. Maintain cultures in the dark for 34 weeks at 26 C. A callus
should appear on explants during this phase. Explants should
be observed every 23 days with a stereoscope.
3. Transfer the explants to a 16 h light/8 h dark photoperiod,
45 mol/m2/s light intensity, at 26 C. Explants should be
subcultured to a fresh set of plates with SM every 34 week.
3.3.2 Harvest
of Putatively
Transgenic Shoots
1. Shoots should develop from the cut ends of explants 23 weeks

after transfer to light. They should be allowed to develop to
the stage where they have at least two leaves.
2. Harvest the shoots and check their transgenic nature by performing a histochemical GUS assay or by observing the GFP
expression under fluorescent microscope.
3.3.3 Histochemical GUS

[10] Assay (See Note 7)
1. Take a 96-well ELISA plate and aliquot 100 L of GUS substrate solution into each well.
2. Cut out the shoots from the explants with the help of forceps
and sterile surgical scalpel. Cut a thin cross section at the base
of the stem or small piece of leaf and place it in one of the wells
of ELISA plate.
3. Seal the plate with Parafilm and keep it at 37 C overnight.
4. Tissue from the transgenic shoots will turn blue in color. Stop
the reaction by washing the tissue three times with 100 mM
Tris, pH 7.0.
5. Bleach out the green color from the tissue (originating from
the presence of chlorophyll) to better visualize the blue staining. For these washes use increasing series of ethanol: 30, 50,
70, and 100 % until the green color is lost.
271
Fig. 3 Photograph of two explants with transgenic shoots carrying functional GFP
in their tissue. Explants were exposed to both blue light and dim white light. Blue
light was used to induce GFP emission and white light to allow photographing of
explants. Scale line 12 mm
3.3.4 GFP Detection

(See Note 7)
1. All shoots that sprouted from explants should be inspected for

the presence of GFP fluorescence. Shoots are observed under
the microscope equipped with a source of blue light which will
be used to induce emission of green light from tissue of transgenic shoots due to the presence of GFP (see Fig. 3). Wild-type
shoots appear red under these conditions due to emission of
red light by chlorophyll under these conditions.
Notes
1. Preparation of cleaned mother plants used as source of budding material is not included into time necessary to produce
fruiting plants as it requires considerable amount of time itself.
Obtaining clean budwood from the certified nursery will be
of great help in this endeavor. In our experience, even some of
272
the budwood obtained from the local USDA branch carried

some microorganisms despite being certified as clean.
Always double-check the material by cutting branches into
pieces and using a few sections from the middle for incubation
with the liquid LB and LW media for 48 h. Only if there is no
growth in the flasks with the media where the sections from
branches were submerged, that material can be used for further propagation.
2. Binary vectors used in these experiments were introduced into
Agrobacterium by employing a freeze-and-thaw method [11].
Upon confirmation that appropriate Agrobacterium strain carries the binary vector of interest, a working stock and a glycerol stock of newly created strains should be made. The
working stock is kept in the refrigerator on plates of LB solid
medium supplemented with appropriate antibiotics (not longer than three weeks as Agrobacterium loses its viability).
Glycerol stock is kept at 80 C.
3. Concentration of 2,4-D will vary depending on the cultivar
that is being transformed.
4. Nalidixic acid (Sigma-Aldrich, prod. #N8878) is a synthetic
quinolone antibiotic that acts in a bacteriostatic manner. In
susceptible bacteria, nalidixic acid blocks DNA replication
through inhibition of DNA gyrase.
5. In spite of precautions such as multiple air curtains and requiring people entering the growth room to wear long-sleeved lab
coats and shoe covers, it is possible for some insects to gain
entry to the growth chamber environment. Under Florida
conditions, fungus gnats may become established and lacking
any natural predators will reproduce easily and feed on the soft
tissue of youngest rootstock seedlings. If fungus gnats are discovered, JT Eaton Bed Bug Spray can be used for control.
Squirt approximately 2 mL of the premixed solution onto the
surface of coir in all seedling cone-tainers, avoiding contact
with germinated seedlings as much as possible. Continue application once a week until fungus gnats have been controlled.
6. For the steps 13 in Subheading 3.2.2, the following tools
should be ready: clippers washed and cleaned with 50 % bleach,
sterilized forceps, solution of bleach (20 %) with 0.1 %
Tween-20, autoclaved Whatman filter paper (46 57 cm)
wrapped in aluminum foil, and autoclaved glass petri plates
with filter paper (9 cm in diameter) moistened with 3 mL of
deionized water.
7. As the volume of work increased in our facility, we started
using the PCR-based screening method to select transgenic
shoots. This method is described in detail in associated chapter
on Citrus juvenile tissue transformation.
273
References
1. Cervera M, Juarez J, Navarro A, Pina JA,
Duran-Vila N, Navarro L, Pea L (1998)
Genetic transformation and regeneration of
mature tissues of woody fruit plants bypassing
the juvenile stage. Transgenic Res 7:5159
2. Almeida WAB, Mourao Filho FAA, Pino LE,
Boscariol RL, Rodriguez APM, Mendes BMJ
(2003) Genetic transformation and plant
recovery from mature tissue of Citrus sinensis
L. Osbeck. Plant Sci 164:203211
3. He YR, Chen SC, Peng AH, Zou XP, Xu LZ,
Lei TG, Liu XF, Yao LX (2011) Production and
evaluation of transgenic sweet orange (Citrus
sinensis Osbeck) containing bivalent antibacterial peptide genes (Shiva A and Cecropin B) via
a novel Agrobacterium-mediated transformation
of mature axillary buds. Sci Hort 128:99107
4. Orbovi V, Grosser JW (2006) Citrus: sweet
orange (Citrus sinensis L. Osbeck Valencia)
and Carrizo citrange [Citrus sinensis (L.)
Osbeck Poncirus trifoliata (L.) Raf.]. In:
Wang K (ed) Agrobacterium protocol methods in molecular biology. Humana, Totowa,
NJ, pp 177189
5. Orbovi V, Pasquali G, Grosser JW (2007) A
GFP-containing binary vector for Agrobacterium
6.
7.
8.
9.
10.
11.
tumefaciens-mediated plant transformation

(ISHS). Acta Hort 738:245253
Hood EE, Helmer GL, Fraley RT, Chilton
region of pTiBo542 outside of T-DNA. J
Bacteriol 168:12831290
2:208213
for rapid growth and bioassays and tobacco
tissue culture. Physiol Plant 15:473497
White PR (1943) Nutrient deficiency studies
and an improved inorganic nutrient for cultivation of excised tomato roots. Growth 7:5365
Walkerpeach
CR,
Velten
J
(1994)
Agrobacterium-mediated gene transfer to plant
cells: cointegrate and binary vector systems. In:
Gelvin SB, Schilperoort RA (eds) Plant molecular biology manual. Kluwer, Belgium, pp 119
Chapter 22
Coffee (Coffea arabica L.)
Eveline Dchamp, Jean-Christophe Breitler,
Thierry Leroy, and Herv Etienne
Abstract
Coffee (Coffea sp.) is a perennial plant widely cultivated in many tropical countries. It is a cash crop for
millions of small farmers in these areas. As for other tree species, coffee has long breeding cycles, which
makes conventional breeding programs time-consuming. For that matter, genetic transformation can be
an effective way to introduce a desired trait in elite varieties or for functional genomics. In this chapter, we
describe two highly efficient and reliable Agrobacterium-mediated transformation techniques developed
for the C. arabica cultivated species: (1) A. tumefaciens to study and introduce genes conferring resistance/
tolerance to biotic (coffee leaf rust, insects) and abiotic stress (drought, heat, seed desiccation) in fully
transformed plants and (2) A. rhizogenes to study candidate gene expression for nematode resistance in
transformed roots.
Key words Abiotic stress, Agrobacterium rhizogenes, Agrobacterium tumefaciens, Coffee leaf rust
resistance, Embryogenic cultures, Functional genomics, Hairy roots, Meloidogyne sp., Nematode
resistance
Introduction
With more than seven million tons of green coffee beans produced
every year on about 11 million hectares all over the intertropical
countries, coffee is an extremely important agricultural crop.
Growing regions typically offer moderate sunshine and rain, steady
temperatures around 26 C, and rich, porous soil. In terms of economic importance on the international markets, coffee is the second
natural commodity in value after petroleum. The total coffee production for year 2009/2010 was of 120.6 million bags (www.ico.
org). Brazil is responsible for about a third of all coffee production
(39.4 million bags of 60 kg), making it by far the most important
coffee-producing country, followed by Vietnam, Indonesia, and
Colombia. About 125 million people depend on coffee for their
livelihood in Latin America, Africa, and Asia.
275
276
Eveline Dchamp et al.
Traditional breeding is aimed at improving the income of the

planters, who are mainly small farmers. As other perennial crops,
coffee has a long juvenile period. Conventional breeding can take
between 25 and 35 years. It is a major drawback for coffee improvement. Genetic engineering could shorten this time by allowing the
incorporation of known genes into elite genetic backgrounds.
Two major species, Coffea arabica (self-pollinated and allotetraploid: 2n = 44, 68 % of the global production) and Coffea
canephora (self-sterile and diploid: 2n = 22) are cultivated all over
tropical areas. Arabica breeding is traditionally based on pure line
selection, but since 15 years, an F1 hybrid selection strategy has
been developed [1, 2]. The main traits of interest for breeding are
the following: yield and beverage quality along with pests and diseases resistance. C. canephora breeding is more oriented toward
improving yield and technological and organoleptic qualities
through creation of hybrids between genotypes of different genetic
groups [3] or selection of improved clones [4].
Works on genomics and gene mining have recently been developed. Genetic transformation is also a tremendous tool for studying the function and expression of genes (e.g., genes involved in
coffee quality or in resistance to diseases and parasites or resistance
to abiotic stress like heat, drought, and salinity) or for understanding mechanisms associated with the introgression of foreign germplasm within a species. Mastering introgression, primarily from
C. canephora to C. arabica, mainly for pest and disease tolerance,
is the major challenge for the next 20 years.
The major pests threatening the production are coffee leaf rust,
coffee berry disease, leaf miner, and nematodes. The leaf miner
Leucoptera sp. has an economically important impact in East Africa
and Brazil. Since the caterpillar develops inside coffee leaves, insecticide sprays do not affect it much. Ingestion of the insecticide or
an insecticidal protein by the miner is necessary for an efficient
treatment. This implies the use of systemic insecticides which are
harmful to farmer and the environment. A valuable strategy would
then be the transgenic approach. The use of Bacillus thuringiensis
genes to transform plants for protection to insect is currently the
most reliable strategy [5, 6], and preliminary investigations were
therefore conducted to determine the susceptibility of Leucoptera
spp. to B. thuringiensis insecticidal proteins and identify candidate
genes for transformation of coffee [7]. The toxin expressed by the
cry1Ac gene, widely used to confer resistance to Lepidopterae [8],
has been demonstrated to be the most effective. Current studies
are in progress to select other B. thuringiensis strains active against
coffee berry borer and white stem borer [9], two coleopteran pests
of economic importance. Transformed plants highly resistant to
leaf miner under greenhouse conditions were tested under field
conditions in French Guiana for 4 years for field resistance [10] in
an experiment with 54 transformation events. Approximately 70 %
277
of the events tested were resistant to leaf miner with a similar

growth and development compared to control plants.
The main cultivated C. arabica varieties are dwarfs and high
yielding and give good quality coffee, but they are susceptible to
numerous pathogens, particularly endoparasitic root nematodes of
the genus Meloidogyne [11] and coffee leaf rust caused by the obligate parasitic fungus Hemileia vastatrix Berk. and Br. (Uredinales).
In many production regions, and more particularly in Brazil and
Central America, Meloidogyne spp. (root-knot nematodes) are a
major agricultural constraint. Their attacks have a considerable
impact, and they can even reduce yields substantially, kill the trees,
and lead farmers to cut off coffee trees. Nematicide products are
expensive, not very efficient, and harmful to humans and the environment. It is unanimously accepted that the way to fight rootknot nematodes is to select resistant varieties. Sources of specific
resistance to Meloidogyne have been identified in diploid species
[12]. The regeneration of hairy roots after transformation with
A. rhizogenes has been reported in a large number of species [13].
Hairy roots are used to study mycorrhization, nodulation and
nitrogen fixation, and the production of secondary metabolites
under controlled conditions in bioreactors or for studying plant/
nematode interaction or functional analysis of resistance gene candidates [14, 15]. Our team has developed the production of roots
transformed by A. rhizogenes to validate candidate genes of resistance to root-knot nematodes by functional complementation and
to study the conditions required for expression of such genes.
Coffee leaf rust is one of the most serious diseases which greatly
limits Arabica coffee production in almost all growing countries
around the world. Therefore, since a long time, the development
of coffee varieties resistant to coffee leaf rust has been a breeding
objective of the highest priority in many countries [16]. A number
of resistance (R) genes to coffee leaf rust have been identified in
the cultivated or wild Coffea gene pool. The genetic and physical
maps of the SH3 resistance locus introgressed species were established [17, 18]. Analysis of SH3 locus in C. arabica has revealed the
presence of 5, 3, and 4 R genes in Ea, Ca, and Cc sub-genomes,
respectively, all of them belonging to CC-NBS-LRR (CNL) subfamily of R genes [19]. Validation of these candidate R genes by
functional complementation with an A. tumefaciens-mediated
transformation process is under way in our laboratory. For both
pestsi.e., Meloidogyne nematodes and coffee leaf rustthe ultimate objective is to breed varieties using molecular marker-assisted
selection (MAS), into which genes of resistance to the different
nematodes and coffee leaf rust races have been pyramided.
Reviews on biotechnology techniques applied to coffee have
been published recently [20, 21]. Most studies deal with largescale propagation techniques through somatic embryogenesis,
somaclonal variation, in vitro preservation of coffee germplasm,
278
genetic transformation, and evaluation and use of genetic resources

based on the utilization of molecular markers. Recent researches
have been conducted in coffee on pest and disease resistance genes
[12, 18, 19], drought resistance genes [22], cup quality improvement genes [23], and specific promoters [24, 25]. Functional analysis of some of them has already been successfully performed.
Genetic tools like genetic maps [26, 27] and BAC DNA libraries
[28] can be useful for new gene searches. Next-Generation
Sequencing technology and more particularly the advances in the
C. canephora and C. arabica genome sequencing [29] open the
possibility to quickly identify many agronomically interesting
coffee genes.
Genetic transformation of coffee was first performed on cells
using protoplast electroporation [30]. Genetic engineering using
Agrobacterium sp. has also been reported [3134]. Regeneration
of transgenic coffee trees was obtained after transformation of
somatic embryos via Agrobacterium rhizogenes [3537] or via
Agrobacterium tumefaciens [3840]. Although somatic embryogenesis is still a tedious process for some coffee species, embryo
regeneration is easily obtained. Very efficient and reliable somatic
embryogenesis processes have been recently developed in C. arabica
[41, 42] and are industrially applied since 2006.
Suitable transformation protocols are of utmost importance,
either to evaluate gene functionality or to introduce new genes of
interest. We developed two different protocols. Embryogenic calli
have been frequently used as the target tissue for transformation,
but the difficulty in producing or maintaining embryogenic tissues
is one of the major problems encountered in genetic transformation of many woody plants, including Coffea arabica. We established the conditions for long-term proliferation of embryogenic
cultures in C. arabica var. Caturra and a highly efficient and reliable Agrobacterium tumefaciens-mediated transformation method
based on their utilization [43]. At the histological level, transformation success was related to the abundance of proembryogenic
masses (PEMs). All the regenerated plants were proved to be transformed by PCR and Southern blot hybridization. The average
transformation frequency (number of transformed calli/total
number of calli subjected to the transformation treatment 100)
ranges from 50 to 90 % depending on the genotypes and quality of
the embryogenic tissues. The present Agrobacterium-mediated
transformation of embryogenic cultures represents a reliable and
useful tool for coffee breeding and functional analysis of agronomically important genes.
The second protocol we describe here has been adapted to
study the expression of genes of resistance to root-knot nematodes. It consists in the rapid regeneration of hairy roots after
transformation of zygotic embryos by A. rhizogenes (see Note 1).
This protocol was developed for coffee, based on those published
279
for other species [44, 45]. Our procedure enables rapid and
routine generation of hairy roots, as well as their maintenance.
Two Coffea arabica genotypes were used for these experiments.
The Caturra variety, which is widely grown in Latin America, is
susceptible to the root-knot nematode Meloidogyne exigua. The
second variety used, Iapar 59 (a Catimor-type interspecific hybrid),
is resistant to numerous diseases and pests. Its resistance to
Meloidogyne exigua has been demonstrated [46].
Materials
2.1 Regeneration
of Whole Transgenic
Plants Using
A. tumefaciens
Leaves from greenhouse grown mature plants of C. arabica.
2.1.1 Plant Materials

2.1.2 Transformation
Vectors
1. Agrobacterium tumefaciens strains: LBA1119.

2. Vector background: Construct has been integrated in the
pBIN19 [47] and the pMDC32 [48] plasmids.
3. Transgenes: (a) a screenable marker gene (see Note 2) and (b)
a selectable marker gene (see Note 3).
2.1.3 Culture Media

for Agrobacterium Strains
1. LB agar high-salt medium: 10 g/L tryptone, 5 g/L yeast

extract, 10 g/L NaCl, 10 g/L agar, pH 7.0.
2. Hygromycin: 50 mg/mL stock solution in ultrapure water.
Sterilize by filtration through a 0.2 m membrane. Dispense
1 mL aliquots in Eppendorf tubes and store at 20 C.
3. Rifampicin: 25 mg/mL stock solution in ultrapure water, dissolve in methanol and bring up the final volume with reverse
osmosis (RO) water. Sterilize by filtration through a 0.2 m
membrane. Dispense 1 mL aliquots in Eppendorf tubes and
store at 20 C.
4. Kanamycin sulfate: 50 mg/mL stock solution in water. Sterilize
by filtration through a 0.2 m membrane. Dispense 1 mL aliquots in Eppendorf tubes and store at 20 C.
5. LB liquid medium containing 50 mg/L kanamycin, 50 mg/L
rifampicin, pH 7.5.
2.1.4 Stock Solutions
1. 6-Benzylaminopurine (BAP): 1 mg/mL stock solution.

Prepare by dissolving in 1 mL of 1 N H2SO4 before making up
to 10 mL with RO water. Store at 4 C.
2. 2,4-Dichlorophenoxyacetic acid (2,4-D): 0.5 mg/mL stock
solution. Prepare by dissolving in 1 mL of 1 N NaOH before
making up to 10 mL with RO water. Store at 4 C.
280
3. 6-(,-dimethylallylamino)purine (2-iP): 0.1 mg/mL stock

solution. Prepare by dissolving in 1 mL of 1 N NaOH before
making up to 100 mL with RO water. Store at 20 C.
4. Indole-3-butyric acid (IBA): 0.1 mg/mL stock solution.
Prepare by dissolving in 1 mL of 1 N NaOH before making up
to 100 mL with RO water. Store at 4 C.
5. Kinetin: 0.1 mg/mL stock solution. Prepare by dissolving in
1 mL of 1 N NaOH before making up to 100 mL with RO
water. Store at 4 C.
6. Cefotaxime: 125 mg/mL in RO water. Sterilize by filtration
and store at 20 C.
7. Acetosyringone (Fluka Chemical cat. no. 38766): 200 M in
EtOH, store at 20 C. Shake well before use.
2.1.5 Media for Plant
Tissue Culture
and Transformation
All media are sterilized by autoclaving under 1.1 kg/cm2 for

20 min at 121 C; antibiotics and cefotaxime added to autoclaved
media after cooled down to 55 C.
1. C callogenesis medium [49]: half-strength MS salts [50],
10 mg/L thiamine HCl, 1 mg/L pyridoxine HCl, 1 mg/L
nicotinic acid, 1 mg/L glycine, 100 mg/L myoinositol,
100 mg/L casein hydrolysate, 400 mg/L malt extract (Sigma),
0.5 mg/L 2,4-D, 1 mg/L IBA, 2 mg/L 2-iP, 30 g/L sucrose,
2 g/L Phytagel, pH 5.6.
2. Embryogenic callus production (ECP) medium [49]: halfstrength MS salts, 20 mg/L thiamine HCl, 20 mg/L glycine,
40 mg/L L-cysteine (Sigma), 200 mg/L myoinositol,
60 mg/L adenine hemisulfate salt (Sigma), 200 mg/L casein
hydrolysate, 800 mg/L malt extract, 1 mg/L 2,4-D, 4 mg/L
BAP, 30 g/L sucrose, 3.2 g/L Phytagel, pH 5.6.
3. R regeneration medium [49]: half-strength MS salts, 10 mg/L
thiamine HCl, 1 mg/L pyridoxine HCl, 1 mg/L nicotinic
acid, 10 mg/L L-cysteine, 2 mg/L glycine, 200 mg/L myoinositol, 400 mg/L casein hydrolysate, 400 mg/L malt extract,
4 mg/L BAP, 40 g/L sucrose, 3.2 g/L Phytagel, pH 5.6.
4. M maturation medium [49]: semisolid MS medium with fullstrength salts, 10 mg/L thiamine HCl, 100 mg/L myoinositol, 0.3 mg/L BAP, 30 g/L sucrose, 3.2 g/L Phytagel,
pH 5.6.
5. G germination medium [49]: semisolid MS plant development
medium with full-strength salts, 10 mg/L thiamine HCl,
100 mg/L myoinositol, 1 g/L activated charcoal, 30 g/L
sucrose, 3.2 g/L Phytagel, pH 5.6.

2.1.6 Other Solutions
and Supplies
2.2 Hairy Root

Regeneration Using
A. rhizogenes
281
1. Leaf surface disinfectant solution: 8 % HClO (w/v).
Seeds of Coffea arabica var. Caturra and Iapar 59 were obtained at

the ICAFE research center of Costa Rica.
2.2.1 Plant Materials

Vectors
The Agrobacterium rhizogenes strain A4RS was used for transformation (see Note 4). This strain derived from the wild strain A4
modified for the resistance to rifampicin and spectinomycin antibiotics [51]. Construct has been integrated in the pBin19 plasmid
[47]. The uidA bacterial gene isolated from Escherichia coli coding
for -glucuronidase (GUS) was introduced [52], with an additional intron for specific expression in plants [53]. The gene was
controlled by the cauliflower mosaic virus (CaMV) 35S promoter
and terminator. The A4RS including the pBIN19 plasmid with the
above construct was called armed A4RS.
2.2.3 Culture Media

for Agrobacterium
rhizogenes Strains
1. MYA medium: 5 g/L yeast extract, 0.5 g/L casein hydrolysate, 8 g/L mannitol, 2 g/L MgSO4, 5 g/L NaCl, and 15 g/L
agar, pH 6.6.
2. Kanamycin sulfate: 50 mg/mL stock solution in water. Sterilize
by filtration through a 0.2 m membrane. Dispense 1 mL aliquots into Eppendorf tubes and store at 20 C.
3. Rifampicin: 25 mg/mL stock solution in water; use a few
drops of 100 % methanol for correct dilution. Sterilize by filtration and store at 20 C.
4. Spectinomycin: 20 mg/mL stock solution in water. Sterilize by
filtration through a 0.2 m membrane and store at 20 C.
5. MYA semisolid medium containing 50 mg/L rifampicin (both
for wild and armed A4RS), 500 mg/L spectinomycin (both
for wild and armed A4RS), 50 mg/L kanamycin (only for
armed A4RS), pH 6.6.
2.2.4 Tissue Culture
Media sterilized by autoclaving for 20 min at 121 C; cefotaxime

added to cooled sterile media.
1. GER germination medium: semisolid MS medium [49] with
full-strength salts, vitamins (10 mg/L L-cysteine, 10 mg/L
thiamine HCl, 1 mg/L pyridoxine HCl, 2 mg/L glycine,
1 mg/L nicotinic acid), 40 g/L sucrose, and 3.2 g/L
Phytagel.
2. Seed surface disinfectant solution: 8 % HClO (w/v), Tween40 (ten droplets).
3. Cefotaxime (Duchefa Biochemie): 200 mg/mL in water.
Sterilize by filtration and store at 20 C.
282
Methods
3.1 Protocol
for Producing Whole
Transgenic Plants
Using A. tumefaciens
3.1.1 Leaf Explant
Sterilization
3.1.2 Callus Culture

Initiation
1. Cut leaves from mother trees in the greenhouse. Optimal stage

is fully expanded leaves, still immature (not as glossy as older
leaves).
2. Sterilize the leaves for 20 min with 8 % HClO (w/v) and rinse
three times with sterile RO water. Cut leaves into small pieces
(0.25 cm2) and culture them (four explants per dish) in 5.5 cm
diameter Petri dishes containing 12.5 mL C callogenesis
medium according to the genotypes (see Subheading 3.1.2).
1. Leaf explants are cultured successively on the two media
defined for the Arabica genotypes. First, culture leaf explants
on C medium in 5.5 cm diameter Petri dishes (four leaf pieces
per plate) for 4 weeks in the dark at 27 C.
2. Then transfer the leaf explants to ECP medium in baby food
jars (25 mL medium) (four leaf pieces per jar) and incubate the
baby food jars during 68 months under a low-light condition
(10 E/m2/s, 16 h/day, 27 C) until embryogenic callus
appears. The yellow or whitish embryogenic callus appears on
the primary necrotic calli that have initially developed on the
cut edges (see Note 5).
3.1.3 Establishment
of Maintained Embryogenic
Callus Cultures
1. Long-term embryogenic cultures are successfully established

using the initial embryogenic callus and by monthly transferring yellowish fragments collected on the upper part of embryogenic calli on fresh semisolid ECP medium. Embryogenic callus
cultures are maintained in the dark at 27 C.
2. Culture aging directly affects the success of transformation.
It has been shown that the optimal culture duration is between
7 and 16 months during which the callus cultures are particularly rich in proembryogenic masses (PEMs). PEMs are the
target cells for A. tumefaciens transformation.
3.1.4 Callus Culture

Preparation
for Transformation
3.1.5 Agrobacterium
tumefaciens Culture
Preparation
1. Three weeks before transformation, yellowish callus fragments are

transferred to ECP medium to be bulked up for transformation.
2. The third week corresponds to exponential growth and tissues
are mainly composed of actively proliferating proembryogenic
cells.
1. Prepare the A. tumefaciens culture from a 80 C glycerol
stock. To prepare glycerol culture, mix 50 % autoclaved glycerol solution with equal volume of bacterial culture. Deep
freeze in 80 C.
2. Inoculate bacteria from the 25 % glycerol stock to Petri dish of
LB agar medium with appropriate antibiotics: kanamycin
50 mg/L and rifampicin 50 mg/L.
283
3. Select one colony and inoculate bacteria in 50 mL Erlenmeyer

flask containing 10 mL LB liquid medium with appropriate
antibiotics: kanamycin 50 mg/L and rifampicin 50 mg/L supplemented with acetosyringone at a final concentration of
100 M.
4. Grow the bacteria overnight on a shaker incubator (100 rpm,
at 28 C) until the optical density (OD) reaches 0.60.8
(OD600nm) (see Notes 6 and 7).
5. Centrifuge the bacteria (2,500 g, for 10 min), and resuspend
in a 10 mL of ECP liquid medium supplemented with 100 M
acetosyringone. It is not required to check OD at that point.
6. Gently shake the bacterial suspension during 1 h at room temperature before use it for tissue infection.
3.1.6 Infection
and Cocultivation
1. Submerge the embryogenic calli directly in the baby food jars

in which they are cultivated with 10 ml A. tumefaciens suspension for 10 min without agitation. Do not close the jars during
this period to avoid ethylene accumulation.
2. The excess of suspension is removed and the inoculated tissues
are cocultivated at 20 C in the dark for 35 days. After this
period the callus tissues are transferred in new sterile baby food
jars and then rinsed twice with 20 mL sterile water. Finally,
20 mL ECP medium containing 1.2 g/L cefotaxime is added
in each jar. Cultures are placed on a rotary shaker at 90 rpm
during 3 h.
3. After this time the liquid is removed and the calli are rinsed
with ECP medium during 15 min.
4. The liquid is removed and the tissues are gently blotted on
sterile Whatman paper to remove excess bacterial solution.
They are subsequently placed in Petri dishes containing ECP
medium with 500 mg/L cefotaxime. From each initial jar,
embryogenic calli subjected to transformation treatment are
transferred to 34 Petri dishes (20 micro-calli/90 mm Petri
dish). Cultures are placed in the dark at 27 C for 4 weeks.
3.1.7 Selection
and Regeneration
1. After decontamination, the cultures are subcultured every

4 weeks twice on R regeneration medium containing 17.76 M
6-BAP and 100 mg/L hygromycin (with pMDC32 plasmid)
or 400 mg/L kanamycin (with pBIN19 plasmid) and decreasing cefotaxime concentrations (250, 125 mg/L) (see Note 8).
The cultures will turn brown progressively during the second
subculture (see Fig. 1a).
2. The cultures are then subcultured twice on M maturation
medium containing 1.35 M 6-BAP, 100 mg/L hygromycin,
and 125 mg/L cefotaxime. Embryogenic calli and then
somatic embryos resistant to hygromycin will appear during
this period (see Fig. 1b, c).
284
Fig. 1 Regeneration of transformed coffee plants from maintained embryogenic cultures [43]. (a) Calli in selective media containing 100 mg/L hygromycin and 125 mg/L cefotaxime, 4 months after cocultivation with
A. tumefaciens LBA1119 without plasmid, used as a control. (b) Regeneration of resistant calli in selective media
containing 100 mg/L hygromycin and 125 mg/L cefotaxime, 4 months after cocultivation with A. tumefaciens
LBA1119 carrying pMDC32; the yellow calli are resistant to hygromycin. (c) Regeneration of torpedo-shaped
somatic embryos 6 months after cocultivation. (d) In vitro plantlet development 8 months after cocultivation.
(e) Acclimatization of transgenic plants in the greenhouse 12 months after cocultivation
3. The other subcultures are carried out on M maturation

medium containing 1.35 M 6-BAP devoid of cefotaxime and
hygromycin until plantlet development (see Fig. 1e). Several
embryos and plants frequently regenerate from each resistant
callus (see Fig. 1d).
4. Ten months after cocultivation, the plantlets are acclimatized
in the greenhouse. During the entire regeneration process, the
cultures are maintained under a 14 h photoperiod (20 mol/
m2/s light intensity) at 26 C until acclimatization.

3.1.8 Molecular Analysis
285
1. Stable expression of GFP is evaluated 30 days after Agrobacterium

inoculation to assess the transformation efficiency. The plant
tissues are screened for GFP expression using a Leica MZ Fluo
III (optic 0.63 Zeiss) fluorescence microscope supplied with a
DC 300F camera (Leica Microsystems, Wetzlar, Germany)
with plant GFP filter no. 3 from Leica: excitation wavelengths,
470540 nm (BP). The autofluorescence from chlorophyll was
blocked using a red interference filter.
2. Polymerase chain reaction (PCR) and Southern analysis are
performed using DNA from coffee leaves to verify the transgenic nature. Genomic DNA extraction is performed using a
Qiagen kit.
3.2 Hairy Root

Regeneration Using
A. rhizogenes
3.2.1 Seed Sterilization
and Zygotic Embryo
Germination
1. Seed sterilization: Remove the parchment from the coffee

beans by hand. Sterilize by immersing the beans in seed surface
disinfectant solution. Stir for 5 min, apply a vacuum for 20 min,
and then stir for 5 min. Rinse three times in sterile water.
2. Soaking: Divide the seeds up into 10 cm diameter Petri dishes
(2 cm deep), containing sterile water, and place in the dark at
27 C. Under these conditions the seeds will be totally imbibed
after 4872 h.
3. Embryo extraction: Remove the pergamine. Use a scalpel to
remove the endosperm over the embryo, cutting from the root
pole toward the cotyledons. Then extract the embryo levering
it out from the root pole with the same scalpel blade.
4. Germination: Culture the zygotic embryos in 5.5 cm diameter
Petri dishes (three embryos/dish and 12.5 mL of medium) on
semisolid GER medium. Place the dishes in the dark at 27 C
for 8 weeks. At the end of that period, the embryos will have
started germinating; they will have a 12 mm long hypocotyl
and a root about 10 mm long.
and Hairy Root Induction
1. Grow the A. rhizogenes strain (with the appropriate construct)

from a 80 C 25 % glycerol stock on MYA semisolid medium
with appropriate antibiotics. The bacteria should be grown at
28 C for 48 h to be used directly for genetic transformation.
2. Use a scalpel with a blade contaminated by drawing it over the
bacterium culture.
3. Make a 2 mm long wound in the hypocotyl of the zygotic
embryos with the contaminated blade.
4. Culture the wounded embryos in 5.5 cm diameter Petri dishes
(three embryos/dish) containing sucrose-free GER medium.
Place the dishes in the dark at 18 C for 2 weeks (see Note 9).
5. After coculturing, rinse the embryos for 2 h in liquid GER
medium containing 500 mg/L of cefotaxime. Cut the taproot
well above the collar and discard (see Note 10).
286
Fig. 2 Regeneration of Coffea arabica transgenic roots (hairy roots) using Agrobacterium rhizogenes [33, 34].
(a) Regeneration of a transgenic C. arabica root at the wounded and infected site (hypocotyl) 6 weeks after
transformation. Bar = 0.4 cm. (b) Several 4 to 6 cm long roots develop from the inoculation site. (c) Composite
plants ready for transfer to greenhouse. (d) C. arabica composite plants in soil substrate ready for nematode
inoculation in resistance tests. (e) Histochemical localization of -glucuronidase (GUS) gene expression in
transgenic roots of C. arabica transformed with the p35S-gusA-int gene construct. The blue staining allows the
localization of tissues that actively express the chimeric GUS gene. The staining is strong in all the meristematic regions and central cylinders. Bar = 3 mm. (f) Axenic culture of hairy roots of C. arabica cv. Caturra;
long-term maintenance in the presence of IBA in the dark
6. Culture the infected embryos (three embryos/5.5 cm dish) on

GER medium with 500 mg/L cefotaxime under low light
(10 E/m2/s), with a 14 h photoperiod at 27 C for 4 weeks.
Transgenic roots will appear after 3 weeks at the wound and
bacterium inoculation site (see Fig. 2a).
7. Transfer the embryos (three embryos/dish) to 2.5 10 cm
Petri dishes containing GER medium + 250 mg/L cefotaxime
287
under the same incubation conditions for 4 weeks. Several

46 cm long roots will develop from the inoculation site
(see Fig. 2b).
8. Culture the embryos again on GER medium + 150 mg/L
cefotaxime (2 embryos/dish) under same conditions for
another 4 weeks.
9. At this time, the transgenic roots (hairy roots) will be highly
branched. One well-branched transgenic root can be conserved
on the non-transformed germinated embryo to obtain a composite plant, i.e., transformed rootstock on a non-transformed
aerial part (see Figs. 2c, d). The highly branched transgenic roots
can be sectioned (see Note 11). They should then be grown in
the dark on GER medium supplemented with 2.5 M IBA in
10 cm diameter Petri dishes (see Note 12). The culture can be
maintained for long period by fresh transfers to this nutrient
medium every 4 weeks at 27 C (see Fig. 2f).
3.2.3 Molecular Analysis
of Hairy Roots
1. Histochemical GUS assay (see Fig. 2e): To assay GUS activity,

drench sectioned hairy roots with a staining solution containing
1 mM 5-bromo-4-chloro-3-indolyl--D-glucuronide (X-Gluc),
and incubate overnight at 37 C, as indicated by Jefferson
[52]. To confine the localization of the blue staining, add
0.5 mM K3Fe(CN)6 and 0.5 mM K4Fe(CN)6 as catalysts.
2. DNA extraction from hairy roots: For DNA isolation from
root tissue, 1 g fresh weight can be either lyophilized or ground
under liquid nitrogen into a fine powder using a mortar and
pestle. Transfer the tissue powder to a 2 mL tube. Lyophilized
samples can be stored at 4 C and disrupted at ambient temperature, while frozen samples should be stored at
80 C. When grinding plant tissue, sample tubes should be
kept in liquid nitrogen and the sample not allowed to thaw.
DNeasy Plant Mini Kit N 69104 (Qiagen) showed to be an
appropriate procedure to obtain adequate purified DNA concentration (>20 g) required for following molecular analysis.
3. PCR analysis: Use hairy roots that display a positive reaction to
the GUS histochemical test. DNA from transformed roots was
extracted using the DNeasy Plant Mini Kit N 69104 (Qiagen).
For amplification of a 584-bp fragment of the gus (uidA) gene
use primers 5-GAATGGTGATTACCGACGAAA-3 and
5-GCTGAAGAGATGCTCGACTGG-3. The PCR mixture
should consist of 5 L (5 ng) of plant DNA, 2.5 L of 10 Taq
buffer (Promega), 1.5 L of 25 mM MgCl2, 1.0 L of 5 mM
deoxynucleotide triphosphate (dNTP), 0.25 L of Taq DNA
polymerase (5 U/L Promega), 1 L from each 10 pmol
primer, and 12.75 L of sterile distilled water. Perform PCR
analysis with a PTC-100 Programmable Thermal Controller
(MJ Research Inc., San Francisco, CA). Heat samples to 94 C
288
for 5 min, followed by 29 cycles at 94 C for 30 s, 56 C for

30 s, and 72 C for 1 min, and then 56 C for 10 min. Separate
amplified products by electrophoresis on 1.0 % agarose gels
with 0.5 mg/L ethidium bromide in 0.5 TAE and detect by
fluorescence under ultraviolet light.
Notes
1. Tests showed that this methodology also worked with somatic
embryos and could therefore be used on heterozygous
materials.
2. Screenable marker: We used the reporter gene GFP5 isolated
from Aequorea victoria jellyfish coding for green fluorescent
protein. The gene was controlled by the constitutive cauliflower mosaic virus (CaMV) 35S promoter.
3. Selectable marker: We used the hygromycin phosphotransferase gene (HPTII) isolated from E. coli conferring resistance to
hygromycin for selection of transformed cells and regeneration
of transgenic plants.
4. Five Agrobacterium rhizogenes wild strains were compared for
transformation efficacy: 1583 also called A4 (agropin mannopin strain), ARqua1 (agropin mannopin strain), 1724 (mikimopin strain), 2659 (cucumopin strain), and 8196 (mannopine
strain). The A4 strain was the most efficient (80 % transformation efficacy), then ARqua1 (30 %), 1724 (10 %), and 2659
(5 %). Hairy roots were not obtained with the 8196 strain.
5. The transformation frequency (number of transformed calli/
total number of calli subjected to the transformation treatment
100) is variable from one genotype to another. For C. arabica, the process is efficient and reliable; the transformation
efficiency can vary between 50 and 90 % depending on the
genotype and the quality of the embryogenic tissues.
6. Both YEP and LB (10 g/L bacto-tryptone, 10 g/L yeast
extract) media can be used for bacteria growing. However,
Agrobacterium grows slightly slower in Luria-Bertani (LB)
medium than in YEP medium.
7. Several binary plasmids have been successfully used for coffee
transformation (pBIN19, pCAMBIAA1, PMDC32).
8. Hygromycin is the most efficient antibiotics for coffee transformation [43]. If kanamycin is used, it should be used at high
concentrations (more than 400 mg/L).
9. The temperature during the coculturing stage had a marked
effect on transformation efficiency with A. rhizogenes. For
example, the results obtained were 7080 % for embryos transformed at 18 C and 2030 % at 27 C [33].
289
10. We discovered competition in the growth of the two types of

roots. Eliminating the non-transgenic taproot encouraged the
development of transgenic roots.
11. Hairy roots must be sufficiently developed before being
sectioned for them to develop autonomously.
12. Coffee tree hairy roots need an exogenous supply of auxin to
grow. The nature and concentration of the auxin affect their
development.
References
1. Bertrand B, Etienne H, Cilas C et al (2005)
Coffea arabica hybrid performance for yield, fertility and bean weight. Euphytica 141:255262
2. Bertrand B, Alpizar E, Llara L et al (2011)
Performance of Arabica F1 hybrids in agroforestry and full-sun cropping systems in comparison with pure lines varieties. Euphytica 181:
147158
3. Leroy T, Montagnon C, Cilas C (1997)
Reciprocal recurrent selection applied to Coffea
canephora Pierre. III Genetic gains and results
of first cycle intergroup crosses. Euphytica
95:347354
4. Capot J (1977) Lamlioration du cafier
Robusta en Cte dIvoire. Caf Cacao Th 21:
233244
5. Estruch JJ, Carozzi NB, Desai N et al (1997)
Transgenic plants: an emerging approach to
pest control. Nature Biotech 15:137141
6. Schuler TH, Poppy GM, Kerry BR et al (1998)
Insect-resistant transgenic plants. Tib Technol
16:168175
7. Guerreiro O, Denolf P, Peferoen M et al
(1998) Susceptibility of the coffee leaf miner
(Perileucoptera spp.) to Bacillus thuringiensis
-endotoxins : a model for transgenic perennial
crops resistant to endocarpic pests. Curr
Microbiol 36:175179
8. Dandekar AM, McGranahan GH, Vail PV et al
(1998) High levels of expression of full-length
cryIA(c) gene from Bacillus thuringiensis in
transgenic somatic walnut embryos. Plant Sci
131:181193
9. Surekha K, Royer M, Naidu R, et al. (2002)
Bioassay of Bacillus thuringiensis toxins against
two major coffee pests, ie coffee berry borer
(Hypothenemus hampei) and coffee white stem
borer (Xylotrechus quadripes). In: SIP (eds)
Annual meeting of the society for invertebrate
pathology. 35, 2002/08/18-23, Foz de
Iguassu, Brsil, Program and Abstracts, p 85
10. Perthuis B, Pradon J, Montagnon C et al
(2005) Stable resistance against the leaf miner
11.
12.
13.
14.
15.
16.
17.
18.
Leucoptera coffeella expressed by genetically

transformed Coffea canephora in a pluriannual
field experiment in French Guiana. Euphytica
144:321329
Campos VP, Sivapalan P, Gnanapragasam NC
(1990) Nematode parasites of coffee, cocoa
and tea. Luc M., Sikora RA., Bridge J eds.
Plant-parasitic nematodes in subtropical and
tropical agriculture. CAB International, In,
pp 113126
Noir S, Anthony F, Bertrand B et al (2003)
Identification of a major gene (Mex-1) from
Coffea canephora conferring resistance to
Meloidogyne exigua in Coffea arabica. Plant
Pathol 52:97103
Christey MC (2001) Use of Ri-mediated transformation for production of transgenic plants.
In Vitro Cell Dev Biol-Plant 37:687700
Veena V, Taylor CG (2007) Agrobacterium
rhizogenes: recent developments and promising
applications. In Vitro Cell Dev Biol-Plant 43:
383403
Jian B, Hou W, Wu C et al (2009) Agrobacterium
rhizogenes-mediated
transformation
of
Superroot-derived Lotus corniculatus plants: a
valuable tool for functional genomics. BMC
Plant Biol 9:78. doi:10.1186/1471-2229-9-78
Van der Vossen HAM (2005) State of the art of
developing durable resistance to biotrophic
pathogens in crop plants, such as coffee leaf
rust. In: Zambolim E, Zambolim M, Varzea
VMP (eds) Resistance to Coffee Leaf Rust.
Brazil, Vicosa, p 305
Mah L, Combes MC, Varzea VMP et al
(2008) Development of sequence characterized DNA markers linked to leaf rust
(Hemileia vastatrix) resistance. Mol Breeding
21:105113
Lashermes P, Combes MC, Ribas A et al
(2010) Genetic and physical mapping of the
SH3 locus that confers resistance to leaf rust in
coffee (Coffea arabica L.). Tree Gen Gen
6:973980
290
19. Ribas A, Cenci A, Combes M-F et al (2011)

Organization and molecular evolution of a
disease-resistance gene cluster in Coffee
trees. BMC Genomics 12:240, http://www.
biomedcentral.com/1471-2164/12/240
20. Etienne H, Anthony F, Dussert S et al (2002)
Biotechnological applications for the improvement of coffee (Coffea arabica L.). In Vitro
Cell Dev Biol- Plant 38:129138
21. De Los Santos-Briones C, HernndezSotomayor SMT (2006) Coffee biotechnology.
Braz J Plant Physiol 18:217227
22. Marraccini P, Freire LP, Alves GSC et al (2011)
RBCS1 expression in coffee: Coffea orthologs,
Coffea arabica homeologs, and expression
variability between genotypes and under
drought stress. BMC Plant Biol 11:85
23. Marraccini P, Pereira LPP, Ferreira LP et al
(2003) Biochemical and molecular characterization of enzyme controlling sugar metabolism during coffee bean development. ISPMB
conference, Barcelona (Spain), 2328 June
2003, poster S1914
24. Marraccini P, Deshayes A, Ptiard V et al
(1999) Molecular cloning of the complete 11S
seed storage protein gene of Coffea arabica
and promoter analysis in transgenic tobacco
plants. Plant Physiol Biochem 37:273282
25. Petitot AS, Barsalobres-Cavallari C, Ramiro D
et al (2013) Promoter analysis of the WRKY
transcription
factors
CaWRKY1a
and
CaWRKY1b homoeologous genes in coffee
(Coffea arabica). Plant Cell Rep 32(8):1263
1276, doi:1007/s00299-013-1440-3
26. Lashermes P, Combes MC, Prakash NS et al
(2001) A genetic linkage map of Coffea
canephora: effect of segregation distortion and
analysis of recombination rate in male and
female meiosis. Genome 44:589595
27. Leroy T, De Bellis F, Legnate H et al (2011)
Improving the quality of African robustas:
QTLs for yield- and quality-related traits in
Coffea canephora. Tree Genetics & Genomes
7:781798
28. Leroy T, Marraccini P, Dufour M et al (2005)
Construction and characterization of a Coffea
canephora BAC library to study the organization of sucrose biosynthesis genes. Theor
Applied Genet 111:10321041
29. Denoeud F, Carretero-Paulet L, Dereeper A
et al (2014) Structure and adaptive landscape
of the coffee genome. Science (in press)
30. Barton CR, Adams TL, Zarowitz MA (1991)
Stable transformation of foreign DNA into
Coffea arabica plants. In: ASIC (eds) 14th
International colloquium on coffee science,
San Francisco (USA), 1419 July 1991, ASIC,
Paris (France), pp 853859
31. Feng Q, Yang MZ, Zheng XQ et al (1992)

Agrobacterium mediated transformation of
coffee (Coffea arabica L.). Chn J Biotech
8:255260
32. Freire AV, Lightfoot DA, Preece JE (1994)
Genetic transformation of coffee (Coffea arabica L.) by Agrobacterium spp. Hortsci 29:454
33. Alpizar E, Dechamp E, Espeout S et al (2006)
Efficient production of Agrobacterium
rhizogenes-transformed roots and composite
plants for studying gene expression in coffee
roots. Plant Cell Rep 25:959967
34. Alpizar E, Dechamp E, Guilhaumon C et al
(2008) Agrobacterium rhizogenes-transformed
roots of coffee: conditions for long-term proliferation, morphological and molecular characterization. Ann Bot 101:929940
35. Spiral J, Ptiard V (1993) Dveloppement
d'une mthode de transformation applique
diffrentes espces de cafiers et rgnration
de plantules transgniques. In: ASIC (eds)
15th International colloquium on coffee science, Montpellier (Fra), 611 June 1993,
ASIC, Paris (France), pp 115122
36. Spiral J, Thierry C, Paillard M et al (1993)
Obtention de plantules de Coffea canephora
Pierre (Robusta) transformes par Agrobacterium
rhizogenes. C R Acad Sci Paris 316:16
37. Sugiyama M, Matsuoka C, Takagi T (1995)
Transformation of coffee with Agrobacterium
rhizogenes. In: ASIC (eds) 16th International colloquium on coffee science, Kyoto (Jap), 914
April 1995, ASIC, Paris (France), pp 853859
38. Hatanaka T, Choi YE, Kusano T et al (1999)
Transgenic plants of coffee Coffea canephora
from embryogenic callus via Agrobacterium
tumefaciens-mediated transformation. Plant
Cell Rep 19:106110
39. Leroy T, Paillard M, Royer M et al (1998)
Introduction de gnes dintrt agronomique
dans lespce Coffea canephora Pierre par transformation avec Agrobacterium sp. In: ASIC
(eds) 17th international colloqium on coffee
science, Nairobi (Kenya), 2025 July 1997,
ASIC, Paris, pp 439445
40. Leroy T, Henry AM, Royer M et al (2000)
Genetically modified coffee plants expressing
the Bacillus thuringiensis cry1Ac gene for resistance to leaf miner. Plant Cell Rep 19:382389
41. Etienne H, Bertrand B, Georget F et al (2013)
Development of coffee somatic and zygotic
embryos to plants differs in the morphological,
histochemical and hydration aspects. Tree
Physiol 33:640653
42. Bobadilla Landey R, Cenci A, Georget F et al
(2013) High genetic and epigenetic stability in
Coffea arabica plants derived from embryogenic
suspensions and secondary embryogenesis as
43.
44.
45.
46.
47.
revealed by AFLP, MSAP and the phenotypic

variation rate. PloS ONE 8(2):e56372.
doi:10.1371/journal.pone.0056372
Ribas A, Dechamp E, Bertrand B, Champion A
et al (2011) Agrobacterium tumefaciensmediated genetic transformation of Coffea arabica (L.) is highly enhanced by using long-term
maintained embryogenic callus. BMC Plant
Biol 11:92, doi:10.1186/1471-2229-11-92.
h t t p : / / w w w. b i o m e d c e n t r a l . c o m /
1471-2229/11/92
Mugnier J (1988) Establishment of new axenic
hairy root lines by inoculation with Agrobacterium
rhizogenes. Plant Cell Rep 7:912
Kifle S, Shao M, Jung C et al (1999) An
improved transformation protocol for
studying gene expression in hairy roots of
sugar beet (Beta vulgaris L.). Plant Cell Rep
18:514519
Bertrand B, Anthony F, Lashermes P (2001)
Breeding for resistance to Meloidogyne exigua
in Coffea arabica by introgression of resistance
genes of Coffea canephora. Plant Pathol
50:637643
Bevan M (1984) Binary Agrobacterium vectors
for plant transformation. Nucleic Acids Res
12:87118721
291
48. Curtis MD, Grossniklaus U (2003) A gateway

cloning vector set for high-throughput functional analysis of genes in planta. Plant Physiol
133:462469
49. Etienne H (2005) Protocol of somatic
embryogenesis: coffee (Coffea arabica L. and
C. canephora P.). In: Jain SM, Gupta PK (eds)
Protocols for somatic embryogenesis in
woody plants series: forestry sciences, vol 77.
Springer, Deutschland, pp 167179. ISBN
1-4020-2984-5
for rapid growth and bio assays with tobacco tissue cultures. Physiol Plant 15:473497
51. Jouanin L, Tourneur J, Casse-Delbart F (1986)
Restriction maps and homologies of the three
plasmids of Agrobacterium rhizogenes strain
A4. Plasmid 16:124134
52. Jefferson R (1987) Assaying chimeric genes in
plants: the GUS gene fusion system. Plant Mol
Biol Rep 5:387405
53. Vancanneyt G, Schmidt R, OConnor-Sanchez
A et al (1990) Construction of an introncontaining marker gene. Splicing of the intron
in transgenic plants and its issue in monitoring
early events in Agrobacterium-mediated plant
transformation. Mol Gen Gen 220:245250
Chapter 23
Pineapple [Ananas comosus (L.) Merr.]
Abstract
The efficacy of Agrobacterium-mediated pineapple transformation technique has been improved (mean
percentage of transgenic micro-shoots regenerated from initial callus explants up to 20.6 %) using a novel
encapsulation-based, antibiotic selection procedure. The detailed protocol using a standard plant transformation vector (pCAMBIA1304) as reported in an elite Indian variety (Queen) of pineapple [Ananas
comosus (L.) Merr] can be applied to other varieties of pineapple for introgression of target genes.
Key words Agrobacterium tumefaciens, Antibiotic selection, Encapsulation, Pineapple, Transformation
Introduction
Pineapple [Ananas comosus (L.) Merr, family Bromeliaceae] is
considered as one of the most economically important tropical
fruits. It is the number one agricultural commodity in certain parts
of the world. However, its production often becomes severely limited due to a number of soilborne pathogens (http://www.nhb.
gov.in/fruits/pineapple/pin002.pdf) since the normal practice of
its propagation is through crowns (tops) and slips (side shoots
arising in older leaf axils) (http://www.uga.edu/fruit/pinapple.
htm). Classical pineapple plant breeding is based on crosses, backcrosses, and selection [1]. Because of the long generation cycle of
pineapple, the conventional breeding programs are extremely
time-consuming and can hardly keep pace with the rapid evolution
of pathogenic fungi [2].
Genetic engineering is an attractive tool for improving
elite pineapple clones. This has been attempted with varying
degrees of success either through micro-projectile-mediated gene
delivery [3, 4], selection by micropropagation in temporary
immersion bioreactors (TIBs) [5], or Agrobacterium-mediated
transformation [6] techniques. The target explants for cocultivation
vis--vis transformation range from leaf bases of micropropagated
shoots [3] to embryogenic cell clusters [6]/callus pieces [4, 5].
293
294
Each gene delivery system and choice of target tissue has its own
inherent advantage as well as limitations. Of the three gene delivery systems, the biolistic and use of temporary immersion bioreactors seem to be more technically demanding in comparison to
the Agrobacterium-mediated transformation, which has delivered
success in most of the plant system targeted for transgenic production till date. Regarding the target explant, which would
show high regeneration frequency after cocultivation either
through organogenesis or somatic embryogenesis, direct organogenesis from explants or an intermediate callus stage is a preferred one over regeneration from long-term maintained
embryogenic calli or cell clusters due to relative higher frequency
of the former than the latter. Finally, the efficacy of any transformation program for large-scale production depends on stringent
selection as far as practicable so that true targeted transgenics
can be picked up rightly from the large crowd of false-positive
antibiotic/GUS. This is evident in the entire successful pineapple transformation programs where relatively few transgenic lines
have been confirmed by the workers in spite of obtaining a large
number of GUS-positive regenerants/transformants initially. The
biolistic approach provided an acceptable efficiency of 0.21
1.5 % in case of Smooth Cayenne cultivar of pineapple [4],
while an efficiency of 6.6 % of transgenic plant recovery was
reported [5]. This cultivar while worked out with Agrobacteriummediated transformation technique again encountered a large
number of escape plants, which was gradually eliminated through
a very rigorous and time-consuming stepwise selection procedure [6]. Furthermore, regeneration from embryogenic callus
pieces with occasional somaclonal variation was another bottleneck with this approach [6].
Considering all these factors, the present protocol of an
Agrobacterium-mediated transformation for pineapple using a standard plant transformation vector (pCAMBIA1304) with subsequent encapsulation-based novel antibiotic selection technique was
designed to minimize the occurrence of false-positive plants, which
in consequence would elevate the transformation frequency.
Precisely, in this two-step selection protocol, micro-shoots regenerating from the organogenic calli after cocultivation and initial
screening in agar-gelled media for antibiotic resistance were encapsulated in alginate beads containing hygromycin, the selection antibiotic. The hypothesis was the alginate beads containing sublethal
concentration of antibiotic would provide a uniform environment
for selection to the entrapped micro-shoot that has overcome the
first step of screening in antibiotic containing agar-gelled media.
This endeavor of stringent selection resulted in higher transformation frequency (mean percentage of transgenic micro-shoots regenerated from initial organogenic callus explants up to 20.6 %). The
work was reported by our group in elite Indian variety (Queen) of
pineapple [7]. The scheme of this protocol is presented in Fig. 1.
295
Establishment of aseptic culture

Step
Action
Surface sterilization and

culture of meristems with
leaf primordia from the
innermost leaves in RM2
Subculture
of
the
responding explants in
RM2
Day of
Action/observation
1
30
45-55
Plantlets
separated
out
aseptically and subcultured
individually in maintenance
media in MM
Events
Regeneration
plantlets
from
bases
of
leaf
60
Establishment of regeneration system suitable for transformation

1
Culture
of
excised
meristematic
leaf
base
regions of the aseptically
maintained plantlets in RM1
30-40
10 mm
Development
of
organogenic calli
Fig. 1 Scheme of the entire protocol
296
Agrobacterium mediated transformation followed by encapsulation based

selection
Step
1
Action
Infection of organogenic
callus pieces (explants)
with
Agrobacterium
followed by co cultivation
in induction media (RM1
+ acetosyringone)
Transfer of explants to
agar gelled selection
media (containing 20 mg
/L hygromycin)
Day of
Action/observation
1
Efficiency cascade
100 explants per

experimental
set
(total 408 infected in
four sets)
Same as above but

media containing 30 mg
/L hygromycin
11
Same as above but

/L hygromycin
18
Same as above but

/L hygromycin
25
Same as above but

/L hygromycin
32
~65 70 explants
Encapsulation
of
micro
shoots (excised aseptically
from
regenerated
calli,
individual micro shoot ~1.5
2.0 mm long, rate of
regeneration
6-10
per
explant)
in
Ca-alginate
beads containing 60 mg /L
hygromycin; beads kept in
sterile petri dishes under
culture room conditions
40
~500 micro shoots
Fig. 1 (continued)
10 mm
Step
Action
Day of
Action/observation
70
297
Efficiency cascade
(per experimental set)
~275 micro shoots
Growth of hygromycinresistant micro shoots

rupturing the beads
10
11
Histochemical
GUS
assay of portions of the
selected micro shoots
Multiplication
of
the
selected trasformants in
RM2
for
three
successive sub cultures
of three weeks each (~60
days)
PCR analysis with uidA

gene specific primers of
the
selected
plantlets
micro propagated in MM,
followed
by
Southern
Hybridization
Fig. 1 (continued)
70
36% GUS positive

(99/275)
130
135
onwards
The
uidA
fragment
(1051 bp) amplified in
DNA samples from
~85%
plantlets
(84/99);
30.54%
considering the total
number
of
viable
micro
shoots
(84/275);
20.58%
considering the initial
infected
callus
explants (84/408). All
randomly
selected
plantlets showed low
to
moderate
copy
number
of
gene
integration.
298
2
2.1
Materials
Plant Material
2.2 Agrobacterium
tumefaciens Vectors
and Strains
2.3 Plant
Culture Media
Elite Indian variety (Queen) of field-grown pineapple was used in

the works reported earlier [8].
A. tumefaciens (strain LBA4404) harboring the binary vector
pCAMBIA1304 (12,361 bp; Centre for Application of Molecular
Biology to International Agriculture, Australia) was used for transformation. The T-DNA contains hygromycin phosphotransferase
II (hptII), the hygromycin plant selection gene, and the reporter
genes mgp5 (modified green fluorescent protein) and uidA
(-glucuronidase). All these genes are driven by CaMV35S (cauliflower mosaic virus 35S) promoter.
1. Maintenance Medium (MM): Full-strength MS basal medium
[9] supplemented with myoinositol (100 mg/l), sucrose
(30 g/l), agar (0.75 %), 6-benzylaminopurine (BAP, 1 mg/l),
and indole-3-acetic acid (IAA, 0.1 mg/l).
2. Regeneration Medium 1 (RM1): Similar to MM except the
growth regulators6-benzylaminopurine (BAP, 10 mg/l)
and 1-naphthaleneacetic acid (NAA, 10 mg/l).
3. Regeneration Medium 2 (RM2): Similar to RM1 except the
growth regulators6-benzylaminopurine (BAP, 5 mg/l) and
indole-3-acetic acid (IAA, 0.5 mg/l).
4. Liquid Rooting Medium (LRM): Basal MS medium without
agar, supplemented with IAA (1 mg/l) as the sole growth
regulator.
5. The pH of media is to be adjusted to 5.6 with KOH/HCl
(1 N) before the addition of gelling agent and autoclaving at
121 C, 104 kPa for 15 min. All media (except LRM) are to be
solidified with 0.75 % agar to obtain gel strength of about
800 g/cm2. Cultures are to be kept under a photoperiod of
16 h (white fluorescent light, 4080 mol/m2/s) at 25 2 C
and 78 % relative humidity.
2.4 Bacterial
Culture Media
1. YEB medium: 0.1 % yeast extract, 0.5 % beef extract, 0.5 % peptone, 0.5 % sucrose, 0.049 % MgSO4, pH 7.2, containing kanamycin (100 mg/l, for pCAMBIA1304 selection) and rifampicin
(50 mg/l, for chromosomal background selection) (see Note 1).
2. The autoclaving condition of bacterial culture medium is
similar to that of plant culture medium.
2.5 Chemicals, Stock

Solutions, and Other
Supplies
1. Plant tissue culture general chemicals, vitamins, and growth

regulators: SIGMA.
2. Stock solution of BAP: Weigh 10 mg BAP powder and dissolve with 23 drops of HCl (1 N), volume to be made up to
299
10 ml with double-distilled water (DDW). To be filtersterilized and stored in aliquots at 4 C. Put in water bath
(~3540 C prior use).
3. Stock solution of auxins (IAA/NAA): Weigh 10 mg IAA/
NAA powder and dissolve with 23 drops of ethanol, volume
to be made up to 10 ml with DDW. To be filter-sterilized and
stored in aliquots at 4 C. Put in water bath (~3540 C prior
use).
4. Presterilized (-irradiated; of TARSONS/AXYGEN/others)
plastic Petri plates (90 mm and/or 35 mm diameter) are to
be used for callus induction/coculture/bacterial culture
maintenance.
5. For increased T-DNA transfer, 400 M acetosyringone
(3,5-dimethoxy-4-hydroxyacetophenone) is to be used.
6. Filter papers for coculture step: Whatman, qualitative grade 1.
7. CaCl22H2O and sodium alginate are to be procured from
SIGMA/FLUKA.
8. X-Gluc (5-bromo-4-chloro-3-indolyl
SIGMA preferably is to be used.
glucuronide)
from
9. Genomic DNA of control and putative transgenic plants can

be isolated using the Qiaquick DNeasy Plant Kit (Qiagen) or
any other standard kit of reputed manufacturer.
10. Primers were obtained from MWG Biotech (AG, Ebersberg,
Germany) and can be procured from any reputed company.
11. PCR components were procured from SibEnzyme and can be
obtained from any reputed company dealing with molecular
biology products.
12. PCR amplification can be carried out with thermal cycler
machine of any reputed make like MJ Research, Applied
Biosystems, and Bio-Rad.
13. Agarose (DNase/RNase-free) and ethidium bromide are to be
procured from SIGMA/Invitrogen/Bioline.
14. Tris (tris(hydroxymethyl)aminomethane), EDTA (ethylenediaminetetraacetic acid), and other components for buffer
preparation should be DNase/RNase-free and of reputed
make.
15. Restriction enzymes (e.g., EcoRI and BamHI) are to be procured from Fermentas, Life Sciences, NEB etc.
16. For Southern hybridization nylon membrane (Hybond N+) of
Amersham (GE Healthcare Life Sciences) can be used.
17. Rediprime II Random Labeling Kit of Amersham (GE
Healthcare Life Sciences) can be used for random priming.
300
Methods
3.1 Establishment
and Aseptic
Maintenance of Plant
Cultures
1. Meristems with leaf primordia from the innermost leaves

(numbers 36 from the stem apex, each ~0.51.5 cm long)
from the crowns of any pineapple variety of interest are to be
used as explants.
2. Explants are to be thoroughly washed with few drops of Tween
20 (surfactant).
3. Explants are subsequently surface-sterilized with 0.25 % (w/v)
mercuric chloride for 510 min (see Note 2) followed by rinsing with sterile DDW four times in laminar flow hood chamber. Plantlets regenerate in tuft from the sheathing leaf bases
by direct organogenesis in this stage in RM2 (Regeneration
Medium 2).
4. Each plantlet is separated out aseptically and those are to be
maintained in vitro in MM (Maintenance Medium) as the stock
culture for regeneration and transformation experiments.
3.2 Establishment
of Plant Regeneration
System Suitable
for Transformation
1. Excised meristematic leaf base regions (leaves are to be taken

from the in vitro maintained aseptic plantlets) are cultivated in
Petri dishes (35 mm diameter, sterile) on RM1 (Regeneration
Medium 1).
2. Highly regenerating organogenic calli persistently giving rise
to adventitious shoot bud-like structures by repetitive organogenic calli will be obtained within 45 weeks.
3. Those calli are to be used as the starting explants for subsequent Agrobacterium infection.
4. A set of leaf base regions has to be monthly transferred on induction medium in order to obtain a continuous supply of suitable
explants for carrying out the transformation experiments.
3.3 Maintenance
of Bacterial Culture
3.4 Inoculation
and Cocultivation
A 50 ml bacterial culture initiated from a single Agrobacterium

colony is to be grown overnight (28 C, 180 rpm) in sterile YEB
medium.
1. After attaining an optical density (absorbance) of 1.0 at
600 nm, the bacterial cultures are to be centrifuged at 2,712 g
for 5 min (20 C).
2. The supernatant has to be discarded and the pellet resuspended
in 10 ml of 10 mM MgCl2.
3. After centrifugation at 2,712 g for 5 min, the washed bacterial
pellet is to be resuspended by shaking at 100 rpm for 2 h with
10 ml of MS basal liquid medium (without agar, pH 5.6)
devoid of growth regulator but containing 400 M acetosyringone (preinduction medium; see Note 3).
301
4. Explants (ca. 10 mm callus pieces with initiation of shoot budlike structures) have to be simultaneously excised and aseptically pooled in MS liquid medium without growth regulator.
From that pool about 100 explants per experimental set are to
be placed in 10 ml of preinduction medium in which 10 ml of
preinduced liquid bacterial culture is to be finally added to
obtain a 20 ml coculture.
5. Explants are then to be subjected to vacuum infiltration for
5 min in vacuum desiccators followed by shaking at 100 rpm for
2.5 h. Excess of bacterial suspension has to be removed by filtration with sterile filter papers in Bchner funnel (see Note 4), and
Agrobacterium-infected explants are placed on semisolid MS
induction medium (same as RM1, supplemented with 400 M
acetosyringone, poured in 35 mm Petri plates).
6. The plates are to be left for cocultivation under a photoperiod
of 16 h (white fluorescent light, 4080 mol/m2/s) at
25 2 C and 78 % relative humidity.
3.5 Selection
of Transformants Prior
to Encapsulation
1. The lethal and sublethal doses of cefotaxime (500 and

300 mg/l) and hygromycin (60 and 40 mg/l) have to be
determined separately using uninfected control explants.
2. The infected explants are to be transferred after 3 days of
cocultivation onto agar-gelled selection medium (poured in
35 mm Petri plates), i.e., MS induction medium supplemented
with both decontamination (cefotaxime 300 mg/l) and selective antibiotics (hygromycin B).
3. Explants are to be weekly subcultured on selection medium for
5 weeks with gradual increase of hygromycin concentration
(2060 mg/l in 10 mg intervals).
3.6 Selection
of Transformants After
Encapsulation in Ca
Alginate Beads
1. For stringent antibiotic selection, the surviving cocultivated

prescreened explants, i.e., callus pieces starting to give rise to
hygromycin-resistant micro-shoots on agar-gelled selection
media containing hygromycin of appropriate concentration
(sublethal usually 4050 mg/l; to be standardized earlier), are
to be subsequently encapsulated in Ca alginate beads having
similar concentration of hygromycin.
2. Explants, now individual micro-shoots (1.52.0 mm in length),
are collected (5060 for each concentration of hygromycin) in
liquid MS medium (25 ml) without growth regulator and
CaCl22H2O (see Note 5).
3. The liquid medium containing micro-shoots have to be mixed
with an equal volume (25 ml) of the same medium supplemented with 2.5 % (w/v) sodium alginate (see Note 6). The
alginate-containing medium (containing micro-shoots) is then
302
quickly and continuously dropped (100150 l) in 100 ml of

sterile solution of CaCl22H2O (0.17 M) using a sterile pipette
(or micropipette having cut tips for dispensing) of the appropriate diameter. The drops (beads) containing single microshoots are to be kept in concentrated CaCl22H2O solution for
30 min on a slow gyratory shaker (50 rpm) for proper setting
of the beads.
4. The beads then have to be rinsed with sterile DDW for three
times and placed in sterile Petri dishes (35 mm in diameter) for
incubation in the culture room (see Note 7) under light (as
stated in Subheadings 2.3 and 3.4) for 30 days (49 beads/
Petri plate).
5. The hygromycin-resistant micro-shoots will grow out by rupturing the beads. Others will turn brown and die within the
beads. The chance of obtaining false-positive antibiotics is
very remote since those have been selected within Ca alginate
beads, which have provided a uniform selection gradient unlike
in agar-gelled media.
3.7 Histochemical
GUS Assay
1. Randomly selected hygromycin-resistant micro-shoots emerging from the beads are subjected to histochemical GUS (betaglucuronidase) assays according to the protocol of Jefferson
et al. [10].
2. The whitish to green basal zones of the micro-shoots are
immersed in an X-Gluc (5-bromo-4-chloro-3-indolyl glucuronide) solution (see Note 8).
3. Tissues are incubated overnight in the dark at 37 C for staining and subsequently cleared using an ethanol series (70, 85,
95, and 100 %, 1 h at each concentration).
4. GUS-positive shoots/tissues turn blue, while the white ones
can be discarded as GUS-negative.
3.8 Multiplication
of Selected
Transformants
1. The hygromycin-resistant and GUS-positive micro-shoots

[selected only from the ruptured beads containing high
concentration (60 mg/l and beyond) of hygromycin] are to
be transferred to Regeneration Medium 2 and cultured for
3 weeks under the cultural conditions as stated in
Subheading 2.3, item 5.
2. The proliferated micro-shoots are then to be subcultured every
3 weeks on Maintenance Medium (MM).
3. After 2 months, the healthy shoots can be transferred
individually to Liquid Rooting Medium (LRM) under the cultural conditions as stated in Subheading 2.3, item 5 for 90 days
before hardening and subsequent transplanting to soil.
3.9 Molecular
Analysis
3.9.1 PCR Analysis
303
1. Genomic DNA of randomly selected hardened putative

transformed and control plants is isolated from 100 mg of
leaves following the instruction of kit.
2. PCR analysis of genomic DNA is to be performed with forward
(5-CAACGTCTGCTATCAGCGCGAAGT-3) and reverse
(5-TATCCGGTTCGTTGGCAATACTCC-3) primers targeting the uidA gene (size of the PCR product: 1,051 bp).
3. Each PCR reaction is performed in 25 l total volume consisting of 1 PCR buffer (including MgCl2), 200 M of each
dNTP, 0.4 M of each primer, 25 ng of genomic DNA, and
1 unit of Taq DNA polymerase.
4. PCR amplifications are carried out in a thermal cycler with an
initial denaturation step of 90 s at 94 C followed by 30 s denaturation at 94 C, 45 s annealing at 58 C, and 1 min extension
at 72 C for 30 cycles and 7 min final extension at 72 C [11].
5. The PCR products are resolved in 1.6 % agarose gel
(TAE, 7 V/cm) and detected by ethidium bromide staining
(see Notes 910).
6. Specific PCR product of uidA gene (1,051 bp) indicates
positive transformants.
3.9.2 Southern
Hybridization Analysis
1. For genomic Southern hybridization analysis, approximately

10 g of total DNA is isolated from both transgenic and nontransformed control shoots following the instruction of DNA
isolation kit.
2. DNA of pCAMBIA1304 is to be taken as positive control.
3. All the DNA are digested with two restriction enzymes,
EcoRI and BamHI, in order to generate left border and
right border junction fragments both as single and double
digests (see Note 11).
4. Genomic (10 g) and pCAMBIA1304 (plasmid-positive control, 5 pg) DNA digests are separated on 0.8 % agarose gels
(TAE) overnight at 2 V/cm.
5. The DNA fragments are transferred onto nylon membranes
using standard protocols [12].
6. A PCR-amplified uidA fragment (1,051 bp, primers described
in Subheading 3.9.1, step 2) is to be used as a probe after radio
labeling [-(32P) dCTP] by random priming.
7. Hybridization and autoradiography are to be carried out
according to standard protocols [12] and instructions of the
manufacturers, wherever necessary.
8. Stable integration and copy number estimation of the uidA
gene into the genome of transgenic pineapple are detected
through positive hybridization signals in comparison to the
positive control.
304
Notes
1. Antibiotics are not to be autoclaved along with culture media;
rather they are to be added in media from stock solutions after
filter sterilization through a 0.2 hydrophobic filter in laminar
flow hood chamber. Stock solutions of antibiotics can be stored
at 20 C or can be prepared freshly as per need.
2. Concentration of mercuric chloride and the duration of the
treatment can be increased considering the rate of contamination vis--vis infection-free established explants in culture. Since mercuric chloride is a hazardous chemical,
caution is needed to handle the chemical and also to dispose
the solution.
3. Acetosyringone dissolves in DMSO (dimethyl sulfoxide).
Required amount to be added from prefilter-sterilized stock
solution.
4. Porcelain components of Bchner funnel have to be presterilized by autoclaving.
5. The concentration of CaCl22H2O has to be pre-standardized
(usually it is 0.17 M).
6. The concentration of sodium alginate for optimum gelling has
to be pre-standardized. Usually, it is 2.5 % (w/v). Extreme care
has to be taken during autoclaving media supplemented with
sodium alginate since this chemical has a tendency of losing
gelling capacity if over autoclaved.
7. Petri plates for culture/coculture/selection experiments are to
be sealed properly with PARAFILM (American National Can)
to avoid contamination and losing desirable transformants.
8. X-Gluc solution consists of 2 mM X-Gluc, 100 mM TrisHCl,
pH 7.0, 50 mM NaCl, 2 mM potassium ferricyanide, and
0.1 % v/v Triton X-100.
9. The composition of 50 TAE buffer (100 ml): Tris 24.2 g,
glacial acetic acid 5.71 ml, 0.5 M EDTA 10 ml, pH adjusted to
8.0 with HCl.
10. Ethidium bromide is an extremely hazardous chemical; proper
care should be taken during weighing and dispensing it. Stock
solution: 10 mg dissolved in 1 ml of DDW; for 100 ml of agarose gel, 11.5 l from stock.
11. Unique EcoRI and BamHI restriction sites occur within
pCAMBIA1304 T-DNA, 3,6503,700 bp upstream from the
right T-border.
305
Acknowledgment
A critical reading of the manuscript by Ms. Ranjana Prasad is duly
acknowledged. Authors are thankful to the director of Bose
Institute.
References
1. Botella JR, Cavallaro AS, Cazzonelli CI (2000)
Towards the production of transgenic pineapple to control flowering and ripening. Proc 3rd
Int Pineapple Symp. Acta Hortic 529:115122,
Subhadrabandhu S, Chairidchai P (eds.)
2. Cabot C, Lacoevilhe JC (1990) A genetic
hybridization programme for improving pineapple quality. Acta Hortic 275:395400
3. Sripaoraya S, Marchant R, Power JB, Davey
MR (2001) Herbicide tolerant transgenic
Pineapple (Ananas comosus) produced by micro
projectile bombardment. Annal Bot (Lond)
88:597603
4. Ko HL, Campbell PR, Jobin-Dcor MP,
Eccleston KL, Graham MW, Smith MK (2006)
The introduction of transgenes to control
Blackheart in Pineapple (Ananas comosus L.)
cv. Smooth Cayenne by micro projectile bombardment. Euphytica 150:387395
5. Espinosa P, Lorenzo JC, Iglesias A, Yabor L,
Menendez E, Borroto J, Hernandez L,
Arencibia AD (2002) Production of pineapple
transgenic plants assisted by temporary immersion bioreactors. Plant Cell Rep 21:136140
6. Firoozabady E, Hecker M, Gutterson N
(2006) Transformation and regeneration of
pineapple. Plant Cell Tiss Org Cult 84:116
7. Gangopadhyay G, Roy SK, Basu Gangopadhyay

S, Mukherjee KK (2009) Agrobacteriummediated genetic transformation of pineapple
var. Queen using a novel encapsulation-based
antibiotic selection technique. Plant Cell Tiss
Org Cult 97:295302
8. Gangopadhyay G, Bandyopadhyay T, Poddar
R, Basu Gangopadhyay S, Mukherjee KK
(2005) Encapsulation of pineapple micro
shoots in alginate beads for temporary storage.
Curr Sci 88:972977
10. Jefferson RA, Kavanagh TA, Bevan MW
11. Gangopadhyay G, Bandyopadhyay T, Datta S,
Basu D, Mukherjee KK (2003) Agrobacterium mediated genetic transformation in Indian
Spinach (Beta palonga). Plant Cell Biotechnol
Mol Biol 4:193196
12. Sambrook J, Russell DW (2001) Molecular
cloning: a laboratory manual, 3rd edn. Cold
Spring Harbor Laboratory Press, Cold Spring
Harbor, NY
Chapter 24
Sugarcane (Saccharum Spp. Hybrids)
Abstract
Genetic transformation of sugarcane has a tremendous potential to complement traditional breeding in
crop improvement and will likely transform sugarcane into a bio-factory for value-added products. We
describe here Agrobacterium tumefaciens-mediated transformation of sugarcane. Embryogenic callus
induced from immature leaf whorls was used as target for transformation with the hypervirulent
Agrobacterium strain AGL1 carrying a constitutive nptII expression cassette in vector pPZP200. Selection
with 30 mg/L geneticin during the callus phase and 30 mg/L paromomycin during regeneration of
shoots and roots effectively suppressed the development of non-transgenic plants. This protocol was successful with a commercially important sugarcane cultivar, CP-88-1762, at a transformation efficiency of
two independent transgenic plants per g of callus.
Key words Agrobacterium tumefaciens-mediated transformation, Embryogenesis, Genetic transformation, Saccharum spp. hybrids, Sugarcane
Introduction
The current sugarcane cultivars are typically interspecific hybrids
between Saccharum officinarum and Saccharum spontaneum.
Some of the interspecific hybridizations also involve S. robustum,
S. sinense, S. barberi, Miscanthus, or Erianthus [1].
Sugarcane is an economically important crop in the tropical
and subtropical regions of the world. Over 75 % of the worlds
sugar is derived from sugarcane. Sugarcane is also the most efficient feedstock for the production of the biofuel ethanol. The cost
of sugarcane ethanol production in Brazil is lower than that of corn
ethanol in the USA, and its production emits less greenhouse gases
[2]. Genetic transformation allows targeted improvement of key
traits in crop and biofuel production.
The first transgenic sugarcane plants were described in 1992
following biolistic gene transfer [3]. Agrobacterium-mediated
gene transfer for the production of transgenic sugarcane plants was
first reported in 1998 [4]. In contrast to Agrobacterium-mediated
307
308
gene transfer, early particle bombardment protocols produced

transgenic plants with complex transgene integration pattern and
plasmid backbone integration [5, 6]. However, recently optimized
biolistic gene transfer protocols using low quantities of minimal
expression cassettes result in simple integration patterns without
co-integration of plasmid backbone in sugarcane [79]. Both
Agrobacterium-mediated and biolistic gene transfer protocols for
sugarcane are able to deliver similar results in transformation efficiency, transgene integration complexity, and performance [9].
Herbicide, insect, and virus resistance as well as abiotic stress tolerance were introduced into transgenic sugarcane as reviewed by
Altpeter and Oraby [10]. More recently transgenic sugarcane with
expression of cell wall degrading enzymes [11] or altered cell wall
composition [12, 13] was generated to improve its performance
as biofuel feedstock. High yields of the value-added sugar
isomaltulose were also recently reported through sugarcane metabolic engineering [14].
In this chapter, we provide a protocol for Agrobacteriummediated transformation of sugarcane using immature leaf whorlderived callus [8, 15] as target for inoculation with the super
virulent Agrobacterium tumefaciens strain, AGL1 [16, 17], carrying the neomycin phosphotransferase (nptII) selectable marker
gene [18] expression cassette in the pPZP200 binary vector [19,
20]. Overgrowth of Agrobacterium is minimized by using a very
diluted inoculum and by careful removal of the liquid cocultivation
medium from the calli after the cocultivation period. The average
transformation efficiency with this protocol for the commercially
important cultivar CP 88-1762 is two independent transgenic
plants per 1 g of embryogenic callus.
2
2.1
Materials
Plant Material
2.2 Agrobacterium
Strain and Vector
Tops of sugarcane cultivar CP-88-1762 (see Note 1) are collected

from stalks grown in an air-conditioned greenhouse at the
University of Florida at 30 C during the day and 24 C during the
night with natural lighting and photoperiod. Plants were grown in
Fafard #2 potting mix (Sun Gro Horticulture) in 25 L containers
and fertilized weekly with Miracle-GroLawn Food (The Scotts
Miracle-Gro Company). The tops were cut below the top visible
node when 58 aboveground nodes were visible.
The super virulent Agrobacterium tumefaciens strain AGL1 [16, 17]
was used for the gene transfer carrying the maize ubiquitin (ubi)
promoter and intron [21], neomycin phosphotransferase (nptII)
gene [18], and nopaline synthase (nos) terminator in the pPZP200
binary vector [19, 20] with pVS1 replicon.
2.3
Stock Solutions
309
1. 100 mM AS stock solution (1000): dissolve 196.2 mg acetosyringone (3,5-dimethoxy-4-hydroxyacetophenone) into

8 mL dimethyl sulfoxide (DMSO), bring the total volume to
10 mL with DMSO, and make it fresh each time (see Note 2).
2. CI3 macro stock solution (10) [22]: 16.5 g/L NH4NO3,
19.0 g/L KNO3, 4.4 g/L CaCl2 2H2O, 3.7 g/L
MgSO4 7H2O, and 1.7 g/L KH2PO4. Store at 4 C.
3. Iron stock solution (50): 1.86 g/L Na2EDTA, 1.39 g/L
FeSO4 7H2O. Store at 4 C.
4. CI3 micro stock solution (100) [22]: 83 mg/L KI, 620 mg/L
H3BO3, 1,280 mg/L MnSO4 . H2O, 860 mg/L ZnSO4 .7H2O,
25 mg/L Na2MoO4 . 2H2O, 2.5 mg/L CuSO4 . 5H2O and
2.5 mg/L CoCl2 . 6H2O. Store at 4 C.
5. B5G vitamins (1,000) [22]: 10 g/L thiamine-HCl, 1 g/L
pyridoxine-HCl, 1 g/L nicotinic acid, 100 g/L myoinositol,
2 g/L glycine. Filter sterilize and aliquot 1 mL into sterile
1.5 mL tubes. Store at 20 C.
6. 2,4-D stock solution (1,000): dissolve 300 mg
2,4-dichlorophenoxyacetic acid (2,4-D) in 10 mL 1 M
KOH. Add Milli-Q H2O (EMD Millipore) while stirring and
bring the total volume to 100 mL. Store at 4 C.
7. BAP stock solution (10,000): dissolve 100 mg
6-benzylaminopurine (BAP) in 10 mL 1 M KOH. Add Milli-Q
H2O while stirring and bring the total volume to 100 mL. Store
at 4 C.
8. NAA stock solution (1,000): dissolve 186 mg
1-naphthaleneacetic acid (NAA) in 10 mL 1 M KOH. Add
Milli-Q H2O while stirring and bring the total volume to
100 mL. Store at 4 C.
9. Rifampicin stock solution (1,000): dissolve 125 mg rifampicin (PhytoTechnology Laboratories # R501) powder into
8 mL DMSO and bring the total volume to 10 mL. Aliquot
1 mL into 1.5 mL sterile tubes and store at 20 C.
10. Timentin stock solution (1,000): dissolve 2 g Timentin
(PhytoTechnology Laboratories # T869) powder into 8 mL
Milli-Q H2O and bring the total volume to 10 mL. Filter
sterilize, aliquot 1 mL into 1.5 mL sterile tubes, and store
at 20 C.
11. Cefotaxime stock solution (1,000): dissolve 2 g cefotaxime
(PhytoTechnology Laboratories # C380) powder into 8 mL
Milli-Q H2O and bring the total volume to 10 mL. Filter sterilize, aliquot 1 mL into 1.5 mL sterile tubes, and store at 20 C.
12. Geneticin stock solution (1,000): dissolve 300 mg geneticin
sulfate (G418) (PhytoTechnology Laboratories # G810) powder into 8 mL Milli-Q H2O and bring the total volume to
310
10 mL. Filter sterilize, aliquot 1 mL into 1.5 mL sterile tubes,

and store at 20 C.
13. Paromomycin stock solution (1,000): dissolve 300 mg paromomycin sulfate (PhytoTechnology Laboratories # P710)
powder into 8 mL Milli-Q H2O and bring the total volume to
10 mL. Filter sterilize, aliquot 1 mL into 1.5 mL sterile tubes,
and store at 20 C.
14. AB buffer (20) [23]: 60 g/L K2HPO4, 20 g/L NaH2PO4,
adjust pH to 7.0 using KOH or H3PO4.
15. AB salts (20) [23]: 20 g/L NH4Cl, 6 g/L MgSO4 7H2O,
3 g/L KCl, 0.2 g/L CaCl2, 50 mg/L FeSO4 7H2O.
2.4
Media
2.4.1 Media
for Agrobacterium
1. LB medium (pH 7.0): 10 g/L tryptone, 5 g/L yeast extract,

and 10 g/L NaCl. Adjust pH to 7.0. Add 15 g/L agar for
solidified media. Autoclave at 121 C (100 kPa) for 20 min.
Add 1/1,000 volume rifampicin stock solution and the appropriate antibiotics after the medium cools to 50 C.
2. AB-sucrose minimal medium: combine 50 mL sterile 20 AB
buffer and 50 mL sterile 20 AB salts with 900 mL sterile
sucrose-water (final sucrose concentration is 0.5 %). Adjust pH
to 7.0 [23]. Add 1/1,000 volume rifampicin stock solution
and the appropriate antibiotics.
3. Vir gene induction medium (VGIM): 1 AB buffer, 1 AB
salts, 50 mM 2-(4-morpholino)-ethane sulfonic acid (MES),
0.5 % glucose. Adjust pH to 5.6 [23]. Add 1/1,000 volume
AS stock solution.
2.4.2 Media for Plants
1. CI3 medium [22]: add 100 mL CI3 macro stock solution, 20 mL

iron stock solution, 10 mL CI3 micro stock solution, 1 mL 2,4-D
stock solution, and 20 g sucrose to 600 mL Milli-Q H2O. Adjust
pH to 5.8. Bring the volume to 1,000 mL with Milli-Q
H2O. Aliquot 500 mL into 1,000 mL bottles and add 1.5 g
Phytagel per 500 mL. Autoclave at 121 C (100 kPa) for 20 min.
Add under aseptic conditions 0.5 mL B5G vitamins stock solution per 500 mL medium after the medium cools to 50 C and
dispense into petri dishes.
2. Cocultivation media: add 100 mL CI3 macro stock solution,
20 mL iron stock solution, 10 mL CI3 micro stock solution,
1 mL 2,4-D stock solution, 2 g inositol and 30 g maltose,
1 mL AS stock solution, and 1 mL B5G vitamins stock solution to 600 mL Milli-Q H2O. Adjust pH to 5.4. Bring the
volume to 1000 mL with Milli-Q H2O. Filter sterilize and
store at 4 C.
3. Callus recovery medium: add 100 mL CI3 macro stock solution, 20 mL iron stock solution, 10 mL CI3 micro stock
solution, 1 mL 2,4-D stock solution, and 20 g sucrose to
600 mL Milli-Q H2O. Adjust pH to 5.8. Bring the volume
311
to 1000 mL with Milli-Q H2O. Aliquot 500 mL into 1000 mL

bottles and add 1.5 g Phytagel per 500 mL medium. Autoclave
at 121 C (100 kPa) for 20 min. Add under aseptic conditions
0.5 mL B5G vitamins stock solution, 0.5 mL Timentin stock
solution, and 0.5 mL cefotaxime stock solution after the
medium cools to 50 C and dispense into petri dishes.
4. Callus selection medium: add 100 mL CI3 macro stock solution, 20 mL iron stock solution, 10 mL CI3 micro stock
solution, 1 mL 2,4-D stock solution, and 20 g sucrose to
600 mL Milli-Q H2O. Adjust pH to 5.8. Bring the volume to
1,000 mL with Milli-Q H2O. Aliquot 500 mL into 1,000 mL
bottles and add 3 g agarose per 500 mL of medium. Autoclave
at 121 C (100 kPa) for 20 min. Add under aseptic conditions
0.5 mL B5G vitamins stock solution, 0.5 mL Timentin stock
solution, 0.5 mL cefotaxime, and 0.5 mL geneticin stock solution after the medium cools to 50 C and dispense into petri
dishes (see Note 3).
5. Callus regeneration media: add 100 mL CI3 macro stock solution, 20 mL iron stock solution, 10 mL CI3 micro stock solution,
0.1 mL BAP stock solution, 1 mL NAA stock solution, and 20 g
sucrose to 600 mL Milli-Q H2O. Adjust pH to 5.8. Bring the
volume to 1000 mL with Milli-Q H2O. Aliquot 500 mL into
1000 mL bottles and add 3 g agarose per 500 mL of medium.
Autoclave at 121 C (100 kPa) for 20 min. Add under aseptic
conditions 0.5 mL B5G vitamins stock solution, 0.5 mL Timentin
stock solution, 0.5 mL cefotaxime stock solution, and 0.5 mL
paromomycin stock solution after the medium cools to 50 C and
dispense into petri dishes (see Note 3).
6. Rooting medium: add 100 mL CI3 macro stock solution, 20 mL
iron stock solution, 10 mL CI3 micro stock solution, and 20 g
sucrose to 600 mL Milli-Q H2O. Adjust pH to 5.8. Bring the
volume to 1000 mL with Milli-Q H2O. Aliquot 500 mL into
1000 mL bottles and add 3 g agarose per 500 mL of medium.
Autoclave at 121 C (100 kPa) for 20 min. Add under aseptic
conditions 0.5 mL B5G vitamins stock solution, 0.5 mL Timentin
stock solution, 0.5 mL cefotaxime stock solution, and 0.5 mL
paromomycin stock solution after the medium cools to 50 C
and dispense into petri dishes (see Note 3).
3
3.1
Methods
Timeline
1. Callus induction: 68 weeks (see Note 4).

2. Growth of Agrobacterium: 34 days (23 days for growth of a
single colony and 1 day for liquid culture).
3. Cocultivation: 23 days.
4. Recovery on non-selection medium: 5 days.
312
5. Selection of resistant calli: 6 weeks.

6. Regeneration: 68 weeks.
7. Rooting: 23 weeks.
8. Transplanting and acclimation: 5 days.
9. A total of 67 months is needed to obtain transgenic plants
established in soil followed by 9 months of growth in the
greenhouse to obtain mature plants.
3.2
Callus Induction
1. Disease- and insect-free tops are cut below the top visible node
when 58 aboveground nodes are visible. Expanded leaves are
cut from tops, and the immature leaf whorl is surface sterilized
by wiping with 70 % ethanol.
2. After removing the top layer of the leaf whorl, the tops are
placed into a laminar hood and wiped again with 70 % ethanol.
One to two layers of the leaf whorl are aseptically removed
until the apical meristem becomes visible.
3. Ten to twenty leaf whorl cross sections of 12 mm thickness
are aseptically cut from the leaf whorl section above the apical
meristem using sharp razor blades and placed onto solidified
CI3 medium (see Note 5) [22].
4. Seven days after culture initiation, leaf whorl cross sections are
separated into half circle segments and then subcultured to
fresh CI3 medium every 7 days at 28 C and in darkness (see
Note 6). Callus growth was visible 2 weeks after culture initiation. Calli are used for inoculation with Agrobacterium 68
weeks after culture initiation and 35 days after the last subculture (see Note 4).
3.3 Preparation
of Agrobacterium
Culture
1. Transform the plasmid of choice into A. tumefaciens by electroporation [24].

2. Inoculate 2 mL LB, containing the appropriate antibiotics,
with a single colony of the transformed A. tumefaciens. Grow
the culture overnight at 28 C with shaking at 250 rpm
(Innova 42 shaker).
3. Add 1 mL of the abovementioned culture to a 250 mL sterile
flask containing 50 mL of LB with the appropriate antibiotics.
Grow the culture at 28 C with shaking at 250 rpm (Innova
42 shaker) until OD600 reaches 0.6.
4. Pipette 500 L A. tumefaciens culture and 500 L 25 % (V/V)
glycerol into a 1.5 mL tube to make an A. tumefaciens stock
solution. Store at 80 C. Alternatively it may be used without
storage and without the addition of 25 % glycerol.
5. If using a frozen A. tumefaciens stock solution, thaw it on ice
and pipette 1 mL A. tumefaciens stock solution (or alternatively pipette 500 L fresh culture) into a 250 mL sterile flask
313
with 50 mL AB-sucrose minimal medium [23]. Grow the

culture at 28 C with shaking at 250 rpm (Innova 42 shaker)
until the OD600 is 0.6.
3.4 Inoculation
and Cocultivation
1. Pellet the bacteria by centrifugation for 30 s in a microcentrifuge. Resuspend in 2 volume of VGIM medium. Shake gently
at 20 C with 50 rpm (Innova 42 shaker) for 1424 h. Pellet
the bacteria by centrifugation 30 s in a microcentrifuge [23].
Resuspend in equal volume of liquid cocultivation medium.
2. Transfer calli to a sterile 150 mL flask.
3. Prepare the inoculum by diluting the resuspended bacteria in
liquid cocultivation medium in a 1:49 ratio (see Note 7).
4. Pour the inoculation solution into the flask containing the
calli. Ensure all the calli are submerged in the solution. Incubate
the calli in the inoculation solution at room temperature for
20 min, with occasional and gentle shaking.
5. Transfer the calli onto sterile filter papers (Whatman #1004090)
to remove excessive liquid.
6. Prepare the cocultivation plates by placing three layers of filter
papers into a sterile 9 cm petri dish and pipette 45 mL cocultivation medium onto the filter papers.
7. With a pipette, remove the excess cocultivation medium from
the petri dish and transfer the calli to the filter paper with
cocultivation medium. Seal the petri dish with Parafilm, and
incubate in the dark at 19 C for 3 days.
8. Spread the cocultivated calli on three layers of sterile dry filter
paper to remove excessive moisture. Repeat this process with
fresh filter papers until the filter papers with calli remain dry.
Expose the calli on dry filter paper to the air for 1020 min in
a laminar hood for further drying (see Note 8).
3.5 Recovery,
Selection,
and Regeneration
1. Transfer the calli to recovery medium and incubate at 28 C

for 5 days under a photoperiod with 16 h light and 8 h darkness and with a light intensity of 100 mol/m2/s.
2. Subculture calli onto selection media every 7 days at 28 C
until geneticin-resistant calli develop. Geneticin-resistant calli
normally emerge 56 weeks after the initiation of selection.
3. Transfer the resistant calli onto regeneration media when they
grow to 0.5 cm in diameter.
4. Subculture the resistant calli onto fresh regeneration media
every 710 days and incubate at 28 C under 16 h light and
8 h dark photoperiod with a light intensity of 250 mol/m2/s.
5. After 24 subcultures, transfer shoots taller than 2 cm to rooting medium. The root system establishes in transgenic lines
23 weeks after transfer to rooting medium (see Note 9).
314
3.6 Transplanting
and Greenhouse Care
1. Transfer the plantlets to Fafard #2 potting mix (Sun Gro

Horticulture) after gently washing off excessive agar from the
roots with chlorine-free water. Place transparent containers
(e.g., magenta jars) over the plantlets to protect them from
dehydration and harden for 4 days at 28 C under 16 h light
and 8 h dark photoperiod with a light intensity of 200 mol/
m2/s in a growth chamber.
2. Remove the covers and exposed the plantlets to 16 h light and
8 h dark photoperiod, at 28 C light and 24 C dark with a
light intensity of 500 E/m2/s. Fertilize every week using
Miracle-Gro Lawn Food (The Scotts Miracle-Gro Company)
following the manufacturers instruction. Using manufacturers spoon, add half a spoon per 3.6 L of water. Stir to dissolve
and apply to pots until saturated. Apply fertilizer weekly.
3. When the plants are 10 cm in height, transfer to 1.3 L pots
(Stuewe & Sons Inc. # MT45). Increase the amount of fertilizer to one spoon per 3.6 L of water. Apply fertilizer weekly.
4. Transfer the plants to greenhouse under natural photoperiod
at 2531 C until the plants are 30 cm in height. Fertilize as
described in step 3.
5. Transfer the plants to 5 L pots (Stuewe & Sons Inc. # CP512)
and increase weekly fertilization rate to 2 spoons per 3.6 L of
water when plants develop aboveground nodes.
Notes
1. When alternative genotypes are considered for this protocol,
preselect suitable genotypes on the basis of their ability to generate highly embryogenic callus and their plant regeneration
potential from embryogenic callus.
2. Do not freeze this stock solution; instead make it fresh before
use to preserve its potency.
3. When media are supplemented with geneticin or paromomycin media, use agarose instead of Phytagel or agar to prevent
the reagents from precipitating.
4. Callus growth rates vary with the developmental stage of the
explant and the genotype. Use fast-growing, highly embryogenic callus as soon as it easily detaches from the explant (68
weeks after culture initiation). Longer callus induction periods
increase both the transformation efficiency and the frequency
of undesirable somaclonal variation.
5. The orientation of the leaf whorl cross sections on the medium
influences the induction of embryogenic callus. The removed
surface that is distal to the apical meristem should be in contact
with the medium.
315
6. Frequent subculture supports the formation of embryogenic

callus and enhances the regeneration potential. Genotypic differences exist for the tendency to tissue browning with
extended subcultures. Subcultures should occur before phenolics released from tissues change the color of the medium.
7. Dilution of A. tumefaciens 50 prior to cocultivation minimizes overgrowth of A. tumefaciens in subsequent steps.
8. It is important that the calli are blotted dry to minimize overgrowth of A. tumefaciens in the subsequent steps. Moderate
drying of the calli will not compromise their viability and
regeneration potential.
9. Transgenic plantlets expressing NPTII actively grow roots into
rooting media supplemented with paromomycin. Nontransgenic escape plants or transgenic plants with very low or
no expression of NPTII grow no roots or roots remain on the
surface of the paromomycin containing rooting medium.
References
1. Irvine JE (1999) Saccharum species as horticultural classes. Theor Appl Genet 98:186194
2. Crago CL, Khanna M, Barton J, Giuliani E,
Amaral W (2010) Competitiveness of Brazilian
sugarcane ethanol compared to US corn ethanol. Energy Policy 38:74047415
3. Bower R, Birch RG (1992) Transgenic sugarcane plants via microprojectile bombardment.
Plant J 2:409416
4. Arencibia AD, Carmona ER, Tellez P, Chan
MT, Yu SM, Trujillo LE, Oramas P (1998) An
efficient protocol for sugarcane (Saccharum spp.
L.) transformation mediated by Agrobacterium
tumefaciens. Transgenic Res 7:110
5. Dai S, Zheng P, Marmey P, Zhang S, Tian W,
Chen S, Beachy RN, Fauquet C (2001)
Comparative analysis of transgenic rice plants
obtained by Agrobacterium-mediated transformation and particle bombardment. Mol Breed
7:2533
6. Travella S, Ross SM, Harden J, Everett C,
Snape JW, Harwood WA (2005) A comparison
of transgenic barley lines produced by particle
bombardment and Agrobacterium-mediated
techniques. Plant Cell Rep 23:780789
7. Taparia Y, Fouad WM, Gallo M, Altpeter F
(2012) Rapid production of transgenic sugarcane with the introduction of simple loci following biolistic transfer of a minimal expression
cassette and direct embryogenesis. In Vitro
Cell Dev Biol Plant 48:1522
8. Taparia Y, Gallo M, Altpeter F (2012)
Comparison of direct and indirect embryogenesis
9.
10.
11.
12.
13.
14.
protocols, biolistic gene transfer and selection

parameters for rapid genetic transformation of
sugarcane. J Plant Biotechnol 111:131141
Jackson MA, Anderson DJ, Birch RG (2013)
Comparison of Agrobacterium and particle
bombardment using whole plasmid or minimal
cassette for production of high-expressing,
low-copy transgenic plants. Transgenic Res
22:143151
Altpeter F, Oraby H (2010) Sugarcane. In:
Kempken F, Jung C (eds) Biotechnology in
agriculture and forestry: genetic modification of plants, vol 64. Springer, Heidelberg,
pp 453467
Harrison MD, Geijskes J, Coleman HD, Shand
K, Kinkema M, Palupe A, Hassall R, Sainz M,
Lloyd R, Miles S, Dale JL (2011) Accumulation
of recombinant cellobiohydrolase and endoglucanase in the leaves of mature transgenic
sugar cane. Plant Biotechnol J 9:884896
Jung JH, Fouad WM, Vermerris W, Gallo M,
Altpeter F (2012) RNAi suppression of lignin
biosynthesis in sugarcane reduces recalcitrance
for biofuel production from lignocellulosic
biomass. Plant Biotech J 10:10671076
Jung JH, Vermerris W, Gallo M, Fedenko J,
Erickson J, Altpeter F (2013) RNAi suppression of lignin biosynthesis increases fermentable sugar yields for biofuel production from
field-grown sugarcane. Plant Biotechnol J
11:709716
Mudge SR, Basnayake SW, Moyle RL, Osabe
K, Graham MW, Morgan TE, Birch RG (2013)
316
15.
16.
17.
18.
19.

Mature-stem expression of a silencing-resistant
sucrose isomerase gene drives isomaltulose
accumulation to high levels in sugarcane. Plant
Biotechnol J 11:502509
Chengalrayan K, Gallo-Meagher M (2001)
Effect of various growth regulators on shoot
regeneration of sugarcane. In Vitro Cell Dev
Lazo GR, Stein PA, Ludwig RA (1991) A DNA
transformation-competent Arabidopsis genomic
library in Agrobacterium. Biotechnology 9:
963967
Jones HD, Doherty A, Wu H (2005) Review
of methodologies and a protocol for the
wheat. Plant Methods 1:514
Sarwar M, Akhtar M (1990) Cloning of aminoglycoside phosphotransferase (APH) gene
from antibiotic-producing strain of Bacillus circulans into a high-expression vector, p
KK223-3. Biochem J 268:671677
Bevan M (1984) A new Agrobacterium vector
for plant transformation. Heredity 53:577578
20. Hajdukiewicz P, Svab Z, Maliga P (1994) The

small, versatile pPZP family of Agrobacterium
binary vectors for plant transformation. Plant
Mol Biol 25:989994
21. Christensen AH, Quail PH (1996) Ubiquitin
promoter-based vectors for high-level expression of selectable and/or screenable marker
genes in monocotyledonous plants. Transgenic
Res 5:213218
22. Heinz DJ, Krishnamurthy M, Nickell LG,
Maretski A (1977) Cell, tissue and organ culture in sugarcane improvement. In: Reinert J,
Bajaj YPS (eds) Applied fundamental aspects of
plant cell, tissue and organ culture. Springer,
Berlin, pp 317
23. Gelvin SB (2006) Agrobacterium virulence
gene induction. In: Wang K (ed) Methods in
molecular biology, vol 343. Humana, Tatowa,
NJ, pp 7784
24. McCormac AC, Elliott MC, Chen DF (1998) A
simple method for the production of highly competent cells of Agrobacterium for transformation
via electroporation. Mol Biotechnol 9:155159
Part V
Other Important Plants
Chapter 25
Hemp (Cannabis sativa L.)
Abstract
Hemp (Cannabis sativa L.) suspension culture cells were transformed with Agrobacterium tumefaciens
strain EHA101 carrying the binary plasmid pNOV3635. The plasmid contains a phosphomannose isomerase (PMI) selectable marker gene. Cells transformed with PMI are capable of metabolizing the selective
agent mannose, whereas cells not expressing the gene are incapable of using the carbon source and will
stop growing. Callus masses proliferating on selection medium were screened for PMI expression using a
chlorophenol red assay. Genomic DNA was extracted from putatively transformed callus lines, and the
presence of the PMI gene was confirmed using PCR and Southern hybridization. Using this method, an
average transformation frequency of 31.23 % 0.14 was obtained for all transformation experiments, with
a range of 15.155.3 %.
Key words Agrobacterium-mediated transformation, Callus, Cannabis sativa, Chlorophenol red
assay, Hemp, Mannose selection, Phosphomannose isomerase, Plant tissue culture, Suspension
culture, Transformation protocol
Introduction
Hemp (Cannabis sativa L.) is regaining importance as a cultivated
crop after decades of legal prohibitions. Hemp cultivation is now
permitted in Canada under strict governmental control. The species,
Cannabis sativa, has been selected for very different qualities; while
hemp varieties are cultivated for seed, oil, and fiber and may contain
only trace amounts of the psychoactive drug, 9-tetrahydrocannabinol
(THC), related marijuana varieties are selected for high THC content [13]. Hemp and marijuana are very difficult to distinguish
morphologically but are biochemically distinct.
There is interest in developing improved varieties of hemp that
are resistant to disease and pest pressures and possess enhanced
qualities [1, 4]. Plant tissue culture and genetic transformation are
biotechnological approaches that can be used to compliment conventional breeding toward hemp improvement [5]. Clonal multiplication of hemp plants can be achieved through micropropagation by
shoot tip culture [6]. A method was also identified to encapsulate
319
320
axillary bud explants using synthetic seed technology [7]. Hemp has
long been considered recalcitrant to both regeneration and transformation; explants readily form callus and develop roots but have had
a very poor ability for shoot formation [4, 810]. However, recent
progress is now shifting this notion. Indirect shoot organogenesis
was demonstrated in a variety of explant sources and cultivars, but
the efficiency of plantlet regeneration was low [11]. A much higher
frequency plant regeneration and acclimatization were achieved by
direct shoot organogenesis from nodal segments containing axillary
buds [12]. At present, there is no established protocol for regeneration of hemp by somatic embryogenesis.
Hemp has been shown to be amenable to Agrobacteriummediated transformation [10]. Recently, Wahby et al. [13] successfully demonstrated the ability to establish stable transformed
hemp tumor and hairy root lines using a wide variety of
Agrobacterium tumefaciens and A. rhizogenes strains, respectively.
However, to our knowledge, Agrobacterium-mediated transformation has only rarely been applied toward the improvement of
hemp with desirable traits. In the only account that we are aware,
MacKinnon et al. [4] reported to have developed Botrytis-resistant
hemp plants using an Agrobacterium tumefaciens-mediated transformation procedure; however, details of their work were not
described. Our objective was to demonstrate that gene transfer can
occur in callus cultures, with the anticipation that a regeneration
protocol will be established involving an intervening callus phase.
With the recent advancements in hemp regeneration [11, 12], this
goal is now becoming more attainable.
This chapter describes the Agrobacterium-mediated transformation of hemp callus with the selectable marker gene phosphomannose isomerase (PMI). The PMI gene confers a metabolic
advantage to the plant cell, allowing growth on a selective medium
containing a sugar, mannose, as the selective agent [14]. Methods
are outlined for the initiation and establishment of hemp callus and
suspension cultures. Callus growing on selection is screened for
PMI expression using a biochemical assay. DNA is extracted from
putatively transformed callus lines and analyzed by PCR and
Southern hybridization techniques to detect the gene of interest.
An average transformation frequency of 31.23 % 0.14 was obtained
for all transformation experiments, with a range of 15.155.3 %.
This value represents an average of 31 mannose-metabolizing independent events in 100 explants targeted for transformation.
Materials
2.1 Hemp Tissue

Culture
1. Hemp seeds cv. Anka are monoecious and cultivated for seed.
2. Potting mix soil: Sunshine Mix No. 1 (Sun Gro Horticulture,
Bellevue, WA).
321
3. Commercial bleach: Javex containing 4.5 % NaOCl. For

sterilization, dilute with double distilled water (ddH2O) to
10 % (v/v) Javex.
4. Tween-20 (polyethylene sorbitan monolaurate) surfactant.
5. Filter paper: Whatman No. 1, 70 mm diameter filter paper
(Whatman Int. Ltd., Cambridge, UK).
6. Plant growth regulator (PGR): 1,000 M stock solutions.
Dissolve PGRs in a small amount of 1 N NaOH (for kinetin)
or 70 % ethanol (for 2,4-dichlorophenoxyacetic acid [2,4-D])
and bring to volume with ddH2O. Store at 4 C. Kinetin and
2,4-D can be co-autoclaved with the media.
7. MB5D1K: Murashige and Skoog (MS) macro- and micronutrients [15] (1,900 mg/L KNO3, 1,650 mg/L NH4NO3,
180 mg/L MgSO4, 170 mg/L KH2PO4, 16.9 mg/L
MnSO4H2O, 6.2 mg/L H3BO3, 8.6 mg/L ZnSO47H2O,
0.83 mg/L KI, 0.025 mg/L CuSO45H2O, 0.25 mg/L
Na2MoO42H2O, 0.025 mg/L CoCl26H2O, 440 mg/L
CaCl22H2O, 27.8 mg/L FeSO47H2O, 37.3 mg/L Na2EDTA), Gamborg B5 vitamins [16] (1 mg/L nicotinic acid,
1 mg/L pyridoxine-HCl, and 10 mg/L thiamine-HCl),
0.1 g/L myo-inositol, 30 g/L sucrose, 8 g/L bacteriological
agar (Anachemia Canada Inc., Montreal, PQ), 5 M 2,4-D,
1 M kinetin, pH 5.8.
8. MB2.5D: MS macro- and micronutrients, Gamborg B5 vitamins, 0.1 g/L myo-inositol, 30 g/L sucrose, 8 g/L bacteriological agar (for solid medium), 2.5 M 2,4-D, pH 5.8.
9. Parafilm (Pechiney Plastic Packaging, Chicago, IL).
2.2 Agrobacterium
Culture Conditions
1. Agrobacterium tumefaciens strain EHA101 [17] contains plasmid pNOV3635 as a binary vector [10]. The plasmid
pNOV3635 carries a PMI gene under control of the Arabidopsis
thaliana ubiquitin promoter (Ubq3) and the nopaline synthase
terminator (NOS). Spectinomycin and kanamycin selectable
markers are present on the pNOV3635 plasmid and the Ti
plasmid carrying the virulence genes, respectively.
2. LB (Luria-Bertani medium): 10 g/L bacto-tryptone, 5 g/L
bacto-yeast extract, 10 g/L NaCl, and 15 g/L bacteriological
agar (for solid medium).
3. Spectinomycin dihydrochloride: dissolve in ddH2O at
0.25 M. Filter sterilize using a 0.2 m filter and store in aliquots at 20 C.
4. Kanamycin monosulfate: dissolve in ddH2O at 0.17 M. Filter
sterilize using a 0.2 m filter and store in aliquots at 20 C.
5. Agrobacterium cultures are centrifuged using a Beckman
GS-6R centrifuge (Beckman Coulter Inc., Fullerton, CA).
322
6. Acetosyringone (3,5-dimethoxy-4-hydroxyacetophenone):
dissolve in a small quantity of 100 % methanol. Dilute with
ddH2O at 100 mM. Filter sterilize using a 0.2 m filter and
store in aliquots at 20 C.
2.3
Transformation
2.3.1 Inoculation
and Cocultivation
1. Filtration funnels: a Coors Porcelain Hirsch funnel with a fixed

perforated plate or a Coors Porcelain Buchner funnel with a
fixed perforated plate can be used (Fisher Scientific, Pittsburgh,
PA).
2. Filter paper: Whatman No. 1, sized to fit the perforated funnel
plate (Whatman Int. Ltd., Cambridge, UK).
2.3.2 Selection
1. Timentin: dissolve in ddH2O at 300 mg/mL. Filter sterilize

using a 0.2 m filter. Prepare fresh before each use.
2. Mannose (D-mannopyranose): dissolve in media with other
components.
2.4
PMI Assay
1. Chlorophenol red: dissolve in a small amount of 70 % ethanol

and add to assay medium. Chlorophenol red has a strong,
unpleasant smell and should be dispensed while wearing gloves
in a fume hood.
2. PMI assay media: MB2.5D supplemented with either 20 g/L
mannose (selection) or 30 g/L sucrose (control), 0.1 g/L chlorophenol red, 8 g/L bacteriological agar, pH 6 (see Note 1).
3. Enzyme-linked immunosorbent assay (ELISA) plates.
2.5 Genomic DNA

Extraction and
Molecular Analysis
1. Grind callus samples using a plastic pellet pestle (Kontes Glass

Company, Vineland, NJ) attached to a handheld drill.
2.5.1 Genomic DNA

Extraction
3. Silica sand: approximately 50 g of sand in a glass jar autoclaved

at 121 C and 1520 psi for 25 min (Sigma, St. Louis, MO).
2. Polyvinylpolypyrrolidone (PVPP).
4. DNeasy AP1 buffer: a component of the Qiagen DNeasy

Plant Mini Kit (Qiagen, Valencia, CA).
5. 100 mg/mL RNase A: a component of the Qiagen DNeasy
Plant Mini Kit (Qiagen, Valencia, CA).
6. Qiagen DNeasy Plant Mini Kit (Qiagen, Valencia, CA).
2.5.2 PCR
1. Primers: consist of two 18-nucleotide sequences (40 nM each)

PMI-F 5-ACAGCCACTCTCCATTCA-3 and PMI-R
5-GTTTGCCATCACTTCCAG-3 [18]. Dilute to 1.5 M
with sterile ddH2O. Store at 20 C.
2. 10 PCR buffer: 200 mM TrisHCl and 500 mM KCl. Store
at 20 C (Invitrogen, Burlington, ON).
3. 50 mM MgCl2: store at 20 C (Invitrogen, Burlington, ON).
323
4. Ultrapure dNTP set: stock solutions are made at 10 mM each

dATP, dTTP, dGTP, and dCTP. Store at 20 C (Amersham
Biosciences, Piscataway, NJ).
5. Taq polymerase: store at 20 C (Invitrogen, Burlington, ON).
6. Amplification is carried out using a DNA Thermal Cycler 9700
(PE Applied Biosystems, Mississauga, ON).
2.5.3 Southern
Hybridization
1. HindIII: store enzyme at 20 C.

2. Nylon membrane: positively charged Hybond-XL membrane
(Amersham Biosciences, Piscataway, NJ).
3. Radiolabeled probe: PCR amplification of the 550 bp PMI
gene fragment, substituting a P32-labeled dCTP. The PCR
product is purified using a QIAquick PCR Purification Kit
(Qiagen, Mississauga, ON).
4. X-ray film: Kodak X-OMAT.
Methods
3.1 Hemp Tissue

Culture
1. Sow hemp seeds in 5 cm2 plastic containers containing

moistened potting mix soil at ambient room temperatures
(2124 C). Place seedlings under cool-white fluorescent
lights with an intensity of 18 mol/m2/s and a 12 h photoperiod (see Note 2).
2. By 4 weeks, seedlings grow to a height of about 20 cm and
have 24 pairs of true leaves. Cut seedlings at the base of the
stem, approximately 11.5 cm from the soil.
3. Surface sterilize the seedlings by immersion in 70 % ethanol for
20 s, followed by 10 % commercial bleach containing two
drops of 0.1 % Tween-20/100 mL for 1 min, while stirring
gently. Rinse three times with sterile ddH2O.
4. Transfer seedlings to sterile Petri dishes lined with moistened
filter paper. Excise stem (0.5 cm long) and leaf (0.5 cm2)
sections and transfer explants to MB5D1K solid medium.
Wrap dishes in Parafilm and place cultures in the dark at
ambient room temperature for 1 month for callus development (see Note 3).
5. To initiate suspension cultures, callus developing on explants
are cut into small pieces. Transfer 0.51 mg of callus to 20 mL
of MB2.5D liquid medium in 150 mL Erlenmeyer flasks. Cap
flasks with a double layer of aluminum foil and shake at
115 rpm at ambient room temperature with 12 h/day light at
an intensity of 10 mol/m2/s.
6. Subculture suspension cultures at 2 week intervals by discarding 3/4 of the spent medium and replacing with fresh medium.
324
7. At 4 weeks, transfer suspensions to 50 mL of MB2.5D liquid

medium in 250 mL Erlenmeyer flasks by suctioning 1 mL
packed cell volume through a 3 mm diameter pipette tip. Shake
cultures at 150 rpm.
3.2 Agrobacterium
Culture Conditions
1. Agrobacterium tumefaciens strain EHA101 containing the

binary vector pNOV3635 (Syngenta, Switzerland) is used for
hemp transformation. Inoculate 25 mL of LB liquid medium
with one colony of Agrobacterium. To retain the Ti plasmid
and pNOV3635 within the bacteria, LB is supplemented with
50 mg/L of kanamycin and 150 mg/L of spectinomycin,
respectively. Shake culture at 250 rpm at 28 C for 48 h
(see Note 4).
2. Collect bacterial cells by centrifugation at 3,700 g for 20 min.
3. Wash pellet with MB2.5D and resuspend in MB2.5D containing 100 M of acetosyringone to a final OD600nm 1.61.8.
Incubate culture for 10 min with occasional stirring in the
laminar flow hood prior to inoculating plant cells.
3.3
Transformation
3.3.1 Inoculation
and Cocultivation
1. Using a 3 mm wide-mouthed pipette, transfer 1 mL (packed

cell volume) of hemp suspension cell clumps along with 4 mL
of MB2.5D to a sterile Petri dish.
2. Inoculate suspension cells with 5 mL of Agrobacterium culture
for 30 min with occasional stirring.
3. Meanwhile, a vacuum filtration apparatus is assembled in the
flow hood. Place a clean support stand in the flow hood. Fasten
a 2 L sterile glass filtering flask to the support using a flask
clamp. Attach tubing from the glass filtering flask to a vacuum
source. A clean rubber stopper with a hole is fitted over the
mouth of the filtering flask into which a sterile funnel is placed.
The filtering assembly requires a tight fit to make a seal and
produce a vacuum.
4. Collect hemp suspension cells onto a filter paper by vacuum
filtration.
5. Transfer the filter paper and suspension cells to MB2.5D solid
medium. Wrap dishes with Parafilm and cocultivate for 3 days
in the dark at ambient room temperature.
3.3.2 Selection
1. Gently scrape suspension cells onto a fresh moistened filter

paper placed in a sterile filtering funnel which is fitted onto the
vacuum filtration apparatus. Rinse three times with a total volume of 200 mL of MB2.5D to wash off bacteria.
2. To further eliminate Agrobacterium after washing, transfer the
filter supporting suspension cells to MB2.5D solid medium
containing 300 mg/L of Timentin. Wrap dishes with Parafilm
and place in the dark for 7 days.
325
Fig. 1 Selection of Anka callus transformed with pNOV3635 on MB2.5D with 300 mg/L Timentin and 1 % mannose after 4 weeks. (a) Non-transformed cell masses are arrested in growth. (b) Transformed cell masses are
distinguished by their enlarged size compared to untransformed callus. (c) Transformed callus on mannose
medium, forming large, pale yellow callus protruding from small, dark-yellow parental callus. Photos are of
9 cm diameter dishes. Scale bar: 5 mm for (c). (d, e) Chlorophenol red PMI assay after 34 days. Medium is
composed of MB2.5D, 8 g/L agar, and 0.1 g/L chlorophenol red with either 3 % sucrose or 2 % mannose.
Control wells do not contain callus. (T ) Transformed callus harboring the PMI gene grew on both sugar sources,
turning the medium pale yellow. (AS ) Non-transformed callus metabolized sucrose and acidified the medium,
turning it a pale yellow color. (AM ) Callus incubated with Agrobacterium lacking the PMI plasmid did not acidify
the medium. Well diameter in each dish is 1.5 cm (Reproduced with permission from ref. 10)
3. Transfer small individual callus clumps to MB2.5D solid

medium containing 1 % (w/v) mannose and 300 mg/L of
Timentin (see Note 5). Wrap dishes with Parafilm and place in
the dark for 4 weeks (see Note 6). The appearance of callus
after 4 weeks of incubation is shown in Fig. 1ac.
4. Transfer growing callus to MB2.5D containing 2 % (w/v)
mannose and 150 mg/L of Timentin for 4 weeks in the dark.
3.4
PMI Assay
Most plant cell and tissue cultures are dependent on a carbon

source, often sucrose, supplemented in the medium. Mannose is
recognized as a carbon source that cannot support growth of most
plant cells because of their inability to metabolize the sugar [19].
The PMI selection strategy makes use of mannose as a selection
agent. Cells expressing the PMI gene are conferred a metabolic
advantage over cells lacking the gene. Growth of transgenic tissue
326
is supported on mannose-containing media, while non-transformed

tissue either stops growing or dies from starvation [14, 20].
The chlorophenol red assay [21] is a quick and easy method
to screen for the expression of the PMI gene in putatively transformed cells. The assay is based on the observation that actively
growing plant cells acidify their surroundings [21]. Chlorophenol
red is an indicator dye that is sensitive to pH changes. It can be
incorporated into the mannose selection medium and will produce a color change as the pH of the medium decreases [22, 23].
A color change from red to yellow in the assay medium reflects
callus growth, indicating that the sample expresses the PMI gene.
Callus unable to actively grow and metabolize in the presence of
mannose does not acidify the medium, and the color remains red.
All callus lines testing positive for PMI expression in the chlorophenol red assay were confirmed to carry the PMI gene in PCR
assays (see Note 7).
1. PMI assay media are dispensed in 600 L aliquots into each
well of a sterile 24-well ELISA plate (see Note 8).
2. Transfer callus pieces (approx. 0.6 cm2) into each well of the
ELISA plate. Wrap plate with Parafilm and incubate in the dark
for 3 days.
3. Record color changes in each well and photograph the ELISA
plate (see Note 9). Sample PMI assays are depicted in Fig. 1d, e.
3.5 Genomic DNA
Extraction and
Molecular Analysis
3.5.1 Genomic DNA
Extraction
1. DNA is extracted from callus following a modified protocol

[24]. Grind each 100 mg callus sample with 25 mg of PVPP,
100 mg of sterile silica sand, 200 L of DNeasy AP1 buffer,
and 4 L of RNase A in a 1.5 mL microfuge tube.
2. Add an additional 200 L of AP1 buffer to each sample, vortex, and isolate DNA following the Qiagen DNeasy kit
procedure.
3. Genomic DNA is stored at 4 C.
3.5.2 PCR
1. Assemble all reagents for the PCR reaction. Each 25 L PCR

reaction contains 1.5 mM of MgCl2, 20 mM of TrisHCl,
50 mM of KCl, 200 M of each dNTP, 0.2 M of each primer,
two units of Taq polymerase, 5 L of template DNA (of appropriate dilution), and sterile ddH2O to volume.
2. Primers amplify a 550 bp region within the PMI gene [18].
PCR conditions: initial denaturation step of 3 min at 95 C
followed by 30 cycles of 30 s at 95 C (template denaturation),
30 s at 55 C (primer annealing), and 45 s at 72 C (DNA
synthesis), with a terminal elongation step of 5 min at 72 C.
3. Once the reaction is complete, PCR products can be stored at
4 C or 20 C until further analysis, or samples can be run on
a 0.9 % agarose gel and visualized by illumination with ultraviolet light.

3.5.3 Southern
Hybridization
327
1. Digest genomic DNA with HindIII at 37 C overnight.

2. Electrophorese samples on a 0.8 % agarose gel.
3. Transfer DNA fragments from the gel to a nylon membrane by
capillary transfer with 0.4 M NaOH using a downward blot
assembly [25].
4. Hybridization of the P32-labeled probe to the filter is performed according to the Amersham protocol for Hybond-XL
membranes.
5. Expose membrane to X-ray film in the presence of an intensifying screen for 324 h at 80 C.
Notes
1. Assaying other hemp varieties or tissue types may require
adjusting the concentration of chlorophenol red within the
assay medium. Higher concentrations of chlorophenol red (up
to 2 mg/mL) incorporated into the PMI assay medium caused
transgenic callus to absorb the dye and produced no color
change within wells. The callus did not resume growth when
transferred back to mannose- or sucrose-containing medium.
An excess uptake of chlorophenol red from the assay medium
may arrest tissue metabolism and cause cell death.
2. Hemp seedlings attract thrip insect pests. Thrip eggs are difficult to see and can survive the sterilization process and ruin
experiments. A thrip predatory mite (Amblyseius cucumeris)
can be successfully used as a biological control agent to significantly lower or eliminate the thrip population before a new
batch of seeds are planted for experiments. The predatory
mites have not interfered with experiments and can be purchased from local garden stores.
3. After sterilization, it is important to place seedling material
onto sterile moistened filter paper while cutting explants.
Seedling tissues quickly wilt under flow hood conditions,
which may affect callus development. The moistened filters
keep tissues turgid during processing.
4. Agrobacterium cultures should be frozen at 80 C for longterm storage. To do this, transfer 750 L bacteria and 250 L
50 % (v/v) sterile glycerol to a labeled, sterile cryotube (Nunc,
Thermo Fisher Scientific). Gently invert tube to mix, quickly
freeze in liquid nitrogen, and store at 80 C. To start a culture
for experiments, scrape cells from the frozen culture with a
sterile loop and streak an LB plate containing the appropriate
selection.
328
5. Hemp suspension cells are moved to different treatments on a

filter paper support for ease of transfer. Individual cell clumps
(without filter paper support) are transferred to selection to
maintain better contact with the medium.
6. Callus turns from pale yellow to a darker yellow color within 1
week of being placed on 1 % mannose selection medium. By 4
weeks, cells capable of metabolizing mannose are easily distinguished by their color and larger size. Pale yellow callus
emerges from darker yellow cell clumps, growing larger than
other callus masses.
7. We found two callus lines that were not positive for gene
expression in the PMI assay but were confirmed to harbor the
PMI gene by PCR analysis. It is possible that the PMI assay
may not be sensitive enough to detect low-expressing transgenic tissue or that the PMI gene was silenced.
8. Over time, the color of the PMI assay medium can fade from
red to a pale red/orange color, and the small quantity of assay
medium within wells dries out quickly from water evaporation,
so it is recommended to use freshly prepared assay medium.
9. Control callus not containing the PMI gene (incubated with
EHA101 lacking pNOV3635) can give false-positive results
when assayed for PMI activity. When transferred to mannosecontaining assay medium, control callus will produce a color
change, suggesting that it can metabolize mannose. However,
subculture to fresh assay medium produces no color change,
indicating that callus cannot survive on mannose-containing
media. Control callus may store sugar reserves when grown on
sucrose-containing medium. Upon transfer to mannosecontaining medium, the sugar reserves are utilized for metabolism, acidifying the assay medium. To eliminate false-positive
results, the control callus is incubated for 1 week on mannosecontaining medium prior to analysis by the PMI assay.
Acknowledgments
We thank S. Clemens for providing technical assistance with
Southern hybridizations. This research was funded by the Natural
Sciences and Engineering Research Council of Canada to ZKP and
the John Yorston Scholarship in Pest Management to MF. In
accordance with Health Canada regulations, all hemp cultures
used in this research were subjected to regular analyses for THC
content over the duration of the study to ensure they did not
exceed the legal allowable limit of 0.3 % THC. The cultures were
grown under permit No. 00-F0041-R-01 and disposed of according to the requirements.
329
References
1. Clarke RC (1999) Botany of the genus
Cannabis. In: Ranalli P (ed) Advances in hemp
research. Haworth, Binghamton, NY, pp 119
2. Lata H, Chandra S, Techen N, Khan IA, ElSohly
MA (2011) Molecular analysis of genetic fidelity
in Cannabis sativa L. plants grown from synthetic (encapsulated) seeds following in vitro
storage. Biotechnol Lett 33:25032508
3. Stott CG, Guy GW (2004) Cannabinoids for the
pharmaceutical industry. Euphytica 140:8393
4. MacKinnon L, McDougall G, Aziz N, Millam
S (2001) Progress towards transformation of
fibre hemp. In: Macfarlane Smith WH,
Heilbronn TD (eds) Annual Report of the
Scottish Crop Research Institute, 2000/2001,
SCRI, Invergowrie, Dundee, pp 8486
5. Ranalli P (2004) Current status and future
scenarios of hemp breeding. Euphytica 140:
121131
6. Wang R, He L-S, Xia B, Tong J-F, Li N, Peng
F (2009) A micropropagation system for cloning of hemp (Cannabis sativa L.) by shoot tip
culture. Pak J Bot 41:603608
7. Lata H, Chandra S, Khan IA, ElSohly MA
(2009) Propagation through alginate encapsulation of axillary buds of Cannabis sativa L.: an
important medicinal plant. Physiol Mol Biol
Plants 15:7986
8. Fisse J, Braut F, Cosson L, Paris M (1981)
tude in vitro des capacits organogntiques
de tissus de Cannabis sativa L.; effet de diffrentes substances de croissance. Pl Md
Phytopath 15:217223
9. Mandolino G, Ranalli P (1999) Advances in
biotechnological approaches for hemp breeding and industry. In: Ranalli P (ed) Advances in
hemp research. Haworth Press, Binghamton,
NY, pp 185212
10. Feeney M, Punja ZK (2003) Tissue culture and
hemp (Cannabis sativa L.). In Vitro Cell Dev
11. Slusarkiewicz-Jarzina A, Ponitka A, Kaczmarek
Z (2005) Influence of cultivar, explant source
and plant growth regulator on callus induction
and plant regeneration of Cannabis sativa
L. Acta Biol Crac Ser Bot 47:145151
12. Lata H, Chandra S, Khan I, ElSohly MA
(2009) Thidiazuron-induced high-frequency
direct shoot organogenesis of Cannabis sativa
L. In Vitro Cell Dev Biol Plant 45:1219
13. Wahby I, Caba JM, Ligero F (2013)
Agrobacterium infection of hemp (Cannabis
sativa L.): establishment of hairy root cultures.
J. Plant Interact 8:312320
14. Stoykova P, Stoeva-Popova P (2011) PMI

(manA) as a nonantibiotic selectable marker
gene in plant biotechnology. Plant Cell Tissue
Org Cult 105:141148
16. Gamborg OL, Miller RA, Ojima K (1968)
Nutrient requirements of suspension cultures of
soybean root cells. Exp Cell Res 50:151158
17. Hood EE, Helmer GL, Fraley RT, Chilton
a region of pTiBo542 outside of T-DNA.
J Bacteriol 168:12911301
18. Negrotto D, Jolley M, Beer S, Wenck AR,
Hansen G (2000) The use of phosphomannoseisomerase as a selectable marker to recover
transgenic maize plants (Zea mays L.) via
Agrobacterium transformation. Plant Cell Rep
19:798803
19. Joersbo M (2001) Advances in the selection of
transgenic plants using non-antibiotic marker
genes. Physiol Plant 111:269272
20. Wang H, Petri C, Burgos L, Alburquerque N
(2013) Phosphomannose-isomerase as a selectable marker for transgenic plum (Prunus
domestica L.). Plant Cell Tissue Org Cult
113:189197
21. Kramer C, DiMaio J, Carswell GK, Shillito RD
(1993) Selection of transformed protoplastderived Zea mays colonies with phosphinothricin and a novel assay using the pH indicator
chlorophenol red. Planta 190:454458
22. Wright M, Dawson J, Dunder E, Suttie J, Reed
J, Kramer C, Chang Y, Novitzky R, Wang H,
Artim-Moore L (2001) Efficient biolistic transformation of maize (Zea mays L.) and wheat
(Triticum aestivum L.) using the phosphomannose isomerase gene, pmi, as the selectable
marker. Plant Cell Rep 20:429436
23. Bakshi S, Saha B, Roy NK, Mishra S, Panda SK,
Sahoo L (2012) Successful recovery of transgenic cowpea (Vigna unguiculata) using the
6-phosphomannose isomerase gene as the selectable marker. Plant Cell Rep 31:10931103
24. Schluter C, Punja ZK (2002) Genetic diversity
among natural and cultivated field populations
and seed lots of American ginseng (Panax
quinquefolius L.) in Canada. Int J Plant Sci
163:427439
25. Koetsier PA, Schorr J, Doerfler W (1993) A
rapid optimized protocol for downward alkaline Southern blotting of DNA. Biotechniques
15:260262
Chapter 26
Orchids (Oncidium and Phalaenopsis)
Chia-Wen Li, Chia-Hui Liao, Xia Huang, and Ming-Tsair Chan
Abstract
This chapter describes an efficient and reproducible method for large-scale propagation of Oncidium and
Phalaenopsis protocorm-like bodies (PLBs) using floral stalk sections and seeds, respectively. The propagated PLBs can be used for Agrobacterium-mediated transformation. An advanced transformation system
for Oncidium and Phalaenopsis orchids has been established. This protocol demonstrates that the time
during which the PLBs are cocultivated with Agrobacterium is the key to promoting transformation
efficiency. Modified DNA and RNA extraction methods are also provided to diminish polysaccharide
contamination and to improve the quality for further molecular analysis.
Key words Agrobacterium tumefaciens, Oncidium orchid, Phalaenopsis, Protocorm-like body (PLB)
Introduction
The elegant shapes of orchids make them very popular flowers.
The orchid Phalaenopsis is an important floriculture product in
Taiwan. The export value of Phalaenopsis reached USD
114,175,000 in 2012 (Agricultural Trade Statistics Query System,
Council of Agriculture, Executive Yuan, Taiwan). Oncidium spp.
are also commercially important in Taiwan as cut flowers and as
flowering potted orchid plants. During the 1980s, a commercial
Oncidium Gower Ramsey was introduced into Taiwan and has
become a most important cut orchid flower variety. By 2012, the
planted area of Oncidium had increased to more than 200 ha, and
cut flower exports had reached 1,618 t (valued at USD 18,462,000)
to the Japan floral cutting market, which accounts for 94.3 % of all
cut and potted Oncidium flower exports from Taiwan (Agricultural
Trade Statistics Query System, Council of Agriculture, Executive
Yuan, Taiwan).
Oncidium Gower Ramsey has brought economic benefits, but
the unitary flower colors and patterns of this variety limit market
expansion. Oncidium orchids are self-incompatible, so it is difficult
to obtain new traits by traditional breeding. Since the 1990s, gene
331
332
Chia-Wen Li et al.
manipulation technologies have seen significant developments.

Conventional transformation systemsAgrobacterium-mediated
transformation and particle bombardmenthave been used on
various plant species. Therefore, application of gene-transfer techniques to orchids could provide an effective way to establish new
characteristics such as flower pigmentation [1], flower shape, disease and pest resistance [2, 3], and altered flowering time.
In the previous orchid transformation protocol [2, 4, 5], we
added tobacco suspension cells and an acetosyringone (AS) supplement to the medium for cocultivating orchid PLBs and
Agrobacterium. Recently, we tested and modified this transformation system and found that tobacco suspension cells, AS, and charcoal provided little enhancement of Oncidium transformation or
of growth and development, though active charcoal affects growth
and development in some varieties of Phalaenopsis. We also found
that the cocultivation time and the concentration of Agrobacterium
in the liquid cocultivation medium are keys to improving transformation efficiency. This protocol has simplified the Agrobacterium
preculture procedure and established the optimal concentration of
antibiotics for eliminating Agrobacterium. Here, we describe an
effective orchid transformation system and modified molecular
analysis protocols for orchids that have been fully tested by our
group.
Materials
2.1 Plant Materials

for Initiation
of Protocorm-Like
Bodies (PLBs)
1. Floral stalk of Oncidium Gower Ramsey orchid (see Fig. 1a, b).
2.2 Culture Medium

for Orchids
1. New Dogashima medium (NDM) for PLB initiation (1 l) [6]:

0.48 g NH4NO3, 0.2 g KNO3, 0.47 g Ca(NO3)2 4H2O,
0.15 g KCl, 0.25 g MgSO4 7H2O, 0.55 g KH2PO4, 3 mg
MnSO4 4H2O, 0.5 mg ZnSO4 7H2O, 0.5 mg H3BO4,
0.025 mg CuSO4 5H2O, 0.025 mg Na2MoO4 2H2O,
0.025 mg CoCl2 6H2O, 0.5 l concentrated H2SO4, 0.1 g
myoinositol, 1 mg nicotinic acid, 1 mg pyridoxine HCl, 1 mg
thiamine HCl, 1 mg calcium pantothenate, 1 mg adenine,
1 mg cysteine, 0.1 mg biotin, 21 mg Fe-EDTA, 10 g maltose,
0.4 mg 6-benzylaminopurine (BA), and 0.1 mg naphthaleneacetic acid (NAA) (see Note 1); pH adjusted to 5.4 and then
medium autoclaved. For solid medium, 3 g Phytagel is added
before autoclaving.
2.2.1 For Oncidium
2. Silique of Phalaenopsis orchids (see Fig. 2a).
333
Fig. 1 Development of Oncidium explants during transformation procedures. (a) Floral stalk of Oncidium Gower
Ramsey. Arrows show the nodes. (b) Stalk sections for PLB initiation. (c) PLB formation on NDM medium.
(d) PLB propagation on G10 medium. (e) Cultured Agrobacterium broth and PLBs. (f) PLBs cocultivated with
Agrobacterium in NDM liquid medium. (g, h) PLBs selected on G10 medium with antibiotics. (i) GUS staining of
PLBs after hygromycin selection. (j) Regeneration of transgenic Oncidium seedlings on G10 medium.
(k) Transgenic plants in jars (G10 medium). (l) Transgenic plant in pot (Sphagnum moss medium). (m) Flowering
Oncidium plant
334
Chia-Wen Li et al.
Fig. 2 Development of Phalaenopsis explants during transformation procedures. (a) Phalaenopsis equestris
silique. (b) PLB propagation on NDM solid medium. (c) PLBs cocultivated with Agrobacterium in NDM liquid
medium. (d, e) PLBs selected on T2 medium with antibiotics. (f) Regeneration of transgenic Oncidium seedlings on T2 medium. (g) Transgenic plants in jar (T2 medium). (h) Transgenic plant in pot (Sphagnum moss
medium). (i) Flowering Phalaenopsis equestris plant. (j) Molecular analysis of transgenic plants. Upper panel:
RT-PCR. Lower panel: Southern blot. GH, plants grown in greenhouse; CR, plants grown in culture room;
W, wild-type plant, pflp, sweet pepper ferredoxin-like gene; HPT, hygromycin phosphotransferase gene; 18S,
18S ribosomal RNA
2. G10 medium for PLB propagation (1 l): 4.3 g Murashige and

Skoog (MS) salts (without vitamins, Duchefa), 1 g tryptone,
20 g sucrose, 65 g potato tubers, pH adjusted to 5.4, 3 g
Phytagel (Sigma) (see Note 2) and 1 g charcoal (optional,
see Note 3) added, followed by autoclaving at 15 lb/in.2
pressure, 121 C, for 20 min.
335
3. PLB pretreatment medium: NDM liquid medium with

0.1 mM acetosyringone (AS; optional, see Note 4).
4. Coculture medium: NDM liquid medium.
5. Washing solution: 40 mg/l meropenem in sterilized deionized
water (ddH2O).
6. Selective medium: G10 solid medium supplement with
40 mg/l meropenem and the optimal concentration of antibiotics or other selection agents.
2.2.2 For Phalaenopsis
1. PLB initiation medium (or MS medium, 1 l): 4.3 g MS salts,

MS vitamins (1 mg thiamine HCl, 1 mg pyridoxine HCl, 10 mg
nicotinic acid, 100 mg myoinositol), 20 g sucrose, pH adjusted
to 5.6, 3 g Phytagel or 8 g agar added before autoclaving.
2. PLB propagation medium: NDM solid medium.
3. PLB pretreatment medium: NDM liquid medium with
0.1 mM AS (optional, see Note 4).
4. Coculture medium: NDM liquid medium.
5. Washing solution: 40 mg/l meropenem in sterilized ddH2O.
6. Selective medium (or T2 medium, 1 l): 3.5 g Hyponex No. 1
(N-P-K 7-6-19, Hyponex Co., USA), 1 g tryptone, 0.1 g citric
acid, 20 g sucrose, 1 g active charcoal, 20 g sweet potato, and
25 g unripened banana (outer coat peeled and fine paste prepared using a kitchen mixer). The pH of the medium was
adjusted to 5.4 with 0.1 N HCl or 0.1 N NaOH before autoclaving and gelling with 0.3 % Phytagel (Sigma). For selection,
the medium was supplemented with 40 mg/l meropenem and
the optimal concentration of antibiotics.

and DNA Construct
1. Agrobacterium strain EHA105 (see Note 5).
2.4 Culture Medium

for Agrobacterium
1. YEP solid medium (1 l): 10 g yeast extract, 10 g peptone, 5 g

NaCl, 15 g Bacto Agar; pH adjusted to 7.0 prior to
autoclaving.
2. Binary vector pCAMBIA1304/35S::pflp [2]. This plasmid

contains an antibiotic-selectable marker gene, a nonantibioticselectable marker gene, and a reporter gene. The antibioticselectable marker, hygromycin phosphotransferase (hpt),
confers hygromycin resistance on the transformed plant cells.
The nonantibiotic-selectable marker, sweet pepper ferredoxinlike protein (pflp), confers resistance to soft rot bacteria
Pectobacterium carotovorum subsp. carotovorum (Pcc) [2, 7].
-Glucuronidase (GUS) fusion with green fluorescent protein
(GUS::GFP) driven by the cauliflower mosaic virus 35S promoter (in pCAMBIA1304) causes the transformed plant cells
to appear blue in the presence of 5-bromo-4-chloro-3-indolyl-D-glucuronide (X-Gluc).
336
Chia-Wen Li et al.
2. MGL broth medium (1 l): 2.5 g yeast extract, 5 g tryptone,

0.1 g NaCl, 5 g mannitol, 1 g L-glutamic acid, 0.25 g KH2PO4,
0.1 g MgSO4 7H2O, 1 g biotin; pH adjusted to 7.0 prior to
autoclaving.
2.5 Antibiotics
and Other Stock
Solutions
1. Stock of 50 mg/ml kanamycin dissolved in ddH2O, filter

sterilized, diluted to 50 mg/l for working concentration.
2. Stock of 100 mg/ml hygromycin dissolved in ddH2O, filter
sterilized, diluted to 25 mg/l for working concentration
(see Note 6).
3. Stock of 40 mg/ml meropenem (Myron, China Chemical &
Pharmaceutical Co., Taiwan) dissolved in ddH2O, filter sterilized, diluted to 40 mg/l for working concentration.
4. Stock of 25 mg/ml rifampicin dissolved in dimethyl sulfoxide
(DMSO) diluted to 25 mg/l for working concentration.
5. Stock of 1 mg/ml -naphthaleneacetic acid (NAA): 50 mg
NAA dissolved in few drops of 1 N NaOH and brought to
50 ml with ddH2O.
6. Stock of 1 mg/ml 6-benzylaminopurine (BA): 50 mg BA
dissolved in few drops of 1 N NaOH and brought to 50 ml
with ddH2O.
7. Sodium hypochlorite solution (1 l): 1 % NaOCl (167 ml
Clorox bleach per liter), 0.05 % Tween 20.
2.6 Transgenic Plant

Verification
1. CTAB DNA extraction buffer: 100 mM Tris, 1.4 M NaCl,

20 mM EDTA, 2 % (w/v) hexadecyltrimethylammonium bromide (CTAB), 0.3 % 2-mercaptoethanol. For 100 ml: 1.21 g
Tris base; 8.18 g NaCl; 4 ml 0.5 M EDTA, pH 8.0; 2 g CTAB;
water added to final volume of 100 ml, autoclaved and stored
at room temperature (RT). Add 0.3 ml 2-mercaptoethanol
and 1 g polyvinylpyrrolidone (PVP-40) and warm buffer to
60 C before use.
2. NaCl: 5 M.
3. Na-acetate: 3 M, pH 5.2.
4. TE buffer: 10 mM TrisCl, pH 8.0, 1 mM EDTA,
autoclaved.
5. RNase A: 10 mg/ml.
6. Proteinase K: 1 mg/ml.
7. Liquid nitrogen.
8. Phenol/chloroform/isoamyl alcohol (25:24:1).
9. Chloroform/isoamyl alcohol (24:1).
10. RNAmate (BioChain Institute, Hayward, CA).
11. 100 % isopropanol.
337
12. Ethanol (EtOH): 70 and 100 %.

13. X-Gluc staining solution: 1 mM 5-bromo-4-chloro-3-indolyl
beta-D-glucuronic acid cyclohexylammonium salt (X-gluc,
X-glucuronide), 100 mM sodium phosphate buffer, pH 7.0,
10 mM ethylenediaminetetraacetic acid (EDTA), 0.5 mM
potassium ferricyanide, 0.5 mM potassium ferrocyanide, 0.1 %
Triton X-100.
14. TRIzol (Invitrogen).
15. TEN buffer (100 ml): 1.21 g Tris, 0.75 g EDTA disodium salt
(EDTA Na2), 1.17 g NaCl, pH adjusted to 9.0.
16. RNA extraction buffer (100 ml): 78 ml TEN buffer, 20 ml
20 % sodium dodecyl sulfate (SDS), 2 ml 0.8 M DL-dithiothreitol
(DTT).
17. LiCl: 4 M, diethylpyrocarbonate (DEPC)-treated and
autoclaved.
18. DEPC-treated ddH2O.
19. Acid phenol.
Methods
Different transformation stages of Oncidium and Phalaenopsis are
illustrated in Figs. 1 and 2, respectively. The transformation flow
charts of Oncidium and Phalaenopsis are presented in Figs. 3 and 4,
respectively.
3.1 Initiation
of Protocorm-Like
Bodies (PLBs)
3.1.1 Initiation
of Oncidium PLBs
from Stalk Buds (4 Months)
1. Surface sterilization of Oncidium floral stalk: Stalks were rinsed

for 5 min in 70 % EtOH and for 25 min in sodium hypochlorite solution (under vacuum for 10 min and with shaking at
50 rpm for 15 min), followed by five washes with sterilized
water.
2. The sterilized stalk nodes were cut with axillary buds into
approximately 510 mm slices (see Fig. 1b) and cultured on
NDM solid medium with the appropriate phytohormone
(0.4 mg/l NAA and 0.1 mg/l BA) (see Note 1) (see Fig. 1c).
3. They were subcultured per 34 weeks. Four months later, the
newly differentiated PLBs could be transferred to G10 solid
medium for propagation (see Fig. 1d) and Agrobacteriummediated transformation.
3.1.2 Initiation
of Phalaenopsis PLBs
from Seeds (5 Months)
1. The siliques were sterilized for 5 min in 70 % EtOH and for

25 min in sodium hypochlorite solution (under vacuum for
10 min and with shaking at 50 rpm for 15 min), followed by
five washes with sterilized water.
2. The seeds were sown on MS medium.
338
Chia-Wen Li et al.
Initiate PLBs from Oncidium floral stalks on NDM medium

with appropriate phytohormones (BA/NAA)
4M
Propagate PLBs on G10 medium
21 D
Pretreatment of PLBs in NDM/AS liquid medium
3D
Co-cultivate the PLBs with Agrobacterium in NDM liquid
medium (A600<0.6)
3-7 D
Wash and blot dry the infected PLBs
M
1
2
3
4
5
6
7
8
9
10
11
Select putative transformants on G10/Myron medium with

selection agent, and subculture at 2 weeks interval
5M
Subculture selected explants to G10/Myron medium with
selection agent and subculture at 4 weeks interval
2M
Genomic PCR and GUS histochemical confirmation
12
13
14
15
16
17
18
19
Plant 0.5-1 cm height seedlings on G10 medium
4M
Molecular analysis
20
21
22
23
24
Plant 10-cm height seedlings to Sphagnum Moss medium

and incubate in the green house
12 M
Flowering
25
26
27
28
Fig. 3 Flow chart of Oncidium transformation procedure
3. The newly differentiated green PLBs were subcultured on

NDM solid medium for a month for propagation (see Fig. 2b).
4. Five months later, newly differentiated and propagated PLBs
could be used as materials for Agrobacterium-mediated
transformation.
339
Initiate PLBs from Phalaenopsis Orchid seeds in MS

(without phytohormone) or NDM solid medium
5M
Propagate PLBs in NDM solid medium, and subculture at
3 weeks interval
21 D
Pretreatment of PLBs in NDM/AS liquid medium
3D
Co-cultivate the PLBs with Agrobacterium in NDM liquid
medium (A600<0.6)
3-7 D
Wash the infected PLBs
Select putative transformants on solid T2/Myron medium

with selection agent, and subculture at 2 weeks interval
5M
Propagate selected explants to T2/Myron medium with
selection agent and subculture at 4 weeks interval
5M
Genomic PCR and GUS histochemical confirmation
Plant 0.5-1 cm height seedlings on T2 medium
6M
Molecular analysis
Plant the transgenic plants to Sphagnum Moss medium

and incubate in the green house
12-18 M
T1 progeny
M
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
21
22
23
24
25
26
27
28
29
30
31
32
33
34
35
36
37
38
39
40
Fig. 4 Flow chart of Phalaenopsis transformation procedure
3.1.3 Propagation
of PLBs (21 Days)
1. The PLBs of Oncidium and Phalaenopsis were chopped

(see Note 7) and cultured on G10 and NDM solid medium
(3050 PLBs per 9 cm Petri dish), respectively.
2. The PLBs were incubated for a 16 h photoperiod at 26 C
with light provided by cool white fluorescent lamps with an
intensity of 50100 mol/m2/s. Three weeks later, propagated PLBs could be used for transformation.
340
Chia-Wen Li et al.

Culture
and Preparation
1. Agrobacterium was streaked on YEP solid medium containing

appropriate antibiotics (i.e., 25 mg/l rifampicin for
Agrobacterium EHA105 and 50 mg/l kanamycin for binary
vector pCAMBIA1304), and the plate was incubated at 28 C
for 2 days in the dark.
2. A single colony picked from the plate was inoculated into 3 ml
MGL liquid broth supplemented with appropriate antibiotics
(see Note 8) and cultured at 28 C for 24 h with agitation
(150 rpm).
3.3 Agro-infiltration
and Cocultivation
(57 Days)
1. Newly differentiated Oncidium/Phalaenopsis PLBs (21-dayold culture) were selected from PLB propagation medium
(G10/NDM solid medium) (see Figs. 1d and 2b).
2. Healthy PLBs (about 3 g) were transferred into a 125 ml flask,
30 ml NDM/AS liquid medium was added, and the flask was
incubated in the dark at 26 C for 3 days (optional, see Note 4).
3. AS-pretreated PLBs were transferred into a new 125 ml flask,
and 30 ml NDM liquid medium and 1 ml overnight-cultured
Agrobacterium (A600nm = 0.30.5 in MGL medium) were added
(see Figs. 1e and 2c). The PLBs were cocultivated with
Agrobacterium with shaking (70 rpm) in the dark for 17 days
at 26 C (see Note 9). During the cocultivation period, cocultivated broth was removed and NDM medium added to keep
the bacterial concentration below 0.6 A600nm (see Note 10).
4. The infected PLBs were washed five times in sterilized ddH2O
supplemented with 40 mg/l meropenem (see Note 11).
3.4 Selection
of Transformed
PLBs (5 Months)
1. Oncidium/Phalaenopsis PLBs were blotted dry on a sterilized

paper towel, and healthy ones were transferred onto G10/T2
selective medium (solid medium supplemented with 25 mg/l
hygromycin and 40 mg/l meropenem) (see Notes 6 and 11)
and incubated at 26 C for a 16 h light/8 h dark photoperiod
at a light intensity of 50100 mol/m2/s (see Figs. 1f and 2d).
2. Newly differentiated green PLBs were subcultured ten times
on fresh G10/T2 selection medium every 2 weeks (see Figs. 1g,
h and 2e, f).
3. Selected PLBs can be subjected to GUS histochemical staining
(see Fig. 1i) to check transformation efficiency (see Note 12).
3.5 Plant
Regeneration
and Conversion
(6 Months)
1. Five months later, antibiotic-selected healthy Oncidium/

Phalaenopsis PLBs or small shoots were transferred on to fresh
G10/T2 solid medium without antibiotics, and the cultures
were maintained for up to another 6 months. They were
subcultured at 4-week intervals for plant regeneration
(see Figs. 1hk and 2f, g).
341
2. The putative transgenic plants (about 10 cm in height) can be

transferred from tissue culture jars to pots (with sphagnum
moss medium) and planted in the greenhouse (see Figs. 1l, m
and 2h, i).
3.6 Molecular
Analyses
3.6.1 Isolation
of Genomic DNA
from Putative
Transformants
The CTAB DNA extraction method was modified from Porebski

et al. [8].
1. Orchid tissues (1.0 g) were ground to fine powder with 0.1 g
sea sand in liquid nitrogen, and the samples were further
homogenized for 2 min with 15 ml of 60 C preheated CTAB
DNA extraction buffer.
2. The samples were heated at 60 C for 1 h with shaking (50 rpm)
and then held at RT for 2 min.
3. They were centrifuged at 12,000 g for 10 min at RT, and the
supernatants were transferred to new tubes.
4. Phenol/chloroform/isoamyl alcohol extraction: 15 ml phenol/chloroform/isoamyl alcohol was added, shaken for 5 min
at 50 rpm, and centrifuged at 5,000 g for 10 min at RT, and
then the aqueous phase was transferred to new tubes.
5. Chloroform/isoamyl alcohol extraction: 15 ml chloroform/
isoamyl alcohol was added, shaken for 5 min at 50 rpm, and
centrifuged at 5,000 g for 10 min at RT, and then the aqueous phase was transferred to new tubes.
6. Half the volume (7.5 ml) of 5 M NaCl and 2 volumes (30 ml)
of 100 % EtOH were added to the aqueous phase, followed by
centrifugation at 16,000 g for 10 min at RT.
7. The pellet was washed with cold 70 % EtOH, rinsed with
100 % EtOH, and then air-dried.
8. The DNA pellet was dissolved in 0.3 ml TE at 65 C for 10 min
(optional, 4 C overnight).
9. It was transferred to a 1.5 ml Eppendorf tube, then 3 l
10 mg/ml RNase A and 3 l 1 mg/ml proteinase K were
added (optional) and incubated at 37 C for 1 h.
10. RNAmate (0.3 ml) (see Note 13) and 0.3 ml phenol/chloroform/isoamyl alcohol were added, mixed for 10 min with
50 rpm shaking at RT, and centrifuged at 16,000 g for 15 min,
and then the aqueous phase was transferred to new tubes.
11. TE (50 l) was added to the organic phase, mixed well, and centrifuged at 16,000 g for 15 min, and then the aqueous phase
was combined with the DNA fractions described in step 10.
12. One tenth of the volume of 3 M Na-acetate and 2 volumes
100 % EtOH were added, mixed well, and centrifuged at
16,000 g for 20 min, and then the supernatant was discarded.
342
Chia-Wen Li et al.
13. The pellet was washed with cold 70 % EtOH, rinsed with
100 % EtOH, and then dried.
14. The DNA was dissolved in 50100 l TE and quantified by
spectrophotometry (NanoDrop).
3.6.2 PCR Amplification
1. For 20 l PCR reaction, 0.10.4 g orchid genomic DNA was

mixed with 1 l 10 M forward primer, 1 l 10 M reverse
primer, 2 l 10 Taq buffer, 1 l 2.5 mM dNTPs, and 0.3 l
Taq DNA polymerase (5 units/l), followed by sterilized
ddH2O to final volume 20 l.
2. PCR conditions: 95 C for 3 min; 2535 cycles of 95 C for
25 s, 5065 C (Ta = primer Tm5 C) for 30 s, and 72 C for
1 min/kb; 72 C for 7 min.
3. The PCR products were checked by 1 % agarose gel electrophoresis and then stained with Health View fluorescent dye.
3.6.3 Southern Blotting
1. The appropriate restriction enzyme (RE) such as EcoRI,

HindIII, or BamHI was chosen with only one cut site in the
binary vector (T-DNA).
2. In 100 l RE reaction, 3050 g orchid genomic DNA was
thoroughly mixed with 10 l 10 RE buffer, 1 l 100 BSA,
and 1 l high concentrate RE (50 units/l); sterilized ddH2O
was added to final volume 100 l; and the mixture was incubated at the appropriate temperature (depends on RE type) for
3 h to overnight.
3. The RE reaction product was concentrated by EtOH precipitation or by Speed Vac.
4. The product was separated on a 0.8 % agarose gel, transferred
to a nylon membrane (Hybond N+, Amersham), and then
cross-linked to the membrane using a UV cross-linker.
5. This was followed by the standard Southern blot protocol as
described [9] or the DIG-labeled Southern blot protocol (Roche).
3.6.4 RNA Extraction

Using Rapid TRIzol Method
1. Fresh orchid tissues (0.1 g) were added to each tube with 1 ml

TRIzol reagent, 50 mg sea sand, and one 5 mm stainless steel
bead, vigorously vortexed (Qiagen TissueLyser II) for 5 min at
30 rpm (chilled on ice for seconds at 1 min intervals), and then
incubated at RT for 5 min.
2. After centrifugation at 12,000 g for 10 min at RT, the aqueous phase was transferred into new tubes.
3. Chloroform (0.2 ml) was added, and the tubes were shaken
vigorously by hand for 15 s and then incubated at RT for
2 min.
4. After centrifugation at 12,000 g for 10 min at RT, the aqueous phase was transferred into new tubes.
343
5. Isopropanol (0.5 ml) was added and incubated at RT for

10 min.
6. After centrifugation at 12,000 g for 10 min at RT, the supernatant was discarded.
7. The pellet was washed with 0.5 ml 70 % EtOH and centrifuged
at RT for 5 min, and then the supernatant was carefully
discarded.
8. The pellet was rinsed carefully with 100 % EtOH.
9. The RNA pellets were air-dried and then dissolved in 30 l
DEPC-treated ddH2O.
3.6.5 RNA Extraction
Using Conventional RNA
Extraction
1. Fresh orchid tissues (0.5 g) were homogenized with 0.1 g sea

sand in liquid nitrogen.
2. The tissue powder was collected into prechilled tubes, and
5 ml RNA extraction buffer and 5 ml acid phenol were added
followed by vigorous shaking for 2 min.
3. After centrifugation at 16,000 g for 15 min at 4 C, the aqueous phase was transferred to new tubes.
4. Chloroform (5 ml) was added and the tubes were shaken vigorously for 2 min and then centrifuged at 16,000 g for 15 min
at 4 C.
5. The aqueous phase was transferred to new tubes, mixed thoroughly with 5 ml 4 M LiCl, and then incubated at 4 C
overnight.
6. The samples were centrifuged at 16,000 g for 30 min at 4 C,
and then the supernatant was discarded.
7. The RNA pellet was dissolved in 2 ml DEPC-treated water,
mixed with 0.2 ml 3 M NaOAc and 5 ml 100 % EtOH, and
then incubated at 70 C for 2 h to overnight.
8. The samples were centrifuged at 16,000 g for 30 min at 4 C,
and then the supernatant was carefully discarded.
9. The pellet was rinsed carefully with 70 % EtOH twice and
100 % EtOH once.
10. The RNA pellets were air-dried and then dissolved in 30 l
DEPC-treated ddH2O.
3.6.6 Reverse
Transcription (RT)-PCR
1. For 30 l RT reaction, 13 g total RNA was mixed thoroughly with 2 l 10 M dT(1518) and H2O to a final volume of
11 l, then incubated at 72 C for 10 min.
2. RT mixture (19 l comprising 7.4 l H2O, 6 l 5 RT buffer,
5 l 2.5 mM dNTP, 0.5 l MMLV-reverse transcriptase
(Promega), 0.1 l RNase inhibitor (Takara)) was added and
then incubated at 42 C for 70 min.
344
Chia-Wen Li et al.
3. The RT was inactivated at 72 C for 15 min, and then the

cDNA samples were kept on ice.
4. Sterilized H2O (70 l) was added to each tube.
5. For PCR, 15 l diluted cDNA (the amount depends on target
gene expression level) was used for each reaction.
3.6.7 Histochemical
Examination
of Transformants
1. For GUS staining, antibiotic-selected PLBs or leaves of regenerated plants were soaked in X-Gluc staining solution (pH 8.0)
overnight at 37 C.
2. The chlorophyll was removed by soaking in 95 % EtOH.
Notes
1. The concentration of phytohormones for PLB initiation can
differ among cultivars.
2. If the selection antibiotic is kanamycin, the gelatinous substance
Phytagel should be replaced with agar. Note that the kanamycin
selection system has a higher false-positive ratio than the hygromycin selection system in orchid transformation.
3. Charcoal can improve the growth and development of
Phalaenopsis orchid seedlings by absorbing harmful secondary
metabolites secreted by the orchid. However, it is not a necessary ingredient for Oncidium PLB propagation and regeneration or for Phalaenopsis orchid seed germination.
4. Additional acetosyringone (AS) is optional for Oncidium
transformation. Application of AS has little effect on the transformation efficiency of Oncidium Gower Ramsey and
Phalaenopsis orchids.
5. Other strains of Agrobacterium, such as LBA4404 and
GV3101, can also be employed, while EHA105 demonstrated
a better transformation efficiency as tested in both Oncidium
Gower Ramsey and Phalaenopsis orchids.
6. The antibiotic used for transformation depends on the selection marker of the binary vector; the antibiotic concentration
can differ among cultivars.
7. The age and condition of the PLBs can influence the regeneration efficiency. Differentiated small shoots should be removed
before propagating transformation materials.
8. The antibiotics used for Agrobacterium preculture depend on
the Agrobacterium strain and the cloning selection marker
in the binary vector. MGL broth is better than YEP broth for
Agrobacterium preculture. Agrobacterium cultured in YEP
broth can aggregate, reducing the transformation efficiency.
345
9. The length of the cocultivation period can influence transformation efficiency and can differ among test orchid cultivars
and Agrobacterium strains. Over-cocultivation will lead to
hyperhydricity of the PLBs and make it difficult to eliminate
Agrobacterium on the selection medium.
10. Overgrowth of Agrobacterium needs to be prevented to avoid
the death/desiccation of infected PLBs during the cocultivation period.
11. Timentin (200 mg/l) or other antibiotics can be employed to
replace meropenem (40 mg/l) to eliminate Agrobacterium,
but a higher antibiotic concentration entails more cost.
12. Starting materials (protocorms or PLBs) are small, and the
transformation efficiency is difficult to calculate. In average,
1030 transgenic lines can be obtained from 20 g fresh weight
of activated grown PLBs. In addition, the newly propagated
PLBs both from seeds and floral stalks have higher transformation efficiency than those that have been subcultured for a long
time.
13. RNAmate (BioChain Catalog No.: L1011100, Hayward, CA)
can efficiently reduce polysaccharide and proteoglycan contamination in orchid DNA. RNAmate can also be used for
RNA extraction by mixing with an RNA phenol extraction
reagent such as TRIzol. However, the conventional extraction
method followed by LiCl precipitation can also be used to
eliminate the coprecipitated polysaccharides.
Acknowledgments
This work was supported by grants from Academia Sinica and the
National Science Council of the Republic of China.
References
1. Hieber AD, Mudalige-Jayawickrama RG,
Kuehnle AR (2006) Color genes in the orchid
Oncidium Gower Ramsey: identification, expression, and potential genetic instability in an interspecific cross. Planta 223:521531
2. Liau CH, Lu JC, Prasad V, Hsiao HH, You SJ,
Lee JT, Yang NS, Huang HE, Feng TY, Chen
WH, Chan MT (2003) The sweet pepper
ferredoxin-like protein (pflp) conferred resistance against soft rot disease in Oncidium orchid.
Transgenic Res 12:329336
3. Chan YL, Lin KH, Sanjaya, Liao LJ, Chen WH,
Chan MT (2005) Gene stacking in Phalaenopsis
orchid enhances dual tolerance to pathogen

attack. Transgenic Res 14:279288
4. Chan MT, Chan YL, Sanjaya (2006) Orchids
(Cymbidium spp., Oncidium, and Phalaenopsis).
Methods Mol Biol 344:331338
5. Liau CH, You SJ, Prasad V, Hsiao HH, Lu JC,
Yang NS, Chan MT (2003) Agrobacterium
tumefaciens-mediated transformation of an
Oncidium orchid. Plant Cell Rep 21:993998
6. Tokuhara K, Mii M (1993) Micropropagation of
Phalaenopsis and Doritaenopsis by culturing
shoot tips of flower stalk buds. Plant Cell Rep
13:711
346
Chia-Wen Li et al.
7. You SJ, Liau CH, Huang HE, Feng TY, Prasad

V, Hsiao HH, Lu JC, Chan MT (2003) Sweet
pepper ferredoxin-like protein (pflp) gene as a
novel selection marker for orchid transformation. Planta 217:6065
8. Porebski S, Bailey LG, Baum BR (1997)
Modification of a CTAB DNA extraction proto-
col for plants containing high polysaccharide and

polyphenol components. Plant Mol Biol Rep
15:815
9. Sambrook J, Russell DW (eds) (2001)
Molecular cloning: a laboratory manual, 3rd
edn. Cold Spring Harbor Laboratory, Cold
Spring Harbor, NY
Chapter 27
Poinsettia (Euphorbia pulcherrima Willd. ex Klotzsch)
M. Ashraful Islam, Tage Thorstensen, and Jihong Liu Clarke
Abstract
Genetic engineering is an important tool for introducing desired genes into poinsettia (Euphorbia pulcherrima
Willd. ex Klotzsch). We describe in this chapter an Agrobacterium tumefaciens-mediated transformation
protocol for poinsettia. A detailed description of genetic transformation, antibiotic selection, subsequent
regeneration via somatic embryogenesis, and rooting as well as molecular and morphological analyses is
included. The methodology described here could facilitate the future engineering of poinsettia for research
purpose as well as commercial production of poinsettia plants with improved resistance or novel traits.
Key words Agrobacterium tumefaciens-mediated transformation, Poinsettia, Agrobacterium
tumefaciens, Somatic embryogenesis, Binary vector, Transgenic plants
Introduction
Poinsettia, a nonfood, non-feed ornamental plant, is a contemporary
symbol of Christmas in most parts of the world. Since it was introduced to the USA in 1825 from Mexico, poinsettia has become the
primary potted flower produced and sold in North America,
Europe, Asia, and Australia [1, 2]. The annual production in the
USA and the EU is 50 million and 100 million plants, respectively,
and the yearly production in 2008 was estimated to comprise a
value of around 155 million US dollars [3]. Hence, the innovation
potential of poinsettia is considerable and has become the driving
force for the development of genetic engineering protocols for
poinsettia.
Genetic engineering is an effective tool for breeding ornamental plants with the addition of desirable traits such as engineering
of gibberellin biosynthetic pathway to induce dwarfism in poinsettia reducing the chemical spray (Clarke et al. unpublished results),
novel colors, and resistance to pathogens and insects [46]. This
technology has been successfully utilized in the production or
improvement of a number of important ornamental crops, e.g.,
blue roses [7], novel carnations (www.florigene.com), transgenic
347
348
M. Ashraful Islam et al.
gladiolus [8], and chrysanthemums [9]. To date, transgenic

ornamentals of over 30 genera have been produced by different
transformation approaches [5, 6]. However, there are only a few
reports describing genetic transformation of poinsettia: One was
the US patent 7,119,262 [10] where the inventors used the biolistic transformation approach, while the other two were
electrophoresis-based transformation attempts [11, 12]. However,
no stable transgenic poinsettia has ever been produced using electrophoresis, regardless of the strong transient expressions that were
detected in both studies [11, 12]. The protocol we describe in this
chapter is a stable transformation method for poinsettia using
A. tumefaciens strain LBA4404 harboring a binary vector. By using
this protocol, we have produced transgenic poinsettia plants with
virus resistance via RNA silencing strategy and compact growth
poinsettia lines by overexpressing an Arabidopsis short internode
(SHI) gene [13, 14]. The average transformation frequency is
about 4 % with a range of 110 % depending on the cultivar and
gene of interest. This is a well reproducible protocol that has been
used routinely in our laboratory to generate stable transgenic poinsettia plants.
2
2.1
Materials
Plant Material
2.2 Agrobacterium
tumefaciens Strain
and Vector
Three poinsettia cultivars, Millennium, Polar Bear, and Early

Prestige, are selected for Agrobacterium tumefaciens-mediated
transformation in our laboratory based on their commercial potentials. Of those, Millennium is the mostly used cultivar to generate
transgenic poinsettia plants [13, 14]. Poinsettia plants are grown
under a photoperiod of 16 h light and 8 h dark at 22 C with 70 %
relative air humidity (RH) in the greenhouse. About 515 mm
long internode stems from 8 to 10-week-old poinsettia plants are
preferred as explants for Agrobacterium tumefaciens-mediated
transformation.
Agrobacterium tumefaciens strain LBA4404 (Invitrogen) carrying
a binary vector that possesses a hairpin RNA (hpRNA) cassette is
used. Below is a brief description of the expression cassette and the
plasmid vector construction [13] (see Note 1). The construct pCP
targets the viral coat protein (CP) of poinsettia mosaic virus
(PnMV). The CP sequence was produced by amplifying the corresponding fragments from the viral genome using gene-specific
primers containing XhoI/EcoRI and ClaI/XbaI restriction sites
for the sense and antisense fragments, respectively. The CP fragment in sense and antisense orientations was inserted into the
pHANNIBAL vector (kindly provided by CSIRO Plant Industry,
Canberra, Australia), interrupted by an intron of the pyruvate
orthophosphate dikinase (pdk) gene (Fig. 1) as described by
349
Fig. 1 Hairpin RNA (hpRNA) gene construct containing coat protein-encoding gene (Partially reproduced from
Clarke et al. [13], an OA publication with permission from Springer)
Helliwell and Waterhouse [15]. The CP expression cassette was

then subcloned into the binary plasmid vector pART27 (CSIRO
Plant Industry, Canberra, Australia) for Agrobacterium
tumefaciens-mediated transformation. The pART27 vector contains the selectable marker neomycin phosphotransferase (nptII)
under the control of nopaline synthase promoter (Nos-P), conferring kanamycin resistance in transgenic plants. The cauliflower
mosaic virus 35S (CaMV35S) promoter is used to control the
expression of the CP-cassette (Fig. 1), while octopine synthase
(ocs) terminator (OCS-T) terminates transcription. The plasmid
vector pCP was introduced into A. tumefaciens strain LBA4404 by
electroporation (see Subheading 3.1).
2.3
Stock Solutions
1. Kanamycin sulfate stock solution: 100 mg/mL. Dissolve 1 g

kanamycin sulfate in 10 mL dH2O and sterilize by filtration
through a 0.22 m pore size filter. Aliquot (500 L to 1 mL)
stock in Eppendorf tubes and store at 20 C.
2. Cefotaxime stock solution: 0.5 g/mL. Add 2 mL dH2O with
syringe in a bottle with 1 g cefotaxime to make 0.5 g/mL.
Shake until cefotaxime is dissolved and store stock solution at
20 C.
3. Acetosyringone
(3,5-dimethoxy-4-hydroxy-acetophenone)
stock solution: 100 mg/mL. Dissolve 196 mg acetosyringone
powder to 10 mL dimethyl sulfoxide (DMSO). Make it in a
sterile tube, aliquot it in Eppendorf tubes, and store at 20 C
(see Note 2).
4. 6-Benzylaminopurine or benzyl adenine (BAP) stock solution:
1 mg/mL. Dissolve 10 mg BAP in 1 N NaOH (12 mL) in a
beaker with a magnetic stir bar. Add Milli-Q (MQ) water up to
the desired volume (10 mL). Aliquot it in Eppendorf tubes
and store at 20 C.
5. 4-Chlorophenoxyacetic acid (CPA) stock solution: 1 mg/mL.
Dissolve 10 mg CPA in EtOH or 1 N NaOH (12 mL) in a
beaker with magnetic stir bar. Add MQ water up to the
desired volume (10 mL). Aliquot it in Eppendorf tubes and
store at 20 C.
6. Naphthaleneacetic acid (NAA) stock solution: 1 mg/mL.
Dissolved 10 mg NAA in absolute ethanol or 1 N NaOH
350
(12 mL), then add MQ water up to the desired volume

(10 mL). Aliquot it in Eppendorf tubes and store at 20 C.
7. Isopentenyladenine (2iP) stock solution: 1 mg/mL. Dissolve
10 mg iP in 1 N NaOH (12 mL), then add MQ water up to
10 mL. Aliquot it in Eppendorf tubes and store at 20 C.
8. Indole-3-acetic acid (IAA) stock solution: 1 mg/mL. Prepare
by dissolving 10 mg IAA in absolute ethanol (12 mL) and
make up to volume with MQ water (10 mL). Aliquot it in
Eppendorf tubes and store at 20 C.
9. Indole-3-butyric acid (IBA) stock solution: 1 mg/mL. Prepare
by dissolving 10 mg IBA in 1 N NaOH (12 mL) and make up
to volume with MQ water (10 mL). Aliquot it in Eppendorf
tubes and store at 20 C.
2.4
Media
1. LB (Luria broth) medium: Dissolve 10 g tryptone, 5 g yeast

extract, and 10 g NaCl in 950 mL water and make the volume
up to 1 L. Adjust the pH to 7.0 using 1 N NaOH and autoclave
it. After that, the LB medium is allowed to cool down to
approximately 55 C before adding antibiotic. Otherwise, store
at room temperature or in a cool room at 4 C (see Note 3).
2. LBA (Luria broth agar) medium: Dissolve 10 g tryptone, 5 g
yeast extract, 10 g NaCl, and 15 g agar in 900 mL water.
Adjust the pH to 7.0 using 1 N NaOH and make the volume
up to 1 L. Autoclave it and allow the solution to cool down to
approximately 50 C and store at room temperature for a few
hours or at 4 C (see Note 3).
3. Callus induction medium (CIM): Murashige and Skoog (MS)
medium [16] supplemented with 3 % sugar (30 g for 1 L
medium) in 900 mL water and make the volume up to
1 L. Adjust the pH to 5.75.8. Autoclave it and cool to approximately 50 C. After cooling, it should be supplemented with
0.2 mg/L BAP and 0.2 mg/L CPA. The plates can be stored
for a few weeks at 4 C.
4. Callus induction medium with antibiotics (CIM selection): The
above-described CIM medium supplemented with 10 mg/L
kanamycin and 400 mg/L cefotaxime. The plates can be stored
for a few weeks at 4 C.
5. Somatic embryo induction medium (SEIM): MS medium supplemented with 3 % sugar (30 g for 1 L medium) in 900 mL
water and make the volume up to 1 L. Adjust the pH to 5.7
5.8. Autoclave it and cool to approximately 50 C. After cooling it should be supplemented with 0.3 mg/L NAA,
0.15 mg/L 2iP, 25 mg/L kanamycin, and 400 mg/L cefotaxime. The plates can be stored for a few weeks at 4 C.
6. Root induction (RI) medium: 1/2 strength MS and 2 % sugar
(20 g for 1 L medium) in 900 mL water and make the volume
351
up to 1 L. Adjust the pH to 5.75.8. Autoclave it and cool to

approximately 50 C. It will be supplemented with or without
hormones (1 mg/L IAA or IBA). It can be stored at 4 C for
up to 4 weeks.
7. MS-2: MS medium and 2 % sugar (20 g for 1 L medium) in
900 mL water and make the volume up to 1 L. Adjust the pH
to 5.75.8. Autoclave it and cool down to approximately
50 C. Divide into 100 mL bottles and keep in a cool room
at 4 C.
Methods
3.1 Transformation
of Agrobacterium
tumefaciens
by Electroporation
1. Isolate plasmid DNA from E. coli cultures by using a commercial kit or by following a standard laboratory mini-prep protocol. The concentration of DNA should be about 100 ng/L.
2. Thaw commercially purchased A. tumefaciens LBA4404 cells
(Invitrogen, California, USA) on wet ice (see Notes 4 and 5).
3. Take 20 L competent cells in two new precooled microcentrifuge tubes and add 2 L undiluted and 1 L 10 diluted plasmid DNA respectively in each tube.
4. Mix gently; pipette the cell and DNA mixtures (22 L) immediately into the 0.1 cm cuvette and electroporate using an ECM
630 Electro Cell Manipulator (BTX Harvard Apparatus) with
conditions: 2.0 kV, 200 resistance, and 25 F capacitance.
5. Add 1 mL LB medium to the cuvettes, mix gently by pipetting, and transfer the solutions to a 15 mL tube.
6. Shake for 23 h at 225 rpm and 30 C in the incubator.
7. In the meantime plates with LBA and appropriate antibiotic
(50 g/mL) should be prepared.
8. Transfer the cells to the plates, spread them evenly, and wrap
with plastic film.
9. Keep the plates upside down at 28 C for 2 days or until bacterial colonies appear.
10. Select one colony to proceed with for the glycerol stock (for
long-term storage at 80 C) (see Note 6).
3.2 Preparation
of Agrobacterium
Culture
1. To initiate the Agrobacterium culture, scrape off the culture

from glycerol stock with a toothpick and streak it onto an LB
agar plate (20 mL) with specific antibiotics. Culture at 28 C
for 2 days (see Note 3). In general, streaking is done on solid
medium on LBA plate.
2. Pick one single colony for culturing in 5 mL LB with appropriate antibiotics (50 g/mL) in a glass tube or 15 mL tube.
Grow the culture at 180200 rpm at 28 C.
352
3. Inoculate 4050 L of the mini-culture in 100 mL LB liquid

medium with appropriate antibiotics (50 g/mL) in an
Erlenmeyer flask (250 mL with cap). Incubate at 28 C with
180200 rpm overnight until an OD600 of 0.60.8 is reached.
4. Divide the bacteria culture (100 mL) in two tubes (50 mL) and
spin at 1,571 g for 9 min at 4 C.
5. Discard the flow-through and wash the bacteria suspension
with 20 mL MS-2 (by gently pipetting), and spin again at
2,850 rpm for 5 min at 4 C.
6. Discard the flow-through and dilute the bacterial pellet in
10 mL MS-2 (by gently pipetting) for the bacteria suspension,
and add acetosyringone (100 M).
3.3 Explant
Preparation
1. Excise about 515 mm long internode stem explants from 8 to

10-week-old poinsettia plants and put in a glass with dH2O
(see Note 7). Avoid the hollow part of the stem explants.
2. Surface sterilize the explants with 70 % ethanol for 1 min, 1 %
NaOCl for 10 min, and then rinse thoroughly three times with
sterile deionized and autoclaved water for 3, 10, and 20 min.
3. After sterilization, excise stem segments (11.5 mm thickness)
with the help of scalpel and forceps.
4. Place the excised stem segments in a petri dish containing sterile
filter paper moistened with MS-2 medium until they are ready
to be inoculated with Agrobacterium culture (see Note 8).
3.4 Agrobacterium
Infection,
Cocultivation,
and Plant
Regeneration
1. Inoculate about 75 sterilized stem segments (11.5 mm in

thickness) with 10 mL Agrobacterium culture prepared
(see step 6 in Subheading 3.2.) in a 90 mm petri dish for
10 min with gentle shaking (see Note 8).
2. Carefully transfer the stem segments from the bacteria suspension to fresh sterile filter papers to blot them dry.
3. Place the infected stem segments on CIM supplemented with
acetosyringone (100 M) in petri dishes (50 mm in diameter)
with approximately 15 stem segments in each CIM petri dish
(Fig. 2a) and keep them at 24 C for 72 h in dark (see Note 9).
4. After cocultivation, the explants were blotted gently on sterile
filter paper in order to remove the Agrobacterium on the surface and around each stem segment.
5. Transfer the explants to fresh CIM selection medium, in petri
dishes with 90 mm in diameter, and incubate under a 16 h
photoperiod (light intensity 23 mol/m2/s), 24 C, for about
10 days.
6. When embryogenic calli appear after about 10 days, transfer
the calli to SEIM and continue incubation as described in step 4
above. Subculture of somatic embryos every 3 weeks is carried
353
Fig. 2 Agrobacterium tumefaciens-mediated transformation of poinsettia. (a) Stem segments placed on the
callus induction medium (CIM) after Agrobacterium inoculation. (b) Somatic embryos at different development
stages emerged from embryogenic calli on the somatic embryo induction medium (SEIM). (c) An embryogenic
callus with early-stage somatic embryos. (d) Cotyledonary stage of somatic embryos. (e) Plantlets with welldeveloped roots growing on the root induction medium (RIM). (f) Regenerated plants with roots are transferred
into soil in the greenhouse (Partially reproduced from Clarke et al. [13], an OA publication with permission from
Springer)
out to acquire high efficiency of regeneration of putative transformants (Fig. 2bd).

7. Transfer green shoots and plantlets derived from the somatic
embryos to RI medium in standard 370 mL glass bottles
(Europaglas, 82 mm in diameter, Holmegaards Glasvrker,
DK) or 77 mm 77 mm 97 mm Magenta vessel (SigmaAldrich, Fig. 2e) and grow under a 16 h photoperiod (light
intensity 30 mol/m2/s), 24 C, for 68 weeks until the roots
are established (see Note 10).
8. Gently remove the plantlets with the well-formed root systems
from the glass, rinse to remove medium clinging to the roots,
and transfer the plantlets to soil (Fig. 2f ).
3.5 Plant
Propagation/
Greenhouse
Cultivation
1. Small putative poinsettia plantlets are carefully transferred into

small pots (approximately 5 cm in diameter) containing commercially purchased plant soil. In order to assure establishment
of the poinsettia plantlets under the greenhouse conditions,
the potted small poinsettia plants are covered with a plastic
cover to avoid direct intensive sunlight and maintain soil
humidity for 2 weeks. Water gently every day (see Note 11).
2. Putative transgenic poinsettia plants are further transferred to
bigger pots (ca 10 cm in diameter) after 2 weeks acclimation in
354
the small pots in the greenhouse. Plastic cover is no longer

needed. The conditions for plant growing are 21 C
temperature, 75 % RH, 16 h photoperiod, and a photon flux
density of 100 mol/m2/s.
3. Generation of sufficient plant materials for downstream molecular, physiological, biochemical, and morphological analyses can
be achieved through vegetative cuttingsthe main approach for
poinsettia propagation and production (see Note 12).
Notes
1. Agrobacterium strains must be propagated at optimal conditions (shaker speed: 180 rpm, incubator temperature: 28 C)
to reach the desired optical density (OD600) 0.60.8.
2. Acetosyringone application can increase the transformation
frequencies in many species [17]. It can be used to induce virulence genes in Agrobacterium [18, 19].
3. Antibiotics (50 g/mL) can be added to LB or LB Agar
(LBA), after the medium is cooled down to approximately
50 C. Too high temperature (>50 C) is likely to destroyed or
inactivated antibiotics. For the LBA plates, petri dishes (9 cm
in diameter) are used, and the LBA plates are stored at 4 C.
4. All the bacterial culture preparations are done in a laminar air
flow hood under sterile conditions.
5. A. tumefaciens LBA4404 competent cells can also be prepared
in the laboratory according to the standard molecular protocols. However, the transformation efficiency may be affected
due to the quality of homemade A. tumefaciens cells.
6. Bacterial stocks containing 15 % glycerol are important for
long-term storage of plasmids. Glycerol stabilizes the frozen
bacteria and prevents damage to the cell membranes as well as
keeping the cells alive. A bacterial glycerol stock can be stored
stably at 80 C for many years.
7. Individual stem explants excised from greenhouse-growing
poinsettia plants are kept in water before approximately 2530
stem explants are collected for a transformation experiment.
After sterilization, stem segments (11.5 mm thickness) are
generated and kept under moist conditions on plates (sterile
filter papers are soaked with MS-2 on a plate) prior to transformation avoiding dehydration of stem segments which can lead
to low Agrobacterium tumefaciens-mediated transformation
efficiency.
8. Experiment size can be adjusted based on the explants available. In a standard poinsettia transformation experiment at our
355
laboratory, we use about 300 stem segments and the corresponding volume of Agrobacterium cell culture.
9. The dark culture condition can be achieved by either placing
all petri dishes in a box and cover with aluminum foil to avoid
any light or keep the petri dishes in a dark room.
10. Subculture every third week is necessary to promote the root
development.
11. It is important to cover plantlets with a clear plastic covering
before putting into a tray in the greenhouse. Also put up very
thin cloths (for a few weeks) to prevent direct sunlight as well as
to prevent wilting. Water carefully to regulate soil humidity.
After the plants are established, water should be given every day.
12. Four- to six-week-old putative transgenic poinsettia plants are
at the ideal stage for collecting plant materials for molecular
and various other analyses.
Acknowledgments
Thanks are due to Sissel Haugslien, Dag-Ragnar Blystad, Erling
Flistad, and Carl Spetz for their practical support; CSIRO Plant
Industry for providing pHANNIBAL and pART27 vectors; and
J. Kristiansen nursery for the poinsettia plants. We are grateful to
Dr. Nicholas Clarke for the linguistic correction. This research was
supported by the Research Council of Norway grants 147147/140
and 199398 to Dr. Jihong Liu Clarke.
References
1. Ecke P III, Faust JE, Higgins A, Williams J
(2004) The Ecke poinsettia manual. Ball,
Batavia, IL
2. Williams J (2005) Poinsettia production.
FlowerTech 8:69
3. USDA (2009) [NASS] Floriculture crops:
2008 summary. Sp Cr 61. (http://usda.
mannlib.cornell.edu/usda/current/
FlorCrop/FlorCrop-04-23-2009.pdf)
4. Deroles SC, Boase MR, Lee CE, Peters TA
(2002) Gene transfer to plants. In: Vainstein A
(ed) Breeding for ornamentals: classical and
molecular approaches. Kluwer, Dordrecht,
pp 156196
5. Hammond J, Hsu HT, Huang Q, Jordan R,
Kamo K, Pooler M (2006) Transgenic
approaches to disease resistance in ornamental
crops. J Crop Improv 17:155210
6. Ltken H, Clarke JL, Mller R (2012) Genetic
engineering and sustainable production of
7.
8.
9.
10.
11.
12.
ornamentals: current status and future directions. Plant Cell Rep 31:114111573
Yoshikazu T (2004) Visual biotechnology.
Blue rose realized by biotechnology. Biosci Ind
62:789790
Kamo K, Hammond J, Roh M (1997)
Transformation of Gladiolus for disease resistance. J Kor Soc Hort Sci 38:188193
Teixeira da Silva JA (2004) Ornamental chrysanthemum: improvement by biotechnology.
Smith F, Chou TS, Eisenreich R, Sanford J,
Blowers A, Van Eck J (1997) Production of
transgenic poinsettia. US Patent 7,119,262,
pp 136
Vik NI, Hvoslef-Eide AK, Gjerde H, Bakke K
(2001) Stable transformation of poinsettia via
electrophoresis. Acta Hort 560:101103
Clarke JL, Klemsdal SS, Flistad E, HvoslefEide AK, Haugslien S, Moe R, Blystad DR
356
(2006) Genetic engineering of poinsettia with

the aim of enhancing its resistance to poinsettia
mosaic virus. Acta Hort 722:321325
13. Clarke JL, Spetz C, Haugslien S, Xing S, Dees
MW et al (2008) Agrobacterium tumefaciensmediated transformation of poinsettia,
Euphorbia pulcherrima, with virus-derived
hairpin RNA constructs confers resistance to
poinsettia mosaic virus. Plant Cell Rep 27:
10271038
14. Islam MA, Ltken H, Haugslien S, Blystad D-R,
Torre S et al (2013) Overexpression of the AtSHI
gene in poinsettia, Euphorbia pulcherrima,
results in compact plants. PLoS One 8:e53377.
DOI: 10.1371/journal.pone.0053377
15. Helliwell C, Waterhouse P (2003) Constructs
and methods for high-throughput gene silencing in plants. Methods 30:289295

17. Sheikholeslam SN, Weeks DP (1987)
Acetosyringone promotes high efficiency transformation of Arabidopsis thaliana explants by
Agrobacterium tumefaciens. Plant Mol Biol
8:291298
18. Stachel SE, Messens E, Van Montagu M,
Zambryski P (1985) Identification of the signal
molecules produced by wounded plant cells
that activate T-DNA transfer in Agrobacterium
tumefaciens. Nature 318:624629
19. Melchers L, RegensburgTuink A, Schilperoort
R, Hooykaas P (1989) Specificity of signal
molecules in the activation of Agrobacterium
virulence gene expression. Mol Microbiol
3:969977
Chapter 28
Populus trichocarpa
Quanzi Li, Ting-Feng Yeh, Chenmin Yang, Jingyuan Song,
Zenn-Zong Chen, Ronald R. Sederoff, and Vincent L. Chiang
Abstract
Populus trichocarpa Nisqually-1 is a clone of black cottonwood that is widely used as a model woody plant.
It was the first woody plant to have a full genome sequence and remains today as the model for growth,
metabolism, development, and adaptation for all woody dicotyledonous plants. It is one of the bestannotated plant genomes available. It is also currently studied to improve bioenergy feedstocks and to
learn about responses to environmental variation that may result from climate change. It is the best characterized woody plant for lignin biosynthesis. In spite of its role as a model woody plant, many important
genetic applications have been limited because it was particularly difficult for DNA transformation. The
ability to transform P. trichocarpa is a central component of a systems biology approach to the study of
metabolic and developmental processes, where in combination with genome and transcriptome sequencing, all the expressed genes for specific pathways can be defined, cloned, and characterized for biological
function.
We previously reported on a method for Agrobacterium-mediated genetic transformation in P. trichocarpa (Song et al. Plant Cell Physiol 47: 15821589, 2006). Since then, we have optimized the protocol
based on many experiments that varied in tissue manipulation, media, DNA constructs and Agrobacterium
strains. A modified step-by-step protocol for Agrobacterium-mediated transformation of stem explants is
described here. The health of the tissue explants and the time of cocultivation are among the critical steps
in the protocol for successful transformation. This updated protocol should be helpful to many laboratories that are currently carrying out P. trichocarpa transformation. It should also encourage many labs that
have not yet had success with P. trichocarpa to try again.
Key words Agrobacterium tumefaciens, Genetic transformation, Populus trichocarpa, Transgenic trees
Introduction
Agrobacterium-mediated transformation is a widely used and
powerful tool for molecular genetics and plant biotechnology.
Transgenic plants are unique materials to study gene function.
Near-whole-genome sequence is now available for many species
and is being applied to many problems through new techniques,
such as next-generation sequencing and ChIP-seq, to gain
unprecedented insights into biological structure and function.
357
358
Quanzi Li et al.
Overexpression and knockdown/knockout transgenics are increasing our understanding of gene function and the roles of specific
genes in genetic regulatory networks. Forest trees, which produce
large amounts of lignocellulosic biomass, are major resources for a
diverse array of wood products and as raw materials for construction and pulp/paper and biofuel production [2]. In the genus
Populus, the only species with a complete genome sequence is
Populus trichocarpa [3]. However, this species is difficult to transform compared to other widely studied poplar species, such as P.
tremula or P. tremuloides or several poplar hybrids. Previously we
established a simple and efficient Agrobacterium-mediated transformation protocol for P. trichocarpa (Nisqually-1) using stems as
explants [1]. Since then we have carried out extensive transformation experiments testing different tissue manipulations, types of
constructs, Agrobacterium strains, and media. Overexpression
constructs using either the CaMV35S or a P. trichocarpa 4CL3
promoter always have a two- to threefold higher transformation
efficiency than RNAi constructs using the same 35S or 4CL promoter. After the P. trichocarpa genome was sequenced, many labs
have generated transgenics to study gene function because it is
possible to readily determine the location of most transformation
events. Some labs are still struggling to carry out P. trichocarpa
transformation, because they are not aware of some critical steps in
the transformation process.
In this chapter, we describe an updated stepwise protocol for
Agrobacterium-mediated P. trichocarpa transformation. In this
protocol, stems of fifth to eighth internodes of 5- to 6-month-old
trees are used as explants for infection with A. tumefaciens strain
C58 or GV3101 harboring a binary vector pBI121 or pBI121derived vector. Transgenic shoots can be obtained within 58
months under kanamycin selection. The average transformation
rate is 10 %, and a frequency as high as 20 % can be achieved with
careful adherence to this protocol. This updated protocol should
help more researchers to successfully obtain transgenic P. trichocarpa plants.
2
2.1
Materials
Plant Materials
2.2 Agrobacterium
Strains and Vectors
The explants used for Agrobacterium-mediated transformation are

stem sections of 56-month-old trees (Fig. 1a) grown in a
greenhouse.
1. Agrobacterium strains: C58 [4] or GV3101 [5].
2. Genetic constructs: pBI121 [6] or construct derived from
pBI121.
Populus trichocarpa
359
Fig. 1 Agrobacterium-mediated genetic transformation of Populus trichocarpa (Nisqually-1). (a) P. trichocarpa

trees, 56 months old. (b) A P. trichocarpa plant showing first to seventh internodes. (c) A forceps and doubleedged razor blades used for cutting stem segments. (d) Explants after 2 days of cocultivation with Agrobacterium.
(e) Transgenic calli formed from an explant incubated on CIM2 medium. (f) Callus produced from an explant
that is incubated on SIM1 medium. (g) Shoots generated from callus on SIM2 medium. (h) Micropropagation
of transgenic plants on RPM medium
2.3
Stock Solutions
1. Kanamycin (100 mg/mL): Dissolve 5 g kanamycin monosulfate in distilled H2O and sterilize by passing through a 0.2 m
filter, and store at 20 C.
2. Cefotaxime (200 mg/mL): Add 10 mL sterile distilled H2O to
the bottle to dissolve the 2 g Claforan (cefotaxime) inside.
Additional sterilization of the solution with a filter is not
required. Store at 20 C.
3. Timentin (200 mg/mL): Add 10 mL sterile distilled H2O into
a bottle containing 2 g Timentin. Additional sterilization with
a filter is not required. Store at 20 C.
4. Murashige and Skoog (MS) basal medium with vitamins (10
stock): Put one bag of MS basal medium with vitamins in 1 L
distilled H2O, stir at room temperature for at least 8 h, and
store at 4 C. Shake well before using.
5. Acetosyringone (AS, 200 mM): Dissolve 0.196 g AS in 3 mL
dimethyl sulfoxide (DMSO) and bring volume to 5 mL with
distilled H2O. Pass through a 0.2 m filter into 1.5 mL
Eppendorf tubes and store at 20 C.
6. Kinetin (1 mg/mL): Dissolve 100 mg kinetin in ~2.5 mL
0.5 N HCl and bring volume to 100 mL with distilled
H2O. Sterilization is not needed. Store at 4 C.
360
Quanzi Li et al.
7. 2.4-Dichlorophenoxy acetic acid (2,4-D) (1 mg/mL): Dissolve

100 mg of 2,4-D in ~2.5 mL 1 N KOH and bring volume to
100 mL with distilled H2O. Sterilization is not needed. Store
at 4 C.
8. Thidiazuron (TDZ) (0.5 mg/mL): Dissolve 10 mg in a few
drops of DMSO, and bring volume to 20 mL with distilled
H2O. Sterilize by passing through a 0.2 m filter. Aliquot and
store at 20 C (see Note 1).
9. Zeatin (2 mg/mL): Dissolve 20 mg zeatin in 2.5 mL of 0.5 N
HCl and bring volume to 10 mL with distilled H2O. Sterilize
by passing through a 0.2 m filter and store at 20 C.
10. Lloyd & McCown Woody Plant Medium (WPM) with vitamins (PhytoTechnology Lab).
11. Coconut water (PhytoTechnology Lab).
12. Clorox (8.3 % sodium hypochlorite).
2.4 Tissue Culture
and Plant-Growth
Media
1. Callus Induction Medium 1 (CIM1): 1 MS salts and vitamins, 30 g/L sucrose, 100 mg/L inositol, 0.5 mg/L kinetin,
0.05 mg/L 2.4-D, 6.5 g agar. To prepare, dissolve sucrose and
inositol in ~750 mL water, add 100 mL of 10 MS salts with
vitamins, 500 L of 1 mg/mL kinetin, 50 L of 1 mg/mL
2,4-D, and then adjust pH to 5.7, bring volume to 900 mL,
add 6.5 g agar, autoclave, cool, add 100 mL coconut water.
2. Callus Induction Medium 2 (CIM2): 1 MS salts and vitamins, 30 g/L sucrose, 100 mg/L inositol, 100 mg/L inositol,
0.5 mg/L kinetin, 0.05 mg/L 2.4-D, 50 mg/L kanamycin,
500 mg/L cefotaxime, and 6.5 g agar. Prepare the medium as
CIM1, bring volume to 1 L. After the medium is autoclaved
and cooled, add 500 L of 100 mg/mL kanamycin and 2.5 mL
of 200 mg/mL cefotaxime.
3. Shoot Induction Medium 1 (SIM1): MS salts and vitamins, 30 g/L sucrose, 100 mg/L inositol, 132 g/mL TDZ,
50 mg/L kanamycin, 500 mg/L cefotaxime, and 6.5 g agar.
To prepare, dissolve 30 g sucrose and 100 mg inositol in
~900 mL water, add 50 mL of 10 MS salt with vitamin, adjust
pH to 5.7. Add 6.5 g agar, autoclave, and cool. Add 264 L of
0.5 mg/mL TDZ, 500 L of 100 mg/mL kanamycin and
2.5 mL of 200 mg/mL cefotaxime.
4. Shoot Induction Medium 2 (SIM2): 1 WPM with vitamins,
30 g/L sucrose, 100 mg/L inositol, 2 mg/L zeatin, 50 mg/L
kanamycin, 500 mg/L cefotaxime, and 6.5 g agar. To prepare,
dissolve one bag of WPM with vitamins, 30 g sucrose and
100 mg inositol in 1 L water, adjust pH to 5.7, add 6.5 g agar.
After autoclaving and cooling, add 1 mL of 2 mg/mL zeatin,
50 L of 100 mg/mL kanamycin and 2.5 mL of 200 mg/mL
cefotaxime.
Populus trichocarpa
361
5. Rooting and Propagation Medium (RPM): To prepare,

dissolve 2.41 g of WPM with vitamins, 100 mg inositol, 20 g
sucrose, 0.65 g Ca-gluconate, 0.5 g 4-morpholineethanesulfonic acid (MES) in 1 L water by stirring in a bottle for several
hours, add 6.5 g of agar, dissolve and adjust pH to 5.8, and
autoclave.
3
3.1
Methods
Plant Growth
3.2 Agrobacterium
Culture Preparation
P. trichocarpa plants were grown in pots containing half MiracleGro soil (Scotts Miracle-Gro, Marysville, OH) and half Metro-Mix
200 (Sun Gro, Bellevue, WA) in a greenhouse at 1726 C, 16 h
light/8 h dark cycle (with supplemental light of ~300 E/m2/s).
Miracle-Gro Plant Food (Scotts Miracle-Gro) was applied once a
week (see Note 2).
1. Pick a bacterial colony 2 days before infection from a LuriaBertani (LB) plate (up to 2 weeks old) into 10 mL LB liquid
media containing appropriate antibiotics (50 g/mL kanamycin and 50 g/mL gentamicin) and shake at 220 rpm at 28 C
for 1 day.
2. Inoculate 5200 L of the culture into 25 mL liquid LB in a
125 mL Erlenmeyer flask. Add acetosyringone to a concentration
of 200 M following inoculation. Culture Agrobacterium overnight with shaking at 220 rpm at 28 C. The Agrobacterium culture is ready when the OD600 reaches ~0.4 (see Notes 3 and 4).
3.3 Inoculation
with Agrobacterium
and Cocultivation
1. Sterilize double-edged razor blades by immersion in 70 % ethanol in a petri dish for 20 min (see Note 5).
2. Collect stems that contain the fifth to eighth internodes
(Fig. 1b) from a 56-month-old tree grown in the greenhouse,
cut into two fragments (each ~15 cm long), and immediately
put them in a bottle containing enough 10 % Clorox (0.83 %
sodium hypochlorite) to submerge the segments.
3. Hold stems in Clorox for 20 min with gentle shaking to sterilize the stem fragments.
4. Rinse with 5 L sterile distilled water for the stems from two
trees. After rinsing, put the stem fragments into sterile water in
a sterile glass beaker, leaving about 2 cm out of the water.
5. Cut the stem sections into 0.4 cm long segments in a petri dish
(size 150 15 mm) using a double-edged razor blade held by
a serrated forceps (Fig. 1c), and immediately put the segments
into the Agrobacterium solution. Swirl gently for 35 min by
hand or on a shaker.
362
Quanzi Li et al.
6. Touch the inoculated segments to a clean petri dish to remove

excess Agrobacterium, and place them horizontally round side
down (not cut side down) on a CIM1 plate (see Note 6).
7. Cocultivate the segments on the plate at 25 C in the dark for
2 days (see Note 7).
3.4 Callus Induction
and Shoot
Regeneration
1. After cocultivation, remove the segments (Fig. 1d) from the

plate, and wash them with sterile distilled water at least three
times until the solution is clear (see Note 8).
2. Blot the segments on two layers of sterile filter paper to remove
excess water and transfer them onto CIM2 (see Notes 9 and 10).
3. Incubate the explants at 25 C in the dark for 60 days.
Subculture them onto fresh CIM2 every 34 days for the first
2 weeks and every 14 days for the remaining time on CIM2
medium. Blot the segments on sterile filter paper during each
transfer (Fig. 1e) (see Note 11).
4. Transfer explants to SIM1 and hold at 25 C under a 16 h
light/8 h dark cycle (~140 mol/m2/S) for 60 days (Fig. 1f).
Blot the segments on sterile filter paper to remove excess water.
5. Subculture the explants to fresh SIM1 every 14 days
(see Note 12).
6. Transfer explants to SIM2. Subculture them every 2 weeks
and incubate the explants on SIM2 for 30 days (Fig. 1g). Blot
the segments on sterile filter paper to remove excess water
(see Note 13).
3.5 Rooting
of Shoots
and Propagation
in Magenta Boxes
1. Excise shoots from the stem sections at 0.51.0 cm up from

the base of the growing shoots and stick individual shoots
standing up into RPM agar medium (containing 50 g/mL
cefotaxime) in a Magenta box (see Note 13).
2. Place the Magenta boxes at 25 C in a tissue culture room or a
growth chamber under the same light cycle as in SIM1.
3. Transgenic plants can be propagated by being subcultured in
RPM medium (Fig. 1h).
4. The plants are ready to be moved to a greenhouse after
1 month. Wash out the agar, plant the plantlet in soil, and
cover with a clear plastic cup for 1 week.
Notes
1. TDZ may precipitate. Mix well before adding TDZ into the
warm SIM1 medium.
2. The health of plants is very important for successful transformation, because healthy explants can survive under a high
concentration of acetosyringone (200 M) and for a longer
period of Agrobacterium infection (>46 h).
Populus trichocarpa
363
3. Do not overgrow the Agrobacterium culture.

4. If plants are not healthy, reduce the concentration of acetosyringone or do not add acetosyringone in the Agrobacterium
culture.
5. In order to be able to pick up the razor blades from the petri
dish, place razor blades on a microscope slide. Three razor
blades can be put separately on a microscope slide that has
been autoclaved in a petri dish.
6. Move the explants from the Agrobacterium solution onto the
CIM1 plate as quickly as possible.
7. If Agrobacterium C58 is used, the cocultivation time should be
exactly 46 h. If GV3101 is used, cocultivate for 48 h.
8. If you notice that the Agrobacterium is difficult to wash out
and sticks to your explants, it means over-cocultivation. Overcocultivated explants will turn black and die on CIM2 plates,
or alternatively, Agrobacterium will grow on the explants.
If this happens, reduce the Agrobacterium concentration or
cocultivation time. A red band is always seen on the top of the
cut side of the segments, where the stem has not been in contact with the medium. Keep the red band facing up.
9. Limit the exposure time of explants under the wind of the
hood to keep the explants from drying out.
10. If the CIM2 medium is too soft, Agrobacterium may grow on
it. Usually the medium pH is 5.7. Adjusting the CIM2 pH to
5.8 may help to prevent Agrobacterium growth.
11. A few small calli can be observed after 1 month. If more than
20 % of the explants turn black, it means over-infection. The
reasons may be that the plant was unhealthy, cocultivation time
was too long, or Agrobacterium was overgrown.
12. The callus will turn green and grow larger.
13. If Agrobacterium grows, add Timentin at a final concentration
of 0.2 mg/mL to the medium.
References
1. Song J, Lu S, Chen Z, Lourenco R, Chiang VL
(2006) Genetic transformation of Populus trichocarpa genotype Nisqually-1: a functional
genomic tool for woody plants. Plant Cell
Physiol 47:15821589
2. Ragauskas AJ, Williams CK, Davison BH et al
(2006) The path forward for biofuels and biomaterials. Science 311:484489
3. Tuskan GA, DiFazio S, Jansson S et al (2006)
The genome of black cottonwood, Populus trichocarpa (Torr. & Gray). Science 313:15961604
4. Goodner B, Hinkle G, Gattung S et al (2001)
Genome sequence of the plant pathogen and
biotechnology agent Agrobacterium tumefaciens

C58. Science 294:23232328
TL-DNA gene 5 controls the tissue-specific
expression of chimaeric genes carried by a novel
type of Agrobacterium binary vector. Mol Gen
Genet 204:383396
6. Chen PY, Wang CK, Soong SC, To KY (2003)
Complete sequence of the binary vector
pBI121 and its application in cloning T-DNA
insertion from transgenic plants. Mol Breed
11:287293
Chapter 29
Tall Fescue (Festuca arundinacea Schreb.)
Abstract
Tall fescue (Festuca arundinacea Schreb.) is the predominant cool-season perennial grass in the United
States. It is widely used for both forage and turf purposes. This chapter describes a protocol that allows for
the generation of a large number of transgenic tall fescue plants by Agrobacterium tumefaciens-mediated
transformation. Embryogenic calli induced from caryopsis are used as explants for inoculation with
A. tumefaciens. The Agrobacterium strain used is EHA105. Hygromycin phosphotransferase gene (hph) is
used as the selectable marker, and hygromycin is used as the selection agent. Calli resistant to hygromycin
are obtained after 46 weeks of selection. Soil-grown tall fescue plants can be regenerated 45 months
after Agrobacterium tumefaciens-mediated transformation.
Key words Agrobacterium, Festuca arundinacea, Forage and turf grass, Tall fescue, Genetic transformation, Transgenic plant
Introduction
Tall fescue (Festuca arundinacea Schreb.) is the most important
forage species worldwide of the Festuca genus. It forms the basis
for beef cow-calf production in the east-central and southeast
United States, supporting more than 8.5 million beef cows, and is
used for sheep and horse production [1]. It is also widely used for
general purpose turf and low-maintenance grass cover and plays an
important role in environmental protection [2]. The widespread
use of tall fescue is due to its adaptation to a wide range of soil
conditions, tolerance of continuous grazing, high yields of forage
and seed, persistence, long grazing season, compatibility with varied management practices, and low incidence of pest problems [1].
Tall fescue is a polyploid (2n = 6 = 42), wind-pollinated monocot species with a high degree of self-incompatibility. This makes
breeding management difficult and selection schemes complex,
resulting in slow breeding progress, especially for traits with low
heritability [3]. There has been considerable interest in manipulating tall fescue by genetic transformation in the past decade with
365
366
the aim of improving its agronomic traits [4, 5]. Transgenic tall
fescue plants have been obtained by direct gene transfer to protoplasts, microprojectile bombardment, and Agrobacterium
tumefaciens-mediated transformation [4, 6, 7].
The protocol outlined in this chapter is based on our work [6]
in tall fescue transformation. We used embryogenic calli as explant
and hygromycin as selection agent. Transformation frequency is
about 8.7 % based on the number of transgenic plants recovered
and the number of original intact calli used. The use of highly
embryogenic calli is one of the key factors affecting transformation
frequency.
2
2.1
Materials
Plant Material
2.2 Agrobacterium
tumefaciens Strain
and Selectable Marker
2.3 Culture Media

for Agrobacterium
tumefaciens
Seeds of tall fescue cultivar Jesup [8] (see Note 1).

The Agrobacterium tumefaciens strain EHA105 (see Note 2) was
used in combination with the binary vector pCAMBIA 1305.1,
which carries a hygromycin phosphotransferase gene (hph) and a
-glucuronidase gene (GUSPlus from Staphylococcus sp.), both
under the control of CaMV 35S promoter (www.cambia.org).
Hygromycin was used as selection agent.
1. LB medium: Add 25 capsules (MP Biomedical LLC, Solon,
OH) to 1,000 mL distilled water. Autoclave at 121 C for
15 min.
2. LB agar medium: Add 40 capsules (MP Biomedical LLC,
Solon, OH) to 1,000 mL distilled water. Autoclave at 121 C
for 15 min. Cool to 50 C, add appropriate antibiotics according to the type of plasmid(s) in the strain, and pour 25 mL
aliquots into Petri dishes (100 15 mm).
2.4
Tissue Culture
1. Calcium hypochlorite: Prepare fresh 3 % (w/v) calcium hypochlorite solution in a glass bottle; add a few drops of Tween-80.
2. 2,4-Dichlorophenoxy-acetic acid (2,4-D) solution: 1 mg/mL
(PhytoTechnology Laboratories, Shawnee Mission, KS).
3. M5 medium: Dissolve 4.43 g Murashige & Skoog basal
medium with vitamins (PhytoTechnology Laboratories) in
800 mL distilled water, add 30 g sucrose and 5 mL 2,4-D
(1 mg/mL), make up the volume to 1,000 mL with distilled
water. Adjust pH to 5.8 and add 7.5 g agar. Autoclave at
121 C for 15 min. Cool to 50 C and pour 25 mL aliquots
into Petri dishes (100 15 mm). Store at 24 C.
4. M1 liquid medium: Dissolve 4.43 g Murashige & Skoog basal
800 mL distilled water, add 30 g sucrose and 1.5 mL 2,4-D
367

water. Adjust pH to 5.8 and sterilize with a 0.22 m disposable
filter.
5. Acetosyringone (AS, 100 mM): Dissolve 0.196 g acetosyringone (3,5-dimethoxy-4-hydroxyacetophenone, FW 196.2,
C10H12O4) in 10 mL dimethyl sulfoxide (DMSO). Aliquot
500 L to each 1.5 mL Eppendorf microtube and store in the
dark at 4 C.
6. Hygromycin B (Hm): 50 mg/mL in phosphate buffered saline
(PBS) buffer with average activity 1,000 units/mg
(PhytoTechnology Laboratories). Store in the dark at 4 C.
7. Cefotaxime (250 mg/mL): Dissolve 5 g cefotaxime in 10 mL
distilled water and make up the volume to 20 mL. Sterilize
with a 0.22 m disposable filter and store at 20 C.
8. M1 selection medium: Dissolve 4.43 g Murashige & Skoog
basal medium with vitamins (PhytoTechnology Laboratories)
in 800 mL distilled water, add 30 g sucrose and 1.5 mL 2,4-D
121 C for 15 min. Cool to 50 C and then add 1.0 mL or
1.5 mL hygromycin and 1 mL cefotaxime. Mix well and pour
25 mL aliquots into Petri dishes (100 15 mm) and store at
24 C.
9. Kinetin: 1 mg/mL stock (PhytoTechnology Laboratories).
10. MSK medium: Dissolve 4.43 g Murashige & Skoog basal
800 mL distilled water, add 30 g sucrose and 0.2 mL kinetin
121 C for 15 min. Cool to 50 C and add 1 mL cefotaxime.
Mix well and pour 25 mL aliquots into Petri dishes
(100 15 mm) and store at 24 C.
11. MSO medium: Dissolve 2.22 g Murashige & Skoog basal
800 mL distilled water, add 8 g sucrose, make up the volume
to 1,000 mL with distilled water. Adjust pH to 5.8 and add
7.0 g agar. Autoclave at 121 C for 15 min. Cool to 50 C
and pour 25 mL aliquots into Petri dishes (100 15 mm).
Store at 24 C.
12. Sterile distilled water.
13. Sterile filter paper (7 cm diameter).
14. Sterile 6.6 cm diameter (190 mL) plastic culture vessels
(Greiner Bio-One, Longwood, FL).
15. Sterile 5.0 cm diameter (175 mL) plastic culture vessels
(Greiner Bio-One, Longwood, FL).
368
16. Sterile plastic Petri dishes (100 15 mm).

17. Forceps, scalpel, and blades.
18. Autoclaved glass flask (125 mL).
19. Drummond Pipet-Aid and sterile disposable pipettes.
20. Magnetic stirrer and stir bars.
21. Shaker/incubator.
22. A rotary shaker.
23. Nalgene transparent polycarbonate desiccator.
24. A swing rotor centrifuge.
25. Spectrophotometer.
26. Metro Mix 350 soil (Sun Gro Horticulture, Terrell, TX).
Methods
3.1 Sterilization
and Callus Induction
1. Immerse seeds in 3 % calcium hypochlorite solution in a glass

bottle. Put a magnetic stir bar in the bottle and place the bottle
on a magnetic stirrer. Agitate for 2 h (see Note 3).
2. Rinse the seeds three times with sterile distilled water and leave
the seeds overnight at 4 C.
3. Sterilize the seeds again for 30 min in 3 % calcium hypochlorite
solution the next day; rinse the seeds three times in sterile distilled water (see Note 4).
4. Place about 20 caryopses/seeds per 9 cm culture dish containing M5 medium. Keep dishes, sealed with Parafilm, in the dark
at 24 C.
5. Calli (Fig. 1ac) formed within 57 weeks are used for
Agrobacterium tumefaciens-mediated transformation.
3.2 Agrobacterium
Preparation
1. Streak A. tumefaciens from a glycerol stock onto LB agar plate

with antibiotic selection appropriate for the vector used.
Incubate at 28 C for 2 days.
2. Transfer a single colony from the plate into a flask containing
50 mL LB medium with antibiotic selection appropriate for
the vector used.
3. Incubate the cultures on a shaker/incubator at 200 rpm at
28 C for about 2 days, until the culture has reached an OD600
of 0.8. Add 50 L 100 mM AS to the bacteria culture; incubate one more hour on a shaker.
3.3 Inoculation
of Explants
and Cocultivation
1. Centrifuge the Agrobacterium cultures at 2,400 g for 15 min.

2. Pour off supernatant, resuspend the pellet with M1 liquid
medium, adjust OD600 to 0.50.8, and add 50 L 100 mM
AS. The Agrobacterium is now ready for transformation.
369
Fig. 1 Transgenic tall fescue (Festuca arundinacea) plants obtained after Agrobacterium tumefaciens-mediated
transformation of embryogenic calli. (a) Embryogenic callus induced from caryopses. (b, c) Detailed view of
the embryogenic calli. (d) Hygromycin-resistant calli obtained 5 weeks after Agrobacterium tumefaciensmediated transformation and selection of infected callus pieces on M1 medium. (e) Shoot differentiation of
hygromycin-resistant calli 4 weeks after transfer onto regeneration medium MSK. (f) Rooted transgenic plants
4 weeks after transfer of the differentiated shoots to rooting medium. (g) Greenhouse-grown transgenic plants
5 months after Agrobacterium tumefaciens-mediated transformation. (h) Fertile transgenic tall fescue after
vernalization
3. Transfer tall fescue calli into 6.6 cm culture vessels and break
up the calli into small pieces.
4. Add Agrobacterium suspensions to the culture vessels and
immerse the callus pieces.
5. Place the culture vessels in a polycarbonate desiccator and draw
vacuum (62 cm Hg) for 510 min.
6. Release vacuum, incubate the callus pieces and Agrobacteria
for 20 min with gentle shaking on a rotary shaker.
370
7. Remove the bacteria after the incubation, transfer the infected

callus pieces onto M1 wetted filter papers, and place them in
empty culture dishes in the dark at 24 C for cocultivation
(see Note 5).
3.4 Selection
and Plant
Regeneration
1. After 2 days of cocultivation, transfer the infected callus pieces

onto M1 selection (50 mg/L Hm) medium.
2. After 2 weeks, transfer the infected callus pieces to new M1
selection (75 mg/L Hm) medium. Resistant calli normally
become visible after 34 weeks of selection (Fig. 1d).
3. When the resistant calli are large enough (normally after 46
weeks on M1), transfer the resistant calli onto regeneration
medium MSK.
4. Keep the regenerating cultures at 24 C in fluorescent light
(40 mol/m2/s) at a photoperiod of 16 h in the growth chamber for 46 weeks (Fig. 1e).
5. Transfer the regenerated shoots/plantlets (Fig. 1e) to 5.0 cm
culture vessels containing MSO medium (Fig. 1f).
3.5 Greenhouse
Care, Vernalization,
and Seed Harvest
1. Transfer well-rooted plantlets (Fig. 1g) to 3 3 in. wells in an

18-well flat (6 3 wells) filled with Metro Mix 350 soil
(see Note 6) and grow them under greenhouse conditions
(390 mol/m2/s, 16 h day/8 h night at 24/20 C). Plants
can be grown on Ebb-Flo benches and watered once a day
with fertilized water containing 50 ppm N (Peters Professional
20-10-20 General Purpose is used as the water soluble
fertilizer).
2. Transfer the established plants to 6 in. (1 gal) pots filled with
Metro Mix 350 soil and grow them under greenhouse conditions (390 mol/m2/s, 16 h day/8 h night at 24/20 C).
3. For seed production, the plants need to be vernalized.
Vernalization can be carried out by transferring the plants to
the field in the autumn. However, growing transgenic plants in
the field needs to be approved by regulatory agencies (e.g.,
USDA permit).
4. Alternatively, transgenic plants can be vernalized in a cold
room or growth chamber [9]. The vernalization scheme
involves gradual changes of temperature and day length: (1)
after transferring greenhouse-grown plants to a cold room
(31 mol/m2/s), reduce temperature to 18 C and day length
to 12 h light and let the plants adapt for 3 days; (2) reduce
temperature to 12 C and day length to 10 h and let the plants
adapt for 3 days; (3) reduce temperature to 6 C and day
length to 8 h and vernalize the plants for 12 weeks; (4) increase
temperature to 12 C and day length to 10 h and grow the
plants for 3 days; (5) increase temperature to 18 C and day
371
length to 12 h and grow the plants for 3 days; and (6) transfer
the vernalized plants back to the greenhouse (390 mol/m2/s,
16 h day/8 h night at 24/20 C).
5. After vernalization, plants normally flower in about 2 months
(Fig. 1h). Because tall fescue is an outcrossing species, crosses
need to be made between independent plants (e.g., transgenic
and non-transgenic plants) in order to obtain seeds. For crosspollination, emasculate recipient inflorescence and then bag
them together with two panicles from the pollen donor plant;
supply water to the donor panicles from a 50 mL conical tube
fixed to a bamboo stake [10]. Seeds can be harvested 1 month
after cross-pollination.
Notes
1. Transformation efficiency varies with the cultivar used. By
using this protocol, we have been able to produce transgenic
plants from another widely used cultivar, Kentucky-31.
Endophyte-free seeds should be used.
2. We have been able to produce transgenic tall fescue with either
EHA105 or LBA4404 strain.
3. If the seeds are dirty, the first sterilization time can be extended
to 2.5 h or even 3 h. Make sure all seeds have good contact
with the solution.
4. The majority of seed bracts (lemma and palea) surrounding
caryopsis become detached after the second sterilization. The
surface sterilization procedure will not remove the endophyte
in the seeds. If the seeds contain an endophyte, then the endophyte should be removed by treatment with high humidity and
relatively high temperature. Older seeds contain less viable
endophyte.
5. The amount of callus pieces on each filter paper was equivalent
to approximately 20 original intact calli.
6. Before transfer to soil, rinse the roots with water or remove
excessive medium with a damp paper towel.
References
1. Sleper DA, West CP (1996) Tall fescue. In: Moser
LE, Buxton DR, Casler MD (eds) Cool-season
forage grasses. Madison, WI: American Society
of Agronomy; Crop Science Society of America;
Soil Science Society of America, pp 471502
2. Sleper DA, Buckner RC (1995) The fescues.
In: Barnes RF, Miller DA, Nelson CJ, Heath
ME (eds) Forages. Iowa State University Press,

Ames, IA, pp 345356
3. Stadelmann FJ, Kolliker R, Boller B,
Spangenberg G, Nosberger J (1999) Field performance of cell suspension-derived tall fescue
regenerants and their half-sib families. Crop Sci
39:375381
372
4. Wang Z-Y, Ge Y (2006) Recent advances in

genetic transformation of forage and turf
grasses. In Vitro Cell Dev Biol Plant 42:118
5. Spangenberg G, Wang Z-Y, Potrykus I (1998)
Biotechnology in forage and turf grass improvement. Springer, Berlin
6. Wang Z-Y, Ge Y (2005) Agrobacteriummediated high efficiency transformation of tall
fescue (Festuca arundinacea Schreb.). J Plant
Physiol 162:103113
7. Bettany AJE, Dalton SJ, Timms E, Manderyck
B, Dhanoa MS, Morris P (2003) Agrobacterium
tumefaciens-mediated
transformation
of
Festuca arundinacea (Schreb.) and Lolium
multiflorum (Lam.). Plant Cell Rep 21:

437444
8. Bouton JH, Duncan RR, Gates RN, Hoveland
CS, Wood DT (1997) Registration of Jesup
tall fescue. Crop Sci 37:10111012
9. Wang Z-Y, Bell J, Scott M (2003) A vernalization
protocol for obtaining progenies from regenerated and transgenic tall fescue (Festuca arundinacea Schreb.) plants. Plant Breed 122:536538
10. Wang Z-Y, Ge Y, Scott M, Spangenberg G
(2004) Viability and longevity of pollen from
transgenic and non-transgenic tall fescue
(Festuca arundinacea) (Poaceae) plants. Am J
Bot 91:523530
INDEX
overview......................................................................34
seed source ......................................................................5
seed sterilization and germination ..................................6
selection ......................................................................79
shoot isolation ................................................................9
A
Ananas comosus (L.) Merr. See Pineapple
Apricot
Agrobacterium
preparation............................................................ 115
strains and vectors ................................................. 112
coculture and washing ................................................116
donor plants ........................................................114115
efficiencies ..................................................................112
kanamycin........................................................... 113, 116
materials .............................................................112114
overview..............................................................111112
pBIN19 ...................................................................... 112
transgenic plants
acclimatization ......................................................117
elongation and multiplication ...............................116
regeneration .......................................................... 116
rooting ..................................................................116
B
Blueberry
bacterial strains and binary vector...............................123
bialaphos .....................................................................123
culture media and stock solutions .......................123124
greenhouse care...........................................................128
infection and cocultivation.................................. 125126
kanamycin................................................... 122, 124, 127
leaf explant preparation ..............................................125
overview..............................................................121123
regrowth .....................................................................127
rooting ................................................................127128
selection and regeneration ..........................................127
stock culture establishment .........................................125
Brassica rapa
Agrobacterium
culture ...................................................................5, 6
preparation............................................................67
culture media ..............................................................4, 5
efficiency.........................................................................4
explant isolation, inoculation,
and cocultivation ...........................................7
gentamicin selection ...................................................79
greenhouse care...............................................................9
materials .....................................................................46
C
Cannabis sativa L. See Hemp
Carrot
Agrobacterium
cultures ....................................................... 60, 6263
strains and binary vectors ........................................60
herbicide resistant .........................................................60
materials .................................................................6062
overview..................................................................5960
pCAMBIA1300 ..................................................... 60, 63
seed sterilization and tissue preparation........................62
transformation procedure .......................................6364
transformation rate ........................................... 59, 63, 65
Cassava
Agrobacterium
inoculum preparation .............................................. 75
strains and culture media ........................................73
antibiotics selection......................................69, 72, 76-77
axillary buds enlargement and somatic embryos
development..........................................7375
cassava tissue culture media ..........................................71
efficiency....................................................................... 69
friable, embryogenic callus (FEC) ................... 68, 69, 71,
72, 74, 76, 77, 79
generation of ...........................................................75
materials .................................................................6973
overview..................................................................6769
transformation procedure
cocultivation............................................................76
recovery and maturation .........................................76
regeneration ......................................................7677
rooting and screening..............................................77
transfer to soil and glasshouse care ...................7778
Castanea dentata (Marsh) Borkh. See Chestnut, American
Castanea sativa. See Chestnut, European
Cherry
bacterial strains and binary vector...............................134
culture medium and stock solutions....................134136
greenhouse care...........................................................140
DOI 10.1007/978-1-4939-1658-0, Springer Science+Business Media New York 2015
373
AGROBACTERIUM PROTOCOLS
374 Index
Cherry (cont.)
infection and co-cultivation ........................................138
kanamycin selection .................................... 134, 139, 140
leaf explant preparation ......................................137138
overview..............................................................133134
plant materials ............................................................134
regrowth .....................................................................139
rooting ........................................................................ 139
stock culture establishment
using bud woods with dormant leaf
buds ..................................................136137
using newly formed softwood branches ................136
Chestnut, American
Agrobacterium
preparation....................................................152153
strains and vectors .................................................151
bar gene selection........................................................156
bioreactor ............................................ 146, 148, 150, 153
desiccation .................................................. 146, 148, 153
efficiency............................................................. 143, 157
materials .............................................................148151
overview..............................................................143148
paromomycin selection ....................... 150, 153154, 156
rooting and acclimatization ................................154155
shoot culture ...............................................................154
somatic embryos
establishment ................................................151152
transformation ..............................................153154
Chestnut, European
Agrobacterium-mediated transformation
efficiency ............................................... 165, 172, 175
infection and cocultivation............................171172
kanamycin selection ...................... 166, 168, 172, 175
materials .......................................................165169
overview ........................................................163165
plantlet regeneration .............................................173
preparation for infection .......................................171
somatic embryogenesis induction .................169171
somatic embryos proliferation
and maintenance .......................................171
strain and vector ...........................................165166
forest biotechnology ........................................... 163165
thaumatin-like protein ................................ 164166, 174
Citrus
juvenile tissue transformation
Agrobacterium culture preparation .........................250
Agrobacterium strain and plasmid ..........................247
co-incubation ........................................................ 251
efficiency ...............................................................254
green fluorescent protein detection ....................... 251
materials .......................................................246248
micro-grafting ..............................................252254
overview ........................................................245246
pBI121 ..................................................................247
plant materials preparation ...........................248250
transgene detection by PCR .........................251252
mature tissue transformation
Agrobacterium strain and plasmid ..........................262
co-cultivation ........................................ 261, 269270
efficiency ...............................................................262
explant materials preparation ........................269270
fertilizer application ..............................................266
Green fluorescent protein (GFP)
detection ..................................................271
histochemical GUS assay ..........................................270
kanamycin resistance gene ....................................262
materials .......................................................262265
overview ........................................................259262
pesticide application .............................................266
primary micro-grafting ................................. 267, 268
rootstock production for bud grafting...................265
secondary grafting.........................................267269
selection of transgenic shoots........................270271
transplanting .................................................265266
transgenic shoots harvest ......................................270
Coffea arabica L. See Coffee
Coffee
Agrobacterium rhizogenes-mediated transformation
A. rhizogenes strains and transformation
vectors .......................................................281
culture media ........................................................281
molecular analysis ......................................... 287288
overview ........................................................ 275279
plant materials ......................................................281
seed sterilization and zygotic embryo
germination...............................................285
transformation and hairy root
induction ...........................................285287
Agrobacterium tumefaciens-mediated transformation
A. tumefaciens culture preparation .................282283
callus culture preparation ......................................282
culture media and stock solutions .................279280
infection and cocultivation....................................283
leaf explant sterilization ........................................282
materials .......................................................279281
molecular analysis .................................................285
overview ........................................................277278
selection and regeneration ............................283284
strains and transformation vectors ........................ 279
breeding ..............................................................276278
economic importance.......................................... 275, 276
genertic engineering applications ....................... 276, 278
pBIN19 and pMDC32............................... 279, 283, 288
species .................................................................276279
375
Index
Colocasia esculenta (L.) Schott. See Taro
Cotton
Agrobacterium-mediated transformation
aseptic seed germination .........................................17
cotton tissue culture ................................................16
bacterial inoculant preparation................................ 17
efficiency ..................................................... 14, 19, 21
explant inoculation and cocultivation .....................17
kanamycin resistance test ........................................ 18
materials ...........................................................1516
media ................................................................1516
overview ............................................................1115
regeneration, embryo germination, and plantlet
development................................................18
selection and proliferation.......................................18
soil transfer .............................................................18
transformation ........................................................17
genetic engineering application ....................................12
green fluorescent protein reporter .................................13
Cucumis melo L. See Melon
D
Daucus carota L. See Carrot
E
Euphorbia pulcherrima Willd. ex Klotzsch. See Poinsettia
F
Festuca arundinacea Schreb. See Tall fescue
Fragaria x ananassa. See Strawberry
G
Gossypium hirsutum L. See Cotton
Grapevine
Agrobacterium rhizogenes-mediated hairy root transformation
Agrobacterium preparation and
inoculation ........................................188189
calli and hairy root recovery ..................................189
in vitro plantlets production and
inoculation ................................................188
Agrobacterium tumefaciens-mediated plant transformation
cocultivation.......................................................... 186
embryogenic culture initiation and
maintenance ......................................185186
kanamycin selection ...................................... 186-187
selection and regeneration ............................186187
transplanting and greenhouse
care....................................................187188
materials .............................................................181185
overview..............................................................177181
H
Helianthus annuus. See Sunflower
Hemp
Agrobacterium culture conditions ................ 321322, 324
Agrobacterium strains and binary vectors. .................... 321
inoculation and cocultivation .............................. 322, 324
mannose selection ............................... 320, 322, 326, 328
materials .............................................................320323
overview..............................................................319320
phosphomannose isomerase assay ....................... 325326
phosphomannose isomerase
selection .................................... 320, 324325
pNOV3635 ......................................... 321, 324, 325, 328
polymerase chain reaction ................................... 326327
Southern hybridization ....................................... 323, 327
tissue culture ....................................... 320321, 323324
transformation frequency ............................................320
J
Jatropha
Agrobacterium culture for infection ...............................30
culture media and stock solutions
for Agrobacterium ..................................................... 30
for plant ..................................................................29
efficiency........................................................... 26, 33, 34
infection, cocultivation and regeneration ......................31
kanamycin resistance ..............................................31, 33
materials .................................................................2630
overview..................................................................2526
plant materials ..............................................................26
root induction and acclimatization ...............................31
seed sterilization and explant preparation ..................... 30
transgenic plants
genomic DNA isolation and PCR analysis ...........3233
GUS histochemical assay ........................................32
Jatropha curcas L. See Jatropha
Juglans. See Walnut
M
Manihot esculenta Crantz. See Cassava
Melon
Agrobacterium
preparation............................................................201
strain and vector ...................................................196
donor plants preparation .....................................198199
efficiency............................................................. 196, 201
explant preparation ..................................................... 200
kanamycin selection ............................................ 196, 201
materials .............................................................196198
overview..............................................................195196
pIG121-Hm ....................................................... 196, 201
376 Index
Melon (cont.)
transformation procedures
Agrobacterium inoculation ..................................... 201
regeneration .................................................. 201202
selection ........................................................ 201202
transplanting and acclimation ...............................202
O
Oncidium. See Orchid
Orchid
Agrobacterium preparation ...........................................340
bacterial strain and DNA construct ............................335
culture media ......................................................332335
hygromycin selection .......................................... 333, 344
materials .............................................................332337
overview..............................................................331332
pCAMBIA1304 ................................................. 335, 340
plant materials ............................................................ 332
protocorm-like bodies (PLBs)
initiation for Oncidium ........................................337
initiation for Phalaenopsis ............................337338
propagation ...........................................................339
transformation process
Agro-infiltration and co-cultivation .....................340
regeneration and conversion .........................340341
selection ................................................................340
transgenic plant analysis
genomic DNA isolation ................................341342
histochemical GUS staining .................................344
PCR amplification ................................................342
reverse transcription-PCR ............................343344
RNA extraction ....................................................343
Southern blotting..................................................342
P
Peach
Agrobacterium
preparation............................................................211
strain and binary vector ........................................207
efficiency............................................................. 206, 213
GF677 rootstock ................................................ 206, 207
kanamycin selection ............................ 206, 207, 211212
materials .............................................................207209
meristematic bulks initiation and
regeneration ......................................209210
overview..............................................................205207
pBIN19 .............................................................. 207, 211
plant acclimatization...........................................211212
plant tissue infection ...................................................211
regeneration and selection .................................. 211212
Phalaenopsis. See Orchid
Pineapple
Agrobacterium
culture maintenance .............................................. 300
vectors and strains .................................................298
explants
establishment and maintenance ............................300
regeneration ..........................................................300
frequency ....................................................................294
histochemical GUS assay............................................302
hygromycin selection .................................. 298, 301302
inoculation and co-cultivation ....................................300
materials .............................................................298299
molecular analysis
by PCR .................................................................303
by Southern hybridization ....................................303
overview..............................................................293297
pCAMBIA1304 ......................................... 294, 298, 303
selected transformants multiplication .........................302
transformants selection
after encapsulation in Ca-alginate beads .........301302
prior to encapsulation ...........................................301
Poinsettia
Agrobacterium
culture preparation ........................................351352
DNA introduction by electroporation ..................351
strain and vector ...........................................348349
explant preparation .....................................................352
frequency .................................................................... 348
infection and co-cultivation ................................352353
materials .............................................................348351
neomycin phosphotransferase (npt II) ........................ 349
overview..............................................................347348
transgenic plants
propagation/greenhouse cultivation ..............353354
regeneration ..................................................352353
Populus trichocarpa
Agrobacterium
culture preparation ................................................361
strains and vectors .........................................358359
callus induction and shoot regeneration .....................362
frequency ....................................................................358
inoculation and co-cultivation ............................361362
materials ............................................................. 358361
overview..............................................................357358
pBI121........................................................................358
plant materials ............................................................358
rooting and propagation ............................................. 362
Potato
Agrobacterium
preparation..............................................................92
strain and binary vector ..........................................87
culture media and stock solutions ...........................8789
explant preparation, inoculation and cocultivation.......9293
frequency ......................................................................86
in vitro plant propagation .......................................9192
materials .................................................................8791
overview..................................................................8586
pBI121.............................................................. 86, 87, 95
plant material ................................................................87
377
Index
transgenic plants
callus selection and shoot induction........................93
DNA extraction and PCR analysis .........................94
greenhouse care.................................................9394
GUS histochemical analysis....................................94
shoot elongation and root induction .......................93
transplanting and acclimation .................................93
Prunus armeniaca L. See Apricot
Prunus persica L. See Peach
Prunus spp. See Cherry
S
Saccharum spp. Hybrids. See Sugarcane
Sesame
Agrobacterium
inoculum preparation ........................................4041
strains and selectable markers .................................39
cocultivation ...........................................................40, 41
culture media ..........................................................3940
efficiency.................................................................38, 44
explant preparation .......................................................40
materials .................................................................3840
overview..................................................................3738
pCAMBIA2301 ...........................................................39
transgenic plants
hardening and acclimatization ................................42
rooting ....................................................................42
screening using histochemical GUS
analysis ..................................................4243
shoot regeneration and selection .......................4142
Sesamum indicum L. See Sesame
Solanum tuberosum L. See Potato
Strawberry
Agrobacterium preparation ...................................222223
efficiency............................................................. 219, 225
infection.............................................................. 222223
leaf tissue preparation .................................................222
materials .............................................................219222
overview..............................................................217219
pBI121........................................................................ 219
regeneration and selection ..................................223224
rooting and soil transplantation ..........................224225
Sugarcane
Agrobacterium
culture preparation ........................................312313
strain and vector ...................................................308
callus induction ...........................................................312
efficiency............................................................. 308, 314
geneticin/paromomycin selection ...................... 309310,
313, 314
inoculation and co-cultivation ....................................313
materials .............................................................308311
neomycin phosphotransferase (npt II) ........................308
overview..............................................................307308
recovery, selection and regeneration ............................313

timeline...............................................................311312
transplanting and greenhouse care ..............................314
Sunflower
Agrobacterium
culture .....................................................................50
strain and plasmid ...................................................48
cocultivation .................................................................51
efficiency.......................................................................48
explant culture media ..............................................4950
explant preparation .......................................................50
kanamycin selection ................................................ 48, 52
materials .................................................................4850
overview..................................................................4748
seed disinfection ...........................................................50
transgenic plants
flowering and T1 seed harvesting .....................5354
grafting .............................................................5253
greenhouse acclimaization and transfer
to soil ....................................................5253
molecular analysis ...................................................54
selection and regeneration ......................................52
T
Tall fescue
Agrobacterium
culture media ........................................................366
preparation............................................................368
strain and selectable marker ..................................366
greenhouse care, vernalization and seed
harvest...............................................370371
hygromycin selection .......................................... 366, 370
inoculation and cocultivation ..............................368370
materials .............................................................366368
overview..............................................................365366
pCAMBIA 1305.1 .....................................................366
sterilization and callus induction ................................368
tissue culture .......................................................366368
transformation frequency ............................................366
Taro
Agrobacterium
culture preparation ................................................103
strains and vector ..................................................101
culture media and stock solutions ......................... 99100
efficiency................................................................. 98, 99
infection and cocultivation..........................................103
in vitro plantlets establishment ...........................101103
neomycin phosphotransferase II (npt II) .................... 101
overview..................................................................9799
pBI121........................................................................ 101
plant material ................................................................99
transgenic plants
selection and regeneration ....................................104
transplanting .........................................................105
378 Index
V
Vaccinium corymbosum L. See Blueberry
Vigna unguiculata (L.) Walp. See Cowpea
Vitis vinifera L. See Grapevine
W
Walnut
Agrobacterium
preparation....................................................234235
transformation vectors and strains ........................231
cocultivation .......................................................235236
efficiency..................................................................... 231
germination and plant production ......................237238
histochemical GUS analysis .......................................236
kanamycin/hygromycin selection ................................236
materials .............................................................231233
media and stock solutions ...................................231233
overview..............................................................229231
PCR confirmation ......................................................237
selection ......................................................................236
somatic embryo culture ....................................... 230, 234

Agrobacterium Protocols

Uploaded by

Document Information

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Agrobacterium Protocols

Uploaded by

Copyright:

Available Formats

Methods in

Molecular Biology 1224

Kan Wang Editor

For further volumes:

6 Carrot (Daucus carota L.) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

NUTS AND FRUITS

10 Apricot (Prunus armeniaca L.) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

20 Citrus Transformation Using Juvenile Tissue Explants. . . . . . . . . . . . . . . . . . .

OTHER IMPORTANT PLANTS

25 Hemp (Cannabis sativa L.). . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

27 Poinsettia (Euphorbia pulcherrima Willd. ex Klotzsch). . . . . . . . . . . . . . . . . . .

ALEJANDRO S. ESCANDN Instituto de Gentica Ewald A. Favret, Instituto Nacional

MARISA LPEZ BILBAO Instituto de Biotecnologa, Instituto Nacional de Tecnologa

Tom Lawrenson et al.

the John Innes Centre (http://revgenuk.jic.ac.uk). In the current

1. Vitamins: 10 g/L thiamine-HCl, 1 g/L pyridoxine, 1 g/L

AgNO3 (200 L of the 20 mg/L AgNO3 stock), 10 mg/L

R-o-18 is an inbred line of the Brassica rapa subsp. trilocularis

Tom Lawrenson et al.

2.4 Other Supplies

1. Sterilizing solution: 15 % sodium hypochlorite (BDH

1. Seeds are sterilized by immersion in 70 % ethanol for 2 min

1. Agrobacterium strain AGL1 is transformed by electroporation

5. Twenty-four hours after inoculation with standard inoculum,

1. Cotyledonary petioles are isolated from 4-day-old seedlings.

after a further 1014 days (maximum). There is a gradual

1. Plants are transferred to soil in 9 cm pots (John Innes No. 2)

Tom Lawrenson et al.

4. Rana D, van den Boogaart T, ONeill C,

Keerti S. Rathore et al.

either as seed or as meal following the extraction of edible oil.

Cotton (Gossypium hirsutum L.)

Keerti S. Rathore et al.

Agrobacterium under conditions that were found to be optimal for

Cotton (Gossypium hirsutum L.)

obtain plants following transformation. Problems are encountered

1. YEP: 10 g/L Bacto peptone, 5 g/L NaCl, 10 g/L Bacto

Keerti S. Rathore et al.

4. AB salts stock (20): 20 g/L NH4Cl, 6 g/L MgSO4 7H2O,

1. Cotton seeds (Gossypium hirsutum L., cv. Coker 312).

Cotton (Gossypium hirsutum L.)

1. Streak the Agrobacterium tumefaciens strain, harboring a

3.2 Aseptic Seed

1. Rinse 50 fuzzy cottonseeds under running tap water

Keerti S. Rathore et al.

1. Carefully excise individual calli, representing individual transgenic

1. After one or two subcultures on P7-c4k50, transfer the callus

1. Transfer plants to Sunshine LP5 soil mix (steam-sterilized) in

Cotton (Gossypium hirsutum L.)

Keerti S. Rathore et al.

8. In our earlier protocol [7, 19], we were selecting lines that

Cotton (Gossypium hirsutum L.)

until flowering and then with 8-45-14 NPK mix (Peters

Keerti S. Rathore et al.

11. Bayley C, Trolinder N, Ray C et al (1992)

Cotton (Gossypium hirsutum L.)

transgenic sugar, tuber and fiber crops. Wiley,

Devendra Kumar Maravi et al.

humid conditions encounters devastation by insects [46] and

Seeds of an elite accession of Jatropha curcas, IITGJC-19, were

Agrobacterium tumefaciens strain EHA105 harboring the binary

Jatropha (Jatropha curcas L.)

Co-cultivate explants on liquid co-cultivation medium containing

Wash the explants with sterile distilled water containing