Hector Posts Volume2

Hector's Posts – Volume 2, 1st Edition
Editor's Note
This document contains the postings from mostly one individual, Hector Perez Torres, collected at the
yahoo site: http://groups.yahoo.com/group/evgray/. Within are message numbers from 5,000 to 9,999,
the rest left to subsequent volumes.
Messages
#5030
Re: MRA
Progresive cycloconversion along the SINE wave integral matrix using

8 transformers ... 8 musical notes
3,6,9,12, basic combination is 142857 , Later I will post the

visual Holograms for thoose permutations but have to ask permision
to do it first, keeper is spañish guy ..
RV is just 3 points in a triangle in that hologram .
You go from the macro to the micro ...
the thing is take this to 3d from 7,6,5,4d
Its a simple rotoconverter toy and gives so much trouble

just imagine energy transformer-transmutator engines.
O_o ! (:P] OMG! .......
The magic sinewave is 3 cycles per second ... you have to

cycloconvert it in powers of 3 "tesla knew that" ..
I got another Nocturnal Visit & I am pissed of like hell
Once again I dont keep my prototypes assembled so dont NITROUSOXIDE

me and my family to sleep , I wake up wasted and stoned with the dam
stuff, the bastard who took my swiss knife give it back...
Its not OU ..OK ! I will Curse whoever stole it if its not

returned.
Including the Dumb bitch who left the door open on the way out..
Hector
#5040
Re: Kone's 3phase motor
Kone ! 3 ph PM rotor must be 2 poles 180 deg apart for 3600RPM
4 poles at 90deg for 1800 RPM .. N S , n s n s poles ..
I think we got a murphy here in need of correction for using the

3PH stator coils as pulsemotor or synchromotor .
Check old schematics I proposed ... ? confusion came from the

monopolar setup ??

‰
‰

‰

‰

‰

‰

‰

‰

‰

‰

‰

‰

http://groups.yahoo.com/group/EVGRAY/files/AxialKRV.jpg
Notice 2 pole 2 magnet configuration ..
Its 2 rotor poles per 3 stator coils 120 deg relation of rotor to
stator poles angle of rotation .
Hope it works with this correction ,sorry if somehow I contributed

to it ( I was not Aware you used 3 pole rotor or just slept across
it) ?? +_+ .
Beware of Murphy !!!! O_o !
Hector :)
#5041
Re: Genesis
Its the Electron Spin frequency ....
Thermal stochastic transfer works in this region quite well ..
Coil COOLS and RF signal self substains ...
MM took interest in genesis ? use Audio Speaker alloy metal for the
Cores ... FLAT TESLA LC coil sandwitch in speaker end plates will do
fine , watch for that METAL taste in mouth ( field teleport of
metal on EM field Aether stream .. )
Be carefull Genesis is full of surprizes .. some GOOD ! ^_^ ..

others a bit nasty :(
Hector :)
#5049
Re: Kone's 3phase motor
Just be sure the 3x3 setup is cophased properly, but it cant be

defined as standard 3 phase but ROTARY linear sequential phasing.
Advantage of 2 poles is the 90 deg angle of atraction ....
Based in E gray motor design its exact to your 3x3 setup exept your
set is radial configuration ....
Best Force vector will be at 90 deg within a 120deg sector.
Fix shaft use latch device measure torque at angle variations within
a fixed shaft logaritmic incremental load FP pressure ..
A weight lifted "sideways" up to 90 degrees from vertical will

give you a simil, the angle proximity to HORIZONTAL will give you a
reference power curve from 0 to the quantity FP you choose .
You can DETERMINE at What Exact angle your pulse will give best
performance from Vertical to horizontal loading, you only need to
adjust poles and rotor position relative to test rig 90 deg angle of
loading .
Hector
#5058
Re: ferroresonance
RAISE Q, Loss decreases to a point it self substains like VTA

Configure as "reactor core" it self amplifies ( UFO engine )
As Eistein boose condensate is created: certain resonance conditions

create hyperconductivity cooling at magnetoatomic resonance level
were natural superconductivity exist, like GENESIS coil it freezes
to absolute 0 as it works to max potential .. This at extremes as
condition can be exotermic were the Burn out occurs ( usualy were
BROADBANDING and signal aniquilation occurs ) as the Ferroresonance
papers stated .
Any LC haves a SWEET point were it can be taken at N frequency to

maximal Q using x capacitance, core material plays big time here
were magnetic latching HI M field weak remanance hysteresis
character like VTA Conditioned magnets are key to HI OU Capture
in LC system.
LC needs to be Optimized ( No loss ) no welds , no shorts , no

sinks ... Like RV alternator taken to highest Level ,but with
diference it stays on and does not shut down ....
A bit too early to disclose it but as timeline is limited I do ..
Hector:)
#5214
Re: Rotor diameters
Thanks!, as an advance in my search to find ways to lower cost in

making super E PM motor-generator I took a Baldor CDP3455 motor
and prepared its stator to be used as a rotor and its rotor to be
used as stator ... (I posted this before ) I dont know if it made it
to the list. If we see in a dc motor only a segment of its rotor
contacts the brushes 1/5 to 1/20 , so if we fix the rotor and as a
delta 40 phases winding place a diode on each segment our 1 HP dc
motor becomes a 10KW ac to dc 40 phases generator ...
sinse rotor magnets are inside, centrifugal force mantains them in

place inside cilinder also it can be micro valanced for hi speed 24K
RPM ... that increases power to 50KW ... using hot fast switching hi
voltage diodes ...
this thing can generate by moving it with the hand ... what I need
is a manufacturer interested in this stuff and willing to put big
money on it .
Already gave Idea to Aquire Motor manufacturer and use their already
existing lines to create new stuff in days ...
But if the investors keep falling for the scams rejecting the
worckable stuff we are screwd !
In my case I have aquired acumulative problems that require

relocation of ARK Research .
My time is counted ...
Hector
#5215
Re: Rotor diameters
Errata 2 diodes one positive one negative to each segment all
negatives to common negative all positives to comon positive all
wires same lenght .. 40 phases ... rectified 9 degrees each apart
from the other = super low ripple DC doble voltage 5 amperes per
segment .. that is 360V 200A max (72,000W ) surge max (hi speed) ...
7.2KW constant rating low speed ( not Bad )
Interesting for to concentrate such awesome power under 40 pounds .

Tests must be run ...
Error ! OPPS DARN !

*************************************************************
a diode on each segment our 1 HP dc
> motor becomes a 10KW ac to dc 40 phases generator ...
*************************************************************
Hector
#5238
Re: [EVGRAY] ZZzZzzZzZz YAWWWNN .. !
Thank you Erick for the response. There is another factor lurking in the background
of this resonance phenomenon that has been alluded to but not developed into a
discussion item. That is , what happens to the iron core when it is driven into what
I would say is a super-saturated (magnetically) state and suddenly relaxed? Back
when we were experimenting with the MRA I did test with old magnetos to better
understand what E.V. Gray was seeing in his repulsion pulse motor. Old type
magnetos build magnetic flux in the core while the breaker points are closed
which completes a closed current path to ground. When the magnetic flux begins to
reverse in the second half of the cycle, the breaker points open causing the capacitor
across the breaker gap to suddenly discharge back through the primary windings
which causes a very rapid collapse of the magnetic flux in the core. This is where
the iron is super-saturated and there is a very unusual amount of energy that
comes out of the grounded iron core material which is the "radiant energy" that
many have been trying to generate. Give me your thoughts on this. Re-read
the "ferroresonance" reports and try to understand how the iron core material
was literally destroyed in the transformers. The core material was crushed due
to super-saturation during the resonant condition. Norm
#5279
Re: secret to OU hydrogen production is impedance matching?
Yes I have posted that a lot of times ( resonant Electrolisis )

and the Sonofusion water frequencys 23, to 24.5 Khz and its
harmonics up to WATER boiling 2.45GHZ (microwave oven magnetron )and
down to 2.45 CPS the gas action separation is increased ten fold
with it ... what you think got mallove killed ? ....
"resonance and cold fusion electrolisys " the only question I have
is WHO took his prototype and killed him and were it ended ?.
I just hope the greedy bastards dont make a cent on it ...
Its better to give the secrets out than to die with them ...
It may inspire others to do the same in all levels and construct a

world of plenty and progress ..
You can experiment with transverter as vectored resonant

electrolizer
schematics here may help ...
http://www.nuenergy.org/alt/energy_amplification.htm
In first picture your R load is your electrolitic cells

you have to tailor your coils cores and capacitor to an specific
frequency were they MATCH the best gas production of your electrodes
or plates in your gas chamber ... ( requires lab work ) , this
basics are the key you need to build a working efficient system ..
Hector
#5313
Re: big PM rotor
Kones rotor if SYNCHRONIZED to AC will not HEAT as rotating FIELD is

seen as a DC magnetic field it needs to follow not an AC it needs to
resist, only problem I see from a humorous point of view is it will
need a lot of force to fit inside original stator ...
Anyone got a pail of grease ? ...
LOL! HEHEHE ...
Well it does not matter how it looks what matters is that it works
as intended ... Nice BIG Coils will do well placed in proper
distance relation, as I see ROTOR central MASS adds new interesting
equation to the motor as a 12-14 inch 1/2 to 1 inch thick IRON pipe
may add to use as stator coil holder .
Good thing it did not go to waste ...
I think is important to experiment with magnetic mass effects

on coils and PM elements( for new motor design ..) and that is no
joke.
Hector :)
#5363
Re: RV project by Kumaran
220VAC wired 5 to 7.5 HP motors as alternators give best

radiant energy output ,,
in 415VAC they work OK but lower Q .
Hector
#5441
Re: RV/Alternator Light project
A lot of suggestions ...
Ok as you had 51.74825 eff paralleling wasting 48+% ..
OK ! first tune the toy to minimal loading free wheeling no

loading ..
The alternator side seek 3 LCs max energy near resonance with less
power input , Normal ratio of power in to Virtual LC power is 10 to
1 compared to input "minimal '
You READ AMPERE load that means the amperage of EACH LC you seek a
LOAD as filament lightbulb of SAME AMPERAGE ,,,
Sample 220 vAC 4.5454545 A ,for 1000W then in series you put a
1000W lightbulb to that LC .... as it matches LC ampere load .
Entropicaly in logaritmic decay its true radiated power becomes

1.618 in comparison to input "1" ratio 1:1.618 a corresponding
phase shift is reversed as entropy to primemover but is usualy .618
to 1 in reverse relation . in VTA and MEG this number was closer to
1:1.313 relation , 461.028W being 1HP not 746W that is 1000W must
be run with 618W at input at unity power factor same luminance as
lightbulb directly connected 220VAC , this experiments were done
using 60CPS as frequecy increases so does eff% the Idea is to series
resonate LCR as to make virtual power become real manifest within
physical entity of bulb to create a pure current node were voltage
drop of bulb is minimal 19.8 VAC being able to operate underwater
220VAC lightbulb ... as EV gray demostrated ..
http://www.rexresearch.com/evgray/1gray.htm first picture here ...
first experiment with one leg then go 3 phase the reasoning here is
you are dealing with RESONANCE and your loading relation is in Phase
differences and frequency shifting parameters ,,, Dont try water
stuff unles you got 19.8VAC tip to tip in filament ,else BANG!
This is WAY over regular power engineering concepts but REQUIRED as

basic for alternate energy R&D as this BOOK rules are the only ones
properly justifiying theory of TRANSFORMATION to support were OU
truly comes from ..
I recomend this course ...
http://www.ibiblio.org/obp/electricCircuits/AC/index.html
This added to the Instrument you just built and the ZPE book
descripts plus posted information will permit you to test this
postulates in vitro and relate to written concepts that permits you
to twist the rules in your favor and obtain the seemingly imposible,
as this rules are aplied to the models OU becomes a byproduct of
Energy transform , the otherwise unwanted ferroresonance becomes
a source to enhance and amplify power, heat, EM ,M fields become
power sources.
100 years of waste is much more that we can permit , time to set
things strait related to power engineering and aplications ..
Try the SERIES LRC , even here you obtained 7% more power than
standard home generator and 37% energy savings . This Experiments
permits understanding of RADIANT energy and HOW to use it as to
OBTAIN OU transformation states .. If a resistor kills overunity
Circuit has to be TAILORED to be OU as LOADED ...
TESLAS WORDS are so Easy to understand as he tells to tune the POWER

source to the LOADS needs ( He was using RADIANT energy ) that means
his circuit was perfectly tuned in resonance at maximal energy wile
suplying the loads power needs . (Simple)
Keep this notes , copy & compilate as add-ons to your experiments &
notes..
God Speed and happy experimenting ! " much more to come " RV is an
R&D tool seemly primitive but is far more advance than many
university instruments now on use, it will change the way we look at
power in a verry drastic way, to use RADIANT energy you need to
create it,OK!, RV alternator is cheapest safest way I found you can
create it with, no $5 million university prototype or Tesla 10
million volt coils ! a safer 220 to 900VAC range using 3 PH motors
as reverse inductor "amplitrons" verify you got RF with scope ..
Nodes current and voltage related 0 to each other, 90 deg phase !
That is "RADIANT ENERGY" It makes a magnet dance in your hands as
many other still undisclosed things,,,, (partialy revealed)in here
already .. ( files sections ) Homopolar AC transformers and
others ...
Hector :)
#5445
Re: RV. light/alternator experiments continued "the toy"
If you tune RV to a frequency beneficial in radionics bio frequency

it will enhance plant grow ///
Each plant have specific set of frequencys in acustic-electrical
range that afects it, basic harmonics and sub harmonics..
RV is good for hydrophonic farming "pumps" after you study resonant

lightning in RV you can use KNOWLEDGE to do same effect with
transformers and pure resonance treat filaments as L "inductance"
or Inductive resistance ....
You will find also that NICROME wire is useless with radiant energy
stove HEAT elements or WATER heater & stove oven ones do not work
well with this mode of energy radiation is blocked by shield
sleve .
Hector :)
#5446
Re: 1.6
Electrons are transformers as they need energy to self substain

they aquire energy as this energy is transfered to spherical
standing wave strings they create gravity , M field and E field ...
Alter any you alter the nature of the electron "even transform it "
Hector
#5452
Re: resonating with caps
Hi,
Motors are inductive load. That is why in factory with many motors the
power factor goes - lets say below 70%.
Power factor is corrected by using proper capacitors in parallel to

motor input lines. Capacitance neutralises the inductance -> or
capacitive impedance matches the inductive impedance and neutralizes
it.
Resonance = inductive and capacitive impedance match. In factory case

it corrects the power factor. Alternative to capacitors is to use
condensors or synchro motors (or to run synchro motor in RV mode).
Resonance in factories is still heavily avoided, since it creates peak

voltages and resonance damage. So the power factor is not to 100%
corrected but near 95% maybe.
In RV mode there is proper "internal" impedance match and the power

factor correction supplies kVARs (kiloVoltAmperReactive) to the line -
to the inductive loads, overunity.
In Bedini motors and pulse systems the coil is an inductive/reactive

element that corrects the power factor in _batteries_ (capacitive
element). In factories - the capacitor corrects the inductive load's
power factor, but in Bedini system it is other way around - the coil
corrects the power factor of the battery (=capacitor), big magnet
supplies the energy through the coil.
This secret info is encoded in e-books (PDF).
--Raivo
#5453
Music and its octaves ... as colors in light ..
3 are basic 3 more are mix intermediates and
merge as a single one White ...
So is Music and energy ..
Hector
#5456
Re: resonating with caps
Resonance is inverse to power factor and relative to broadbanding

and Q ... when power factor is trashed we get resonance ..
In RV under no loading it tends to be self power correcting to line

but relative to phase relation in rotary mode tendency is to be as
amplitron amplifier were phase elements tend to be resonant relative
to rotation ... the load becomes a reverse inductor were rotor at no
mechanical resistance represents a hi impedance relative to stator
one ..
As loaded it becomes a low impedance relative to stator one

correspondly the curent - voltage phase angles change ..
Its nesesary to understand this Phase relation and how it can be

USED in reverse to attain power saving ...
Reread , many times I have posted idea in ZPE and OU is to TUNE

to OU condition under the LOAD or atain OU in a NON reflective
detuning mode, OU is nothing else than Ambient energy being pumped
into a working system as it interacts with the ambient.
In power factor the reciprocal is used as cophased EM energy

multiplication factor were Atractor M field is lower than atracted M
field in RV rotoconversion mode resulting in overunity .. (already
Explained in past postings ... A rotary condenser In RV mode becomes
OU machine (true EMA ) Electro Magnetic Amplifier ...
NEEd to get that 3D spiral into 4D one ! remember when I posted a

battery is a big capacitor with a verry long half sinewave discharge
curve ? and that Bedini was power factor correcting his battery ...
( I did it with a reason ...) Key element .... (Basic)
Hector :)
#5460
Re: mechanical switching for inverter?
--- In EVGRAY@yahoogroups.com, "hamey34" <carobana@c...> wrote:

>
> Hi all,
>
> I am setting my RV here in Australia where we have 50cps grid
power it seems as though 60cps is more efficent.
Relation of frequency core mass & winding impedance is KEY to

alternate energy R&D .
To find OPTIMAL frequency and voltage performance of MOTORS becomes

Survival weapons on energy starved world ...
#5466
Re: mechanical switching for inverter?
--- In EVGRAY@yahoogroups.com, "hamey34" <carobana@c...> wrote:
>
> Hi All,
> Thanks for the feedback I wonder how they overcame the ringing effect
> in the transformer
Simple the used multy-vobrator arrangements using the ringing of one

to drive the other , condensers and filters stabilized frequency ...
On coaxial solenoid driver I have to wait as have no money to

reconstruct the experiments that were losT hurricane Georges
Its RV equivalent in Solenoid technology but FAR more powerfull ..
than a motor rotor EM PM or Squirrel cage .
Hector :)
****#5501
#5486
Re: Energy 21 guy is in Australia.... Chance to RV him up .....
5HP x 746W = 3730W /.84eff = 4440.47621W
Minimal for standard 84% eff 5HP motor ....
LOAD or no load ..... on loading can be less on some motors designed

for (*sic) optimal performance when loaded :P''' COFFFff!!!
in RV mode motor is Rerated to .5 to 1.8 HP but with the power on
demand less waste RV mode operation..
Other Advantage ..I am still alive and this can be taken to other
levels as is understood "230 more projects to go" ...
Some basics are understood as replications are made ,but people have
no idea were this can be taken to, 250HP motors weighting 1 pound or
less at room temperature
and that is simply toys ....
Hector :)
#5508
Re: Question about RV
Power Factor allways reflect as a lagging phase current you correct
it you get more power at the end were you need it ...
RV operates at Hi impedance broadbanded semy resonant state were

loading takes it to a more narrowbanded stage of resonance were the
EXTRA phaSE TAKES THE power FACTOR LAG AS A leading ANGLE IN EXTRA
PHASE, VALANCING INPUT POWER FACTOR "Unity" .
If we suply ROTOR with EM or PM with MF of mayor magnitude the

ROTARY condenser Becomes Electro Magnetic amplifier "EMA"
I have Explained this like a trillion times sinse 1980 ,one more
does not matter ...
A rotary condenser operated as RV EMA can save 40% of any house

power bill ... can also be used for cogeneration ...
There is the lab work verification to prove it werever needed ...
Hector :)
#5517
Re: Energy 21 guy is in Australia.... Chance to RV him up .....
250HP motors weighting 1 pound or

less at room temperature
Hector :)
Hector, I sure hope you can elaborate more on this soon, because I
can not even imagine how this is possible.
John
**************************************************************
Nicola tesla got 1000 HP from a 14 ounce (GERMAN silver ) (Type of

stainless steel) disc......
Rain can elaborate more on this with the preliminary Electric

turbine testing he did ...Based in my postings ...
concept is simple higher frequency higher speed Equals more HP per

pound so as stated before 50 KW generators are posible and easy .
US AIR force developed a cryogenic generator the size of a beer can
with a capacity of 5 MEGAWATTS non-cryogenic RF can easy go 50KW
per pound , with special rotors and low cost this can be the future
as transistor was to the tube, RV is as this simil to standard
motors and generators full advantage of this factors can be taken
with RV concept , the only problem is RESISTANCE and agendas ....
What took the AIRFORCE 35 years to develop was already in teslas

patents ( they only had to read all 790 of them to understant it )
in a 6 month period (Easy) .
This technology is OLD to me , its used already in primitive form

as LOW end Gas power stations 75KW turbine generators, the CORE
and rotor weight less than 10 pounds,use titanium shaft with hollow
core take it to seven ,use PM NB thin core shave it to 6.5 use
Aluminium sodiun coper alloy wire take it to 3, use sintered EMF
profiled cores take it to 1.5 LBs use CORELESS axial 5phase 72
degree logaritmic vector alternator design and you have 100HP 1
pound motor with 99.98% eff ... (EASY) no sweat ...
What is needed? and "EDUCABLE" engineering team and money to

burn ...
Hector ... :)
#5531
Re: DCPMRV
NICE ! :))) to do what no others have done !!!!!
RV PM MOTOR idea is AC DC true brushless ADVANCE EMA type motor, you

VERIFIED in vitro that ANY PM or EM rotor can be converted to EMA
electromegnetic Amplifier motor , NEWMAN ,BEDINI motor is indeed
within that EXISTANT motor, a 3600 Syncronous 3PH motor can be WORK
as DC motors using 6 switches 3 positive 3 negative in positive
negative pairs to each A,B,C, Phases in single phase an H switched
bridge drives the PM rotor , timing angle and PULSELENGHT then are
key to POWER factor correct your batterys, EMA effect with RV
operation mode ....
nice !!!!! Step ^_^ to mayor change ! no wonder lately the

interference is goin up, Darn ! there are ways to specify special
ROTORS and convert standard 3PH motors to RV syncronous PM type
motor-alternator ..... If I were able to find an intelligent stock
exchange broker with balls something interesting might be done.
Still wondering were in the Hell westinghouse reincarnated ... ?
Hector :)
#5540
> > I also have an 1800rpm, 12KW,3 ph, 110/208 generator head that
I
> would like to mate to an RV motor.
> **********
> Can this Generator head be wired to 460VAC? is it brush or
> brushless EM rotor ? as to make it a POWER factor Correcting EMA
> engine ... at 120VAC
> **********
OK getting deeper here if this Unit can be made to operate in 460VAC

and if rotor EXITING is done by 2 ring brushes ..
As from a delta 208-240 Be rewired to a wye 460VAC it can be USED

as EM EMA motor and RUN with the inverter as to get minimal current
with ROTOR exitation .. at X shaft load ...
or to be USED as SYNCRONOUS condenser to cogenerate KVARS into home
system as POWER factor correction same as the "sundance" but this is
the REAL stuff not the rippoff scam ... 30 to 46% energy savings .
RV is used to take gen head to synchronous speed This is done with

proper gearing as head is taken to speed it is switched into power
line and rotor is exited to provide leading KVARS into the
synchronous system .... exitation is adjusted as to minimize home
Amperage use as measured at Utility power meter wires ....
RV can be OPERATED from solar cell battery inverter system as to

OVER accelerate rotor providing leading rotary vector resulting in
TRUE syncronous cogeneration RV inverter can be operated at
Variable frequency mode to do this ... ..
For Ideas Study POWER factor Correction ... and my comments on EMA
related to the use of ROTARY condensers with RV and in RV modes ..
http://www.ibiblio.org/obp/electricCircuits/AC/AC_11.html
Hector
#5546
Re: RV test results , On that 1800 RPM generator ...
If its Connected in DELTA you just need to rewire it to WYE

soldering ring terminals to wire and use a terminal strip to make it
R&D parameter variable say to have 12 lines to configure at any
voltage or combination ..in many units this lines are tied and
bundled but can be wired to identified wire terminals as to do
what I propose...
Exiter you just need a VARIAC to control DC to the EM ROTOR
field .. Fan can be REMOVED for RV operation ... original Exiter
is modified for selective operation , variable Rotary condenser or
as stand alone generator ..
RV as mentioned before is Used to take it to speed you switch to

powerline and exite rotor to correct your power factor
Sample you have 100 Amps at utility line .... you start your
generator as Synchronous condenser (first tests can be done at 230 )
using 2 lines ... synchronicity can be measured with 2 230
lightbulbs in series as they turn OFF you switch condenser to line
and start powering up the Rotor EM field as theory HOLDs your 100
amps will beging to drop down 20 or 30% ... that will be your power
bill savings .... From there you can go to 460VAC derating to lower
power but under EMA operation mode ....
With PM rotor in Synchronicity you dont need capacitor to mantain

rotation with Powerlines ...
Your GENERATOR BECOMES an EV GRAY EMA 4 RV MIX motor but at low

voltage ..
If rotor is made with PM (permanent magnets) and windings are

frequency and pulseleght driven it surpases any other motor ever
made ... ( I already tested this ) ran out of money .. but theory
is same for up to big 1 mw units (just be sure to keep them away
from hurricanes )...
I can design this unit to weight nothing but untill proper funding
apears we eat dung ...
Hector :)
#5565
Re: Got my RV motor going
Vectors are defined as Fordward force and reflected force in AC such

Vectors can be measured as phase angle relation be it voltage or
current "Phasors' in DC they become linear potential positive -
negative differential with N" joule force as capacity and voltage
discharged at x time within entropic logaritmic decay until it
reaches 0, " Valance " .
That added to kone definition helps a bit more, from power factor
correction to EMA & ZPE this definitions contain the knowledge to
justify their workings ...
This is one of the best info Stuffings i can find, verry helpfull
for RV & R&D stuff ... reversing some of the "Equations" &
aplications is the KEY to energy transform ....
Hector:)
#5566
You Will be more pleased if you Study the EFFECT covering the FAN had
in the RV ... This principle is the ONE REQUIRED for the THERMODINAMIC
TURBINE REACTOR Tesla Proposed 100 years AGO ....
To put a hurricane in a box generating energy from Ambient heat ...
as RV this is "Another Toy" but is quite more Expensive ....
From that moment on I need an Army to protect me ..... as that is true

energy from the vaccum .. and is mechanical in nature ....
cyclone vortex energy ... "Absorbatron engine" Thermal reactor

converter .
Just ask WHY motor energy needs go down as you cover fan and HOW
the Thermodynamics LAWS can be "Raped" with it using "gravity" !
With the money and R&D institute .. you will see what I ment with this
being "toys" ... (I need to win the "war" first )but that I cant make
alone ....
Thanks !
Hector :)
#5580
Re: For Dan about 1500 and 3000rpm motor combo
Runing Alternator at faster speed is no problem , just watch the

voltage and be sure motor has Inverter use grade "2500V hipot "
to play safe on the hi voltage issue ....
nice is to have variable speed as to search CORE best frequency &

Q some motors make it to 30KHRZ as rotors explode and
desintegrate ..... small 3phase motors testing ....
hi frequency compensates for size ...
47 to 450 CPS are good RV frequency range 100CPS is a good

frequency many systems can tolerate just use bigher gears to
step down ....
Hi frequency = smaller motors = higher HP
In 1980 I quite discused this with rockwell aerospace engineers I

was shown things that aparently you will never see , exept if I
teach people how to do them ...
The main problem is not technology its the dam corporate greed ...
It is time we all piss on them ..
Hector :)
#5582
Re: startermotor commutator in DCPMRV
PM rotor makes any MOTOR an EMA motor, Kone take a look at Raivos
Cad design ....
take also look at standard generator POLE design to design your

rotors that is the right design , other advance variations posible .
DARN ! how much i need the darn funds & the lab, I am tired of
eating Dung ! so much frustrating interference ! ...
Hector
#5584
I Uploaded the + biasing conversion for it spikes & CEMF goes back to
battery for transformer operated inverters I get +.02 amps goin back
to battery from transformer "idling " if it was not for the driver
board load of .9 A this thing is WAY OU ... At resonant modes....
Hector
#5594
Re: DCPMRV goes 5000rpm
Quite specified in postings that PM RV was something else and OU out
of the box if put to work in DC pulse or as a hi impedance rotary
condenser in AC, the HP limit due to POLE slip is eliminated giving
it 50 % to 90% more power, There are many EXPIRED patents on PM
rotor designs that can be USED in conjuction with PUBLIC RV PM ROTOR
information and aplications ..
Every 3 PH Motor out there can be made into a PM RV , I realy wonder

why in the heck investors and people with monetary power have not
started to pump money on my research and make reasonable offers to
develop it further ....
In part is because the I can do this myself and greed ... the bad
things is for a misserable toy they miss the "mother load" ...
Whoevers gets to me FIRST gets it ... (If they can get pass the
interference) thats it .
Another "Murder atemp" was performed on me it will take a bit to

restore molecular cortex integrity using XL100 technology ...
I think this bastards will not stop until they are incenerated from
the face of the earth ....
Their wish is my command ..... "I will walk on their ashes"
I warrantee that ...
Hector :|
#5604
Re: ö
In the files section you can find homopolar ac transformer and

the description made of it is within the posting files ,
A coaxial homopolar device can be made RV reverse induction driven

as RV alternator as can be lineary configured think, 12.7 volts
at 3,500A at 1 to 5 power ratio .
That is what I want funding for .... and this is still another
toy ...
Hector :)
#5641
Re: New file uploaded to EVGRAY
Using the 220 AC from the RV alternator LC you can bridge in DIODE
plug 480VDC or bridge mode 240 DC for a constant 5 to 10 amperes
and switch alternatively to inverter charger inverter charger as it
reaches 13.8 V (using 2 batterys, it will take a shorter time to
charge in vectored 220 DC as internal resistance is reduced
proportional to the voltage increase ...
You can initiate with bridge shorted with on switch that you
turn "OFF" to charge battery "on" .
Rv is the first device you turn on by turning a switch off ...
HEHE LOL!
Just watch out for the COLD fusion effects
This is a WAY to loop RV ... not the one,I liked but is a way to do
it fast and Dangerously "cheesse" ... just design proper cuttoff
as Batterys are not designed for radiant energy (just be carefull )
loop using intermitent battery exchange ... limit to 13.8 VDC too
fast rise and your inverter silicon will go fusion-fision with the
in vitro familiar blue toxic smoke :P
The cheesse stuff is an orange salt that forms at poles usualy

transuranic in nature and "HOT" "buy rad meter " as pb 206 creates
some problems of its own with the cold fussion stuff ... for thoose
loving danger and weapons of mass destruction sonofusion frequencys
are
23 - 24.5 khrz 245- 348 CPS Sub harmonics up to 2.45GHZ

(microwave)frequency octaves .... passing signal across magnetron
using the radiant DC vector creates a fusion reactor using RV
alternator , as RV alternator can hit 10KW energy level creating
100KW sonofusion level .... plug is vectored across magnetron at
800VDC level = is sumerged in water (expendable ) one shot long run
Usualy pb 206 hydrates aquiring SI 20 atom and jumps to U234+1

then aquires another IS20 clusted becoming americum 241+10 (251)
witch decays again to produce k40 and PB205 so for thoose wanting to
built their own K40 mini nukes this will be verry interesting K 40
is ultra stable until hit with proton initiator discharge the darn
thing goes nuclear , a cigarette pack size can carry a 20KT punch .
MMM interesting to initiate the hera of the home made nukes !
OPPS ! its public ! AWW too late who gives a fuck !
Hector O_o !
#5695
Re: DCPMRV no of poles?
Once the LOWER intensity field atracts the higher intensity one (PM)
rotor the INDUCED CEMF will surpass the power required for turning
motor ... BECOMING true EMA engine ....
OU ....
Just immagine a 99.8% efficient laminate of a 10 HP motor working

with a perfect PM rotor ....
Were is Georges Westinghouse when we need him ? ..
Hector ;)
#5701
Re: PM rotor question
Must be 4 poles nsns exactly at 90 degrees from each other ...
Hector
#5702
Re: PM rotor question
Modulation heats Nb PM to death so if its strongly modulated they

will deplete ... (The Zipper still remains unziped for this reason)
But quite Exact if I say EMA with PMs like Kone said is 4X more
power and RV with a properly design PM rotor is 10 X a conventional
motor in RV mode ,,,
This Motors can be produced now "cheap " , they are also produced
as "servomotors" with a few changes in its design they are made into
super EMAs .
The preliminary testing of 40 phases motor puts windmills in 10KW

range any baldor PM stator motor converted to external rotor and
rotor converted to internal stator can be used .
I got several fanuc servomotors that can be converted to SUPER

multyphase EMAs its a thing I told ALF from the start and I agree
with kone in same line of R&D EMA
rotor can be PM 2 pole and stator 3 Pole 3 phase , it has to be
understood that this 3 poles create a virtual rotating OVAL field
"like an immaginary wankel rotary motor" we just need to visualize
how this fields are created and rotate ...
With the proper FUNDING this can into production in no time but with
people preprogramed into a self fuck status nothing can be done.
I will opt for separation of the system .. so ash start looking for
that BIG acreage somewere because thoose RICH guys with money will
NOT have this technology & not will be welcome into any comunity
having it when shit hits the fan , (We will nuke them ) ... when the
time comes ,if they dare to interfere in our afairs ..
I am Talking clearly thoose helping Us will be helped thoose on

greed agendas will be left to rot within the system entropy .
When the Tagging starts ,"when people are injected with the
electronic ID " the ORDERS are detect tag, kill the carrier
people giving away their souls for life and security will loose
security and ultimately will loose their lives as they become
detectable liability (intruder Bait) the mentality leading to
accept the "MARK" is the same mentality that warantee them to be
non-desirable for human progress (Automatons to be eliminated from
face of the earth ) as servants to "black dark forces" deevolving
entitys.
no survivors, no prisioners, no remorse ... ( I warn out of this

because we KNOW the real agenda behing the TAG ) and it does not
have to do a shit with religion or conspiracy theory .
Time is OVERDUE to start doing things ... and time for all of us
to "dissapear" from the system I dont realy want to think is 12 or
14 family groups . I hope it can go into 150,000 before the
human "HERD" are started to be tagged like animals, here in Puerto
Rico they CREATED and Staged child kidnapings then came up with the
Child registry and tagging system as a solution ...
It becames Obious as the type of victims they choosed and impact in

comunity .. Even used the EBS to Hammer in the panic ...
YEP ! your kid is safe ! later in adulthood he disents we locate him

and microwave him to death !
THE chip IS THE ANSWER TO PEOPLE ABILITY TO ADAPT AND DISTORT THE
WIRELESS MONITORING NOW IN USE ALTERING THEIR BRAIN WAVELENGSHT AND
EVOKED POTENTIAL SIGNATURE MAKING MONITORING AND CONTROL IMPOSIBLE.
APART FROM THE alternate ENERGY TECHNOLOGY WE MUST BECOME aware OF

THIS TECHNOLOGY ..
Read :
Princess Petunia
4/26/2005
1:09 pm EDT
Robotized People
Has it always been the case that so many people have trouble
thinking for themselves, or is this a phenomenon of modern times? So
many people can´t figure out a problem if they can´t follow a
specific set of procedures. Abstract thought and concepts are beyond
them. People who think like this are more likely to blindly follow
an authoritarian government, as they don´t evaluate the set of rules
set before them. Those who would force their rules on others are
serving the nazis, whether they realize it or not. Truly spiritual
people are anti-authoritarian and embrace the freedom to think and
evaluate systems.
(END)
********************************
I think I am not The Only one Becoming aware that we are

encountering an engineered phenomena not a natural Human
evolution problem ..
the Farther you go back in archeology the more ADVANCE items and
ruins you find, until you encounter UFOS, computers, teleportation
and time travel .. (and the same self destruct dymamics we find
now ) that caused civilization demise .
Hector
#5741
Re: ON plywood PMRV And PM Motor Multyphasic dynamotors
The PM ones Outer Stator is placed in cup at end of shaft ....

the rotor is fixed to a plate as to fit like original inside but is
fixed to it non rotating , the commutator is then diode bridged as a
multy phase alternator , if laminate is good quality Who cares ?
that is my point with the BALDOR motor , got near no rotor drag
unloaded not like the current PMAs that need to be turned with
a wrench ...
sinse you want coreless get one of this pancake motors used in GM
cars ...
Disasemble rotor & tap the 111 wired leading out of it and diode
bridge them with 222 diodes + - rotate casing install rotor
fixed ..
at 60,000 RPM will give you 10KW of power As a motor its 13.4 HP
No core .....
On Core Issues I cant believe A silicon Iron nickel core with a .03
% loss cant be better than a wire winded NUT & bolt or blacksand
Epoxy Core in a bathroom tissue cardboard center used as a mold
Its like saying A Newman motor can outperform an RV in ac ... under
load ..
An AC motor with a 96% eff must be better to Use as EMA than any
other homemade system ...
Just PMng the rotor properly ......
Hector
#5754
Re: off topic
More Info ....
PM stator made into rotors are A OK for hi current hi speed low

voltage dc generation 10 diode rectifiers from standard alternators
work the 33 phases (DELTA) 10.90909 degrees ...
you can fire 3 phases segments in pulsemode to get not 15 but 100HP
at 30,000 rpm ... "depends in laminate quality"
preliminary experiments can be done with PM fan motors ,air

conditioner FANS , wiper motors , blower motors or any PM
stator brush DC motor ,,,,even with HP printer motors (brush type)
or kid toy motor (3 Phases ) ....
This is quite A revelation and revolutionary engineering aplication

for this kind of motor winding .
Still waiting for "Ambientalist" support for this ... What the heck
is happening with this peoples brains !
I am not surely sure I am inmortal so they better get their act

moving .... (As I will not test this in vitro) ...
(The inmortality stuff) ''
Hector :)
#5760
Re: On Laminates & deception ......
Just disasemble toy motor ( 3 phases)
disasemble car wiper motor 12 to 24 phases depending on make ...

Datsun car alternators use 4 phases 8 diodes 4 + 4 - .
Each commutator segment is a phase they overlap at 360/p were P is

number of commutator segments wired in DELTA , read Tesla 3rd brush
regulation "He was Telling something BIG there " but no one
noticed ...
Hector
#5824
Re: RE effect
Look for the Homopolar transformer little schematic ,,,,
A pipe smaller inside a bigher pipe BUT with SAME MASS "weight per
feet "
Power is taped from OUTSIDE pipe , wile inner pipe is in SERIES

with RESONANT LC ....
I posted this 5 years ago in many groups and had reposted it many
times .....
The Famous Egray RADIANT energy Tube is HOMOPOLAR RF AC TRANSFORMER!

"Basic" ... RF matching transformer ..
Aplications require lot of experimenting ( That is what RV is For )

as its alternator as a RADIANT energy generator & amplifier
does the same as EGRAY motor & TESLA Amplifiying transmitter but at
a lower cost.
RV is alike LASER in the 1950s people still dont know what to do

with it ... But Once its utility is understood and it Makes its Way
into UNI labs the world will be changed by it ..
As the WASTE in current system will be unmask (non-justificable)

in view of logical energy conservation issues ...
The Most common issue and argument I have found is that HEY ! its a
7.5 HP motor and is reduced to 1 HP .....
I say OK find me an standard motor that uses 40W idling with NO

Microprossesor managed IGTBs or SCR regulation ....
(There is none ) ...
Its too heavy . ( what aluminum frames and carbon fiber shafts are
for ?
LOW HP per weight ... What Hi frequency electric turbine operation
is for ... ? Weight to HP ratio increases to the square proportional
to frequency (and Q factors )
It slips magneticaly at slow speed ... (what PM rotors are for ? )
Pulsemotor Modes, and true Computer power management and recovery

are for ?
For Every Debunker excuse there is a reply untill only a PERSONAL

agenda remains ...
That one can be dealt in other ways ....(Publication is one )

Some can rant all they want and try to prony brake RV with their ass
cheeks untill the smoke reaches their brains, then they realize
their asses are on fire .
History is always full of people that resist change for the "Heck of
it" to maintain their security within an stagnant system bent toward
self destruction ..
Even with working models we have to face that day to day ..
incredible but true, the other resistance we find is from thoose

that recognize RV value but want to burry it untill they can patent
it themselves in a "modified" aparently different Form ...
3 and counting 5 more to go , thoose are the ones that ask for info
and are backstabbing and sabotaging every effort made to obtain
funding and resources, the ones debunking and discrediting the
technology and R&D werever and however they can.
Traced to GOVERMENT, Corporations and University alike .....

With intent to "FIX" and apropiate the technology to their standards
and controls ..
Hector :)
#5826
Re: RE effect
Remember the Rotating 3PH transformer fields, same is aplicable to

motor stator and ELF waves ....
RF is quite difficult to manage as the Turning things off to turn

them On using resonant LCs and how a SHORT can be of lower power
expenditure than a resistor as that short is turned "off"
As Pcon "ED" on his RV LC experiments ....

Its OU even if its Heavy experimental stuff and not as efficient as
a specifically enginered to be OU stuff ....
The Part of RF and sonoacustics is something Science has not EVEN

TOUCHED properly as the idea in engineering is to AVOID resonance
and AVOID noise, consecuently they AVOID expontaneous transform,
this phenomena creates like the sample posted here of ferroresonance
on a comercial transformer were I indicated to analize the frequency
spectrum in search of harmonics .(Old Post)
In we Delta match a series of Phased LCs using homopolar AC

transformers creating STAR loop, once initiated in Hi Q the system
never Turns off taking the self feeding power loop into a self
destruct hypersaturation state creating energy singularity within
the rotary elements ....
That was the Thing missing from seike formulations and his Reverse
atomic reactor design and theory .
This is aplicable to Norman MRA as well to any hyper Q system
The TV PLUG (transverter is used to EXTRACT partial Energy from

rotating STAR reactor using parralleling parasite LCs combined with
the Homopolar RF transformers.
I tested this theory using AM and FM comercial radio final stages

matching networks as well as Amateur Radio equipment years ago.
It can made a difference if we stride to change the system ..

this technology is so powerfull it can poke holes in the Sun
(Tested in vitro ) "no details", Bearden Knows ... But the coward
chickenned away :> Maybe afraid ETs may Phone home as papa smurf
descend from heavens to spank him ...
Sorry for being cryptic , just dont LOL! yourselves to death ! !
LOL!
Hector :)
#5830
Re: RE effect/splatter coils in RV
In RV ALTERNATOR at RESONANCE the 60CPS turn into ELF RF RADIANT

energy sinewave ..
Magnet vibrates strongly as its aproached to active LC wire wile in

RV primemover input wire is minimal ..
the ENERGY required to induce current and voltage in a METER that
responds to true POWER in order to move a needle (Analog) is real .
As per picture 120200x.JPG in ARK files section ...Analog or digital
meter responds to a REALITY ....
IF there is a condition that causes a FALSE reading then my argument

is what can be done to ENHANCE the phenomena that CAUSED the anomalic
reading , as METER respomds to energy then a DEVICE tailored to
RESPOND to this ENERGY will work with it (TUNING ) being the key to
this transformation.
The mentality asociated with debunking ZPE energy R&D must be bended
back to the source and shoved hard in the same logic such minds use in
their arguments, repetitive of the old you cant do this human
stagnating retrograde mentality ..
If a piece of WIRE tells me in a meter 1500W are passing thru it

the mechanics to indicate that are the same required to extract
such energy if it Exedes Unity ..... A meter uses x value of
Resistance at a given value of Voltage & amperage to obtain a reading
this deflecting proportionaly a neddle or rectified & dumped in a
resistor and converted to digital reading ..
The FALSE power is quite real ...
As Resonance is wished for then Power Extraction

as enhanced OU effect is also wanted ...
RV alternator Generates RADIANT energy Sinewaves ....
And can be used to generate any kind of tesla wave using

SCR trigered pulsing system ...
Hector
#5831
Re: big DCPMRV scope shot
You have 2 different impedances interacting , one bandspasses other

filters , you need specialy modified Vectorscope to see the signal
in realtime 4D in a given timeframe .
Or use 4 channel scope in combination with audio spectroscope ....
Hector
#5835
230 VAC 1 phase use 100uF to see if it goes to 9-10 amps 226-236VAC
Use only RUN winding in ALTERNATOR 1 phase as LC ..
In one phase I tested one of theese 5KW ....
This is 7.2KW
http://www.harborfreight.com/cpi/ctaf/Displayitem.taf?
itemnumber=45416
used as LC alternator the 230 winding as self exited LC can produce

7.2KW x 1.618 = 11,649.6W radiant resonance with some 470W
input ... in need to be optimized as I went low (overbudget) and is
now in storage.
Oh! when The Grants! OH! When the Grantt Are coming IN ! .....
LOL! GOOD for boosting BINGOMOTOR generator output 1800W

. bUt JLN did not Even answered the darn Emails ...
Ferroresonant Electrolisys & sonofusion ...
Remember Mallove ...... he went public (The wrong Way ) ..
http://jlnlabs.imars.com/bingofuel/html/bfr5hpgen.htm
Just think:
Eliminate the darn carbon rods use stacked capactrodes as hydrogen-

oxigen generator and RV alternator as LC sonofusion resonator ....
Be carefull , Bingo can go bango on this mode ...
Hector
#5838
Water AC capacitors .... CAPACTRODE "Insulated electrode "
If Ac is passed capacitively across insulated plates the inner

insulated surface acts as electrode I designed that concept for COLD
fusion ....
the Water disasociates within the charged surface region at n change

x voltage z frequency within a given resonant NODE in LC
configuration within a given area ... water becomes its own
electrode ...sonofusion easy attained in RF radiant modes
if plates are stacked the charge in series produces more gas than a
single chamber using same current as in hi Q resonance water
becomes superconductor metal
Frequencys all harmonics of 23,to 24.8KCPS
Hydrogen is a METAL ... deuteriun amd tritium also ... compacted to

Hydrogen 21 " SI21 " it creates cold fusion ...
After normal water disasociates heavy water remains in the chamber
Why you think mallove was killed for ?
It was not for "planting Roses" HEHEHE !
He constructed a model, went greedy, but choose verry unwisely to

whom he showed it too ....
I invented the capactrode concept trying to find a way to eliminate

electrode wear in electrolisys gas generators and charge purify
water ,its one of the 230 proyects i have and I posted and explained
it public long ago in this same forum ..
Shared With mallove the more "deep specks" ....
I searched and it seems to have dissapeared ... so copy and keep now
an you can bet SOBs forum leeches are ready to patent it ...
I used zaphyre,pyroceram, pyrex , glass quartz and other materials

as well , concept works well and haves many Uses specialy in COLD
fusion , were it can reduce the price of reactors dramaticaly ...
Use wisely keep public dont go greedy ,dont get killed ....
3 PH resonant capactrode rotary sonofusion reactor is a reality
and is part of resonant RV LC concepts ...
100 W in 1000W out is average COP 10 but is not a toy , requires

NASA Eghead brain to built (and I think even doctorate level ones
may still fall wanting ... )
But that does not mean you all cant try the capactrode concept
IN DC is also a far out concept ... just beware of the Radiation

blue light ...
Water does realy strange things used as a "capacitor" dielectric ...
For your Information ultra pure water is NOT conductive ...
Under a charge it BECOMES a POLYMER ....

As a polymer it can be programed to phaseshift into SHAPES &
forms .. this responding to Human PK commands ...
in a few century you all can learn to use this ......

but not under this systems of things ..
Hector :)
#5857
Re: "...water becomes a polymer..."
You are making hydrogel ....
I am talking that at specific frequency & magnetic-electric field

water becomes SOLID and 12 times stronger than diamond .....
holding awesome levels of energy ...
by polarizing such Water into mathematicaly programed shapes we can

built anything with it ....
(Just pure water ) 110% pure avove pure .... (Morphoelastic)..
Some of this material hAS BEING CREATED BY ATOMIC DETONATIONS IN

PURE ICE ...
ITS CALLED mega-ICE related also to UFO phenomena ...
Hector
#5865
Re: Digest Number 1123
You may need frequency and pulselenght adjusments in normal DC to DC

H network inverters the Upconversion to Hi voltage is adjusted as
to EXITE the ferrosplana to OU states charging the capacitors under
sinusoidal logaritmic standing wave... the H network fires the
capacitor charge as also frequency and pulselenght adjust ....
Logaritmically they are OU ,Early TRACE switchers were 150% eff but
they were Instantly removed from market as also early DEC digital
Electronics Corp voltage inverters were also OU .
Current INVERTERS can be made to be OU but FCC required Noise

snubbing and parasitic frequency producing crystals were added to
ferroxplana mixture (Ferric strontium titanate cores ) as to make
resonant cores as noisy as posible ....
Redesign the circuit and modificate to RING ... What you do with the
OU is personal issue ....
as before I dont recomend looping ...
Hector :)
#5871
Re: Digest Number 1123
I think we can live with the noise .... I was being informative that
audible NOISE = OU in ferroxplana cores ...
60 CPS resonant transformers also go acustical .....
Hector :) no need to remake Wheel ....
#5894
ON lightbulb, Idea is to MATCH amperage of LC with bulb resistance

so ....
sample if 3 amps then is 2x series x 4 parralell (4 groups of 2 120
lightbulbs in series to match 240 LC voltage at 3.3333 Amps!
Here the MASS relative resonance in NODAL segment becomes revealed

a single filament matching the AMPERE load of a resonant LC will
light at current node Under a MINIMAL voltage drop but giving Same
POWER output than a conventional lighbulb, this is what EV GRAY
called COLD electricity.
AMEN !
:P
#5899
Remember R represents a series L to L and series C to C and reflects

as such a purely resistive load were RA and RV are theoreticaly in
phase at a 0 angle or POINT in SPACE, like the center of a valance
in equilibrium .
So the REAL value is a virtual Ampere load as seen by the pure LC

were Voltage is not reflecting the reality of that point but shifted
to other point within the circuit ... Node , Anty-node
In ZPE and magnetic amplification this is the difficulty the experts

stummble and fall face into the reality every part parameter
reflects in the other ....
A battery by sample , its L its R and its C ,It has an Intrinsic

resonant value as an unit or its parts , its a self tuning on state
device with thoose R,C,L values being VARIABLES within a working
unit ...
Reason Konemotor was working in OU - non OU cycles and reason

Engineers failed to analize properly, ED also met the wave within
the Wave oscillations in a partial loop ...
Idea is to optimize energy use then to be able to use OU transform

one ...
Battery as seen by L from a rising AC half sinewave is

C "capacitance" when CL frequency Equals THE WAVE FREQUENCY POWER
MULTIPLIES BY 1.618 IN LOGARITMIC EMA , this multiplied also by Q
EMA factor ... gives OU gain over Isotropic virtual dipole ..
A need to Know in deep Bedini and KONE design and the term I use
that BEDINI just POWER FACTOR corrected his battery ...
BE in any form ...
Same rules apply...

...
Increase C in LRC to compensate R broadbanding loss
Step By step the knowledge is aquired .... reason for the RV tool in
first place , learn to produce radiant energy and how it manifest in
the rotoconversion effect, impedance match in power engineering
aplications using 3rd generation technology .. (Energy saving) and
EMA R&D ...
Working with the toy makes the difference thoose things that are
aparently bothersome are the ones with the "secret" answers .
The reverse of aparent loss is GAIN ...
If mathematicaly we have Sine & cosine is obious in energy we got

same manifest that represent energy transform ... The famous
Negentrophy bearden mentioned so much but failed to demostrate
others..
(End)
Local temperature 110 F

and global warming is conspiracy theory ....
I am feeling theoretical immaginary heat

and roasting myself in my non existant sweat !
http://img.lop.com/images/glp/images/icons/flip.gif
Hector :)
#5920
Re: RV R-load tuning
Remember the LCR demo is key to understand RADIANT energy Relation

not itself as Standard method of aplication ....
how it aplies to OU is on the Transverter plug design ...
In a PM rotor the Magnet Translates as Inductive VA energy goin into

a capacitor (transform to VAR) the RELATION of L and C being
RESONANT radiant ONE in half LC diode vectored Tank the OPTO
isolation circuit and BLANK energy firing non-reflective to source
Stage is SECRET to EXTRACT ZPE energy ,,,,
Out in the net sinse 1998 (Posted in JLN ) and public sinse first
discovered in 1979 given to Energy Savers inc in 1984
as "suppressed" Energy Saving lights ...
Also given as Resonant "H" driven HI frequency inverter system .
Used as Exiter method reverse induction in POWERPLANT EXITERS ..
AS .....
www.harborfreight.com/cpi/ctaf/Displayitem.taf?itemnumber=45416
#5945
Re: [for hector] biocompatible musical Spectrum frequency in Resonance
Color Frequency spectrum converted to ACUSTIC electrical Sub-

harmonic Equivalent. Musical Tones
http://www.riferesonator.com/bio-electro.htm
http://www.rt66.com/%7Erifetech/
http://www.rifetechnologies.com/
http://www.dogpile.com/info.dogpl/search/web/therapeutic%2Bmusical%
2Btones%2B
(Infinite )
Hector
#5969
Re: more photos of 16magRV
Kone the potential of this rotor with a Caliper core and winding
is interesting ....
Magnet interrupt generator .... Magnet passes gap saturates core

as magnet leaves core collapses in a low hi impedance Q in radiant
resonant AC mode the more magnets poles and higher motor speed the
higher the core caliper frequency and Q "depending also in winding'
turn ratio and wire ..
Caliper can be done with salvaged transformer core "E" and "I"
plates cutt as you wish to form a close gap tolerance were the
magnet will pass and create a shorted M field path in core
as magnet passes, the open gap creates a full Hi frequency hi Q
collapse ,(in a resonant condition that will be OU) .
At hi speed the GAP creates an EMP alike spark gap in a tesla coil.
like Magneto in aircraft generator or old model T ignition system.
A single coil in hi frequency can give more power than a series of

several coils in low frequency ...
In your setup to avoid intercoil dephasing bridge each coil output

into dc then parralell up to a big current ....
the timing as I see in picture relative magnet and coil position

is off phase to correct it is better to vector to pure dc into a
capacitor and series or parralell in DC as you want that way you
avoid the phasing problem ...
each coil output goes to a diode bridge from bridge to capacitor

DC output (as coils are independent) can go in series or parallel
up to its VA combined outputs limits ( were ripple and dephasing
takes over if overloaded ) ..
"nice setup" setting each coil in a caliper will increase power

output ten times ...
6 coils at 3450RPM 920 cps *1725 RPM 460CPS* that is military

quality AC good to run surplus military motors nobody wants ...
the 450CPS ones ... at 200 Volt coils .... 460CPS
posibilitys are endless and interesting ...
Hector :)
Re: MullerRV update
Perfect ! as cores do in fact increase energy ....
DARN ! if a normal energy saver motor is made of Iron silicon core

and its eff % is over 98% the Information on coreloss is Obsolete
disinfo due to the FACT thoose 30 and 40 % loss material no longer
exist .... test any MODERN UTILITY transformer for loss, it will
strike you that Modern core materials even have GAIN at certain
resonant conditions instead of loss ... the old notion that Si cores
cause loss is bullshit disinfo at this stage...
This Inherited From NEWMAN and BEDINI work .... their statements
Cores were bad .... were in fact is cores give you POWER ....
Its the Magnetic GAP and resonance issues.
What maters is the RESONANT condition at Charging an LC capacitor to

max level upon a magnet influence ... using a given coil and core
mass combination.
Is this if done under Collapse field interval LOADING will not

reflect to source ... and if C is discharged in a load at BLANK
interval it will not be reflective to source .
JM charger does the same by transistor switching but dynamic is

different, there is a "time factor" that evens out the OU tensor to
Non - OU under averaging equation , fact is tuning will be more
bitchy than RV to attain such average, also there is no PM magnet
energy factor as in your machine ... the 2 must be compared as there
is light in this revelation ...
I state as Many times before, OU is no longer in issue, its the

transformation issues we must work on (aplications )and lab
demostrations .
Plus the System restrictions and midle ages alike inquisition

against us.
Hector :)
#5986
Re: 12 Volt Fluorescent Lamp Drivers
Take it to resonance using limiting resistor in line (can be 12 volt

signal lightbulb ) and it will be OU .
A patent is being worked on thoose .. Using specific resonance

parameters ... (OU) Quite novel aplication ....
can work 8 Hrs on a single aa 1.5 DCV battery
:)
#6046
Re: Hitlers Flying Saucers-A Guide to German Flying Discs of the Second World War
Their technology was Atlantean given by the Tibetans monks to them

there are still atlantean bases deep in tibet full of UFOS and stuff
you can not immagine (Including looped RV systems ) ...
A few mile from us there are people that dont know even fire ....
Primitives in comparison to us ...
A few miles from Us there are people that travel in time and
interdimensionaly with life spans of 10,000 years , own UFOs
and interplanetary ships as we own cars, boats or planes ....
We are the "primitives" in comparison ....
Hector :)
#6047
Re: Hector and Shareware
3 phase is usualy 230/460 120V rare ? only certain military
equipment used 120VAC 3Phase 47 to 450 CPS ...
like German 1940 Iron cross OU alternators ..... U254 captured by

US forces at end of war used ZPEM powersource ...
The inquisitors from hell suppressed the technology ..
we still Suck petrol greed penis ..... (Forced rape ) .
Well I just hope things can be made with godspeed ....
When ? How ? Were ? Remains in question...
Thanks!
Hector :)
#6061
Re: RV-Mullergen progress
Congratulations Kone ! (I am smiling EAR to EAR ) ^_^ !
a multy phase bridge array and you can parallel all thoose outputs,
diode doblers may increase voltage nesesary to charge 12V batterys
with the 10W OU ... if vector looped ...
Just be sure to keep voltage at 12.7-13.8 VDC as not to dry fry

battery !
NICE !
On Tantalums reread my opinion on its use in ZPE circuits , they

become Atomicaly unstable ... ( do strange stuff) including shorting
out and exploding like small dynamite sticks , internal humidity =
cold fusion ...
Hector :)
#6089
Re: Konzen's bifilar coils
He needs to saturate the core so its better to have an strong

core bound field than an external purely inductive one ..
if too external it will interact with other elements creating
parasitic drag (loss) coil need to transfer a charge to capacitor
Avoiding SWR (reflected power ) that results in detuning & OU
transform loss ... capacitor is RF element were WAVE transfers to
potential (charge) as Voltage Value aported to it ..
Bifilars & multyfilar are useful were impedance matching issues

affect coil parameters were elements need to be isolated as not to
interact negatively with each other (NULL) and were surface currents
become issue , a fine stranded #0 cable works with less loss than a
SOLID core #0 bar at hi frequency ... see sharp "inverter" microwave
ovens the inverter primary is a #8 stranded wire cable if you use
SOLID it will overheat and melt (burn down ).
Core Coil and capacitance are critical variables in the OU

transform , in order to obtain an EMA class c amplifier the magnetic
component must correct power factor of the inductive and capacitive
ones , at a given CORE impedance were the ENERGY transform occurs,
in ac is FULL resonance in DC is half resonance states were pulse
becomes a logaritmic voltage gain from a discharging coil & or core
into a capacitor were it becomes a POWER vector (potential)
Extracted from the 0 point of resonant oppossed curvature
If voltage is maximal current is 0 if voltage is 0 current is

maximal this states create SPACE vaccum and space tensor were
energy compresses and relaxes, in theory 2 off phase identical LCs
in common grounded circuit must create potential differential
relative to their space-vacccum states , being thoose captured such
devices extract energy from thermal and electron spin ones .
(transformation) with posibility of self substaining and extraction

of energy.
Hector
#6097
Re: Otto Smith motor
94% EFF on FULL load.....

But unloaded is 106% unefficient as all its energy is WASTED ..
I am not selling an ADD a phase here..... It another thing one that

can end foreing oil dependency ...
Hector
#6102
Re: Couch Ssytem and SaCo magnets
Maybe best way is starting to built and sell something , or modify

something to another thing , I gave the Idea to all, start making
and selling RV run stuff and RV as a Research tool ....
forget about the royalty ... if thing goes well throw me a few bucks
(on as you can basic) to make more toys for all of you to built &
sell,the 40 phases motor generator is still in the cooking pot.
PM RV is another Manufacturable goody .
Truly if it HELPS you start building RVs and sell them to thoose
that cant, I dont mind a bit .
Hector :)
#6106
Re: Konzen's bifilar coils/regauging cores again
Info on ROTARY condenser machine theory will help a lot ..
Here you can see rotary condensers ...
http://www.pscpower.com/pages/series%20sc.htm
If we see it from a perspective they "Regause" the utility lines

making you save energy , in Hi impedance they become EMAs
Electro Magnetic Amplifier ....
Its simple A coil atracting a magnet of higher magnetic intensity

will get induced power from the stronger M field ...
In low impedance this effect is not noticed much but at higher ones
it exibits OU due to EMA effect,(Electro Magnetic Amplification)
Theory ..
see chapter 11 power factor ( Calculate this with hi impedance

relative to m field in PM rotor synchronous machines ...)
What I have posted will become evident ... ( Its OU )
BEDINY was correcting his battery power factor , Newman his COILS ,
Bearden his Magnets ..... (Pun Intentional) ;)
rotary machines are Quantal linear amplifier exiters *modulators*)

of a sort , resonance is means to MODULATE an M fiels as to atain
signal amplification .. VTA is good sample of this
Keep this notes ...
Hector :)
#6120
Re: OU spark plugs?
There is what is call electron cooling by means of electrical charge ..
HEAT is due to an increase in electron orbital energy level ..
If Combustion is enhanced by the arc producing NITROUS OXIDE at the

same time creating a COLD plasma that permits more energy to go into
GAS expansion than creating RADIANT HEAT in IR regions ...
Coating inner engine in reflective IR region titanium nitride or

iconel monel alloy increases IR reflect goin to nitrogen CO2
expansion .... as if spark plasma were an acustic laser thermal
resonator alike were energy goes to mechanical expansion of GAS .
Again I go to the FACT ALL OU is due to transformation of energy.
My proff of theoretical concept relies on an Expired patent

number 3,977,191 Atomic Expansion Reflex Optics
Power optics Power source (AEROPS) requires an Extreme engineering

knowledge to understand and replicate.
Firestorm SPARK plug creates a similar effect, quantificable and

justificable under the ou transform theory i have posted so much
about.
*****************************
#6159
Re: Bigger RV-Mullergen 13coils per side
Nice :) You can use dual coils, also dual magnet disks with COILS in
center "as Stator" that way magnet GAP energyzes coil in concentrated
form ...
My 111 phases alternator is still on drawing board but uses dual 6 Nb

magnet array enclosed in circular bell housing them this "calipers"
the full field in the CORELESS flat coil windings in 111 phases
that go to 222TA IC (motor generator design ... )
You may use that to your advantage also encasing the 2 coil or one
coil into looping the field across its lenght ...
check tesla early gen patents and the old Ford T magneto design ...
Hector
#6161
Re: RV (emp frying)
It uses fast acting Air press 1/2 inch actuator valves used in
industry...
Adapted to the Standard spark plug ... remember I was working on
this .. the distributor switches this valves open energizing them
at up stroke of compression cycle power is regulated by open time
and AIR intake restriction (Carburator Vane) study AIR hog toy
plane ,there is a big key .
If I had the Money 20 years ago all cars may be runing now
solar RV AIR hybrids....
The problem is the godammed fucking money greed that permeates

the free energy circles ... interference being the order of the day .
Deviation and waste the other , you have no idea of what this MAFIA
can do and have done to us.
Its time I screw them back ...
Hector :)
#6167
Re: Air hog engine patent
If its Negre patent He COPIED the LEE ROGERS ONE ( I sended Him copy)
he redesigned using AIR conditioning COMPRESOR design as PROPIETARY
technology as he sold himself to the money Whores ...
They left me OUT, I dont Exist we never, knew the guy, he is nuts
agenda.
LEE ROGERS PATENT is the TRUE BASE of the magic, Patent Number
4,292,804 Air Hogs are a Partial DEMO of lee ROGERS one difference
is AIR HOG is 2 cycle and VALVE is Piston pressure differential
actuated as per propietary never disclosed secret ,regular
models "pin" actuated ...
No Answer from over 250 independent Ambientalist & organizations ..

the problem is not technology but sheep slaves brainless people ...
if 80,000 trillion dollars can be wasted on a fucking war WHY I am
not permited to RAISE a single cent to end the cause and need for
it ..?
Hector
#6179
Re: RV-Muller OU test
^_^ !
Thats Another Weight Into the TRUE WAY to OBTAIN OU by

transformation and MAGNETIC amplification , the Alternator
Saturation of the Core wire and consecuential OU...
Remember NORMAN WOOTAN did this with off the shelve generator
and that by FINDING were the GENERATORS loose their POWER and OU is
atenuated we can find WAYS to Increase OU producing effects ....
Important :
IF a COIL POWER is INDUCED in a COIL CORE to SATURATION POINT when

the MAGNET influence recedes makes the FIELD collapse ....
IF Induction is not Restricted by means of a DIODE we can SATURATE

COIL with no LOAD RESISTANCE as COIL field COLLAPSES this reverses
across diode from coil into Capacitor & load resistor ...
Having Multiple COILS charging into CAPACITORS in Multy phase mode
creates a CONSTANT DC tensor imposible to be DEBUNKED as it contains
NO power FACTOR component Being near pure DC.
Primemover receives NO REFLECTED POWER as LINEARITY is BROKEN by

magnetic PUMP isolation (Magnetic halfwave modulation )
Demostrated is ,there is an Universal set of practical RULES and

NOW EQUIPMENT to demostrate Overunity , OU is a fact , now come
Aplications .... DENIS LEE SUNDANCE motor IS OU with RV .., EKLIN
Brown Generator IS OU with RV , NEWMAN MOTOR AS GENERATOR driven by
an RV is OU ... Muller Motor Now as Demostrated by Kone IS OU ,
FACT is ANY HOME GENERATOR or MOTOR can be MODIFIED to GENERATE

OU .... using this simple KISS METHOD of biasing, witch can be
Combined with coil "Regausing" Ones to enhance OU effects ..
I am REALY HAPPY that AFTER NORMAN WOOTAN , KONE did the Same,as I
will never FORGET how he was treated Like SHIT in JLN group , nor I
will forget how the guys at KEELYNET Ignored Norman results ,
professional Envy ? I dont Know ....
CARMEN send me Email but I havent being able to get MAIL back ,
years ago I tried to make ALF try RV to drive EMA4 and MODIFY
Standard EM GENERATOR TO PERFORM in EMA MODES ... TO BUILT PM RVs
but as You Know we ended doing war. (Shit Happens)
Congratulations If you LOOP the "mother" make a lot of Copys and

teach others to do it (DONT END LIKE MALLOVE ) his goddamed
secretivity in RV-TV Sonofusion aplication issues killed him .
...
#6205
Re: Re : 32vs13 RVmullgen more pictures
Sorry for the Expresion but I piss on thoose idiots that treated
Kone as shit on JLN group HAHAHAHA HEHEHEHE ! (I cant be more
happy )
If you want to loop check the loop bypass circuits posted for the
DC section of RV as long you keep battery at 12.7 volts and on a
charging vector without frying inverter you are OK your load is
inverter and battery , need to calculate ampere loading in your
coils and bypass vector it to inverter at the same time reversing
current to battery ... Remember Your VOLTAGE will be a VIRTUAL Value
and the Current will be REAL One ..
Voltage 12 to 12.7 in a verry long wave Amperage to inverter is a

constant , amperage to battery is a variable cycling long wave also
corresponding to OU tensor differential within oscillatory wave as
ED obtained in his RV , bad thing we cant obtain 12-24V 3 phase PM
motor alternators but with SUPPORT this can be easy manufactured.
Konehead-Muller motor-generator works....
If RV reverse induction generated 1200W with less than 100W input

using LAMINATES ... think What can be DONE with a PROPER generator
design ...
Remember Norman WOOTAN used off shelve PM motor to attain his OU

readings as a generator, in kone pictures this design is similar to
Muller design and a MAGNETO ignition design ....
The Importance is OU is demostrated, rotoconversion theory

definitely aplies to MULLER design, we need a compromise from people
to raise money and built a research center were people like us can
be suported and can create the things society needs to survive , the
DESING and Manufacture canot be left to thoose that preceded us with
constant failure nor we can be left HI and DRY giving our hard work
free to have a corporate mounster Patent and apropiate this ..
Hope Others also Take inspiration on Kone Work and Use their RVs to
WORK on their LOW LENZ generators ....
The REVIVAL of ECKLIN-BROWN generator and magnetic distributor

concepts may now be taken more seriously as DEBUNKERS may have to
eat their own words .
You cant Drive an OU generator WITh a MOTOR that wastes 110% of its
energy doing nothing ... but you can drive it with an RV ....
Other things will become evident with RV , it has a LOAD range were
it reflects no loading to source in PM this RANGE is quite EXTENDED
ant there is were the HI impedance PF and EMA issues will hit the
fan ... sshh dont tell anyone RV alone IS OU ... but as a MOTOR
it canot give ou driving a 37% efficient generator ... LOL!
ON OU demostration ..
It May Had being made Earlier if BEDINI , ALF , or NEWMAN may had
used RV primemover to drive their designs ....
And As told before may wished Muller to see his generator working
with RV.
Was kone Destiny to do it ...
If generator is OU Rv will drive it .... 1.618 gain will suffice to

loop if designed properly ...
Magnetic interrupt and MODULATION combined in semy resonant states

is what makes EMA posible and it is TRANSFORMATION not magic ...
...
#6214
Re: RV-Muller OU test
There is something I need to Explain About cores and windings ...
There is a relation to COIL impedance and CORE impedance & DRAG.
you must REMEMBER RAIVO EXPERIENCE with the ALTERNATOR were PMAs
oversaturated COILS become a source of drag due to ROOM TEMPERATURE
MEISMER and HALL EFFECT in the core internal composition that tends
to go Electricaly superconductive and magneticaly resistive to
induction ..
In a CAR alternator a Ib or Cs magnet in rotor resulted in

Oversaturation wile lower field intensity Ceramic 8 ,5 gave better
performance at Hi speed .
Kone, I aclarate this Info as there is the NEED to attain OU using

METAL CORES also as in SOLID state this Knowledge is essential
depending in frequency a set of VARIABLES have to be used as to
atain degrees of performance , remember a 7.5 HP US motor can be
taken to 11 W in RV mode 'Tuned" a 75KW transformer in hi impedance
mode uses .3 W and we are dealing with over 500 pounds of steel -
boron silica laminate there ....
Issues ....
Laminate can reduce size and increase power ...

Laminate is not the problem ( its SATURATION of it that CREATES
DRAG ! & loss , DETUNING impedance mismatching of E field and M
field .
Laminates need to be closed circuits, cant be totaly open as tuning

becomes more under RF rules ( like the ferrite plug in small
radios )
Laminate OU parameters need to be defined as 99.9% of the motors

& generators use them ... so we have to DEAL with it ....until I can
raise the money to develop 111 phases coreless coaxial looped field
generator to universal off shelve item .
The issues with Muller design is to implement in standard

frames ,were obious Muller failed but You have electrical results
this cant be interpreted by as told before, thoose EXPERTS in
engineered entropy can NEVER transfer what You GOT into Usable end
universal product as they CANT neither TUNE loop an RV or get OU by
pulsing an Iron Kitchen sink into stochastic resonance mode .
ALF EMA 4s are still useless impractical pieces of Iron if not taken
to STANDARD frame , I offered ALF a billion times to take EMA4 to
low voltage RV modes, he paid no heed ( you did first I am glad ).
The Aproach at this stage is critical , dont FALL under the POWER of
usurpers (Corporate Mafia ) ... else all you have done is lost.
The moment you permit interference from academia type monkey brains
to digest what you got it will be delayed to death on NATIONAL
SECURITY issues , I am quite worried here .... ( I can sense
something is not right ) were is the GODDAMED son of a bitch that
destiny has to put up the FUCKING money for this ....?????
WERE in the FUCK are the Georges Westinghouses of this goddamed

Era ? Thoose Green piss Multy billion dollar guys .....
(sorry for being emotional)
I projectile SHIT on Bill Gates ! FUCKING Son of a bitch !
Belinda Gates foundation Must be renamed to MI-PINGA INGRATES Son of

bitches foundation.
They Dont put a peny in alternate energy .......
Ok now I feel better ...... ^_^ !
Hector :)
PS: I shit on Bush ....( Another hypocrite son of a bitch ) .

#6228
Re: Kone : Permanent Magnet Alternator
ADDING to this this, loss is due to Over saturation of laminates

that SUMS importance of CORE material USED and its magnetic
saturation point at given frequency voltage and current potential
If you cant move it with a finger at no loading ,the engineering is
no good and generator is NO GOOD for ZPE and or RS (Rotoverter
System work ) Importance of the meaning LOW lenz component is a LOW
reflection of mechanical POWER to the primemover, its ovious by now
that if a mechanical system is loaded by the generator it drives way
over the energy it produces its not OU ....
TARGET in a GENERATOR is no load near 0 mechanical load ....
Coreless PM gen 0 load must be no higher than .003%
Target in a motor "Primemover-driver" is no load 0 power demand
In PM (permanent magnet) RS (rotoconversion system) motor

synchronized to line is SYNCHRONOUS CONDENSER MACHINE and provides
KVARS to system in OVERUNITY EMA modes at HI impedance ..
That is MAGNETIC ROTOR field intensity determines KVARS injected

in suply system ... an EM (Electro-magnet) driven System makes
posible to control POWER factor and Electromagnetic Amplification
EMA level also adjusting Rotation angles (phasors) of electric
signal (Power).
Suming it up perfect generator minimal drag at no load ..

Maximal power output with low loading to source .
Perfect motor minimal Power use at no load max eff at loading in HP

output (lowest power usage per HP ) .
right now 99.999% of all generators comercialy available are unfit

for Alternate energy and ZPE R&D use , best motors for RS
(Rotoverter System) construction are 84% Plus eff 230/460VAC 3PH
5 to 7.5 HP motors as to built working unit , using LOW impedance
end weld OIL or FILM AC capacitors ... Further testing had narrowed
best results in this HP range for 60CPS ...
Using PMs Permanent Magnet Rotor all HP ranges can be used by

frequency and speed being determinant of performance to EACH motor,
PM must NEVER exede saturation of cores this MUST COOL down but
never HEAT up under semy resonant power, Generating or working as a
motor (Prime Mover) same factors aply .
EVERRY MOTOR and GENERATOR haves an OPTIMAL SPEED & frequency and
Loading factors were it is more efficient and performs the best.
(Lab proven & tested ) within certain RANGE most of them can exibit
overunity phenomena due to natural magnetic amplification EMA
effects.
Hector :)
#6250
Re: musical notes from looping sequencies [for hector and ronald]
OK numbers and "CODES" to play With ...
0.758241 voltage x 42.85 x 7
A..4"(AA,CAA,C,GAA,CC,GA)5"...G
A.....(CA)(AA)(GA)(CAA)....G
ACAAACAACGAACCGACAAG
142.857
475.281
253.968
Matrix 666 = 333+333
27+30+33=90 hz
9=1+4+2+8+5+7=27
Transformation elements required ... 8
Just Dont get "Burned" priority (finish RV basic demo)

other priority ... without grants I cant move from the place I am in
nor do the local demos needed ..
Hector
#6253
A..4"(AA,CAA,C,GAA,CC,GA)5"...G
A.....(CA)(AA)(GA)(CAA)....G
ACAAACAACGAACCGACAAG
This are DNA Genetic code alterations needed to work physical in

sinewave transdimensional states ...
Hector
#6259
Re: musical notes from looping sequencies [dna info]
7 colors of light are the base for all existant DNA /RNA
combinations in the universe ..
Man is represented by Yellow, RED, Blue
Woman by violet, green, orange ....
were female and male form 6 that create the david star with the
WHITE color at the Center 7 correspondimg to the duality of
universe represented by 11 male & female letter K ....
CODE (K777) this corresponds to genetic codes ( mutations that

correspond to music "sound" and light (energy) matter corresponds
to "Lucifer" traped light energy were God spirit is represented
as Christ crusified .. that means YOU (people) as part of GOD spirit
are BOUND "crusified" to material existance ...
"Forget about the Jesus paid for your sins stuff"
In reality is You as part of creation are part of GOD spirit

incannated (Bejesus) and are nailed to a material existance
(crusified to the Vertical horizontal planes of 3D ) suffering your
Ignorance "sin" of not remembering your origin "God" knowing dung of
how to control its 48 basic laws, just think of the hard times to
get the basics of the other 4096 LAWs base for Universal construct
'creation" .
If this does not hit a ring note , codes k888 , K999 will ring a
bell as nature has 2 roads in evolution , one is transformation the
other entrophy and destruction ( I am a master at the 2 ) so thoose
dealing in black magic will soon see the fruits of their work , as I
will step and walk in their ashes ( In a sense already done) '2137'.
There are 3 things that need to be deal with ..
politics
religion
Economics
With politics we deal with the truth , logic , and get rid of
politicians ..
With Religion we tell humanity the truth , tell them that paradise
is made were he is , that moving man to HEAVENS will not fix the
problem , but only turn heaven into another hell ..
( Requires Transformation ) Education , as any thing else Faith is
ENERGY you can waste it kneeling before an stone idol or you can
use it to aquire wisdom and become one with GOD ... (choice) .
Get Rid of religious fanatism (all religions)..
Economy ...
Base it in abundancy and acummulated Work , were the value of things

are determined by man Hour not by decadent entropic devaluated money
system, turn the WORLDS armys to fight poverty and ignorance teach
the ancient wisdom of tantra to regulate population and to
tramnsform human entity to beings of light (also by Choice ).
in 7 years Earth can be reprogramed rebooted without recurring to

destruction (thermonuclear warfare ) to ERASE collective memory ..
like in RV ... Energy can be transformed with minimal Waste ...
Man can also be transformed with minimal waste .... That is what
technology is for ( tool for transformation ) not idol to be
worshiped as a God ...
(end)
A few Drops of water into the sea .....
Hector :)
#6284
Re: photos of 133213 RV "Mullervertor"
The NORMAL DEVEALED magnet - coil count is 14 - 14

in 3 phase is 3 coils to 2 pole ration Exept in 40 phases overlaping
there is 40-2 ratio , Sundance ratio 14-13 .
The MAGNET pole drag issues need to be acounted be it single pole n

or s modulation or AC pole resonant logaritmic Electro Magnetic
Amplification .....( TRUE EMA ) .
Goin back to OU , is method not only machine ,Muller ,ECKLIN-Brown

& others designs work well with RV , to be sinsere RV is only device
tailored and designed to test this type of generators.
RV can be put in market Easy , just let me handle the R&D and
engineering deparment of any mayor motor manufacturer for a few
days , a few mental enemas and a horse whip can do wonders in R&D
deparments .. LOL! :P
Put this figure 111 phases 15 volts per phase 8 amps per phase
that is 13,320W in a 4 inch x 2 inch space .....
at 50K rpm make it 90KW in that same space ......
I also did my homework in CORELESS design ... Broke some eggs

making omelet (verry expensive and demanding stuff ....
but takes years to get interest
( WE have a SOCIAL problem not a technical one)
I have 3 options ....
Response from people ( limited )
Aquire power ( will require War )
USE pure psycotronic technology development ( Open Stargate to FULL

potential ) And may God have mercy on whoever crosses my path with
bad intent.
...
#6293
Re: coil and core dimensions
Tips to notice ....
kone stated the need to TUNE vector RUN cap ( tune source to load )
core COIL and MAGNET EM must be IMPEDANCE matched .....
A magnet has an specific frequency were it matches specific

Impedance influencing specific CORE mass or and composition.
Everry generator has a BEST speed best loading "character" were its
usualy OU (Overunity )
Hector :)
#6312
Oops nevermind Re: [EVGRAY] Re: photos of 133213 RV "Mullervertor"
interesting , but finding the combination of magnet polarity,

impedance relation and wiring combinations to get it to OU is
another thing .... LOOKS like Kones Muller but Is not Kones muller.
First we must see number of magnets & number of coils, Phase angle
relative to Each coil and how they are wired as to REGAUSE or REACT
to field in the 3 posible ways to get EMA (Electro Magnetic
Amplification)... As Sundance we can see similarity of concept that
goes to BASIC AXIAL design ...
Will try to upload picture ....
Hector
#6455
Core: " specific frequency and "impedance " .
Coil: Must MATCH core impedance and frequency from saturation to 0

field point.
Capacitor : Must be as to make LC resonant or semy resonant in a

given loading range .... vectored to DC or as AC aplication.
So CORE specific frequency must be matched in with specific wire

turns to also specific CAPACITANCE as to match a given SPEED of
rotor at a given magnetic FIELD intensity as to attain EMA (Electro
Magnetic Amplification ) mode ...
Importance in aplicating BOOK principle of RESONANCE ....
as to attain Unusual magnetic Amplification modes were energy is

transfered from Ambient to Endoelectroinductive states in a system
reflecting as OVERUNITY, or "extreme energy saving states" ...
Best results are Hi impedance Broadband low reflectivity to

Primemover (low power usage ) resonant states ..
Upon loading this states to to LOW impedance (lenz effect on LC

component) goin hi Q and narrowbanded in specific frequency ...
(Resonant )
In case of generator this is the AC frequency its magnetic POLES
generate as they pass and induce alternate AC n s poles or
alternate pulse nn or ss poles were rotating speed must be x 2
times in case full resonant AC plug is used to prevent coil (LC
gunning) in nnnn or ssss only operation ...
SO primary importance is to match your cores properly to your rotor

and match rotor speed to best LC frequency ...
Kone matched to BEST capacitor voltage increase (Resonamnt PEAK ) at

given load ...
Keep this Notes as they are the KEY to get OU from ANY kind of
generator as they are universal in nature
all you need is to aply book formula and a bit of common sense
But as lab experience shows common sense is a must (Kone style)

without that doctorate level education is useless.
:)
congratulations to all of you ! (KEEP the Notes, Keep public

Add to compilations & republish (pass it on )...
Then ..
Send me a bulletproff vest and a commando kevlar helmet
LO ! :P
Hector :)
#6456
Gunning is the Term used as you reverse polarity in a runing DC
motor as to reverse rotation instantly without stoping the motor
completely ..
As discused before in a Norman Wootan posting and my reply in AC

gunning creates Extreme lagging power factor figures resulting in
creation of EXTREME kvar energy pulse EMP .. in case of switchin
BOUNCE small gap resulted in instant evaporation of hundred ampere
rated switches or relays (due to ARC discharge of extreme EMP
potential.
In case of VECTORING gunning can be transfered from a negative KVAR

region to a multiplied and amplified charge in a capacitor within
plugged LC configuration were this CHARGE can be non reflectively
discharged and isolated from main magneticaly driven LC component.
Aplying this to asynchronous coil induction and using Capacitor

collected EMP vector potential as parralleled DC stream will add the
EMP as class c magnetic amplification signature resulting in
Overunity ... as asynchronity will tend to charge some coils in
REPULSIVE mode against MAGNET path centain degrees of lenz effect
neutralization will take efect withing the alternator .
You will have coils being repulsed and others in atraction lowering
rotor magnetic drag as one wave overimposes over the other
circulating clocwise and counterclock wise within a virtual torus ,
were theese rotating components meet the amplification effect occurs
being of REPULSINE electric nature (ZPE) , the EMA effect is taken
from magnetic field modulation and alternation at same time adding
as vectors as contrary to entropic standard system were they result
in loss substracting potential from each other ...
This Explains some Kones postings about Muller generator making
Muller A bit more RV alternator alike but with the big difference of
its asynchronous and PM character advantage .
This things need to be public ...
KEEP and pass on this important notes .. (Tips)
Hector :)
#6489
Re: Gunning And Overunity ...
--- In EVGRAY@yahoogroups.com, EB <eb24@d...> wrote:

> Hi Hector, welcome back.
>
> To get this stright, you are saying Kone's motor is showing OU
because of the spacing of the magnets and the coils are such to have
overlaping magnetic fields which is partly canceling the lenz effect?
*******
Its part of the EFFECT similar to the 3PHASE Oval shaped field
rotating the 2 rotor poles at 120Deg the 3 to 2 ratio rotor stator
coil relation . EVEN NONE setup.
*******
> For us that are trying to replicate his thing, changing magnet
size and strignth can totally mess up this lenz canceling effect.
Some of us could not obtain identical magnets as Kones. I for
example got 1/2 inch wide magnets which will mean a slightly closer
spacing of the magets on the rotor. This will have a greater
overlaping effect and hopefully great lenz canceling effect.
***********
this depends on spacing and field intensity
the worst sin is to oversaturate ...
it creates drag ,,,, Ask Raivo about Super PMA losses ...
OR READ What Is Posted posted already here ...(Somewere )
Hector
***********
#6539
Re: Need help understanding coil performance
> Hector, doesn't putting a capacitor on the DC side of a full wave

> rectifier take it out of the LC circuit?
>
> Erick
>
If you picture the diode plug it separates C component from LC into

2 half tanks (LC)
In full wave bridge
If you take the LC relation from a 4rt dimensional look you have a
varactor circuit linear driven LC at each cycle were R determines
the value of impedance at source driving it (Simple) capacitor
size determines peak to peak value of rectified potential as a
charge in a capacitor, energy resultant is calculated in joules (
capacitor voltage and the energy it can deliver in watt seconds (VA
(
**********
> Hector,(Snip) does rectifier take it out of the LC circuit?
> Erick
**********
In Transverter plug discharging C in blank interval does take it out

of the circuit as load is non entropicaly reflective to source ..
The remanent charge is recovered by charge cycle in a frequency

determined shift within VARACTOR theory specifics (broadband )
hi impedance.
If capacitor potential is 0 the charging takes a hi Q lower

impedance logaritmic C charge within a CORNU spiral (as optical slit)
charge path resulting in true magnetic amplification from the 4D
zero point tensor , this under "resonant" conditions.
Diode does not isolate L from C just converts it to half tank

rectifiying half wave ... 30cps case of house AC Pulses into C
A diode bridge does the same But dobles half wave pulses 60CPS AC
If a second LC tuned at 120CPS is placed at bridge pulsed DC output

you have an AC cyclo-converter frequency dobling circuit ...iF
diodes are set as FREQUENCY MIXER bridge using LC and diodes you
can convert any signal say shuman resonance 11 CPS into useful 66 to
72CPS .... and get free energy from the EARTH resonance ....
Needs extreme expertize in AC-RF even if it seems so darn simple ...

but RV and transverter are the same stuff anyone need to understand
concept ..(aplications).
Hector
#6540
Re: Need help understanding coil performance
This little coil puts out 3.50 amps when shorted, and 20VDC. It
lights an automotive tail light bulb brighter than my other coil.
But still the RV seems to consume twice the power and the coil
produces. seems about 50% eff when you max out the coil output.
>
> Erick
IF AC ....
Try paralleling some capacitance with R ( lightbulb load ) to

correct the LR POWER FACTOR loss ... ( basic Start )
Or use nn or ss unipole induction and load the CEMF EMP non

reflective to Primemover coil charges in fordward discharges at
collapse ..
Idea is to learn the basics to "bend" LENZ law and lab tested RV is
the best tool to do it, the LOAD as integral part must be tuned to
source and source to load NEEDS ... ( Tesla Wrote about the same )
too bad he did not teach people to build RVs .....
Maybe motor materials were too primitive back then ..(laminates).

Too much loss ????
Hector :)
#6542
Another COIL Core RF - DC Repeat
Pure "L"
Idea is to charge coil and "core" (If any) to saturation being the
collapse discharge the OU producing element
Pure "LC"
Idea is to charge a capacitor to max potential within a resonant

circuit with the lowest power usage to primemover, RV alternator does
that already .. OU using reverse resonant induction Lab Tested & OU
L being impedance matched to C as to attain EMA gain from M field.
PM induction RV & Muller RV
Here POWER factor & resonance intermix were PM " M field " saturates
a COIL & core as to cause a charge resulting in OU potential as it
gains power from M field "EMA " and ZPE "C" components.
JM charger , RV & transverter play big issue here ... (LC)
current problem is attaining the PM induced OU states and

understanding how to transfer this power as a vector to a battery ...
Check looped RV schematic ...
If by sample I got 200V at 10 Amps we have to figure that is the same

as 20v at 100A at alternator end, capacitance and impedance
responding to same proportion but increasing Q to the hilt x10 Q
extreme "OU" states ... battery and its charge becomes a VARACTOR
diode in series with this LC, battery power is determined by amperes
in amperes out within a virtual load, inverter becomes R in parrallel
with source that becomes added to series LC vector source the RV
output becomes a current vector within the R component were battery
becomes a varactor in a negative resistor state were such becomes C
and L as reverse induction is attained, RV output becomes virtual
higher VOLTAGE battery to LOAD were current transfers from lower state
in a current reversal to higher state one, voltage differential causes
reversed voltage to reverse current to lower power region into
battery.. R becomes a virtual shunt regulator, in this case
inverter ...
****************
In RV schematic the symbol of transformers and diodes from the RV
alternator represent the downconversion of voltage and increase of
current and this is done using RF engineering rules ...
****************
Thoose rules are simpler if using a muller generator but issues are
the same the sum of vectored DC must relate to battery parameter and
your inverter specifics and within a range of 10 to 15 volts DC as to
play safe, current & Volt ampere is were the magic is, the battery as
i have mentioned a million times is a VARACTOR LOAD relative to the
SOURCE impedance, to mantain OU transform from ZERO point the
RESONANCE TENSOR must be mantained within all circuit elements , so
its time to get an inverter, power up the RV from a DC battery and
start vectoring your generator output into the battery and load
stream ....
As a simple shunt is all that is needed to demostrate OU (Current

charging battery ) and a voltmeter to monitor voltage 12.7 optimal ...
a series of loads must be provided to prevent overcharge and create
the hyperwave OU- non-OU HI-LOW wave cycles normal to a well tuned
system . regulating load can be at any stage ...
ED was working on this preliminary and got wave effect as

descripted ... principle is quite well demostrated issue is to
transfer it to a working physical model within closed loop and
mitigate the impedance mismatch problems (Main problem for many).
Tips:
Coil voltage as DC must be greater than battery ...
real load must be battery not a resistor ...
The real POWER then becomes voltage differential of source relative to

battery multiplied by the amperage ...(Charge) "OU"
The recirculating power is immaginary "virtual" power within a local
singularity created by the device as a whole ....
Aplications ("Extreme" energy saving )
LOL :P
HEHEHE
Hector :)
#6581
Re: The simple little coil
Excuse me .....
Tesla spoke of tuning the Load and source , not beating energy to
death with a horse penis .
A shorted out coil trashes whatever impedance matching relation

it haves with the M field ....
M field, coil and capacitor tuned at a given speed and a given

frequency
with a properly designed core, coil, capacitor, relation ....
Are key to OU.. shorting is OK to test lenz drag ...
RV idea is to optimize energy output not prony brake it to death.
The real design challenge is to drive current back to a battery and

in DC its POWER factor is measured in REVERSE voltage relation ..
say battery 12.7 VDC source 13.7 VDC differential is 1VDC
In a charge relation then reverse resistance is the power

determining aspect say as a sample 1 Ohm then the power charging
battery is (1V =(13.7VDC - 12.7VDC)) x 1Ohm = 1W True relative power
transfer ratio ..
so we have as a tensor (DC ) equivalent of Phasor (AC) (power

factor ) relative rotation angle to cophased element "synchronous" .
So as we may equate battery resistance + load resistance in amps

at a given VOLTAGE drop lets say 12.7VDC AT 10 AMPS THAT REQUIRES
TO VALANCE A TENSOR OF 10A so we must calculate voltage required to
valance such were generator Source voltage power must be higher
than battery as to reduce draw and reverse charge to it , impedance
must then be lower than battery one as to transfer current to load
and reverse to battery (same formula avove ) were the generator
overcomes power requirements feeding a reversed power factor vector
to battery .. DC is nothing more than an extremely long sinewave
and RF rules also aply to it but as pure standing waves ....
Understand that and looping is within grasp ...
I still insist, concentrate in energy savings aplications ....
Hector :)
#6604
Get one of thoose sharp inverter technology microwaves ....
as you operate on the thing notice the inverter circuit design..
how the 2 IGTBs discharge into the primary coil (multy-filar) using
3 capacitive elements to get 800w at magnetron input ...
3KV DC from diode plug .... understand why this circuit is OU ...
and ask yourselves how it ended in a microwave ovens ......
the problem is not the technology ....
Its people and logistics ( It Sucks! )
not to mention system .....
codeword phrase : Hairy mice (mouse) hatching from eggs (my mistake).
Amen !
Hector :)
#6605
Re: emachineshop
--- In EVGRAY@yahoogroups.com, "koneheadx" <konehead@m...> wrote:

>
> Pop a big neo magnet down a copper tube (or nickel if you can find
> one) and you will see how conductive metal will slow down the drop
of the magnet as an experiment.
on this same line cut a line "gap" down the metal pipe
the magnet will fall with 95% less resistance .....
the pipe "ring" short to m field was removed ... A rod within a rod
spun at right "tensor" will be negatively inductive, a 4FT long tube
can generate 3000 amps at 15VDC as I get funding I can demostrate this
postulates I can tap the atomic spin atomic engine itself ...
I attained homopolar reverse induction making copper magnetic super
resonant conductor at 0 cycles per second resonance....
using no magnets ..... only ("reverse induction" )
The sinewave is a flat singularity within 4D space were power becomes

a linear diferential within 2 points in node & anty node of its linear
construct ..
But i cant do this in a hamster & mice bio lab ........
( I need big guns and ammo R&D $$$ ) no more greed induced suppression
and controls...)
someone attemting to get in to my computer as I post this .....
screw Him !
Hector :)
#6637
Re: The simple little coil
Hi Erick!
Just some ideas.
Try LC resonance test with your coils to find an indicative C value

for voltage resonance.
I've seen it to affect very well the Bedini style setup (RPM increased
2x if I remember well).
Try your cap bank at range 10uF (1-100uF) finding the voltage
resonance. Measure amperage, see the input draw. If you spot the input
resonance write down the capacitor value: e.g. 10uF. (you may try RLC
as well)
Then take FWRB: connect the same cap at DC with 10ohm load (and you
may vary cap sizes to see if there is an effect).
In previous postings of Hector we know that LC is a amplification

'tandem' that work together in resonance and semiresonance (diode plug
with 2 diodes + 2 caps).
coil open voltage VDC: ___

input draw: ___
coil short circuit AC amps: ___

input draw: ___
coil short circuit DC amps with bridge: ___
input draw: ___
LC resonance V: ___
LC resonance A: ___
input draw: ___
RLC resonance V: ___

RLC resonance A: ___
input draw: ___
Using this method when one capacitor is fully charged the other is
discharged into the load is very promising advanced switching scheme
for further advanced testings.
The current DC idea is very good as it has no switching, but later in

our life we need switching for the next projects: RV-Muller alternator
switching, RV alternator diode plug switching, solid state resonance
diode plug switching. The only problem is to open-source the universal
circuit for opto-diode-plug or hall-effect 12-300V range.
--Raivo :)
#6705
Re: Diode choice
Not only hogging but guning (Gun diode ) they oscillate in RF mode
modulating current and voltage ....
that is why they must be MATCHED PAIRS (same reverse resistance )

they are usualy worth ten times the normal ones price ....
as is one in 300 shot to one to match a PERFECT 4 zero tolerance

figure using digital DVM pair matching measurments ....
So start buying them Bulk and match in the different values in 1K

of diodes you may match a perfect 50 pairs 10% or so ... in
different values and a cuartet or matched trio ... Exact value
3 to 4 in 1,000 "aproximate"
Hector :)
#6812
A powerplant 2 bearing generator is obtained 10KW
Specs 120/230/460 VAC 60CPS ring exited rotor (brush) bashler

regulator /// 1600RPM 4 pole alternator
Regulator is substituted by manual or current regulated adjust EM
exitation power
System is wired to 460 VAC a pony RV starts is to syncronous speed

once is syncronous is connected to line were exitation voltage and
current magnetizes rotor creating RV power factor correction
synchonous dynamotor. this conected to your house reduces power
factor loss to 0 with adaptive sensing and adjusting ..
That is 40% energy savings Average ...
Use PM rotor this FEEDS EMA OU power to home, use series variac to
regulate KVARS or Magnetic current regulated amplifier to control PM
KVAR output .
In places far away from grid power source this can save 60% on power
bills correcting PF line loss ...
This are Solutions that can be implemented NOW in vitro using off
shelve stuff ...
Hector
#6838
...
Single phase Current, voltage & power factor
V x A X PF = W
3 PHASE
((((V1+V2+V3/3) X (A1+A2+A3/3))X 1.732) X PF = W
AT AN INSTANT IN A,B,C PHASES READING YOU HAVE OU !!!
compared to INPUT of single phase to 3PH system ... And I have not
Touched Hiper-relativity rotary logaritmic equations or Optical slit
aplication of CORNU spiral to virtual Amplitron alike relation of
this circuit ....
Anyway its all in the compilations for reading ... you just need to
built the device ...as is the same thing you are looking for ..
Specialy in ROTARY condenser POWER Factor correction aplications...
Purely overunity ... Bedini And Newman power factor corrected their
batterys ... Bearden power factor Corrected his MAGNETS And coils in
Meg (Reverse)
You will get what you seek as you understand this.

Hector
#6917
Re: Question 4 Hector
Another thing that creates this is the utility power source specialy
if there are fluctuations on impedance withing the UTILITY lines
themselves creating phase angle variations "drift" of current and
voltage (Becomes Virtual Impedance variations relative to RV ...
Using 2 current meters you will see phases current will drift also
within 3 phases one goin down while other goes up ..using POWER
FACTOR METER you will notice a POWER factor fluctuation in
proportion to the current one in the line imput ..
its part of many little bitchy things we must learn ..
Use motor with Inverter to see if it reacts in same way or if

problem goes away ...
Post Here as this things are the Spice of R&D ....
Its the Addictive part of RV ,,,,
LOL :P
Hector :)
#691
Re: Question 4 Hector
Another AD on
Initial SERIES loading also causes oscillation on reactive values
A lightbulb resistance on a line becomes a variable as its

resistance variates with HEAT as power intensifies or decreases
creating alikes of tunel diode oscillator.
same on variable loading to RV alternator LCs .. be it hi amperare

DC motor or the like .... RV alternator exites and as motor goes to
maximal speed it dies then re exites agasin then dies using RV to
diode plug to DC motor conection ... diode bridge will do same ..
If you mechanicaly LOAD the DC motor to a given POINT it will stay

ON as impedance is valanced with RV alternator LC as to mantain self
exitation ...
Understanding why this happens is part of understanding the
mechanics of OU energy transform .. Every part relates to others
every value parameter is affected by others ...tuning esential .
know how vital ..
Hector
#6927
Re: R&D Spice
:P
If the Inverter transistors are H reverse diode protected from the

DC hi Voltage in semy resonant synchronous condition POWER factor
feeds back to DC capacitors in the Inverter as RV goes leading
this condition is OU within what I describe as producing a

HYPERWAVE ...
In past postings I mentioned an alternative to feed RV ALt hi output

directly to the Inverter HI Voltage capacitors itself and downstep
power to battery using parallel AC trafo from AC end to low 12.7
VDC conversion to attain battery feedback.
This TESTINGS must be done with battery CHARGED to optimal 12.7 to

13.8 VDC as you may be getting INVERTER SHUTDOWN CUTTOOF and may
NOT be a hyperwave effect but simply a LOW battery effect that
affects the inverter workings.
Just be carefull with the blue smoke And silicon goin nuclear ...
Hector
#6934
One of this Days as You dominate resonance better you can resonate a
75 KW transformer using a single AA 1.5V battery ......
OR
Light 3 4 foot FL tubes with a 1.3VDC dime sized battery for 6HRS
or more ..... runing in 3phase LC hi Q resonant looped oscillator
Tesla did it Why not Us ...
Hector :)
#6978
Re: Airlines going bust
I can redesign their engines to run on WATER using thermodynamic
cavity detonation modifying existant jet engines ...
But greed will not permit it .. and Thermodynamic transform is not

yet known exept for a few here that got the WATER diesel info and
read my postings .... Same formulas aply to turbine engines..
I only need to demostrate in vitro ,,, but Whos got the money ?
Hector
#7002
Re: All north 32 mag rotor and litz coil
TRUE as load acts as a VARACTOR diode & only a few are qualified to
deal with thoose theoretic aspects and NONE in POWER engineering one
( REASON I gave RV as public domain ) gives chance to experiment.
Lets get to the "CORE"
In pulse generator, that means using ONE pole, Idea is to CHARGE the
COIL core with the PM and using the M field collapse as power
source being non reflective to mechanical power source ..
R LOAD will a variable determining the time T and Current level

discharge of L ,L will be affected by C internal interwinding
capacitance and OTHER also self changing parameters The 4rt
dimension is the PROJECTION of all the parameters to an unified set
of final values determined by all the components ..
The MODEL testing is the only WAY now posible to perceive this
aspects until the proper formulations can be included in electrical
computer simulations .
Now anyone can be able to SEE were OU is LOST and why alternators
and generator design are flawed and the need to change engineering
concepts into a more broadbanded region were RF knowledge becomes
Vital to be able to integrate and interlace the INTERRELATED
parameters affecting the way generators and motors work ..
Rv is a Toy to discover interesting new things ....
Its Fun ! :) ZPE resides in resonance ....(Transformation)

not magic...
Hector :)
#7017
Re: funds - OU into reality
a magnetoic amplifier Stardard consist of a transformer loaded with

dc to act as a dual flux (Pair) of triode tubes as to control
impedance of its coils ..
Search Magnetic Amplifier , voltage regulation, power plant control

systems , welding machine magnetic current regulators , radar
magnetic amplifier regulator 3 phase .. & others
Hector
#7036
http://www.chorusmotors.gi/technology/patents.shtml
From the First Public disclosure of Rv to the latest multy phase

postings ....
You dont have free energy because a FEW powerfull people want you as
ENERGY slaves and that is a fact .
Here they Deny ,,, behind curtain everything gets patented in part
and pieces ... This PATENTS include Kone recovery circuit & others
public here well before the patents were issued .
The problem is not technology its politics and slavery .
Get RV as Is and as power saving device ...
will upload compressed patent folder to RV replication group ...
Hector ... Enjoy ... :) :P
#7133
Re: non-reflecting to source
Kone stated ..
> Shorting out the gencoils also could "be said" to be taking the
coils to zero too....
> ciaoK
****************************
Takes them to lower impedance were M field GUNS them to saturation

in a semy superconductive state were V =0 and I = N(maximal Current)
as Coil is OPENED the compressed superconductive tensor (electron
saturation) I (Current) in the wire is released as a VOLTAGE discharge
of great magnitude ( reread postings on NEWMAN motor ) arc effect
REREAD my posting were I descripted how a coil hi voltage is

discharged across a gap in a series of turn on turn off pulses as its
VA NODES roll across the gap ....
Reread posting on NORMAN WOOTAN FAN MOTOR EXPERIENCE and the creation
of NEGATIVE impedance states (Guning ) resulting in a virtual
superconductive state ...
A wire saturated with electrons becomes superconductive at normal

temperature being able to stochasticaly gain temperature energy
(HEAT) and transfering this energy to the ELECTRON region pumping the
VOLTAGE UP ,increasing CAPACITOR voltage ....
NEWMAN contribution may be forgotten , but we cant reject its

contribution in understanding this phenomena , RV alternator is the
same but in a squirrel cage reverse induction exited mode..
Bedini ,meg,Jim and Muller is same stuff Maybe I am the only person
explaining it as is ... And many hate me for it as it broadbands and
kills all secrets patents and R&D out there ...
Its so dam simple it scapes the mind .... (Teslas hidden secret ..)
Hector
#7137
Re: non-reflecting to source
There is a mass radiation parameter that must be taken in

consideration using series - parrallel connnection some filaments
being partialy magnetic will not glow at all even having same ampere
loading character (Resistance ) ohms law does not cover this nor
other Book data ...
Material damping of resonance does ocurr in some lightbulbs

containing nicrome alloy (Magnetic) in filament sintering
composition..
Apart from this problem the rest is tuning ...
Hector
#7139
non-reflecting to source + (ZPE )
More added to arcing ....

> Hi HEctor
>
> OK really makes sense - just like you said; shorting coil (switch
ON)
> makes for maximum current produced inside coil, ( as seen by
ammeter
> shorting coil in any test) but there are no volts registered while
> shorted,
******
Spark gap dynamics:
as a voltage spike croses a GAP this equals a short that makes

voltage cutt off ( 0 volt state ) opening the spark gap up as it
reaches cutt off voltage were Ions cannot substain conductivity
across gap as this open occurs Coil regauses to collapse state were
voltage increases again until air Ions become conductive creating
plasma bridge in spark gap , a series of Hi frequency ons and offs
creates the bzzzzzzzzt of DC arcing seen in scope as stepped random
discharges within a dc stream ...
*************
then turn switch OFF and this "springs" UP coil output to

> cap with HV since the current trapped in the coil releases with
> vengeance you could say.
*************
shorted Coil dynamics :
Exactly ! if we get the magnetic field intensity as to be TUNED in

Magnetic resonance in a shorted condition in a HI broadband
impedance coil the SHORT will be seen as an INFINITE farad
capacitor "Virtual solid conductor",for thoose of you following the
experiment becomes quite more easy to understand the implication of
this revelation ...
coil state logaritmicaly drops in impedance and cools down as it

attains a virtual electron saturation becoming superconductive at
room temperature ( 0 voltage is a ZERO point energy state were HEAT
will flow and be transfered to I (current as energy ) ...
As you open the circuit this energy is pumped as a voltage potential

into a condenser were it can be extracted with posted methods ...
******************
> It works great and its easy. Plus its not just spikes, as some
would say, since with resistor load across cap, you can double the
output of the coil in true-power that way...no resistor or high ohm
> resistors have more impressive voltage of course....
Its EMA sine wave capture as there is no gap random plasma pulse
modulation and energy loss ..
This is the beggining of understanding true ZPE energy production
using dirrect M field inductance ( start ) creating a near VTA
rotary Inductor "reverse of rotary condenser" ..
IN low to HI impedance virtual rotary inductor machine .
hope the people reading this realize the implications and instead of
supressing it take it to the place it deserves giving due credit to
all the people involved in making it posible ....
This information is public and repetitive add on to information

given sinse 1980 ARK Research and EVGray Groups 2000-2005
( public domain .) Pass it on ....
Thanks.. (things can be turned on by turning them off ) LOL! :P
Hector :)
#7132
Re: shorted-coil circuit drawing

> Hi Hector
>
> On my DC car motor (the forklift motor) it has 37 poles to the
copper
> conmmutator,
You can create a 37 phases recovery bridge by positive and negative

connections to each commutator segment so will operate on
37 phases delta grid , its an aplication missed in the chorus motor

patent they were not bridged for recoverry ( I never had it in my
computer files ) so they were not able to steal it ...
I am giving it public now ..... Raivo can give you the link to the
Multy phase motor generator prototype pics using external PM rotor ..
(now public ) a positive and negative diode go to each segment
creating simil to 3 phases bridge but being 37 phases in your case ...
37Phases delta rectified circuit .. all wires lenght must be EQUAL

to valance diode currents and current collector points must be hall
drift compensated in order to avoid cross current losses .
Hector
#7145
Re: non-reflecting to source + (ZPE )
> > Hi Hector,
>
> I assume you mean the DC current was rectified from the coil
before going the spark gap.
If its DC it simply follows a path ,rectifier is not needed as

reference (only if AC is rectified to DC vector ...
> I have done spark discharge with pure DC current before. I had a
huge electrolytic capacitor bank charged to 2000 volts. I used
carbon rod for the spark gap. The discharge arc made a nice smooth
sound. I could make it arc smoothly for a few seconds before the cap
voltage dropped too much. Does this DC arc I described doing the
same thing as you described above?
Yes Even natural lightning responding to plasma -ion specifics of

conductive path ..
Since the source is the capacitor bank, is there a hi freq on-off

> thing going on here as well?
Yes remember OLD time spark gap transmitters .. wire lenght and gap
determines turn on and off range of frequencys (including
harmonics)
Hector :)
#7151
Re: Academic
This was already given in the Electret and quantal diode stuff ..
Heating compounds like wax charging to 14+kilovolt and up, cooling and
creating electron tunneling materials (Old postings ) ...
Just requires the place and resources to do ...
But Its simplicity ofuscates the complex minds and solution scapes
the hands searching it ..
> Hector:
#7152
Re: Hector's 40 phase PM alternator
--- In EVGRAY@yahoogroups.com, "raivope" <raivo@s...> wrote:

> Here is it:
> http://tinyurl.com/dlxb9
Thanks ... Erata pase is ment to be "phase"
Winding in a DC motor rotor are overlapped so to get Phase relation

we divide 360 degrees of rotation by number of delta windings (40)
equaling 9 deg per winding ... for a multy phase arrangement is near
pure DC requiring no or minimal filtering .
Thanks
This pictures were Captured by Raivo using web cam .. so sorry for
low resolution ...
Only 2 prototypes were made using off shelve baldor PM DC motor ..
other things remain to be done but ran out of funds , this is the
type of basic motor-generator were the low Voltage ZPE solution
resides ... all PM dc motors can be converted to multyphasic motor
generators .... kone may have fun using a PM stator from a CAR
starter spun over a fixed rotor at 3,450 RPM were all its brush
segments are rectified .... it Beats the PMA output by a big
marging .... for better result a baldor DC motor is better as rotor
laminate is low loss .... this is tested by measuring drag loss with
no load ...
Thanks
Hector
#7161
Re: Thanks for the info
Vector an RV alternator dc output into it , use VR6 cadmium

bisulfite solution to reverse sulfatation were posible ...
just be careful with fusion reactions ..
Hector
#7171
Re: Interesting OU link..... sqrt (-1)
There is more to it , Seike formulations are doorway to

understanding this ...
Square root of one is a new region of mathematical realm that needs

to be adjusted also the primitive digital computers of today must be
replaced with analog sine integral ones ...
Hector
#7175
Re: ASI-Computer ;)
Idea is simple,in digital circuit you got 1-0 One-zero bits in Analog
you use RF mixer streams that carry full information and give instant
answers .
Sample 2 RF signals summed up divided,integrated or modulated give

you an instant answer ... in case of a cryogenic argon computer it
gives the answer before you formulate the question as it exedes speed
of light and answer is proyected a few miliseconds to the past.
look for RF mixers ...

http://www.phys.unsw.edu.au/RESEARCH/quantum.html
Then think how to mix it with this ...
I sank once $60,000 in this, still got the parts

600 Rf mixers $47 Each ,VCOs and other stuff in storage.
It works, but with no infrastructure is like dropping a turd to the

sea, a feeding frenzy and no shit left.
computer intent was to determine time & space shift nesesary for time
travel .... T.A.S.M.I.N proyect alike .. That as other things ended
shitfted to shithole dimension,as Big corporate GREED took over time
and space too.
Options left ..... (WAR).... start from stick and stones again
and us with brains being Gods .... just being redundant this time ..
Hector :[
#7278
Electrons, as they are polarized they tend to repel each other from
the center conductor ,this creates surface currents and resistance...
in multy filar conductors they tent to repell each other back to
center mantaining a more even current flow in conductor ,,,
If someone wants to do an interesting test just rewire a 3 phase motor

to 12-28VAC using this type of isolated fiber multifilar wire bundles
x 10 the mF to 1000 - 1500 MF for self exitation and VECTOR this
properly to a battery , a STANDARD HOME generator 2 bearing (harbor
freight ones ) can be REWIRED to 12-48 volt combinations to vector the
HI amperage dirrectly to battery using reverse induction ..
ALSO same system aplies to PM generators as the CORE loss isues are
IMPLANTED disinformation in order to disuade people in converting
STANDARD of SLELVE items to OU devices ..
EV Gray EMA motor can be done using any off the shelve inverter grade
synchronous motor generator or PM generator runing in RV modes .
Just Avoid the Oversaturated cores ...
if baldor motor cores in a 20 HP motor only got .03 % loss and an

UTILITY transformer CORE only got .001% loss them What are we talking
about ? You will never get that using nails or black sand ..
Ferrite and ferroxplana are for HI frequency ,not so off the shelve ...
I think is time to go back to MODERN low loss laminates and aply what
you have learned with the homemade cores, to lets say the 40 coils of
a DC baldor motor wired to 40 phases diode bridge to give 10 times the
rated output . Using Stator as Rotor and rotor as Stator ..
like in roof mounted fans ..
Some People want me dead for telling you this ,my life is a fu*king
hellhole, so please make good use of the info .
Untill me or someone else put an RV up US goverment butts! !
Thanks!
Hector
#7279
Re: RV Muller project by Kumaran ( Switching the Coil)
I asked if the group wanted me to give next step ,(I will do it

anyway ... )
Fast switching solid state self resseting fuses .. PARALELL TO COIL
They OPEN up as Coil reaches a maximal current dont reset untill

voltage returns to 0 ( 1/300 of a second reset type recomended )
CAN BE FAST SWITCHING SOLID STATE ONES as used in redundant mill

telecom lines.
Hector:)
#7283
Re: multy wire strand conductors )Multifilar ..
Magnet intensity is WAY to TUNE to laminate Impedance were OU states

are found ..Oversaturate like in the Wind generators PMAs and you
loose 500W on the spot ...
Oversaturation Equals drag , laminate Equals stochastic transform

were in resonance Heat=(IxI)rT creating ou transform ( Rotary
condenser machines In RV mode are WAY OU )
like RV you just need to try .... ( experimenting with Harbor
freight 120/240VAC generators and jumping to 230/460 EM EMA/RV run
ones ...
99% of the standard power is 50-60CPS so we have to deal in POWER

management in this REGIONS in order to be able to recover energy
from OU states (as RV alternator ones )
For The power Elite is priority no one finds to make MEGS out of 3PH
transformers , and RV out of 3 phase motors ,and rotary condensers
out of generators and the such ...
Is more easy to PM an standard generator that to built one from

scratch as is more practical to try to address the losses in
standard art and take it to ZPE states ..
I think RV demostrates that well , a PM alternator taken to EXACT

point of laminate saturation is what we need to have this in
STANDARD off the shelve mortals can replicate stuff ...
Not everibody is prepared to take a flat motor rotor and modify it

to UFO 2125 sonde technology 111 phases operation.
I can take one of those to 75KW using Nb70 mill grade PMs but only
Gods of the Olympus will be able to replicate the stuff, not so off
the shelve to do stuff..
I think many tricks can be learn from using CAR DC motors and diode
bridging the rotor commutator segments ..
you can boost internal Ceramic magnet power by aplicating external

Nb 50 2x2x.5 blocks and U framing them in steel with adjustable gap
to adjust field intensity ...
Normal use is to use stator as rotor at hi RPM diode bridging all

commutator segments as to get 100% power of all its windings into a
collector buss ..
Think if Norman Wootan set up was OU using standard servo as

generator think what the multyphasic generator will do if taken to
Radiant energy states USING PM magnets ...
I think a car Air conditioner PM motor stator can be end belled to a
shaft and turned to 3450 RPM over a DC motor rotor ...
As poor man experiment for low budget RVrs... as I cant ask you to
burn $1,200 in Baldor PM DC motors ...
Havent finish the BIG one due to interference only did preliminary
testing,will have to wait untill the 75K tools, liverating myself
from certified diplomated donkey orifices that cant even costruct an
screw without screwing themselves and every body they know with
it ..
Thanks
Hector :)
#7288
Remember the relation on impedance that is needed as to attain
logaritmic resonant gain within an LC componets induced from a
magnetic field ..
The natural core resonances summed to an optimal ampere turn wire

relation for best Q at lowest impedance (loaded)and highest
impedance un-loaded at a verry broadbanded state were coil will
asume highest voltage potential .
Shorting a coil as a magnetic field induces a current in the coil

equals having an infinite farad capacitor were its virtual resistive
component is 0 ohms (superconductive ) ..
Coil by consecuential relation becomes virtual superconductive

states were current tends to become maximal relative to infinite Q
in infinite farad capacitor untill electron saturation charge
becomes also near infinite (superconductive condensate ) in L
current node , as virtual capacitor is disconected the coil field
collapse causes the charge to be released from a current node to a
VOLTAGE one crossing 0 point barrier transfering potential to a
capacitor of a given lower resonant point than infinite one ..
We got that e=M(xC)C/T and H=(I²)rt of 16 basic transfer equations
cores do transfer Thermal and magnetic ambient noise potential

(aetheric) to electrical realm OU being nothing more than another
manifest of stochastic resonance phenomena justified by standard
formulations .. a magnet becomes an energizer battery as electron
spin energy is transfered to magnetic Field then to MARNETIC
modulated field transfering thermal or noise component to e field by
means of current pumping ..
My point as with RADIANT energy is that it can be created in LOW

voltage Hi Q modes of resonance using off the shelve components and
hardware and that OU states can be obtained in Standard generators ,
motors and transformers ...
Review post on resonance ( remember the statements we seek what

engineers try to avoid (resonance & natural harmonics ) that we have
to turn things ON by turning them OFF short to saturate open to
release potential into logaritmic resonant charge into specific
capacitor value, RV demostrated that sinse the begining using
reverse induction, surpases meg by order of 5 in hyperwave modes,
this taken to PM generators RV / EMA /Muller combination is the kEY
to REA: world ZPE aplications (specialy as ALREADY proved energy
saving ones ) 14+ rv replications
Charge & farads determine joules second so there is no bulshit way

of determining JOULES - HP transfer in potential ( that finishes off
with the debunker bullsh*t ) and burries it into a pure DC - volt
ampere potential were power factor issues are also terminated ..
I hope this Repetition enlightens a bit more on ZPE issues ..

any efficient generator can be converted to ZPE machine be it
EM/PM /RIEM (Electro magnet ) (permanent magnet)(reverse Induction
electro magnet)
There is no way I can be more clear and simple about it ..,RV

demostrate this state in ac reverse induction radiant energy
alternator mode ..
OU is no longer in question , we have to seriously deal with the

aplications and that is transfering the lab toy experience to
standard frame technology we have to face a truth that the
technology is already existant , that 100% of it is patent expired
already and that the importance is the method ( Given public) and
understanding how to aply that to Usefull practical items ,,
Like a simple bench drill and other tools you can think off ..
looping may come easyer and as a byproduct of ENERGY saving

technology as a move is made toward RESONANT power on demand modes
of power usage (transformation ).
AS we stride to change this system ..
Delphi went bankrupt = USA went bankrupt = capitalism does not work
as is theft of human blood and effort to benefit a few wile the rest
is fucked up and poor ..
alternate and free energy changes the equation drastically

RV has to go CNN , discoverry , national Geographyc before is too
late to prevent wwIII .. Bedini motor cannot power a car but an RV
as Electronic turbine can , Newman 7500pound motor cant be carried
in an Small truck but a PM RV can be put in a car trunk easy ..
And This can be taken to 100KW per pound in the near future (today
with proper resources ) and a bit of help ...
Thanks!
Hector :)
#7303
Re: RV Muller project by Kumaran ( Updates)
Visual proyecting the OU mechanics ...
M field can be considered a charge constant , as a capacitor

being discharged in a COIL lets call it mC (Magnetic Capacitor)
Your COIL core and COIL L being Shorted becomes NEAR 0 resistor
were its ENERGY value is eD (electron density per square centimeter)
as measured in the AMPERE density section of an STANDING wave ....
see my postings on POWER factor correction and RF ..
That Means the Magnet being a ROTARY condenser imparts its energy
as VOLTAGE mC and converts it to PURE CURRENT NODE were VOLTAGE =
near 0 being 0 perfect virtual 0 Energy point state but were
ELECTRONS are at saturation point and can aquire energy from HEAT
and ambient noise ..
At maximal M field were the short circuit is open then the virtual
Current node tensor collapses into a relative finite resistance
capacitor were its Ampere density is transformed into a CHARGE value
potential , 3 factors contribute here , coil core ,wire turns ,wire
size, Capacitor Value and its dielectric charge constants under RF
signal , were Stored energy can be defined by Joules at time of
discharge , core and Coil will rest to Ambient energy state or
preferable UNDER ambient egergy were it COOLS down ..
Whatever is said or commented that is ZPE in its simplest form be it

solid state or rotary machines its the same stuff common to all
devices ,,
Keep this notes .. Read seikes formulations, he almost hit it ...

just was not able to demostrate in vitro using standard devices .
But all of you have them now ...
On anty gravity phenomena issues is result of forcing electron spin

energy down forcing electron to decay, as electron decays they
become NEGATIVE in time and space creating anty-gravitic field.
(other problems do arrise with PMs as they contain traces of K40

and other exotic materials that go nuclear so is better to avoid
using 1.06 t0 1.6MHZ syncotron radiation emmiting frequency
harmonics ..
Stay thermal .. Stay in Energy savings for the time being , untill
this Hits the Fan spreads wide and open ...
MUHAHAHAHAHA! (:P
Hector
#7323
Re: RV Muller project by Kumaran ( Updates)
Summary
When running at 3000 rpm, the coil produces more power (5 times more
then 1500 rpm). Yet the 3HP motor is far less efficient compare to
7.5HP. Why?
Because there is a Core Coil mass relation that is tied to squirrel

cage rotor mechanics ... The Core Coil wire relations sweet to ZPE
and resonant state conditions ( verry variable in motor Makes and
models but best range is 3HP to ten HP limit
...
#7356
Thermodynamic law is based in Energy transformation ..
just need to be Updated to a bit less primitive form ..
hurricanes and Tornados are OU machines ,it just takes a bit of money
and support and I can put a few in a can to produce all the energy the
world needs ...
Using Off the shelve primitive technology at hand ( nothing exotic or

ET tech ) just plain Do now earth technology circa 1898-1940 period
stuff with a bit more advance up to date materials .
Hector
#7370
For cars the electric turbine RV is best as a 24,000 RPM
5 HP motor can put out 60 HP ///
Hector :)
#7376
Re: inverter tech
Remember Speed compensates torque .... hi frequency 3 phase inverter

runing multiplies HP using step down gearing (like in a turbine )
a 3 HP motor rotor at 15,000 RPM has about 11 tons of kinetic force

and definitely under certain Pulsedriven conditions can deliver 30
to 40 HP (Lab tested already long ago)
Hector
#7400
Re: prime mover and alternator as one single machine
In EM or PM syncronous machine were POWER FACTOR and resonance are

used to RUN in Magnetic amplification mode is posible , squirrel
caged ones are more difficult he must find the Sweet point Of
Resonance in the laminate plates were Energy transforms from thermal
to magnetoelectric energy and be (summed up the loading) be self
substaining, be inclined more to think that the magic may be in the
WATER pump used, that a modification was made to hydrosonicaly
extract energy fron hydrites in the water creating energy
transformation vortex ..
The solution here is take a look and have him dump the info in the
net ( add it to the INFO on ROTARY condenser machines ) RV modes and
power factor correction rol in OU production (resonance ) if its
electric and not hydrosonic...
In squirrel cage this condition usualy creates overspeed looping

destroying unit in a few seconds & melting the coils (danger).
One coil feeds the other resonant angle summing up vectors , this is
the same STAR generator developed for US air force Skunk works
Aurora proyect .. look for Chorus motor patents ... (Eye openner)
I was showing Raivo yesterday Small models of modifying any DC motor

ROTOR as multy PHASE generator , A next step advance is use PM field
to substain synchronous PM fed rotary magnetic field in RV mode ...
in this I put the STATOR in an end bell in a shaft this stator bell
used now as a ROTOR is spun on the ROTOR now fixed as stator were
each commutator segment is switched and dioded to RESONANT OU state
using the MAGNETIC synchronous field as VAR provider to Substain the
SELF oscillations of the HI Q resonant rotary field ..
Read Norman Wootan MRA work as we hit same phenomena and agree is
same stuff ... difference is here we can tailor a % of the load to
be part of gain equation (Extracted from system) were in MRA it was
not posible as LOADING detunes the system broadbanding to a NON OU Q
state ..
OU is no longer in ISSUE , its the aplications we are talking about
I go for energy savings, as the basics are aplied using the tools we
can go into higher level ( at this point is quite unsafe to play in
looping modes ) the lions will eat you alive, looped RV is trying to
sodomize a lion using no lubricant (you will be eaten )the system
will rape you back.
RV as ENERGY saver cant be denied ,its verry hard to supress ....

as an OFF shelve parts OU generator is made Then by default looping
and ou will be made by anyone, but RV has to GO first as Energy
saver.
Remember Kone RV /muller Mix took 5 years to be at the point it is

and that the theory being made public is nothing without the in
vitro lab experience , you cant have OU in a system of WASTE, you
need first to MANAGE power at minimal loss and then manage power at
verry hi eff grades in order to attain a level of knowledge that
permits you to manage and transform OVERUNITY obtained power Gains.
Believe it or not all the Knowledge is here in this forum and is
quite complete, from the RADIANT energy creation, to power recovery
systems., it just requires effort in building & learning as you
built the tools to create more tools and prototypes.
There is a lot of work to do ...

(And its a hell of FUN giving joy !! )
Hector :)
#7451
A car anternator as is from (OFF the shelve)
At a given SPEED and at a given REGULATED rotor

EM field intensity becomes EXTREMELY overunity ..
'To the point it can RUN and inverter and feed itself ...
the battery becomes the infinite virtual capacitor were Coil phases
load their OU energy to , water in electrolite becomes quantal
nuclear fuel to the reaction ( so needs to be added daily ) ...
Note to dogs : I dont keep assembled looped working models at home

or my lab so dont bother entering to steal them ...
AMEN ! Thoose of you doing the experiments with the RV Muller gens
can now understand easy how to make this posible ...
Using proper CORES and PMs in PMA alternators can produce Overunity
generators from off shelve parts and pieces (or whole units )
same aplies to any generator ...
Its not the invention its the Method, teach the method the invention
persists for eternity ... Teach a man to fish he will not hunger
give him fish he becomes dependent & non redundant ...
Hector :)
#7507
Re: project by Kumaran_what's next?
Next step after Optimal coil-magnet is determined is choosing BEST

CAPACITOR to attain logaritmic GAIN as coil Current node potential
is transfered to capacitive charge so as Coil to go near 0 current
pumping capacitor to max voltage ... That is MAX farad Max voltage
potential into choosen capacitor to atain max storaged JOULE
POTENTIAL at a given frequency ..
Things to look ..
Frequency , coil impedance , Q , Capacitor , Mfield intensity .
Reread info on RESONANCE ... As optimal OU condition is determined

by properly combining all this parameters in TUNED condition
I know is repetitive but good to visualize ..
At rest, PM aproaches shorted coil,potential is induced, coil

attains maximal current and sees Short as infinite capacitance were
coil attain maximal current relative to its parameters and M field
effect .. Coil becomes Current standing wave node were voltage is 0
but current is maximal .... I
ª.
At maximal field intensity Coil is open, From the Current standing

wave node (electron density ) virtual Kinetic accumulator (spring
like) current transfers to VOLTAGE potential - + on opposed pair
acceleration were T (time) V (voltage) And I current transfer into a
Voltage node (Capacitor ) is determined by Core & wire turn
impedance relation to such capacitor in HALF wave relation were a
diode permits energy as voltage potential to transfer fully as a
capacitor charge (one way) half wave (see diode plug) .
References To study , standing waves, resonance , Rf antenna

design ..
Radiant energy IS RF learn RF secrets KNOW ZPE secrets !
OU results as part of a Coil core ambient temperature component is

trasfered to electric resonant ones (Electron spin & thermal).
Refer to Stochastic resonance as theoretical justification ..
Basic genesis formula H=(IxI)rT as Other justification.
VTA, MEG and other models as witness expresions exibited

temperature drop as working in overunity modes .
This is indicative to a Transform mechanic being the true base for

ZPE /FE OU manifest ..
We are dealing with reality and whatever is real becomes demostrable

and usefull.
Carry on !! Its so good when things work ! ^_^ !
Hector...
#7522
Re: pulse length frequency inverter-> RV mode
Answers within text ..
--- In EVGRAY@yahoogroups.com, Matt Trainer

<trainerenterprises@y...> wrote:
>
> I have seen the same thing. In fact, I use that shudder to stop
my motor really fast. Otherwise, it takes several minutes for the
motor to spin down on it's own.
***
OK its due to reverse induction braking , desynchronizing and
slippage ... remember rotor is virtual inductor and capacitor makes
it synchronous to specific speed and ac current frequency ..
***
>
> Also, I have noticed that when I switch between
> start cap to run cap right at the shudder point, the input amps
drop to near zero for a second or two then pick back up to .5 - .6.
>
If you accelerate using frequency inverter and deaccelerate the

rotor makes the power goes negative as rotor angle of rotation
becomes leading acting as generator the capacitor tends to lead the
angle (over-speed ) as you switch to low capacitance this leading
slip turns for an instant in asyncronous generation state .. were
rotor provides energy to source ... curent goes to 0 or negative .
refer to asynchronous generation, cogeneration & power factor

rotary condenser machines , read prior posting on this isues
(in need of new compilation ) & a bit of BS removal (unintentional).
reread compilation on bedini "power correcting his battery".
Snip more down to go --- read on ..
> EB <eb24@d...> wrote:

>
>
> ashtweth_nihilistic wrote:
>
>>
> > One thing you could do for me, and this is ask H if he has
experienced a bad shudder happening near full RPM just before the
next cap should be switched out.
That is due to exess capacitance and overruning (tendency of rotor

to spin at higher frequency than line frequency) as ANGLE of
rotation imposed on the 3 phase lines exedes and overlaps the next
creating a counter rotation null field (braking ).
I have found if I don't get the caps changed over

> > quick enough this shudder happens and the RPM drops
dramatically, and I have to reboot again and go though the same
sequence.
use less starting capacitance were motors hums in frequency beat

mode but not exeding the slip limit .. or use centrifugal start
switch to drop off capacitor at bellow maximal rotation speed
a centrifugal switch from 1 phase motor can be used for this at
proper speed of course , if you got 3200 RPM at 60cps you must use
a switch for 3450-3600 RPM range if 1800 then 1725 to 1800 and so
on .
>>
> > >From my experience so far I feel there needs to be an RPM
monitoring > circuit where the caps are all automatically cut out at
the right time.
spartan off the shelve already existant redundant EMP ew warfare

resistant KISS >centrifugal start switch <.. installed in fan
housing external for easy maintenance .. mostly cleaning if not
sealed.. I posted this already way back ... but repetition is good .
put in compilation also ..
With this simple circuit and the variable pulsing circuit the
> > RPM and torque would be accurate and stable from start to go and
no messing around.
For variable frequency a switch to 3 phase inverters is recomended

the RV one phase set up is test bed to understand phase relation to
frequency capacitance and impedance , in 3 phase alone is a bit
nightmarish without the single phase inverter experience needed to
attain OU conditions were in 3 phase this is attained with
pulselenght frequency and amplitude , here we reach a point were the
hi level engineering must be addressed in a well funded R&D lab were
all of us can participate ( out current stagnation point ) clashes
and bitchfights are born on desperado urges on being king on the
hill issues ... ( that is why I insist of showing RV power savings
and use as R&D tool first and mantaining our progress public as we
go as we hit the area that is common to all 130,000 patents on free
energy but that no inventor before had explained as to justify
scientificaly in an integrated sense making USEFULL form ..
A working thingy ! gizmo whatever to solve or mitigate in practical

use the enery crisis ...
(For that some people want me impaled and roasted on a lance)

RV is a hot nail in the ass to their agendas and economic
interest.
Refresh comments on subject bellow ...
>
> Hi Ash, I have an idea what that shudder is. I have experienced
the same thing. It will happen when you disconnect the power source
to the RV when the start cap is still connected.
Rotor becomes reverse inductor to LC at lower frequency LC brakes

rotor by inductive braking .. LC tends to generate higher frequency
harmonics ( refer to chorus motor patents as to existance of this
harmonics) (other aplication).
> What is happening is the RV becomes a RV generator the moment you

> disconnect the source power. Anyone can try this. Simply power up
the RV with the start cap connected. As soon as full RPM is reached,
> disconnect the power. If you have the right size capacitance
connected,the RV will hit the resonance as it spins down. Once that
happens you hear the shudder and the RPM drops super fast.
>
> Erick
Right on the nail ! RV becomes RV alternator relate to synchronous

condenser postings and using off shelve generators for RV POWER
factor CORRECTION OU aplications ,energy saving-motor generator and
others , my "GROUP" idea sinse 30 years was to integrate and
infiltrate technology within the industrial arena to make imposible
to supress free enery at a given time, the technology is there
the method is within RV disclosure ..
With proper funding and support this might be done faster just
need to be pushed to CNN, discovery channel, National geographyc so
is not hidden within the system power of shadowing denial and
apropiation ....
Make RV you NEXT kid school science proyect ...
Lets see what the SYSTEM makes out of it ....
Run a Muller/ Ecklin brown generator or whatever you choose ...

with it ..
Hector :)
#7586
Re: It is hard to change the general opinions ,in depite of evid. of experiments
Tell thoose university idiots to put a microwave oven magnet or

speaker magnet in front of a BW TV screen and watch the image spiral
sideways following the logaritmic spiral lines of the M field ...
( Thoose donkey orifices dont have an inch of common sense lab
experimentation.. ) reverse the pole the lines spiral the other way
its a cheap mans electron beam Magnetogram reader//
The lab models fornicate diplomated idiots brains badly (no posible
denial )
At the end we will win anyway ..
Hector :)
#7608
Re: TUNNING zero point energy [resoance ]
If you read past postings I divide into levels
Resonance , thermal ,electron,atomic, chronal (time Space )
safest is Thermal & electron ...
Read stochastic resonance as base ...
mechanics are all transformation ....
This is like religion .. a lot of CULTS arrise upon interpretation

of "Gods" word ,,,
Hector :)
#7662
Re: Matt's RV Results
Comments within same text .....
--- In EVGRAY@yahoogroups.com, Matt Trainer

<trainerenterprises@y...> wrote:
>
> very stable as well even after four hours of running.
Tuning is stable and predictable ..
The output actually went

> up some after it ran a while and the input stayed the same. I'm
assuming it was because of the bearings getting warmer and the lube
working better.
True as predicted it can be used to quantify lubrication efficiancy
in machine designing green energy saving equipment ...
Other reason for the increase is rotor conditioning to being

polarised in synchronicity ...
>
> It has virtual power of over 1200 watts with an input of less than
270 watts!
Welcome to RV club .... Do the hand magnet aproach to TASTE radiant

energy ... :)
> I know it can get better with some tuning to a load but I still
have a huge smile on my face. :)
It feels so GOOODDDDD when things work ... still lot to learn and
lot of experiments to do , radiant energy (RF) differs a lot from
normal utility power , you got now 2 things ..
You have the primemover reverse dynamometer rotoverter tool.
You got the alternator Runing and RADIANT ENERGY in virtual

logaritmic Overunity .
Now OU being no longer in question..
All the work is coming together and I have learned a lot.
Like stated ,,Theory is one thing building is another ..
> Now I need to know how to load it correctly to measure real power
and then it extract it. I'd appreciate any help I can get with this.
You can use as is RV to as energy saving tool driver ...
Use it to develop the already explained methods of extraction
The potential can be vectored as a capacitive charge using the

proper method , as Kone/muller design alternator reread all
postings on Coil exitation (impedance and resonance ) ///
The RV alternator is the first PRACTICAL low cost Low Voltage Way of
producing true RADIANT energy ( no tesla coils ) no 5KV million
dollar Gray motor ..
> Here's a link to a few pics I took once I got it stable.

>
> http://www.selfmademillions.com/rv1.html
>
> Thanks everyone for all your help!
You are welcome !
> Matt
>
Hector *_* !!!
#7664
OK Scope will show a semy resonant PF angle differential of current

and voltage close to 90 deg on alternator ...
Radiant energy on this CONDITION is not LOADED as to create it

because if loaded the condition goes under unity , so power must be
VECTORED to load load being part of an LRC circuit , here is were
RADIANT energy separates from normal ac ... like in Kones generators
coils You Short OUT coil to create virtual infinite capacitance in
order to attain maximal current in coil at 0 voltage (shorted )
The true definition of ZPE ( ZERO VOLTAGE ) ZERO POINT
Be it Current node or VOLTAGE node in RF there is allways a ZERO

point reference were the logaritmic amplification projects in a
spiral from 3d to 4D horizontal from vertical at 90degrees within a
time space cone of 72 degrees scalar projection..
( Way of crudely defining a Cornu spiral within optical slit )
were amplification from ambient energy occurs,,
refer to stochastic resonance phenomena ...
#7703
Re: core material
Shorting in stages and releasing power into capacitor Acts as

Electron maser Pump ( Read NEWMAN motor plasma effect ) Read old
postings on same subject that ARC discharge across a GAP is a series
of PULSES and not a continuous plasma conductive stream due to
shifting current and voltages nodes within an LC and open AIR gap
becomes an on off oscillating switch.
This takes HEAT and drives it into the Electric potential of the
coil reducing atomic and thermal signature ( ambient energy ) .
resulting in OU (Overunity transformation) into electrical circuit

containing such intended design ...
Hector :)
#7830
Re: RF issues
No as is a filtered non interfering signal falls under part 95 law

as no antenna is provided for radiation broadcasting and any
interference is limited to less than 33 feet ( cathode ray
modulation) of electron beams ) and radiation by means of powerlines
is limited to POWER factor correction VAR effect ... HAVING EXTRA
FILTERING EFFECT... i WAS VERRY CAREFULL IN CHOOSING ITS standard
off shelve parts to comply to everry UL/CSA & OSHA federal
regulations on safety , any standard actual home generator produces
ten times the EM FIELD RV does due to a lower impedance and waste
of energy 1800W goes to exite rotor were in RV is substained with
80W -100w
HECTOR :)
#7831
Re: lots of stuff +IR cam
THINK IN MUSIC OCTAVES WITHIN A COLOR YOU HAVE 7 TONES OR SHADES OF

SUB TONES AS IN BASICS, IN MICROWAVES YOU HAVE A MICROWAVE GUIDE CAN
CONDUCT MULTIPLE FREQUENCYS THAT RESONATE WITHIN A GIVEN SET OF
MEASURES ... IN VLIR YOU CAN SE THE basic TEMPERATURE SIGNAL OF
HUMAN AURA USING IODINE CRYSTALS , USING STOCHASTIC RESONANCE
OPTICAL AMPLIFICATION YOU CAN DETECT A HUMAN BEING BIO SIGNATURE 600
METERS deep inside a cave under a mountain such amplifiers are top
secret and are being used in spy satellites ,can detect DNA RNA
signature from 24,000 miles up ....(Yes dial you up by DNA code )
It makes me sick how they entertain the sheep with 100 meter
resolution mars pictures when actualy they have sub light wavelenght
neutrino telescopes & other toys to see a fleas ass hairs from here
to the moon ...
Hector :)
#7898
Re: building the pulser side
That makes Flash tubes good Thyratron substitutes ,and the cold
cathode ones does not have thoose problems , including a suppressor
grid to eliminate leak back ..
Problem is NSA will jump on you as they have nuclear trigger
secundary usage .. ( They get extremely paranoid if you order one)
so you have to declare a set of complex specifications as for a non
military "innocentive" usage (Not mentioning ZPE aplications).
Hector :)
#7948
In radiant energy effects as in resonance there are regions of
standing wave energy called Nodes ... this nodes are either a 0
current and max voltage regions or 0 voltage and max current regions
as alike measured in 1:1 VRSW RF antenna dipole ..
Rv can be run dirrectly from the air using air capacity plate (RF
antenna) using 10nth shuman harmonic of 72CPS all that is required is
10 feet sphere capacitor and a heck of a tuning ability
to run it totaly wireless in Tesla wireless mode ...
rotoconverters may be old patent but the disclosure of what can be

done with them is not , tap the 10KHZ white noise of the atsmosphere
and you have free energy forever , for that you will need 100 pole
motors to speed down from thoose frequencys or verry fast RV electric
turbine engines ...
" A few More toys" you still havent got an idea yet ...
Hector :)
#7976
Re: RV on hold ( Modified sinewave inverters)
A modified sinewave inverter (off the shelve ( can be frequency

controlled and its 2 HALF DC squarewave PULSES can be PULSELENGHT
controled
All phil needs is to Modify Such OFF the shelve designs into
Variable parameters ones ..
www.dalbani.com (inverters )
and you can order custom built 3 phase frequency drives from
www.galco.com 47CPS to 470CPS at 230vac & transformer step down to

120vac , also with pulselenght regulation option...
all that is required is the tuning ZPE knowhow..

to get thoose energy POWER saving states .. LOL! :)
Hector:)
#7994
Re: EV Gray conversion
Gray tube is pulse driver RF ac homopolar transformer

were the energy in reality is extracted from Electron density
modulation from within standirg wave RF signal nodes under pure
resonance , same energy is produced in the lower voltage RV
alternator in pure resonant low impedance states.
Hector
#8009
Re: Radiant Energy -- Wireless Transformer of High Power Lines?
I posted in PES the powerlines had nothing to do with it and if a

signal is decoupled from a source the receiver does not effect a
LOADING of such power lines ...
Hendershot secret is contained in reactor core diagram in files

Read Norman Wootan MRA work that sums it up and is still under
ELEKTRON energy transformation elements (Aether is 3 levels up )
in engineering ,hendershot is within electron energy amplifiers
classification (Level 1A ) RF radiant energy Transformation devices.
(Basic)
Hector
#8010
Re: HAARP-> some thing uselfull [for H]
Ash , A lot can be made using this , to the level the goons were
scared Sh*tless entered inllegaly into my home and stole 3 tesla
patent books dealing with Teslas AMPLIFIYING TRANSMITTER ...
(a simple tesla Coil )
The secret is simple , you first find the type of signal you have on a
site (natural standing waves) you determine frequency and provide an
air capacity and COIL to tap into it, you exite your (TESLA COIL)
TO SYNCHRONIZE TO the standing wave signature to aquire class c
amplifier alike in the coil air capacity elements at hi Q modes
the instant the signals cophases the system becomes self substaining
at signal potential x 10, that is like 64,000 hp for a 128KHz
signature in colorado springs area .. Colorado USA.
you need to locate the nodes and place the resonators in order to tap
the standing wave signals .
The problem is not technology its People politics religion and

stupidity mix with infinite greed and economic power agendas..
Hector
#8016
Re: Radiant Energy -- Wireless Transformer of High Power Lines?
OPPS! went blank at first but maybe that was right answer ....
as All the answers believe or not are here ,in this forum repeated
over and over and over
A few step ...
learn to attain resonance , understand its Q modes, broadband

narrowband, understand conversiuon losses & gains, understand
current nodes and voltage nodes (basic)
understand Q gain and Electron density magnetic multiplication

factors .. stochastic resonance basics ..
phases and rotary magnetic components , feedback amplification ,

power factor correction and the full MRA papers and reference
coupled to in hand lab experience in all prior components in vitro
That is impedance (coil an cores) fundamental resonance & harmonics

in transformers & impedance matching in RF engineering practice
antenna matching and RF transformer matching aplied to POWER
transformers in pure resonant looped states ..
Concept is simple 2 resonant tanks in ultra hi q states tailored to

cophase and amplify themselves in a loop using a ratio matching of
current and voltage nodes of 1:5:1:5 were condition is such that
thermal electron energy is transfered to circuit mantaining its
power in a self substaining loop were true gain results in
logaritmic projection of such signal Cop 1 : 1.618 with resultant
lowering of electron Kelvin temperature constant at a rate of 38.2%
N BTU HR .
...
#8018
Re: Radiant Energy - Hendershot device
Answers within text ..

> I doubt those homemade capacitors and hand made coils have
> such precision.
**********
That is Why at all this years no one replicated it as the weaved
basket was his impedance tuning network ..
**********
>
> The Hendershot device is basically two tuned circuits coupled
> together via 1:5 conventional iron core transformers.
> The Q-factor of those LC weren't so high to overcome losses.

> Even more to extract power from them.
***************************************************
You forget there were 2 coils and 2 booster capacitors coupled to
transformers alike ferroresonant ones .. (weavebasket) engineered to
HIDE its simplicity ... like RV its simplicity does not sell it so
he had to make SAME mistake as EV Gray Exclusive not even GOD can
replicate stuff ( YESS ! Once I show this stuff I will be Rich ,so
and so ) not even his son knew how to replicate it and he taught no
one .
And that is the mistake, Q is dependant on COIL core relation and

not on single static parameters (aparently LOW Q ).
How much power you got from it? At what frequency?
same concept was mema tested in dual 75KW transformers, at resonance

that went to 750KW resonant virtual energy spining the rotary signal
within 3 X 3 end to end looped phases that is 1.5 megawatts of raw
power using homopolar bazuka type match for feedback (external
elements..) This was not taken to loading stages as to measure
output capacity, but as theoretic rule its non reflective potential
was 38%, frequency range is 47CPS to 450CPS depending in Q and
broadbanding, system Does respond to Location and is subjected to
anomalic phenomena responding to hi degree of degausing (severe).
So men in black ,ET blondes and mean mothers from outer space get to
be the order of the day once you make this and get it operational
Want to make it Easy? ... Think ferroresonant transformers LC
Think LC is OU relative to line power and think in terms of one be

female and male in a wild orgy of electrical sex .. power factor
correcting each other ! the problem is making them to copulate
properly .. ( The Female ant and the male elephant theory aplies )
so carefull "Tuning" is the key nodes Male female I↨O .
Reactor core.gif in ark files is basic BLOCK diagram

AChomo.jpg is basic coupling method , circuit Banger
is starting (initiator) or System Motivator , yep I gave the darn
thing as a puzzle .
Like RV sooner or later will be replicated in whole concept ,but

Resonance needs to be dominated to perfection .
Some of the group were working on this concepts already ()check old
postings on 3 phase Transformers , ferroresonant transformers and
such... Norman Wootan Also but I dont know the status of that as as
he stated he is pursuing another line ? OR METHOD (CRYSTALS)?
wHO KNOWS?
aLL i KNOW THAT FOR REPLICATION of a looped system all the
parameters that compose such system must be known Also I know if
people pursue energy savings using resonance and RF engineering
practice they will hit it sooner or later, as chickens first walk
then fly to the tree tops and barn roofs ... So its path to ZPE .
(THE EGG AND THE CHICKEN) FROM QUANTUM PERSPECTIVE....
In 4D concept the Chicken is first (future) travels to the past lies

his ancestors eggs then after creating a colony returns to the
future.
( BUT SHE NEEDED to learn to fly first....)
Hector (:> PKAH !
( God is a BIG chicken) be one with the egg ! LOL!
#8026
Re: H comments for Z.E.U.S
Zeus is already integrated in energy saving lights , they just need

tritium hydrogen deuterium mix in FL tube and stays lit for 25 years
or longer with no turning off .. using molecular maser resonator LC
(FL-r). integrated in circuit board) , tritium is restricted by US
goverment and Internacional nuclear energy commision...
That sucks !
Hector
#8027
Re: Science fair help (generators)
--- In EVGRAY@yahoogroups.com, "Hector" <arkresearch@h...> wrote:
On Generator design ... using PM dc motors
Dc motors do not make good generators "as is"

If you dissasemble one you can see the brushes and the area of
commutators they touch . in case of a baldor DC motor if you have
40 commutators in 40 windings delta connected and brushes touch only
2 commutator segments you are using only 1/10 of your rotor winding
plus the others become shunts drawing power from the first ,
independent star configuration prevents self shunting ..
as generator diode bridging in 40 phases bridge uses full potential

of windings in overlapping phases in continuous DC stream in
magnetic PM top N-S field crest within the structure ..
Good test is to create PM end bell from PM dc motor and rotate it

with RV in a full phased Wye rewired DC motor rotor (Now stator)
and quantify energy generated in pure DC ..
that is raw 4 times over the full load capacity of motor at 10 times
more efficient . Depending in Quality of motor and rotor laminates
( some realy suck ! ) RV permits you to see were they suck and why ?
... its were quality and design influences performance ...
In engineering energy savings alternate energy systems what matters

is quantification and method ( RV is a primary R&D tool )
the first energy you save is the one you dont waste ...
If you save it then you can transform it ( here is were OU Overunity
comes into play) (energy saving aplications) ...
Hector :)
#8029
Re: Jinis transverter replication ( Electron )
Tips on energy transform OU ..
> --- In EVGRAY@yahoogroups.com, Jinis <jinis_services@y...> wrote:

?? Some advices very
> > appreciated!
>>
> > Here is what I have already started and I will put all progress
of
> TV replication here:
> > http://www.m-primus.com/www/de/data/tv/tv.html
>>
> > Now I am trying to find out the optimal input voltage for
primary.
That will be your minimal self substainig Resonant constant ...
energy required to overcome time energy decay e-(H/2L)T

> Some Ideas what input voltage I
> > have to choose according to my readings?? I now, Hector wrote we
> should take one fourth of
> > nominal, but I don't know exactly for what voltage the
> transofermer was used. I believe it was
> > 380V to 220V (660 windings to 390 windings) - some V reducing
> transformer.
The Constant determines the impedance match required (ratio) as is

variable on aspects as Q ,ampere turn ,core parameter ,wire size
capacitor voltage & electrect dielectric constant & others you will
find as you go ..
> > I found already ferroresonance effect (voltage jump) using 69.8uF
nice that is MEG MRA and VTA principle !!! ^_^ !!!
> cap in the secondary. But

> > depending on the direction of my measurements (increasing input
> voltage or decreasing input
> > voltage), this FR effect (voltage jump in the secandary) occurs
> between 92.5V (goes from down to
> > up) and 82.5V (goes from up to down).
Voltage tendency to go UP as input goes down & acustic physical

noise increasing in transformer ? ( predictable) until it Cutts
off a certain point ..(resonance shuts down) as null wave is
created..
>
Should I take let say 85V as

> input and tune the C for LC
> > resonance (like section with negative resistance)??
find your resonance substaining constant ( energy required to feed

circuit resonance )before reaching cutt off region..
Note that you cant start resonance with this level of energy ,that
resonance needs to exist in order to go down in power to find this
constant .... ( Other reason Researchers were lost in Hendershot
design) he started a RESONANT pulse as to start circuit .. if there
is no resonance you can never try to substain a positive constant
feedback as THERE IS NOTHING BEING AQUIRED TO SUBSTAIN IT .
>>
> > Even if I found the ferroresonace effect I could not find till
now the optimal C value for LC ,
its were the core rings ...
> > resonance. Are there any good advices how to combine
ferroresonace and LC resonance together (it
> > is required at all to combine ferroresonace and LC resonance)??
>>
In ferroresonance the idea is to hit a fundamental frequency were

the electron spin energy transfers to the core magnetic oscillation
in were energy HEAT tranfers from current flow as H=(IxI)Rt as crude
simple equation to justify genesis transform ( hiQ ) resonant mode .
> I have planned tomorrow to make experiments for finding out the
> characteristic curve when the core becames saturated in
dependence of input voltage and input current.
You must find capacitor VALUE were at a NATURAL frequency Core

becomes hypersaturated state and squeals like a pig been bitten by a
hungry dog ..
Thoose details Expertly capacitate you to calculate best COIL

CAPACITOR relation to aquire hypersaturated states in transformer
cores determining best OPTIMAL frequency to aquire Overunity
transformation states were a node constant is provided to correct
time decay drift and mantain a loop ... using 2 resonant jing jang
systems ..
>>
> > After I will find the optimal input voltage and optimal C value
I will try to use the diode plug > for increasing Q as Hector
suggested.
Plug is for Extracting usable potential using non reflecting power

spliting capacitance bridging the 2x2 , and 4x4 designs.
In MRA the Calteck doctorated idiots tried to milk the cow by

killing it , Loading killed the OU effect and any posibility of self
substaining ... In VTA was less effecting as the SOURCE was innerent
Bariun ferrite tendency to latch that augmemnted ferroresonant
effect as to create enhanced OU transform , but were is the material
to work with ? (Suppressed ) the inventor neither teached method or
got true specifications of materials used and thoose having them
retain it as trade secret ,so gentile researchers remain screwd in
that sense untill they understand MEG and can transfer that
knowledge to transformers (Normal) and RESONANCE ... to attai
understanding of what I have revealed sinse 1999...
> > Please check out my mesurements.
Lets see what is your lower Resonance substaining potential ....
it will reflect back to line as power factor correction .. VAR ..
There is were the fun starts ... LOL:)
Sages keep this notes ,pass them on ,this is the no bull simple real
stuff in ZPE OU R&D ,things like RV that you can test and use in a
REAL lab using OFF the shelve hardware.. (just requires proper
method)
HEHEHE .
Hector :)
#8033
Re: H comments for Z.E.U.S
Sonofusion creates deuterium & tritium --- In Hydrogen plasma

creates large ammout of energy ..
Hector
#8048
Re: Plasma resonance + stuff
Stochastic resonance gives near all answers , cophasing gives

others ,LASERS & Masers , traveling wave amplifiers ,piezo acustics
amplifiers and a hundred technologys gives true practical answers
and certain frequencys are not that hi .... like the fish in the
water they cant see it , but is there ...
On Wavitons yes they can be used to tap ZPE and ZPE manifests in 9
basic levels ( ELEkTRON being current science one Knows ) that
relates to KNOWN uses of electron particle , untill I can teach
people how to create vitrons by transfering electrons to 4d states
and create static light (non moving photons ) using off shelve cheap
stuff it will be a bit difficult to jump to other RESONANT regions
of ZPE (specialy resonant plasma ones ).
Hector ... economics limits realy SUCK !
#8099
Re: Transverter/resonance experiments
Try Hi q resonance at 90 deg phases ...
Compensate frequency drift using variable frequency source
Compensate time signal compresion USING PULSELENGHT control

of input signal (square) modified sinewave
split and match input impedance as to drive with rotary phasor angle
defining power input as phasor difference (reflected power to line )
correct input PF .. and note the differences ..
I think you will like the NOISE of real OU ///
LOL!
Hector :)
#8102
Varactor effect drift
As a Core is mantained in Hi Q hypersaturated modes Input voltage

variations produce frequency drift creating beat harmonics increasing
loading to source, synchronising hypersignal becomes an art as voltage
is LOWERED frequency needs to be compensated to keep proper rotary
angle and mitigate parasitic beat harmonics , the cophasing of signals
as stated before is measured in angle of rotation relative to power
input and LC minimal substaining power required to mantain resonance..
Hector :)
#8108
Re: not_fully_off_topic-lifter
Yes inversely proportional to the speed of light and as light speed is

attained the charge equals 0 as electron mass becomes infinite and
enters 4D but this is dependent relative to time direction and
polarity used
Hector
#8114
Re: not_fully_off_topic-lifter
If electrons rotate in anty coreolis force orientation of spiral

within spiral in disc surface yess ...(G e- shield ) system entropy
has to be reversed in time to attain OU as local - G field is
created to counter the positive G earth field ... Searl had a good
start on that but The zoo Masters tilted his brain so he is giving
no secrets ... and mine are a bit hard to translate without the Toys
and a good UFO building 101 lab manual ...
Darn "! who is goin to put the money to play making the basic tinker
toys ?
(Frustrating) :(
Hector
#8196
Re: elusive resonant
0 --------------- 0 --------------------
>
> Question:
>
> 1. So what basis of resonance computation I will
> follow before I proceed in buying all necessary
> materials ?
You have to see the motor rotor as a variable element seen as

reverse negative inductor were theoretical optimal point is
syncronous rotation of fields at null or neutral point were voltage
& current are theoretical 0 at 0 loss .. in real world we have loss
exept if rotor is PM were we have GAIN in VARS as power factor
correction ..
>
> 2. What you mean " resonance extremely broadbanded Hi Q
> and Low Q impedance or Do we have exact or
> estimated parameters value of the two Q or some
> sort of border line ?
At no load impedance can be 600ohms or higher once rotation is

aquired ,on loading impedance can go as low as 23ohms
The idea is tuning the 3 phases at near valanced 120 degrees , there
the magic happens .. Extreme efficiency at higher impedances low
temperature operation..
>
> Sorry for so many question, Realy I am not well familliar about
resonance. I only want to make sure I know what I am doing and
buying. You will get yourself a verry advanced and simple R&D tool
( Just ask thoose that had built it ) you can quantify an ant hair
friction on the shaft using hi definition DVM, measure lubricant
effectiveness (as R&D aplication sample).
Basicaly as per instructions a motor 3Phase 5 to 7.5 HP_ any speed
dual winding 9 or 12 lines 230/460VAC preferable external fan 184
Frame TCH oil capacitors 370VAC 7.5-24 mF range runing 100 150mf
starting capacitance and assorted capacitors for tuning 1,5,mF up
to ten ...
Then wire as plans, for starting use current or centrifugal speed
relay (switch) can be used .
I know you will have a lot of fun... as nearly all motor

manufacturers say runing a 3Phase motor on 120VAC house current is
impossible LOL!
Hector :)
#8216
Re: Gray motor
Use a 230/460VAC generator as asyncronous EM motor and use resonant

Based switching and control.
Problems with Spark gap resonant switching are RF interference,

Ozone gas generation, dielectric breakdown and LOW HP ..
And Yes, we have tested it already in many ways you cant even
immagine, Newman Ran an interesting version of it but never wanted
to go RV mode like you did, positive aspect is for PM ROTOR your
system does work quite efectively and will not be subjected to EW
warfare or EMP if TFE wire is used, So for lifter gyroscopes and
that sort of thing it does have its aplications , military also ,EW
countermeasures ...
sometimes primitive and simpler is better ...
nice Page ! verry nice work ...
Hector
&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&
&&&&&&&&&&&&&&&&&&&&&
&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&
&&&&&&&&&&&&&&&&&&&&&
#8590
Re: Tesla quote "tremendous advantage to break at the peak of the wave"
In one of the compilations there is the TRUE tesla coil driver
The HV secundary is RESONANT to CAPACITOR PLATES were an SPARK GAP

conects the Coil primary and discharges at the CREST of the WAVE
This APLIES to VOLTAGE node (MAXIMAL ) were in KONE COIL is CURRENT

Mode Maximal , the secret as stated many times is Knowing to USE the
POWER NODES in resonance ..
Refer to poor mans thyratron postings for more data .. as it was

intended for PEAK triggering the TRANSVERTER PLUG capacitors APLIED
to RESONANT adjusted PM ROTOR GENERATOR MACHINE .. like Muller or
any conventional machine as NON reflecting JOULE power discharge ..
Crest can be..
Current peak at 0 voltage (Kone Coil)

Voltage peak at 0 current (Transverter Capacitor Plug )
ALL Manifested in TESLA COIL PRIMARY Were such BASIC circuit is

used in AC signal dual mode .
Ac feeds primary secundary goes peak at resonance charging capacitor

spark gap fires at crest into a literaly shorted turn that GOES MAX
amperage as gap is active (Joule discrarge ) were AMPERAGE flow is
maximal as such Shorted turn equivalent were in OPEN air E field is
maximal at Spark Gap opening the field signal collapses and regauses
causing the FAMOUS hi voltage effect of TESLA discharge ..
The signal is AC 60CPS but the PEAK discharge consist of Stepped

10KH to 256Khz within EACH sinewave peak , refer to my newman motor
postings to Spark Gap postings on BEDINI motors and plasma
discharges..
Tesla secrets in reality are verry simple ..
to the point of breakdown...
Hector :)
#9240
Re: whats up Hector
Tips ?
Norman Wootan Work , and PC switching power suply design using PURE
resonance ..
Inverters can be made OU (as base) and LOOPED if properly driven to do

so ...
The compilations have all the info , you only need to do the LAB
experiments to aquire the (TOUCH ) rv, transverter,meg,vta ,rma ..
konemotor, bedinimotor all valid usefull test beds for OU .
and on tesla amplifiying transmitter I gave details long ago ..
10 ft diameter spherical capacitor antenna and LC tunable from 10KHZ

to 128KHZ with a 240 FT grownd rod ,and lots of life insurance if you
cant manage the Conjured power from heavens .... Exite with another
Tesla coil ,when it goes resonant within EARTH standing wave node it
goes 36,000 HP instantly in resonance with EARTH dipole ..
Resistance must be 51.1 ohms at 26856W radiant disipation (RF) .
Design as that parameter is valid universal one ..
Hector :)
#9341
Stolen from another furum (And i give a rat ass ) as info is quite
interesting !! aplicable to healthy "radiant Energy ZPE devices..
Save in your notes... this octaves are aplicable up to photonic
(light frequency ) healing machines
Enjoy !
Hector :)
Solfeggio Frequencies- Sound And DNA-The hidden Mysteries Of 528 HZ
What Are The Ancient Solfeggio Frequencies?
These original sound frequencies were apparently used in Ancient

Gregorian Chants, such as the great hymn to St. John the Baptist,
along with others that church authorities say were lost centuries
ago. The chants and their special tones were believed to impart
tremendous spiritual blessings when sung in harmony during religious
masses. These powerful frequencies were rediscovered by Dr. Joseph
Puleo as described in the book Healing Codes for the Biological
Apocalypse by Dr. Leonard Horowitz. I give honor to both of these
gentleman for the part they've played in helping return these lost
frequencies back to humanity.
The Six Solfeggio Frequencies include:
UT – 396 Hz – Liberating Guilt and Fear

RE – 417 Hz – Undoing Situations and Facilitating Change
MI – 528 Hz – Transformation and Miracles (DNA Repair)
FA – 639 Hz – Connecting/Relationships
SOL – 741 Hz – Awakening Intuition
LA – 852 Hz – Returning to Spiritual Order
For example, the third note, frequency 528, relates to the note MI
on the scale and derives from the phrase "MI-ra gestorum" in Latin
meaning "miracle." Stunningly, this is the exact frequency used by
genetic biochemists to repair broken DNA – the genetic blueprint
upon which life is based!
A Little History
At the turn of the century the awareness of DNA entered the

collective consciousness of the world. We have incarnated into this
human experience as divine beings with a blueprint, a set of
instructions. We know that a very small percentage (3%) of those
instructions make up our physiology.
Carl Sagan writes that most of our genetic information (about 97%)
is unused DNA. He refers to this as "genetic gibberish." Is it
possible that most of who we are still lies dormant as our human
potential?
In the old paradigm of religion, "potential" remained a mystery to

the human mind, therefore we coined a mystical term
called "SPIRIT." "Spirit" was something that was detached from who
we were, something we didn't have and could only be gained through
the systems of most religions.
The old paradigm and its premise stated that we began as biology in
the womb of our mothers. Telliard deChardin tells us that we are not
a human being trying to attain a spiritual experience, but, rather,
we are spiritual beings having a human experience. This shift in
perception causes a tremendous difference in the way we perceive
ourselves in this third/fourth time-space continuum.
Being a student of "A Course In Miracles" in the late 80's, I was

faced with a dichotomy in the idea that we are not a body. I never
understood this statement fully until I read a quotation by Albert
Einstein which stated: "Concerning matter, we have been all wrong.
What we have called matter is energy, whose vibration has been so
lowered as to be perceptible to the senses. There is no matter."
I believe what is being stated is that at the deepest level we are

not separate, as a body, as a spirit, as a soul — we are just energy-
beings. This is the level of consciousness being opened to us from
which a new paradigm is emerging for the purpose of healing all
separation. The popular term, "The Divine, is in me"- makes "me"
separate from the Divine. May I suggest a shift in the saying
to: "The Divine, AS me" to remove the separation.
As we move from genetics and concepts like Soul, "Soul Mates"

and "Soul work," we move beyond physical diagnosis, into a new field
of quantum physics. In this new field, where consciousness is seen
as a unified field where everything is everything else, (T.O.E.
Theory - The Theory of Everything) —there are no boundaries. There
is no "this" or "that;" no you or me. It is a pure field of
awareness – consciousness. I solved the dichotomy about "we are not
our body" by changing my perception of genetics to energetics -
realizing that we are not meant to ignore our physiology, but
recognize the body as energy, vibrating at a very dense frequency.
Repairing DNA
I was first introduced to DNA in 1988 when I was going through a

transitional period, during which I felt that I had come to the end
of everything that I believed. A tape was given to me of a gentleman
speaking in an accent, (which I thought at the time, was rather
boring), and I didn't understand what he was talking about. Then all
of a sudden, as I was ready to turn it off, he said: "Quantum
physics has found that there is no empty space in the human cell,
but it is a teeming, electric-magnetic field of possibility or
potential." That's all he said!
But whatever frequency was contained in those words, RESONATED

something inside the CORE of my BEING — and I had a KNOWING in me
that the NOTHING I thought I was looking at was the EVERYTHING. Much
like in Zen, and the idea of becoming "as an empty bowl." Eastern
Religions (including the Bible) refer to it as the VOID – The
Nothing that is EVERYTHING – The Womb of Creation. I knew that I was
experiencing a re-birth! The person on that tape was Dr. Deepak
Chopra.
I had never heard of Deepak Chopra in 1988, as he was just coming on

the scene about that time. I credit him for a very important
transition in my life, just from the statement he made on that tape.
Today, in retrospect, I would call my response to that statement
a "cellular memory experience." We know that intelligence is stored
within the cells of the body, and when the right resonance comes and
releases that information to become inherent information or inherent
KNOWLEDGE – that comes from the true Self. That is why so many of us
seem to jump form one stimuli to another looking for what will
resonate in us.
The work being done today with energy at the cellular level really
excites me, since I had been very interested in DNA before it became
a household word. In fact, I think it took me two years just to
learn how to pronounce it (deoxyribonucleic acid did not roll off my
tongue quickly). But, I was determined to understand this
tremendously powerful energetic blueprint for life, as we know it,
at the cellular level on this planet. DNA became a part of the
collective consciousness when CNN produced a special on the Genome
Project in 2000.
As I pursued my passion for the study of DNA, I attended a workshop

by Dr. Robert Girard from California on DNA Activation. His work
focused on using certain sounds and frequencies to activate DNA and
I started doing DNA Activation workshops. Through those workshops,
an article was given to me that reported how biochemists are using
the frequency 528Hz to repair human DNA. The article stated that it
was a "C." When I read that I thought, "All I would need to do is go
to a piano or other instrument and play a "C" and then, in the DNA
workshops we would be able to repair DNA."
Well, it wasn't that simple, because I discovered that the

regular "C" that we all know of in this culture (which is from the
diatonic scale of do, re, mi, fa, so, la, ti, do) was not the 528 Hz
frequency "C", as described in the article. Instead, I discovered
that a regular "C" vibrates to a frequency of only 512 Hz, and that
the "C" of 528 Hz used in DNA repair had been a part of an ancient
scale called the Solfeggio Scale. Moreover, the difference in the
scales existed because of different tuning methods that were
utilized in ancient times, vs. those in general use today. Later, we
will explore that difference between how we create music today vs.
how we used to create it, and how that simple change has made all of
the difference in the world.
How I found out about the Ancient Solfeggio Frequencies
I found this ancient scale to be part of a 6-tone scale sequence of

electro-magnetic frequencies called the Original Solfeggio Scale
through the book "The Healing Codes of Biological Apocalypse" by Dr.
Leonard Horowitz. These particular frequencies were rediscovered by
Dr. Joseph Puleo, who received them in a wonderful experience that
some would suggest was mystical. These frequencies are not something
new, but they are something very old.
I shared the information about these frequencies with a musician

friend who had a studio in her home. After reviewing the
information, she decided that she would like to experiment with
these frequencies in the form of meditation music. She was also in
touch with Jonathan Goldman (author of the book, "Healing Sounds")
and he knew of these frequencies, and was using them in some of his
music such as "The Lost Chord" CD. Aryiana requested that he have
the tuning forks made for her to research the frequencies. I asked
if she could also have a set made for me.
After I received the tuning forks and began talking about them
around the country, I noticed that people were resonating with the
information about these powerful frequencies. It felt as though
something was going on in a much larger picture. We were connecting
energetically to this information, and yet I didn't know what I was
going to do with the tuning forks. Then people began to ask if I
could use the tuning forks on them. From those experiences, and with
information I had gathered, a method and technique began to develop.
I called the technique SomaEnergetics TM, which is designed to
utilize the optimum energy of the Solfeggio frequencies using tuning
forks. Soma, meaning "body" in the Greek, combines the wholistic
idea of the body as an energy field - SomaEnergetics TM.
When starting these first tunings, the main frequency that I knew
the most about was 528 Hz – that biochemists are using for DNA
repair. I realized that the right side of the body is controlled by
the left-brain, and the left side by the right brain and that these
correspond with our inner male and female energies. As I took the
fork down each side of the body, I could get in touch with the
dominate ancestral DNA that comes thru the Mother's side or Father's
side of the chromosomes. I would many times get a tremendous
imbalance in the sound between the two sides. The purpose of energy
work, as many of you know, is to attain balance. For example, if
everything is in balance, such as the ph level, the physical body
can heal more naturally.
It's the same way in our energy bodies. If we can find that energy
balance, that equilibrium, where everything aligns or everything
comes into synchronization into the rhythm of the dance of life –
then healing becomes the natural state. It's nothing supernatural,
or miraculous. I think a lot of spiritual texts have referred to
this idea when they describe, "going home to heaven." Heaven, to me,
is the complete synchronization with higher frequencies and
vibrations of creation being totally entrained. In other words,
being in a state of at-one-ment.
When I would continue to do the technique, the sound would begin to

even out between the male and female sides of the body, and the
client would indicate they were "feeling" a shift. As that would
occur, I was totally amazed, and asked myself, "What is happening
here?" Although I've been a speaker of spiritual things for over 40
years, I can't tell you that I've been the most intuitive person in
the world. All of a sudden I started having certain feelings about
what to do with the forks. I found that at some point in working
with the client, I stopped "doing" the tuning forks (being the
initiator of the technique), and they started "doing me" – seeming
to direct the movement of the Forks! After hundreds of tunings and
positive testimonies, I have learned to trust the Ancient Solfeggio
Scale frequencies in the form of Tuning Forks as a legitimate
modality.
Energy and Relationship
Everything is relationship. I remember Dr. Fred Wolf, who is a

physicist stating on a tape "Everything is consciousness." He
further noted, "When you are observing an object, on some level the
object is observing you." As I listened to that statement, I thought
it was strange. I then realized that because something doesn't have
a human consciousness, as I do, that doesn't mean it doesn't have
it's own consciousness. Apparently, observing something changes it
on some level – that the observer, and the observed are one.
I treat the Solfeggio tuning forks as a conscious "entity." They are

energy, they're vibration, they're frequency – the client is
vibration, frequency and energy – I am vibration, frequency and
energy. All of that coming together begins to produce a synergetic
experience that takes place on many levels. The energy bodies that
we focus on using the Solfeggio Frequencies are the physical, the
etheric, the mental/emotional, and the astral.
Sound, Vibration and Form
For more than 200 years, researchers have been validating the
connections of Sound and Vibrations on physical form. The first to
make that connection was German scientist Ernst Chladni, who, in
1787, detailed his research in his book "Discoveries Concerning the
Theory of Music." In that pioneering work, he explained ways to make
sound waves generate visible structures. He detailed how a violin
bow, drawn at a right angle across a flat plate covered with sand,
produces patterns and shapes. Today, those patterns and shapes are
called Chaldni figures. (Coincidentally, Chaldni died in 1829, the
same year as Beethoven. Mozart, a Free Mason, heavily influenced
Beethoven about the mathematics of music, and likely influenced
Chaldni as well).1
In 1815, Mathematician Nathaniel Bowditch followed up on Chaldi's

discoveries. He concluded that the conditions for these designs to
arise were because the frequencies, or oscillations per second, were
in whole number ratios to each other—such as 1:1, 1:2, 1:3 and so
on.2
The study of wave phenomena, the ability of sound to organize and

repattern matter, is called Cymatics. According to John Beaulieu, in
Music and Sound in the Healing Arts, "Form is the more elusive
component of sound. Sound-forms can be seen by subjecting mediums
such as sand, water, or clay to a continuous sound vibration."
The Oscillator creates a pulse, which vibrates the steel plate. The
forms on the plate are examples of sound organizing matter." Jenny
also "noticed that when the vowels of ancient languages like Hebrew
and Sanskrit were pronounced, the sand took the shape of the written
symbols for those vowels. "Modern languages, including English,
failed to generate those patterns."
"Space is not empty. It is full, a plenum as opposed to a vacuum,

and is the ground for the existence of everything, including
ourselves. The universe is not separate from this cosmic sea of
energy." David Bohm
Jenny concluded that were examples of cymatic elements everywhere—

"vibrations, oscillations, pulses, wave motions, pendulum motions,
rhythmic courses of events, serial sequences, and their effects and
actions"—and they effected everything including biological
evolution. The evidence convincingly demonstrated that all natural
phenomena were ultimately dependent on, if not entirely determined
by the frequencies of vibration. He argued that physical healing
could be aided or hindered by tones. Different frequencies
influenced genes, cells, and various structures in the body, he
claimed.
Vibration of Music of the Spheres: "Every cell pulsates, reflects

and interacts with acoustic oscillations of the medium. Even the
earth and sun vibrate in unison based on a main rhythm of 160
minutes. Each musical note is therefore united to non-audible notes
of higher octaves, and each symphony to other symphonies that we do
not hear, and although they make our cells oscillate and possibly
resonate. Even DNA has it's own melody.
The musical nature of nuclear matter from atoms to galaxies is now

recognized by official science."3 In " Molecules of Emotion," by
Candice Pert, Ph.D., she writes, "… basically, receptors function as
scanners (sensing molecules, on a cellular level). They cluster in
cellular membranes, waiting for the right ligand (much smaller
molecules than receptors), to come dancing along (diffusing) through
the fluid surrounding each cell, and mount them – binding with them
and (tickling ) them to turn them on and get them motivated to
vibrate a message into the cell. Binding of the ligand to the
receptor is likened to two voices, striking the same note and
producing a vibration that rings a doorbell to open the doorway to
the cell."
Poet Cathie Guzetta summarized this science best when she wrote:
"The forms of snowflakes and faces of flowers may take on their

shape because they are responding to some sound in nature. Likewise,
it is possible that crystals, plants, and human beings may be, in
some way, music that has taken on visible form."
How Did The Solfeggio Frequencies Get Lost?
I discovered that these powerful frequencies had been given to the

church many years ago for a very spiritual purpose. This was back
when the church was a wonderful place for the people in the villages
to gather together. The church served as a social, political, and
spiritual place. People came to Mass, which at that time, was done
in Latin (until Vatican II came along). When people sing in Latin or
musical tones, it is very powerful, because it gets through all of
the limited thought forms, and into deeper levels of the
subconscious – accessing insights beyond belief systems.
As described above by Dr. Candice Pert, PhD, energy and vibration go

all the way to the molecular level. She states that we have 70
different receptors on the molecules and when vibration and
frequency reaches that far they begin to vibrate. Moreover, she
observed, "as they begin to vibrate they sort of touch each other,
and tickle each other, and they play and mount each other." It's
this whole energetic dance ritual, at the cellular level, that opens
the chromosomes and exposes the DNA to the frequencies. When we do
toning, drumming, chanting, or tuning forks – it can be a way to
direct energy for transformational purposes.
Vibration and sound can be used, like most things, either with
positive intention or negative intention. Used negatively, it's
nothing more than control and manipulation. Most of the world has
been built upon control and manipulation by the way we communicate
thru language. A lot of different texts, such as the Bible, talk
about the importance of just making Sound—whether it's chants,
drumming, or speaking in tongues (such as the charismatic
fundamentalists do), they are just different ways that people are
accessing deeper levels of themselves. I suggest to you that the
Solfeggio Tuning Forks are an even purer ways of doing that with
positive intention.
When Dr. Joseph Puleo was researching the tones, he was directed to
a Monsignor at a university in Spokane WA, who was head of the
mediaeval department. Following a 20 minute conversation, the
"Can you decipher Mediaeval Latin?'

Àbsolutely!'
Ànd you know the musical scale and everything?'
Àbsolutely!'
`Well then, could you tell me what ÙT - queant laxis' means?'
After a brief pause, the Monsignor quipped, Ìt's none of your
business'
Then he hung up."1
Additionally, as Dr. Puleo researched the tones further, he came

across a book on Gregorian chants by Professor Emeritus Willi Apel
who "argued that the chants being used today were totally incorrect,
and undermined the spirit of the Catholic faith."1 Moreover,
Professor Apel reported that "one-hundred fifty-two chants were
apparently missing. The Catholic Church presumably "lost" these
original chants. The chants were based on the ancient original scale
of six musical notes called the Solfeggio."1 Trust me, nothing is
lost, it's just neatly put away; however, they cannot hide from the
masses what is energetically placed within the Soul.
According to Professor Willi Apel,1 "The orgin of what is now called

Solfeggio...arose from a Mediaeval hymn to John the Baptist which
has this peculiarity that the first six lines of the music commenced
respectively on the first six successive notes of the scale, and
thus the first syllable of each line was sung to a note one degree
higher that the first syllable of the line that preceded it. By
degrees these syllables became associated and identified with their
respective notes and as each syllable ended in a vowel, they were
found to be peculiatly adapted for vocal use. Hence "Ut" was
artificially replaced by "Do." Guido of Arezzo was the first to
adopt them in the 11th century, and Le Marie, a French musician of
the 17th century added "Si" for the seventh note of the scale, in
order to complete the series."
Further research states that, "Pope Johannes later became a saint -

Saint Iohannes - and then the scale was changed. The seventh
note "Si" was added from his name. "Si" later became "Ti." These
changes significantly altered the frequencies sung by the masses.
The alterations also weakened the spiritual impact of the Church's
hymns. Because the music held mathmatic resonance, frequencies
capable of spiritually inspiring mankind to be more "Godlike," the
changes affected alterations in conceptual thought as well, further
distancing humanity from God." In other words, whenever you sing a
Psalm, it is music to the ears. But it was originally intended to be
music for the soul as well or the "secret ear." Thus by changing the
notes, high matrices of thought and to a great extent well being,
was squelched. Now it is time to recover these missing notes."1
I'd heard of do, re, me, fa, so, la, ti, do. I particularly
responded to it whenever I hear that song by Julie Andrews from "The
Sound of Music." I literally have a "brain cell firing" as it is
engraved into my brain, and I see her coming over the mountain in
the movie. I didn't realize this was actually a second, modified
scale. The original Solfeggio scale was actually: UT, RE, MI, FA,
SO, LA.
Looking at the definitions of each of the original syllables, using

hidden entries from Webster's Dictionary and the Original Greek
Apocrypha, I have determined that these original frequencies can be
used for: Turning grief to joy, helping the person connect with
their Source to bring forth miracles, DNA repair, connecting with
spiritual family, solving situations & becoming more intuitive, and,
finally, returning to spiritual order.2 Through music these tones
can assist all the channels in staying open and keep the life force
(the Chi) literally flowing thru the Chakra System quite freely. Is
this is what the six electro-magnetic frequencies were to accomplish
that were put into "lost" hymns and Gregorian chants?
I think we are living in a tremendously wonderful time, and rather

than seeing the glass as "half empty," I see it as "half full."
Rather than accepting "CNN's perspective" of the world view, it's
about finding perspective thru the vision of your own heart. It is
about change and transformation of mankind to the next level of
evolution. We, as Spiritual Light Workers, have made ourselves
accessible at this time, by Divine Appointment, to be here to help
those in humanity who choose (it's all based upon irrevocable
choice) to stay, or to go. Those who have chosen to stay will come
into our lives, and we have already agreed to assist them.
It's all about assisting other people. It's not to be

their "Healer," but to assist them in knowing who they are and
connecting with their true Source. It is about providing an
atmosphere of non-judgement, a Sacred Space, for the purpose of
healing themselves. We should be continuously teaching while
assisting people. The old paradigm teaches us to keep the
information among the professionals. The new paradigm is to share
the information, and empower the client. Everyone you work with—
whether it's Reiki, Massage, Tuning Forks or other modalities you
are using, you should feel that you've empowered that person, so
they can extend this information to someone else. Healing has become
about our evolution by reconnecting our additional strands of DNA.
Healing is also about assisting the person in restoring themselves
to a state of "Spiritual Wholeness."
1 "Healing Codes for the Biological Apocalypse" by Dr. Leonard

Horowitz, p. 345-6
2 Ibid.
3 From "Man's Cosmic Game" by Guiliana Conforto
The 3, 6, and 9
As we look at the six original Solfeggio frequencies, using the

Pythagorean method, we find the base or root vibrational numbers are
3,6, & 9. Nicola Tesla tells us, and I quote: "If you only knew the
magnificence of the 3, 6 and 9, then you would have a key to the
universe."
John Keely, an expert in electromagnetic technologies, wrote that

the vibrations of "thirds, sixths, and ninths, were extraordinarily
powerful." In fact, he proved the "vibratory antagonistic thirds was
thousands of times more forceful in separating hydrogen from oxygen
in water than heat." In his "Formula of Aqueous Disintegration" he
wrote that, "molecular dissociation or disintegration of both simple
and compound elements, whether gaseous or solid, a stream of
vibratory antagonistic thirds, sixths, or ninths, on their chord
mass will compel progressive subdivisions. In the disintegration of
water the instrument is set on thirds, sixths, and ninths, to get
the best effects."
In the book of Genesis it states that there are six days of

creation. Yet many talk about the creation week – or seven days, and
the Christian Bible views the number seven as the number of
completeness. Why Seven? It is due to the influence of the Near
Eastern culture at the time in which Jesus lived, when it was
believed that there were only seven planets.
When wrestling with adding a 7th number, I was mystically drawn to

an article in Discover Magazine. In his newest book, Just Six
Numbers, Rees argues that six numbers underlie the fundamental
physical properties of the universe, and that each is the precise
value needed to permit life to flourish. In laying out this premise,
he joins a long, intellectually daring line of cosmologists and
astrophysicists (not to mention philosophers, theologians, and
logicians) stretching all the way back to Galileo, who presume to
ask: Why are we here? As Rees puts it, "These six numbers constitute
a recipe for the universe." He adds that if any one of the numbers
were different "even to the tiniest degree, there would be no stars,
no complex elements, no life." (From Discovery Magazine).
As some authors have speculated, could these tones have played a

role in the miraculous shattering of Jericho's great wall in six
days before falling on the seventh day? Some scientists are now
stating that if we have been created, we most likely would have been
sung into existence. Is it possible that the six days of creation
mentioned in Genesis represent six fundamental frequencies that
underlie the universe? Religious scholars believe both events
occurred as a result of sounds being spoken or played.
Other scientists, including the geniuses Nikola Tesla, Raymond Rife,

as well as Mozart, Haydn, Beethoven, and Chladni, all must have
known about, and used the concept of, the inherent power of threes,
sixes, and nines. So we are dealing with three powerful numbers: 3-6-
9. Everyone of the six Solfeggio Tuning Forks all add up,
individually to the Pythagorean scheme of 3-6-9. In fact, because
there are two sets of 3-6-9 (anagrams) in the solfeggio, they are
even more powerful as these combinations serve as "portals" to other
dimensions!
Just Intonation – 12 Tone Equal Temperament
As I observed earlier, another reason these Ancient Solfeggio

frequencies became "lost" was because of the change in tuning
practices throughout history. The standard tuning method for the
past 200 years is quite different from the tuning practices dating
from antiquity through about the 16th century A.D. These ancient
tuning practices used a system of tuning known as Just Intonation.
The tuning practice adopted for western cultures during the 16th,
17th, and 18th centuries, and used today, is known as Twelve-Tone
Equal Temperament.
The explanation of the fundamentals of these tuning systems is far

too complex for this agenda, but the following quote from a book
written by David B. Doty, titled The Just Intonation Primer, should
give an idea of the confinement that music has been relegated
to. "Essentially, music has been placed in a box of limitations"— as
the result of the rigidity imposed by the Twelve-Tone Equal
Temperament tuning standards in use today.
"Although it is difficult to describe the special qualities of Just

(Intonation) intervals to those who have never heard them, words
such as clarity, purity, smoothness, and stability come readily to
mind. The supposedly consonant intervals and chords of (12-Tone)
Equal Temperament, which deviate from simple rations to varying
degrees, sound rough, restless, or muddy in comparison."
Just Intonation can be found in many of the great Fathers of

Classical Music – Beethoven and Hyden, just to name a few. They did
not use this 12-tone temperament and I think that is why we have a
richer experience when we hear music that was composed several
hundred years ago. Classical Music based on Just Intonation gives us
a different rapport with time and space and brings us into our
higher chakras.
Native American chanting is many times based on Just Intonation. The

chanting seems to sound monotone, but we are finding out that within
the monotone sound is multi-dimensional harmonics.
How these different types of tones affect our health
Consequently, since all music in our contemporary world (from

commercials, to modern hymns and symphonies) has been composed
utilizing the 12-Tone Equal Temperament Scale, they all have
vibrational limits. As a result, vibrational frequency of the tones
of modern music can create situations such as "boxed-in thinking,"
stuffed and suppressed emotions; and fear-based " lack"
consciousness—all of which then tend to manifest into physical
symptoms of "dis-ease."
This is in contrast to music created from the Ancient Solfeggio

Scale, which stimulates the vibration of expanded creativity, easier
problem solving and holistic health.
Again, it should be noted that although there are contemporary notes

that approximate the Solfeggio tones, they are not the same
frequencies as the ancient tones. Example: The Solfeggio tone, Mi.
vibrates to 528 Hz. The closest, comparable, contemporary tone is C,
above Middle C, which vibrates at 512 Hz. Our research indicates
that the vibrational frequencies contained in the Solfeggio tones
hold these original healing potentials
#9536
Re: A Challenge for Hector and Me
This deserves a reply to the point and specific ...
http://www.harborfreight.com/cpi/ctaf/displayitem.taf?
Itemnumber=45416
This GENERATOR uses REVERSE induction winding AS STATED in POSTINGS

dating sinse the DISCLOSURE of BINGO MOTOR (brown gas project in JLN
lab group ..
Eliminating the Exiting capacitor from exiter winding ... AND
Using a CAPACITOR on its BASIC OUTPUT WINDING to archieve RESONANCE
state produces RADIANT ENERGY in well beyond OU region, aplicable to
SERIES tuned LCR electrolytic chamber , in CAR alternator using 23K
to 24.5KCPS sonofusion can be attained in electrolitic chambers ..
USING SAME LCR RV and transverter RESONANCE principle ..
(Universal OU principle ) RADIANT ENERGY = RF = OU transform
IN 60CPS AC of HOME - TYPE 120VAC -240VAC generators in radiant

mode of operation logaritmic gain is 1.618 as predicted by magnetic
amplification cornu spiral projection of phased signal to RF
hypersignal (Radiant energy )
http://www.m-primus.com/www/de/data/tv/tv.html
jinis WORK can EASY explain how to RESONATE AC signal into ELECTRODES
under resonance ....(R (electrode)being resistive impedance variable
in LC"R" )
(I am realy AMAZED at the memory retentive loss this group can

attain in a few weeks time ) :( (not to say frustrating ), Mallove
well tested and DID sonofusion RESONATOR as per same DEMO of JINIS
WORK .... (Transverter) principle (Ferroresonance) and it WORKED
perfectly in SOLID state as well as ROTARY units (RV)....
In the WORK it was found ELECTRODES reacted with WATER and METAL was
transmuted sample LEAD Pb 206 isotope to plutonium .. U239 ..
The solution I gave was the CAPACTRODE ,using CAPACITORS plates and
dielectric material (as aluminum oxide) containing water as center
dielectric were at ac resonance (multy octave to 2.450GHZ ) water
frequency sonofusion was attained in all the harmonic frequencys of
RF spectrum gamma .
Mallove Died because he had the BALLS to do it ,but not the

intelligence to give it public , so all I ask people is to BUILT
replicate and CONFIRM such knowledge is real and were it came from.
This DATES from 1983 SLC R&D period , the first COLD fusion
catalyst used was SODIUM aluminate (Made by reacting pure aluminium
with Caustic soda (sodium hydroxide solution )were under fusion
paladium was produced enhancing the effect ..
WITH Transverter , Jinis work, RV alternator APLICATION TO HOME

GENERATORS is more than PROFF needed to lay this in perspective as
to make practical aplications to WATER - gas technology and to
the forgotten COLD fussion issues ....( E-mailed many on this issues)
LC is initiated shorting electrodes, open and TUNE compensated under

LOAD "R" as resonance IS ATTAINED)
Car alternators if PERFECTED can run EASY in RADIANT energy mode as

to efectively drive hydrogen sonophotofussionreactors ...
Of all things said is the Method , the MANAGEMENT and perfecting

that will make this posible, all written in former postings dating
YEARS way back and a few dozen dead researchers more.
I made an Exeption and posted this, risking another HIT from the bad
guys ..
Use it Well , it has given me more problems than money or fame ..

(No use if I am dying OR END DEAD ) so use, keep public and pass it
on ...
remember ALL THIS WAS tested ALREADY IN THE lab, ITS APLICATIONS ,
NOT SPECULATIVE BULLSHIT THEORETICS .
Hector
PS :
Dont go back reinventing the wheel (take next step ) dont let the
information be erased or lost (print the goddamed things to paper or
BURN it to NON rewritable NON ERASEABLE CDs.
Its a pity all this work will be gone if they hit the mark and i
die ..
(I feel like vomiting ! :P""""""" )
(GOIN BACK TO SILENT MODE )
(DO NOT DISTURB)
#9623
I advice to reread the patent ..
the 3 x 27 9 step 3 phase firing circuit sequential used ...
the secundary firing of spark gap and the stepped discharges produced
from A an square pulse to B stepped staircase pulse into capacitor
banks ..
Think TESLA coil and cycloconversion into hi frequency that takes on

from ..
HVAC 10KV 60CPS to a Capacitor discharge at TOP crest of RESONANT

10KV secundary into an stepped hi frequency discharge into a hyper Q
tesla coil primary ...
This things point again to RESONANCE hyper Q states , logaritmic

magnetic amplification factor in LCs ..
Easy transferable to RV low voltage hi impedance rotary pulsed

machines (I refer to a PM rv design ) pulsedriven with logaritmic
power CEMF recovery in full phases diode bridge . 3x3 configured or
(n X n) n being number of phases used .. as in multyphase PM
genemotor concept .
all that is required an standard 230/460 3 phase motor with a PM

rotor designed as to be magnetized to near saturation point but not
exeding core saturation as to have minimal on NO saturation drag
effect.
you can have an EMA-RV run in AC ,tuned to perform in tesla coil

alike POWER amplifying mode .
(Keep this notes) copy and pass on .
If only ALF might have realize the implications when i made this
same posting 7 years ago and went EMA-RV his units might have run
looped years ago, reviving the EMA concept.
Again secret is tuning into the resonant states and optimizing use
of the power attained without killing the OU effect ..
Hector :)
#9674
From: "koneheadx" <konehead@...> Date: Wed Oct 5, 2005 8:23 am
Subject: Robert Calloway email about bifilars and radiant energy
Hi all
I got these emails from RC you all might want to read:
"Electron flow by itself wont get the job done.

You yourself have talked about splatter coils. They contribute some
but not enough. The splatter is a small variant of radiant
electricity. The only problem is splatter does not care for a normal
coil for receiving the current. Most is never received thus wasted.
There is way more there than you may think. Tesla knew this. That is
why he patented a special coil. (nobody really knew why) It is a
bifilar series connected coil. It will receive this splatter or
radiant electricity completely. These bifilar coils have confused
everyone that has experimented with them. They are useless for
receiving magnetic flux, you can pump electrons through them with
ease but for what? They are just a heater coil. Useless..correct?
Wrong....:) They will receive and collect radiant electricity. To
create radiant electricity, you will have to modify your pulse motor
just abit. Think of gas running through your wires instead of
electron flow while doing this. Tesla always referred to radiant
electricity as a fluid nature. What you want is to pulse your coils
very hard and fast. Double your supply voltage to your coils at
least. You want to push them to their limit with voltage and amps
without destroying the coils. I start with normal voltage to get the
motor going, then switch to a higher voltage to prevent coil and
switch burn out. Don't worry..your emf collection wiring will still
collect and run the bemf back to your batteries. (you may have to go
to larger diodes) This will drive your motor to a very high rpm,
which is what you want. Make sure your pulse switches can handle the
extra speed and amps. They will float if you don't. The higher the
speed, the lower the amp draw. But something new will begin to
happen. You will start to feel a stinging on your hands and face.
Wear your safety glasses. Nothing can shield this effect. It goes
through anything. It wont hurt you but it is irritating. You are
getting close. Get your speed up more until this quits happening.
Stop the motor and build a bifilar coil wired (coreless) in series.(
I can send you a diagram if you wish) Or several of them. Place
these coils around the motor. Not around the pulse coils!!! Just
start out putting them a foot or so around the motor and measure
voltage. (set your meter on AC) Bifilar coils don't want or like
magnetic flux, they are a receiver coil of the radiant electricity.
Now when you have done that, place one clear across the room and
measure voltage. Surprise!!!!!!! You will have to play with your
setup awhile to get it right. The stinging sensation will let you
know that you are headed in the right direction. You have sampled a
very small fraction of radiant electricity in your motors and may
never have even known it. This procedure will allow the full effects
to show itself. You can pass this on to fellow experimenters if you
wish. Let me know if you try this or need help. Regards, Robert"
The next email:
"The pulse motors designs touch the edge of what's out there, but
they are not the ultimate way to release radiant energy by no means.
Use bifilar air coils as receivers of radiant energy.
(Have one hooked up to a meter when lightning strikes) I no longer
use pulse motors, except one for show. For releasing pure radiant
energy, it requires a unidirectional pulse with no reversal (no bemf). The
magnetic arc gap is the only switching device that can do this. The off/on
switching occurs when strong neo magnets are placed at 90 degrees to the flow
of arc current direction. 500 to 1500 volts from a microwave oven transformer
controlled by a variac thru large bridge diodes into a large cap
allow smooth DC to flow through the magnetic arc gap that is unidirectional. It
is
a very dangerous method.
All concerns for safety must be realized. Wear

a full face shield and rubber gloves.Coils can blow up and
disintegrate. Death can occur very quickly by being careless. You are pulsing
the dc
current to a coil at several thousand times per second. Bemf does not have time
to
reverse and flow. You do not want it to reverse flow. You want the
switching to keep a constant high pulsed DC voltage pressure on the
coil. At that point....radiant energy is released.
The metal surrounding walls in a shop become electrified. Some magnets stuck on
the metal walls now fall off. Any normal coils laying around become weakly
energized. Loose laying light bulbs develop a weak glow. It will scare the
bejesus out of you at first.
The bifilar air coil (series tied) accepts the stuff very well. This
bifilar coil configuration cancels the magnetic field within itself
allowing radiant energy to be received easily. 24 gauge wire is a good place to
start. I will not release any pacific details because there are too
many variable parameters that have to be considered. But this info is
the basic method to start experimenting with. I expect you to be skeptical of
my
statement claim. I would be. But you will just have to try it for yourself.
Be careful, Robert
-------------End of Kone's letter-------------------

Hector Posts Volume2

Uploaded by

Document Information

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Hector Posts Volume2

Uploaded by

Copyright:

Available Formats

Hector's Posts – Volume 2, 1st Edition

Progresive cycloconversion along the SINE wave integral matrix using

3,6,9,12, basic combination is 142857 , Later I will post the

RV is just 3 points in a triangle in that hologram .

You go from the macro to the micro ...

the thing is take this to 3d from 7,6,5,4d

Its a simple rotoconverter toy and gives so much trouble

O_o ! (:P] OMG! .......

The magic sinewave is 3 cycles per second ... you have to

I got another Nocturnal Visit & I am pissed of like hell

Once again I dont keep my prototypes assembled so dont NITROUSOXIDE

Its not OU ..OK ! I will Curse whoever stole it if its not

I think we got a murphy here in need of correction for using the

Check old schematics I proposed ... ? confusion came from the

Notice 2 pole 2 magnet configuration ..

Hope it works with this correction ,sorry if somehow I contributed

Beware of Murphy !!!! O_o !

Its the Electron Spin frequency ....

Thermal stochastic transfer works in this region quite well ..

Coil COOLS and RF signal self substains ...

Be carefull Genesis is full of surprizes .. some GOOD ! ^_^ ..

Just be sure the 3x3 setup is cophased properly, but it cant be

Advantage of 2 poles is the 90 deg angle of atraction ....

A weight lifted "sideways" up to 90 degrees from vertical will

RAISE Q, Loss decreases to a point it self substains like VTA

As Eistein boose condensate is created: certain resonance conditions

Any LC haves a SWEET point were it can be taken at N frequency to

LC needs to be Optimized ( No loss ) no welds , no shorts , no

A bit too early to disclose it but as timeline is limited I do ..

Thanks!, as an advance in my search to find ways to lower cost in

sinse rotor magnets are inside, centrifugal force mantains them in

In my case I have aquired acumulative problems that require

My time is counted ...

Interesting for to concentrate such awesome power under 40 pounds .

Error ! OPPS DARN !

Yes I have posted that a lot of times ( resonant Electrolisis )

I just hope the greedy bastards dont make a cent on it ...

It may inspire others to do the same in all levels and construct a

You can experiment with transverter as vectored resonant

In first picture your R load is your electrolitic cells

Kones rotor if SYNCHRONIZED to AC will not HEAT as rotating FIELD is

LOL! HEHEHE ...

Good thing it did not go to waste ...

I think is important to experiment with magnetic mass effects

220VAC wired 5 to 7.5 HP motors as alternators give best

in 415VAC they work OK but lower Q .

A lot of suggestions ...

Ok as you had 51.74825 eff paralleling wasting 48+% ..

OK ! first tune the toy to minimal loading free wheeling no

Entropicaly in logaritmic decay its true radiated power becomes

This is WAY over regular power engineering concepts but REQUIRED as

I recomend this course ...

TESLAS WORDS are so Easy to understand as he tells to tune the POWER

If you tune RV to a frequency beneficial in radionics bio frequency

RV is good for hydrophonic farming "pumps" after you study resonant

Electrons are transformers as they need energy to self substain

Power factor is corrected by using proper capacitors in parallel to

Resonance = inductive and capacitive impedance match. In factory case

Resonance in factories is still heavily avoided, since it creates peak

In RV mode there is proper "internal" impedance match and the power

In Bedini motors and pulse systems the coil is an inductive/reactive

This secret info is encoded in e-books (PDF).

Resonance is inverse to power factor and relative to broadbanding

In RV under no loading it tends to be self power correcting to line