You are on page 1of 9

Gentica Molecular A

Turno prtico 1- grupo 3


Aristides Mendes n 32362; Joo Brito n 32908; Pedro Fonseca n 32844; Rute Morais n 31483

Amplificao de DNA para genotipagem por PCR Sequenciao


Introduo
A anlise de sequncias nucleotdicas especficas muitas vezes dificultada pela presena de material estranho e/ou
pelas quantidades extremamente reduzidas que se encontram disponveis para anlise. A tcnica de PCR (Polymerase Chain
Reaction) permite superar estas limitaes [7].
A amplificao por PCR envolve processos cclicos de desnaturao do DNA (por aco da temperatura), annealing
dos oligonucletidos iniciadores (primers) s suas sequncias complementares e extenso dos primers emparelhados, levada a
cabo por uma enzima termoestvel [7]. Os oligonucletidos iniciadores que hibridam com a sequncia de interesse durante a
fase de annealing devem ter as seguintes caractersticas: tanto o forward primer como o reverse primer devem ter entre 18 a 25
nucletidos; no devem possuir sequncias complementares entre si; no devem ser constitudos por regies repetitivas; devem
apresentar um contedo em CG aproximado a 50%; a temperatura de annealing deve estar situada entre os 55 C e os 65 C; a
temperatura de melting entre os primers no deve diferir de mais de 3C; entre outras [1,5].
Uma das finalidades da tcnica de PCR pode ser a deteco de polimorfismos, como por exemplo o polimorfismo I/D
do gene ACE1. Este gene, que se encontra no cromossoma 17q23 do ser humano, constitudo por 26 exes interrompidos por
25 intres, codifica para a protena ACE, que responsvel pela converso da hormona angiotensina I na sua forma activa, a
angiotensina II [4]. A sua forma activa est associada a um maior risco de problemas cardiovasculares, pois esta possui uma
actividade vasoconstrictora, sendo que um aumento na sua concentrao se traduz num aumento da presso arterial [2,8,9]. O
polimorfismo em questo caracteriza-se pela presena (I - insero) ou ausncia (D deleco) da sequncia Alu de 287 bp no
intro 16 do gene ACE1, apresentando trs gentipos observveis na populao: homozigotia D/D, homozigotia I/I, e
heterozigotia I/D [2].
A tcnica de PCR pode tambm ser utilizada na sequenciao de mutaes associadas a doenas genticas. A
ocorrncia de mutaes no gene MYBPC3 est igualmente associada a problemas cardiovasculares, como por exemplo a
cardiomiopatia hipertrfica. Este gene, localizado no cromossoma 11p11.2, o mais frequentemente mutado e codifica para a
protena MyBP-C (Cardiac Myosin Binding Protein C), que possui funes estruturais no sarcmero cardaco [3,10]. A maioria
das mutaes em MYBPC3 so nonsence ou frameshift, resultando em protenas truncadas provocando haploinsuficincias
[3,11].
O objectivo deste trabalho consistiu na extraco e purificao de gDNA de clulas do epitlio bucal, para aplicao
da tcnica de PCR, com a finalidade de se determinar o polimorfismo I/D associado ao gene ACE1 e de se sequenciar o exo 7
do gene MYBPC3 para a determinao de mutaes genticas.

Materiais e Mtodos
Foi seguido o protocolo disponibilizado, com os ajustes pontuais indicados.
Aula 1: Extraco de DNA a partir de clulas do epitlio bucal. Determinao de integridade, pureza e concentrao de
DNA
A extraco de DNA do epitlio bucal foi realizada por todos os elementos do grupo. Recorreu-se a um escovilho
para recolher clulas adicionais do interior da bochecha, adicionando-as amostra. O volume de protease utilizado foi 100l.
Depois da precipitao em etanol, foram seleccionadas as duas melhores amostras de DNA. As amostras escolhidas foram,
posteriormente, secas em estufa. Aps a secagem, ressuspenderam-se os pellets adicionando 475l de TE a uma amostra e
150l de TE a outra. Na preparao do gel de agarose, foram acrescentados 5l de GelRed por cada 100ml de gel. O gel foi
corrido a 85V durante 30 minutos.
Aulas 2 e 3: Amplificao de DNA para genotipagem por PCR, e Sequenciao
A partir da electroforese em gel de agarose, foi escolhida a melhor amostra das duas corridas. O DNA no foi diludo.
Foi realizado um controlo positivo, apenas, no PCR para determinao de polimorfismos, tendo-se efectuado controlos
negativos em ambos. As misturas de PCR foram sujeitas a um spin imediatamente antes da amplificao. Finda esta, os tubos

foram armazenados a -20C. Na electroforese do produto obtido na primeira amplificao, foram aplicados 15l de produto de
amplificao com 5l de loading buffer.
Anlise e purificao de produtos de amplificao
Utilizaram-se 7l de GelRed e 150ml com TAE 1x na preparao do gel de agarose. Foi adicionado todo o produto de
amplificao com 5l de loading buffer. 300l de soluo L1 foram adicionados por cada 100mg de agarose; na nossa
amostra, isto perfez 575l. A agitao do tubo foi feita por inverso a cada cinco minutos. O volume de TE adicionado foi de
30l. Depois de purificado, o DNA foi carregado em novo gel de agarose a 2%, recorrendo a 5l de loading buffer e corrido a
80V por 45min.

Resultados
Extrao de DNA a partir de clulas do epitlio bucal
Figura 1 Fotografia do gel de electroforese (0,8% (p/v), TAE 1x,
5 L Gel Red, 85 V durante 30 min). Poos: 1) Marcador
Molecular Hyperladder IV; 2 e 3) Amostras do grupo 1; 4 e 5)
Amostras do grupo 2; 6 e 7) Amostras do grupo 3; 8 e 9) Amostra
do grupo 4; 10 e 11) Amostras do grupo 5; 12 e 13) Amostras do
grupo 6; 14, 15 e 16) Amostras do grupo 7.

PCR para determinao do polimorfismo I/D do ACE1


Os Primers usados na amplificao por PCR foram:
Primer F1: CTGGAGACCACTCCCATCCTTTC

Primer R1: GACGTGGCCATCACATTCGTCAGAT


Figura 2 Fotografia do gel de electroforese dos produtos de
amplificao por PCR para determinao do polimorfismo I/D
do ACE1 (2% (p/v) agarose, 5 L Gel Red, TAE 1x, 90V
durante 30 min) Poos: 1) Marcador Molecular HyperLadder IV
2) Controlo negativo 3) Controlo Positivo 4) Amostra do Grupo
1; 5) Amostra do Grupo 2; 6) Amostra do Grupo 3; 7) Amostra
do Grupo 4; 8) Amostra do Grupo 5; 9) Amostra do Grupo 6; 10)
Amostra do Grupo 7;

PCR para Sequenciao (MYBPC3_Ex7)


Os Primers usados no PCR foram:
Primer F2: GGTCATGGATGGCAAGTCT

Primer R2: CCCAGTCGAGACCCTGAAG

Figura 3 - Fotografia do gel de electroforese com amostras prpurificadas (2% agarose, 5 L Gel Red, TAE 1x, 80V, 40 min).
Poos: 1) Marcador Molecular Hyperladder IV; 2) Controlo
negativo; 3) Amostra do grupo 1; 4) Amostra do grupo 2; 5) Amostra
do grupo 3; 6) Amostra do grupo 4; 7) Amostra do grupo 5; 8)
Amostra do grupo 6; 9) Amostra do grupo 7.

Figura 4 - Fotografia do gel de electroforese com amostras purificadas


(2% agarose, 5 L Gel Red, TAE 1x, 80V durante 40 minutos). Poos: 1)
Marcador Molecular Hyperladder IV; 2) Amostra do grupo 4; 3) Amostra
do grupo 3; 4) Amostra do grupo 1; 5) Amostra do grupo 5; 6) Amostra do
grupo 2; 7) Amostra do grupo 6; 8) Amostra do grupo 7.

Discusso de resultados
Analisando a Figura 1, conseguimos inferir sobre a pureza e integridade do DNA genmico extrado de clulas do
epitlio bucal. Verifica-se, em todas as lanes, uma reteno do DNA. Contudo, existe menor quantidade de DNA retido na lane
3 e na lane 10. Na lane 3 no existe nenhum arrastamento, levando a concluir que no existiu degradao mecnica do DNA.
Ainda na lane 3 poder-se- afirmar que o grupo no conseguiu uma extraco eficiente ou que o DNA no foi devidamente
solubilizado em tampo TE. Contudo, em todas as outras lanes podemos aferir que existiu degradao das amostras aquando
do seu manuseamento, pois apresentam arrastamento no gel. Todas as outras lanes apresentam reteno que poder dever-se
presena de DNA genmico de alto peso molecular ou contaminao com protenas. O DNA do nosso grupo (lanes 6 e 7)
segue as mesmas verificaes. Em suma, o DNA no se encontra integro no apresentando, por isso, migrao no gel (ausncia
de bandas). A contaminao inerente a protenas poder dever-se a uma incubao incorrecta ou insuficiente aps adio da
proteinase K.
No gel da Figura 2, esto representados os produtos de PCR do intro 16 do gene ACE1 com a utilizao dos Primers
F1 e R1, que nos permitir determinar o polimorfismo I/D desse mesmo gene. Verifica-se que ocorreu, apenas, amplificao
nas lanes 3,4,5 e 9. Na lane 2, correspondente ao controlo negativo (sem DNA), no existiu amplificao tal como era
esperado. Na lane 3, como j foi dito verificou-se amplificao, visto esta conter o controlo positivo para a nossa amostra. Nas
restantes lanes onde ocorreu amplificao, observam-se duas bandas no gel, com pesos moleculares compreendidos entre os
100 e os 200bp, de acordo com os pesos moleculares do marcador molecular (Anexo1). A banda com peso aproximado aos
100bp corresponder a uma amplificao inespecfica, que poder dever-se a uma temperatura de annealing baixa. A banda
com peso molecular prximo dos 200bp poder ser a banda correspondente ao peso molecular de 190bp identificativa do
gentipo DD do ACE1. Assim sendo, poder afirmar-se que os indivduos representados pelas lanes 4, 5 e 9 so homozigticos
para o alelo D, uma vez que s apresentam uma banda de 190bp. No existe nenhum indivduo homozigtico para o alelo I,
pois no visvel nenhuma banda com menor distncia de migrao correspondente banda caractersitca do alelo I (490bp),
nem nenhum heterozigtico para o polimorfismo I/D (nenhum resultado apresenta duas bandas, uma correspondente a 190bp e
outra aos 490bp). Para que no haja amplificao inespecfica deveramos repetir o PCR, aumentando agora a temperatura de
annealing. Nas lanes em que no se verifica a presena de bandas no gel poder-se- afirmar que ou no existiu amplificao
(como mencionado anteriormente) devido a possveis erros de pipetagem nessas mesmas lanes, o que influenciou a
concentrao de Master Mix e, por conseguinte, afectou a concentrao de Mg2+ podendo levar sua escassez; e/ou que existiu
contaminao do DNA por protenas. A escassez de Mg2+ leva a uma ausncia de produto de amplificao.
Na Figura 3, verifica-se a existncia de produtos de PCR do exo 7 do MYPBC3, com a utilizao dos Primers F2 e
R2, 3 nas lanes de 4 a 9. A amplificao nas lanes correspondentes s amostras dos grupos 3, 4 e 5 contradiz o resultado obtido
para os mesmos grupos na Figura 2. Conclui-se, ento, que o DNA no estaria muito contaminado com protena como
mencionado acima para as lanes correspondentes s amostras dos grupos 3,4 e 5. Uma vez que existiu amplificao neste
ltimo PCR, podemos assumir que a inexistncia da mesma na Figura 2 se deve ao facto de uma m ressuspenso do DNA.
Existe degradao parcial do produto na lane 4 e uma menor degradao na lane 5, podendo afirmar-se tal inferncia devido ao
arrastamento apresentado. Nas lanes 6, 7 e 8, apesar de ter ocorrido amplificao, existe reteno de algum DNA genmico no
poo que poder estar pouco ou nada contaminado com protena. Na lane 3 no ocorreu amplificao. O controlo negativo,
presente na lane 2 no amplificou tal como se esperava. Para realizar a purificao de fragmentos de PCR, utilizaram-se os
fragmentos obtidos neste PCR. Pela anlise da Figura 4, verifica-se uma s banda em quase todas as lanes, indicando que a
purificao foi realizada com sucesso nestes casos. Na lane 2 verifica-se que a banda presente possui um peso molecular
inferior ao previsto, isto leva-nos a concluir que a banda isolada a partir do gel no foi a correcta. Na lane 3 no se vem

bandas devido amostra no ter sido bem carregada. Na lane 8 a banda presente possui um peso molecular superior ao
previsto e, portanto neste caso tambm conclumos que a banda isolada a partir do gel no foi a correcta.
Atravs dos cromatogramas, disponibilizados pela docente, relativos sequenciao do produto de PCR do exo 7 do
gene MYBPC3 (Anexos 3 e 4) obtiveram-se duas sequncias (controlo e paciente). Realizando um alinhamento destas
sequncias com genoma humano presente na base de dados do software BLASTn, com o intuito de determinar se existia uma
mutao causadora de doena, obtivemos uma homologia de 100% para a sequncia controlo e uma homologia de 98% para a
sequncia do paciente (Anexo 5). Observando, detalhadamente, os resultados devolvidos pelo programa para a 2 sequncia foi
possvel concluir que ocorreu uma transio de uma citosina para uma timina. Neste caso, a mutao, tambm, seria detectada
pela anlise visual do cromatograma pois, no local da mutao, existem dois picos de fluorescncia, correspondentes ao
nucletido mutado e ao nucletido normal, concluindo assim que o paciente seria heterozigtico. De referir que a anlise nocomputorizada do cromatograma deve ser realizada para evitar a ocorrncia de falsos negativos em casos de existirem dois
picos de fluorescncia.
Analisando os vrios resultados obtidos em ambos os PCR efectuados e submetendo os primers a anlise de estruturas
secundrias que eles possam formar (neste ponto foi utilizado a ferramenta NetPrimer da Premier Biosoft, sendo que se podem
ver os resultados no Anexo 2), podemos concluir que estes foram adequados para as experincias efectuadas. Atravs da
ferramenta de anlise concluiu-se que as nicas estruturas secundrias possveis seriam emparelhamento homlogos no caso do
primer F2 e do R2, devido ao facto de estas serem as nicas ligaes que apresentam uma energia livre de Gibbs inferior a 6kcal/mol e, portanto, estveis. Por fim, para solucionar o problema por contaminao com protena poder-se- proceder a uma
nova extraco. Quanto m ressuspenso do DNA no tampo TE poder ser contornada se a amostra sofrer um congelamento
e posterior descongelamento para aumentar a quantidade de DNA em resuspenso.

Referncias
[1]

Carrier, L. et al. 1997. Organization and sequence of human cardiac myosin binding protein C gene (MYBPC3) and
identification of mutations predicted to produce truncated proteins in familial hypertrophic cardiomyopathy. Circ
Res. 80(3):427-34.

[2]

Caulfield M, Newell-Price J. 1995.The angiotensin converting enzyme gene in cardiovascular. Disease. Br Heart
J.74:207-8.

[3]

Christiaans I, et al. 2010. Founder mutations in hypertrophic cardiomyopathy patients in the Netherlands. Neth Heart
J. 18(5):248-54.

[4]

Dikmen M et al. 2006. Are the angiotensin-converting enzyme gene and activity risk factors for stroke? Arq
Neuropsiquiatr. 64(2A):211-6.

[5]

Murphy KM, Berg KD, Eshleman JR. 2005. Sequencing of genomic DNA by combined amplification and cycle
sequencing reaction. Clin Chem. 51(1):35-9.

[6]

Protocolo de Gentica Molecular A 2011/2012. PCR. FCT UNL.

[7]

Saiki, R. et al. 1988. Primer-Directed Enzymatic Amplification of DNA with a Thermostable DNA polymerase.
Science. 239 (4839): 487-91.

[8]

S D O'Dell, S E Humphries, I N M Day. 1995. Rapid methods for population-scale analysis for gene polymorphisms:
the ACE gene as an example. Technique. Br Heart J. 73:368-371.

[9]

Vallone PM, Butler JM. 2004. AutoDimer: a screening tool for primer-dimer and hairpin structures. Biotechniques.
37(2): 226-31.

[10]

Van Driest SL, et al. 2004. Myosin binding protein C mutations and compound heterozygosity in hypertrophic
cardiomyopathy. J Am Coll Cardiol. 44(9):1903-10.

[11]

Ferramenta BLAST2Sequences, do programa BLASTn:


http://www.ncbi.nlm.nih.gov/blast/Blast.cgi?PAGE=Nucleotides.

[12]

Ferramenta NetPrimer da Premier Biosoft: http://www.premierbiosoft.com/netprimer/index.html.

[13]

http://www.bioline.com/h_ladderguide.asp.

Anexo 1
Peso Molecular das bandas do Marcador Molecular HyperLadder IV

Anexo 2
Resultados da anlise de primers pela ferramenta NetPrimer
Primers para ACE1
Primer F

Caractersticas gerais

Emparelhamento homlogo

Primer R

Caractersticas gerais

Emparelhamento homlogo

Emparelhamento cruzado

NOTA: Nos parmetros inicias escolheu-se uma temperatura de melting de 59C e uma concentrao de ies magnsio de
2mM

Primers para MYBPC3


Primer F
Caractersticas gerais

Emparelhamento homlogo

Primer R
Caractersticas gerais

Emparelhamento homlogo

Emparelhamento cruzado

NOTA: Nos parmetros inicias escolheu-se uma temperatura de melting de 56C e uma concentrao de ies magnsio de
1,6mM

Anexo 3
Cromatograma relativo sequenciao da sequncia controlo do exo 7 do gene MYBPC3:

Anexo 4
Cromatograma relativo sequenciao da sequncia do exo 7 do gene MYBPC3 de um paciente:

Anexo 5
Resultados da anlise de sequncias MyBPC3 pela ferramenta BLASTN
Controlo

Paciente