Professional Documents
Culture Documents
DOI 10.1007/s12272-010-1117-1
Institute of Natural Medicine, Hallym University, Chuncheon 200-702, Korea, 2Department of Pharmacology, College of
Medicine, Hallym University, Chuncheon 200-702, Korea, and 3Department of Molecular Biology, College of Natural
Science, Daegu University, Gyeongbuk 712-714, Korea
(Received June 21, 2010/Revised August 10, 2010/Accepted August 16, 2010)
Visnagin, which is found in Ammi visnaga, has biological activity as a vasodilator and reduces
blood pressure by inhibiting calcium influx into the cell. The present study demonstrates the
anti-inflammatory effect of visnagin on lipopolysaccharide (LPS)-stimulated BV-2 microglial
cells. When cells were treated with visnagin prior to LPS stimulation, production of nitric
oxide and expression of iNOS were attenuated in a dose-dependent manner. Visnagin also
caused a significant decrease of mRNA expression and release of TNF-, IL-1 and IFN. In
addition, visnagin reduced LPS-induced IL-6 and MCP-1 mRNA level. We further found that
visnagin dose-dependently inhibited LPS-induced AP-1 and NF-B luciferase activities. Taken
together, our results for the first time suggest that the anti-inflammatory effect of visnagin
might result from the inhibition of transcription factors, such as AP-1 and NF-B.
Key words: Anti-inflammation, Microglial cells, Visnagin, Inducible nitric oxide synthase,
AP-1, NF-B
INTRODUCTION
Microglial cells are critical effector cells of immune
response and host defense in the central nervous
system (CNS). Under neuroinflammatory conditions,
such as brain injury, stroke, ischemia, Alzheimers disease, Parkinsons disease and HIV-associated dementia in the CNS, microglial cells become activated by
changing morphology from resting ramified cells to
amoeboid-like phagocytic cells, which proliferate, migrate to injured sites, and produce biologically active
molecules such as nitric oxide (NO), cytokines and
chemokines (Tuttolomondo et al., 2008; Graeber and
Streit, 2010). The overproduction of inflammatory
mediators such as cytokines, chemokines, NO and
prostaglandin E2 (PGE2) by microglia in the CNS
causes the neuropathological process of inflammatory
CNS diseases (Tzeng et al., 2005; Graeber and Streit,
Correspondence to: Hong-Won Suh, Department of Pharmacology, College of Medicine, Hallym University, Chuncheon 200702, Korea
Tel: 82-33-248-2614, Fax: 82-33-248-2612
E-mail: hwsuh@hallym.ac.kr
1843
1844
2, pro-inflammatory genes and chemokines in microglial cells. Visnagin inhibits LPS-induced iNOS, TNF, IL-1, IFN and IL-6 and induces expression of IL10. Our results implicate that anti-inflammatory
effects of visnagin may result from an inhibition of
transcription factors (TFs), such as AP-1 and NF-B.
iNOS
Fa
Rb
cagctgggctgtacaaacctt
cattggaagtgaagcgtttcg
TNF-
F
R
catcttctcaaaattcgagtgacaa
tgggagtagacaaggtacaaccc
IFN
F
R
atctggaggaactggcaaaa
tgagtccattgaatgcttgg
IL-1
F
R
aagggctgcttccaaacctttgac
tgcctgaagctcttgttgatgtgc
COX-2
F
R
ttcaaaagaagtgctggaaaaggt
gatcatctctacctgagtgtcttt
MCP-1
F
R
cttctgggcctgctgttca
ccagcctactcattgggatca
KC-1
F
R
cttgaaggtgttgccctc
tggggacaccttttagcatc
IL-6
F
R
gaggataccactcccaacagacc
aagtgcatcatcgttgttcataca
IL-10
F
R
ggttgccaagccttatcgga
acctgctccactgccttgct
-actin
F
R
agagggaaatcgtgcgtgac
caatagtgacctggccgt
Forward sequence.
Reverse sequence.
KC, mouse GRO-, a mouse CC chemokine with highest
sequence identity to human GROs and interleukin-8; MCP-1,
monocyte chemoattractant protein-1, a CXC chemokine;
COX-2, cyclooxygenase-2.
b
1845
TBST buffer.
Statistical analysis
All values shown in the figures are expressed as the
mean S.D. obtained from at least three independent
experiments. Statistical analysis was conducted by
one-way analysis of variance (ANOVA) with Tukey's
post-hoc test using GraphPad Prism version 4.03 for
Windows (GraphPad Software). P < 0.05 was considered to indicate statistical significance.
RESULTS
Visnagin inhibits iNOS expression and NO production in LPS-stimulated BV-2 cells
In this study, we first examined the effects of visnagin
on LPS-induced iNOS gene expression and NO production in BV-2 cells. Visnagin significantly inhibited
LPS-induced NO production in a dose-dependent manner (Fig. 1C). LPS-induced expression of iNOS mRNA
(Fig. 1D) and protein level (Fig. 1E and F) were also
significantly attenuated by visnagin. To examine
whether the inhibitory effect of visnagin on iNOS induction resulted from toxicity, cell viability was measured using a CCK-8 kit at 24 h after treatment. Data
showed visnagin had no effect on cell viability up to a
concentration of 100 M (Fig. 1B). These results show
that visnagin has an inhibitory effect on iNOS induction without cell toxicity in microglial cells.
Visnagin inhibits expression of pro-inflammatory cytokines in LPS-stimulated BV-2 cells
We investigated the effect of visnagin on the expression of pro-inflammatory cytokines, such as TNF-,
IL-1 and IFN. LPS-induced expressions of TNF-,
IL-1 and IFN were significantly inhibited by visnagin
(100 M) at 6 h (Fig. 2). In addition, their release from
media was also attenuated in a dose-dependent manner
at 24 h after stimulation (Fig. 3). To confirm the antiinflammatory effect of visnagin, we further investigated the effect of visnagin on the expression of other inflammatory related genes. As shown in Table II, LPS
caused an induction of COX-2, MCP-1, KC, and IL-6
mRNA and visnagin significantly attenuated LPSinduced MCP-1 and IL-6 mRNA levels, but visnagin
had no effect on LPS-induced COX-2 mRNA (Table II)
and protein (data not shown) levels. Interestingly, stimulation with visnagin and LPS significantly increased expression of IL-10 anti-inflammatory cytokine,
compared to the LPS-treated group (Table II). Taken
together, these results indicate that visnagin may
reduce the expression of pro-inflammatory cytokines
and chemokines and induce the expression of anti-
1846
Fig. 1. Effect of visnagin on the expression of iNOS and production of NO in LPS-stimulated BV-2 cells. (A) Chemical
structure of visnagin. (B) Cell viability assay using CCK-8 kit was examined at 24 h following treatment with visnagin (0,
5, 10, 25, 50 and 100 M). Cells were pretreated with visnagin for 0.5 h prior to LPS (500 ng/mL) treatment. NO production
from media at 24 h (C) and iNOS mRNA level at 6 h (D) and iNOS protein level at 24 h (E) were determined after LPS
stimulation. Expression of iNOS protein was quantified using Multi Gauge software (Fujifilm Life Science) from Western
blot bands (F). Data are represented as mean S.D. from three independent experiments (***p < 0.001, vehicle vs LPStreated group; +p < 0.05, ++p < 0.01, +++p < 0.001, LPS vs LPS plus visnagin-treated group).
inflammatory cytokines.
DISCUSSION
In the present study, we for the first time, have investigated the effect of visnagin on the expression of
inflammation related genes in LPS-stimulated microglial cells. Stimulation with LPS can induce the expression of iNOS, COX-2, pro-inflammatory cytokines
and chemokines in microglial cells (Saud et al., 2005;
Thompson et al., 2008; Kao et al., 2010; Lu et al., 2010).
Several lines of evidence suggest that microglial cells
can secrete pro-inflammatory cytokines, such as IL-1,
IL-6, IFN and TNF-, which in turn, can act on these
cells in an autocrine manner (Graeber and Streit,
Fig. 2. Effect of visnagin on the mRNA expression of TNF, IL-1 and IFN in LPS-stimulated BV-2 cells. Cells were
pretreated with visnagin (100 M) for 0.5 h prior to LPS
(500 ng/mL) treatment. Total RNA was isolated after 6 h in
LPS-treated BV-2 cells. The mRNA levels for TNF- (A), IL1 (B) and IFN (C) were measured by quantitative realtime PCR. The gene expression was normalized with -actin
gene expression. Data are represented as mean S.D. from
three independent experiments (**p < 0.01, ***p < 0.001,
vehicle vs LPS-treated group; +p < 0.05, ++p < 0.01, LPS vs
LPS plus visnagin-treated group).
1847
1848
Group
Vehicle
Visnagin (100 M)
1 0.34
1 0.31
1 0.41
1 0.87
1 0.72
16.43 1.12***
19.10 2.13***
15.74 0.92***
15.65 1.71***
11.71 0.59***
0.86 0.96
1.55 0.54
0.86 1.39
1.25 0.81
1.03 0.24
Visnagin + LPS
5.48 1.41NS
4.48 0.42++
4.13 0.62NS
7.09 1.91+++
2.86 0.64#
Fig. 4. Effect of visnagin on the activation of AP-1 and NFB transcription factors in LPS-stimulated BV-2 cells. At 24
h after transient transfection of cells with AP-1 (A) and NFB (B) luciferase reporter vectors, the cells were pretreated
with visnagin (0, 50 and 100 M) for 0.5 h prior to stimulation with LPS (500 ng/mL). The cellular luciferase activity
was measured as described in Materials and Methods. Data
are represented as mean S.D. from three independent
experiments (***p < 0.001, vehicle vs LPS-treated group; ++p
< 0.01, +++p < 0.001, LPS vs LPS plus visnagin-treated group).
ACKNOWLEDGEMENTS
This research was supported by Priority Research
Centers Program (NRF, 2009-0094072), Basic Science
Research Program (NRF, 2010-0009147), The Regional Research Universities Program/Medical & BioMaterials Research Center, ad a grant (2010K000814)
from Brain Research Center of the 21st Century
Frontier Research Program funded by the MEST, the
Republic of Korea.
REFERENCES
Aquilano, K., Baldelli, S., Rotilio, G., and Ciriolo, M. R., Role
of nitric oxide synthases in Parkinson's disease: a review
on the antioxidant and anti-inflammatory activity of
polyphenols. Neurochem. Res., 33, 2416-2426 (2008).
Bae, E. A., Kim, E. J., Park, J. S., Kim, H. S., Ryu, J. H., and
Kim, D. H., Ginsenosides Rg3 and Rh2 inhibit the activation of AP-1 and protein kinase A pathway in lipopolysaccharide/interferon-gamma-stimulated BV-2 microglial
cells. Planta Med., 72, 627-633 (2006).
Candelario-Jalil, E., De Oliveira, A. C., Graf, S., Bhatia, H.
S., Hull, M., Munoz, E., and Fiebich, B. L., Resveratrol
potently reduces prostaglandin E2 production and free
radical formation in lipopolysaccharide-activated primary
rat microglia. J. Neuroinflammation, 4, 25 (2007).
Chen, J. C., Ho, F. M., Pei-Dawn Lee, C., Chen, C. P., Jeng,
1849
K. C., Hsu, H. B., Lee, S. T., Wen Tung, W., and Lin, W.
W., Inhibition of iNOS gene expression by quercetin is
mediated by the inhibition of IkappaB kinase, nuclear factorkappa B and STAT1, and depends on heme oxygenase-1
induction in mouse BV-2 microglia. Eur. J. Pharmacol.,
521, 9-20 (2005).
Chu, S. C., Marks-Konczalik, J., Wu, H. P., Banks, T. C., and
Moss, J., Analysis of the cytokine-stimulated human inducible nitric oxide synthase (iNOS) gene: characterization of differences between human and mouse iNOS promoters. Biochem. Biophys. Res. Commun., 248, 871-878
(1998).
De Simone, R., Levi, G., and Aloisi, F., Interferon gamma
gene expression in rat central nervous system glial cells.
Cytokine, 10, 418-422 (1998).
Duarte, J., Perez-Vizcaino, F., Torres, A. I., Zarzuelo, A.,
Jimenez, J., and Tamargo, J., Vasodilator effects of visnagin
in isolated rat vascular smooth muscle. Eur. J. Pharmacol.,
286, 115-122 (1995).
Duarte, J., Torres, A. I., and Zarzuelo, A., Cardiovascular
effects of visnagin on rats. Planta Med., 66, 35-39 (2000).
Faggioli, L., Costanzo, C., Donadelli, M., and Palmieri, M.,
Activation of the Interleukin-6 promoter by a dominant
negative mutant of c-Jun. Biochim. Biophys. Acta, 1692,
17-24 (2004).
Graeber, M. B. and Streit, W. J., Microglia: biology and
pathology. Acta Neuropathol., 119, 89-105 (2010).
Jang, S., Kelley, K. W., and Johnson, R. W., Luteolin reduces
IL-6 production in microglia by inhibiting JNK phosphorylation and activation of AP-1. Proc. Natl. Acad. Sci.
U.S.A., 105, 7534-7539 (2008).
Jung, J. S., Yan, J. J., and Song, D. K., Protective effect of
decursinol on mouse models of sepsis: enhancement of
interleukin-10. Korean J. Physiol. Pharmacol., 12, 79-81
(2008).
Kao, T. K., Ou, Y. C., Raung, S. L., Lai, C. Y., Liao, S. L., and
Chen, C. J., Inhibition of nitric oxide production by quercetin in endotoxin/cytokine-stimulated microglia. Life Sci.,
86, 315-321 (2010).
Kaul, B. and Staba, E. J., Visnagin: biosynthesis and isolation from Ammi visnagi suspension cultures. Science,
150, 1731-1732 (1965).
Kawanokuchi, J., Mizuno, T., Takeuchi, H., Kato, H., Wang,
J., Mitsuma, N., and Suzumura, A., Production of interferon-gamma by microglia. Mult. Scler., 12, 558-564 (2006).
Lee, C. J., Lee, S. S., Chen, S. C., Ho, F. M., and Lin, W. W.,
Oregonin inhibits lipopolysaccharide-induced iNOS gene
transcription and upregulates HO-1 expression in macrophages and microglia. Br. J. Pharmacol., 146, 378-388
(2005).
Lu, D. Y., Tang, C. H., Chen, Y. H., and Wei, I. H., Berberine
suppresses neuroinflammatory responses through AMPactivated protein kinase activation in BV-2 microglia. J.
Cell. Biochem., 110, 697-705 (2010).
Park, S. H., Kang, J. S., Yoon, Y. D., Lee, K., Kim, K. J., Lee,
K. H., Lee, C. W., Moon, E. Y., Han, S. B., Kim, B. H., Kim,
1850
H. M., and Park, S. K., Glabridin inhibits lipopolysaccharide-induced activation of a microglial cell line, BV-2, by
blocking NF-kappaB and AP-1. Phytother. Res., 24 Suppl
1, S29-S34 (2010).
Perez, R. L., Ritzenthaler, J. D., and Roman, J., Transcriptional regulation of the interleukin-1beta promoter via
fibrinogen engagement of the CD18 integrin receptor. Am.
J. Respir. Cell Mol. Biol., 20, 1059-1066 (1999).
Rauwald, H. W., Brehm, O., and Odenthal, K. P., The
involvement of a Ca2+ channel blocking mode of action in
the pharmacology of Ammi visnaga fruits. Planta Med.,
60, 101-105 (1994).
Ray, B. and Lahiri, D. K., Neuroinflammation in Alzheimer's
disease: different molecular targets and potential therapeutic agents including curcumin. Curr. Opin. Pharmacol.,
9, 434-444 (2009).
Saraiva, M. and O'garra, A., The regulation of IL-10 production by immune cells. Nat. Rev. Immunol., 10, 170-181
(2010).
Saud, K., Herrera-Molina, R., and Von Bernhardi, R., Proand anti-inflammatory cytokines regulate the ERK pathway: implication of the timing for the activation of microglial cells. Neurotox. Res., 8, 277-287 (2005).
Strle, K., Zhou, J. H., Shen, W. H., Broussard, S. R., Johnson,
R. W., Freund, G. G., Dantzer, R., and Kelley, K. W.,
Interleukin-10 in the brain. Crit. Rev. Immunol., 21, 427449 (2001).
Thompson, W. L., Karpus, W. J., and Van Eldik, L. J., MCP1-deficient mice show reduced neuroinflammatory responses
and increased peripheral inflammatory responses to
peripheral endotoxin insult. J. Neuroinflammation, 5, 35
(2008).
Tuttolomondo, A., Di Raimondo, D., Di Sciacca, R., Pinto, A.,