Fish & Shellsh Immunology 60 (2017) 65e71

Contents lists available at ScienceDirect

Fish & Shellsh Immunology

journal homepage: www.elsevier.com/locate/fsi

Full length article

Dietary effect of apple cider vinegar and propionic acid on immune

related transcriptional responses and growth performance in white
shrimp, Litopenaeus vannamei
Sajjad Pourmozaffar*, Abdolmajid Hajimoradloo, Hamed Kolangi Miandare
Department of Fisheries, Faculty of Fisheries and Environmental Sciences, Gorgan University of Agricultural Sciences and Natural Resources, Gorgan, Iran

a r t i c l e i n f o

a b s t r a c t

Article history:
Received 5 August 2016
Received in revised form
4 November 2016
Accepted 9 November 2016
Available online 10 November 2016

This experiment was conducted to study the effect of various levels of ACV and Propionic acid (PA) on
expression of immune related genes and growth performance in white shrimp (Litopenaeus vannamei).
Three hundred and seventy-ve shrimps with an average initial weight of 10.2 0.04 g were collected
and acclimatized for two weeks. Five experimental diets including control diet, 0.5% PA diet and 1%, 2%
and 4% ACV diets were applied to feed the shrimps. They were fed 4 times a day with 2.5% of body
weight. After 60 days of culture, shrimps fed with ACV and PA diets showed no signicant difference in
growth performance. Expression of prophenoloxidase (proPo), lysozyme (Lys), penaeidin-3a (Pen-3a)
and Crustin (Cru) genes were determined from hepatopancreas, using the real-time PCR after 15, 30 and
60 days. Expression of Lys and proPo genes was signicantly up regulated in shrimps fed with ACV and
PA diets compared to the control group after 30 and 60 days of treatment. After 15 days, Pen-3a gene
expression was signicantly higher in PA group compared to the control group. Also, shrimps fed with 1%
and 4% ACV and PA diets showed signicantly increased expression of Pen-3a after 30 days. In contrast,
expression of Cru was signicantly down regulated in response to ACV diets, but, Cru expression in
treated shrimps with PA diet was greater than the control group after 30 and 60 days. Overall, the results
provided evidence that ACV could be used as a natural immunostimulant for shrimps in order to adjust
and enhance expression of the immune related genes.
2016 The Authors. Published by Elsevier Ltd. This is an open access article under the CC BY-NC-ND
license (http://creativecommons.org/licenses/by-nc-nd/4.0/).

Keywords:
Litopenaeus vanname
Apple cider vinegar
Propionic acid
Growth performance
Immune genes

1. Introduction
The occurrence and spread of diseases in aquaculture industry
can signicantly restrict the productivity and as a result, farmers
extremely use antibiotics in order to prevent diseases. The wide use
of antibiotics can increase concerns due to their negative effects on
growth performance, resistant bacterial strains in host animals,
potential harms to human and the environment. So their usage has
been limited or banned in many countries. Also, A protective way
such as using vaccines has been investigated to reduce the outbreak
of diseases and mortality in aquaculture systems; however, it
cannot be utilized for all crustaceans because they don't have
specic immune systems [1]. That is why, identifying appropriate

* Corresponding author. Department of Fisheries, Gorgan University of Agricultural Sciences and Natural Resources, Gorgan, 49138-15739, Iran. Fax: 98
7142216191.
E-mail address: Sajjad5550@gmail.com (S. Pourmozaffar).

antibiotic alternatives is receiving increasing attention and organic

acids also recently have been investigated to apply in aquaculture
feeds [2]. Moreover, other dietary additives, including probiotics
and immunostimulants have increased the immunological responses of L. vannamei [1,3,4]. Organic acids are Generally Regarded as Safe compounds often containing one or more carboxyl
groups (eCOOH) with antimicrobial in the livestock food industry
[5]. Organic acids (C1eC6) such as citric, formic, lactic, malic, acetic,
butyric, propionic and sorbic acids have been shown to promote
growth performance in aquaculture animals. Several studies have
revealed that dietary supplements of organic acids or their salts
enhanced the growth performance in Beluga (Huso huso) [6], Red
drum (Sciaenops ocellatus) [7], Rainbow trout (Oncorhynchus
mykiss) [8], White leg shrimp (Litopenaeus vannamei) [5,9] and
piglet [10].
The primary antimicrobial action of organic acids is limiting
growth of bacteria. Carboxyl group in organic acids can passively
diffuse through cell wall of Gram negative bacteria, and reduces the
internal bacterial cytoplasm pH thus prevents bacterial metabolism

http://dx.doi.org/10.1016/j.fsi.2016.11.030
1050-4648/ 2016 The Authors. Published by Elsevier Ltd. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).

66

S. Pourmozaffar et al. / Fish & Shellsh Immunology 60 (2017) 65e71

and reduces harmful bacteria in the host [5,11,12]. Oral consumption is the most common way to add organic acids. The Shrimps
(L. vannamei) fed with butyrate showed lower number of Vibrio sp.
in the intestine [9]. Also, total viable bacteria and Vibrio numbers in
the hepatopancreas tiger shrimps (Penaeus monodon) fed with
organic acids signicantly decreased [2]. Similarly, the benzoic acid
in piglets could reduce, the number of gram negative bacteria in
piglets [10]. Recently, in vitro assays have used organic acids to
evaluate the inhibitory effects on growth of Vibrio harveyi and the
results indicated that the minimum inhibitory concentrations of
acetic and propionic acids were 0.041% and 0.03%, respectively [13].
Because of these promising results, assessment of immune related
genes activity caused by products of organic acids has been deemed
essential.
At the present time, feed additives of natural origin, used in
natural medicine with a fractional afnity. ACV (Apple Cider Vinegar) is one of these natural substances known for hundred years
from renaissance. In fact, it was rstly used some 5000 years ago.
Hippocrates, prescribed the mixture of honey and apple cider
vinegar as a therapy for various diseases [14]. ACV is an acidic solution produced by fermenting apples. ACV counteracts injurious
bacteria that might be present in some foods and could aid digestion process [15]. In addition, it was recently shown that this substance hase a variety of pharmacological functions, (e.g.
antioxidant, antidiabetic, etc.), and also is able to decrease the
cholesterol level [16].
Despite the benecial effects of dietary organic acids supplementation in animal species, to the best of our knowledge, no
previous studies exists regarding the application of dietary ACV in
aquaculture. Therefore, the objectives of the present study performed to investigate dietary ACV and PA effects on growth parameters and expression of immune related genes in Litopenaeus
vannamei with initial body weight of 10 g.

diet, 1%, 2%, 4% ACV and 0.5% PA diets to ensure equal amounts of
gelatin in all experimental diets. The proximate composition of
diets have been described in the methodology as determined
following standard AOAC methods [18] and previously described in
da silva et al. [9]. The method of Kjeldahl based on nitrogen levels
was used to determine the crude protein. The crude ber was
analyzed by the sulfuric acid detergent method. The dry matter was
estimated by gravimetric analysis after drying in an oven at 100  C
for 24 h. The crude ash was calculated gravimetrically by burning,
in a mufe furnace, at 550  C for 6 h. Finally, the crude lipid was
analyzed based on ether extractison.
2.2. Experimental design
Three hundred and seventy-ve healthy individuals of
L. vannamei (10.2 0.04 g) obtained from the local commercial
shrimp farm in Gomishan, Golestan province, Iran. They were
transported to the aquaculture lab at Gorgan university of Agricultural Sciences and Natural Resources then acclimatized to the
experimental conditions for two weeks. After adaptation, the
shrimps were randomly distributed to fteen 400 L berglass tanks
at 20.27 1.21 ppt and 25.84 1.64  C. Water quality parameters
were measured daily. Shrimps were fed daily with the experimental diets. Also, they were fed at 2.5% of body weight with its
experimental diets at 07:00, 11:30, 15:30 and 22:00 during the
experimental period (60 days). Food Ingredients and composition
are presented in Table 1. At the end of acclimatization, the shrimps
were randomly distributed to ve groups and fed with the commercial diet (control group) while the other groups were fed with
different doses of ACV (containing 5% acetic acid) including 1%, 2%
and 4% and 0.5% liquid Propionic acid (Sigma Aldrich St. Louis, Mo,
USA, pure 99.5%).
2.3. Biometry and growth parameters assay

2. Material and method

2.1. Feed preparation
Food composition is presented in Table 1. Commercial shrimp
feed (from pellet sizes of 2 mm) were produced from Beyza Feed
Mill (Iran) for use at stage of the grow-out cycle. After grinding the
feed, we mixed it with water. The pelletizing process was carried
out through a meat grinder [12] and gelatin was added as binder
[17]. For experimental diets, ACV and PA were sprayed over a basal
shrimp feed. The experimental diets were dried according to a
previously described method [12]. The gelatin was added in control
Table 1
Ingredient (g kg1 dry matter) and proximate composition of basal diet.
Ingredient

Treatments
Control

1% ACV

Fish meal
255
255
Soybean meal
320
320
Wheat our
275
275
Wheat gluten
50
50
Shrimp shell meal
30
30
Fish oil
30
30
Lecithin
10
10
Vitamin complex
20
20
Mineral complex
10
10
Proximate composition (g kg1 dry weight)
Dry matter
907
907
Crude protein
475
475
Crude lipid
110
110
Crude ber
51
51
Crude ash
75
75

2% ACV

4% ACV

0.5% PA

255
320
275
50
30
30
10
20
10

255
320
275
50
30
30
10
20
10

255
320
275
50
30
30
10
20
10

907
475
110
51
75

907
475
110
51
75

907
475
110
51
75

At the end of the feeding trial, growth performance of different

treatments were calculated according to Zokaeifar et al. [20].
Weight gain (%) {(Final body weight  Initial body weight)/
Initial body weight}  100.
Specic growth rate (SGR %) {(ln Final bodyweight  ln Initial
body weight)/Experiment period}  100.
Food conversion ratio (FCR) Total feed intake (g)/Total wet
weight gain (g).
2.4. RNA extraction
During the feeding period, three shrimps from each replication
were sampled randomly after 15, 30 and 60 days for immune genes
expression assays. Expressions of Lys, Cru, Pen-3a, proPo and bactin were determined from the hepatopancreas. The samples were
frozen immediately in liquid nitrogen and stored at 80  C until
RNA extraction. Total RNA of hepatopancreas was isolated using
RNAx Plus (CinnaGen, Iran) according to the manufacturer's instructions. Afterwards, the quantity and concentration of RNA were
measured by spectrophotometer at 260 and 280 nm, and the RNA
ratios (A260:A280) greater than 1.8 were used for further experiments. The RNA quality was evaluated by electrophoresis on a 1.5%
agarose gel and staining with ethidium bromide. First-strand cDNA
synthesis by SuPrime Script RT Premix (2X) cDNA Synthesis Kit
(GeNet BIO Inc; Daejeon, South Korea) following the protocol
suggested by company.
2.5. Relative mRNA expression of immune related genes
Primers of each gene were designed using Primer 5.0 software,

S. Pourmozaffar et al. / Fish & Shellsh Immunology 60 (2017) 65e71

based on the genes identied in the cDNA library (Table 2). Realtime PCR was carried out in IQ5 system (Bio Rad, USA) using 1x
SYBR Green PCR Master Mix (SYBR Biopars, GUASNR, Iran), 100 nM
of each forward and reverse specic primers, 10 ng of cDNA template and nuclease free water to nal volum of 20 ml were used and
all thermal prole of PCR reaction mixtures was done after Miandare et al. [3]. Table 2 reveals the primers used for amplication of
Lys, Cru, Pen-3a, proPo and b-actin. To validate the real-time PCR
primers, each genes specic primer pair was run in duplicate, along
a temperature gradiant (55e65  C) in the same plate. The PCR efciency and change in relative mRNA expression were calculated
based on the standard melting curve [21] analysis with dilution
series cDNA (including ve dilutions from 1/5 to 1/200). The PCR
efciency was to the following equation [22].

PCR efficiency 101=slope1  100

The obtained data were analyzed using the iQ5 optical system
software version 2.0 (Bio-Rad).
2.6. Statistical analysis
Statistical analysis was performed using SPSS (version 18). All
data were analyzed by one-way analysis of variance (ANOVA) [3]
with post hoc LSD to adjust P values for multiple comparisons.
Normality was conrmed by the KolmogoroveSmirnov test.
P < 0.05 was considered statistically signicant.
3. Result
3.1. Growh performance
The result of growth performance in Litopenaeus vannamei
shrimp fed with different ACV levels and PA diets are shown in
Table 3. However, no signicant differences in growth performance
were detected among the ACV and PA treatments. The FCR of
shrimp ranged from 3.01 to 3.67, with the highest and lowest FCR in
the 4% ACV and control treatments, respectively; although no
signicant differences were detected (Table 3).
3.2. Lys gene expression
The expression proles of the four immune related genes in
hepatopancreas of the white shrimp (Litopeneaus vannamei) after
dietary ACV and PA treatments are shown in Fig. 1AeD. Dietary
intake of ACV and PA signicantly enhanced the mRNA expression
of Lys after 30 and 60 days (p < 0.001) compared with the control
diet group. There was no considerable difference between treatments, except for the 1% ACV diet that showed signicant down
regulation after 15 days of treatment. The highest expression of Lys
was appeared under PA treatment after 60 days (Fig. 1A).

67

3.3. Cru gene expression

Based on the results, the relative quantication of Cru gene
showed a regular decrease after the ACV feeding diets during the
experimental period (p < 0.001). In contrast, the Cru mRNA level
was higher in shrimp fed PA diet supplemented compared to the
control group and reaching its peak after 30 days (p < 0.001)
(Fig. 1B). The results suggested that the Cru gene expression was
related to the ACV and PA diets.
3.4. Pen-3a gene expression
The Pen-3a gene expression pattern of L. vannamei fed with the
diet supplemented with different levels of ACV and PA are presented in Fig. 1C after 30 days of treatment, Pen-3a gene expression
was signicantly up regulated at 1%, 4% ACV and PA supplemented
diets (p < 0.001). This difference was observed in 1% and 2% ACV at
the end of the experiment (Fig. 1C). Moreover, the expression of
Pen-3a decreased and reached its minimum at 4% ACV and PA
diets compared with 1% and 2% ACV groups on day 60 (p < 0.001).
There were no signicant differences in Pen-3a expression among
the ACV and control treatments, but the highest level was recorded for PA diet after 15 days (p < 0.001) (Fig. 1C).
3.5. proPo gene expression
During the culture, shrimps fed with ACV and PA diets showed
signicant enhancement in expression of proPo gene. (p < 0.001)
(Fig. 1D). In contrast, the expression pattern was observed in Cru
gene in ACV groups. Therefore, the proPo transcript level was
induced by supplementary diets, and reached the maximum in PA
treatment after 60 days. (p < 0.001) (Fig. 1D).
4. Discussion
ACV contains avonoids, polyphenolic, organic acid, vitamin
and mineral elements. These components contribute to variety of
pharmacological functions [16]. Also Practical evidences suggested
that acetic acid is the major element in apple cider vinegar [14,15].
Its concentration is usually about 3e9% in ACV. Growth enhancement effect of ACV is attributed to its role in nutrient digestibility
and its high contents of several nutrients, such as organic acids,
vitamins and minerals. Khajepour and Hosseini [6] demonstrated
that citric acid enhanced growth, apparent protein and phosphorus
digestibility. Previous studies have reported that addition of
organic acids blend 2% and their salts (butyrate and propionate)
0.5e2% in diets of white shrimp with initial weight 0.12 and 2.5 g
respectively, (L. vannamei) improved growth at the end of the
experimental period [5,9]. However, another study indicated that
the benecial effects of organic acids on growth performance might
possibly be due to an increase inactivity of several digestive

Table 2
Primers used for the real-time PCR assay of four immune related genes and one internal control b-actin gene of shrimp.
Gene

Accession number

qPCR primers, forward/reverse

Amplicon

Efciency (%)

ProPo

AY723296

122

98

Lys

AY170126.2

123

96

Pen-3a

Y14926

121

95

Cru

AF430076

141

97

b-actin

AF300705

CGGTGACAAAGTTCCTCTTC
GCAGGTCGCCGTAGTAAG
TGT TCC GAT CTG ATG TCC
GCT GTT GTA AGC CAC CC
CACCCTTCGTGAGACCTTTG
AATATCCCTTTCCCACGTGAC
ACGAGGCAACCATGAAGG
AACCACCACCAACACCTAC
CCACGAGACCACCTACAAC
AGCGAGGGCAGTGATTTC

150

98

68

S. Pourmozaffar et al. / Fish & Shellsh Immunology 60 (2017) 65e71

Table 3
Growth performance of shrimp fed with control and ACV (Apple Cider Vinegar) and PA (Propionic acid) diets.
Parameters

Control

1% ACV

2% ACV

4% ACV

0.5% PA

IBW (g)
FBW (g)
WG (%)
SGR (% day
FCR

10.21 0.045a
14.09 0.59a
37.964 5.9a
0.64 0.08a
3.01 0.5a

10.26 0.045a
14.10 0.55a
37.451 5.8a
0.63 0.08a
3.06 0.52a

10.15 0.05a
13.87 0.59a
36.667 5.53a
0.62 0.08a
3.12 0.51a

10.20 0.025a
13.52 1.03a
32.867 5.21a
0.56 0.15a
3.67 0.99a

10.19 0.02a
13.69 0.43a
34.33 4.53a
0.59 0.06a
3.30 0.4a

1

IBW, Initial body weight; FBW, Initial body weight; WG, weight gain; SGR, specic growth rate; FCR, feed conversion ratio. Values (mean SE) containing different superscripts
in same row denote signicant difference among the treatments (p < 0.05).

enzymes in stomach, pancreatic and intestinal [7]. But, the mechanism of this effect in enhancing growth performance is not known
yet. In contrast, our results demonstrated that the additives used in
this study do not affect the performance in the stage of rearing
evaluated (10e14 g). In the present study, the shrimps fed with
ACV supplemented diets were obviously more active when feed
was supplied compared to those fed with the control diet after
about 15 days onwards. However, there is not sufcient data on
using ACV in aquaculture industry. Similarly, previous studies
have illustrated that utilizing different organic acids blends did not
signicantly enhance growth of tilapia (Oreochromis sp) and
rainbow trout (Oncorhynchus mykiss) [11,17].
Shrimp diseases globally are one of the main limitations for
making sustainable progress in shrimp aquaculture industry; so
studies of shrimp immune related genes expressions has received
accumulative attentions. The results of the present study were
exclusively based on the expressions of selected genes from
hepatopancreas. Furthermore, previous studies, have indicated that
the hepatopancreas is a crucial organ in the immune system of
penaeid shrimp [24]. In this study, it has been clearly shown that
the different immune related genes were expressed at different
times.
The crustaceans lack a highly developed specic immune system unlike the vertebrates and rely highly on non-specic cellular
and humoral factors. Humoral responses include the proPo activating system, phosphatase, Lys and antimicrobial peptides (AMPs)
such as Pen, Cru, anti-lipopolysaccharide factors (ALFs), etc. [25].
Lys was named by Fleming in 1922 for the rst time [26]. Lysozyme,
also recognized as muramidases is a well-known AMP and this
protein is involved in a broad range of defense mechanisms
including bacteriolysis, opsonization, immune response, and antimicrobial and antiviral activity [27]. The rst penaeidae Lys cDNA
was introduced in Litopenaeus vannamei [28]. The results revealed
that, shrimps fed with of ACV and PA showed an increased
expression level of Lys gene after 30 and 60 days after of treatments. Therefore, studies of enhancing of immune system of
shrimps arising by the organic acid compounds such as PA is scarce.
However, increase of Lys gene expression was as a result of
enhancement of innate immune protection against infectious
pathogens, environmental toxicants and stressors. In agreement
with our results, Miandare et al. [3] reported positive effect of dietary probiotic supplementation on Lys expression gene in white
shrimp. The expression of Lys was up-regulated in hepatopancreas
6 h post-injection lipopolysaccharide [29]. Park and Choi [30]
demonstrated that lysozyme activity was signicantly higher for
Nile tilapia (Oreochromis niloticus) fed the mistletoe (Viscum album
coloratum) supplemented diets as well signicant decrease in
mortality was observed after challenge with Aeromonas hydrophila
infection. However, the Lys also had wide range of antibacterial
activities against Gram positive and Gram negative shrimp pathogens such as Micrococcus lysodeikticus, V. harveyi, Edwardsiella
tarda, V. alginolyticus and V. parahemolyticus [26,31e33]. Viral
infection can result in 100% mortality of aquatic organisms within

days of infection and poses a enormous threat to shrimp farming

industry worldwide, particularly, the disease caused by White Spot
Syndrome Virus (WSSV). Therefore, Lys gene level against WSSV
was up regulated and reduced the level of viral infection by
enhancing the innate immune response of shrimp to infection in
blue shrimp (Litopenaeus stylirostris) [27].
Cru is one of the most widespread classes of AMPs reported
from penaeids. Different types of Cru exist and they differ from each
other in just 1e4 amino acids and have been reported previously
[25]. The results of the present study demonstrated that ACV diets
remarkably decreased expression level of Cru during the experimental period. Conversely, it was found that expression of Cru was
signicantly up regulated in response to PA diet. To date, the
fundamental mechanism of increasing shrimp immune system,
particularly AMPs by organic acid is not clearly known. Regarding
antibacterial activity of Cru, most reports have suggested activation
against Gram positive bacteria, In contrast, activity against Gram
negative bacteria or fungi was rarely detected [25,34,35]. Okumura
[4] reported that, lipopolysaccharide injection decreased mRNA
levels of Cru in the white shrimp (L. vannamei). Prawn (Macrobrachium rosenbergii) fed with the 6 g kg1 banana (Musa acuminata) showed that up-regulated Cru expression after 120 day of
feeding trial [36]. In addition, oral administration of peptidoglycan
exhibited an increased expression level of Cru gene in kuruma
prawn (Marsupenaeus japonicus) at 7 day post feeding [37]. However, based on some studies absence of Cru results in an obvious
increase in mortality rates in L. vannamei and Marsupenaeus japonicus after infection with the Gram negative shrimp pathogen,
V. penaeicida, whereas infection with Fusarium oxysporum does not
change shrimp mortality state [38,39]. The available published reports to date show activity of Cru against only a few Gram negative
bacteria.
Penaeidins (5.5e6.6 kDa peptides) are an important family of
antimicrobial peptides (AMPs) in penaeid shrimp [4,40]. To date,
some 40 penaeidins have been recognized in shrimp, and divided
into ve sub-groups (Pen 1e5) based on the amino acid sequence
similarities [40]. Pen, a class of AMPs from shrimp, was initially
isolated from Litopenaeus vannamei and reported by Destoumieux
and Colleagues [41,42]. Moreover, they have strong activity against
Gram positive bacteria, fungi, and also moderate activity against
Gram negative strains [4,41], viruses and protozoans [42]. Pen
mRNA was expressed in hemocytes, heart, hepatopancreas, gills,
stomach and intestine, and was up regulated after bacterial challenge [11,15]. However there is no available information on the
effects of dietary ACV on immune responses of shrimp. The main
nding of the present study is that ACV diets (1%, 4% and 1%, 2%)
led to increase in mRNA levels of Pen-3a compared to the control
diet after 30 and 60 days, respectively. In addition, Shrimps fed with
0.5% PA showed the highest and lowest expression of Pen-3a after
15 and 60 days of treatment, respectively Our results revealed, up/
down-regulation of Pen-3a gene in shrimp fed with ACV and PA
diets, in a time dependent manner. With this regard Miandare et al.
[3] have reported that white shrimp (L. vannamei) fed with dietary

S. Pourmozaffar et al. / Fish & Shellsh Immunology 60 (2017) 65e71

Fig. 1. A. Relative mRNA expression of Lysozyme (Lys) of the shrimp Litopenaeus

vannamei fed with diets supplemented with Apple Cider Vinegar (ACV) and Propionic
acid (PA). Values are presented as the mean SD. Different lowercase letters indicate
statistically signicant differences (p < 0.05). B. Relative mRNA expression of Crustin
(Cru) of the shrimp Litopenaeus vannamei fed with diets supplemented with Apple
Cider Vinegar (ACV) and Propionic acid (PA). Values are presented as the mean SD.
Different lowercase letters indicate statistically signicant differences (p < 0.05). C.
Relative mRNA expression of Penaeidin-3a (Pen-3a) of the shrimp Litopenaeus vannamei fed diets supplemented with Apple Cider Vinegar (ACV) and Propionic acid (PA).
Values are presented as the mean SD. Different lowercase letters indicate statistically
signicant differences (p < 0.05). D. Relative mRNA expression of Prophenoloxidase
(proPo) of the shrimp Litopenaeus vannamei fed with diets supplemented with Apple
Cider Vinegar (ACV) and Propionic acid (PA). The values are presented as mean SD.
Different lowercase letters indicate statistically signicant differences (p < 0.05).

69

supplemented with PrimaLac showed signicantly higher expression level of Pen-3a in comparison with the control group. Cell wall
component from multi-strain probiotic (PrimaLac) such as lipopolysaccharides and peptidoglycans stimulate expression level of
Pen-3a in shrimp. Conversely, injection of lipopolysaccharide
inhibited the expression of Pen level in white shrimp [4]. Also,
white shrimp fed with b-1,3-glucan diets down-regulated Pen-3
gene after 6 and 12 h feeding [44]. Pen-3a might be a powerful
antibacterial protein which plays a role in innate immunity in
penaeid shrimp. An et al. [40] reported that MjPen-II demonstrated
antibacterial activity against both Gram positive and Gram negative
bacteria in kuruma shrimp (Marsupenaeus japonicus). On other
study suggested that, Pen 3 mRNA expression was up regulated
after microbial challenge with Vibrio parahemolyticus [41]. The upregulation of penaeidin mRNA expression increases young haemocytes which are actively expressing penaeidin genes in the
circulating haemocyte population, resulting in an enhancing
phagocytosis and agglutination [4].
The proPo system is a strong regulated defense mechanism that
is involved in biosynthesis of melanin and production of toxic intermediates for pathogenic [45]. Also, proPO was rst introduced in
the freshwater craysh Pacifastacus leniusculus in 1995 [46]. The
prophenoloxidase activating system (proPOAS) is an efcient non
self-recognition system which consists of several important proteins including proPo, pattern-recognition proteins (PRPs), serine
protease (SP), and serine protease inhibitors (serpins). The proPO, is
inactive proenzyme of phenoloxidase (PO) [47]. According to the
other investigations two types proPo genes was cloned and
described from the species L. vannamei and Penaeus monodon
[48,49]. Relative expression of proPo, signicantly increased in
ACV and PA treatments during the treatment period. The proPO
activity response to immune stimulants such as, probiotic (PrimaLac and Lactobacillus plantarum), lipopolysacharide and Sargassum
wightii has previously been reported in L. vannamei and Penaeus
monodon [3,4,46,50]. These results demonstrated that dietary ACV
and PA administration could enhance PO activity resulting from
advancement the gene transcription and translation of proPOs in
L. vannamei. In agreement with our results, some researchers has
shown that, shrimps fed with the diet containing organic acids
blend showed enhanced PO activity and consequently led to higher
survival against Vibrio harveyi [2,5]. Amparyup et al. [48] and Chiu
et al. [46] reported up regulation of proPo expression increased
resistance to Vibrio alginolyticus. Furthermore, another study reported up regulation of proPo in shrimp fed with Bacillus subtilis
diets compared to the control group after challenge with V. harveyi
[20]. In contrast, based on some investigations proPo expression
was down regulated in shrimps challenged with white spot syndrome virus (WSSV) [51,52] and necrotizing hepatopancreatitis
bacterium after 24 days [53]. Similarly, ProPo expression was down
regulated and caused raised Penaeus monodon mortality following
V. harveyi infection [54]. So, the expression and regulation of proPo
of shrimps were signicantly related to the diet administration,
environmental changes and pathogens challenge. Previous studies
demonstrated that organic acids led to improved resistance of
shrimp to pathogens [2,5,11]. This led to the hypothesis that they
contribute to regulate the AMPs secration of shrimp and maintained or increased the immune response of shrimp. However, little
information is available about the molecular mechanisms of
organic acid on immune related genes of shrimp.
5. Conclusion
The present study revealed that ACV and PA diets had no
benecial effects on growth performance in the stage of rearing
evaluated in this study (10e14 g). Furthermore, transcriptomic

70

S. Pourmozaffar et al. / Fish & Shellsh Immunology 60 (2017) 65e71

study demonstrated up-regulation of Lys, Pen-3a and proPo genes

expression in shrimp fed ACV and PA diets. Though, dietary ACV
decreased Cru gene expression but PA diet showed a remarkable
increase of Cru mRNA level. Further investigations are required to
better understand roles of ACV in different immune response
procedures in shrimp.
Acknowledgments
The authors would like to thank the staff at Aquaculture Lab of
Gorgan University of Agricultural Sciences and Natural Resources
for their kind help during the study.
References
[1] D. Subramanian, Y.H. Jang, D.H. Kim, B.J. Kang, M.S. Heo, Dietary effect of
Rubus coreanus ethanolic extract on immune gene expression in white leg
shrimp, Penaeus vannamei, Fish Shellsh Immunol. 35 (2013) 808e814, http://
dx.doi.org/10.1016/j.fsi.2013.06.008.
[2] W.K. Ng, C.B. Koh, C.Y. Teoh, N. Romano, Farm-raised tiger shrimp, Penaeus
monodon, fed commercial feeds with added organic acids showed enhanced
nutrient utilization, immune response and resistance to Vibrio harveyi challenge,
Aquaculture
449
(2015)
69e77,
http://dx.doi.org/10.1016/
j.aquaculture.2015.02.006.
[3] H.K. Miandare, P. Yarahmadi, M. Abbasian, Immune related transcriptional
responses and performance of Litopenaeus vannamei post-larvae fed on dietary probiotic PrimaLac, Fish Shellsh Immunol. 55 (2016) 671e678, http://
dx.doi.org/10.1016/j.fsi.2016.06.053.
[4] T. Okumura, Effects of lipopolysaccharide on gene expression of antimicrobial
peptides (penaeidins and crustin), serine proteinase and prophenoloxidase in
haemocytes of the Pacic white shrimp, Litopenaeus vannamei, Fish Shellsh
Immunol. 22 (2007) 68e76, http://dx.doi.org/10.1016/j.fsi.2006.03.013.
[5] N. Romano, C.B. Koh, W.K. Ng, Dietary microencapsulated organic acids blend
enhances growth, phosphorus utilization, immune response, hepatopancreatic integrity and resistance against Vibrio harveyi in white shrimp, Litopenaeus vannamei, Aquaculture 435 (2015) 228e236, http://dx.doi.org/10.1016/
j.aquaculture.2014.09.037.
[6] F. Khajepour, S.A. Hosseini, Citric acid improves growth performance and
phosphorus digestibility in Beluga (Huso huso) fed diets where soybean meal
partly replaced sh meal, Animal Feed Sci. Technol. 171 (2012) 68e73, http://
dx.doi.org/10.1016/j.anifeedsci.2011.10.001.
[7] S. Castillo, M. Rosales, C. Pohlenz, D.M. Gatlin, Effects of organic acids on
growth performance and digestive enzyme activities of juvenile red drum
Sciaenops ocellatus, Aquaculture 433 (2014) 6e12, http://dx.doi.org/10.1016/
j.aquaculture.2014.05.038.
[8] A.J. Hern

andez, S. Satoh, V. Kiron, Supplementation of citric acid and amino
acid chelated trace elements in low-sh meal diet for rainbow trout affect
growth and phosphorus utilization, J. World Aquac. Soc. 43 (2012) 688e696,
http://dx.doi.org/10.1111/j.1749-7345.2012.00589.x.
~ o, N. Bolivar, W.Q. Seiffert, Butyrate
[9] B.C. da Silva, F. do N. Vieira, J.L.P. Mourin
and propionate improve the growth performance of Litopenaeus vannamei,
Aquac. Res. 47 (2014) 612e623, http://dx.doi.org/10.1111/are.12520.
[10] H. Kluge, J. Broz, K. Eder, Effect of benzoic acid on growth performance,
nutrient digestibility, nitrogen balance, gastrointestinal microora and parameters of microbial metabolism in piglets, J. Animal Physiology Animal
Nutr.
90
(2006)
316e324,
http://dx.doi.org/10.1111/j.14390396.2005.00604.x.
[11] W.K. Ng, C.B. Koh, K. Sudesh, A. Siti-Zahrah, Effects of dietary organic acids on
growth, nutrient digestibility and gut microora of red hybrid tilapia, Oreochromis sp., and subsequent survival during a challenge test with Streptococcus agalactiae, Aquac. Res. 40 (2009) 1490e1500, http://dx.doi.org/
10.1111/j.1365-2109.2009.02249.x.
[12] B.C. da Silva, F. do N. Vieira, J.L.P. Mourinoo, G.S. Ferreira, W.Q. Seiffert, Salts of
organic acids selection by multiple characteristics for marine shrimp nutrition, Aquaculture 384e387 (2013) 104e110, http://dx.doi.org/10.1016/
j.aquaculture.2012.12.017.
[13] S. Mine, R. Boopathy, Effect of organic acids on shrimp pathogen, Vibrio harveyi, Curr. Microbiol. 63 (2011) 1e7, http://dx.doi.org/10.1007/s00284-0119932-2.
[14] Z. Beheshti, Y. Huak Chan, H. Sharif Nia, F. Hajihosseini, R. Nazari, M. Shaabani,
M.T. Salehi Omran, Inuence of apple cider vinegar on blood lipids, Life Sci. J. 9
(2012) 2431e2440.
[15] M. Iman, S.A. Moallem, A. Barahoyee, Effect of apple cider Vinegar on blood
glucose level in diabetic mice, Pharm. Sci. 20 (2015) 163e168, http://
dx.doi.org/10.5681/PS.2015.006.

zbir, Apple
[16] M. Nazirolu, M. Gler, C. Ozgl,
G. Saydam, M. Kkayaz, E. So
cider vinegar modulates serum lipid prole, erythrocyte, kidney, and liver
membrane oxidative stress in ovariectomized mice fed high cholesterol,
J. Membr. Biol. 247 (2014) 667e673, http://dx.doi.org/10.1007/s00232-0149685-5.

[17] Z. Xie, F. Wang, H. Liu, S. Guo, A. Zhu, H. Niu, Gelatin-walled microencapsulated diet for larval shrimp (Penaeus japonicus Bate) manufactured
using the uidized bed coating process, Aquac. Res. 42 (2010) 65e73, http://
dx.doi.org/10.1111/j.1365-2109.2010.02557.x.
[18] AOAC, AOAC Ofcial Methods of Analysis, Association of Ofcial Agricultural
Chemists, Washington, D.C., 1992, pp. 136e138, 15th.
[20] H. Zokaeifar, J.L. Balcazar, C.R. Saad, M.S. Kamarudin, K. Sijam, A. Arshad,
N. Nejat, Effects of Bacillus subtilis on the growth performance, digestive
enzymes, immune gene expression and disease resistance of white shrimp,
Litopenaeus vannamei, Fish Shellsh Immunol. 33 (2012) 683e689, http://
dx.doi.org/10.1016/j.fsi.2012.05.027.
[21] A. Larionov, A. Krause, W. Miller, A standard curve based method for relative
real time PCR data processing, BMC Bioinforma. 6 (2005) 62, http://dx.doi.org/
10.1186/1471-2105-6-62.
[22] A. Radonic, S. Thulke, I.M. Mackay, O. Landt, W. Siegert, A. Nitsche, Guideline
to reference gene selection for quantitative real-time PCR, Biochem. Biophysical Res. Commun. 313 (2004) 856e862, http://dx.doi.org/10.1016/
j.bbrc.2003.11.177.
[24] D. Pan, N. He, Z. Yang, H. Liu, X. Xu, Differential gene expression prole in
hepatopancreas of WSSV-resistant shrimp (Penaeus japonicus) by suppression
subtractive hybridization, Dev. Comp. Immunol. 29 (2005) 103e112, http://
dx.doi.org/10.1016/j.dci.2004.07.001.
[25] D. Banerjee, B. Maiti, S.K. Girisha, M.N. Venugopal, I. Karunasagar, A crustin
isoform from black tiger shrimp, Penaeus monodon exhibits broad spectrum
anti-bacterial activity, Aquac. Rep. 2 (2015) 106e111, http://dx.doi.org/
10.1016/j.aqrep.2015.08.009.
[26] Y. Tian, X. wang Liang, Y. qing Chang, J. Song, Expression of c-type lysozyme
gene in sea cucumber (Apostichopus japonicus) is highly regulated and time
dependent after salt stress, Comp. Biochem. Physiology Part - B Biochem. Mol.
Biol. 180 (2015) 68e78, http://dx.doi.org/10.1016/j.cbpb.2014.10.004.
[27] W. jun Mai, W. na Wang, Protection of blue shrimp (Litopenaeus stylirostris)
against the against WSSV challenge (WSSV) when injected with shrimp
lysozyme, Fish Shellsh Immunol. 28 (2010) 727e733, http://dx.doi.org/
10.1016/j.fsi.2010.01.002.
[28] T. Chen, C. Ren, Y. Wang, P. Luo, X. Jiang, W. Huang, C. Chen, C. Hu, Molecular
cloning, inducible expression and antibacterial analysis of a novel i-type
lysozyme (lyz-i2) in Pacic white shrimp, Litopenaeus vannamei, Fish Shellsh
Immunol. 54 (2016) 197e203, http://dx.doi.org/10.1016/j.fsi.2016.04.008.
[29] A.B. Peregrino-Uriarte, A.T. Muhlia-Almazan, A.A. Arvizu-Flores, G. GomezAnduro, T. Gollas-Galvan, G. Yepiz-Plascencia, R.R. Sotelo-Mundo, Shrimp
invertebrate lysozyme i-lyz: gene structure, molecular model and response of
c and i lysozymes to lipopolysaccharide (LPS), Fish Shellsh Immunol. 32
(2012) 230e236, http://dx.doi.org/10.1016/j.fsi.2011.10.026.
[30] K.H. Park, S.H. Choi, The effect of mistletoe, Viscum album coloratum, extract
on innate immune response of Nile tilapia (Oreochromis niloticus), Fish
Shellsh Immunol. 32 (2012) 1016e1021, http://dx.doi.org/10.1016/
j.fsi.2012.02.023.
[31] W. Mai, C. Hu, cDNA cloning, expression and antibacterial activity of lysozyme
C in the blue shrimp (Litopenaeus stylirostris), Prog. Nat. Sci. 19 (2009)
837e844, http://dx.doi.org/10.1016/j.pnsc.2008.10.008.
[32] E. De-La-Re-Vega, A. Garca-Galaz, M.E. Daz-Cinco, R.R. Sotelo-Mundo, White
shrimp (Litopenaeus vannamei) recombinant lysozyme has antibacterial activity against Gram negative bacteria: Vibrio alginolyticus, Vibrio parahemolyticus and Vibrio cholerae, Fish Shellsh Immunol. 20 (2006) 405e408,
http://dx.doi.org/10.1016/j.fsi.2005.06.005.
[33] H. Li, M.G. Parisi, M. Toubiana, M. Cammarata, P. Roch, Lysozyme gene
expression and hemocyte behaviour in the Mediterranean mussel, Mytilus
galloprovincialis, after injection of various bacteria or temperature stresses,
Fish Shellsh Immunol. 25 (2008) 143e152, http://dx.doi.org/10.1016/
j.fsi.2008.04.001.
[34] C. Sun, X.J. Du, W.T. Xu, H.W. Zhang, X.F. Zhao, J.X. Wang, Molecular cloning
and characterization of three crustins from the Chinese white shrimp, Fenneropenaeus chinensis, Fish Shellsh Immunol. 28 (2010) 517e524, http://
dx.doi.org/10.1016/j.fsi.2009.12.001.
[35] P. Supungul, S. Tang, C. Maneeruttanarungroj, V. Rimphanitchayakit, I. Hirono,
T. Aoki, A. Tassanakajon, Cloning, expression and antimicrobial activity of
crustinPm1, a major isoform of crustin, from the black tiger shrimp Penaeus
monodon, Dev. Comp. Immunol. 32 (2008) 61e70, http://dx.doi.org/10.1016/
j.dci.2007.04.004.
[36] W. Rattanavichai, Y.N. Chen, C.C. Chang, W. Cheng, The effect of banana (Musa
acuminata) peels hot-water extract on the immunity and resistance of giant
freshwater prawn, Macrobrachium rosenbergii via dietary administration for a
long term: activity and gene transcription, Fish Shellsh Immunol. 46 (2015)
378e386, http://dx.doi.org/10.1016/j.fsi.2015.06.031.
[37] A. Rattanachai, I. Hirono, T. Ohira, Y. Takahashi, T. Aoki, Cloning of kuruma
prawn Marsupenaeus japonicus crustin-like peptide cDNA and analysis of its
expression, Fish. Sci. 70 (2004) 765e771, http://dx.doi.org/10.1111/j.14442906.2004.00869.x.
[38] S.G. Hipolito, A. Shitara, H. Kondo, I. Hirono, Role of Marsupenaeus japonicus
crustin-like peptide against Vibrio penaeicida and white spot syndrome virus
infection, Dev. Comp. Immunol. 46 (2014) 461e469, http://dx.doi.org/
10.1016/j.dci.2014.06.001.
[39] J.E. Shockey, N.A. O'Leary, E. de la Vega, C.L. Browdy, J.E. Baatz, P.S. Gross, The
role of crustins in Litopenaeus vannamei in response to infection with shrimp
pathogens: an in vivo approach, Dev. Comp. Immunol. 33 (2009) 668e673,

S. Pourmozaffar et al. / Fish & Shellsh Immunology 60 (2017) 65e71

http://dx.doi.org/10.1016/j.dci.2008.11.010.
[40] M. An, J. Gao, X. Zhao, J. Wang, A new subfamily of penaeidin with an additional serine-rich region from kuruma shrimp (Marsupenaeus japonicus)
contributes to antimicrobial and phagocytic activities *, Dev. Comp. Immunol.
59 (2016) 186e198, http://dx.doi.org/10.1016/j.dci.2016.02.001.
[41] S. Shanthi, B. Vaseeharan, cDNA cloning, characterization and expression
analysis of a novel antimicrobial peptide gene penaeidin-3 (Fi-Pen3) from the
haemocytes of Indian white shrimp Fenneropenaeus indicus, Microbiol. Res.
167 (2012) 127e134, http://dx.doi.org/10.1016/j.micres.2011.07.003.
[42] S.P. Antony, I.S.B. Singh, R. Philip, Molecular characterization and phylogenetic
analysis of a penaeidin-like antimicrobial peptide, Fi-penaeidin from Fenneropenaeus indicus, Aquaculture 319 (2011) 298e301, http://dx.doi.org/
10.1016/j.aquaculture.2011.06.011.
[44] Y.C. Wang, P.S. Chang, H.Y. Chen, Differential time-series expression of
immune-related genes of Pacic white shrimp Litopenaeus vannamei in
response to dietary inclusion of b-1,3-glucan, Fish Shellsh Immunol. 24
(2008) 113e121, http://dx.doi.org/10.1016/j.fsi.2007.09.008.
[45] P. Sangsuriya, W. Charoensapsri, S. Chomwong, S. Senapin, A. Tassanakajon,
P. Amparyup, A shrimp pacifastin light chain-like inhibitor: molecular identication and role in the control of the prophenoloxidase system, Dev. Comp.
Immunol. 54 (2016) 32e45, http://dx.doi.org/10.1016/j.dci.2015.08.003.
[46] C. Chiu, Y. Guu, C. Liu, T.-M. Pan, W. Cheng, Immune responses and gene
expression in white shrimp, Litopenaeus vannamei, induced by Lactobacillus
plantarum, Fish Shellsh Immunol. 23 (2007) 364e377, http://dx.doi.org/
10.1016/j.fsi.2006.11.010.
[47] K. Wei, J. Yang, Copper-induced oxidative damage to the prophenoloxidaseactivating system in the freshwater cray sh Procambarus clarkii, Fish Shellsh Immunol. 52 (2016) 221e229, http://dx.doi.org/10.1016/j.fsi.2016.03.151.
[48] P. Amparyup, W. Charoensapsri, A. Tassanakajon, Prophenoloxidase system

[49]

[50]

[51]

[52]

[53]

[54]

71

and its role in shrimp immune responses against major pathogens, Fish
Shellsh Immunol. 34 (2013) 990e1001, http://dx.doi.org/10.1016/
j.fsi.2012.08.019.
M.S. Yeh, C.Y. Lai, C.H. Liu, C.M. Kuo, W. Cheng, A second proPO present in
white shrimp Litopenaeus vannamei and expression of the proPOs during a
Vibrio alginolyticus injection, molt stage, and oral sodium alginate ingestion,
Fish Shellsh Immunol. 26 (2009) 49e55, http://dx.doi.org/10.1016/
j.fsi.2008.10.003.
M. Sivagnanavelmurugan, B.J. Thaddaeus, A. Palavesam, G. Immanuel, Dietary
effect of Sargassum wightii fucoidan to enhance growth, prophenoloxidase
gene expression of Penaeus monodon and immune resistance to Vibrio parahaemolyticus, Fish Shellsh Immunol. 39 (2014) 439e449, http://dx.doi.org/
10.1016/j.fsi.2014.05.037.
H.S. Ai, J.X. Liao, X. De Huang, Z.X. Yin, S.P. Weng, Z.Y. Zhao, S.D. Li, X.Q. Yu,
J.G. He, A novel prophenoloxidase 2 exists in shrimp hemocytes, Dev. Comp.
Immunol. 33 (2009) 59e68, http://dx.doi.org/10.1016/j.dci.2008.07.017.
H.S. Ai, Y.C. Huang, S.D. Li, S.P. Weng, X.Q. Yu, J.G. He, Characterization of a
prophenoloxidase from hemocytes of the shrimp Litopenaeus vannamei that is
down-regulated by white spot syndrome virus, Fish Shellsh Immunol. 25
(2008) 28e39, http://dx.doi.org/10.1016/j.fsi.2007.12.002.
M.D. Figueroa-Pizano, A.B. Peregrino-Uriarte, G. Yepiz-Plascencia,

n, L.R. Martnez-Co

rdova, Gene expresM. Martnez-Porchas, T. Gollas-Galva
sion responses of white shrimp (Litopenaeus vannamei) infected with necrotizing hepatopancreatitis bacterium, Aquaculture 420e421 (2014) 165e170,
http://dx.doi.org/10.1016/j.aquaculture.2013.10.042.
W. Charoensapsri, P. Amparyup, I. Hirono, T. Aoki, A. Tassanakajon, Gene
silencing of a prophenoloxidase activating enzyme in the shrimp, Penaeus
monodon, increases susceptibility to Vibrio harveyi infection, Dev. Comp.
Immunol. 33 (2009) 811e820, http://dx.doi.org/10.1016/j.dci.2009.01.006.