Professional Documents
Culture Documents
Editor's Note
This document contains the postings from mostly one individual, Hector Perez Torres, collected at the
yahoo site: http://groups.yahoo.com/group/evgray/. Within are message numbers from 5,000 to 9,999,
the rest left to subsequent volumes.
Messages
#5030
Re: MRA
Including the Dumb bitch who left the door open on the way out..
Hector
#5040
Re: Kone's 3phase motor
Kone ! 3 ph PM rotor must be 2 poles 180 deg apart for 3600RPM
4 poles at 90deg for 1800 RPM .. N S , n s n s poles ..
‰
‰
‰
‰
‰
‰
‰
‰
‰
‰
‰
‰
http://groups.yahoo.com/group/EVGRAY/files/AxialKRV.jpg
Its 2 rotor poles per 3 stator coils 120 deg relation of rotor to
stator poles angle of rotation .
Hector :)
#5041
Re: Genesis
MM took interest in genesis ? use Audio Speaker alloy metal for the
Cores ... FLAT TESLA LC coil sandwitch in speaker end plates will do
fine , watch for that METAL taste in mouth ( field teleport of
metal on EM field Aether stream .. )
Hector :)
#5049
Re: Kone's 3phase motor
Based in E gray motor design its exact to your 3x3 setup exept your
set is radial configuration ....
Best Force vector will be at 90 deg within a 120deg sector.
Fix shaft use latch device measure torque at angle variations within
a fixed shaft logaritmic incremental load FP pressure ..
You can DETERMINE at What Exact angle your pulse will give best
performance from Vertical to horizontal loading, you only need to
adjust poles and rotor position relative to test rig 90 deg angle of
loading .
Hector
#5058
Re: ferroresonance
Hector:)
#5214
Re: Rotor diameters
this thing can generate by moving it with the hand ... what I need
is a manufacturer interested in this stuff and willing to put big
money on it .
Already gave Idea to Aquire Motor manufacturer and use their already
existing lines to create new stuff in days ...
But if the investors keep falling for the scams rejecting the
worckable stuff we are screwd !
Hector
#5215
Re: Rotor diameters
Errata 2 diodes one positive one negative to each segment all
negatives to common negative all positives to comon positive all
wires same lenght .. 40 phases ... rectified 9 degrees each apart
from the other = super low ripple DC doble voltage 5 amperes per
segment .. that is 360V 200A max (72,000W ) surge max (hi speed) ...
7.2KW constant rating low speed ( not Bad )
Hector
#5238
Re: [EVGRAY] ZZzZzzZzZz YAWWWNN .. !
Thank you Erick for the response. There is another factor lurking in the background
of this resonance phenomenon that has been alluded to but not developed into a
discussion item. That is , what happens to the iron core when it is driven into what
I would say is a super-saturated (magnetically) state and suddenly relaxed? Back
when we were experimenting with the MRA I did test with old magnetos to better
understand what E.V. Gray was seeing in his repulsion pulse motor. Old type
magnetos build magnetic flux in the core while the breaker points are closed
which completes a closed current path to ground. When the magnetic flux begins to
reverse in the second half of the cycle, the breaker points open causing the capacitor
across the breaker gap to suddenly discharge back through the primary windings
which causes a very rapid collapse of the magnetic flux in the core. This is where
the iron is super-saturated and there is a very unusual amount of energy that
comes out of the grounded iron core material which is the "radiant energy" that
many have been trying to generate. Give me your thoughts on this. Re-read
the "ferroresonance" reports and try to understand how the iron core material
was literally destroyed in the transformers. The core material was crushed due
to super-saturation during the resonant condition. Norm
#5279
Re: secret to OU hydrogen production is impedance matching?
"resonance and cold fusion electrolisys " the only question I have
is WHO took his prototype and killed him and were it ended ?.
Its better to give the secrets out than to die with them ...
http://www.nuenergy.org/alt/energy_amplification.htm
Hector
#5313
Re: big PM rotor
Well it does not matter how it looks what matters is that it works
as intended ... Nice BIG Coils will do well placed in proper
distance relation, as I see ROTOR central MASS adds new interesting
equation to the motor as a 12-14 inch 1/2 to 1 inch thick IRON pipe
may add to use as stator coil holder .
Hector :)
#5363
Re: RV project by Kumaran
Hector
#5441
Re: RV/Alternator Light project
The alternator side seek 3 LCs max energy near resonance with less
power input , Normal ratio of power in to Virtual LC power is 10 to
1 compared to input "minimal '
You READ AMPERE load that means the amperage of EACH LC you seek a
LOAD as filament lightbulb of SAME AMPERAGE ,,,
Sample 220 vAC 4.5454545 A ,for 1000W then in series you put a
1000W lightbulb to that LC .... as it matches LC ampere load .
first experiment with one leg then go 3 phase the reasoning here is
you are dealing with RESONANCE and your loading relation is in Phase
differences and frequency shifting parameters ,,, Dont try water
stuff unles you got 19.8VAC tip to tip in filament ,else BANG!
http://www.ibiblio.org/obp/electricCircuits/AC/index.html
This added to the Instrument you just built and the ZPE book
descripts plus posted information will permit you to test this
postulates in vitro and relate to written concepts that permits you
to twist the rules in your favor and obtain the seemingly imposible,
as this rules are aplied to the models OU becomes a byproduct of
Energy transform , the otherwise unwanted ferroresonance becomes
a source to enhance and amplify power, heat, EM ,M fields become
power sources.
100 years of waste is much more that we can permit , time to set
things strait related to power engineering and aplications ..
Try the SERIES LRC , even here you obtained 7% more power than
standard home generator and 37% energy savings . This Experiments
permits understanding of RADIANT energy and HOW to use it as to
OBTAIN OU transformation states .. If a resistor kills overunity
Circuit has to be TAILORED to be OU as LOADED ...
Keep this notes , copy & compilate as add-ons to your experiments &
notes..
God Speed and happy experimenting ! " much more to come " RV is an
R&D tool seemly primitive but is far more advance than many
university instruments now on use, it will change the way we look at
power in a verry drastic way, to use RADIANT energy you need to
create it,OK!, RV alternator is cheapest safest way I found you can
create it with, no $5 million university prototype or Tesla 10
million volt coils ! a safer 220 to 900VAC range using 3 PH motors
as reverse inductor "amplitrons" verify you got RF with scope ..
Nodes current and voltage related 0 to each other, 90 deg phase !
That is "RADIANT ENERGY" It makes a magnet dance in your hands as
many other still undisclosed things,,,, (partialy revealed)in here
already .. ( files sections ) Homopolar AC transformers and
others ...
Hector :)
#5445
Re: RV. light/alternator experiments continued "the toy"
You will find also that NICROME wire is useless with radiant energy
stove HEAT elements or WATER heater & stove oven ones do not work
well with this mode of energy radiation is blocked by shield
sleve .
Hector :)
#5446
Re: 1.6
Alter any you alter the nature of the electron "even transform it "
Hector
#5452
Re: resonating with caps
Hi,
Motors are inductive load. That is why in factory with many motors the
power factor goes - lets say below 70%.
--Raivo
#5453
Music and its octaves ... as colors in light ..
3 are basic 3 more are mix intermediates and
merge as a single one White ...
So is Music and energy ..
Hector
#5456
Re: resonating with caps
Hector :)
#5460
Re: mechanical switching for inverter?
#5466
Re: mechanical switching for inverter?
--- In EVGRAY@yahoogroups.com, "hamey34" <carobana@c...> wrote:
>
> Hi All,
> Thanks for the feedback I wonder how they overcame the ringing effect
> in the transformer
Hector :)
****#5501
#5486
Re: Energy 21 guy is in Australia.... Chance to RV him up .....
Other Advantage ..I am still alive and this can be taken to other
levels as is understood "230 more projects to go" ...
Some basics are understood as replications are made ,but people have
no idea were this can be taken to, 250HP motors weighting 1 pound or
less at room temperature
Hector :)
#5508
Re: Question about RV
Power Factor allways reflect as a lagging phase current you correct
it you get more power at the end were you need it ...
I have Explained this like a trillion times sinse 1980 ,one more
does not matter ...
Hector :)
#5517
Hector, I sure hope you can elaborate more on this soon, because I
can not even imagine how this is possible.
John
**************************************************************
Hector ... :)
#5531
Re: DCPMRV
Hector :)
#5540
> > I also have an 1800rpm, 12KW,3 ph, 110/208 generator head that
I
> would like to mate to an RV motor.
> **********
> Can this Generator head be wired to 460VAC? is it brush or
> brushless EM rotor ? as to make it a POWER factor Correcting EMA
> engine ... at 120VAC
> **********
For Ideas Study POWER factor Correction ... and my comments on EMA
related to the use of ROTARY condensers with RV and in RV modes ..
http://www.ibiblio.org/obp/electricCircuits/AC/AC_11.html
Hector
#5546
Re: RV test results , On that 1800 RPM generator ...
Sample you have 100 Amps at utility line .... you start your
generator as Synchronous condenser (first tests can be done at 230 )
using 2 lines ... synchronicity can be measured with 2 230
lightbulbs in series as they turn OFF you switch condenser to line
and start powering up the Rotor EM field as theory HOLDs your 100
amps will beging to drop down 20 or 30% ... that will be your power
bill savings .... From there you can go to 460VAC derating to lower
power but under EMA operation mode ....
I can design this unit to weight nothing but untill proper funding
apears we eat dung ...
Hector :)
#5565
Re: Got my RV motor going
That added to kone definition helps a bit more, from power factor
correction to EMA & ZPE this definitions contain the knowledge to
justify their workings ...
http://www.ibiblio.org/obp/electricCircuits/AC/index.html
This is one of the best info Stuffings i can find, verry helpfull
for RV & R&D stuff ... reversing some of the "Equations" &
aplications is the KEY to energy transform ....
Hector:)
#5566
You Will be more pleased if you Study the EFFECT covering the FAN had
in the RV ... This principle is the ONE REQUIRED for the THERMODINAMIC
TURBINE REACTOR Tesla Proposed 100 years AGO ....
Just ask WHY motor energy needs go down as you cover fan and HOW
the Thermodynamics LAWS can be "Raped" with it using "gravity" !
With the money and R&D institute .. you will see what I ment with this
being "toys" ... (I need to win the "war" first )but that I cant make
alone ....
Thanks !
Hector :)
#5580
Re: For Dan about 1500 and 3000rpm motor combo
The main problem is not technology its the dam corporate greed ...
It is time we all piss on them ..
Hector :)
#5582
Re: startermotor commutator in DCPMRV
PM rotor makes any MOTOR an EMA motor, Kone take a look at Raivos
Cad design ....
DARN ! how much i need the darn funds & the lab, I am tired of
eating Dung ! so much frustrating interference ! ...
Hector
#5584
Re: RV project by Kumaran
I Uploaded the + biasing conversion for it spikes & CEMF goes back to
battery for transformer operated inverters I get +.02 amps goin back
to battery from transformer "idling " if it was not for the driver
board load of .9 A this thing is WAY OU ... At resonant modes....
Hector
#5594
Re: DCPMRV goes 5000rpm
Quite specified in postings that PM RV was something else and OU out
of the box if put to work in DC pulse or as a hi impedance rotary
condenser in AC, the HP limit due to POLE slip is eliminated giving
it 50 % to 90% more power, There are many EXPIRED patents on PM
rotor designs that can be USED in conjuction with PUBLIC RV PM ROTOR
information and aplications ..
In part is because the I can do this myself and greed ... the bad
things is for a misserable toy they miss the "mother load" ...
Whoevers gets to me FIRST gets it ... (If they can get pass the
interference) thats it .
I think this bastards will not stop until they are incenerated from
the face of the earth ....
Hector :|
#5604
Re: ö
That is what I want funding for .... and this is still another
toy ...
Hector :)
#5641
Re: New file uploaded to EVGRAY
Using the 220 AC from the RV alternator LC you can bridge in DIODE
plug 480VDC or bridge mode 240 DC for a constant 5 to 10 amperes
and switch alternatively to inverter charger inverter charger as it
reaches 13.8 V (using 2 batterys, it will take a shorter time to
charge in vectored 220 DC as internal resistance is reduced
proportional to the voltage increase ...
You can initiate with bridge shorted with on switch that you
turn "OFF" to charge battery "on" .
HEHE LOL!
This is a WAY to loop RV ... not the one,I liked but is a way to do
it fast and Dangerously "cheesse" ... just design proper cuttoff
as Batterys are not designed for radiant energy (just be carefull )
loop using intermitent battery exchange ... limit to 13.8 VDC too
fast rise and your inverter silicon will go fusion-fision with the
in vitro familiar blue toxic smoke :P
Hector O_o !
#5695
Re: DCPMRV no of poles?
Once the LOWER intensity field atracts the higher intensity one (PM)
rotor the INDUCED CEMF will surpass the power required for turning
motor ... BECOMING true EMA engine ....
OU ....
Hector ;)
#5701
Re: PM rotor question
Hector
#5702
Re: PM rotor question
But quite Exact if I say EMA with PMs like Kone said is 4X more
power and RV with a properly design PM rotor is 10 X a conventional
motor in RV mode ,,,
This Motors can be produced now "cheap " , they are also produced
as "servomotors" with a few changes in its design they are made into
super EMAs .
With the proper FUNDING this can into production in no time but with
people preprogramed into a self fuck status nothing can be done.
I will opt for separation of the system .. so ash start looking for
that BIG acreage somewere because thoose RICH guys with money will
NOT have this technology & not will be welcome into any comunity
having it when shit hits the fan , (We will nuke them ) ... when the
time comes ,if they dare to interfere in our afairs ..
When the Tagging starts ,"when people are injected with the
electronic ID " the ORDERS are detect tag, kill the carrier
people giving away their souls for life and security will loose
security and ultimately will loose their lives as they become
detectable liability (intruder Bait) the mentality leading to
accept the "MARK" is the same mentality that warantee them to be
non-desirable for human progress (Automatons to be eliminated from
face of the earth ) as servants to "black dark forces" deevolving
entitys.
Time is OVERDUE to start doing things ... and time for all of us
to "dissapear" from the system I dont realy want to think is 12 or
14 family groups . I hope it can go into 150,000 before the
human "HERD" are started to be tagged like animals, here in Puerto
Rico they CREATED and Staged child kidnapings then came up with the
Child registry and tagging system as a solution ...
THE chip IS THE ANSWER TO PEOPLE ABILITY TO ADAPT AND DISTORT THE
WIRELESS MONITORING NOW IN USE ALTERING THEIR BRAIN WAVELENGSHT AND
EVOKED POTENTIAL SIGNATURE MAKING MONITORING AND CONTROL IMPOSIBLE.
Read :
Princess Petunia
4/26/2005
1:09 pm EDT
Robotized People
Has it always been the case that so many people have trouble
thinking for themselves, or is this a phenomenon of modern times? So
many people can´t figure out a problem if they can´t follow a
specific set of procedures. Abstract thought and concepts are beyond
them. People who think like this are more likely to blindly follow
an authoritarian government, as they don´t evaluate the set of rules
set before them. Those who would force their rules on others are
serving the nazis, whether they realize it or not. Truly spiritual
people are anti-authoritarian and embrace the freedom to think and
evaluate systems.
(END)
********************************
the Farther you go back in archeology the more ADVANCE items and
ruins you find, until you encounter UFOS, computers, teleportation
and time travel .. (and the same self destruct dymamics we find
now ) that caused civilization demise .
Hector
#5741
Re: ON plywood PMRV And PM Motor Multyphasic dynamotors
that is my point with the BALDOR motor , got near no rotor drag
unloaded not like the current PMAs that need to be turned with
a wrench ...
sinse you want coreless get one of this pancake motors used in GM
cars ...
Disasemble rotor & tap the 111 wired leading out of it and diode
bridge them with 222 diodes + - rotate casing install rotor
fixed ..
at 60,000 RPM will give you 10KW of power As a motor its 13.4 HP
No core .....
On Core Issues I cant believe A silicon Iron nickel core with a .03
% loss cant be better than a wire winded NUT & bolt or blacksand
Epoxy Core in a bathroom tissue cardboard center used as a mold
Its like saying A Newman motor can outperform an RV in ac ... under
load ..
An AC motor with a 96% eff must be better to Use as EMA than any
other homemade system ...
Hector
#5754
Re: off topic
you can fire 3 phases segments in pulsemode to get not 15 but 100HP
at 30,000 rpm ... "depends in laminate quality"
Still waiting for "Ambientalist" support for this ... What the heck
is happening with this peoples brains !
Hector :)
#5760
Re: On Laminates & deception ......
Hector
#5824
Re: RE effect
A pipe smaller inside a bigher pipe BUT with SAME MASS "weight per
feet "
I posted this 5 years ago in many groups and had reposted it many
times .....
The Most common issue and argument I have found is that HEY ! its a
7.5 HP motor and is reduced to 1 HP .....
Its too heavy . ( what aluminum frames and carbon fiber shafts are
for ?
LOW HP per weight ... What Hi frequency electric turbine operation
is for ... ? Weight to HP ratio increases to the square proportional
to frequency (and Q factors )
History is always full of people that resist change for the "Heck of
it" to maintain their security within an stagnant system bent toward
self destruction ..
3 and counting 5 more to go , thoose are the ones that ask for info
and are backstabbing and sabotaging every effort made to obtain
funding and resources, the ones debunking and discrediting the
technology and R&D werever and however they can.
Hector :)
#5826
Re: RE effect
That was the Thing missing from seike formulations and his Reverse
atomic reactor design and theory .
(Tested in vitro ) "no details", Bearden Knows ... But the coward
chickenned away :> Maybe afraid ETs may Phone home as papa smurf
descend from heavens to spank him ...
LOL!
Hector :)
#5830
Re: RE effect/splatter coils in RV
The mentality asociated with debunking ZPE energy R&D must be bended
back to the source and shoved hard in the same logic such minds use in
their arguments, repetitive of the old you cant do this human
stagnating retrograde mentality ..
Hector
#5831
Re: big DCPMRV scope shot
Hector
#5835
Re: RV project by Kumaran
230 VAC 1 phase use 100uF to see if it goes to 9-10 amps 226-236VAC
Use only RUN winding in ALTERNATOR 1 phase as LC ..
In one phase I tested one of theese 5KW ....
This is 7.2KW
http://www.harborfreight.com/cpi/ctaf/Displayitem.taf?
itemnumber=45416
Oh! when The Grants! OH! When the Grantt Are coming IN ! .....
http://jlnlabs.imars.com/bingofuel/html/bfr5hpgen.htm
Just think:
Hector
#5838
Re: RV project by Kumaran
I searched and it seems to have dissapeared ... so copy and keep now
an you can bet SOBs forum leeches are ready to patent it ...
Use wisely keep public dont go greedy ,dont get killed ....
3 PH resonant capactrode rotary sonofusion reactor is a reality
and is part of resonant RV LC concepts ...
But that does not mean you all cant try the capactrode concept
Hector :)
#5857
Re: "...water becomes a polymer..."
Hector
#5865
Re: Digest Number 1123
Logaritmically they are OU ,Early TRACE switchers were 150% eff but
they were Instantly removed from market as also early DEC digital
Electronics Corp voltage inverters were also OU .
Redesign the circuit and modificate to RING ... What you do with the
OU is personal issue ....
Hector :)
#5871
Re: Digest Number 1123
I think we can live with the noise .... I was being informative that
audible NOISE = OU in ferroxplana cores ...
#5894
Re: RV project by Kumaran
AMEN !
:P
#5899
Re: RV project by Kumaran
A need to Know in deep Bedini and KONE design and the term I use
that BEDINI just POWER FACTOR corrected his battery ...
Step By step the knowledge is aquired .... reason for the RV tool in
first place , learn to produce radiant energy and how it manifest in
the rotoconversion effect, impedance match in power engineering
aplications using 3rd generation technology .. (Energy saving) and
EMA R&D ...
Working with the toy makes the difference thoose things that are
aparently bothersome are the ones with the "secret" answers .
http://img.lop.com/images/glp/images/icons/flip.gif
Hector :)
#5920
Re: RV R-load tuning
Out in the net sinse 1998 (Posted in JLN ) and public sinse first
discovered in 1979 given to Energy Savers inc in 1984
as "suppressed" Energy Saving lights ...
AS .....
www.harborfreight.com/cpi/ctaf/Displayitem.taf?itemnumber=45416
http://www.ibiblio.org/obp/electricCircuits/AC/AC_11.html
#5945
Re: [for hector] biocompatible musical Spectrum frequency in Resonance
http://www.rt66.com/%7Erifetech/
http://www.rifetechnologies.com/
http://www.dogpile.com/info.dogpl/search/web/therapeutic%2Bmusical%
2Btones%2B
(Infinite )
Hector
#5969
Re: more photos of 16magRV
Kone the potential of this rotor with a Caliper core and winding
is interesting ....
Caliper can be done with salvaged transformer core "E" and "I"
plates cutt as you wish to form a close gap tolerance were the
magnet will pass and create a shorted M field path in core
as magnet passes, the open gap creates a full Hi frequency hi Q
collapse ,(in a resonant condition that will be OU) .
At hi speed the GAP creates an EMP alike spark gap in a tesla coil.
Hector :)
This Inherited From NEWMAN and BEDINI work .... their statements
Cores were bad .... were in fact is cores give you POWER ....
Hector :)
#5986
Re: 12 Volt Fluorescent Lamp Drivers
:)
#6046
Re: Hitlers Flying Saucers-A Guide to German Flying Discs of the Second World War
A few mile from us there are people that dont know even fire ....
Primitives in comparison to us ...
A few miles from Us there are people that travel in time and
interdimensionaly with life spans of 10,000 years , own UFOs
and interplanetary ships as we own cars, boats or planes ....
Hector :)
#6047
Re: Hector and Shareware
3 phase is usualy 230/460 120V rare ? only certain military
equipment used 120VAC 3Phase 47 to 450 CPS ...
Hector :)
#6061
Re: RV-Mullergen progress
a multy phase bridge array and you can parallel all thoose outputs,
diode doblers may increase voltage nesesary to charge 12V batterys
with the 10W OU ... if vector looped ...
NICE !
Hector :)
#6089
Re: Konzen's bifilar coils
Hector
#6097
Re: Otto Smith motor
Hector
#6102
Re: Couch Ssytem and SaCo magnets
forget about the royalty ... if thing goes well throw me a few bucks
(on as you can basic) to make more toys for all of you to built &
sell,the 40 phases motor generator is still in the cooking pot.
PM RV is another Manufacturable goody .
Truly if it HELPS you start building RVs and sell them to thoose
that cant, I dont mind a bit .
Hector :)
#6106
Re: Konzen's bifilar coils/regauging cores again
http://www.pscpower.com/pages/series%20sc.htm
In low impedance this effect is not noticed much but at higher ones
it exibits OU due to EMA effect,(Electro Magnetic Amplification)
Theory ..
http://www.ibiblio.org/obp/electricCircuits/AC/index.html
BEDINY was correcting his battery power factor , Newman his COILS ,
Bearden his Magnets ..... (Pun Intentional) ;)
Hector :)
#6120
Re: OU spark plugs?
There is what is call electron cooling by means of electrical charge ..
HEAT is due to an increase in electron orbital energy level ..
#6159
Re: Bigger RV-Mullergen 13coils per side
Nice :) You can use dual coils, also dual magnet disks with COILS in
center "as Stator" that way magnet GAP energyzes coil in concentrated
form ...
You may use that to your advantage also encasing the 2 coil or one
coil into looping the field across its lenght ...
check tesla early gen patents and the old Ford T magneto design ...
Hector
#6161
Re: RV (emp frying)
It uses fast acting Air press 1/2 inch actuator valves used in
industry...
Adapted to the Standard spark plug ... remember I was working on
this .. the distributor switches this valves open energizing them
at up stroke of compression cycle power is regulated by open time
and AIR intake restriction (Carburator Vane) study AIR hog toy
plane ,there is a big key .
If I had the Money 20 years ago all cars may be runing now
solar RV AIR hybrids....
Hector :)
#6167
Re: Air hog engine patent
If its Negre patent He COPIED the LEE ROGERS ONE ( I sended Him copy)
he redesigned using AIR conditioning COMPRESOR design as PROPIETARY
technology as he sold himself to the money Whores ...
They left me OUT, I dont Exist we never, knew the guy, he is nuts
agenda.
LEE ROGERS PATENT is the TRUE BASE of the magic, Patent Number
4,292,804 Air Hogs are a Partial DEMO of lee ROGERS one difference
is AIR HOG is 2 cycle and VALVE is Piston pressure differential
actuated as per propietary never disclosed secret ,regular
models "pin" actuated ...
Hector
#6179
Re: RV-Muller OU test
^_^ !
Remember NORMAN WOOTAN did this with off the shelve generator
and that by FINDING were the GENERATORS loose their POWER and OU is
atenuated we can find WAYS to Increase OU producing effects ....
Important :
I am REALY HAPPY that AFTER NORMAN WOOTAN , KONE did the Same,as I
will never FORGET how he was treated Like SHIT in JLN group , nor I
will forget how the guys at KEELYNET Ignored Norman results ,
professional Envy ? I dont Know ....
CARMEN send me Email but I havent being able to get MAIL back ,
years ago I tried to make ALF try RV to drive EMA4 and MODIFY
Standard EM GENERATOR TO PERFORM in EMA MODES ... TO BUILT PM RVs
but as You Know we ended doing war. (Shit Happens)
Sorry for the Expresion but I piss on thoose idiots that treated
Kone as shit on JLN group HAHAHAHA HEHEHEHE ! (I cant be more
happy )
If you want to loop check the loop bypass circuits posted for the
DC section of RV as long you keep battery at 12.7 volts and on a
charging vector without frying inverter you are OK your load is
inverter and battery , need to calculate ampere loading in your
coils and bypass vector it to inverter at the same time reversing
current to battery ... Remember Your VOLTAGE will be a VIRTUAL Value
and the Current will be REAL One ..
Hope Others also Take inspiration on Kone Work and Use their RVs to
WORK on their LOW LENZ generators ....
You cant Drive an OU generator WITh a MOTOR that wastes 110% of its
energy doing nothing ... but you can drive it with an RV ....
Other things will become evident with RV , it has a LOAD range were
it reflects no loading to source in PM this RANGE is quite EXTENDED
ant there is were the HI impedance PF and EMA issues will hit the
fan ... sshh dont tell anyone RV alone IS OU ... but as a MOTOR
it canot give ou driving a 37% efficient generator ... LOL!
ON OU demostration ..
It May Had being made Earlier if BEDINI , ALF , or NEWMAN may had
used RV primemover to drive their designs ....
And As told before may wished Muller to see his generator working
with RV.
...
#6214
Re: RV-Muller OU test
you must REMEMBER RAIVO EXPERIENCE with the ALTERNATOR were PMAs
oversaturated COILS become a source of drag due to ROOM TEMPERATURE
MEISMER and HALL EFFECT in the core internal composition that tends
to go Electricaly superconductive and magneticaly resistive to
induction ..
Issues ....
ALF EMA 4s are still useless impractical pieces of Iron if not taken
to STANDARD frame , I offered ALF a billion times to take EMA4 to
low voltage RV modes, he paid no heed ( you did first I am glad ).
The Aproach at this stage is critical , dont FALL under the POWER of
usurpers (Corporate Mafia ) ... else all you have done is lost.
The moment you permit interference from academia type monkey brains
to digest what you got it will be delayed to death on NATIONAL
SECURITY issues , I am quite worried here .... ( I can sense
something is not right ) were is the GODDAMED son of a bitch that
destiny has to put up the FUCKING money for this ....?????
Hector :)
EVERRY MOTOR and GENERATOR haves an OPTIMAL SPEED & frequency and
Loading factors were it is more efficient and performs the best.
(Lab proven & tested ) within certain RANGE most of them can exibit
overunity phenomena due to natural magnetic amplification EMA
effects.
Hector :)
#6250
Re: musical notes from looping sequencies [for hector and ronald]
A..4"(AA,CAA,C,GAA,CC,GA)5"...G
A.....(CA)(AA)(GA)(CAA)....G
ACAAACAACGAACCGACAAG
142.857
475.281
253.968
27+30+33=90 hz
9=1+4+2+8+5+7=27
Hector
#6253
A..4"(AA,CAA,C,GAA,CC,GA)5"...G
A.....(CA)(AA)(GA)(CAA)....G
ACAAACAACGAACCGACAAG
Hector
#6259
Re: musical notes from looping sequencies [dna info]
7 colors of light are the base for all existant DNA /RNA
combinations in the universe ..
were female and male form 6 that create the david star with the
WHITE color at the Center 7 correspondimg to the duality of
universe represented by 11 male & female letter K ....
If this does not hit a ring note , codes k888 , K999 will ring a
bell as nature has 2 roads in evolution , one is transformation the
other entrophy and destruction ( I am a master at the 2 ) so thoose
dealing in black magic will soon see the fruits of their work , as I
will step and walk in their ashes ( In a sense already done) '2137'.
politics
religion
Economics
With politics we deal with the truth , logic , and get rid of
politicians ..
With Religion we tell humanity the truth , tell them that paradise
is made were he is , that moving man to HEAVENS will not fix the
problem , but only turn heaven into another hell ..
( Requires Transformation ) Education , as any thing else Faith is
ENERGY you can waste it kneeling before an stone idol or you can
use it to aquire wisdom and become one with GOD ... (choice) .
Get Rid of religious fanatism (all religions)..
Economy ...
Man can also be transformed with minimal waste .... That is what
technology is for ( tool for transformation ) not idol to be
worshiped as a God ...
(end)
Hector :)
#6284
Re: photos of 133213 RV "Mullervertor"
RV can be put in market Easy , just let me handle the R&D and
engineering deparment of any mayor motor manufacturer for a few
days , a few mental enemas and a horse whip can do wonders in R&D
deparments .. LOL! :P
Put this figure 111 phases 15 volts per phase 8 amps per phase
that is 13,320W in a 4 inch x 2 inch space .....
...
#6293
Re: coil and core dimensions
kone stated the need to TUNE vector RUN cap ( tune source to load )
Everry generator has a BEST speed best loading "character" were its
usualy OU (Overunity )
Hector :)
#6312
Oops nevermind Re: [EVGRAY] Re: photos of 133213 RV "Mullervertor"
First we must see number of magnets & number of coils, Phase angle
relative to Each coil and how they are wired as to REGAUSE or REACT
to field in the 3 posible ways to get EMA (Electro Magnetic
Amplification)... As Sundance we can see similarity of concept that
goes to BASIC AXIAL design ...
Hector
#6455
Core: " specific frequency and "impedance " .
http://www.ibiblio.org/obp/electricCircuits/AC/AC_6.html
Keep this Notes as they are the KEY to get OU from ANY kind of
generator as they are universal in nature
all you need is to aply book formula and a bit of common sense
http://www.ibiblio.org/obp/electricCircuits/AC/AC_6.html
:)
Then ..
LO ! :P
Hector :)
#6456
Gunning is the Term used as you reverse polarity in a runing DC
motor as to reverse rotation instantly without stoping the motor
completely ..
You will have coils being repulsed and others in atraction lowering
rotor magnetic drag as one wave overimposes over the other
circulating clocwise and counterclock wise within a virtual torus ,
were theese rotating components meet the amplification effect occurs
being of REPULSINE electric nature (ZPE) , the EMA effect is taken
from magnetic field modulation and alternation at same time adding
as vectors as contrary to entropic standard system were they result
in loss substracting potential from each other ...
This Explains some Kones postings about Muller generator making
Muller A bit more RV alternator alike but with the big difference of
its asynchronous and PM character advantage .
Hector :)
#6489
Re: Gunning And Overunity ...
*******
Its part of the EFFECT similar to the 3PHASE Oval shaped field
rotating the 2 rotor poles at 120Deg the 3 to 2 ratio rotor stator
coil relation . EVEN NONE setup.
*******
> For us that are trying to replicate his thing, changing magnet
size and strignth can totally mess up this lenz canceling effect.
Some of us could not obtain identical magnets as Kones. I for
example got 1/2 inch wide magnets which will mean a slightly closer
spacing of the magets on the rotor. This will have a greater
overlaping effect and hopefully great lenz canceling effect.
***********
this depends on spacing and field intensity
the worst sin is to oversaturate ...
it creates drag ,,,, Ask Raivo about Super PMA losses ...
OR READ What Is Posted posted already here ...(Somewere )
Hector
***********
#6539
Re: Need help understanding coil performance
If you take the LC relation from a 4rt dimensional look you have a
varactor circuit linear driven LC at each cycle were R determines
the value of impedance at source driving it (Simple) capacitor
size determines peak to peak value of rectified potential as a
charge in a capacitor, energy resultant is calculated in joules (
capacitor voltage and the energy it can deliver in watt seconds (VA
(
**********
> Hector,(Snip) does rectifier take it out of the LC circuit?
> Erick
**********
A diode bridge does the same But dobles half wave pulses 60CPS AC
Hector
#6540
Re: Need help understanding coil performance
This little coil puts out 3.50 amps when shorted, and 20VDC. It
lights an automotive tail light bulb brighter than my other coil.
But still the RV seems to consume twice the power and the coil
produces. seems about 50% eff when you max out the coil output.
>
> Erick
IF AC ....
Idea is to learn the basics to "bend" LENZ law and lab tested RV is
the best tool to do it, the LOAD as integral part must be tuned to
source and source to load NEEDS ... ( Tesla Wrote about the same )
too bad he did not teach people to build RVs .....
Hector :)
#6542
Another COIL Core RF - DC Repeat
Pure "L"
Idea is to charge coil and "core" (If any) to saturation being the
collapse discharge the OU producing element
Pure "LC"
Here POWER factor & resonance intermix were PM " M field " saturates
a COIL & core as to cause a charge resulting in OU potential as it
gains power from M field "EMA " and ZPE "C" components.
JM charger , RV & transverter play big issue here ... (LC)
Tips:
Coil voltage as DC must be greater than battery ...
real load must be battery not a resistor ...
LOL :P
HEHEHE
Hector :)
#6581
Re: The simple little coil
Excuse me .....
Tesla spoke of tuning the Load and source , not beating energy to
death with a horse penis .
Hector :)
#6604
Get one of thoose sharp inverter technology microwaves ....
how the 2 IGTBs discharge into the primary coil (multy-filar) using
3 capacitive elements to get 800w at magnetron input ...
3KV DC from diode plug .... understand why this circuit is OU ...
codeword phrase : Hairy mice (mouse) hatching from eggs (my mistake).
Amen !
Hector :)
#6605
Re: emachineshop
on this same line cut a line "gap" down the metal pipe
the magnet will fall with 95% less resistance .....
the pipe "ring" short to m field was removed ... A rod within a rod
spun at right "tensor" will be negatively inductive, a 4FT long tube
can generate 3000 amps at 15VDC as I get funding I can demostrate this
postulates I can tap the atomic spin atomic engine itself ...
I attained homopolar reverse induction making copper magnetic super
resonant conductor at 0 cycles per second resonance....
( I need big guns and ammo R&D $$$ ) no more greed induced suppression
and controls...)
screw Him !
Hector :)
#6637
Re: The simple little coil
Hi Erick!
I've seen it to affect very well the Bedini style setup (RPM increased
2x if I remember well).
Try your cap bank at range 10uF (1-100uF) finding the voltage
resonance. Measure amperage, see the input draw. If you spot the input
resonance write down the capacitor value: e.g. 10uF. (you may try RLC
as well)
Then take FWRB: connect the same cap at DC with 10ohm load (and you
may vary cap sizes to see if there is an effect).
LC resonance V: ___
LC resonance A: ___
input draw: ___
Using this method when one capacitor is fully charged the other is
discharged into the load is very promising advanced switching scheme
for further advanced testings.
--Raivo :)
#6705
Re: Diode choice
Not only hogging but guning (Gun diode ) they oscillate in RF mode
modulating current and voltage ....
Hector :)
#6812
A powerplant 2 bearing generator is obtained 10KW
Use PM rotor this FEEDS EMA OU power to home, use series variac to
regulate KVARS or Magnetic current regulated amplifier to control PM
KVAR output .
In places far away from grid power source this can save 60% on power
bills correcting PF line loss ...
This are Solutions that can be implemented NOW in vitro using off
shelve stuff ...
Hector
#6838
...
Single phase Current, voltage & power factor
V x A X PF = W
3 PHASE
compared to INPUT of single phase to 3PH system ... And I have not
Touched Hiper-relativity rotary logaritmic equations or Optical slit
aplication of CORNU spiral to virtual Amplitron alike relation of
this circuit ....
Anyway its all in the compilations for reading ... you just need to
built the device ...as is the same thing you are looking for ..
Specialy in ROTARY condenser POWER Factor correction aplications...
Purely overunity ... Bedini And Newman power factor corrected their
batterys ... Bearden power factor Corrected his MAGNETS And coils in
Meg (Reverse)
#6917
Re: Question 4 Hector
Another thing that creates this is the utility power source specialy
if there are fluctuations on impedance withing the UTILITY lines
themselves creating phase angle variations "drift" of current and
voltage (Becomes Virtual Impedance variations relative to RV ...
Using 2 current meters you will see phases current will drift also
within 3 phases one goin down while other goes up ..using POWER
FACTOR METER you will notice a POWER factor fluctuation in
proportion to the current one in the line imput ..
LOL :P
Hector :)
#691
Re: Question 4 Hector
Another AD on
Initial SERIES loading also causes oscillation on reactive values
Hector
#6927
Re: R&D Spice
:P
Just be carefull with the blue smoke And silicon goin nuclear ...
Hector
#6934
One of this Days as You dominate resonance better you can resonate a
75 KW transformer using a single AA 1.5V battery ......
OR
Light 3 4 foot FL tubes with a 1.3VDC dime sized battery for 6HRS
or more ..... runing in 3phase LC hi Q resonant looped oscillator
Hector :)
#6978
Re: Airlines going bust
I can redesign their engines to run on WATER using thermodynamic
cavity detonation modifying existant jet engines ...
I only need to demostrate in vitro ,,, but Whos got the money ?
Hector
#7002
Re: All north 32 mag rotor and litz coil
TRUE as load acts as a VARACTOR diode & only a few are qualified to
deal with thoose theoretic aspects and NONE in POWER engineering one
( REASON I gave RV as public domain ) gives chance to experiment.
In pulse generator, that means using ONE pole, Idea is to CHARGE the
COIL core with the PM and using the M field collapse as power
source being non reflective to mechanical power source ..
The MODEL testing is the only WAY now posible to perceive this
aspects until the proper formulations can be included in electrical
computer simulations .
Now anyone can be able to SEE were OU is LOST and why alternators
and generator design are flawed and the need to change engineering
concepts into a more broadbanded region were RF knowledge becomes
Vital to be able to integrate and interlace the INTERRELATED
parameters affecting the way generators and motors work ..
Hector :)
#7017
Re: funds - OU into reality
Hector
#7036
http://www.chorusmotors.gi/technology/patents.shtml
You dont have free energy because a FEW powerfull people want you as
ENERGY slaves and that is a fact .
Here they Deny ,,, behind curtain everything gets patented in part
and pieces ... This PATENTS include Kone recovery circuit & others
public here well before the patents were issued .
#7133
Re: non-reflecting to source
Kone stated ..
> Shorting out the gencoils also could "be said" to be taking the
coils to zero too....
> ciaoK
****************************
Reread posting on NORMAN WOOTAN FAN MOTOR EXPERIENCE and the creation
of NEGATIVE impedance states (Guning ) resulting in a virtual
superconductive state ...
Bedini ,meg,Jim and Muller is same stuff Maybe I am the only person
explaining it as is ... And many hate me for it as it broadbands and
kills all secrets patents and R&D out there ...
Its so dam simple it scapes the mind .... (Teslas hidden secret ..)
Hector
#7137
Re: non-reflecting to source
Hector
#7139
non-reflecting to source + (ZPE )
More added to arcing ....
Its EMA sine wave capture as there is no gap random plasma pulse
modulation and energy loss ..
This is the beggining of understanding true ZPE energy production
using dirrect M field inductance ( start ) creating a near VTA
rotary Inductor "reverse of rotary condenser" ..
IN low to HI impedance virtual rotary inductor machine .
hope the people reading this realize the implications and instead of
supressing it take it to the place it deserves giving due credit to
all the people involved in making it posible ....
Hector :)
#7132
Re: shorted-coil circuit drawing
I am giving it public now ..... Raivo can give you the link to the
Multy phase motor generator prototype pics using external PM rotor ..
(now public ) a positive and negative diode go to each segment
creating simil to 3 phases bridge but being 37 phases in your case ...
Hector
#7145
Re: non-reflecting to source + (ZPE )
> > Hi Hector,
>
> I assume you mean the DC current was rectified from the coil
before going the spark gap.
> I have done spark discharge with pure DC current before. I had a
huge electrolytic capacitor bank charged to 2000 volts. I used
carbon rod for the spark gap. The discharge arc made a nice smooth
sound. I could make it arc smoothly for a few seconds before the cap
voltage dropped too much. Does this DC arc I described doing the
same thing as you described above?
Yes remember OLD time spark gap transmitters .. wire lenght and gap
determines turn on and off range of frequencys (including
harmonics)
Hector :)
#7151
Re: Academic
This was already given in the Electret and quantal diode stuff ..
Heating compounds like wax charging to 14+kilovolt and up, cooling and
creating electron tunneling materials (Old postings ) ...
Just requires the place and resources to do ...
But Its simplicity ofuscates the complex minds and solution scapes
the hands searching it ..
> Hector:
#7152
Re: Hector's 40 phase PM alternator
Thanks
This pictures were Captured by Raivo using web cam .. so sorry for
low resolution ...
other things remain to be done but ran out of funds , this is the
type of basic motor-generator were the low Voltage ZPE solution
resides ... all PM dc motors can be converted to multyphasic motor
generators .... kone may have fun using a PM stator from a CAR
starter spun over a fixed rotor at 3,450 RPM were all its brush
segments are rectified .... it Beats the PMA output by a big
marging .... for better result a baldor DC motor is better as rotor
laminate is low loss .... this is tested by measuring drag loss with
no load ...
Thanks
Hector
#7161
Re: Thanks for the info
Hector
#7171
Re: Interesting OU link..... sqrt (-1)
Hector
#7175
Re: ASI-Computer ;)
Idea is simple,in digital circuit you got 1-0 One-zero bits in Analog
you use RF mixer streams that carry full information and give instant
answers .
computer intent was to determine time & space shift nesesary for time
travel .... T.A.S.M.I.N proyect alike .. That as other things ended
shitfted to shithole dimension,as Big corporate GREED took over time
and space too.
Options left ..... (WAR).... start from stick and stones again
and us with brains being Gods .... just being redundant this time ..
Hector :[
#7278
Electrons, as they are polarized they tend to repel each other from
the center conductor ,this creates surface currents and resistance...
in multy filar conductors they tent to repell each other back to
center mantaining a more even current flow in conductor ,,,
ALSO same system aplies to PM generators as the CORE loss isues are
IMPLANTED disinformation in order to disuade people in converting
STANDARD of SLELVE items to OU devices ..
EV Gray EMA motor can be done using any off the shelve inverter grade
synchronous motor generator or PM generator runing in RV modes .
Just Avoid the Oversaturated cores ...
Ferrite and ferroxplana are for HI frequency ,not so off the shelve ...
I think is time to go back to MODERN low loss laminates and aply what
you have learned with the homemade cores, to lets say the 40 coils of
a DC baldor motor wired to 40 phases diode bridge to give 10 times the
rated output . Using Stator as Rotor and rotor as Stator ..
Some People want me dead for telling you this ,my life is a fu*king
hellhole, so please make good use of the info .
Thanks!
Hector
#7279
Re: RV Muller project by Kumaran ( Switching the Coil)
Hector:)
#7283
Re: multy wire strand conductors )Multifilar ..
For The power Elite is priority no one finds to make MEGS out of 3PH
transformers , and RV out of 3 phase motors ,and rotary condensers
out of generators and the such ...
I can take one of those to 75KW using Nb70 mill grade PMs but only
Gods of the Olympus will be able to replicate the stuff, not so off
the shelve to do stuff..
I think many tricks can be learn from using CAR DC motors and diode
bridging the rotor commutator segments ..
Havent finish the BIG one due to interference only did preliminary
testing,will have to wait untill the 75K tools, liverating myself
from certified diplomated donkey orifices that cant even costruct an
screw without screwing themselves and every body they know with
it ..
Thanks
Hector :)
#7288
Remember the relation on impedance that is needed as to attain
logaritmic resonant gain within an LC componets induced from a
magnetic field ..
Like a simple bench drill and other tools you can think off ..
Delphi went bankrupt = USA went bankrupt = capitalism does not work
as is theft of human blood and effort to benefit a few wile the rest
is fucked up and poor ..
#7303
Re: RV Muller project by Kumaran ( Updates)
That Means the Magnet being a ROTARY condenser imparts its energy
as VOLTAGE mC and converts it to PURE CURRENT NODE were VOLTAGE =
near 0 being 0 perfect virtual 0 Energy point state but were
ELECTRONS are at saturation point and can aquire energy from HEAT
and ambient noise ..
At maximal M field were the short circuit is open then the virtual
Current node tensor collapses into a relative finite resistance
capacitor were its Ampere density is transformed into a CHARGE value
potential , 3 factors contribute here , coil core ,wire turns ,wire
size, Capacitor Value and its dielectric charge constants under RF
signal , were Stored energy can be defined by Joules at time of
discharge , core and Coil will rest to Ambient energy state or
preferable UNDER ambient egergy were it COOLS down ..
Stay thermal .. Stay in Energy savings for the time being , untill
this Hits the Fan spreads wide and open ...
MUHAHAHAHAHA! (:P
Hector
#7323
Re: RV Muller project by Kumaran ( Updates)
Summary
When running at 3000 rpm, the coil produces more power (5 times more
then 1500 rpm). Yet the 3HP motor is far less efficient compare to
7.5HP. Why?
#7356
Thermodynamic law is based in Energy transformation ..
just need to be Updated to a bit less primitive form ..
hurricanes and Tornados are OU machines ,it just takes a bit of money
and support and I can put a few in a can to produce all the energy the
world needs ...
Hector
#7370
For cars the electric turbine RV is best as a 24,000 RPM
5 HP motor can put out 60 HP ///
Hector :)
#7376
Re: inverter tech
Hector
#7400
Re: prime mover and alternator as one single machine
The solution here is take a look and have him dump the info in the
net ( add it to the INFO on ROTARY condenser machines ) RV modes and
power factor correction rol in OU production (resonance ) if its
electric and not hydrosonic...
One coil feeds the other resonant angle summing up vectors , this is
the same STAR generator developed for US air force Skunk works
Aurora proyect .. look for Chorus motor patents ... (Eye openner)
Read Norman Wootan MRA work as we hit same phenomena and agree is
same stuff ... difference is here we can tailor a % of the load to
be part of gain equation (Extracted from system) were in MRA it was
not posible as LOADING detunes the system broadbanding to a NON OU Q
state ..
OU is no longer in ISSUE , its the aplications we are talking about
I go for energy savings, as the basics are aplied using the tools we
can go into higher level ( at this point is quite unsafe to play in
looping modes ) the lions will eat you alive, looped RV is trying to
sodomize a lion using no lubricant (you will be eaten )the system
will rape you back.
Hector :)
#7451
A car anternator as is from (OFF the shelve)
'To the point it can RUN and inverter and feed itself ...
the battery becomes the infinite virtual capacitor were Coil phases
load their OU energy to , water in electrolite becomes quantal
nuclear fuel to the reaction ( so needs to be added daily ) ...
AMEN ! Thoose of you doing the experiments with the RV Muller gens
can now understand easy how to make this posible ...
Using proper CORES and PMs in PMA alternators can produce Overunity
generators from off shelve parts and pieces (or whole units )
same aplies to any generator ...
Its not the invention its the Method, teach the method the invention
persists for eternity ... Teach a man to fish he will not hunger
give him fish he becomes dependent & non redundant ...
Hector :)
#7507
Re: project by Kumaran_what's next?
Hector...
#7522
Re: pulse length frequency inverter-> RV mode
Answers within text ..
>
> Also, I have noticed that when I switch between
> start cap to run cap right at the shudder point, the input amps
drop to near zero for a second or two then pick back up to .5 - .6.
>
>>
> > >From my experience so far I feel there needs to be an RPM
monitoring > circuit where the caps are all automatically cut out at
the right time.
With this simple circuit and the variable pulsing circuit the
> > RPM and torque would be accurate and stable from start to go and
no messing around.
>
> Hi Ash, I have an idea what that shudder is. I have experienced
the same thing. It will happen when you disconnect the power source
to the RV when the start cap is still connected.
With proper funding and support this might be done faster just
need to be pushed to CNN, discovery channel, National geographyc so
is not hidden within the system power of shadowing denial and
apropiation ....
Hector :)
#7586
Re: It is hard to change the general opinions ,in depite of evid. of experiments
The lab models fornicate diplomated idiots brains badly (no posible
denial )
Hector :)
#7608
Re: TUNNING zero point energy [resoance ]
Hector :)
#7662
Re: Matt's RV Results
>
> It has virtual power of over 1200 watts with an input of less than
270 watts!
> I know it can get better with some tuning to a load but I still
have a huge smile on my face. :)
It feels so GOOODDDDD when things work ... still lot to learn and
lot of experiments to do , radiant energy (RF) differs a lot from
normal utility power , you got now 2 things ..
> Now I need to know how to load it correctly to measure real power
and then it extract it. I'd appreciate any help I can get with this.
The RV alternator is the first PRACTICAL low cost Low Voltage Way of
producing true RADIANT energy ( no tesla coils ) no 5KV million
dollar Gray motor ..
> Matt
>
#7664
#7703
Re: core material
This takes HEAT and drives it into the Electric potential of the
coil reducing atomic and thermal signature ( ambient energy ) .
#7830
Re: RF issues
HECTOR :)
#7831
Re: lots of stuff +IR cam
It makes me sick how they entertain the sheep with 100 meter
resolution mars pictures when actualy they have sub light wavelenght
neutrino telescopes & other toys to see a fleas ass hairs from here
to the moon ...
Hector :)
#7898
Re: building the pulser side
That makes Flash tubes good Thyratron substitutes ,and the cold
cathode ones does not have thoose problems , including a suppressor
grid to eliminate leak back ..
Problem is NSA will jump on you as they have nuclear trigger
secundary usage .. ( They get extremely paranoid if you order one)
so you have to declare a set of complex specifications as for a non
military "innocentive" usage (Not mentioning ZPE aplications).
Hector :)
#7948
In radiant energy effects as in resonance there are regions of
standing wave energy called Nodes ... this nodes are either a 0
current and max voltage regions or 0 voltage and max current regions
as alike measured in 1:1 VRSW RF antenna dipole ..
Rv can be run dirrectly from the air using air capacity plate (RF
antenna) using 10nth shuman harmonic of 72CPS all that is required is
10 feet sphere capacitor and a heck of a tuning ability
to run it totaly wireless in Tesla wireless mode ...
" A few More toys" you still havent got an idea yet ...
Hector :)
#7976
Re: RV on hold ( Modified sinewave inverters)
All phil needs is to Modify Such OFF the shelve designs into
Variable parameters ones ..
www.dalbani.com (inverters )
and you can order custom built 3 phase frequency drives from
#7994
Re: EV Gray conversion
Hector
#8009
Re: Radiant Energy -- Wireless Transformer of High Power Lines?
Hector
#8010
Re: HAARP-> some thing uselfull [for H]
Ash , A lot can be made using this , to the level the goons were
scared Sh*tless entered inllegaly into my home and stole 3 tesla
patent books dealing with Teslas AMPLIFIYING TRANSMITTER ...
The secret is simple , you first find the type of signal you have on a
site (natural standing waves) you determine frequency and provide an
air capacity and COIL to tap into it, you exite your (TESLA COIL)
TO SYNCHRONIZE TO the standing wave signature to aquire class c
amplifier alike in the coil air capacity elements at hi Q modes
the instant the signals cophases the system becomes self substaining
at signal potential x 10, that is like 64,000 hp for a 128KHz
signature in colorado springs area .. Colorado USA.
you need to locate the nodes and place the resonators in order to tap
the standing wave signals .
Hector
#8016
Re: Radiant Energy -- Wireless Transformer of High Power Lines?
OPPS! went blank at first but maybe that was right answer ....
as All the answers believe or not are here ,in this forum repeated
over and over and over
#8018
Re: Radiant Energy - Hendershot device
>
> The Hendershot device is basically two tuned circuits coupled
> together via 1:5 conventional iron core transformers.
Some of the group were working on this concepts already ()check old
postings on 3 phase Transformers , ferroresonant transformers and
such... Norman Wootan Also but I dont know the status of that as as
he stated he is pursuing another line ? OR METHOD (CRYSTALS)?
wHO KNOWS?
aLL i KNOW THAT FOR REPLICATION of a looped system all the
parameters that compose such system must be known Also I know if
people pursue energy savings using resonance and RF engineering
practice they will hit it sooner or later, as chickens first walk
then fly to the tree tops and barn roofs ... So its path to ZPE .
#8026
Re: H comments for Z.E.U.S
That sucks !
Hector
#8027
Re: Science fair help (generators)
that is raw 4 times over the full load capacity of motor at 10 times
more efficient . Depending in Quality of motor and rotor laminates
( some realy suck ! ) RV permits you to see were they suck and why ?
... its were quality and design influences performance ...
Hector :)
#8029
Re: Jinis transverter replication ( Electron )
> > I found already ferroresonance effect (voltage jump) using 69.8uF
nice that is MEG MRA and VTA principle !!! ^_^ !!!
Note that you cant start resonance with this level of energy ,that
resonance needs to exist in order to go down in power to find this
constant .... ( Other reason Researchers were lost in Hendershot
design) he started a RESONANT pulse as to start circuit .. if there
is no resonance you can never try to substain a positive constant
feedback as THERE IS NOTHING BEING AQUIRED TO SUBSTAIN IT .
>>
> > Even if I found the ferroresonace effect I could not find till
now the optimal C value for LC ,
> > resonance. Are there any good advices how to combine
ferroresonace and LC resonance together (it
> > is required at all to combine ferroresonace and LC resonance)??
>>
> I have planned tomorrow to make experiments for finding out the
> characteristic curve when the core becames saturated in
dependence of input voltage and input current.
>>
> > After I will find the optimal input voltage and optimal C value
I will try to use the diode plug > for increasing Q as Hector
suggested.
Sages keep this notes ,pass them on ,this is the no bull simple real
stuff in ZPE OU R&D ,things like RV that you can test and use in a
REAL lab using OFF the shelve hardware.. (just requires proper
method)
HEHEHE .
Hector :)
#8033
Re: H comments for Z.E.U.S
Hector
#8048
Re: Plasma resonance + stuff
and certain frequencys are not that hi .... like the fish in the
water they cant see it , but is there ...
On Wavitons yes they can be used to tap ZPE and ZPE manifests in 9
basic levels ( ELEkTRON being current science one Knows ) that
relates to KNOWN uses of electron particle , untill I can teach
people how to create vitrons by transfering electrons to 4d states
and create static light (non moving photons ) using off shelve cheap
stuff it will be a bit difficult to jump to other RESONANT regions
of ZPE (specialy resonant plasma ones ).
#8099
Re: Transverter/resonance experiments
Try Hi q resonance at 90 deg phases ...
split and match input impedance as to drive with rotary phasor angle
defining power input as phasor difference (reflected power to line )
correct input PF .. and note the differences ..
LOL!
Hector :)
#8102
Varactor effect drift
Hector :)
#8108
Re: not_fully_off_topic-lifter
Hector
#8114
Re: not_fully_off_topic-lifter
Darn "! who is goin to put the money to play making the basic tinker
toys ?
(Frustrating) :(
Hector
#8196
Re: elusive resonant
0 --------------- 0 --------------------
>
> Question:
>
> 1. So what basis of resonance computation I will
> follow before I proceed in buying all necessary
> materials ?
>
> 2. What you mean " resonance extremely broadbanded Hi Q
> and Low Q impedance or Do we have exact or
> estimated parameters value of the two Q or some
> sort of border line ?
The idea is tuning the 3 phases at near valanced 120 degrees , there
the magic happens .. Extreme efficiency at higher impedances low
temperature operation..
>
> Sorry for so many question, Realy I am not well familliar about
resonance. I only want to make sure I know what I am doing and
buying. You will get yourself a verry advanced and simple R&D tool
( Just ask thoose that had built it ) you can quantify an ant hair
friction on the shaft using hi definition DVM, measure lubricant
effectiveness (as R&D aplication sample).
Basicaly as per instructions a motor 3Phase 5 to 7.5 HP_ any speed
dual winding 9 or 12 lines 230/460VAC preferable external fan 184
Frame TCH oil capacitors 370VAC 7.5-24 mF range runing 100 150mf
starting capacitance and assorted capacitors for tuning 1,5,mF up
to ten ...
Then wire as plans, for starting use current or centrifugal speed
relay (switch) can be used .
Hector :)
#8216
Re: Gray motor
And Yes, we have tested it already in many ways you cant even
immagine, Newman Ran an interesting version of it but never wanted
to go RV mode like you did, positive aspect is for PM ROTOR your
system does work quite efectively and will not be subjected to EW
warfare or EMP if TFE wire is used, So for lifter gyroscopes and
that sort of thing it does have its aplications , military also ,EW
countermeasures ...
Hector
&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&
&&&&&&&&&&&&&&&&&&&&&
&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&
&&&&&&&&&&&&&&&&&&&&&
#8590
Re: Tesla quote "tremendous advantage to break at the peak of the wave"
Hector :)
#9240
Re: whats up Hector
Tips ?
Norman Wootan Work , and PC switching power suply design using PURE
resonance ..
The compilations have all the info , you only need to do the LAB
experiments to aquire the (TOUCH ) rv, transverter,meg,vta ,rma ..
konemotor, bedinimotor all valid usefull test beds for OU .
Hector :)
#9341
Stolen from another furum (And i give a rat ass ) as info is quite
interesting !! aplicable to healthy "radiant Energy ZPE devices..
Save in your notes... this octaves are aplicable up to photonic
(light frequency ) healing machines
Enjoy !
Hector :)
For example, the third note, frequency 528, relates to the note MI
on the scale and derives from the phrase "MI-ra gestorum" in Latin
meaning "miracle." Stunningly, this is the exact frequency used by
genetic biochemists to repair broken DNA – the genetic blueprint
upon which life is based!
A Little History
Carl Sagan writes that most of our genetic information (about 97%)
is unused DNA. He refers to this as "genetic gibberish." Is it
possible that most of who we are still lies dormant as our human
potential?
The old paradigm and its premise stated that we began as biology in
the womb of our mothers. Telliard deChardin tells us that we are not
a human being trying to attain a spiritual experience, but, rather,
we are spiritual beings having a human experience. This shift in
perception causes a tremendous difference in the way we perceive
ourselves in this third/fourth time-space continuum.
Repairing DNA
The work being done today with energy at the cellular level really
excites me, since I had been very interested in DNA before it became
a household word. In fact, I think it took me two years just to
learn how to pronounce it (deoxyribonucleic acid did not roll off my
tongue quickly). But, I was determined to understand this
tremendously powerful energetic blueprint for life, as we know it,
at the cellular level on this planet. DNA became a part of the
collective consciousness when CNN produced a special on the Genome
Project in 2000.
After I received the tuning forks and began talking about them
around the country, I noticed that people were resonating with the
information about these powerful frequencies. It felt as though
something was going on in a much larger picture. We were connecting
energetically to this information, and yet I didn't know what I was
going to do with the tuning forks. Then people began to ask if I
could use the tuning forks on them. From those experiences, and with
information I had gathered, a method and technique began to develop.
I called the technique SomaEnergetics TM, which is designed to
utilize the optimum energy of the Solfeggio frequencies using tuning
forks. Soma, meaning "body" in the Greek, combines the wholistic
idea of the body as an energy field - SomaEnergetics TM.
When starting these first tunings, the main frequency that I knew
the most about was 528 Hz – that biochemists are using for DNA
repair. I realized that the right side of the body is controlled by
the left-brain, and the left side by the right brain and that these
correspond with our inner male and female energies. As I took the
fork down each side of the body, I could get in touch with the
dominate ancestral DNA that comes thru the Mother's side or Father's
side of the chromosomes. I would many times get a tremendous
imbalance in the sound between the two sides. The purpose of energy
work, as many of you know, is to attain balance. For example, if
everything is in balance, such as the ph level, the physical body
can heal more naturally.
It's the same way in our energy bodies. If we can find that energy
balance, that equilibrium, where everything aligns or everything
comes into synchronization into the rhythm of the dance of life –
then healing becomes the natural state. It's nothing supernatural,
or miraculous. I think a lot of spiritual texts have referred to
this idea when they describe, "going home to heaven." Heaven, to me,
is the complete synchronization with higher frequencies and
vibrations of creation being totally entrained. In other words,
being in a state of at-one-ment.
For more than 200 years, researchers have been validating the
connections of Sound and Vibrations on physical form. The first to
make that connection was German scientist Ernst Chladni, who, in
1787, detailed his research in his book "Discoveries Concerning the
Theory of Music." In that pioneering work, he explained ways to make
sound waves generate visible structures. He detailed how a violin
bow, drawn at a right angle across a flat plate covered with sand,
produces patterns and shapes. Today, those patterns and shapes are
called Chaldni figures. (Coincidentally, Chaldni died in 1829, the
same year as Beethoven. Mozart, a Free Mason, heavily influenced
Beethoven about the mathematics of music, and likely influenced
Chaldni as well).1
The Oscillator creates a pulse, which vibrates the steel plate. The
forms on the plate are examples of sound organizing matter." Jenny
also "noticed that when the vowels of ancient languages like Hebrew
and Sanskrit were pronounced, the sand took the shape of the written
symbols for those vowels. "Modern languages, including English,
failed to generate those patterns."
Poet Cathie Guzetta summarized this science best when she wrote:
Vibration and sound can be used, like most things, either with
positive intention or negative intention. Used negatively, it's
nothing more than control and manipulation. Most of the world has
been built upon control and manipulation by the way we communicate
thru language. A lot of different texts, such as the Bible, talk
about the importance of just making Sound—whether it's chants,
drumming, or speaking in tongues (such as the charismatic
fundamentalists do), they are just different ways that people are
accessing deeper levels of themselves. I suggest to you that the
Solfeggio Tuning Forks are an even purer ways of doing that with
positive intention.
When Dr. Joseph Puleo was researching the tones, he was directed to
a Monsignor at a university in Spokane WA, who was head of the
mediaeval department. Following a 20 minute conversation, the
I'd heard of do, re, me, fa, so, la, ti, do. I particularly
responded to it whenever I hear that song by Julie Andrews from "The
Sound of Music." I literally have a "brain cell firing" as it is
engraved into my brain, and I see her coming over the mountain in
the movie. I didn't realize this was actually a second, modified
scale. The original Solfeggio scale was actually: UT, RE, MI, FA,
SO, LA.
The 3, 6, and 9
http://www.harborfreight.com/cpi/ctaf/displayitem.taf?
Itemnumber=45416
http://www.m-primus.com/www/de/data/tv/tv.html
jinis WORK can EASY explain how to RESONATE AC signal into ELECTRODES
under resonance ....(R (electrode)being resistive impedance variable
in LC"R" )
In the WORK it was found ELECTRODES reacted with WATER and METAL was
transmuted sample LEAD Pb 206 isotope to plutonium .. U239 ..
The solution I gave was the CAPACTRODE ,using CAPACITORS plates and
dielectric material (as aluminum oxide) containing water as center
dielectric were at ac resonance (multy octave to 2.450GHZ ) water
frequency sonofusion was attained in all the harmonic frequencys of
RF spectrum gamma .
I made an Exeption and posted this, risking another HIT from the bad
guys ..
remember ALL THIS WAS tested ALREADY IN THE lab, ITS APLICATIONS ,
NOT SPECULATIVE BULLSHIT THEORETICS .
Hector
PS :
Dont go back reinventing the wheel (take next step ) dont let the
information be erased or lost (print the goddamed things to paper or
BURN it to NON rewritable NON ERASEABLE CDs.
Its a pity all this work will be gone if they hit the mark and i
die ..
#9623
I advice to reread the patent ..
the secundary firing of spark gap and the stepped discharges produced
from A an square pulse to B stepped staircase pulse into capacitor
banks ..
If only ALF might have realize the implications when i made this
same posting 7 years ago and went EMA-RV his units might have run
looped years ago, reviving the EMA concept.
Again secret is tuning into the resonant states and optimizing use
of the power attained without killing the OU effect ..
Hector :)
#9674
From: "koneheadx" <konehead@...> Date: Wed Oct 5, 2005 8:23 am
Subject: Robert Calloway email about bifilars and radiant energy
Hi all
I got these emails from RC you all might want to read:
"The pulse motors designs touch the edge of what's out there, but
they are not the ultimate way to release radiant energy by no means.
Use bifilar air coils as receivers of radiant energy.
(Have one hooked up to a meter when lightning strikes) I no longer
use pulse motors, except one for show. For releasing pure radiant
energy, it requires a unidirectional pulse with no reversal (no bemf). The
magnetic arc gap is the only switching device that can do this. The off/on
switching occurs when strong neo magnets are placed at 90 degrees to the flow
of arc current direction. 500 to 1500 volts from a microwave oven transformer
controlled by a variac thru large bridge diodes into a large cap
allow smooth DC to flow through the magnetic arc gap that is unidirectional. It
is
a very dangerous method.
The metal surrounding walls in a shop become electrified. Some magnets stuck on
the metal walls now fall off. Any normal coils laying around become weakly
energized. Loose laying light bulbs develop a weak glow. It will scare the
bejesus out of you at first.
The bifilar air coil (series tied) accepts the stuff very well. This
bifilar coil configuration cancels the magnetic field within itself
allowing radiant energy to be received easily. 24 gauge wire is a good place to
start. I will not release any pacific details because there are too
many variable parameters that have to be considered. But this info is
the basic method to start experimenting with. I expect you to be skeptical of
my
statement claim. I would be. But you will just have to try it for yourself.
Be careful, Robert
-------------End of Kone's letter-------------------