Biochemical and Biophysical Research Communications 383 (2009) 192197

Contents lists available at ScienceDirect

Biochemical and Biophysical Research Communications

journal homepage: www.elsevier.com/locate/ybbrc

Investigation of requirements for efcient gene delivery using the HIV-1

based lentiviral transduction system
Seon Hee Kim, Soo In Jang, Chul Yong Park, Ji Chang You *
National Research Laboratory of Molecular Virology, Department of Pathology, School of Medicine, The Catholic University of Korea, Seocho-gu Banpo-dong 505,
Seoul, Republic of Korea

a r t i c l e

i n f o

Article history:
Received 20 March 2009
Available online 5 April 2009

Keywords:
Gene transduction
Packaging signal
RNAGag interaction
Viral RNA encapsidation

a b s t r a c t
The specic recognition and selection of the HIV-1 packaging signal psi (W) sequence which is mediated
by Gag protein is believed to be pivotal for selective viral genomic RNA packaging and has been a basis for
the development of HIV-based transgene delivery systems. However, the requirement of the psi sequence
has been questioned recently by a report postulating that the psi element is not absolutely required for
transgene transduction. Here, we used a four-plasmid transgene delivery system and analyzed the
results by HIV p24 antigen assay, MT4 infection assay, HT1080 colony assay, and reverse transcriptionPCR (RT-PCR). The results clearly demonstrate that the psi sequence must be present for efcient transgene encapsidation and transduction.
2009 Elsevier Inc. All rights reserved.

Introduction
The Human Immunodeciency Virus-1 (HIV-1) belongs to a lentivirus subfamily of Retroviridae and contains 10 kb of plusstrand RNA [1]. The full-length unspliced viral RNA generated
and exported from the nucleus by the viral RevRRE (Rev Responsive Element) interaction [2,3] can serve as a template for translation of Gag or Gag/Pol proteins as well as a genomic viral RNA
encapsidated into progeny virions. In this encapsidation process,
recognition and selection of the viral genomic RNA mediated by
the specic interaction between the Nucleocapsid (NC) domain of
Gag protein and a packaging signal called the psi (W) sequence located downstream of the 50 Long Terminal Repeat (LTR) [47] are
required for selective viral genomic RNA packaging and for generation of functional infectious virus [810]. A complex of viral genomic RNA and Gag protein has been observed to co-localize in the
perinuclear region [11] and to be transported to the plasma membrane by intracellular trafcking to encapsidate the RNA into virions [1214]. Mutations in the NC domain and the psi sequence
have been shown to affect their specic interaction and to result
in generation of virus particles with packaging defects [10,15],
including the incorporation of cellular tRNA or mRNA, or spliced
viral RNAs instead of full-length viral genomic RNA [8].
The specicity of viral RNA packaging has been exploited as the
basis for a number of lentivirus-based transgene delivery systems
[1618]. These systems generally employ several distinct engi* Corresponding author. Fax: +82 2 2258 7790.
E-mail address: jiyou@catholic.ac.kr (J.C. You).
0006-291X/$ - see front matter 2009 Elsevier Inc. All rights reserved.
doi:10.1016/j.bbrc.2009.03.150

neered plasmids, including a transgene plasmid in which the transgene transcription unit is placed downstream of the psi sequence,
along with other plasmids expressing either Gag/Pol protein or Env
protein.
However, the necessity of the psi sequence for viral packaging,
and thus transduction of a transgene, has recently been challenged.
Previous studies have suggested that a portion of the Gag gene
sequence, in addition to the psi sequence, is required and increases
the encapsidation level of viral genomic RNA when it is placed between the psi sequence and a transgene [1620], thus constituting
an extended packaging signal.
More recently, Laham-Karam and Bacharach have shown that
even when the entire psi sequence including SL14 was deleted,
the transduction efciency of transgene RNA was not greatly affected. Transduction efciency was only 2- to 5-fold less than wild
type, arguing strongly that the psi element is not absolutely
required for transgene transduction [21].
To clarify the role of the psi sequence and the partial Gag gene
sequence in the efcient packaging and transduction of transgenes,
we examined the effect of systematic deletions of these elements
using a four-plasmid transgene delivery system. Our results clearly
indicate that the psi element must be present for efcient transgene encapsidation and transduction, and that a portion of the
Gag gene sequence also makes a minor contribution.
Materials and methods
Plasmid construction. HIV-based lentiviral transgene plasmids
were constructed as follows. pLenti/EGFP (Enhanced Green

S.H. Kim et al. / Biochemical and Biophysical Research Communications 383 (2009) 192197

Fluorescence Protein) was generated by removing the b-globin Intron II and tetR regions with EcoRI treatment with pLenti6/TR
(Invitrogen, Carlsbad, CA) and replacing them with an EGFP open
reading frame from pEGFP-N1 (Clontech, CA). To create the pLenti/PBS plasmid, PBS primers (PBS.EcoRV_F: 50 -AGGCGCCCGAACAG
GGACTTGAAAGCGAAAGGGAAACCAGAGGAGCTCTCTCGGATATCCC
TGGAGGAGGC-30 , PBS.EcoRV_R: 50 -GCCTCCTCCAGGGATATCCGAG
AGAGCTCCTCTGGTTTCCCTTTCGCTTTCAAGTCCCTGTTCGGGCGCCT-30 )
anked by the NarI site at the 50 -terminal, and EcoRV (underlined)
followed by EcoNI sites at the 30 -terminal were chemically synthesized (Genotech, Republic of Korea), and annealed together. This
double-strand DNA fragment was digested with NarI and EcoNI
and inserted into pLenti/EGFP in which the region from PBS to
MAp was deleted by treatment with the same restriction enzymes.
To generate pLenti/PBS.Map plasmid, the MAp region was amplied from pLenti/EGFP (F-MAp_EcoRV: 50 -CCCGATATCAGC
GGGGGAGAA-30 , MAp_R: 50 -GCCTCCTCCAGGTCTGAAGATC-30 ) and
ligated into pLenti/PBS after digestion of both insert and backbone
plasmids with the same EcoRV and EcoNI restriction enzymes.
pLenti/PBS.psi was cloned by inserting a DNA fragment containing
PBS and the psi sequence, which was obtained by PCR from pLenti/
EGFP (Lenti_PBS_F: 50 -CGGCGCCCGAACAGGGACTT-30 , Lenti_psi_R:
50 -TCCTCCTCCAGGTAATACTGACGCTC-30 ), into pLenti/EGFP in
which the PBS to MAp region had been deleted by NarI and EcoNI
treatment.
The MAp region of pLenti/EGFP was replaced by a multiple cloning site (MCS) sequence to test the effect of MAp substitution.
Three hundred fty base pairs of MCS was separated from
pSE380, digested with XmnI, and inserted into EcoNI- and Klenow-treated pLenti/PBS.psi to produce pLenti/MCS.
pLP1, pLP2, and pLP/VSVG that express Gag/Pol, Rev, and VSVG,
respectively, were purchased from Invitrogen. Every plasmid constructed was veried by enzyme digestion and sequencing.
Transfection of 293FT cells. 293FT cells were maintained in Dulbeccos modied Eagle medium (DMEM) supplemented with 10%
of fetal bovine serum, 1% of penicillin/streptomycin, and 1% of
non-essential amino acids at 37 C and 5% CO2. One day before
transfection, 1  106 293FT cells were seeded into 6-well plates
and incubated for 24 h. Three micrograms of protein-expression
plasmids (pLP1, pLP2, and pLP/VSVG) and 1 lg of lentiviral transgene plasmids plasmids were used for virus packaging. Most of
the transfection procedure was performed according to the manufacturers instructions. Briey, packaging plasmids and lentiviral
transgene plasmid were mixed with 250 ll of opti-MEM (Gibco,
MD) and incubated for 5 min at room temperature. Lipofectamine
2000TM (Invitrogen) transfection reagent was then dropped onto the
plasmid mixture. The DNAreagent mixture was incubated for
40 min at room temperature and then added to 293FT cells.
After 56 h, the DNAreagent mixture was removed, and fresh
DMEM with 100 mg/L sodium pyruvate was added to cells. After
30 h, 293FT cells and the culture media were harvested and
analyzed.
Infection of MT4 cells. MT4 cells were cultured in RPMI 1640
media with 10% fetal bovine serum and 1% penicillin/streptomycin
at 37 C and 5% CO2. To determine viral infectivity, 1  105 MT4
cells were suspended in 20 ll of RPMI and seeded in 96-well
plates. Two hundred microliters of viral supernatants obtained
from transfected 293FT cells were ltered with 0.2-lm pore lters,
added to MT4 cells, and incubated at 37 C for 3 h. Then, viral
supernatants were removed, and 200 ll of RPMI were added to
wells and incubated for 48 h. Forty-eight hours postinfection,
GFP-positive MT4 cells were observed by uorescence microscopy
(Axiovert 200, Zeiss, Germany) and quantitatively analyzed by
FACS.
FACS analysis. The FACSort apparatus (Becton Dickinson, NJ) was
used to analyze transfected 293FT cells or infected MT4 cells. One-

193

fth of the 293FT cells harvested 30 h posttransfection were

suspended in 1 ml of PBS and then analyzed by uorescence-activated cell sorting (FACS). MT4 cells, which were infected with viral
supernatants and incubated for 48 h, were harvested and suspended in 1 ml PBS, and EGFP-positive cells were counted by FACS.
HIV p24 Enzyme-Linked ImmunoSorbent Assay (ELISA). To measure the p24 concentration in viral supernatants, 100 ll of
harvested viral supernatants were serially diluted (10-fold dilutions) with 1 phosphate buffer. One hundred microliters of
diluted supernatants were added to wells coated with p24 antibody in the Vironostika HIV-1 antigen p24 ELISA kit (Biomerieux,
France). The amounts of the viral antigen were determined by following the manufacturers instruction.
Colony assay. HT1080 cells were maintained in Dulbeccos modied Eagle medium (DMEM) supplemented with 10% fetal bovine
serum, 1% penicillin/streptomycin, and 1% non-essential amino
acids at 37 C and 5% CO2. One day before infection, 1  105 cells
were seeded in 6-well plates and incubated at 37 C overnight. At
30% conuence, viral supernatants were serially diluted (10-fold)
four times, to a total volume of 1 ml and added to wells with a
6 lg/ml nal concentration of polybrene (Sigma, MO). After incubation at 37 C overnight, diluted viral supernatants were replaced
with 2 ml of complete culture medium. The next day, blasticidin
(5 lg/ml nal concentration; AG Scientic, CA) was added to each
well and incubated at 37 C for 1516 days. Every third day, the
DMEM in wells was exchanged with new media containing blasticidin. After 1516 days of selection, each well was washed with
1 ml PBS and, 1 ml of crystal violet solution [1% crystal violet (Sigma) and 10% ethanol] was added and incubated for 10 min at room
temperature. Then the cells were washed with 1 ml PBS four times
to remove excess crystal violet, and stained colonies were counted.
Reverse transcription-PCR. Viral supernatants were prepared
from transfected FT cells in a 100-mm dish, according to the manual of the Lipofectamine 2000 manufacturer (Invitrogen); 9 ml of
viral supernatant was harvested from each 100-mm dish and centrifuged at 50,000g for 2 h to collect virions. The resulting pellets of
virions were suspended in 0.3 ml DMEM at 4 C and incubated
overnight. Suspended virion solution (0.25 ml) was mixed with Trizol LS (0.75 ml; Invitrogen), and a general RNA extraction protocol
was followed. Fifty nanograms of RNA were treated with DNase I
(Promega, WI) and used for RT-PCR. RT-PCR was performed per
the protocol in the Titanium One-Step RT-PCR Kit manual (Clontech). The following two types of primers, EGFP and 50 -LTR, were
used. The EGFP primers were 50 -GTGAGCAAGGGCGAGGAGCTG-30
(forward sequence) and 50 -GGGTCTTGTAGTTGCCGTCGTC-30
(reverse sequence). The 50 -LTR primers were 50 -GATCTGAGCCTG
GGAGCTCTC-30 (forward sequence) and 50 -CCTTTCGCTTTCAAGTCC
CTGTTC-30 (reverse sequence).

Results
To evaluate the necessity of the psi element for packaging and
transduction of a transgene using a recombinant lentiviral vector
system, we examined ve different lentiviral transgene plasmids,
all containing CMV promoter-driven EGFP transgenes, as shown
in Fig. 1. The pLenti/EGFP plasmid contains complete PBS, psi,
MAp, and RRE elements, in that order, immediately downstream
of the 50 -LTR. The pLenti/PBS.psi, pLenti/PBS.MAp, and pLenti/PBS
plasmids harbor deletions of MAp, psi, and both MAp and psi
regions, respectively. We also constructed pLenti/MCS, a plasmid
in which the MAp region of pLenti/EGFP was replaced by a non-viral MCS sequence with a length similar to that of MAp to address
the inuence of MAp on viral packaging.
Three plasmids necessary for virus production, pLP1, pLP2, and
pLP/VSVG, expressing HIV Gag/Pol, Rev, and VSVG proteins, respec-

194

S.H. Kim et al. / Biochemical and Biophysical Research Communications 383 (2009) 192197

Fig. 1. Schematic depictions of the lentiviral transgene plasmids. The pLenti/EGFP plasmid contains viral sequence elements between RSV and CMV promoters that are
needed for efcient HIV-1 packaging. One or two elements were deleted or substituted in the other plasmids. To construct pLenti/MCS, we replaced MAp on pLenti/EGFP with
MCS. Thus, the name of the plasmid indicates its composition.

tively, were co-transfected into 293FT cells with each of the constructed transgene plasmids that we tested, and the transfection
efciency of each was determined using uorescence microscopy
and FACS analysis according to EGFP-positive 293FT cells. Similar
transfection efciency was obtained for each of the experimental
sets, ranging from 95.6 0.7% to 99.2 0.1% (Fig. 2A and Table 1).
The viral supernatants from transfected 293FT cells were har-

vested, and the amount of viral particles produced was determined

by measuring the amount of p24 antigen using an HIV p24 ELISA
assay. The results shown in Fig. 2B and Table 1 present relatively
similar levels of viral particle production ranging from 157 13
to 225 17 ng/ml. Thus, both transfection efciency and virus production were found to be unaffected by the use of the different
transgene plasmids.

Fig. 2. Results of 293FT cell uorescence microscopy and p24 ELISA. (A) Transfected 293FT cells were observed by uorescence microscopy. The transfection efciencies were
similar as measured by the percent of EGFP-positive 293FT cells using FACS analysis as described in Table 1. (B) The concentration of p24 antigen in the viral supernatants was
measured by ELISA, and the amounts of p24 were relatively similar.

195

S.H. Kim et al. / Biochemical and Biophysical Research Communications 383 (2009) 192197
Table 1
Numerical values of transfection efciencies, p24 concentrations, and transducibility of transgene virus.

EGFP
PBS.psi
PBS.MAp
PBS
MCS

Transfection efciency
(%) (mean SE)

p24 concentration
(ng/ml) (mean SE)

Compensated p24 concentration (p24

concentration/transfection efciency) (mean, ng)

HT1080 colony
(CFU/ml)

Transducibility (colony/
compensated p24)

98.4 0.2
98.5 0.1
99.2 0.1
95.6 0.7
96.9 0.1

207 12
177 13
185 15
225 17
157 13

210
180
187
235
162

60,000
20,000
10
8
20,000

285.71
111.11
0.05
0.03
123.46

However, when MT4 cells were infected with the same viral
supernatants using equal amounts of viral particles as determined
by the p24 antigen assay, strikingly different results were observed
(Fig. 3). At 48 h postinfection, EGFP signals were detected in almost
85% of MT4 cells infected with virus that was produced using the
pLenti/EGFP plasmid. However, in MT4 cells infected with virus
produced using pLenti/PBS.psi or pLenti/MCS transgene plasmids,
the percent of EGFP-positive cells was a few fold less than that of
MT4 cells infected with pLenti/EGFP-generated virus, and MT4
cells infected with either pLenti/PBS.MAp- or pLenti/PBS-produced
virus showed a reduction in EGFP-positive cells of approximately
two to three orders of magnitude. Together, these results indicate
that reduction in EGFP transgene transduction is not due to any

differences in the amount of virus produced, but rather to the presence or absence of the sequence elements that we tested in the
transgene plasmids. That is, selective packaging and transduction
of the viral RNA containing the EGFP transgene require the presence of the psi element in lentiviral transgene plasmids.
The result of the infection assay using MT4 cells was further
veried by the HT1080 colony assay (Fig. 3A and Table 1). The
same viral supernatants used to infect MT4 cells were added to
HT1080 cells to estimate viral infectivity by colony formation. After
selection with blasticidin for 15 days, pLenti/EGFP-produced virus
resulted in 6  104 colony forming units (CFU)/ml of viral supernatant. The pLenti/PBS.psi and pLenti/MCS plasmids, which contained
the psi sequence but no MAp region in the transgene plasmids,

Fig. 3. Lentiviral infection with two different cell lines. Harvested viral supernatants were added to MT4 cells and HT1080 cells to verify transducibility of the virus.
(A) Images of the HT1080 colony assay showing stained colonies resulting from serial dilution to illustrate differences in viral concentrations. Each number described in the
power of 10 on the images indicates the dilution factor of the well positioned below it. (B) Microscopic images of MT4 cells (left: optical image; right: uorescence image).
Numbers of infected cells are similar for MT4 and HT1080 assays. Ratios of EGFP-positive MT4 cells were obtained by FACS assays.

196

S.H. Kim et al. / Biochemical and Biophysical Research Communications 383 (2009) 192197

Fig. 4. Packaging efciency of lentiviral transgene vectors. Reverse transcription-PCR was performed with 50 ng of viral RNA extracted from virions, and primers used in the
experiments were complementary to the EGFP gene and the 50 -LTR region on viral RNA. PCR products of 325 bp and 194 bp were produced by RT-PCR as expected. To
demonstrate the absence of contaminating DNA, the same amount of RNA was used for PCR without RT. No DNA contamination was detected.

gave a similar result of 2  104 CFU/ml, which is 2- to 3-fold lower

than that of pLenti/EGFP. On the other hand, pLenti/PBS.MAp,
which has no psi region, produced 10 CFU/ml, and pLenti/PBS, in
which both psi and MAp were eliminated, produced 8 CFU/ml of
viral supernatant. As in the MT4 infection assay, very different
transgene transduction efciencies were observed between the
transgene plasmids in the HT1080 assay. Thus, the results clearly
indicate that the presence of the psi region on viral transgene
RNA is required for efcient transgene RNA packaging and contributes more than any other element.
To further dene whether the differences in transduction efciency between the viruses were indeed due to differences in the
viral transgene RNA packaged into virions, we aimed to probe viral
transgene RNA by RT-PCR. For this purpose, we employed two
types of primers, targeting EGFP and the 5LTR region present in
all of the transgene plasmids used, and we performed RT-PCR analysis with equal amounts of RNA extracted from virions. The viruses
produced from pLenti/EGFP, pLenti/PBS.psi, and pLenti/MCS plasmids showed similar signal intensities for EGFP and LTR in 25
cycles of RT-PCR; however, pLenti/PBS.MAp and pLenti/PBS
showed far lower intensities than those of pLenti/EGFP or pLenti/
PBS.psi (Fig. 4). This was not due to the absence of viral transgene
RNA in pLenti/PBS- or pLenti/PBS.MAp-produced viruses, because
we were able to detect amplied EGFP and LTR bands in 35 cycles
of RT-PCR. The results therefore indicate that pLenti/PBS- and
pLenti/PBS.MAp-derived viruses package the viral transgene RNA
with lower efciencies. The RT-PCR results are in a good agreement
with the MT4 and HT1080 infection assays, providing further
conrmation that viral transgene RNA is packaged efciently only
in the presence of the psi element. Thus, the psi element is an absolute requirement.
Discussion
In this study, we clearly demonstrated that deletions or substitutions of the psi and MAp elements did not affect the amount of
viral particles produced, but that efcient encapsidation of viral
transgene RNA depended absolutely on the presence of the psi sequence. Our results are in sharp disagreement with a recent report
that showed that transduction efciency of transgene RNA with a
transgene vector lacking the psi sequence was only 2- to 5-fold less
than with wild type vector containing the psi sequence [21], thus
suggesting that the psi element is not absolutely required for
transgene transduction. What is the source of this discrepancy?
Several differences between the systems that produced these
different results should be noted. Firstly, Laham-Karam and Bacharach used the pCMVdelta8.2 plasmid as the Gag/Pol expression
plasmid. The pCMBdelta8.2 plasmid expresses almost all of the
HIV viral proteins except the envelope and the Vpu proteins [22],
and preserves viral RNA sequences other than the psi sequence.
However, we used a plasmid that encodes and expresses Gag/Pol
only, thus eliminating any possible recombination between the
transgene plasmid and the Gag/Pol expression plasmid in co-trans-

fected cells during virus production. Secondly, we deleted the entire psi sequence including SL14 in our psi-deleted transgene
plasmid (pLenti/PBS.MAp), but a splicing donor sequence normally
embedded in SL2 of psi and some residual sequences around the
psi sequence are preserved in the psi-deleted transgene plasmid
used by Laham-Karam and Bacharach. Thirdly, while Laham-Karam
and Bacharach used a RT assay to determine the level of virus production and the amounts of virus for the infection assay, we used a
p24 viral antigen assay that counts all virus particles produced in a
given condition whether or not the particles are replication-competent. Further detailed comparison and analysis is needed to
establish whether these differences account for the observed
discrepancy.
Another notable result of our study is that the transgene transduction efciency of the pLenti/PBS.psi vector, which does not harbor the MAp sequence, was 2- to 3-fold lower than that of the
pLenti/EGFP vector. This result suggests that the MAp sequence
may also play a role in viral transgene packaging, as MAp has been
reported to bind Gag protein [1719]. Thus, the small reduction of
transduction efciency in the absence of MAp in our assay may be
due to the absence of an additional afnity region provided by the
Map sequence. Our results with the pLenti/MCS vector further support this hypothesis because the substitution of the MAp sequence
with the MCS sequence, which has a similar length to MAp, did not
produce the full effect of the MAp sequence or raise the transduction efciency. We have tested other transgene plasmids containing MCS fragments of different lengths (225 bp or 152 bp), but
the results were the same as those with pLenti/MCS (data not
shown). Thus, these results suggest that the MAp sequence may
not be merely a spacer that functions to sequester the packaging
signal from other surrounding RNAs, but that it may harbor a weak
afnity site for Gag.
In conclusion, our results indicate that the psi sequence, including SL14, is the most important sequence and is unequivocally
required for efcient encapsidation and transduction of viral transgene RNA in the HIV-based lentiviral gene delivery system.
Aknowledgments
The authors thank Dr. Young Joong Lee, Yu Young Jeong, Wone Hae
Ka, and Kyung Lee Yu for advices and supports. This work was
supported by a National Research Laboratory grant (M1050000014806J0000-14810), and a research grant (M10863000011-08N630001110) from the Korean Ministry of Science and Technology.
References
[1] E.O. Freed, M. Martin, HIVs and their replication, in: D. Knipe, P. Howley (Eds.),
Fields Virology, Lippincott Williams & Wilkins, Philadelphia, 2001, pp. 1971
1986.
[2] I. Najera, M. Krieg, J. Karn, Synergistic stimulation of HIV-1 rev-dependent
export of unspliced mRNA to the cytoplasm by hnRNP A1, J. Mol. Biol. 285
(1999) 19511964.
[3] E.O. Freed, HIV-1 replication, Somat. Cell Mol. Genet. 26 (2001) 1333.

S.H. Kim et al. / Biochemical and Biophysical Research Communications 383 (2009) 192197
[4] E.O. Freed, HIV-1 gag proteins: diverse functions in the virus life cycle, Virology
251 (1998) 115.
[5] S.I. Jang, Y.H. Kim, S.Y. Paik, J.C. You, Development of a cell-based assay probing
the specic interaction between the human immunodeciency virus type 1
nucleocapsid and psi RNA in vivo, J. Virol. 81 (2007) 61516155.
[6] E.C. Anderson, A.M. Lever, Human immunodeciency virus type 1 Gag
polyprotein modulates its own translation, J. Virol. 80 (2006) 1047810486.
[7] J.A. Berglund, B. Charpentier, M. Rosbash, A high afnity binding site for the
HIV-1 nucleocapsid protein, Nucleic Acids Res. 25 (1997) 10421049.
[8] D. Muriaux, J. Mirro, D. Harvin, A. Rein, RNA is a structural element in
retrovirus particles, Proc. Natl. Acad. Sci. USA 98 (2001) 52465251.
[9] R.D. Berkowitz, A. Ohagen, S. Hoglund, S.P. Goff, Retroviral nucleocapsid
domains mediate the specic recognition of genomic viral RNAs by chimeric
Gag polyproteins during RNA packaging in vivo, J. Virol. 69 (1995) 64456456.
[10] A. Aldovini, R.A. Young, Mutations of RNA and protein sequences involved in
human immunodeciency virus type 1 packaging result in production of
noninfectious virus, J. Virol. 64 (1990) 19201926.
[11] E. Poole, P. Strappe, H.P. Mok, R. Hicks, A.M. Lever, HIV-1 GagRNA interaction
occurs at a perinuclear/centrosomal site: analysis by confocal microscopy and
FRET, Trafc 6 (2005) 741755.
[12] X. Dong, H. Li, A. Derdowski, L. Ding, A. Burnett, X. Chen, T.R. Peters, T.S.
Dermody, E. Woodruff, J.J. Wang, P. Spearman, AP-3 directs the intracellular
trafcking of HIV-1 Gag and plays a key role in particle assembly, Cell 120
(2005) 663674.
[13] M.D. Resh, Intracellular trafcking of HIV-1 Gag: how Gag interacts with cell
membranes and makes viral particles, AIDS Rev. 7 (2005) 8491.

197

[14] B. Liu, R. Dai, C.J. Tian, L. Dawson, R. Gorelick, X.F. Yu, Interaction of the human
immunodeciency virus type 1 nucleocapsid with actin, J. Virol. 73 (1999)
29012908.
[15] A. Lever, H. Gottlinger, W. Haseltine, J. Sodroski, Identication of a sequence
required for efcient packaging of human immunodeciency virus type 1 RNA
into virions, J. Virol. 63 (1989) 40854087.
[16] L. Naldini, U. Blomer, P. Gallay, D. Ory, R. Mulligan, F.H. Gage, I.M. Verma, D.
Trono, In vivo gene delivery and stable transduction of nondividing cells by a
lentiviral vector, Science 272 (1996) 263267.
[17] C. Parolin, T. Dorfman, G. Palu, H. Gottlinger, J. Sodroski, Analysis in human
immunodeciency virus type 1 vectors of cis-acting sequences that affect gene
transfer into human lymphocytes, J. Virol. 68 (1994) 38883895.
[18] G.L. Buchschacher Jr., A.T. Panganiban, Human immunodeciency virus vectors
for inducible expression of foreign genes, J. Virol. 66 (1992) 27312739.
[19] J.H. Richardson, L.A. Child, A.M. Lever, Packaging of human immunodeciency
virus type 1 RNA requires cis-acting sequences outside the 50 leader region,
J. Virol. 67 (1993) 39974005.
[20] J. Luban, S.P. Goff, Mutational analysis of cis-acting packaging signals in human
immunodeciency virus type 1 RNA, J. Virol. 68 (1994) 37843793.
[21] N. Laham-Karam, E. Bacharach, Transduction of human immunodeciency
virus type 1 vectors lacking encapsidation and dimerization signals, J. Virol. 81
(2007) 1068710698.
[22] L. Naldini, U. Blomer, F.H. Gage, D. Trono, I.M. Verma, Efcient transfer,
integration, and sustained long-term expression of the transgene in adult rat
brains injected with a lentiviral vector, Proc. Natl. Acad. Sci. USA 93 (1996)
1138211388.