International Journal of Environment, Ecology,

Family and Urban Studies (IJEEFUS)

ISSN(P): 2250-0065; ISSN(E): 2321-0109
Vol. 6, Issue 4, Aug 2016, 1-8
TJPRC Pvt. Ltd.

MORPHOLOGICAL AND MOLECULAR CHARACTERIZATION OF PYTHIUM

APHANIDERMATUM THE INCITANT OF RHIZOME ROT IN TURMERIC
RAJALAKSHMI J, DURGADEVI D, HARISH S & RAGUCHANDER T
Department of Plant Pathology, Centre for Plant Protection and Studies,
Tamil Nadu Agricultural University, Coimbatore, Tami Nadu, India
ABSTRACT
Rhizome rot, caused by Pythium aphanidermatum is one of the most serious disease resulting a significant
yield loss in turmeric every year. However, the incidence and severity of the disease differ from one location to other, one
geographical area to other and even differs from country and region wise. The reasons for this disease severity have been
attributed to the variation in host genotype, virulence of the pathogen, prevalence of congenial soil physico-chemical and
plants surrounding environment and cultural practices. In this study, ten isolates of Pythium were collected from
Coimbatore and Erode districs of Tamil Nadu. Pathogenecity test revealed that all the isolates were virulent with
different level of resistance on cultivar at stage in the green house. Ten isolates of Pythium aphanidermatum has been
characterized on the basis of colony diameter, cultural and morphological characters. Cultural and morphological

primer with ITS 2 rDNA internal transcribed spacers has been used to develop an accurate identification of the species
on turmeric.
KEYWORDS: Rhizome Rot, Turmeric, Pythium Aphanidermatum

Original Article

characteristics revealed considerable diversity among the Pythium aphanidermatum isolates. In this study, Oomycetous

Received: Jun 04, 2016; Accepted: Jun 24, 2016; Published: Jun 29, 2016; Paper Id.: IJEEFUSAUG20161

INTRODUCTION
Turmeric (Curcuma longa L.) is a golden spice crop being cultivated in India since ancient times for its
rhizomes, and has a potential to earn foreign exchange because of its wide utilization in Ayurvedic industry.
Though it is well known for its medicinal value, its cultivation is hindered by several diseases. Turmeric is
susceptible to diseases viz., leaf blight, anthracnose and rhizome rot. Among the various diseases, rhizome rot
caused by Pythium sp. is a major constraint in all turmeric-growing areas of India (Rathiah, 1987; Nageshwar Rao,
1994; Ramarethinam and Rajagopal, 1999). It causes severe yield reduction and reduces the quality of rhizome
(Rathiah, 1982). Rhizome rot resulted in yield loss of 50% in the Erode district of Tamil Nadu.
Different species of Pythium is involved in causing rhizome rot in different parts of the country. Rhizome
rot of turmeric incited by Pythium aphanidermatum was first reported in Sri Lanka by Park (1934), later it was
reported as P. graminicoloum from the Krishna district of Andhra Pradesh by Ramakrishnan and Sowmini (1954)
and P. myriotylum from Assam by Rathiah (1982).
Understanding the disease epidemiology and host-pathogen Interaction is greatly dependent on the
knowledge of diversity of pathogen at field level as diverse population ofa pathogen have different levels of
interaction with the host under variable environmental conditions. Attempt has not been made yet to classify and
characterize the isolates of P. aphendidermatum obtained from turmeric crop on the basis of common
www.tjprc.org

editor@tjprc.org

Rajalakshmi J, Durgadevi D, Harish S & Raguchander T

morphology, and ITS sequences. Accurate identification is necessary in order to adopt effective agricultural measures as
soon as possible. Therefore molecular approaches including Polymerase Chain Reaction (PCR) has been tested to identify
Pythium spp. (Tambong et al., 2006; Klemsdal et al., 2008) as well as other plant pathogenic fungi (Langrell et al., 2011).
Species-specific molecular primers are used to detect Pythium spp. in soil and plant samples. PCR method offers a rapid,
simple and reliable alternative to conventional methods to identify common fungal isolates. The aim of this study is that
solicitation of molecular techniques to identify the P. aphanidermatum associated with rhizome rot of turmeric.

MATERIALS AND METHODS

Isolation of Pythium from Different Regions of Tamil Nadu
Survey was conducted in major turmeric growing districts viz., Coimbatore district, Erode district and Salem
district of Tamil Nadu, India, to assess the incidence of rhizome rot of turmeric based on the external symptoms.
The pathogen was isolated by tissue segment method (Rangaswami, 1958) on potato dextrose medium. Infected pseudo
stems and rhizomes were cut into small pieces (11.5 cm), surface sterilized with 0.1% mercuric chloride for 60 seconds
and washed in sterile distilled water thrice, and then placed in Petri plate containing potato dextrose agar (PDA) medium.
The hyphal tips of fungi growing from the pieces were transferred aseptically to PDA slants for maintenance of the culture.
Cultural and Morphological Variability
The cultural variability of the pathogen was studied by using Potato Dextrose Agar (PDA) medium. Six mm disc
of pure culture of each isolates was inoculated at the centre of the plates and were incubated at room temperature.
Three replications were made for each isolate. The mycelial growth was measured and colony characters were visually
observed after 18, 24 and 36 hours of incubation till the complete growth of the pathogens in Petri plates
(Yadav and Joshi, 2012). Totally ten isolates of Pythium were isolated and identified. The pathogen was identified as P.
aphanidermatum based on morphological characters as described by Middleton (1943).
Molecular Characterization of Pythium by using Oomycetes Specific Primer
Genomic DNA Extraction
For DNA isolation, the cultures were grown in potato dextrose broth (PDB; pH 5.5) for 7 days at 28 1 C in a
shaker incubator. Mycelia were filtered through filter paper (What man no.1) and DNA was extracted using the
Cetyltrimethyl Ammonium Bromide (CTAB) method (Murray and Thompson, 1980). The mycelium was ground in liquid
nitrogen, transferred to DNA extraction buffer (0.1 M Tris, 1.5 M NaCl, 0.01 M EDTA) and kept at 65 C for one hour
with occasional stirring. Equal volumes of chloroform: isoamyl alcohol (24:1) were added to all tubes, followed by
centrifugation. The upper aqueous phase obtained by precipitation with 0.6th volume of ice-cold isopropanol was again
centrifuged. The pellet was washed with 70% ethanol and dried at room temperature. Finally, the nucleic acid was
dissolved in TE buffer and stored at -20 C.
PCR Amplification
PCR analysis was performed using Oomycete ITS (Internal Transcribed Sequence) region primers to differentiate
Pythium from other closely related fungi (White et al., 1990). The PCR reaction was performed in 20 l vol,
(0.25 mM each of primer pair - 18S (5-TCC GTA GGT GAA CCT GCG G-3) and 28S (5-TCC TCC GCT TAT TGA
TAT GC-3), 0.25 mM dNTP, 1.5 mM MgCl2, 50-80 ng of template DNA, 2 U of Taq DNA polymerase and 1x PCR buffer
mix. PCR was undertaken using a Master cycler programmed for initial denaturation at 94C for 5 min, followed by 35
Impact Factor (JCC): 3.7216

NAAS Rating: 3.63

Morphological and Molecular Characterization of Pythium

Aphanidermatum the Incitant of Rhizome Rot in Turmeric

cycles of denaturation at 94C for 1 min, annealing at 68C for 1 min, and extension at 72C for 1.5 min. At the end of the
amplification reaction, a final extension step was achieved at 72C for 7 min. The PCR products were run on 1.2% agarose
gels containing 5 mg/ml of ethidium bromide in a TAE (1X) as the running solution. The electrophoretic migration was
carried out during 2 h under a 80V. The amplified products were visualized and photographed under UV light
(Nzungize et al., 2011).
Ten isolates of Pythium obtained from turmeric were identified to the species level using sequences of primer pair
Pa1 (TCCACGTGAACCGTTGAAATC)/ITS2 and other pair primer Pa3 (ATTTTTCAAACCCATTTACC)/ITS2
(White et al., 1990). The reaction mix for PCR amplification of the DNA consisted of 20 l vol, (0.25 mM each of primer
pair, 0.25 mM dNTP, 1.5 mM MgCl2, 50-80 ng of template DNA, 2 U of Taq DNA polymerase and 1x PCR buffer mix).
PCR was undertaken using a Master cycler programmed for initial denaturation at 94C for 5 min, followed by 35 cycles
consisting of denaturing at 94 0C for 30 sec, 67C (Pa1)/57 C (Pa3) annealing for 1 min, extension at 72 0C for 2 min and
with a final extension at 72 0C for 10 min. All amplified DNA products were resolved by electrophoresis on agarose gel
(1.2%) in TAE (1X) buffer, stained with ethidium bromide and photographed.

RESULTS AND DISCUSSIONS

Survey and Isolation of Turmeric Rhizome Rot
The survey of major turmeric growing agro-ecological regions of Tamil Nadu, from which diseased specimens
were collected. The disease incidence varied from 30 to 60% incidence. The pathogen responsible for causing rhizome rot
were isolated and identified as P. aphanidermatum. Pathogenicity studies on the involvement of pathogen in causing
disease were studied. It was observed that P. aphanidermatum (50%) were found to be associated with rhizome rot of
turmeric. Turmeric cultivation is very much reduced due to rhizome rot in all turmeric growing areas of Tamil Nadu.
The survey on rhizome rot reflected 20.050.0% incidence in different turmeric growing areas of Tamil Nadu
(Kavitha et al., 2012). Earlier the rhizome rot incidence was noticed to an extent of 49.9% in Erode district
(Ramarethinam and Rajagopal, 1999). However, the present study revealed the maximum disease incidence of 50% in both
Coimbatore and Erode district of Tamil Nadu, which accounts for a yield loss up to 40%. Studies on rhizome rot of
turmeric in Andhra Pradesh indicated that Pythium spp. was associated with rhizome rot (Anandam et al., 1996).
P. aphanidermatum from different locations were successfully isolated and each isolate was observed under
microscope, where in all the six isolates produced bright white fluffy mycelial growth and among the isolates no visible
differences were observed. These findings are confirmity with the isolation technique suggested by Saha et al. (2002) and
Dutta (2007).
Cultural and Morphological Variability
Morphological diversity was studied based on the phenotypic appearance of the isolates. The observations were
recorded on the basis of hyphal characteristics and several colony features of 10 isolates of Pythium were observed on PDA
medium after specific incubation period. In the present study, all the ten isolates (Py1, Py2, Py3, Py4, Py5, Py6, Py7, Py8,
Py9 and Py10) produced white fluffy, dense mycelial growth observed within 24 hours and isolates were apparently similar
(Table 1). The isolates produced similar growth except Py8 recorded maximum and fast mycelial growth, followed by Py2,
Py6, Py7 and Py10 and whereas Py4, Py3, Py5, Py9 and Py1 comparatively slow growing. The ten isolates produced
coenocytic mycelium measuring 3 to 4 m in diameter and oospores produced after seven days maximum oospores were

www.tjprc.org

editor@tjprc.org

Rajalakshmi J, Durgadevi D, Harish S & Raguchander T

recorded in isolate Py8, while in case of other isolates number of oospores per microscopic field were observed to be 4-5
oospores (Figure1a, b, c, d and e).
The studies on the cultural and morphological characters of the isolated pathogen showed its close identity with P.
aphanidermatum which was described by earlier workers (Lucas, 1975; Mehrotra and Aggrawal, 2004; Rangaswami and
Mahadevan, 2005 and Gaur and Chauhan, 2007). Pythium spp. has been identified on morphological features, particularly
those of the antheridia, oogonia and associated oospores, supplemented by the structures producing zoospore-containing
sporangia (Hashem, 2010). Prabhukarthikeyan (2015) reported that the Pythium mycelium is hyaline, ramified, non septate
and hyphae grew on the plate very fast, forming white colonies with loose and aerial mycelia.
Molecular Characterization of Pythium Aphanidermatum
PCR amplification with specific primers ITS1 and ITS2 yielded a single fragment of 210 bp (Figure 2a and 2b).
The respective gene sequences of the isolate were submitted in NCBI GenBank under accession number. Based on
sequences of the internal transcribed spacer (ITS) of the ribosomal DNA, that all ten isolates belongs to genus Pythium.
The PCR reaction allowed amplifying the fungal ITS fragments of 800 bp. It is known that the ITS fragment of Pythium is
of 800 bp (Mahuku et al., 2007). Specific PCR primers of the ITS rDNA were used to identify the Pythium species
(Klemsdal et al., 2008). Species-specific molecular primers are a powerful means for detecting P. aphanidermatum in soil
and plant samples (Alaei and Rostami, 2013). Nzungize et al., 2011 also reported that only 96 isolates of the 231 samples
had the Pythium expected specific size of ITS fragment (800 bp) and these isolates were submitted for sequencing analysis.
The ability of the booster PCR to detect P. aphanidermatum from artificially infected plants was tested. An amplified
210-bp band indicating a positive result was obtained from infected cucumber stem and root and even from plant tissue that
had not shown disease symptoms (Wang et al., 2003).

CONCLUSIONS
The soilborne Oomycete, Pythium aphanidermatum is one of the most serious threats to turmeric crops in India
(Radhakrishnan and Balasubramanian, 2009). The present study, defines the accurate identification of P. aphanidermatum
based on morphological, molecular characteristics using specific PCR primers for the DNA-mediated detection from
infected rhizomes. In our present study, totally ten isolates of Pythium were isolated from major turmeric growing areas of
Tamil Nadu viz., Erode and Coimbatore. In the same way, Kavitha et al. (2012) reported that rhizome rot of turmeric
caused by P. aphanidermatum. They isolated Pythium spp. from the infected rhizomes obtained from major turmeric
growing areas of Tamil Nadu. Hence, this technique can be useful tools for detection and diagnosis of P. aphanidermatum
in early stages of infection and help to reduce losses caused by this pathogen.

ACKNOWLEDGEMENT
The authors wish to acknowledge the Department of Science and Technology (DST), New Delhi, India for their
financial support.
REFERENCES
1.

Alaei, H., & Rostami, F. (2013). Identification of cucumber damping-off based on morphological and molecular
characterizations in Rafsanjan. Iran. J. Plant. Path., 48, 177-182

2.

Anandam, R.J., Sudhakara Rao, A. & Vinod Babu, K. (1996). Studies on rhizome rot of turmeric. Ind. Cocoa, Arecanut Spices

Impact Factor (JCC): 3.7216

NAAS Rating: 3.63

Morphological and Molecular Characterization of Pythium

Aphanidermatum the Incitant of Rhizome Rot in Turmeric

J., 20, 1720

3.

Dutta, S. (2007). Evaluation of botanicals against damping-off (Pythium aphanidermatum) of tobacco (Unpulished M. Sc.
(Ag.) Thesis). Anand Agricultural University, Anand

4.

Gaur, S., & Chauhan, S.V.S. (2007). Seasonal diversity of Pythium at Yamuna river Agra, India. J. Mycol. Pl. Pathol., 37, 3739

5.

Hashem, A.S. (2010). Two pathogenic species of Pythium: P. aphanidermatum and P. diclinum from a wheat field. Saudi J.
Biol. Sci., 17, 347352

6.

Kavitha, K., Nakkeeran, S., and Chandrasekar, G. (2012). Rhizobacterial-mediated induction of defense enzymes to enhance
the resistance of turmeric (Curcuma longa L.) to Pythium aphanidermatum causing rhizome rot. Archives of Phytopathology
and Plant Protection, 45, 199-219

7.

Klemsdal, S.S., Herrero, M.L., Wanner, L.A., Lund, G., & Hermansen, A. (2008). PCR based identification of Pythium spp.
causing cavity spot in carrots and sensitive detection in soil samples. Plant Pathol., 57, 877-886

8.

Lucas, G.B., (1975). Disease of tobacco. North Carolina State University, Raleigh, North Carolina.

9.

Mahuku, G., Navia, M., & Buruchara, R. (2007). Development of PCR markers tightly linked to Pyult1, a gene that confers
Pythium root rot resistance in the common bean genotype and1062. Phytopathol., 97, 69-79

10. Mehrotra, R.S., & Aggrawal, A. (2004). Rots, damping-off, downy mildews and white rusts. Tata McGraw-Hill Publishing
Company Limited, New Delhi. pp 312-368.
11. Middleton, J.T., (1943). The taxonomy, host range and geographic description of the genus Pythium. Mem. Torrey Bot. Club,
20, 140
12. Murray, M.G., & Thompson, W.F. (1980). Rapid isolation of high molecular weight plant DNA. Nucleic Acids Research, 8,
4321-4326
13. Nageshwara Rao, T.G. (1994). Turmeric rhizome rot and its management. Spice India, 7, 1719.
14. Nzungize, J., Gepts, P., Buruchara, R., Buah, S., Ragama, P., Busogoro, J.P., & Baudoin, J.P. (2011). Pathogenic and
molecular characterization of Pythium species inducing root rot symptoms of common bean in Rwanda. African Journal of
Microbiology Research, 5, 1169-1181
15. Park, M. (1934). Report on the work of mycology division. Adm. Rept. Dir. Agric., pp. 126-133
16. Prabhukarthikeyan, S.R. (2015). Understanding the mechanism of bioprotection in Curcuma longa L. using Pseudomonas
fluorescens against Pythium aphanidermatum by tripartite interaction (Unpublished doctoral thesis). Tamil Nadu Agricultural
University, Coimbatore -03, pp-89
17. Radhakrishnan, N., & Balasubramanian, R. (2009). Salicylic acid induced defence responses in Curcuma longa (L.) against
Pythium aphanidermatum infection. Crop Protection, 28, 974-979
18. Ramakrishnan, T.S., & Sowmini, C.K. (1954). Rhizome rot and root rot of turmeric caused by Pythium graminicolum. Indian
Phytopath., 7, 152159
19. Ramarethinam, S., & Rajagopal, B. (1999). E cacy of Trichoderma spp. organic amendments and seed dressing fungicides on
rhizome rot of turmeric. Pestology, 13, 2130
20. Rangaswami, G. (1958). An agar blocks technique for isolating soil micro organisms with special reference to Pythiaceous
fungi. Sci. Culture, 24, 85
www.tjprc.org

editor@tjprc.org

Rajalakshmi J, Durgadevi D, Harish S & Raguchander T

21. Rangaswami, G., & Mahadevan, A. (2005). Diseases of vegetables. Prentice-Hall of Indian Pvt. Ltd. Pp. 286-358.
22. Rathaiah, Y. (1982). Rhizome rot of turmeric. Indian Phytopathol., 35, 415-417
23. Rathiah, Y. (1987). Control of soft rot of ginger with Ridomil. Pesticides, 21, 2930
24. Saha, G., Maity, S.S., & Khatua, D.C. (2002). Technique for isolation of Pythium aphanidermatum from soil and laboratory
evaluation of fungitoxcants against it. J. Mycopathol. Res., 40, 145-147
25. Stephen, R., Langrell, H., Morel, O., & Robin, C. (2011). Touchdown nested multiplex PCR detection of Phytopthora
cinnamomi and P. cambivora from French and English chestnut grove soils. Fungal Biology, 115, 672-82
26. Tambong, J. T., de Cock, A. W. A. M., Tinker, N. A., & Levesque, C. A. (2006). Oligonucleotide Array for Identification and
Detection of Pythium Species. Appl. Environ. Microbiol., 72, 2691-2706
27. Wang, P.H., Wang, Y.T., & White, J.G. (2003). Species-specific PCR primers for Pythium developed from ribosomal ITS1
region. Letters in Applied Microbiology, 37, 127-132
28. White, T.J., Bruns, T., Lee, S., & Taylor, J. (1990). Amplification and direct sequencing of fungal ribosomal RNA genes for
phylogenetics. San Diego: Academic Press. pp. 315322.
29. Yadav, D.L., & Joshi, K.R. (2012). Cultural, morphological, pathogenic and biochemical variability in isolates of Pythium
aphanidermatum, incitant of damping-off in bidi tobacco. Indian phytopath., 65, 386-390

APPENDICES
Table 1: Radial Growth and Cultural Characteristics of Pythium Isolates
Isolates

Average Radial
Growth (cm)
24 hours
36 hours

Py1

5.9

9.0

Py2

6.5

9.0

Py3

6.0

9.0

Py4

6.2

9.0

Py5

6.0

9.0

Py6

6.5

9.0

Py7

6.5

9.0

Py8

7.0

9.0

Py9

6.0

9.0

Py10

6.5

9.0

Impact Factor (JCC): 3.7216

Cultural Characteristics
Moderate, dull white with sparse growth
and smooth margin
Rapid, whitish with slightly raised growth
with smooth margin
Moderate growth with whitish sparse
growth
Moderate growth, dull white with aerial
flat mycelium
Moderate with whitish raised fluffy growth
and smooth margin
Rapid, whitish aerial fluffy growth with
smooth
Rapid growth with dull white and flat
mycelial growth
Rapid with whitish raised fluffy growth
and smooth margin
Rapid with whitish medium fluffy growth
Rapid growth along with raised fluffy
growth

Oospore
Formation
+
+
+
+
+
+

NAAS Rating: 3.63

Morphological and Molecular Characterization of Pythium

Aphanidermatum the Incitant of Rhizome Rot in Turmeric

a. Pure Culture Pathogen; b. Mycelium Hyaline and Aseptate; c. Oogonium Formation; d. and e. Oospore Formation
Figure 1: Morphological Charactertistics of Pythium Aphanidermatum

Lane1 100bp ladder; Lane 2-Lane9 Py1 to Py8

Figure 2a: PCR Based Amplification of ITS Region of Pythium Species

Lane1 100bp ladder; Lane 2-Lane11 Py1 to Py10; Lane 12 1kb ladder
Figure 2b: PCR Based Amplification of Oomycetes Primer (Pa1 and Pa3)

www.tjprc.org

editor@tjprc.org