You are on page 1of 11

Microbiology Research Journal International

18(2): 1-11, 2017; Article no.MRJI.30484


Previously known as British Microbiology Research Journal
ISSN: 2231-0886, NLM ID: 101608140

SCIENCEDOMAIN international
www.sciencedomain.org

Effect of Physicochemical Parameters on the


Biodegradation of Phenanthrene by Pseudomonas
aeruginosa
V. N. Yogananda Murthy1, V. N. Murulidhar2 and M. Mahesh1*
1

Department of Biotechnology, Azyme Biosciences Pvt. Ltd., Bengaluru-560069, Karnataka, India.


2
Department of Botany, Government First Grade College of Arts, Science and Commerce,
Sira-572137, Karnataka, India.
Authors contributions

This work was carried out in collaboration between all authors. Author MM designed the study and
wrote the protocol. Author VNM wrote the first draft of the manuscript. Authors VNM and MM
managed the analyses of the study. Author VNYM reviewed the experimental design and all drafts of
the manuscript. All authors read and approved the final manuscript.
Article Information
DOI: 10.9734/MRJI/2017/30484
Editor(s):
(1) Grzegorz Cieslar, Department and Clinic of Internal Diseases, Angiology and Physical Medicine, Medical University of
Silesia, Poland.
Reviewers:
(1) S. R. Khandelwal, HPT Arts and RYK Science College, Nasik, Maharashtra, India.
(2) Yousif Abd El-Aziz Elhassaneen, Minoufiya University, Shebin El-Kom, Egypt.
(3) P. N. Palanisamy, Kongu Engineering College, India.
Complete Peer review History: http://www.sciencedomain.org/review-history/17290

Original Research Article

Received 11th November 2016


th
Accepted 16 December 2016
th
Published 20 December 2016

ABSTRACT
Aim: Polycyclic aromatic hydrocarbons (PAHs) are categorised as potentially harmful chemicals of
environmental and health apprehension. Microbial degradation is the principle practice for effective
elimination and abolition of PAHs from polluted environment. Phenanthrene, a PAH compound,
recalcitrant xenobiotic causes severe damage to kidney, liver, fat tissues and causes cancer.
Removal of this from environmental pollutants is expensive by existing methods. To overcome this,
an attempt has been made for the degradation of phenanthrene by using microorganisms.
Materials and Methods: Seven organisms were isolated from thirty six soil samples using M9
media with phenanthrene. One organism that shows highest degradation was identified by
morphological and molecular (16S rRNA sequencing) analysis. Physical parameters such as
incubation period, concentration, pH and temperature and chemical parameters like carbon,
_____________________________________________________________________________________________________
*Corresponding author: E-mail: drmahesh.azyme@gmail.com;

V. N. Yogananda Murthy et al.; MRJI, 18(2): 1-11, 2017; Article no.MRJI.30484

nitrogen and metal ion sources were used for efficient degradation of phenanthrene.
Results: Results revealed that, among the seven organisms, one organism was significantly
effective in degradation and was identified as Pseudomonas aeruginosa by 16S rRNA sequence
and strain kar5, accession No KT225506 was registered in National Centre for Biotechnology
Information (NCBI). Maximum degradation was noticed using 100 ppm concentration at 37C with
pH 7 and 96 hr. Starch showed slightly high degradation compared to other carbon sources such as
sucrose, lactose, maltose and cellulose. In nitrogen sources, tryptone revealed more degradation
than casein, gelatin, egg albumin and bovine serum albumin. Metal ions like MgCl2 and ZnCl2
recoded significant degradation measured by spectrophotometer at 340 nm and confirmed by
HPLC. Maximum growth of microorganism measured by spectrophotometer at 600 nm and reached
to OD 0.851 0.7.
Conclusion: Study confirms that, physico-chemical parameters play a significant role in degrading
soil with high PAHs concentration.
Keywords: HPLC; microbial degradation; spectrophotometer; polycyclic aromatic hydrocarbon;
16S rRNA.
formed
as
products
during
incomplete
combustion of organic matter and their extensive
occurrence in the environment is of great
concern, while many of them are toxic,
mutagenic and carcinogenic [8-9].

1. INTRODUCTION
Polycyclic aromatic hydrocarbons (PAHs) are an
abundant class of organic compounds existing in
the atmosphere. PAHs are ubiquitous compound
originate from natural and anthropogenic
pyrolysis of organic material like forest fire,
automobiles exhaust, coal refining practices and
oil industry [1]. These compounds assumed as
the maximum abundant organic amalgams on
the earth pose a threat to the environment and
mankind [2]. Significant levels are detected in air,
water, soils and sediments [3]. Microbial
degradation of PAHs by bacteria and fungi is
considered as a safe and environment friendly
technique to eradicate contaminated impurities.
Biodegradation of PAHs in soil by microbial
action is of great importance because soil is a
sink for the accumulation of hydrophobic
pollutants including PAHs. Potentially, the rate of
biodegradation could be changed by the addition
of some nutrients [4]. Phenanthrene found as
pollutant in soil, estuarine waters, sediments and
other terrestrial and aquatic sites. When
phenanthrene is ingested, it is lipid soluble and
easily absorbed by the human body. During
metabolism, phenanthrene breaks down in to
epoxy compounds that are highly mutagenic and
carcinogenic affecting lungs, liver and skin [5].
PAHs are commonly found due to atmospheric
activities which include incomplete combustion of
organic matter. Since PAHs are known to
encompass bioaccumulation possesses serial
threat to aquatic and terrestrial habitats [6]. PAHs
are the most important pollutants have been
recognized as potentially toxic with high durability
that causes accumulation of these compounds
in terrestrial organisms. They reduce the
biodiversity rate and reproduction as well as
destroying terrestrial regions [7]. PAHs can be

Currently, many methods are being used for


treatment of contaminated water environments.
Biological processes play a major role in
removal of contaminants and they take
advantage of the astonishing catabolic versatility
of microorganisms to degrade/convert such
compounds [10]. However, bioremediation is an
effective technology with a range of advantages
over the traditional methods. Bioremediation of
waste materials contain hydrocarbons and
heavy metals are based on the ability of
microorganisms such as bacteria and fungi to
absorb or degrade them to non-toxic products.
Microorganisms could be indigenous to a
polluted area or isolated from another place and
transferred to the contaminated site [11].
Bioremediation is regarded as an alternative
method to detoxify PAHs from the environment.
Recent studies have shown that phenanthrene
can be degraded by different bacteria such as
Pseudomonas species, Mycobacterium and
Nocardioides [12-14]. In addition, Sphingomonas
species isolated from soils was able to degrade
phenanthrene and other PAHs [15]. Although
many bacterial species are capable of degrading
PAHs have been isolated, more efficient
PAHs degraders are always ideal in In-situ
bioremediation of PAHs contaminated soils and
sediments [16]. Understanding the significance of
toxicity of phenanthrene in soil, an attempt
has been made to evaluate Pseudomonas
aeruginosa
as
a
potential
strain
for
bioremediation. Further, the study optimises
the necessary conditions for enhancing the
2

V. N. Yogananda Murthy et al.; MRJI, 18(2): 1-11, 2017; Article no.MRJI.30484

efficacy of phenanthrene biodegradation by


Pseudomonas aeruginosa.

(953FACAAGCGGTGGAGCATGTGGT) and 10
picomoles
of
reverse
primer
(1507RaACCTTGTTACGACTTCACCCCAG)was
obtained from Sigma-Aldrich and makeup the
volume to 50 micro litre. The amplified condition
was 95C for 5 min and subjected to
denaturation at 94C for 1 min, annealing at
55C for 1 min, primer extension at 72C for 1
min and for 30 cycles further final extension was
at 72C for 5 min. Amplified sample was run on
agarose gel with 1 kb plus ladder (Invitrogen
Tracklt) to confirm the amplified fragment length.
Sequencing data obtained from Eurofins lab,
Bengaluru was used for identification of organism
compare with 16S rRNA database from NCBI for
similar sequence.

2. MATERIALS AND METHODS


2.1 Soil Sample Collection
Phenanthrene degrading bacterial culture was
isolated by soil samples collected from different
localities such as coal tar, rubber waste,
automobiles and polymer industries in Bengaluru
in a clean, sterile plastic bags and kept at 4C
until they were processed for further operation.

2.2 Chemicals
Phenanthrene (Sigma-Aldrich, purity 96%),
Muller-Hilton media and Luria Bertani (HiMedia), Acetonitrile (Merck) and all
chemicals used for extraction, preparation of
minimal media and bacteria culture were of
analytical grade and supplied by SD fine, India.
Spectrophotometer (Chemito 2000 India) and
HPLC, (Waters 510 Isochratic USA).

2.5 Antibiotic Susceptibility Test


Disk diffusion technique was carried out for
antibiotic susceptibility test. Twelve Commercially
available antibiotics like Ampicillin/Sulbactam (20
mcg), Co-trimoxazole (25 mcg), Cefotaxime (30
mcg), Piperacillin (100 mcg), Chloramphenicol
(30 mcg), Ciprofloxacin (5 mcg), Ceftizoxime (30
mcg), Tetracycline (30 mcg), Ofloxacin (5 mcg),
Gentamicin (10 mcg), Amikacin (30 mcg) and
Gatifloxacin (10 mcg) were selected based on
the CLSI [21] standards placed on the inoculated
agar surface. All the antibiotic discs were
purchased
from
Pathoteq
Biological
Laboratories, India. Test was performed by
applying bacterial inoculums of approximately
8
2 10 CFU/mL on Mueller-Hinton agar plates by
selecting an overnight 18 - 24 hour culture of the
isolates and suspended in a tube contain 0.85%
saline. Turbidity was adjusted to 0.5 McFarland
standards. Suspension was stretch uniformly
over the already prepared Muller Hinton agar
plate by sterile swab stick and antibiotics were
placed on the plates with sterile forceps. Plates
were incubated for 16 - 24 hours at 35C - 37C.
Zones of inhibition were calculated and recorded
after the incubation period and values were
compared with CLSI standards.

2.3 Isolation of Bacteria


Phenanthrene degrading bacteria were isolated
from soil samples using M9 media (Na2HPO4 6
g/L, KH2PO4 3 g/L, NaCl 5 g/L, NH4Cl 10 g/L,
MgSO4 0.1 g/L) [17] with 100 ppm phenanthrene
used as carbon source. Soil samples were
serially diluted, 1 ml of inoculums was poured
into sterile petriplates, media was poured over
that and allowed for solidification. After
solidification petriplates were incubated at 37C
till the distinct colony was formed. Isolated
colonies were recultured on the Luria Bertani
slants.

2.4 Identification of Bacterial Culture


Isolated phenanthrene degrading bacterial
cultures were identified on the basis of their
morphological characteristics and biochemical
tests according to the Bergeys manual of
systematic
bacteriology
[18-19].
Further
identification was carried out by using 16S rRNA
gene sequencing. Genomic DNA was isolated
from bacterial culture and confirmed by agarose
gel electrophoresis [20]. rRNA sequence was
amplified using Corbet research PCR (Australia)
under the following system. 50 ng of template
DNA (2 micro litre), 44 micro litre master mix
(Invitrogen platinum PCR super mix-11306-016),
10
picomoles
of
forward
primer

2.6 Effect of Physical Parameters on


Phenanthrene Biodegradation
2.6.1 Incubation period
All biodegradation experiments were carried out
in M9 media containing 100 ppm phenanthrene
in 100 ml. Inoculate 1 ml culture persuaded by
phenanthrene and incubated at 37C in shaker
incubator with 150 rpm. Degradation and growth
of organism was measured at 340 nm and 600
3

V. N. Yogananda Murthy et al.; MRJI, 18(2): 1-11, 2017; Article no.MRJI.30484

Bovine Serum Albumin (BSA) of different


concentrations i.e. 0.1% to 1.0% used to
influence the degradation of Phenanthrene was
tested at optimum condition.

nm respectively by UV Spectrophotometer at
regular intervals of 12 hrs.
2.6.2 Concentration
Phenanthrene aliquots with concentration 50
ppm, 100 ppm, 150 ppm, 200 ppm and 250 ppm
were added to 100 ml of M9 media separately in
250 ml conical flasks. 1 ml of seed culture was
inoculated and incubated at 37C in shaker
incubator at 150 rpm for 96 hrs. Degradation and
growth of organism was measured at 340 nm
and
600
nm
respectively
by
UV
Spectrophotometer.

2.7.3 Metal ions


Effect of different metal ions such as ZnCl2,
CuSO4, MnSO4, MgCl2 and FeCl3 of various
concentrations of 10 mg to 100 mg were used.
100 ml M9 media along with metal ions were
incubated in rotary shaker for 96 hrs and
optimum conditions were used for the
degradation.

2.6.3 pH

2.8 HPLC Analysis


Degradation

In the experiment, pH ranging from 4.0 to 9.0


was used. pH 4.0-6.0 was adjusted by 1N HCL
and 8.0-9.0 by 1N NaCo3 in 100 ml of M9 media
with 100 ppm phenanthrene separately in 250 ml
conical flasks. Inoculate 1 ml culture enhanced
by phenanthrene and incubated at 37C in
shaker incubator at 150 rpm for 96 hrs.
Degradation and growth of organism was
measured at 340 nm and 600 nm, respectively
by UV Spectrophotometer.

of

Phenanthrene

HPLC chromatography method was used for the


separation
of
phenanthrene
[22].
After
optimization of phenanthrene degradation, cell
free media was used for the HPLC analysis.
Analytical confirmation of phenanthrene standard
was done using HPLC system consisting of
water model 510 isocratic pump, model UVdetector 486 and C18 column (4.6 mm X 250 mm
kromacil). Mobile phase 70:30 acetonitrile: water
with a flow rate of 1 ml/min for 0 to 10 min,
phenanthrene was detected at 254 nm and
concentration was calculated using calibration
curve.

2.6.4 Temperature
Temperature used for the degradation of
phenanthrene ranges at 20, 25, 30, 37, 40, 45
and 50C. Inoculate 1 ml of enriched culture and
incubated at above mentioned temperatures in
shaker incubator at 150 rpm for 96 hrs.
Degradation and growth of organism was
measured at 340 nm and 600 nm respectively by
UV Spectrophotometer.

3. RESULTS
Six organisms were isolated from thirty six soil
samples collected from different industrial
areas in Bengaluru. The organism showing
maximum degradation was confirmed by
spectrophotometer at 340 nm and growth was
measured at 600 nm to found CFU/ml. The
organism was identified using 16S rRNA gene
sequencing and biochemical tests. Universal
primers (27 F and 1492 R) for the amplification
of 16S rRNA were able to amplify the region
giving 1.5 kb size fragment in isolated strain.
Amplicon envisaged on 1% agarose gel with 1X
Tris-acetate EDTA buffer at constant voltage of
80 V. Based on 16S rRNA sequence data,
BLAST search showed 99% resemblance with
Pseudomonas aeruginosa (Fig. 1) and
biochemical tests also shows same characters.

2.7 Effect of Chemical Parameters on


Phenanthrene Biodegradation
2.7.1 Carbon sources
Effect of different carbohydrates on various
concentrations was studied. Glucose, sucrose,
lactose, maltose, cellulose and starch of different
concentrations starting from 0.1% to 1.0% were
used along with 100 ml M9 media and 1 ml of
seed culture was inoculated and incubated
in rotary shaker for 96 hrs. Degradation and
growth of the organism was measured
spectrophotometrically.

This strain is registered in NCBI data bank as


Kar5,
accession
number
KT225506
(http://www.ncbi.nlm.nih.gov/Genebank). In the
results among twelve antibiotics such as
Ampicillin/Sulbactam (20 mcg), C0-Trimoxazole

2.7.2 Nitrogen sources


Effect of different proteins sources such as
Tryptone, Casein, Gelatin, Egg Albumin and
4

V. N. Yogananda Murthy et al.; MRJI, 18(2): 1-11, 2017; Article no.MRJI.30484

Fig. 1. Phylogenic tree of Pseudomonas aeruginosa based on 16S rRNA gene sequences and
numbers at the nodes show bootstrap support stages
(25 mcg), Cefotaxime (30 mcg), Piperacillin (100
mcg), Chloramphenicol (30 mcg), Ciprofloxacin
(5 mcg), Ceftizoxime (30 mcg), Tetracycline (30
mcg), Ofloxacin (5 mcg), Gentamicin (10 mcg),
Amikacin (30 mcg) and Gatifloxacin (10 mcg),
Co-Trimoxazole recorded least zone of inhibition
and it is indicating less resistance to this
antibiotic. On the other hand, Ciprofloxacin
shows highest zone of inhibition indicating more
sensitivity (Fig. 2).

degradation was shown at 96 hrs and growth of


organism was measured at 600 nm, optical
density reaches to 0.85 0.7 (Fig. 3).

Fig. 3. Bacterial growth of Pseudomonas


aeruginosa at different incubation period for
the degradation of phenanthrene

Fig. 2. Clear zone of inhibition of all 12


antibiotics for Pseudomonas aeruginosa

Different concentrations of phenanthrene were


used for the degradation. After 96 hrs,
degradation was estimated spectrophotometrically at 340 nm. Results revealed that,
degradation was maximum at 100 ppm. Growth
of the organism at 96 hrs is 0.890 and optical
density (OD) was measured spectrophotometrically at 600 nm (Fig. 4).

Amount of phenanthrene degradation was


studied from 12 hrs to 144 hrs of incubation.
There was an activity found at 96 hrs of
incubation, degradation decreased gradually
after 96 hrs. Degradation was measured by
spectrophotometer at 340 nm, 78% of

pH was an important factor significantly affecting


the degradation of phenanthrene. Fermentative
degradation of phenanthrene was carried out at
different pH at 4, 5, 6, 7, 8, 9 and 10. Maximum
degradation of 80% was at pH 7 with growth at
0.890 and OD measured spectrophotometrically.
5

V. N. Yogananda Murthy et al.; MRJI, 18(2): 1-11, 2017; Article no.MRJI.30484

Degradation and microbial growth decreased


significantly above pH 8 (Fig. 5).

nitrogen source compared to other nitrogen


sources and significant change in the
degradation was noticed when the P value is
0.01 (Fig. 8).

Fig. 4. Bacterial growth of Pseudomonas


aeruginosa at different concentrations for the
degradation of phenanthrene

Fig. 6. Bacterial growth of Pseudomonas


aeruginosa at different temperatures for the
degradation of phenanthrene

Fig. 5. Bacterial growth of Pseudomonas


aeruginosa at different pH levels for the
degradation of phenanthrene
Fig. 7. Bacterial growth of Pseudomonas
aeruginosa at various carbon sources for the
degradation of phenanthrene

Degradation of phenanthrene at different


temperatures viz., 20, 25, 30, 35, 40, 45 and
50C in a rotary shaker was examined by
keeping the other fermentation condition
constant. It is observed that, maximum
degradation of 90% occurred at 35C and
degradation and growth was very low above
45C (Fig. 6).
Effect of different carbohydrates on various
concentrations was examined. Glucose, sucrose,
lactose, maltose, cellulose and starch at 0.1%
level were used along with 100 ml M9 medium.
Starch gave slightly high degradation than other
sugars and P value is 0.11. But there is no
significant change in the degradation (Fig. 7).
Different proteins sources such as tryptone,
casein, gelatin, egg albumin and BSA were used
for the degradation.
Approximately 5%
degradation was enhanced in tryptone as a

Fig. 8. Bacterial growth of Pseudomonas


aeruginosa at various nitrogen sources for
the degradation of phenanthrene
6

V. N. Yogananda Murthy et al.; MRJI, 18(2): 1-11, 2017; Article no.MRJI.30484

Various metal ions such as ZnCl2, CuSO4,


MnSO4, MgCl2 and FeCl3 were used for the
degradation. Among these metal ions, MgCl2 and
ZnCl2 show maximum degradation and change in
degradation were highly significant when P value
is 0.003 (Fig. 9).

sequence data can be used for multiple


purposes, unlike DNA hybridization (70%
association) there are no defined threshold
values (e.g., 98.5% similarity) above that there is
universal agreement which constitutes definitive
and conclusive identification to the rank of
species. One of the best advanced processes to
identification of bacteria analysis by 16S rRNA
sequences is the single best method [30]. Use of
16S rRNA gene classifications to study the
bacterial phylogeny and taxonomy has been by
far the most common housekeeping genetic
marker used for a many reasons include (1) its
occurrence in almost all bacteria, frequently
existing as a multigene family, (2) function of the
16S rRNA gene over time has not changed,
signifying that random sequence changes are
more accurate measure of evolution and (3) 16S
rRNA gene (1,500 bp) is big enough for
informatics determinations [31].

Fig. 9. Bacterial growth of Pseudomonas


aeruginosa at various metal ions for the
degradation of phenanthrene

In the present study, one strain with high


phenanthrene degrading ability was isolated and
identified as Pseudomonas aeruginosa. This
genus was reported as a PAH degrader that
could also decompose many other organic
recalcitrant pollutants [32]. The isolated organism
was Pseudomonas aeruginosa and there was no
resistance against twelve antibiotics to confirm
that it is non-pathogenic organism. P. aeruginosa
is a gram negative organism, an opportunity
pathogen which causes critical damage to the
tissue like liver, urinary tract and kidney results in
fatality. Results obtained are of harmless and
promise to use this strain for the biodegradation
of PAHs compounds. Rapid method for
identification of pathogenic organism by
antibiotic susceptibility test in vitro is best
confirmed [33].

After optimization of phenanthrene degradation,


cell free media was used for the HPLC analysis.
The standard phenanthrene Retention Time (Rt)
is 1.7 min, and our results also show the same
(Rt) and it confirms the qualitative analysis of
phenanthrene. Quantitative estimation was done
by area and based on the area 96% degradation
was occurred (Fig. 10).

4. DISCUSSION
Bengaluru is well known for rapid increase in
urbanisation, industrialisation and globalisation.
Soil samples collected areas are highly polluted
with hydrocarbons, heavy metals, pesticides etc.
Polluted soils with hydrocarbons are good
sources for the segregation of PAHs degrading
bacteria that can be used for the exclusion of
such compounds from the location [23-24].
Number of bacterial species is known to degrade
PAHs and most of them are isolated from
contaminated
soil
or
sediments
[25].
Pseudomonas aeruginosa [26], Pseudomonas
fluoresens, Mycobacterium sp., Haemophilus sp.,
Rhodococcus sp. are some of the commonly
studied PAHs degrading bacteria [27-28].
Supplementation of contaminated soils with
compost
materials
can
also
enhance
biodegradation without long-term accumulation of
extractable polar. A DNA fragment commonly
used for taxonomic determinations of bacteria is
the 16S rRNA gene [29]. 16S rRNA gene

Physical factors such as incubation period,


concentration, pH and temperature have been
shown to play a major role in controlling microbial
growth and activity during hydrocarbon
biodegradation [34]. Incubation time plays a very
important role in multiplication of the organisms,
increases the time and low nutrient results in the
increase of colony forming unit and normally the
incubation time taken is nearly more than a week
[35]. Present results also revealed the same.
Rate of biodegradation depends on microbial
population,
degree
of
acclimatisation,
accessibility of nutrients, chemical structure of
the compound, cellular transport properties and
chemical partitioning in the growth medium [36].
pH has been found as the most important factor
affecting biodegradation process. pH of culture
7

V. N. Yogananda Murthy et al.; MRJI, 18(2): 1-11, 2017; Article no.MRJI.30484

Fig. 10. HPLC analysis for the degradation of phenanthrene


medium can affect microbial diversity by altering
the enzymatic activity, transporting processes
and nutrient solubility [37]. It was reported that
most petroleum degrading bacterial species have
degrading property at pH = 6-8, but the optimum
degradation abilities is observed at pH near 7
[38]. Biodegradation process was active at a pH
range from 6 to 8 in the present experiment, but
highest biodegradation rate (23%) was obtained
at pH 7. Present results are similar to the one
observed in phenanthrene degradation in
Mycobacterium vanbaalenii PYR-1 at pH 6.5 to
7.5 [39]. Degree of biodegradation is
censoriously dependent on salinity, temperature,
pH, nutrients and presence of readily available
carbon sources [40-42]. It is reported that,
phenanthrene degraded powerfully at pH 7 and
temperature 35C and the degradation rate
improved by the addition of yeast extract and
glucose [43]. Temperature was found as the next
effective factor affecting biodegradation process.
In general this is one of the most important
factors affecting biodegradation of petroleum
hydrocarbons through its positive effects on
bacterial metabolism [44]. In the present
experiment, best biodegrading efficiency was
achieved at nearly highest temperature (35C).
This could be due to the increased solubility of
PAHs at higher temperatures that is causing a
noticeable improvement in the bioavailability of
molecules [45].

Obtainability of an easily used carbon source


carbohydrates also did not enhance degradation
of Phenanthrene. Indicating carbohydrates are
not a limiting factor and organic carbons are the
common substrates i.e., usually referred to as
heterotrophic microorganisms for the main
energy sources [46]. Present study reveals that,
lack of nitrogen source may slow down the
biodegradation of phenanthrene and cause it to
gather in the sediments. It is reported that,
phosphorus and not nitrogen was a limiting factor
in the biodegradation of p-nitrophenol (PNP) in
lake water [47]. Earlier reports revealed slightly
inhibited
enzyme
production
at
lower
concentrations of metals and subsequent
reduction in hydrocarbon content [48]. Study
conducted on biodegradation of phenanthrene in
a soil slurry reactor using an immobilized
bacterial culture of Zoogloea and reported that,
an overall degradation of phenanthrene was 87%
[49]. PAHs can be removed from soil by
composting and revealed 90% degradation of
phenanthrene after 30 days [50].

5. CONCLUSION
Pseudomonas aeruginosa isolated from soil with
hydrocarbon residues has the potential in
degrading
phenanthrene
under
optimum
conditions in bioremediation process of the
contaminated environment. In congruence with
8

V. N. Yogananda Murthy et al.; MRJI, 18(2): 1-11, 2017; Article no.MRJI.30484

the earlier findings, present study provides that


Pseudomonas aeruginosa is considered as a
potential
strain
for
biodegradation
of
phenanthrene in hydrocarbon industries. It is
suggested that a study of the interaction of
physicochemical parameters is crucial for the
optimization of PAHs biodegradation processes.
The findings recommended that, employing
Pseudomonas aeruginosa is more efficient than
the earlier reported bioremediation agents.

8.

9.

COMPETING INTERESTS
Authors have
interests exist.

declared

that

no

10.

competing

REFERENCES
1.

2.

3.

4.

5.

6.

7.

Hughes JB, Beckles DM, Chandra SD,


Ward CH. Utilization of bioremediation
processes for the treatment of PAHcontaminated sediments. J. Ind. Microbiol.
Biotech. 1997;18(2):152-160.
DOI: 10.1038/sj.jim.2900308
Mrozik A, Piotrowska-Seget Z, Labuzek S.
Bacterial degradation and bioremediation
of polycyclic aromatic hydrocarbons. Pol.
J. Environ. Stud. 2003;12(1):15-25.
Yang Y, Hildebrand F. Phenanthrene
degradation in subcritical water. Anal.
Chim. Acta. 2006;555(2):364-369.
DOI: 10.1016/J.ACA.2005.08.078
Das K, Mukherjee AK. Crude petroleum-oil
biodegradation efficiency of Bacillus
subtilis and Pseudomonas aeruginosa
strains isolated from a petroleum-oil
contaminated soil from North-East India.
Bioresour.
Technol.
2007;98(7):13391345.
DOI: 10.1016/J.BIORTECH.2006.05.032
Tian L, Ma P, Zhong JJ. Kinetics and key
enzyme
activities
of
phenanthrene
degradation by Pseudomonas mendocina.
Process Biochem. 2002;37(12):1431-1437.
DOI: 10.1016/S0032-9592(02)00032-8
Jarup L. Hazards of heavy metal
contamination. Br. Med. Bull. 2003;
68(1):167-182.
DOI: 10.1093/bmb/ldg032
Hetzer A, Daughney CJ, Morgan HW.
Cadmium
ion
biosorption
by
the
thermophilic
bacteria
Geobacillus
stearothermophilus
and
G.
thermocatenulatus.
Appl.
Environ.
Microbiol. 2006;72(6):4020-4027.
DOI: 10.1128/AEM.00295-06

11.

12.

13.

14.

15.

16.

17.

Juhasz AL, Naidu R. Bioremediation of


high molecular weight polycyclic aromatic
hydrocarbons: A review of the microbial
degradation
of
benzo[a]pyrene.
Int.
Biodeter. Biodegr.
2000;45(1&2):57-88.
DOI: 10.1016/S0964-8305(00)00052-4
Langworthy DE, Stapleton RD, Sayler GS,
Findlay RH. Lipid analysis of the response
of a sedimentary microbial community to
polycyclic aromatic hydrocarbons. Microb.
Ecol. 2002;43(2):189-198.
DOI: 10.1007/s 00248-001-1040-6
Samanta SK, Singh OV, Jain RK.
Polycyclic
aromatic
hydrocarbons:
Environmental
pollution
and
bioremediation. Trends Biotechnol. 2002;
20(6):243-248.
DOI: 10.1016/S0167-7799 (02)01943-1
Park HI, Kim DK, Choi YJ, Pak D. Nitrate
reduction using an electrode as direct
electron donor in a biofilm-electrode
reactor. Process Biochem. 2005;40(10):
3383-3388.
DOI: 10.1016/J.PROCBIO.2005.03. 017
Doddamani
HP,
Ninnekar
HZ.
Biodegradation of phenanthrene by a
Bacillus species. Curr. Microbiol. 2000;
41(1):11-14.
DOI: 10.1007/s002840010083
Balashova
NV,
Kosheleva
IA,
Golovchenko
NP,
Boronin
AM.
Phenanthrene
metabolism
by
Pseudomonas and Burkholderia strain.
Process Biochem. 1999;35:291-296.
DOI: 10.1016/S0032-9592(99)00069-2
Miller CD, Hall K, Liang YN, Nieman K,
Sorensen D, Issa B, Anderson AJ, Sims
RC. Isolation and characterization of
polycyclic aromatic hydrocarbon-degrading
Mycobacterium isolates from soil. Microb.
Ecol. 2004;48(2):230-238.
DOI: 10.1007/ s00248-003-1044-5
Iwabuchi T, Yamauchi YI, Katsuta A,
Harayama S. Isolation and characterization
of marine Nocardioides capable of growing
and degrading phenanthrene at 42C. J.
Mar. Biotechnol. 1998;6(2):86-90.
Prabhu Y, Phale PS. Biodegradation of
phenanthrene by Pseudomonas sp. strain
PP2: Novel metabolic pathway, role of bio
surfactant and cell surface hydrophobicity
in
hydrocarbon
assimilation.
Appl.
Microbiol. Biotechnol. 2003;61(4):342-351.
DOI: 10.1007/s00253-002-1218-y
Kubota A, Maeda T, Nagafuchi N,
Kadokami
K,
Ogawa
HI.
TNT
biodegradation
and
production
of

V. N. Yogananda Murthy et al.; MRJI, 18(2): 1-11, 2017; Article no.MRJI.30484

18.

19.

20.

21.

22.

23.

24.

25.

26.

dihydroxylamino-nitrotoluene by aerobic
TNT degrader Pseudomonas sp. Strain
TM15
in
an
anoxic
environment.
Biodegradation. 2008;19:795-805.
DOI: 10.1007/s10532-008-9182-6
Garrity, Boone G, Castenholz DR, Richard
W. Bergeys manual of systematic
bacteriology. New York: Springer-Verlag.
2001;1:27-31.
Chen J, Wong MH, Wong YS, Tam NFY.
Multi-factors on biodegradation kinetics of
polycyclic aromatic hydrocarbons (PAHs)
by Sphingomonas sp. a bacterial strain
isolated from mangrove sediment. Mar.
Pollut. Bull. 2008;57(6-12):695-702.
DOI: 10.1016/J.MARPOLBUL.2008.03.013
Marmur J. A procedure for the isolation of
deoxyribonucleic
acid
from
microorganisms. J. Mol. Biol. 1961;3(2):208-218.
DOI: 10.1016/S0022-2836(61) 80047-8
Clinical and Laboratory Standards Institute.
Performance standards for antimicrobial
th
susceptibility
testing.
The
24
Informational Supplement; 2014.
Wolfe MF, Schwartz GJB, Singaram S,
Mielbrecht EE, Tjeerdema RS, Sowby ML.
Effects of salinity and temperature on the
bioavailability of dispersed petroleum
hydrocarbons to the golden brown algae,
Isochrysis
galbana.
Arch.
Environ.
Contam. Toxicol. 1998;35(2):268-273.
DOI: 10.1007/s002449900375
Jacques RJS, Santos EC, Bento FM,
Peralba M, Selbach PA, Fla S, Camargo
FAO.
Anthracene
biodegradation
by Pseudomonas sp. isolated from a
petrochemical sludge land farming site. Int.
Biodeter. Biodegr. 2005;56(3):143-150.
DOI:10.1016/j.ibiod.2005.06.005
Al-Thani RF, Abd-El-Haleem DAM, AlShammri M. Isolation and characterization
of polyaromatic hydrocarbons-degrading
bacteria from different Qatari soils. Afr. J.
Microbiol. Res. 2009;3(11):761-766.
Phale PS, Basu A, Majhi PD, Deveryshetty
J, Vamsee-Krishna C, Shrivastava R.
Metabolic diversity in bacterial degradation
of aromatic compounds. OMICS: A Journal
of Integrative Biology. 2007;11(3):252-279.
DOI:10.1089/omi.2007.0004
Romero MC, Cazau MC, Giorgieri S,
Arambarri AM. Phenanthrene degradation
by microorganisms isolated from a
contaminated stream. Environ. Poll. 1998;
101(3):355-359.
DOI: 10.1016/S0269-7491 (98)00056-6

27.

28.

29.

30.

31.

32.

33.

34.

35.

10

Lyle NH, Pena OM, Boyd JH, Hancock


REW. Barriers to the effective treatment of
sepsis: Antimicrobial agents, sepsis
definitions, and host-directed therapies.
Ann. N. Y. Acad. Sci. 2014;1323:101-114.
DOI:10.1111/nyas.12444
Coral G, Karagoz S. Isolation and
characterization
of
phenanthrene
degrading bacteria from a petroleum
refinery soil. Ann. Microbiol. 2005;
55(4):255-259.
Li JL, Bai R. Effect of a commercial alcohol
ethoxylate surfactant (C11-15 E7) on
biodegradation of phenanthrene in a saline
water
medium
by
Neptunomonas
naphthovorans. Biodegradation. 2005;16
(1):57-65.
DOI: 10.1007/s10531-004-0429-1
Janda JM, Abbott SL. 16S rRNA Gene
sequencing for bacterial identification in
the diagnostic laboratory: pluses, perils
and pitfalls. J. Clin. Microbiol. 2007;45(9):
2761-2764.
DOI: 10.1128/JCM.01228-07
Patel JB. 16S rRNA gene sequencing for
bacterial pathogen identification in the
clinical laboratory. Mol. Diagn. 2001;6(4):
313-321.
DOI: 10.1007/BF03262067
Zhang H, Kallimanis A, Koukkou AI,
Drainas C. Isolation and characterization
of novel bacteria degrading polycyclic
aromatic hydrocarbons from polluted
Greek soils. Appl. Microbiol. Biotechnol.
2004;65(1):124-131.
DOI: 10.1007/s00253-004-1614-6
Kerremans JJ, Verboom P, Stijnen T,
Hakkaat-Van Roijen L, Goessens W,
Verbrugh HA, Vos MC. Rapid identification
and antimicrobial susceptibility testing
reduce antibiotic use and accelerate
pathogen-directed antibiotic use. J.
Antimicrob. Chemother. 2008;61(2):428435.
DOI: 10.1093/jac/dkm497
Coulon F, McKew BA, Osborn AM,
McGenity TJ, Timmis KN. Effects of
temperature and biostimulation on oildegrading microbial communities in
temperate estuarine waters. Environ.
Microbiol. 2007;9(1):177-186.
DOI: 10.1111 /j.1462-920.2006.01126.x
Janssen PH, Yates PS, Grinton BE, Taylor
PM, Sait M. Improved culturability of
soil bacteria and isolation in pure culture
of novel members of the divisions
Acidobacteria,
Actinobacteria,

V. N. Yogananda Murthy et al.; MRJI, 18(2): 1-11, 2017; Article no.MRJI.30484

Proteobacteria and Verrucomicrobia. Appl.


characteristics between free-living bacteria
and attached bacteria during the PAH
Environ. Microbiol. 2002;68(5):2391-2396.
DOI: 10.1128/AEM.68.5.2391-2396.2002
biodegradation in a soil/water system. Eur.
36. Timothy
Hong
YS,
Rosen
MR,
J. Soil Biol. 2007;43(5-6):283-296.
Bhamidimarri R. Analysis of a municipal
DOI: 10.1016/j.ejsobi.2007.02.012
wastewater treatment plant using a neural 44. Mohn WW, Stewart GR. Limiting factors
network-based pattern analysis. Water
for hydrocarbon biodegradation at low
Res. 2003;37(7):1608-1618.
temperature in Arctic soils. Soil Biol.
DOI: 10.1016/S0043-1354(02)00494-3
Biochem. 2000;32(8-9):1161-1172.
37. Lin C, Gan L, Chen ZL. Biodegradation of
DOI: 10.1016/S0038-0717(00)00032-8
naphthalene by strain Bacillus fusiformis 45. Margesin R, Schinner F. Biodegradation
(BFN). J Hazard Mater. 2010;182(1-3):
and bioremediation of hydrocarbons in
771-777.
extreme environments. Appl. Microbiol.
DOI: 10.1016/J.JHAZMAT.2010.06.101
Biotechnol. 2001;56(5-6):650-663.
38. Srikanth Reddy M, Naresh B, Leela T,
DOI: 10.1007/s002530100701
Prashanthi
M,
Madhusudhan
NC,
46. Zaidi BR, Imam SH. Factors affecting
Dhanashri
G,
Prathibha
Devi.
microbial
degradation
of
polycyclic
Biodegradation of phenanthrene with
aromatic hydrocarbon Phenanthrene in the
biosurfactant production by a new strain of
Caribbean coastal water. Mar. Poll. Bull.
Brevibacillus sp. Bioresour. Technol. 2010;
1999;38(8):737-742.
101(20):7980-7983.
DOI: 10.1016/S0025-326x(99)00037-5
DOI: Org/10.1016/J. biortech.2010.04.054
47. DAnnibale A, Ricci M, Leonardi V,
39. Kim YH, Freeman JP, Moody JD,
Quaratino D, Mincione E, Petruccioli M.
Engesser KH, Cerniglia CE. Effects of pH
Degradation of aromatic hydrocarbons by
on the degradation of phenanthrene and
white-rot
fungi
in
a
historically
pyrene by Mycobacterium vanbaalenii
contaminated soil. Biotechnol. Bioeng.
PYR-1. Appl. Microbiol. Biotechnol. 2005;
2005;90(6):723-731.
67(2):275-285.
PMID: 15858792
DOI: 10.1007/s00253-004-1796-y
48.
Wan
N, Gu J, Yan Y. Degradation of
40. Margesin R, Schinner F. Biodegradation
p-nitrophenol
by
Achromobacter
and bioremediation of hydrocarbons in
xylosoxidans NS isolated from wetland
extreme environments. Appl. Microbiol.
sediment. Int. Biodeter. Biodegrad. 2006;
Biotechnol. 2001;56:650-663.
59:90-96.
DOI: 10.1007/s002530100701
DOI: 10.1016/j.ibiod.2006.07.012
41. Okpokwasili GC, Nweke CO. Microbial
49. Lu XY, Zhang T, Fang HHP. Bacteriagrowth and substrate utilization kinetics.
mediated PAH degradation in soil and
Afr. J. Biotechnol. 2005;5:305-317.
sediment. Appl. Microbiol. Biotechnol.
42. Adelaja O, Keshavarz T Kyazze G. The
2011;89(5):1357-1371.
effect of salinity, redox mediators and
DOI: 10.1007/s00253-010-3072-7
temperature on anaerobic biodegradation
of petroleum hydrocarbons in microbial 50. Kathi Srujana, Anisa B. Khan. Isolation and
characterisation of Polycyclic Aromatic
fuel cells. J. Hazard Mater. 2015;283:211Hydrocarbon degrading soil microbes from
217.
automobile workshop sediments. J.
DOI: 10.1016/J.JHAZMAT.2014.08.066
Environ. Sci. Technol. 2012;5(1):74-83.
43. Chang YT, Lee JF, Chao HP. Variability of
DOI: 10.3923/jest.2012.74.83
communities
and
physiological
_________________________________________________________________________________
2017 V. N. Yogananda Murthy et al.; This is an Open Access article distributed under the terms of the Creative Commons
Attribution License (http://creativecommons.org/licenses/by/4.0), which permits unrestricted use, distribution, and reproduction
in any medium, provided the original work is properly cited.

Peer-review history:
The peer review history for this paper can be accessed here:
http://sciencedomain.org/review-history/17290

11