Biotech 2 Lab Manual

Biotechnology 2
Laboratory
Spring 2007
Instructor:
Dr. David Binninger
This product was funded by a grant awarded under the Presidents High Growth Job Training Initiative, as implemented by
the U.S. Department of Labors Employment & Training Administration. The information contained in this product was
created by a grantee organization and does not necessarily reflect the official position of the U.S. Department of Labor. All
references to non-governmental companies or organizations, their services, products, or resources are offered for informational
purposes and should not be construed as an endorsement by the Department of Labor. This product is copyrighted by the
institution that created it and is intended for individual organizational, non-commercial use only.
Biotechnology 2 Laboratory
BSCL4428
Spring 2007
Instructor:
Dr. David Binninger
Office: Biological Sciences Building, Room 210
Office Hours:
Monday and Wednesday from 9:00AM-12:00PM or
By appointment
Phone: 297-3323
Email: binninge@fau.edu
E-mail is the most effective way of reaching me
Required
1.
Laboratory notebook, which is available in the FAU campus bookstore

in the textbook section. It has a very colorful cover, numbered pages
and carbonless tear-out pages.
2.
Laboratory manual, which can be downloaded from Blackboard.
Course Objective
The objective of this laboratory course is to provide you with hands-on experience in
some of the basic, but essential laboratory skills required in molecular biology and
biotechnology. Emphasis will be placed on understanding the concepts behind
designing and implementing controlled experiments.
Student Conduct
All rules and regulations regarding the students responsibilities, discipline and
honor code, as outlined in the college catalog, will be observed.
Biotechnology 2 Laboratory manual
Spring 2007
Holidays
There are no official university holidays that coincide with a scheduled class.
Determination of your grade

Notebook and Results 20%
Quizzes 10%
Three out-of-class assignments 8% each for a total of 24%
Lab Practical 20%
Two in-class written exams 13% each for a total of 26%
In-Class Written Exams

There will be two in-class written exams that account for 40% of your course
grade. These are short answer and problem-based exams, which emphasize the
concepts and important technical aspects of the techniques that you are learning in
this course. A major portion of the exam will focus on the various types of routine
calculations required for preparation of reagents.
Important: Many students find the exams challenging and their exam scores are
often a major factor in determining the final course grade. There are discussions
throughout this manual on the conceptual and technical details of the procedures
you are learning. There will also be discussions in class. This material forms the
basis of the written exams.
Laboratory notebook
The laboratory notebook must be purchased from the FAU bookstore. The notebook
has carbonless pages that will be torn out and turned into your TA before you leave
the laboratory. These pages must be well thought out and legible. We will be going
over, in detail, what is expected of you in this record-keeping process. See pages 89.
Quizzes
Short quizzes will be given at the beginning of each lab period. The purpose is to
encourage you to read the relevant material in the lab manual before coming to
class. Collectively, the quizzes account for 10% of your grade.
A Clean Working Environment

Now is the time to develop good laboratory techniques that include keeping your lab
space clean and organized. Please note that your mother doesnt work here. The
following is a list of behaviors which will result in a 1-point deduction in your
notebook grade.
Disappear for extended periods of time
Leaving trash in the sink
Spring 2007
Not cleaning up properly

Negligence and/or abuse of equipment
Questions that clearly indicate that you are not prepared
Non-participation (your lab partner(s) are doing all of the work)
Results
At this stage in your academic career, it is reasonable to expect an acceptable level
of proficiency in the laboratory. The instructor, along with the teaching assistants,
will evaluate the quality of your work.
Late for Class

You are expected to be in the lab, ready to work promptly at 9AM. The teaching
assistants will hand out the quiz promptly at 9AM. If you are seated at that
time, you will not be allowed to take the quiz.
Missed Lab Periods

It is important that you attend every lab. Most of the experiments will develop over
a course of several lab periods. Making-up a missed lab is not practical since
both sections of the lab course run concurrently.
An absence from lab will be allowed only in truly exceptional circumstances and a
written, verifiable excuse is provided. Examples of acceptable excuses include a
doctors note showing illness, court subpoena or a family tragedy. If you are going
to miss (or have already missed) a lab and have a written excuse, please talk with
Dr. Binninger as soon as possible. For an excused absence, you will be offered an
opportunity to receive credit for the missed lab by doing an out-of-class written
assignment. Please see Dr. Binninger for additional details. Note that in keeping
with FAU policy, reasonable accommodations for religious observances will be
made.
Unexcused absences will result in lose of all points associated with that days
activities.
Ensuring Success in the Course

1.
2.
Attend all labs.

Read the corresponding material in the manual before the lab. See
comments concerning quizzes above.
3.
Most importantly, try to understand the purpose of the

experiment before you enter the lab!
4.
Go back over your lab notes as soon as possible after the lab and
determine where any weaknesses in your understanding lie.
5.
6.
7.
Spring 2007
Utilize the instructors and teaching assistants office hours to ask any
questions about areas with which youre having difficulty.
Use your other biology textbooks, or go to the library for related books,
as resources for understanding basic concepts.
Explore the Internet.
Grading Scale
Grade
A
AB+
B
BC+
Percentage
93
92-90
89-87
86-83
80-82
79-77
Grade
C
CD+
D
DF
Percentage
76-73
73-70
69-67
66-63
62-60
59
Course Schedule
The proposed schedule for experiments, bioinformatics assignments and exams
can be found at http://biology.fau.edu/~binninger/Biotech_2/biotech_2_2007.htm
Spring 2007
Maintaining Your Laboratory Notebook

Use the first two to three pages of your laboratory notebook for a Table of Contents.
On these pages, list the experiments by name, as you perform them, with their
starting page number.
Use a pen (no pencils!) when writing in your notebook.
Never remove (or insert) pages from your notebook (this excludes the carbonless
(yellow) copies of course). When filling only part of a page, cross through the empty
space. When adding in tables or photos, tape them on a notebook page and sign
over the edge of the insert. Label these inserts clearly.
Try to keep your notebook clean and neat.
Write using only conventional terms. Do not use abbreviations, names or symbols
that other people will not understand.
Write down the data that you generate during the experiment directly into your
notebook. Dont keep scrap papers that can be misplaced or jumbled out of order.
Write down the facts honestly and pointedly. Your notebook is not a journal and
irrelevant personal remarks are not appropriate.
Sign and date the bottom of every page. Have a witness sign and date the bottom
of each page every day before the end of lab. Print your name below the
signature so we know who signed it.
Note:
In the industry:
your notebook will be retained and a copy of it will be made and stored in a
second place.
your witness will usually be someone not working on the same scientific
project, but someone working in your lab who can verify that you were
performing the experiments on the days that you specified.
For each experiment, include the following sections:

Purpose
Briefly state (in a couple of sentences) the purpose(s) of the experiment.
Include the reason(s) for performing the experiment, as well as the expected
outcome(s).
Spring 2007
Materials and Methods

This section includes all solutions, reagents, equipment and protocols that
you employed in this experiment. In order to be efficient with time, a scientist will
not write the protocol every time that he/ she uses it, but instead, will write the
protocol the first time it is used and refer back to the protocol (by referencing the
lab notebook and page). In this class, the lab manual can be referred to as a
source for protocols, but any changes or deviations must be noted in the
notebook.
Results
As mentioned above, write down the data that you generate during the
experiment directly into your notebook. This section has to be particularly clear
and easy to read. Label clearly any tables or graphs that you construct to explain
your data. Include all calculations that you used to perform the experiment, as well
as, those used to analyze the data.
Discussion
Discuss the final results: were they as expected? If not, why not? Interpret
the data and include supporting reasons for why the experiment had the outcomes
it did. What experiment would you perform next, if given the opportunity to decide?
References
Record the sources of information that you used to conduct the experiment (in
this class, typically the lab manual).
Spring 2007
Equipment Use, Lab Technique, and Waste Disposal

Pipettes
Graduated pipettes are made of glass and have graduations along the
length of the pipette to allow the accurate measurement and
dispensing of fluids. We may use pipettes of 1.0ml, 5.0ml, and 10.0ml
total volume.
Pasteur pipettes are made of glass and do not have graduations.
Sterile Handling
Both types of pipettes are supplied in a metal canister. Pipettes are
supplied sterile! The pipettes must be handled properly to maintain
the sterile condition. To remove a pipette from the canister, hold the
canister in one hand while carefully removing the lid with the other
hand. Hold the open canister horizontally and shake gently until a
single pipette is extending enough to grab it with the hand holding the
lid.
Only touch the pipette near the top and only as much as is
necessary!
Replace the lid without allowing the pipette to come in contact with
any object. Place the closed canister on the bench in a horizontal
position.
DO NOT STAND THE PIPETTE CANISTERS ON END!
Graduated pipettes are installed on a thumbwheel aspirator.
Pasteur pipettes use a rubber bulb.
Disposal
Graduated pipette remove it from the thumbwheel aspirator and
immediately place it into the disposal canister at your workstation
with the tip down. When necessary or at the end of lab, transfer the
used pipettes from the disposal canister at your workstation to the
Pipette Waste Canister at the side bench with the tips down.
Pasteur pipette remove it from the bulb and immediately place it
into the disposal canister at your workstation with the tip down.
When necessary or at the end of lab transfer the used pipettes from
the disposal canister at your workstation to the tray labeled
Contaminated Glass Waste at the side bench.
DO NOT RETURN PARTIALLY USED PIPETTE CANISTERS
TO THE PIPETTE DRAWERS!
Spring 2007
Automatic Micropipetters
Automatic micropipetters are used for repeated accurate measuring of small
amounts of liquids. They are very expensive. You may use pipetters that
will measure as little a quantity as 0.5l.
Sterile HandlingThe automatic pipetters themselves are not sterile, but they
incorporate sterile disposable plastic tips. These tips are provided in a
sterile condition in a plastic box. Proper procedure must be followed to
maintain the sterility of the tips in the box. While holding the
automatic pipetter in one hand, open the pipette tip box only enough to
remove a tip. Press the end of the automatic pipetter onto the tip for a
snug fit. Remove the pipetter with the tip attached. Close the lid.
Disposal
Immediately following the use of the pipette tip, eject the tip into the
disposal canister at your workstation using the ejector on the
automatic pipetter. When necessary, or at the end of lab, transfer the
used pipette tips from the disposal canister at your workstation to
the waste disposal tub labeled Contaminated Plastic Waste.
Do Not Place Used Pipette Tips In Any Waste Receptacle Other Than
the Tub Labeled Contaminated Plastic Waste.
Glass Petri Plates:

Sterile toothpicks will be provided in reusable glass Petri plates. To
aseptically remove a toothpick for transfers of bacteria or yeast open the
Petri plate in a hinged manner. Remove a single toothpick touching it only
in the middle while touching no other toothpicks or the inside of the plate.
Close the lid. At the end of lab, return the glass Petri plates to your
instructor at the front bench. As the Glass Petri Plates Are Not
Contaminated and Are Not Waste, Do Not Place Them in Any Waste
Receptacle!
Disposable Petri Dishes

The disposable Petri plates that you will be using are made out of plastic and
will be provided either empty, or containing a variety of microbiological
media. Used plastic Petri plates should be placed in the waste disposal tub
labeled Contaminated Plastic Waste. Do not stack plates in the tub any
higher than the sides of the tub. If the tub is too full, ask your instructor and
a new tub will be provided.
Spring 2007
Glass Test Tubes

Labeling
Label each test tube as you receive it to avoid confusion as to the contents of
the tube. Make the label using label tape and a sharpie marker. Do not
write directly on the tube or place any marking on the tube caps.
Disposal
Used contaminated tubes should be placed in tube racks in the
area of the side bench labeled for test tubes.
Microcentrifuge Tubes
Labeling
The microcentrifuge tubes that you will be using are made of plastic and have
a total volume of 1.5ml. You may write directly on microcentrifuge tubes
with a fine tip Sharpie marker.
Disposal
Microcentrifuge tubes are made of plastic. Used microcentrifuge tubes
should be placed into the waste disposal tub labeled Contaminated Plastic
Waste. They should not be put in test tube racks at any time. If you need
a rack for microcentrifuge tubes ask your instructor and one will be provided
for you.
If you have any question as to the use of any equipment, or disposal of
any materials, please ask your instructor or the laboratory coordinator.
Spring 2007
10
Overview of The
Semester
Biotechnology 1 Lab focused primarily on DNA manipulation. In this course, you
will gain experience working with RNA and protein. The experiments will involve
the MsrA genes from Drosophila since this an active research interest of mine. You
were introduced to the MsrA gene in the PCR-based experiment from Biotechnology
Lab 1. However, the techniques you are learning are broadly applicable to other
genes and organisms of interest.
The MsrA gene is a member of a family of genes that encode an enzyme called
methionine sulfoxide reductase. Methionine contains a sulfur atom that is very
easily oxidized, which often leads to an impaired or fully inactive protein. The MsrA
and MsrB enzymes reduce the sulfur in methionine sulfoxide, often restoring
enzymatic activity to the damaged protein. This highly important gene has been
found in (nearly) every organism that has been investigated from E. coli to humans.
The first set of experiments will teach you how to:
Isolate total cellular RNA from Drosophila
Determine the amount and purity of the RNA using UV absorbance
Separate the RNA molecules by size using gel electrophoresis
Use reverse-transcription and PCR (called RT-PCR) to measure levels of
MsrA mRNA.
The second set of experiments will teach you how to:
Clone a cDNA copy of the MsrA gene into a vector designed to over-express the
recombinant protein in E. coli.
The third set of experiments will teach you how to:

Purify the recombinant MsrA protein by affinity chromatography
Measure enzyme activity
Resolve a complex mixture of proteins by denaturing gel electrophoresis
Identify the recombinant protein by Western blotting
Spring 2007
11
Experiment 1
Measuring Changes in Gene Expression Using RT-PCR
Introduction
A common theme in a wide range of research projects is the investigation of
differential gene expression. More specifically, to identify and quantify changes
in the levels of mRNA for specific genes in response to a physiological challenge,
environmental assault, cellular differentiation, etc.
Northern (RNA) hybridization was the standard technique for analyzing RNA
for several decades. It offers the advantage of providing information on both the
amount and the size of the transcript. However, current research projects often
require quantitative analyses that are more precise and/or use less RNA than is
needed for Northern blots. Reverse-transcription PCR (RT-PCR) overcomes these
obstacles. First, the amount of RNA needed for a single sample for Northern
hybridization is sufficient for 50 or more RT-PCR assays. Second, RT-PCR can be
more precise than Northern blots in determining changes in the mRNA levels. It
must be done properly and it is not trivial, but it can be done if needed.
Purpose
We will investigate the expression of the MsrA locus in three strains of
Drosophila. One is a wild-type and should express a normal mRNA. The second
is a revertant that arose when a P-element excised from the locus. If it really is a
revertant, there should also be expression of a normal mRNA. The third is a
deletion mutation that resulted from excision of a P-element. The deletion
removed ~500 bp upstream of the transcription start site and almost 1,000 bp of
the transcription unit. Therefore, we expect this strain to be a null-mutant and
not express a functional MsrA mRNA.
Overview of the Experiment
In Biotechnology Lab 1 you isolated genomic DNA from adult Drosophila. In this
exercise, you will first learn to isolate total cellular RNA from adult Drosophila.
It is important that you work carefully when handling RNA since it is more
labile than DNA and ribonucleases (RNAse) are ubiquitous. We will then
determine the amount and purity of your RNA preparations using the
spectrophotometer. We will also analyze the integrity of the RNA by gel
electrophoresis.
Spring 2007
12
The RNA will be used as a substrate for RT-PCR. Since PCR requires a DNA
template, we must first make cDNA using reverse transcriptase, a primer and
your RNA as a template. The cDNA will then be used as a template for PCR
amplification.
Overview of the RNA Extraction
We will use a commercial product called Trizol made by Invitrogen. It utilizes
phenol, guanidine isothiocyanate and precipitation with isopropanol or ethanol
in the isolation of the RNA. The following is a discussion of key points related to
the role of each of these reagents in the RNA isolation procedure.
Phenol Extraction Proteins readily dissociate from DNA in the presence of

phenol, which is a strong organic solvent. Chloroform also helps denature both the
protein and lipids while facilitating the separation of the organic and aqueous
phases. The DNA and RNA are less soluble in the chloroform-phenol mixture
compared to phenol alone. This reduces loss of nucleic acid into the organic phase.
Isoamyl alcohol is usually added to prevent foaming. One common name for the
chloroform: isoamyl alcohol (24:1 ratio) mixture is Sevag. At pH 7-8, the DNA is also
in the aqueous phase while the protein forms an opaque layer between the phases
(called the interphase). If the phenol is adjusted to pH 5-6, DNA will be retained in
the organic phase while RNA stays in the aqueous phase.
Guanidinium isothiocyanate -Guanidinium isothiocyanate is a powerful protein

denaturant that has been very effective in RNA purification methods, even from
tissue rich in ribonucleases (RNAse). Adding guanidinium isothiocyanate to
phenol/chloroform extraction and alcohol precipitation improves the recovery of high
quality intact RNA.
Alcohol Precipitation - Adding monovalent cations (K+, Na+, NH4+) to nucleic acid
solutions causes salts to form with the negatively charged nucleic acids. Adding
alcohol (ethanol or isopropanol) causes the nucleic acids to precipitate. Isopropanol
has the advantage that less alcohol is needed to precipitate the nucleic acid.
However, salts and other contaminants are more likely to also precipitate compared
to using ethanol. Precipitations are typically performed at -20C. However,
precipitation using ammonium acetate can be done at room temperature.
Part A RNA isolation

Each student will prepare RNA from one of the following strains of Drosophila.
WT Lab yw stock, which is wild-type for the MsrA gene
Spring 2007
13
RVT A revertant of an MsrA mutation caused by insertion of a P-element

transposon that jumped-out of the locus, leaving the DNA with its
original sequence
DEL A deletion mutation in the MsrA gene caused by excision of a Pelement transposon that lead to a loss of ~1.5 kbp of DNA
Materials
4 Trizol Reagent (see comments on the previous page)
4 Microcentrifuge at 4C
4 High speed homogenizer
4 Microcentrifuge tubes
4 75% ethanol (made using undenatured absolute ethanol)
4 CHCl3
4 Micropipetters with tips
4 RNAse-free water
4 Isopropanol
Procedure
1.
Homogenize flies (5 to 10 flies are sufficient) in 1mL Trizol Reagent.
2.
Centrifuge at maximum speed for 10 min at 4C
3.
Transfer the supernatant to a clean microcentrifuge tube.
4.
Allow the sample to incubate at room temperature for 5 min.
5.
Add 200 l of CHCl3, vortex for 15 sec, and then incubate the sample at room
temperature for 2-3 min.
6.
Centrifuge at full speed for 15 min at 4C.
7.
Transfer the aqueous phase to a clean microcentrifuge tube.
Do not disturb the interphase! The DNA is in the interphase and the
8.
proteins are in the pink-colored organic phase.

Precipitate the RNA by adding 500 l isopropanol and 1 l 10mg/ml glycogen.
Mix by inverting once.
9.
Incubate the samples at room temperature for 10 min.
10.
Centrifuge at maximum speed for 10 min at 4C.
11.
Pour off the supernatant without disturbing the pellet.
14
Spring 2007
12.
Wash the RNA pellet with 1 ml 75% ethanol.
13.
Vortex sample for 15 sec and centrifuge at 12,000 rpm for 10 min at 4C.
14.
Decant the ethanol. Centrifuge again for a few seconds to collect the residual
ethanol. Remove all visible ethanol with a micropipette.
Sometimes you may find that small droplets of ethanol stubbornly adhere
to the side of the microcentrifuge tube. A micropipetter can be useful for
removing them.
15.
Allow the pellet to air dry for a few minutes before resuspending the pellet in
30 - 50l of RNAse free water.
Resuspend in 30l if you cannot see the pellet or 50l if a pellet is clearly
visible.
16.
Label the collection tube. Your RNA sample will be stored at -75C until
needed.
B. Determining the Amount and Quality of RNA Using a

Spectrophotometer
RNA and DNA maximally absorb ultraviolet light at a wavelength of 254260nm. A 40g/ml RNA solution has an absorbance of 1.0 at 260nm (A260=1.0).
The RNA sample is also measured at 280nm, which is closer to the optimal
wavelength for protein. This helps to evaluate how clean the RNA sample is. A
260/280 ratio of 1.9 or higher indicates a highly purified RNA sample. A
significantly lower ratio indicates the presence of protein and other
contaminant(s).
Previous experiments indicate that you should recover ~1g total RNA per adult
Drosophila. Assuming you started with five adult flies and your sample is in
30l, the RNA concentration is probably ~200g/ml (5g/0.03ml = 166g/ml =
~200g/ml). Assuming your RNA sample is 200g/ml, the absorbance at 260nm
A260 would be 5 (200g/ml/40g/ml/A260 = 5 A260). You will need to dilute a
sample of your RNA to accurately determine the absorbance value using the
spectrophotometer. Based on an assumed recovery of 5g, a 50-fold dilution
should give an A260 = 0.1.
Be sure that you understand how to determine the concentration and A
/A280
ratio of an RNA sample. This will be covered on one of the written exams.
260
Spring 2007
15
Materials
Microcentrifuge tubes
Micropipetters with tips
Water (highest quality)
Spectrophotometer
UV-transparent cuvettes (designed for use of ultraviolet light)
Procedure
As discussed above, you should make a 50-fold dilution of your RNA sample in
water.
1. For a 50-fold dilution, add 10l RNA to 490l water. Vortex to mix well.
2. The teaching assistant will help you measure the absorbance of the sample at
260nm and 280nm
You must use special plastic cuvettes since most plastics absorb ultraviolet
light very effectively. Alternatively, most research labs use quartz
cuvettes, which are expensive (about $200 each) and very easily damaged.
The spectrophotometer needs to be zeroed to account for any absorbance due

to factors other than RNA. In this experiment, what was used to zero the
instrument?
3. To determine the concentration of your RNA sample, multiply the A260

reading by 50 to obtain the absorbance of your sample. To convert to g/ml,
multiply the A260 value by 40.
4. To determine the A260/A280 ratio, divide the A260 reading by the A280 reading.
Hopefully the ratio will be close to 1.9 or higher.
What if the A260/A280 ratio is too low (~1.5

or less)?
A low A260/A280 ratio often indicates the presence of protein or more likely small
amounts of phenol. The phenol can be a problem since it can inactivate the reverse
transcriptase. An additional ethanol precipitation can be effective at removing the
phenol or contaminating proteins.
1.
Add RNAse-Free water to your RNA sample to bring the volume to 100l.
2.
Add 50l 7.5M ammonium acetate (NH4OAc) and 375l ethanol (100%).
Spring 2007
3.
Vortex to mix well and then chill at -70C for 10 min.
4.
Centrifuge at maximum speed for 15 min.
5.
Completely remove all of the ethanol supernatant (see steps 14 -15 on page
15).
6.
Resuspend the RNA pellet in 30l RNAse-free water.
7.
Measure the A260 and A280 values again (see page 16).
16
Did the A260/A280 ratio improve?

C. Preparation of an Agarose Gel for RNA Analysis
The procedure for analyzing RNA by gel electrophoresis is similar to that used for
DNA. The major difference is the presence of a denaturant (formaldehyde) in the gel
used for RNA analysis. RNA is predominately single-stranded, but usually has some
secondary structure (e.g. stem loops) that can alter its mobility. The denaturing
conditions of the gel help ensure that the RNA remains fully single-stranded during
electrophoresis.
The denaturing agarose gels that are routinely used for electrophoresis of RNA
samples contain a limited amount of formaldehyde (usually 3ml of 37%
formaldehyde solution per 100ml of agarose). According to Federal Health and
Safety guidelines, these gels must be used in a certified fume hood. We do not have
a fume hood available in the teaching laboratories. Therefore, we are going to use
the standard TAE agarose gel that you used previously for your plasmid DNA and
PCR samples. While there is likely to be some effect on mobility due to secondary
structure in the RNA, the results are usually satisfactory.
Casting an agarose gel
The concentration of agarose in the gel can be varied depending on the size range of
DNA or RNA fragments being resolved. It also significantly affects the strength of
the gel. The agarose concentration is expressed as a percentage. A 1% agarose gel
contains 1g agarose in 100ml buffer. Lower percentage gels work best for larger
DNA fragments, but the gels are more fragile. Conversely, higher percentage gels
work better for resolving smaller DNA or RNA fragments and they are more
durable. For separation of total RNA, which varies widely in size, a 1.5% agarose
gel should work well.
The horizontal gel electrophoresis unit that we will be using is shown below.
Spring 2007
17
Spring 2007
18
Materials
4 Agarose electrophoresis grade
4 20X TAE Buffer
4 Top loading balance
4 Flask about 250ml
4 100-ml graduated cylinder
4 Electrophoresis unit
4 Gel casting tray
4 Gel comb
4 Plastic wrap
4 Label tape and marker
4 Ethidium bromide 10l 1g/ml per gel.
Each bench will cast one agarose gel

Procedure
1.
Prepare 50ml of 1X TAE buffer by making the appropriate dilution of your 20X
TAE Buffer stock using NanoPure water.
________ ml of 20X TAE Buffer in a final volume of 50ml
Alternatively, you may be provided with 1X TAE

2.
Calculate the mass of agarose needed for 50ml of 1.5% (w/v) agarose.
________ g agarose for 50 ml of 1.5%
3.
Weigh the agarose into a weigh boat and then transfer it to a 125-ml or larger
flask.
4.
Add 50ml 1X TAE buffer.
5.
Carefully use the microwave oven to melt the agarose.
6.
While the agarose is being melted, carefully slide the gel tray into the
electrophoresis unit with the rubber gaskets pressed against the sides.
7.
The comb has teeth with different thicknesses. Insert the comb so the thicker
(1.5mm) teeth are pointing down.
8.
Spring 2007
19
The agarose solution needs to come to a full boil. However, be careful that it
does not boil over. After it reaches the boiling point, move the flask to the bench
and allow it to cool to about 55-60C. The flask should still be quite warm, but
not too hot to hold in your hand.
Handle the hot flask carefully!

9. The teaching assistant will add a small amount (~10g; 1l of 10mg/ml stock)
ethidium bromide to the molten agarose.
10. Carefully pour the molten agarose into the tray.
The agarose must be cool enough to hold in your hand. If the agarose is
too hot (>55C), the plastic of the electrophoresis unit may be damaged!
11. Allow the agarose to solidify completely.
12. Remove the gel comb by carefully pulling upward with a steady even pressure.
13. Carefully remove the gel tray from the electrophoresis unit. Wrap the gel tray
with the agarose gel in plastic wrap to prevent it from drying out. Use a piece of
label tape to mark your gels before giving them to the teaching assistant. The
gel will be stored at 4C until needed.
Spring 2007
20
D. Gel Electrophoresis of RNA

As noted previously, RNA samples are usually analyzed by gel electrophoresis
under denaturing conditions. The most widely used denaturant is formaldehyde,
which is a known carcinogen. We do not have fume hoods for running gels that
contain formaldehyde, so we will use the standard TAE agarose gels that you used
previously for your DNA samples. Even though the RNA may not be fully
denatured, the results are usually good enough to determine the quality of your
RNA.
Materials
RNA sample
TempBlock at 65-70C
Ice bucket with ice
Sample buffer used for DNA samples
Procedure
1. Prepare an RNA sample for electrophoresis by combining
2g RNA and water in a total volume of 15l. The volume of RNA that you
need will depend on the concentration of your RNA sample, which you
determined in the previous lab.
_____l RNA (2g total)
_____l water
2. Add 5l Sample Buffer (this is the same sample buffer we used for your DNA
samples)
3. Heat at 65-70C for 10 minutes.
4. Briefly chill the sample on ice.
5. Load your RNA sample onto the agarose gel, noting which lane contains your
sample.
6. Run the gel at ~150V until the tracking dye has traveled about 2/3 the length
of the gel.
7. Try to observe the RNA using a handheld UV lamp. The figure shows an
RNA sample from yeast. Your RNA was isolated from Drosophila cells, but
the results should be similar.
Spring 2007
21
Expected Results
There are three classes of RNA in cells mRNA, tRNA and ribosomal RNA (rRNA).
The rRNA makes up about 95% of the total RNA in the cell. The mRNA is the most
heterogeneous in size, but usually only comprises 1-2% of the total RNA. The
remaining RNA is tRNA, which is rather small (about 75 bases). Therefore, the
most striking feature of the ethidium bromide stained agarose gel containing total
RNA is the major ribosomal RNA bands (see figure to the left).
E. Reverse Transcription
Background
Synthesis of cDNA from RNA templates is now a fundamental step in a
variety of techniques such as cDNA cloning, preparation of hybridization probes and
RT-PCR. Even though the template is RNA, reverse transcriptase is a DNA
polymerase and requires a primer to initiate synthesis. Three general classes of
primers are commonly used.
a.
Oligo-dT a short olionucleotide of repeated dTs, usually about 20
nucleotides in length. This primer will anneal with the poly(A) tail of mRNA
from eukaryotic cells. This primer works well, but has the drawback of
overly representing the 3 end of the mRNA since the reverse transcriptase
is not highly processive and tends to stall before reaching the 5 end of the
mRNA.
b.
Random primers a complex mixture of short (6-9 nucleotides) oligomers

representing all possible sequences. The primers anneal at various positions
along the mRNA. The approach will not yield a full-length cDNA (why?), but
more completely represents all of the mRNA sequences. We will be using
random hexamers (6 bases in length).
c.
Spring 2007
22
Gene specific primer uses the 3 downstream primer from the primer pair
used for PCR amplification of a specific cDNA. This approach is useful if you
are only interested in one specific gene. cDNA made using oligo-dT and
random primers can be used as templates for any appropriate pair of PCR
primers.
Materials
Drosophila RNA (from the previous lab)
Superscript III reverse transcriptase (Invitrogen)
Random hexamer primers (Promega)
Water (ultra high quality)
100mM EDTA
TE (TrisCl, pH 8.0 with 1mM EDTA)
TempBlocks at 70C and 42C
Ice bucket with ice
Note: The following procedure is a general one for reverse transcriptase. You may be
given a modified procedure in class if we are using a different system.
Procedure
1.
Obtain a microcentrifuge tube containing 5l water with 0.5g random
hexamers.
2.
Add 5l of total Drosophila RNA for a final volume of 10l.
3.
Heat the sample at 70C for 10 min.
4.
Chill the sample on ice for 3 min.
5.
Centrifuge for a few seconds in the microcentrifuge.
6.
Add 10l of the following mixture:

4l 5X Reverse Transcription Buffer
2l 100mM DTT
1l 10mM dNTPs
1l RNAse inhibitor (40U/l Amersham)
1l reverse transcriptase (200U/l Superscript II)
Total volume is now 20l
7.
Centrifuge for a few seconds in the microcentrifuge.
8.
Incubate at 42C for 60 min.
9.
Add 1l 100mM EDTA and heat at 90C for 2 min to inactivate the
reverse transcriptase.
10.
Add 79l water to bring the final sample volume to 100l.
11.
Clearly label the tube and then give it to the teaching assistant. Your
sample will be stored at -20C until the next lab.
Spring 2007
23
F. Polymerase Chain Reaction (PCR)

Background
The polymerase chain reaction (PCR) provides a rapid and sensitive method to
amplify a specific gene sequence. In our exercise, we will use PCR to amplify two
gene specific cDNAs that were synthesized in the reverse transcriptase reaction.
If the PCR reaction is analyzed during the linear phase of the exponential
amplification, then differences in the amount of PCR product (amplicon)
synthesized reflect differences in the relative amounts of starting mRNA. Thus,
combining reverse transcription and PCR (RT-PCR) provides a highly sensitive
method to evaluate differential gene expression. This method is especially useful
when the amount of starting material (mRNA) is limited.
Materials
cDNA (from previous lab period)
RNA preparation (from a previous lab period)
2X PCR Reaction Mix (see below for composition)
PCR primers for amplification of selected mRNA
The 2X PCR Reaction Mix contains the four deoxynucleotide triphosphates

(dNTPs) and the Taq polymerase in the appropriate buffer. The only
additional components are the cDNA (from the reverse transcription) and
the gene-specific primers.
Procedure
Each student will assemble two PCR reactions. Both reactions will contain
all of the components needed for the reaction except the primers. One reaction
will contain the primers for the MsrA cDNA while the other contains the primers
for the MsrB cDNA.
Note: The following procedure may be

modified due to changes in the PCR
system being used.
1. Add the following to a 200l PCR-tube, keeping it on ice as much as possible:
30l 2X PCR Reaction Mix
10l diluted cDNA reaction products
2. Mix thoroughly by pipetting the mixture with a micropipetter.
3. Transfer 20l to a clean 200l PCR-tube.
Spring 2007
24
4. Add 5l each oligonucleotide primer (20pmol of each primer) for MsrA to one
tube and 5l each oligonucleotide primer (20pmol of each primer) for MsrB to
the second tube.
Caution: Be sure you add each primer. A common mistake is adding

the same primer twice or omitting one primer.
5.
The reaction was assembled in a 200l round-top tube that is specially

designed to fit the PCR thermal cycler that we will be using.
Be sure to label your tubes clearly.

6. The following PCR profile will be used:
One cycle at 94C for 1 minute
40 cycles of 94C for 20 sec, 52C for 30 sec and 68C for one min.
Chill to 4C and hold.
Older PCR thermal cyclers required a layer of mineral oil over the reaction
to act as a vapor barrier to prevent condensation on the top of the tube.
Newer instruments, like the one you are using, have a heated top that
prevents formation of condensation. Therefore, the mess and bother of
dealing with mineral oil in your reaction has been eliminated.
G. Cast a 2.5% Agarose Gel

Materials and Procedure
Cast a 2.5% agarose gel in TAE buffer.
H. Gel electrophoresis of PCR product

Materials
PCR amplification products

DNA Sample Buffer
Electrophoresis apparatus with power supply
2.5% agarose gel (prepared in the previous lab)
Micropipetters with tips p10 and p100
DNA size markers 100 bp ladder
Procedure
1. Obtain your numbered tubes containing your PCR amplification products.
2. Add 5l DNA Sample Buffer to the 200l tube containing your PCR reaction
products
Spring 2007
25
3. Load your sample into a well in the agarose gel. Be sure to note which lane is
your sample.
4. Load the DNA size markers. This is typically done using Lane 1 at the left
edge of the gel.
5. Run the gel at 100-150V until the bromophenol blue dye is midway down the
gel.
6. We should be able to view the gels before class ends since there is ethidium
bromide in the gel.
Spring 2007
26
Experiment 2
Construction of an Expression Vector for
Synthesis of Recombinant Drosophila MsrB
Protein in E. coli
Introduction
In Biotechnology 1 Lab, you used a plasmid vector in an experiment to amplify a
DNA fragment in E. coli. We will now use a specialized vector designed for
production and purification of recombinant proteins.
Classical biochemical techniques for protein purification are effective, but are
typically labor-intensive and often require large amounts of the biological source of
the protein in order to obtain a small amount of purified protein. Recombinant DNA
techniques have improved this process by using a host organism (E. coli in our
experiment) to synthesize large amounts of the desired protein dramatically
reducing the time and cost of protein purification. It also allows the purification of
proteins that are normally found at very low levels in the cells of interest.
We will approach this problem in two phases. The first will be construction of a
recombinant plasmid designed for expressing a fusion protein at high levels in E.
coli. The second phase will be to purify and analyze the recombinant protein.
pGEX Vector
There are a wide variety of plasmid vectors that have been engineered for
expression of recombinant proteins in E. coli. We will use a vector called pGEX that
was developed by Amersham (see map on the next page). The protocols used are
based on those of the manufacturer. The key features of this vector are:
1.
an origin of replication (derived from pBR322)
2.
an ampicillin resistance gene for selection of transformants
3.
a lacIq gene ,which codes for the lac repressor protein
4.
tac promoter , a derivative of the lac promoter. Thus, expression of

the GST fusion protein can be induced by addition of IPTG.
5.
glutathione S-transferase (GST) coding sequence immediately

downstream of the tac promoter
6.
a multiple cloning site at the 3 end of the GST sequence to allow inframe cloning of the cDNA for the gene of interest
7.
Spring 2007
27
Thrombin cleavage site (Leu-Glu-Val-Leu-Phe-Gln-Gly-Pro) between

the GST and polylinker to allow cleavage of the GST portion of the
fusion protein.
The first two features origin of replication and an ampicillin-resistance gene are
also present in plasmid cloning vectors used for routine cloning of DNA fragments.
Other aspects of this vector will be explained as we go along with the experiment.
Spring 2007
28
Drosophila msrB Gene

We will construct pGEX recombinant plasmids for overexpression of the msrB gene
from Drosophila. This gene codes for one of several enzymes called methionine
sulfoxide reductases. Their function is to repair methionine residues in proteins
that have been damaged by oxidation to methionine sulfoxide. At this stage of the
project, it is not critical that you understand the enzymatic and biochemical
properties of these proteins.
Construction of the recombinant expression vector will require nine steps:
1.
Preparation of the pGEX plasmid vector
2.
PCR amplification of Drosophila msrB coding sequence
3.
Digestion of the pGEX and msrB DNA with EcoRI and XhoI.
4.
Dephosphorylation of the digested pGEX DNA with alkaline phosphatase.
5.
Analysis of DNA by agarose gel electrophoresis.
6.
Ligation of the pGEX DNA with msrB fragment.
7.
Preparation of competent E. coli (strain XLI-Blue II) for transformation.
8.
Transformation of XLI-Blue II cells with the ligated pGEX/msrB DNA.
9.
Analysis of transformants.
A. Isolation of pGEX plasmid DNA

Overview
Bacterial cells containing the pGEX plasmid are lysed in an alkaline detergent
solution. Addition of potassium acetate at low pH causes the proteins, cell wall
fragments, and chromosomal DNA to precipitate. After centrifugation, the
supernatant primarily contains bacterial RNA and the plasmid DNA, which is
precipitated in the presence of ethanol.
Materials and Reagents
Solution 1
Solution 2
Solution 3
Solution 4
Solution 5
Solution 6
10mM EDTA, 25mM TrisHCl, pH 8.0

0.2N NaOH and 1% SDS
3M potassium acetate, pH 4.8
phenol/chloroform (1:1)
chloroform (100%)
ethanol (100%)
Spring 2007
29
Micropipetters and tips

Microcentrifuge
Waste containers
Experimental Procedure
Know where your plasmid DNA is at all times!
E. coli plasmid mini prep
1. Obtain one tube each of phenol/chloroform (Solution 4), chloroform (Solution
5), and ethanol (Solution 6). Label them with your name.
2. Obtain a tube with 1.5 ml of the E. coli cell culture that you are going to use for
your plasmid DNA isolation. Collect the cells by centrifugation at 6,000 rpm for
1 minute.
3. Remove all liquid using a micropipetter and add 150l of Solution 1. Vortex
vigorously to resuspend the cell pellet.
4. Add 150l of Solution 2. Vortex until solution becomes almost transparent and
viscous (due to denatured genomic DNA). Do not leave the sample in this
alkaline solution for more than 3 minutes.
5. Add 150l Solution 3, vortex for 10 seconds.
6. Add 250l of water saturated phenol/chloroform (pH. 7.5). Use the entire
amount that we provide in tube (Solution 4). Tightly close the tube; squeeze the
tube between your fingers and shake vigorously for 20 seconds. Then centrifuge
for 1 minute at highest speed (12,000 rpm).
Two layers and a white interphase will form, which contains most of the
cellular protein, cell wall debris and the genomic DNA. The top layer
contains the plasmid DNA and bacterial RNA. The bottom layer contains
the phenol/chloroform.
7. Use a 200l pipetter and carefully transfer the top layer into your tube
(Solution 5) containing 250l of chloroform. Tip the tube to the side when the
top phase gets low to avoid removing white interphase material. Tightly close
the tube. Shake vigorously for 20 seconds and centrifuge for 1 minute in the
microcentrifuge.
8.
Use a micropipette to transfer the top layer to your final tube containing 820l
of ethanol (Solution 6). Avoid transferring any material from the interphase
or bottom layer. Close tube and invert twice. Placed tube in the centrifuge with
Spring 2007
30
the hinge of the cap up. The pellet will form at the bottom directly below the
hinge. Centrifuge at full speed for 8 minutes.
9.
Remove the ethanol with a 1 ml pipetter. Quick spin (centrifuge) for 10 seconds
to collect residual ethanol from the tube wall. Remove remaining ethanol and
resuspend pellet in 20l of NanoPure water. Clearly label the microcentrifuge
tube with your name before giving it to your teaching assistant. The tubes will
be stored at 4C until needed.
B. PCR amplification of msrB Open Reading Frame (ORF)

Background
As the name polymerase chain reaction indicates, PCR is a method to
exponentially amplify large amounts of a DNA fragment from a very small amount
of template. PCR consists of multiple cycles of DNA synthesis. The steps of a PCR
cycle are:
Step 1.
Denaturation of DNA by heating at 94C for 20 seconds
Step 2.
Annealing of primers at primer specific temperature (usually

between 37-68C, see calculation of annealing temperature below) for
30 seconds
Step 3.
Amplification of DNA at 68C (depending on the polymerase) for 30

seconds to 25 minutes (depending on the length of the fragment and
speed of polymerase)
Step 4.
Repeat (steps 1-3) 15-60 times (depending on amount of template and

desired yield).
Step5.
Cool down to 4C until removal from PCR machine.
Important information
Step 1.
It is recommended to denature the DNA for an additional 1-2 minutes

at 94C at the beginning of the first cycle.
Step 2.
The annealing temperature depends on the base content and length

of the primer pair. In general, we prefer to use primers that are 1622 nucleotides in length with a calculated annealing
temperature of 55-65C. There are several formulas to calculate the
primer annealing temperature. A simple formula adds the
temperature of individual nucleotides using A+T=2C, G+C=4C
and subtracts 4C from the total. If the two primers have different
annealing temperature, we have to use the lower one. However,
because of potential false priming, we want to avoid primer pairs with
annealing temperatures that differ more than 5C.
Step 3.
Spring 2007
31
The breakthrough of PCR came with the isolation of DNA

polymerases from thermophilic bacteria that are heat
resistant. Thus, they survive temperatures required for DNA
denaturation. DNA polymerases from different bacteria differ in speed
and accuracy of DNA synthesis. The fastest DNA polymerases
amplify about 1kb in 1 minute. Thus, a 3kb fragment requires at
least 3 minutes. Fragments larger than 5kb may require additional
time. Most DNA polymerases are more accurate but less efficient at
68C than at 72C.
Designing msrB PCR Primers for Cloning into the pGEX Vector
PCR primers are complementary to the end-points of the to be amplified
DNA sequence. They provide the necessary 3 end for the DNA polymerase to start.
As long as we maintain a perfect complementary stretch of about 12-16
nucleotides at the 3 end of the primer, we can also introduce noncomplementary sequences of any length at the 5 end of the primer without
compromising annealing to the template DNA and amplification by the DNA
polymerase.
To overexpress the msrB gene of Drosophila, we will use the pGEX-4T-2
vector. We will clone the open-reading frame (ORF = protein coding sequence) of the
msrB gene into the EcoRI site at the 5 end and an XhoI site at the 3 end of pGEX4T-2 vector (see figure below).
Important point: The gene of interest is being cloned as a fusion protein. We have to
design the 5 primer so that the correct reading frame is maintained.
Design of the 5 primer calculation of the annealing temperature
The sequence of the msrB gene upstream of the ATG start codon was altered into an
EcoRI site (GAATTC) to fit the coding frame before the EcoRI site of pGEX-4T2.
Actual msrB sequence
5 primer
5-CCAGCAGCGACTATGGATAACAAGAGCGAGAAG-3
5-CCAGGAATTCTTATGGATAACAAGAGCGAGAAG-3
After ligation, the fused sequence will read

5-GGA TCC CCA GGA ATT CTT ATG GAT AAC AAG AGC GAG AAG-3.
Spring 2007
32
The sequence to the left of the EcoRI site (GAATTC) is from the pGEX-4T-2 vector,
the sequence to the right from the msrB PCR fragment. At the amino acid level, the
fusion sequences after thrombin cleavage site reads Gly Ser Pro Gly Ile Leu Met.
Calculation of the annealing temperature
The primer and original sequence only share 5-TATGGATAACAAGAGCGAGAAG-3.
Thus, the nucleotides of the primer in front of this sequence do not contribute to
base pairing and the annealing temperature for this primer calculates:
(10{A}+3{T}) x 2C + (2{C}+7{G}) x 4C 4C = 26C + 36C 4C = 58C
Design of the 3 primer calculation of the annealing temperature
The sequence of the msrB gene downstream of the TGA stop codon (blue) was
altered into an XhoI site (CTCGAG) that can be used for cloning into the XhoI site
of pGEX-4T2.
Actual msrB sequence
complementary
5GCCCATTGCCCAGCAGTGATGCCGAGGATC 3
3CGGGTAACGGGTCGTCACTACGGCTCCTAG 5
complementary
5 primer
5- GATCCTCGGCATCACTGCTGGGCAATGGGC-3
5-GATCCTCGAG ATCACTGCTGGGCAATGGGC -3
After ligation, the fused sequence will read

5-GCCCATTGCCCAGCAGTGATCTCGAGCGGCCGCATCGTGA-3.
The sequence to the left of the XhoI site (CTCGAG) is from the msrB PCR fragment.
The altered primer sequence is underlined. Note that the sequence shows the
complementary strand in the direction of the open reading frame. The sequence
to the right of the XhoI site is from the pGEX-4T-2 vector. Since the stop codon is
upstream (to the left of the sequence), the frame is irrelevant.
Calculation of the annealing temperature
The homology to the original sequence is only 5-ATCACTGCTGGGCAATGGGC-3.
Thus, the nucleotides of the primer in front of this sequence do not contribute to
base pairing and the annealing temperature for this primer calculates:
(4{A}+4{T}) x 2C + (5{C}+7{G}) x 4C 4C = 16C + 48C 4C = 60C
The annealing temperature of our 5 primer is 58C, while the 3primer is 60C.
Thus, if we want to use these primers as a pair, we have to use the lower
annealing temperature of 58C.
Spring 2007
33
Amplification of the msrB coding region

Materials
Microcentrifuge tubes for PCR thermal cycler (200l)

2X PCR mix (contains the Taq polymerase and dNTPs in the requisite buffer)
PCR thermal cycler
p10 micropipetters with tips
Ice buckets with ice
msrB cDNA fragment
EcoRI and XhoI primers for msrB open reading frame
Procedure
Set up the following reaction in a 200l tube on ice:
15l of 2X PCR Mix
5l
of msrB cDNA
10l of primer mix (10 pmol of each primer, 0.3 M final concentration)
PCR amplification conditions
Step 1.
1 minute at 94 C
Step 2.
20 seconds at 94C
Step 3.
30 seconds at 52C (as calculated on the previous page)
Step 4.
1 minute at 68C (the expected fragment is about 750 bp long)
Step 5.
repeat for 40 cycles
Step 6.
hold temperature at 4C.
C. Digestion of pGEX
Materials
Micropipetters
Water (NanoPure)
10 X Reaction Buffer (compatible with both EcoRI and XhoI)
XhoI enzyme
EcoRI enzyme
RNAse A
TempBlock at 37C
Spring 2007
Ice
pGEX plasmid DNA (prepared previously)
Procedure
Assemble the following solutions in a clean microcentrifuge tube:
25 l of dH2O
10 l of pGEX plasmid DNA
4 l of your 10x Reaction buffer
1 l of EcoRI (10u),
1l of XhoI (10u)
1l of RNAseA (0.2g)
Incubate at 37C for 4 hours.
Store at 20C until the next lab period.
D. Digestion of the msrB PCR fragment

We amplified the Drosophila msrB protein coding sequence in a volume of 30 l.
Now we have to generate the sticky EcoRI and XhoI overhangs for ligation into
pGEX.
Materials
Micropipetters
Water (NanoPure)
10 X Reaction Buffer (compatible with both EcoRI and XhoI)
XhoI enzyme
EcoRI enzyme
RNAse A
TempBlock at 37C
Ice
Procedure
1. Assemble the following solution in a clean microcentrifuge tube:
30 l of PCR (MsrB cDNA) sample
5 l of H2O
4 l of 10X Reaction Buffer (suitable for both enzymes)
1 l of a mixture of EcoRI and XhoI mix (5u each)
2. Incubate at 37C for 1-4 hours.
34
Spring 2007
35
3. Store at 20C until the next lab period.
E. Dephosphorylation of pGEX
In the last lab period, we digested the pGEX vector with EcoRI and XhoI and froze
the samples. To avoid any self-ligation, we will treat the vector with alkaline
phosphatase, which will remove the phosphate groups at the 5 ends of the
digested vector fragment.
Materials
Micropipetters
Water (NanoPure)
10X Alkaline Phosphatase Buffer
Alkaline phosphatase (1 unit/l)
Microcentrifuge tube with 100l phenol: chloroform mixture
Microcentrifuge tube with 100l chloroform
3M sodium acetate (NaOAc)
Ethanol
TempBlock at 37C
Ice
Procedure
1.
2.
3.
4.
5.
6.
Defrost the samples at 37C for 15 minutes.

Add 5 l of 10x Alkaline Phosphatase buffer.
Add 5 l of Alkaline Phosphatase (1u/l).
Incubate at 37C for 30 minutes.
Add 50 l of dH2O.
Transfer solution into a microcentrifuge tube with 100 l of
phenol/chloroform.
7. Shake and centrifuge for 1 minute at 12,000 rpm.
8. Transfer aqueous layer into a microcentrifuge tube with 100 l of chloroform.
9. Shake and centrifuge for 1 minute at 12,000 rpm.
10. Transfer aqueous layer into tube with 7 l of 3M NaOAc and 250 l of
ethanol.
11. Invert twice and centrifuge for 10 minute at 12,000 rpm.
12. Remove supernatant with the 1 ml pipetter, quick spin and remove
remaining solution with the 200l pipetter.
13. Dissolve pellet in 10 l of dH2O and store labeled tube at 20C.
Spring 2007
36
F. Preparation of a 2% agarose gel for electroelution of the MsrB PCR

DNA
In the next lab period, we will separate the msrB PCR fragment from the primers
and the nucleotides using a procedure called electroelution. For that purpose, we
will prepare 50 ml of a 2% agarose gel in 1x TAE final concentration. Use the larger
gel combs to create larger wells in the gel. This will make handling the gel fragment
easier during subsequent steps following electrophoresis. Alternatively, you can use
Scotch tape with a regular gel comb to create a long well in the gel. After melting
the agarose in the microwave, allow it to cool to a manageable temperature (~5055C). Add 1 l of ethidium bromide (10 mg/ml, careful, carcinogenic!), mix and
pour the gel in the gel box.
Important information: The msrB fragment is approximately 500 bp long. As a rule,
fragments larger than 1kb can be isolated with a 0.7 % gel. Fragments smaller than
1kb are isolated in higher percent gels (1-4%, depending on the size).
Avoid one major mistake: Never make a gel with water instead of TAE or TBE!
G. Gel isolation of the msrB PCR fragment and preparation of an

agarose gel
Objective
We will gel-isolate the digested msrB PCR fragment. In the next lab period, we will
analyze a sample of the isolated pGEX and msrB DNA samples using agarose gel
electrophoresis to estimate the amount required for ligation.
Materials
Gel electrophoresis units with power supply

Agarose and 2% agarose gels from previous lab period
20x TAE Buffer
10x DNA loading dye with bromophenol blue
1 kb DNA marker (optional)
Ethidium bromide (10 g/l)
Gloves
Saran Wrap
VersaDoc3000 Digital Gel Documentation Apparatus
UV-transilluminator box
Safety face shield
Razor blades
Blunt-end forceps
Dialysis tubing with clamps
Tubes with 350 l of 1xTAE
Spring 2007
37
Tubes with 250 l of phenol/chloroform

Tubes with 250 l of chloroform
Tubes with 25 l of sodium acetate and 1 ml of ethanol
Procedure
1. During the previous lab period, we digested the msrB PCR fragment with a
combination of EcoRI and XhoI and prepared a 2% agarose gel.
2. Place the gel in gel box and cover with approximately 300 ml of 1x TAE running
buffer.
3. Add the appropriate volume of 10X bromophenol blue loading dye, mix, and load
the entire PCR sample into the wide slot on the gel.
4. For some experiments, it is helpful to include DNA size markers. You will be told
if they are needed for this experiment.
5. Run the gel at 100-140V for ~30 minutes. While waiting, each bench will prepare
50 ml of a 1.5% TAE-agarose gel. Melt the agarose in the microwave. After
cooling, add 1 l of 10mg/ml ethidium bromide to your gel and pour into the gel
box.
6. Label a microcentrifuge tube with your name. While wearing gloves, remove the
gel with the PCR fragment from the gel box and place on a piece of Saran Wrap.
Do not remove the TAE solution from the gel box!
7. Remove glove and transfer gel on the Saran
Wrap to the Digital Gel Documentation
apparatus for photographing. Alternatively,
the gel can be photographed in the lab with
the Polaroid camera.
The figure to the right shows the
separation of a 1 kb DNA ladder

on a 0.7% agarose gel. If you used
these DNA size markers on your
gel, does the separation look
different on your 2% gel?
8. Transfer the gel on the Saran Wrap to the

UV-light box. Wear a face-shield. Use a razor
blade to cut the msrB band out of the gel and
a blunt-end forceps to transfer it into the
labeled microcentrifuge tube.
Spring 2007
38
9. Wear gloves for this step. Remove one piece of dialysis tubing from the beaker.
Put a clamp on one end. Do not leave extra tubing at the end as shown in
the picture on the next page! Use a blunt-end forceps to transfer the agarose
fragment from the tube to the inside of the tubing.
10. Add 350 l of 1X TAE to the tubing.
11. Remove any air bubbles and attach a clamp on the other end. Place the dialysis
bag into the gel box. The fragment should not float! It should be completely
covered with buffer! You should be able to place up to four fragments per gel
box.
12. We will transfer the msrB DNA from the agarose gel fragment to the buffer in
the dialysis tubing by electrophoresis at 140V for ~20 minutes. You can monitor
the movement of the DNA fragment out of the gel slice using a handheld UV
lamp.
You will not lose your DNA when it leaves the gel slice. The DNA is too large
to pass through the pores of the dialysis tubing.
13. After 20 minutes, stop the electrophoresis. Obtain one tube with
phenol/chloroform, chloroform, and ethanol and label them. Remove one clamp
Spring 2007
39
and carefully transfer all the solution from the dialysis bag into the tube with
250 l of phenol/chloroform.
Be very careful when transferring the buffer with a pipette. If you spill
the contents of the dialysis bag, your MsrB DNA is gone!
14. Vortex the tube for the 30 sec and then centrifuge for 1 minute at 12,000 rpm.
15. Transfer aqueous layer into a microcentrifuge tube with 250 l of chloroform.
16. Vortex the tube for the 30 sec and then centrifuge for 1 minute at 12,000 rpm.
17. Transfer aqueous layer into tube with 250l of 3M sodium acetate and 1 ml of
ethanol.
18. Invert twice and store at 20C until the next lab period.
H. Analysis and ligation of pGEX and msrB DNA fragments

Objectives
a.
Determine the concentration of pGEX vector DNA and MsrB cDNA in your
samples.
b.
Assemble a ligation reaction to create the recombinant pGEX/MsrB plasmid
DNA
Materials
pGEX plasmid DNA digested with EcoRI and XhoI and dephosphorylated
MsrB cDNA digested with EcoRI and XhoI followed by gel purification
1.5% agarose gel prepared during the previous lab period
Micropipetters
Water (NanoPure)
10X Bromophenol Blue DNA Gel Buffer
10X DNA Ligase Buffer
DNA Ligase
1 Kb DNA Size Ladder (or other appropriate size markers)
Procedure
1.
Obtain the tube with the gel-isolated msrB fragment in ethanol and
centrifuge for 10 minute at 12,000 rpm.
2.
Carefully remove supernatant with the 1 ml pipetter, quick spin and remove
remaining solution with the 200l pipetter.
3.
Dissolve pellet in 20 l of dH2O.
Spring 2007
40
4.
Clearly label the tube. This is the MsrB cDNA.
5.
Obtain your personal tube with the digested pGEX vector.
6.
Obtain two clean microcentrifuge tubes. Add 11.5l water and 1.5l 10X DNA
Sample buffer to each tube.
7.
Add 2 l of your pGEX DNA to one tube and 2l MsrB cDNA to the other
tube.
8.
The TAs will coordinate loading the gel samples. DNA size markers (e.g. 1Kb
DNA ladder) should be loaded in lane 1. Each students samples should be
loaded in adjacent lanes.
7.
Run the gel at 140V for 30 minutes.
8.
Wearing gloves remove the gel and place on a piece of Saran Wrap.
9.
Remove your gloves and transfer the gel on the Saran Wrap to the Digital Gel
Documentation apparatus. Take a picture of the gel and estimate DNA
amount of 1 l. Alternatively, the gel can be photographed with the Polaroid
camera in the lab.
Ligation of the msrB coding sequence into pGEX

For efficient ligation and transformation, we need approximately 200ng of vector
and 500ng of insert.
1.
Add _____ l of dH2O
2.
Add _____ l of pGEX
3.
Add _____ l of msrB
4.
Add
l of 10x Ligase buffer
5.
Add 1 l of Ligase (3u)
______________________________
10 l total volume
Incubate at room temperature over night. Store at 20C until transformation.
Spring 2007
41
I. Digestion of Ligation Products with SalI

As discussed previously, we want to minimize the number of nonrecombinant
(vector only) clones to increase our chances of recovering the desired MsrB/pGEX
recombinant clone. The pGEX vector does not utilize the blue-white selection for
recombinant clones or other readily discernible phenotype. We will have to screen
numerous clones for the MsrB/pGEX clone if a significant fraction of the clones only
contain the pGEX vector.
Linear DNA molecules are very poor substrates for transformation of E. coli.
Therefore, we can reduce the number of nonrecombinant clones by digesting with a
restriction enzyme that does not cleave the desired recombinant clone. We
cleaved the pGEX vector with EcoRI and XhoI. The recombinant clone will lack the
DNA sequences between these two restriction sites, which include the SalI and
SmaI sites in the polylinker (see the figure on pg. 34). The MsrB cDNA does not
contain either a SalI or SmaI restriction site based on the sequence of the cDNA in
the GenBank DNA database. Therefore, digestion of the ligation reaction with
either SalI or SmaI should linearize any pGEX vector molecules, but not cleave the
desired MsrB/pGEX recombinant clone. This digestion step should significantly
reduce the background of nonrecombinant clones following transformation.
Materials
Micropipetters
Water (NanoPure)
10X SalI Reaction Buffer
SalI enzyme
TempBlock at 37C
Ice
Ligation reaction from the previous lab
7.5M ammonium acetate
200mM EDTA
Ethanol
Procedure
1. Assemble the following solutions in a clean microcentrifuge tube:
20l ligation reaction
68l water
10 l of 10X SalI Reaction buffer
2l of SalI (20 Units),
2. Incubate at 37C for 60 min.
Spring 2007
3.
After the incubation, add:

5l 200mM EDTA
50l 7.5M ammonium acetate
300l ethanol
4.
Close the microcentrifuge tube securely and vortex for a few seconds.
5.
Label the tube clearly before giving it to the teaching assistant.
6.
Your sample will be stored at -20C until the next lab period.
42
At the beginning of the next lab period,

1. Centrifuge your sample at maximum speed for 20 min.
2. Remove the ethanol supernatant and centrifuge again for a few seconds.
3. Remove the remaining traces of supernatant with a micropipetter.
4. Allow the sample to air dry for a few minutes.
5. Resuspend the pellet in 20l water.
J. Preparation of electrocompetent cells and plasmid

transformation by electroporation
Background
In the Biotechnology I lab, we prepared competent E. coli for transformation
by treating the cells with ice-cold calcium chloride. For this experiment, we will use
electroporation for transformation, which is reported to be 10 to 1,000-fold more
efficient. The principle is to use a brief (milliseconds; msec) high voltage (~1,0002,500 V) pulse to create transient pores in the membrane that make the cell
permeable to macromolecules such as DNA. The technique can also be used to
introduce RNA, proteins, and dyes. It can be adapted for use with almost any type
of cell bacterial, fungal, plant, or animal.
The length and voltage of the pulse must be optimized for each cell type. If
the conditions are not excessive, the pores reseal and the cell survives. If the voltage
and/or pulse are too great, the cells will die due to irreversible damage to the cell
membrane. Two other important parameters are the ionic strength of the
surrounding cell medium and the cell density. The ionic strength of the solution
Spring 2007
43
determines the electrical current. We will wash our cells several times in sterile
water to reduce the conductivity of the cell medium. If the ionic concentration is too
high, the cells will be electrocuted and die. In the end, we will concentrate the E.
coli cells to about 1011 cells/ml. We will apply a field of 1.2 kV within a cuvette that
is 10 mm wide.
Materials
E. coli cells (strain XL1-Blue)
Ice buckets
Ice cold sterile water
Recombinant DNA from ligation reaction
Electroporation cuvettes one per student
Electroporation apparatus
Temp-Block at 37C
Small culture tubes containing 2ml LB medium one per three students
LB plates with ampicillin one per student
Glass rods and ethanol for spreading cells
Preparation of electro-competent cells
Strain XL1-Blue was grown to saturation overnight. The cells were then diluted
1:100 into fresh LB medium and grown with vigorous shaking to an OD600 = 0.8.
1.
Transfer 6 ml of E. coli cells into four labeled microcentrifuge tubes.
2.
Harvest the cells by centrifugation at 6,000 rpm for 2 minutes.
3.
Remove the supernatant with a 1 ml pipetter.
4.
Use a 1 ml pipetter to resuspend (wash) the cells in 1ml ice-cold sterile

water.
5.
Centrifuge at 6,000 rpm for 2 minutes. If the supernatant is turbid,

centrifuge again.
Keep the cells on ice as much as possible.
44
Spring 2007
Caution: The cell pellet may not adhere well to the tube.
6.
Carefully remove the supernatant and then resuspend each cell pellet in 250
l of ice-cold water. Combine all of the cells into one microcentrifuge tube.
7.
Centrifuge the tube at 6,000 rpm for 2 minutes. Centrifuge again if

necessary.
8.
Remove supernatant with a 1 ml pipetter. Quick-spin, remove the remaining

solution with a 200 l pipetter, and resuspend the cell pellet in 50 l of
sterile water.
If you prepare multiple samples of cells and you want to freeze them,
resuspend the pellet in 50 l of ice-cold 15% glycerol.
The cell density of E. coli at 1.0 O.D. is ~10
cells/ml. What is the estimated

cell density of the 50 l of cells? How close did you get to the target of 1011
cells/ml if the initial culture had OD = 0.8?
Electroporation
1.
Add 3l of your ligated DNA to the cells. Mix by gently pipetting up and down.
2.
Transfer the cells into a 10 mm electroporation cuvette. Gently tap the cuvette
to remove potential air bubbles.
3.
Transfer the cuvette into the electroporation chamber and slide it in all the
way.
4.
Press both buttons of the electroporator set at 1.2 KV. After a few seconds, you
will hear a beep.
5.
Remove cuvette, add 500 l of LB, and transfer with special tip into
microcentrifuge tube.
6.
Incubate tube at 37C for 30-60 minutes.
7.
After 30-60 minutes, spread 200l of the transformed cells onto labeled LB-Amp
plate.
8.
Incubated the plate at 37C overnight. The next day, the plates are stored at 4C
until needed.
Spring 2007
45
K. Toothpick PCR analysis of recombinant DNA

Introduction
The traditional method to determine whether you were successful with your DNA
construction project would be to make a mini-prep of plasmid DNA, digest with the
appropriate restriction enzymes followed by gel electrophoresis.
We will try a sensitive technique using PCR to analyze the DNA using only a few
cells collected on the end of a toothpick. The cells will be suspended in a PCR
reaction. When the sample is heated to 94C to denature the DNA, the bacterial
cells lyse, making the plasmid DNA available to serve as a template for PCR. The
primers are ones used to make the MsrB cDNA. Therefore, the PCR will only
generate the corresponding amplicon if the recombinant pGEX vector contains the
MsrA cDNA.
Materials
Plates with your transformants
PCR Master Mix containing both MsrB cDNA primers
NanoPure water
Ice buckets with ice
Sterile toothpicks
Micropipetters with tips p10 and p100
200l tubes for the PCR thermal cycler
PCR thermal cycler
Procedure
1.
Add 100l water to a microcentrifuge tube.
2.
Select a well-isolated transformant. Touch the colony with the tip of a sterile
toothpick
Do not pick up a glob of cells. Touching the colony is sufficient,

even though you dont see cells on the end of the toothpick.
3.
Twirl the end of the toothpick directly in 100l water to dislodge the cells.
4.
Repeat the process with up to 10 transformants using the same tube of water.
Rationale: This is a process called sib selection. If at least one of your
transformants is the desired pGEX/MsrB recombinant plasmid, there will be

sufficient DNA to generate the MsrB PCR product. If you carefully labeled
Spring 2007
46
the clones that you selected, you could then individually analyze each of the
clones to find the one (or more) containing the pGEX/MsrB clone.
5.
Vortex briefly to mix the cells.
7.
Transfer 5l of the cell mixture to 200l PCR tube.
8.
Add 20l PCR Master Mix to a 200l PCR tube. Note the number on the tube
to identify your sample.
The PCR Master Mix contains the 5 and 3 primers for the MsrB cDNA
and the Taq Polymerase in the appropriate buffer.
8.
Place the tube in the PCR thermal cycler. The PCR amplification conditions
are 5 min @ 94 C, 35 cycles of 1 min @ 94C, 2 min at 55C and 3 min at
72C followed by 10 min at 72C and then hold at 4C.
9.
Prepare a 2.0% agarose gel that will be used to analyze the PCR products
during the next lab.
L. Gel electrophoresis of PCR products

Materials
Tube containing your PCR products
10X DNA Sample Buffer
100bp DNA ladder for molecular size markers
2.0% agarose gel, which was cast during a previous lab meeting
Electrophoresis apparatus
Power supply with leads
20X TAE buffer (student prepared)
Water
500ml-flask
Graduated cylinder
Procedure
1.
Add 5l DNA Sample Buffer to your PCR DNA sample.
2.
Prepare 250ml 1X TAE Buffer using your 20X TAE Buffer stock.
3.
Carefully place the gel tray with the agarose gel into the electrophoresis unit
with the open ends of the gel tray oriented toward the electrodes.
4.
Add 1X TAE Buffer until the gel is covered with 2-3mm of buffer.
Spring 2007
47
5.
Load the 100bp ladder size markers into Lane 1 (left side with wells oriented
to the top).
6.
Load your pGEX DNA sample, noting which lane has your sample. You may
use all of the PCR sample if you wish
7.
Run the gel at 100-40V until the bromophenol blue tracking dye is a few cm
from the bottom of the gel.
8.
Photograph the gel with either the Polaroid camera or the VersaDoc Digital
Imaging System
Spring 2007
48
Experiment 3
Overexpression, Isolation, and Characterization of a
Recombinant Fusion Protein in E. coli
Overview
In the previous experiment, we cloned the open-reading frame (ORF) of the msrB gene
from Drosophila into the pGEX plasmid vector. In Experiment 3, we will overexpress and
affinity-purify a Glutathione S-transferase (GST)MsrA fusion protein. In this experiment, we
will perform the following assays:
1.
We will overexpress the GST- MsrA protein in E. coli
2.
We will measure total protein concentrations with the Bradford Assay.
3.
We will isolate GST- MsrA by polyacrylamide gel electrophoresis (PAGE).
4.
We will transfer proteins from gels to PVDF membranes and use

immunochemical reagents (antibodies) to detect the GST- MsrA protein
(Western Blotting).
5.
We will affinity purify the GST- MsrA fusion protein.
6.
We will test the activity of the purified GST- MsrA protein with an enzymatic
assay.
Part A - Bradford assay to measure protein concentration

Background
We will need to determine the concentration of protein samples at several steps during
the purification process. Marion Bradford developed a simple and rapid procedure for
determining protein concentrations in a solution (Bradford, Anal. Biochem. 72: 248, 1976). This
method is based upon the change in absorbance in the dye Coomassie Blue G-250 upon binding
of protein. Thus, the protein concentration can be determined by measuring the absorbance of
the solution at 595 nm in the photospectrometer. There are other methods to determine protein
concentration (e.g. Lowry procedure). However, the Bradford method is the most widely used.
We will make a standard curve using protein samples of known concentrations, which
can be used to determine the unknown concentrations of our protein samples in the future. As for
lany measurements using the photospectrometer, there is only a linear correlation within O.D.
readings between 0.1-0.8. Thus, the amount of protein in this assay has to be sufficient to
fall within this range! Concentration is defined as the amount per defined volume. Notice that
the x-axis of the graph is the amount of protein (within the defined volume of the assay, in our
case 1 ml). Thus, the protein concentration is the amount of protein (x-axis) per l of
protein added to the assay (diluted in 1 ml). To obtain higher readings, you can add a larger
volume (more l) of a protein solution to this assay. Of course, the protein concentration of your
sample stays the same, since the higher amount of protein is divided by the increased volume.
49
Spring 2007
Materials
5X Bradford reagent
Samples of known protein concentrations (bovine serum albumin,
BSA) one set per group of three students
Sample of BSA with unknown concentration
Water (blank)
Spectrophotometer
Plastic cuvettes
Procedure
1.
Obtain a set of protein standards containing 0, 2, 4, 6, 8, 10, and 12 g of BSA

in 800 l of water.
2.
Each student will receive a numbered tube containing a protein of an

unknown concentration.
3.
Prior to reading the absorbance in the spectrophotometer add 200l 5X

Bradford reagent to each tube and mix thoroughly (1 ml total assay volume).
4.
Wait at least 5 min before reading the absorbance at 595nm. The color
development is usually stable for up to an hour.
To determine the base line (zero) of your spectrophotometer
measurements, use 800l of water (0 g BSA) and 200l of 5x Bradford

Reagent.
5.
Record the O.D. readings in Table1.
Table 1. O.D. readings of known standard protein concentrations.

Amount of protein
6.
OD595
Amount of protein
0 g
8 g
2 g
10 g
4 g
12 g
6 g
? g
OD595
Use the data of Table 1 to draw a Bradford standard curve on the graph on
the next page).
7.
50
Spring 2007
Use the standard curve to determine the concentration of your unknown

sample. Provide this information to the teaching assistant for grading.
Bradford standard curve for determination of protein

concentration
0.7
0.6
0.5
0.4
OD595
0.3
0.2
0.1
0
10
12
Protein (g)
Part B - Induction of GST-MsrA protein synthesis in E. coli

The following procedure was started the previous evening (step 1). Early in the
morning, the cells were inoculated (step 2) and induced for 3 hours (step 4). We
continue now with step 5.
Procedure
1.
Grow an E. coli culture with the pGEX-msrA plasmid in 10 ml of LB-Amp

(100 g/ml).
2.
Inoculate a one-liter LB-Amp (100g/ml) culture with the 10 ml overnight

culture.
3.
Grow cells to a log phase of about O.D.600 = 0.7.
4.
Transfer 100 ml of culture into a separate sterile flask. This will be our uninduced control of E. coli proteins. To the remaining 900 ml, add IPTG (0.5
mM final concentration) to induce expression of the msrA gene.
Spring 2007
51
5.
After 3 hours, harvest the cells by centrifugation at 5,000 rpm for 15 minutes
at 4C.
6.
Decant supernatant and resuspend the cells in 2 ml (uninduced) and 8 ml

(induced) of ice-cold Buffer A (50 mM TrisCl pH 7.5, 150 mM NaCl).
7.
Transfer aliquots of 2 ml each into 15 ml conical tubes (keep on ice). The cells
are lysed by sonication for 15 seconds in the cold room. Place on ice and
repeat sonication four times. In the last round, sonicate once for 60 seconds.
8.
Combine all aliquots and remove cellular debris by centrifugation for 30

minutes at 8,000 rpm. Transfer new aliquots of 1 ml each into
microcentrifuge tubes and store at 20C.
Part C - Bradford assay of E. coli protein extracts and SDSpolyacrylamide gels (PAGE)
Objective
We will run a polyacrylamide gel (PAGE) and perform a Western blot. To
perform this experiment, we have to know the appropriate protein concentrations of
the un-induced and induced protein samples. Each group of three students will
perform a Bradford assay of our un-induced and induced extracts. Since the
incubation time affects the absorbance, we have to measure again the standard
protein concentrations. Then we will discuss the use of polyacrylamide gels.
Procedure
Follow the Bradford assay protocol on page 49.
1.
Obtain a set of protein standards containing 2, 4, 6, 8, 10, and 12 g BSA/ 800

l water.
2.
Add 200l of 5X Bradford reagent and measure the O.D. at 595 nm.
Draw a standard curve.
3.
Dilute the protein samples of the un-induced and induced extracts 10-fold
(1:9).
4.
Measure the O.D. of 2 l undiluted and 1 and 5 l of the (1:9) diluted sample
in 800 l of water + 200 l of 5x Bradford.
5.
Record the O.D. readings in Table1 on the next page
6.
52
Spring 2007
Use the information of Table 1 to draw a Bradford standard curve onto the
graph on the next page.
Compare the standard curve with the one done previously (p. 50). Use the
standard curve to determine the amount of the three measurements and
consequently the concentration of your unknown sample. Which amount
provides the most accurate calculations to determine the actual protein
concentration? Discuss your reasoning with the teaching assistants.
Table 1. O.D. readings of protein concentrations.

Amount of protein
OD595
Amount of protein
0 g
? g/2l uninduced
2 g
? g/1l/10 uninduced
4 g
? g/5l/10 uninduced
6 g
8 g
10 g
12 g
? g/2l induced
? g/1l/10 induced
? g/5l/10 induced
OD595
53
Spring 2007
Bradford standard curve for determination of protein

concentration
0.7
0.6
0.5
0.4
OD595
0.3
0.2
0.1
0
10
12
Protein (g)
Polyacrylamide gels (PAGE)
In general, proteins are smaller than nucleotides. While a DNA base-pair
exhibits a molecular weight of approximately 650 daltons (Da), an amino acid is in
the range of about 120 Da. Therefore, it is necessary to use a more cross-linked
polymer with a smaller pore size than agarose to separate proteins (Fig. 1.5).
Polyacrylamide gels are physically tougher than agarose gels. The gel forms when
a mixed solution of acrylamide and cross-linker monomers co-polymerize into long
chains that are covalently cross-linked. The gel structure is held together by the
cross-linker (Fig 1.5b). The most common cross-linker is
N,N'-methylenebisacrylamide (bisacrylamide). The most common ratio for protein
gels is 29 parts acrylamide and 1 part bisacrylamide (29:1). There are two types of
protein gels: denaturing gels contain sodium dodecyl sulfate (SDS) that
disrupts protein folding. Denatured proteins run according to their molecular mass,
since the negative charges of SDS correlate with the size of the proteins. In addition
to SDS, the loading buffer (dye) for denaturing gels often contains 2mercaptoethanol, which reduces (breaks) covalent disulfide bonds. In contrast,
proteins run in native gels (no SDS) exhibit different electric charges and various
three-dimensional structures that affect their mobility within the gel. Therefore, it
is difficult to predict how proteins migrate on native gels.
Caution:
Spring 2007
54
non-polymerized
acrylamide is a strong
neurotoxin! Do not get
it on your skin! After
polymerization,
polyacrylamide is not
toxic and can be
discarded in the trash.
Polymerization of polyacrylamide gel

The free-radical polymerization of acrylamide gels can be initiated either by a
peroxide or by a photochemical method. The most common method uses
ammonium persulphate as the initiator peroxide and the quaternary amine,
N,N,N',N'-tetramethylethylenediamine (TEMED) as the catalyst. The amount of
TEMED determines how fast the polymerization will occur. The temperature of the
acrylamide solution also affects the speed of the polymerization reaction.
Stacking gels
The actual polyacrylamide gel typically consists of the bottom 2/3 of the gel.
The top 1/3 is a stacking gel that consists of a 2.5% acrylamide solution at a lower
pH of 6.8. Since polyacrylamide gels are vertical gel and exhibit long wells that can
be filled with more than 20 l of protein solution, protein molecules enter the gel at
different time points like in a marathon race, where the slower runners cross the
start line minutes after the actual start. The role to the stacking gel is to slow down
the protein molecules that enter first. Thus, the stacking gel has the effect of
concentrating the protein molecules in a defined band (rather than a smear).
Part D - Preparation of a 10% SDS-polyacrylamide gel (PAGE)

Materials
40% acrylamide/bisacrylamide solution (29:1)

1.5 M TrisCl, pH 8.8
1.0 M TrisCl, pH 6.8
20% SDS
Spring 2007
55
10% ammonium persulphate (APS) in water

TEMED (N,N,N',N'-tetramethylethylenediamine)
Water
Stock solutions:
10% separating gel
49.50 ml
25.00 ml
25.00 ml
0.50 ml
of deionized water
of 40% acrylamide/bisacrylamide (29:1)
of 1.5 M TrisCl, pH 8.8
of 20% SDS
2.5% stacking gel
68.25 ml
6.25 ml
25.00 ml
0.50 ml
of deionized water
of 40% acrylamide/bisacrylamide (29:1)
of 20% SDS
Procedure
Like agarose gels, small molecules separate better at higher concentrations.
In contrast, larger proteins separate better at low acrylamide concentrations. There
are commercially available pre-cast gradient gels that accommodate separation of
different size proteins. Gradient gels exhibit a higher acrylamide concentration on
the bottom (e.g. 15%) compared to the top (e.g. 5%). For proteins of a specific size,
we use 5% gels for very large proteins (>90 kDa), 10% for medium range proteins
(the majority of proteins, 40-90 kDa), 12% gels for small proteins (30-50 kDa), and
15% for very small proteins (10-40 kDa). Ready-to-use stock solutions of different
concentration and stacking gels are stable for about two months (gels) and several
months (stacking gels). To discard old stock solutions, simply polymerize the
solution with APS and TEMED.
Casting of a 10% acrylamide gel
1.
In a 100 ml beaker, add 4.6

ml of 10% acrylamide
solution.
2.
Add 46 l of 10% APS.
3.
Add 4.6 l of TEMED and

mix by gently swirling. The
polymerization reaction
now starts and you have to
cast the gel in the next 5
minutes. Make sure the gel
cast is ready before adding
the TEMED.
Spring 2007
56
4.
With a 1 ml pipetter, add the solution into the gel cast. Avoid adding air
bubbles when you eject the solution from the pipette tip.
5.
Using a 200l pipetter, add small drops of water on top of the gel. You want
to add about 0.5 cm of water to ensure a smooth straight gel surface (Fig.
1.6).
6.
Let the gel polymerize for 20-30 minutes. Do not move the gel cast during
this time.
7.
Take a Kim wipe, tilt the gel

cast and slowly remove the
overlaying water layer.
8.
Mix 2.6 ml of stacking

solution with 26 l of 10%
APS and 2.6 l of TEMED.
9.
With a 1 ml pipetter, add the

solution into the gel cast.
Avoid adding air bubbles
when ejecting the solution
from the pipette tip.
10.
Remove potential air bubbles

and carefully insert the comb
(Fig. 2.5).
11.
After 30 minutes of polymerization, the gel is ready for use. You can store the
gel for several days at 4C by placing a deionized water soaked Kim wipe on
the top of the gel and covering the gel cast with Saran wrap.
57
Spring 2007
Part E - PAGE electrophoresis and Western blotting (WB)

Materials
1x running buffer
4x loading dye
heat block set at 68C
1x blotting buffer
1x TTBS
PVDF membranes
Blotting paper
Stock solutions:
1x running buffer
Initially dissolve in
Add to a final volume of
60 g
288 g
20 g
1 liter
20 liter
of Tris base
of glycine
of SDS
of deionized water
of deionized water
0.8 g
of SDS (8% final concentration)
2.5 ml
2.0 ml
of 2-mercaptoethanol
4.0 ml
of glycerol
2.0 mg
of bromophenol blue dye (BPB)
Add deionized water to a final volume of
10.0 ml
4x loading dye
(with 2-mercaptoethanol)
58.13 g
of Tris base (480 mM).
29.30 g
of glycine (390 mM)
3.75 g
of SDS (0.375%)
Add deionized water to a final volume of
1 liter
10x blotting buffer
(with 2-mercaptoethanol)
1x blotting buffer
700 ml
100 ml
200 ml
of deionized water
of 10x blotting buffer
of methanol (20%)
8.0 g
NaCl (136 mM final)
0.2 g
KCl (2.7 mM final)
3.0 g
Tris base (25 mM final)
1ml
Tween20 (0.1% final)
Dissolve salts in 800 ml of deionized water, adjust with HCl to pH of 7.4, add 1 ml of
Tween20, and fill with water to 1 liter.
1x TTBS buffer
Spring 2007
58
Procedure
Loading and running of the gel
1.
Carefully remove comb from

the stacking gel (Fig. 2.6). Use
a Kim wipe to remove excess
acrylamide on top of the wells.
2.
Assemble the cast(s) in the gel

box. Remove the tape on the
bottom of the cast. The side of
the wells (lower side) has to
face to the inside.
3.
Carefully add 1x running

buffer to the inside and outside
reservoir. Fill buffer to a level higher than the wells (they are covered with
buffer).
4.
Defrost samples on ice. Add the appropriate amount of 4x loading dye to you
sample.
5.
Heat the samples (with the dye) for 2 minutes at 68C. Place on ice
6.
Using a gel loading tip (special long narrow tip) on a 10l pipetter, load 6l of
the rainbow marker into the first lane. Since you cannot see the wells very
well, slowly eject small amounts of the solution (Fig, 2.17). Once you can see
that you are adding the solution into the correct well, eject the remaining. If I
have two gels, I load the marker into the first well to the right of the front gel
and in the first well to the left of the back gel. Since the gels are reversed and
both face the inside reservoir, the marker is at the same position.
Important:
If you are in the process of
ejecting the solution of a
sample, never release the
pipetter and pipette in
reverse. Otherwise, you will
take up running buffer into
your tip, mix it with your
sample, and dilute (and ruin) it
in the process.
Spring 2007
59
7.
Once the marker is loaded, you can estimate the position of the next well for
loading your first sample.
8.
After all the samples are loaded, attach the top of the gel box and run the gel at
180 V for 60-80 minutes (run blue dye to the bottom of the gel).
Transfer of proteins to a PVDF membrane

For analysis based on antibody reactivity, the separated molecules need to be
free of the electrophoresis matrix. The most efficient method is transferring
(blotting) the proteins of the gel onto a membrane filter that binds the molecules as
they emerge. The proteins (or nucleic acids) stay predominantly on the surface of
the membrane, where they are accessible for detection. The membrane materials
used most frequently in blotting are nitrocellulose, various forms of modified and
unmodified nylon, and polyvinylidenedifluoride (PVDF). Since hydrophobic PVDF
membranes are more robust than nitrocellulose membranes and bind proteins very
well, they are most frequently used for
Western blotting. They also exhibit low
background and high resolution in
antibody reactions.
The transfer of the sample from the
gel to the membrane can be driven either
by capillary flow of buffer or by transverse
electrophoresis. The use of capillary flow
to transfer DNA from agarose gels to
nitrocellulose was first described by
Southern (1975), hence the name Southern
blot. Using the same method for transfer of
RNA is called Northern blotting, and any
blot transfer of proteins is called Western
blotting for simple playful consistency of
nomenclature. There are two commonly
used methods for protein transfers. The
first method sandwiches the gel with the
membrane between two pieces of foam and
transfers the proteins horizontally
submerged in transfer buffer (Fig. 1.9A).
This method is used for large quantities of
proteins and very large proteins. The more
frequently used method, the semi-dry
transfer, vertically transfers the proteins
to the membrane sandwiched between
soaked blotting papers that serve as small
reservoirs for the transfer buffer (Fig.
1.9B).
Spring 2007
60
Procedure
1.
Remove the gel from the gel box and disassemble the gel cast. It will stick to
one side.
2.
Remove the stacking gel with a Kim wipe.
3.
Cut an appropriate piece of PVDF membrane (same size as the gel) and wet it
with 100% methanol in a small container.
4.
Discard the methanol and cover the membrane with 1x blotting buffer
(containing 20% methanol). Submerge the hydrophobic membrane.
5.
Place the PVDF membrane onto the gel and cover it with blotting filter
membrane soaked in 1x blotting buffer.
6.
Invert the gel and carefully remove the gel from the cast with a blunt end
forceps.
7.
Place the half sandwich onto a piece of Saran wrap. Remove the bottom of the
gel with a cutting tool. Complete the sandwich by adding a soaked blotting
membrane on top. Check the orientation of the sandwich: filter paper
(bottom), PVDF membrane, gel, filter paper (top). Press
the sandwich from inside to the periphery to remove
possible trapped air bubbles.
8.
Transfer the sandwich to the middle of the transfer

chamber and add a few drops of transfer buffer. Close
the chamber.
9.
Blot (transfer) the proteins at 15 V for 60 minutes in

the transfer chamber.
10.
Remove and disassemble the sandwich. If the transfer

was successful, the Kaleidoscope marker has
transferred to the membrane. Submerge the PVDF
membrane in 5% fat-free milk solution in TTBS at
room temperature at 4C overnight or at least for one
hour.
The antibody reactions are discussed below. As a next step,

the membrane will be incubated with the primary antibody
for one hour at room temperature. In our case, we will use a
rabbit-raised anti-GST antibody at a 1:1000 dilution in TTBS.
After removing the antibody, the membrane will be washed four times for 15
minutes with 1x TTBS (change four times). A secondary biotinylated anti-rabbit
Spring 2007
61
antibody will be incubated with the membrane for one hour. After removing the
antibody, the membrane will be washed again four times for 15 minutes with 1 x
TTBS. Biotinylated Horse-Radish-Peroxidase (HRP) is linked to the secondary
antibody with avidin for one hour and washed again four times for 15 minutes with
TTBS. A substrate for HRP will be added and the resulting chemiluminescent
signal will be recorded with a high-resolution digital camera or photographic film.
Kaleidoscope marker. Proteins of known molecular weights are labeled with
different color markers allowing easy estimates of the size of transferred proteins.
Note that the labeled proteins migrate slightly different between different batches
of marker. Pay attention to the molecular weight list that that is provided to each
batch of marker.
Spring 2007
62
Detection of proteins with antibodies/Results from Western

Blotting
Immunohistochemistry assays
Antibodies are produced by Bcells to protect the host against
intruding microorganisms. They are
encoded by two genes and consist of
tetrameric proteins of two heavy chain
and two light chains. The forked ends of
different antibodies are very variable
and can form strong interactions with
specific protein structures (epitopes).
The C-terminal ends of the heavy chains
are specific for individual species. This
characteristic can be exploited by
generating secondary antibodies
against this portion of primary
antibodies. It is possible to attach an
enzyme or a chemical moiety to a
primary antibody to detect the presence
of an interacting protein with a chemical
reaction or by fluorescence. However,
this would limit the use of this antibody.
Thus, in most cases we pursue a
combinatorial strategy. Secondary
antibodies raised against the species
specific C-terminus of antibodies are
modified with different enzymes and
fluorescent chemical moieties. The
advantage of this approach is that we
can use different secondary antibodies
and detection methods to identify a
particular protein. On the other hand,
we can use the same secondary
antibodies in combination with a variety
of primary antibodies raised in the same
animal species against different
proteins. Two of the most common enzymes attached to secondary antibodies are
Alkaline Phosphatase (AP) and Horse Radish Peroxidase (HRP). There are
substrates for both enzymes that produce either a color reaction (blue for AP, brown
Spring 2007
63
for HRP) or the emission of light that can be detected by film or more recently by
digital cameras. The latter method is called chemiluminescence. Figure: GST
fusion proteins are detected by a combination of anti-GST primary antibodies made
in goats combined with anti-goat secondary antibodies, which are coupled for
instance with HRP and detected with a color or chemiluminescent substrate.
Part F - Protein purification using glutathione affinity beads

Materials
Tubes of induced/uninduced protein extract, one per group of three
students
Tubes of glutathione beads
Tubes of Buffer A washing buffer (50 mM TrisCl pH 7.5, 150 mM
NaCl)
Tubes of 125 l aliquots of 10 mM reduced glutathione elution buffer
Tube with 4x BPB/SDS loading dye
Procedure
1.
Mix a 1 ml aliquot of induced extract with 200 l of beads for 1 hour at 4C on

a rocker.
2.
Centrifuge at 6,000 rpm for 1 minute at 4C.
3.
Remove supernatant and wash beads with 1 ml of washing Buffer A for 5

minutes at 4C.
4.
Repeat step 2 and 3 three times (total).
5.
6.
Remove supernatant and elute protein with 125 l of 10 mM glutathione in

50 mM TrisCl pH 7.5 for 5 minutes at 4C on the rocker.
7.
8.
Collect 120l and transfer into new (labeled) microcentrifuge tube.
9.
In a separate tube, mix 18l of protein extract and 6 l of 4x loading dye.
Spring 2007
64
Western blotting of purified GST-MsrA protein

Coomassie staining of GST-Luciferase fusion proteins expressed from
pGEX-6P-1 before and after digestion by the protease Thrombin. This is an
example to illustrate the expected results of your experiment.
M.
Protein molecular weight standards.
Lane 1.
Sonicated E. coli cell extract containing a pGEX-6P-1 plasmid that

codes for GST-luciferase.
Lane 2.
Purification after binding to Glutathione Sepharose, washing, and

elution with 10 mM reduced glutathione.
Lane 3.
Purification of Luciferase from supernatant after binding to

Glutathione Sepharose, washing, and digestion with Thrombin for 8
hours.
Lane 4.
Purification of Luciferase from supernatant after binding to

Glutathione Sepharose, washing, and digestion with Thrombin for 16
hours.
Lane 5.
Eluted proteins after binding to Glutathione Sepharose, washing,

followed by Thrombin digestion and elution with buffer containing
10 mM reduced glutathione.
Lane 6.
Spring 2007
65
Purification of GST after binding to Glutathione Sepharose followed by

Thrombin digestion, washing, and elution with buffer containing
10 mM reduced glutathione.
Part G - Immunodetection with Antibodies

Procedure
1. Rinse the blocked membrane with TTBS.
2. Add the primary antibody at the appropriate dilution in TTBS and incubate
the membrane for 1 hour at room temperature. We use a -MsrA (rabbit)
antibody at a dilution of 1:1000.
3. Wash the membrane four times for 15 minutes with fresh changes of TTBS at
room temperature.
4. Add the secondary antibody at the appropriate dilution in TTBS and incubate
the membrane for 1 hour at room temperature. The secondary antibody is
coupled either with an enzyme (Horse Radish Peroxidase, HRP) or with
Biotin. We use a -Rabbit-Biotin secondary antibody at a dilution of 1:1000.
Why do we use a -Rabbit antibody?
room temperature. During these washing steps, combine 10l of reagent A
(Avidin) and 10l of reagent B (Biotin-HRP) to 4ml of TTBS. Avidin has
multiple high affinity binding sites for Biotin and acts as a cross-linker.
6. ABC reaction: incubate the membrane in the reagents AB for 1 hour at room
temperature. In this reaction, Avidin will cross-link the AB-HRP complex to
the Biotin of the secondary antibodies.
room temperature.
8. Mix an equal volume of the chemiluminescence detection solution 1 with
detection solution 2. The volume has to be sufficient to cover the membrane.
9. Remove the membranes from the washing solution and drain the excess
TTBS. Place the membrane on a piece of Saran Wrap, the side with the
transferred protein up. Add the detection reagent to the membrane. The
reagent is held by surface tension of the membrane. Make sure the whole
membrane is evenly covered.
10. Incubate for 3 minutes.
Spring 2007
66
11. Drain the excess detection reagent and transfer the membrane to another
piece of Saran Wrap. Cover the membrane with Saran Wrap without
generating air pockets.
12. Place the membrane, protein side up, in a digital camera system for
detections of the chemiluminescence. Alternatively, expose X-ray films placed
on top of the filter to the chemiluminescence for different periods in the dark
room.

Biotech 2 Lab Manual

Uploaded by

Document Information

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Biotech 2 Lab Manual

Uploaded by

Copyright:

Available Formats

Biotechnology 2

E-mail is the most effective way of reaching me

Laboratory notebook, which is available in the FAU campus bookstore

Laboratory manual, which can be downloaded from Blackboard.

Biotechnology 2 Laboratory manual

Determination of your grade

In-Class Written Exams

A Clean Working Environment

Biotechnology 2 Laboratory manual

Not cleaning up properly

Late for Class

Missed Lab Periods

Ensuring Success in the Course

Attend all labs.

Most importantly, try to understand the purpose of the

Biotechnology 2 Laboratory manual

Biotechnology 2 Laboratory manual

Maintaining Your Laboratory Notebook

For each experiment, include the following sections:

Biotechnology 2 Laboratory manual

Materials and Methods

Biotechnology 2 Laboratory manual

Equipment Use, Lab Technique, and Waste Disposal

Biotechnology 2 Laboratory manual

Glass Petri Plates:

Disposable Petri Dishes

Biotechnology 2 Laboratory manual

Glass Test Tubes

Biotechnology 2 Laboratory manual

The third set of experiments will teach you how to:

Biotechnology 2 Laboratory manual

Biotechnology 2 Laboratory manual

Phenol Extraction Proteins readily dissociate from DNA in the presence of

Guanidinium isothiocyanate -Guanidinium isothiocyanate is a powerful protein

Part A RNA isolation

Biotechnology 2 Laboratory manual

RVT A revertant of an MsrA mutation caused by insertion of a P-element

Centrifuge at maximum speed for 10 min at 4C

Transfer the supernatant to a clean microcentrifuge tube.

Allow the sample to incubate at room temperature for 5 min.

Centrifuge at full speed for 15 min at 4C.

Transfer the aqueous phase to a clean microcentrifuge tube.

proteins are in the pink-colored organic phase.

Incubate the samples at room temperature for 10 min.

Centrifuge at maximum speed for 10 min at 4C.

Pour off the supernatant without disturbing the pellet.

Biotechnology 2 Laboratory manual

Wash the RNA pellet with 1 ml 75% ethanol.

B. Determining the Amount and Quality of RNA Using a

Be sure that you understand how to determine the concentration and A

Biotechnology 2 Laboratory manual

The spectrophotometer needs to be zeroed to account for any absorbance due

3. To determine the concentration of your RNA sample, multiply the A260

What if the A260/A280 ratio is too low (~1.5

Biotechnology 2 Laboratory manual

Vortex to mix well and then chill at -70C for 10 min.

Centrifuge at maximum speed for 15 min.

Resuspend the RNA pellet in 30l RNAse-free water.

Did the A260/A280 ratio improve?

Biotechnology 2 Laboratory manual

Biotechnology 2 Laboratory manual

Each bench will cast one agarose gel

Alternatively, you may be provided with 1X TAE

Add 50ml 1X TAE buffer.