Research in Microbiology 160 (2009) 592e599

www.elsevier.com/locate/resmic

Bacteriocin production by Staphylococcus aureus involved in bovine

mastitis in Brazil
Hilana Ceotto a, Janana dos Santos Nascimento a,c, Maria Aparecida Vasconcelos de Paiva Brito b,
Maria do Carmo de Freire Bastos a,*
a
Departamento de Microbiologia Geral, Instituto de Microbiologia Professor Paulo de Goes, Universidade Federal do Rio de Janeiro, CCS, Bloco I, Cidade
Universitaria, 21941-590 Rio de Janeiro, RJ, Brazil
b
Embrapa Gado do Leite, Juiz de Fora MG, Brazil
c
Instituto Federal de Educac~ao, Ciencia e Tecnologia do Rio de Janeiro, RJ, Brazil
Received 4 May 2009; accepted 15 July 2009
Available online 25 July 2009

Abstract

In the present study, 257 Staphylococcus spp. strains were isolated from bovine mastitis cases in 56 different Brazilian dairy herds located in
the southeast region of the country and tested for antimicrobial substance (AMS) production. Forty-six strains (17.9%) exhibited AMS
production and their identification as Staphylococcus aureus was based on the presence of Gram-positive cocci and on positive results in tests for
the ability to coagulate rabbit plasma, to ferment mannitol, and to produce acetoin. The AMS were characterized as bacteriocins (Bac) by their
sensitivity to proteolytic enzymes. The Bac strains were tested for resistance to 14 antimicrobial agents showing different profiles. Eighteen
strains (39.0%) expressed a multiple antibiotic resistance phenotype. Forty-five strains exhibited at least one plasmid DNA. Cross-immunity
analysis against strain S. aureus A70, which produces aureocin A70, amplification of the aurABCD operon (which encodes aureocin A70) or
detection of this same operon by DNA/DNA hybridization revealed that 34 strains produce bacteriocins either identical or similar to aureocin
A70. The remaining 12 Bac strains produce antimicrobial peptides that seem to be distinct from the best characterized staphylococcal
bacteriocins described thus far. The bacteriocin produced by strain 4185 may possess potential practical applications, since it was able to inhibit
important pathogens such as Bacillus cereus, Listeria monocytogenes, and Staphylococcus spp. isolated from nosocomial infections.
2009 Elsevier Masson SAS. All rights reserved.

Keywords: Bacteriocins; Staphylococcus aureus; Bovine mastitis; Antimicrobial peptides; Staphylococcins

1. Introduction with the presence of a plasmid in the cells. However, genes

Bacteriocins are defined as antimicrobial peptides or
proteins with bactericidal activity against other bacteria. The
bacteriocin-producing strains are immune to their own product
and this immunity is conferred by an immune system which is
generally expressed concomitantly with the bacteriocin struc-
tural genes [22]. Bacteriocin production is often correlated
* Corresponding author. Tel./fax: 55 21 2560 8344.
E-mail addresses: hceotto@yahoo.com.br (H. Ceotto), jann.rj@uol.com.br
(J.S. Nascimento), mavpaiva@cnpgl.embrapa.br (M.A.V.P. Brito), mcbastos@
micro.ufrj.br, mcbastos2@yahoo.com.br (M.C.F. Bastos).
encoding several bacteriocins have been shown to be located on
the bacterial chromosome [21].
Many bacteriocins produced by Gram-positive bacteria,
especially by lactic acid bacteria, have been identified and
characterized. They form a heterogeneous group of peptides
and proteins that can be grouped into four classes [5,20]. The
lantibiotics (class I) are small heat-stable peptides (<5 kDa)
containing unusual amino acids. Class II is composed of non-
modified peptides (<10 kDa). Class III is composed of large
heat-labile proteins, and class IV is composed of cyclic
peptides.
The bacteriocins from classes I and II have been exten-
sively investigated and their mode of action has been clearly

0923-2508/$ - see front matter 2009 Elsevier Masson SAS. All rights reserved.
doi:10.1016/j.resmic.2009.07.007
 H. Ceotto et al. / Research in Microbiology 160 (2009) 592e599 593

elucidated, since they occur more frequently and possess
potential industrial and medical applications [5,20]. To date,
only nisin, a class I bacteriocin produced by strains of Lac-
tococcus lactis, and pediocin PA-1, a class II bacteriocin
produced by Pedicococcus acidilactici, have been approved as
preservatives in foods [12].
Staphylococcins are bacteriocins produced by Staphylo-
coccus spp. Most are either lantibiotics (Pep5, epicidin 280,
epidermin, epilancin K7, nukacin ISK-1 and staphylococcin
C55/BacR1) or class II bacteriocins (aureocin A70 and
aureocin A53). Only one staphylococcin belonging to class III,
lysostaphin, has been described thus far [5].
Pep5 is a 34-amino acid lantibiotic produced by a clinical
isolate of Staphylococcus epidermidis, strain 5. The Pep5
biosynthetic gene cluster, including its structural gene, pepA,
is encoded by the 20 kb plasmid pED503 [23]. Epicidin 280 is
a 30-amino acid peptide, which has 75% similarity with Pep5.
Its structural gene, eciA, is found on plasmid pCH01, larger
than 40 kb, in strain S. epidermidis BN280 [19]. The epilancin
K7 structural gene, elkA, is located on the chromosomal DNA
of strain S. epidermidis K7 [36]. The epidermin structural
gene, epiA, is encoded by plasmid Tu32 (54 kb) and codes for
a 22-amino acid peptide produced by S. epidermidis Tu3298
[2]. Nukacin ISK-1 is a bacteriocin produced by the strain
S. warneri ISK-1. Its gene cluster is encoded by plasmid pPI-1
(30.2 kb) and nukA is the nukacin ISK-1 structural gene [34].
The strain Staphylococcus aureus C55 contains a w32 kb
plasmid which carries the genetic determinants for staphy-
lococcin C55, including the structural genes sacaA and sacbA
[27].
The aurABCD operon codes for aureocin A70, a four-
peptide bacteriocin produced by S. aureus A70. The aurABCD
operon and the other genes involved in aureocin A70
production are found on pRJ6, a 7.9-kb plasmid [18,29].
Aureocin A53 is a 51-amino acid peptide produced by
S. aureus A53, and its structural gene, aucA, is located on the
10.4-kb plasmid pRJ9 [28].
Staphylococcins can inhibit many bacterial species,
including several bacterial pathogens, and, therefore, may
possess potential practical applications as possible alternatives
to antibiotics in medicine and as biopreservatives in food
industry [5]. Therefore, in the present study, bacteriocin
production was analyzed in Staphylococcus spp. strains asso-
ciated with bovine mastitis in different Brazilian dairy herds in
order to detect new staphylococcins that could have potential
biotechnological applications.
2. Material and methods
The Corynebacterium fimi NCTC 7547, which is highly
sensitive to staphylococcins [5], was used in inhibition assays.
Other staphylococcal strains from previous studies were also
employed in the present work as controls of either bacteriocin
production or for the presence of bacteriocin structural genes.
These strains are described in Table 1.
The staphylococcal strains were stored in TSB (Difco) with
40% glycerol (w/v) and C. fimi NCTC 7547 was stored in BHI
(Difco) with 40% glycerol (w/v) at 20  C until needed. The
staphylococcal strains were cultivated in either BHI (Difco) or
in GM17 [M17 (Difco) supplemented with 5% (w/v) glucose]
at 37  C for 18 h. The lactic acid bacteria used in some tests
(see below) were cultivated in MRS (Becton, Dickson and
Company) at 37  C for 18 h. The media were supplemented
with either agar at 0.6% (w/v) for tests of AMS production or
with agar at 1.5% (w/v), for preparation of solid medium.
2.2. Assays for antimicrobial substance production
The AMS production and the spectrum of action of each
AMS were tested on BHI agar plates by the deferred antago-
nism test as previously described [18] using the 257 staphy-
lococcal strains as producers and C. fimi NCTC 7547 as an
indicator.
To confirm the inhibition spectrum of each AMS, bacteria
were grown in 5 ml of GM17 broth for 18 h at 37  C, cells
were removed by centrifugation and culture supernatants were
sterilized by filtration using a Millipore membrane (pores of
0.45 mm). AMS activity was then measured by the serial
dilution method in microtiter plate assays as described else-
where [5].
Forty-one different Gram-positive bacteria were used as
indicators for the determination of the spectrum of activity:
Bacillus cereus, Bacillus megaterium, Bacillus mycoides,
Enterococcus faecalis 2708, Enterococcus faecium E86,
Table 1
Staphylococcus spp. strains previously described and used in this study.
Strains Relevant features Reference
S. aureus
A70 Bac (aureocin A70); pRJ6 (7.9 kb) 18
A70 Bac Strain A70 cured of pRJ6 18
A53 Bac (aureocin A53); pRJ9 18
(10.4 kb)
C55 Bac (staphylococcin C55); 27
pC55 (32 kb)
MB32 Bac; pSH2 (15 kb), pRJ6 (7.9 kb), This work
pRJ5 (2.5 kb)
MB196 Bac; pRJ15 (27 kb), pRJ10 (10.4 kb), This work
pRJ16 (4.4 kb), pRJ17 (1.2 kb)

2.1. Bacterial strains and growth conditions S. epidermidis

5 Bac (Pep5); pED503 (20 kb) 15
BN280 Bac (epicidin 280); pCHO1 (>40 kb) 19
In the present study, 257 Staphylococcus spp. strains were K7 Bac (epilancin K7) 36
tested for antimicrobial substance production. These bacterial Tu3298 Bac (epidermin); pTu32 (54 kb) 1
strains were isolated from either clinical (severe) or subclinical S. simulans 3299 Bac (simulancin 3299a); pRJ97 (>25 kb) 26
(moderate) bovine mastitis cases in 56 different dairy herds a
Simulancin 3299 was shown to be identical to nukacin ISK-1 (unpublished
located in the southeast region of Brazil. data).
594 H. Ceotto et al. / Research in Microbiology 160 (2009) 592e599
L. lactis IL1403, L. lactis NZ900, L. lactis 2084, L. lactis
subsp. cremoris, Listeria innocua 397, Listeria monocytogenes
11LM, L. monocytogenes L1/2A, L. monocytogenes 7898,
Micrococcus luteus ATCC 4698, S. aureus A22c, S. aureus
B14a, S. aureus C10C, S. aureus D9R, S. aureus E7, S. aureus
F6, S. aureus G4, S. aureus H2R, S. aureus I26a, S. aureus
J18C, S. aureus 4, S. aureus 24, S. aureus 77, S. aureus 130,
S. aureus 177, S. aureus 195, S. epidermidis 38, S. epidermidis
118, S. epidermidis 102Hp, S. epidermidis 1430, Staphylo-
coccus haemolyticus 58, S. haemolyticus 69Hp, Staphylo-
coccus saprophyticus 1788, Staphylococcus schleiferi 128,
Streptococcus dysgalactiae, Streptococcus pyogenes, and
Pediococcus pentosaceus.
The indicator strains L. monocytogenes and B. cereus are
food-borne pathogens. S. aureus and coagulase-negative
Staphylococcus (CNS) strains were isolated from patients with
nosocomial infections in hospitals located in the southeast
region of Brazil.
2.3. Effect of proteolytic enzymes
The effect of trypsin (Sigma, 1 mg/ml) and protease XXIII
(Sigma, 1 mg/ml) on AMS activity was determined by the
method described by Giambiagi-deMarval et al. [18]. Lack of
inhibition zones after the treatment with the proteolytic
enzymes, when C. fimi NCTC 7547 was used as the indicator
strain, suggested that the antimicrobial compound had
a proteinaceous nature.
2.4. Identification of the strains
Only Staphylococcus spp. strains that exhibited AMS
production were identified to the species level on the basis of
Gram staining, rabbit plasma coagulation, mannitol fermen-
tation and acetoin production [3].
2.5. Antibiotic susceptibility
The antibiotic susceptibility profile of the AMS producers
was determined by the agar diffusion method using antibiotic
disks (Sensifar) according to the instructions of the Clinical
and Laboratory Standards Institute [10]. The following anti-
biotics were used: ampicillin (10 mg), cephalothin (30 mg),
ciprofloxacin (5 mg), clindamycin (2 mg), chloramphenicol
(30 mg), erythromycin (15 mg), gentamicin (10 mg), imipe-
nem (10 mg), mupirocin (5 mg), oxacillin (1 mg), penicillin
(10 U), rifampin (5 mg), tetracycline (30 mg), and vancomy-
cin (30 mg). The inhibition zones were observed after 18 h of
incubation at 35e37  C and interpreted following the CLSI
guidelines.
2.6. DNA isolation and manipulations
Whole-cell lysates were prepared as described by Giam-
biagi-deMarval et al. [18] and the plasmid profiles were
determined by agarose gel electrophoresis [0.7% (w/v)].
Strains MB32 and MB196 were used as molecular weight
controls for plasmid DNA, since they contain staphylococcal
plasmids of known sizes (indicated in Table 1).
The total DNA from the AMS strains, used in the PCR
reactions, was extracted by the boiling technique, as previ-
ously described by Nascimento et al. [25].
Genomic DNA used in Southern blottings was prepared as
previously described by Potter et al. [32] and digested with the
restriction enzymes EcoRI (Invitrogen) or HindIII (Invitrogen)
according to the manufacturers recommendations.
2.7. Detection of staphylococcin structural genes by PCR
In order to detect the staphylococcin structural genes, PCR
reactions were performed. The primers used for amplification
of each gene are listed in Table 2.
Each PCR reaction contained: 50 pmol of each primer,
2.5 U of Taq DNA-polymerase (Promega), 1X reaction buffer
(Promega), 5 mM MgCl2, 2.5 mM of each deoxyribonucleo-
side triphosphate and 50 ng of total DNA from the AMS
strains tested [25].
The amplification was done in a Programmable Thermal
Controller (PTC-100, MJ Research, USA) and the thermal
cycling consisted of an initial denaturation step at 92  C for
3 min followed by 30 cycles at 92  C for 1 min, 50e56  C for
1 min (annealing), adjusted according to the Tm of each pair
of primers, and 72  C for 1 min (extension), and a final
extension step at 72  C for 5 min. The amplicons were
analyzed by agarose gel electrophoresis [1.4% (w/v)], using as
molecular-weight markers the 100-bp DNA ladder (Promega).
2.8. Detection of staphylococcin structural genes by
DNA/DNA hybridizations
The staphylococcin structural genes (aurABCD, aucA,
sacaA/sacbA, pepA, epiA, elkA, eciA, and nukA) were ampli-
fied by PCR and the corresponding amplicons were purified by
the Wizard SV Gel and PCR Clean-Up System (Promega) and
used as probes.
Southern blot hybridization using the aurABCD amplicon
as a probe was performed in order to investigate whether this
operon was carried by plasmids with a size similar to that of
pRJ6, a 7.9 kb plasmid that codes for aureocin A70. Therefore,
for the detection of this operon, plasmid DNA from staphy-
lococcal AMS strains was used as the tested DNA.
For Southern blot hybridizations using aucA, sacaA/sacbA,
pepA, epiA, elkA, and eciA amplicons as probes, the genomic
DNA was digested with EcoRI, and, when using the nukA
amplicon as a probe, the genomic DNA was digested with
HindIII. Both plasmid DNA and digested genomic DNA were
separated by agarose gel electrophoresis [0.7% (w/v)]. The
gels were blotted onto nylon membranes (Hybond-N, GE
Healthcare), using standard methods [33].
Labeling and DNA/DNA hybridizations with probes
aurABCD, aucA, sacaA/sacbA, pepA, and epiA were per-
formed using the Gene Images AlkPhos Direct Labeling and
Detection System (GE Healthcare). When amplicons elkA,
eciA, and nukA were used as probes, labeling and DNA/DNA
 H. Ceotto et al. / Research in Microbiology 160 (2009) 592e599 595

Table 2
Primers used in this study.
Genes to be amplified Primers Tm Amplicon size Relevant features
50 30 
aurABCD Forward: P4B CCTTATAACTTCGAATGCT 48 C 525 pb Aureocin A70 structural genes
0 0
Reverse: P5 5 AAATATTAACAAGAGAAA3 42  C
50 0
aucA Forward: auc1 GAAGTTGTGAAAACTATTA3 48  C 322 pb Aureocin A53 structural gene
0 0
Reverse: auc2 5 CATAAAACAAAGAGCCAAAGT3 56  C
50 30
sacaA and sacbA Forward: C55F AGCGTGGTGATTCTTATG 50  C 499 pb Staphylococcin C55 structural genes
0 0
Reverse: C55R 5 TCTGATTTATTTAGTTCTGGATA3 47  C
50 30
pepA Forward: AGAGGAGGTGGTTATATATG 48  C 427 pb Pep5 structural gene
0 0
Reverse: 5 TGAGTTCCATGCCCAGTG3 50  C
50 0
epiA Forward: GGAGTGTTTAAAATGGAAGC3 50  C 431 pb Epidermin structural gene
50 30
Reverse: CCTTTTCCCAGTCTATTTTG 49  C
0 0
elkA Forward:K7F5 CTCAAAAGAGTGATTTAAGTCCGC3 49  C 115 pb Epilancin K7 structural gene
50 30
Reverse: K7R2 CCACCAGTAATATTGCAACCGC 50  C
0 0
eciA Forward: 280F 5 CGGAGGGATATATTATGG3 41  C 195 pb Epcidin 280 structural gene
50 0
Reverse: 280R CAATCACTACTATTGACAATCAC3 45  C
50 30
nukA Forward: nukAF AGGAGGTAACAAACATGG 52  C 195 pb Nukacin ISK-1 structural gene
0 0
Reverse: nukAR 5 CCCCTTTTTATGAACAACAAG3 54  C

hybridizations were performed using the Amersham Mega-
prime DNA Labeling System (GE Healthcare). Both
systems were used according to the manufacturers
instructions.
3. Results
3.1. Bacteriocin production
Forty-six strains of Staphylococcus spp. (17.9%) from 12
different dairy herds were found to exhibit antagonistic
activity against C. fimi NCTC 7547. The inhibition zones
varied from 11 to 48 mm in diameter; 39 strains (84.8%)
presented inhibition zones larger than 20 mm. All 46 AMS
were inactivated by at least one proteolytic enzyme tested,
indicating their proteinaceous nature (Table 3). Thus, they can
be considered bacteriocins.
3.2. Identification
3.4. Cross-immunity toward S. aureus A70
Generally, strains that produce either identical or similar
bacteriocins exhibit cross-immunity, since the immune
systems are specific to their cognate bacteriocin. The presence
of cross-immunity between bacteriocin producers is indicative
of relatedness between their bacteriocins. Therefore, cross-
immunity between the 46 S. aureus Bac strains and S. aureus
A70, which produces aureocin A70, was tested on BHI agar
plates. The 46 S. aureus Bac were used as producers against
strains S. aureus A70 and S. aureus A70 Bac (cured of pRJ6,
which encodes aureocin A70), used as indicators.
The bacteriocins produced by 17 strains (4091, 4093, 4100,
3913, 3959, 3705, 4150, 4230, 3633, 4180, 4183, 4185, 3853,
4044, 4045, 4046, and 4323) did not inhibit both strains tested
as indicators, suggesting that strains A70 and A70 Bac are
resistant to the bacteriocins produced by all 17 strains. The
remaining 29 strains (63.0%) inhibited growth of S. aureus
A70 Bac but did not inhibit growth of S. aureus A70, sug-
gesting the presence of cross-immunity among them.

The results of the tests performed were conclusive for the
identification of all 46 strains as S. aureus, since they were
Gram-positive cocci arranged in irregular clusters, and were
positive for rabbit plasma coagulation, mannitol fermentation,
and acetoin production.
3.3. Antibiotic susceptibility
Among 14 drugs tested, only four strains (8.7%) were
susceptible to all antibiotics. The percentages of strains
exhibiting a resistance phenotype to one or more drugs are
shown in Fig. 1. Eighteen strains (39.1%) exhibited a multiple
antibiotic resistance phenotype, i.e, they were resistant to at
least three different categories of drugs.
S. aureus isolates were mainly resistant to ampicillin
(67.4%), erythromycin (58.7%), and tetracycline (41.3%). No
strain was resistant to vancomycin, mupirocin, and imipenem
(Table 3).
3.5. Plasmid profile of Bac strains
Forty-five strains showed at least one plasmid DNA form.
Only one strain, 4045, did not present any plasmid form,
suggesting that genes involved in its bacteriocin production
are located on the bacterial chromosome. Thirty-five strains
(76.1%) exhibited a plasmid DNA with a size similar to that of
pRJ6 (7.9 kb) [18]. The plasmid profiles of the Bac strains
are also shown in Table 3.
3.6. Detection of the aurABCD operon
The aurABCD operon encodes the four peptides which
compose aureocin A70. The presence of this operon was
investigated in the 46 Bac strains by PCR and DNA/DNA
hybridization. S. aureus A70, which produces aureocin A70,
was used as a positive control, and strain A53, which produces
aureocin A53, was used as a negative control.
596 H. Ceotto et al. / Research in Microbiology 160 (2009) 592e599

Table 3
Characteristics of bacteriocin-producing S. aureus strains.
Herd S. aureus Bac strain Effect of proteolytic enzymes Plasmid profile Resistance profile Presence of the aurABCD operonc
Protease XXIII Trypsin (size in kb)

1 4087CI S NT 4.4; 8.0a; >27 Tc

4089CI R S 8.5a; >27 Em, Tc
4091R R S 8.5a; >27 Ap, Pc
2 4093R S NT 2.4; 3.8; 13.5; >27 Ap, Em, Pc, Tc e
4100R S NT 3.5 Ap, Pc e
3 3913R R S 3.1; 3.6; 4.9 Ap, Cp, Em, Pc, Tc e
4 3958CI S NT 8.5a; 9.5 Ap, Em, Pc
3959R R S 3.1; 3.6; 5.0 Ap, Cl, Gm, Pc, Tc e
3962CI S NT 8.5a Ap, Em, Gm
3963CI S NT 8.5a; >27 Ap, Cp, Cl, Co, Em, Pc
5 3705R S NT 2.3; 3.4; 8.0a > 27 Ap, Em, Pc
6 4061CI R S 4.3; 8.0a Ap, Em, Pc, Tc
4063CI S NT 4.3; 8.0a Ap, Cl, Em, Pc, Tc
4066CI S NT 4.3; 8.0a Ap, Cp, Cl, Co, Em, Pc, Tc
4071CI R S 7.9a Ap, Cp, Em, Pc, Tc
4143CI R S 4.5; 8.0a; >27 Ap, Pc, Tc
4147CI R S 4.3; 8.1a; >27 Ap, Pc, Tc
4148CI R S 4.3; 8.2a; >27 Ap, Em, Pc, Tc
4150R S NT 3.0; 4.2 Ap, Pc, Tc e
4154CI R S 4.3; 8.0a; >27 Ap, Em, Pc, Tc
4230R S NT 3.0; 5.5 Ap, Ce, Pc e
7 3633R R S 3.7; 8.0a Ce, Rf
8 4180R R S 3.4 e e
4181CI R S 8.1a; >27 Ap, Co, Pc
4183R R S 7.9 Ap, Gm, Pc e
4185R R S 11.5 Ap, Pc e
9 3853R R S 2.9; 3.2; 4.5 Ap, Cp, Em, Gm, Pc, Tc e
10 4042CI R S 8.1a Ap, Pc
4044CI S NT 3.0; 3.5; 8.0a Ap, Co, Em, Pc, Rf, Tc
4045R S NT e Ap, Cl, Em, Gm, Pc, Tc e
4046R R S 8.0; >27 Em e
11 2246CI R S 8.1a Ap, Cp, Co, Em, Gm, Pc
12 4314CI S NT 7.9a Ap, Ce, Em, Pc, Rf, Tc
4315CI R S 7.9a Cl, Co, Em, Rf, Tc
4316CI R S >27b Ap, Em, Pc, Rf
4317CI R S 7.9a Ce
4318CI R S 7.9a Cl, Em
4319CI R S 7.9a Em
4320CI R S 7.9a e
4322CI R S 7.9a Ap, Pc
4323R R S 8.3a; >27 Ap, Em, Pc
4324CI R S 7.9a Em
4325CI R S 7.9a Em
4326CI R S 7.9a; >27 e
4328CI R S 7.9a; >27 e
4329CI R S 7.9a Em, Gm
CI, cross-immunity with aureocin A70; R, strain A70 was resistant to the bacteriocin produced by the corresponding strain; Ap, ampicillin; Ce, cephalothin;
Cl, clindamycin; Co, chloramphenicol; Cp, ciprofloxacin; Em, erythromycin; Gm, gentamicin; Pc, penicillin; Tc, tetracycline; S, sensitivity to this proteolytic
enzyme; R, resistance to this proteolytic enzyme; NT, not tested.
a
Plasmid hybridization with the aurABCD operon used as a probe.
b
Chromosomal hybridization with the aurABCD operon used as a probe.
c
Detected by either PCR or DNA/DNA hybridization.

A 525 bp fragment corresponding to the aurABCD ampli-
con was detected in 28 Bac strains (60.9%) by PCR. On the
other hand, hybridization signals were detected in 34 strains
(73.9%; Table 3). In 33 strains, the signal was detected on
plasmids with w8.0 kb, a size similar to that of pRJ6, and in
the remaining one the signal was detected in the remnants of
the bacterial chromosome. Some representative results are
shown in Fig. 2. The results suggest that the bacteriocins
produced by these 34 S. aureus strains, involved in mastitis
cases, are related to aureocin A70.
3.7. Detection of aucA, sacaA/sacbA, pepA, eciA, elkA,
epiA, and nukA bacteriocin structural genes
The 12 Bac strains that did not present the aurABCD
operon were tested for the presence of structural genes
 H. Ceotto et al. / Research in Microbiology 160 (2009) 592e599
Fig. 1. The percentage of 46 S. aureus Bac strains involved in bovine mastitis
showing resistance to different numbers of antimicrobial agents.
involved in aureocin A53, staphylococcin C55/BacR1, Pep5,
epidermin, epicidin 280, epilancin K7, and nukacin ISK-1
production. These genes were investigated by both PCR and
DNA/DNA hybridizations.
The bacteriocin producer strains (S. aureus A53, S. aureus
C55, S. epidermidis 5, S. epidermidis Tu3298, S. epidermidis
BN280, S. epidermidis K7, and Staphylococcus simulans 3299)
were used as a positive control for detection of its cognate
structural gene. S. aureus A70 was used as a negative control.
S. simulans 3299 produces a bacteriocin, simulancin 3299,
which proved to be identical to nukacin ISK-1 (unpublished
results) and therefore this strain was employed as a positive
control for nukacin ISK-1 production.
None of the genes amplified by the primers described in Table 1
could be detected by either PCR or DNA/DNA hybridizations.
3.8. Spectrum of action of the bacteriocins
The spectrum of action of the bacteriocins produced by
S. aureus strains 3853, 3913, 3959, 4045, 4046, 4093, 4100,
Fig. 2. Southern blot hybridization using the operon aurABCD, amplified by
PCR, as a probe. The lanes represent plasmid DNA isolated from strains: (A)
S. aureus A53 (negative control); (B) S. aureus A70 (positive control); (C)
4318; (D) 4319; (E) 4320; (F) 4322; (G) 4324; and (H) 4316. Crm, remnants of
chromosomal DNA. OC, open circular; CCC, covalently closed circle.
597
4150, 4180, 4183, 4185, and 4230, which seem to be different
from all staphylococcins tested, was then investigated against
41 indicator microorganisms.
Strains 3853, 3913, 3959, 4045, 4046, 4093, 4100, 4150,
4180, 4183, and 4230 inhibited only M. luteus ATCC 4698,
a strain commonly used as an indicator of bacteriocin
production due to its sensitivity to these AMS. Strain 4185
inhibited M. luteus, L. lactis and all Listeria spp. strains tested,
including L. monocytogenes, and B. cereus, by inhibition
assays on agar plates. In addition, the bacteriocin produced by
strain 4185 exhibited antagonistic activity toward S. aureus 4,
S. epidermidis 118, S. epidermidis 102Hp, and S. haemolyticus
69Hp, but only when the microtiter plate assay was employed.
4. Discussion
Bac strains have been isolated in Brazil at varying
frequencies (from 6.4% to 32.5%) among staphylococcal
strains of different sources [17,18,25,30]. From 257 staphy-
lococcal strains involved in bovine mastitis tested in this study,
17.9% were shown to be Bac.
All 46 Bac strains were identified as S. aureus, the most
widespread causative agent of bovine mastitis. Once it is
established in the mammary glands of the animal, S. aureus is
very difficult to eradicate [8,38].
Many drugs have been used for mastitis treatment (peni-
cillins, macrolides, lincosamides, and cephalosporins), but
several factors, including the ability of S. aureus to survive
inside neutrophils, to induce formation of microabscesses and
its resistance to the antibiotic used for treatment, result in
infections that are difficult to manage therapeutically [4,9,16].
From 46 S. aureus involved in bovine mastitis analyzed in the
present study, 18 (39.1%) expressed a multiple antibiotic
resistance phenotype, with a higher percentage of resistance to
ampicillin (67.4%), erythromycin (58.7%), and tetracycline
(41.3%).
Cross-immunity tests against S. aureus A70 and detection
of the aurABCD operon by PCR and DNA/DNA hybridization
revealed that 34 strains (73.9%) produce a bacteriocin either
similar or identical to aureocin A70. In only one strain, 4316,
the aurABCD operon probe hybridize with the remnants of
chromosomal DNA, suggesting that in this strain the genes
responsible for bacteriocin production could be located either
on the bacterial chromosome or on a plasmid which migrates
with the chromosomal remnants. In 33 strains, the aurABCD
operon seems to be located on a plasmid with w8.0 kb, a size
similar to that of pRJ6, a 7.9 kb plasmid which encodes
aureocin A70. However, curing the strains of the plasmids
would definitively prove the location of the bacteriocin genes
on them.
The detection of an 8.0-kb plasmid encoding a bacteriocin
similar to aureocin A70 in most of the Bac strains was not
a surprise. Plasmids with a size similar to that of pRJ6 have
been frequently isolated by our group in studies related to
identification of new bacteriocins produced by Staphylococcus
spp., including CNS [17,18,26,25,31]. Its prevalence among
Bac strains of this genus is probably related to its ability to
598 H. Ceotto et al. / Research in Microbiology 160 (2009) 592e599
be mobilized by staphylococcal conjugative plasmids
[11,17,30]. However, mobilization of the putative Bac plas-
mids detected in the present study was not investigated.
In class II bacteriocins, immunity proteins display strong
specificity with respect to the bacteriocins, protecting the
producer cell against their cognate bacteriocins [22].
Although strains 3633, 3705, 4044, and 4091 produce
aureocin A70 variants, strains A70 and A70 Bac were
resistant to the bacteriocins produced by them, demonstrating
that even without an immune system against aureocin A70,
strain A70 Bac is still protected against bacteriocins from
strains 3633, 3705, 4044, and 4091. Resistance to aureocin
A70 variants could be correlated with cell envelope changes
such as alterations in cell membrane lipid composition and
fluidity, cell wall thickness or cell wall charge [12].
In L. monocytogenes resistant to class IIa bacteriocins, this
phenotype seems to be linked to reduced expression of
a mannose permease of the phosphotransferase system.
However, other factors, such as cell membrane fluidity and cell
surface charge, also impact upon its bacteriocin resistance
[12].
In 12 strains (3853, 3913, 3959, 4045, 4046, 4093, 4100,
4150, 4180, 4183, 4185, and 4230), the aurABCD operon could
not be detected by either PCR amplification or DNA/DNA
hybridization, suggesting that the bacteriocins produced by
these strains are different from aureocin A70. Complementary
tests were then performed with these strains in order to test
whether their bacteriocins were different from the other
staphylococcins already described in the literature.
The structural genes involved in aureocin A53, staphy-
lococcin C55/BacR1, Pep5, epidermin, epicidin 280, epilancin
K7, and nukacin ISK-1 production could not be detected either
by PCR or by DNA/DNA hybridizations in the 12 strains that
did not carry the aurABCD operon, suggesting that these
strains produce bacteriocins distinct from the substances
encoded by these genes.
Although aureocin A70 seems to be highly disseminated
among Staphylococcus spp., aureocin A53 was isolated only
once by our group [18]. Staphylococcin C55/BacRI has been
isolated twice [13,27]. Epidermin seems to be the most
frequently produced lantibiotic in the group of CNS, as it is
isolated from many strains of S. epidermidis and also from
other staphylococcal species [6]. Epicidin 280 is considered
a natural variant of Pep5 [19]. In 2005, an epilancin K7
variant, epilancin 15X, was described [14]. Two different
variants of nukacin ISK-1 have also been reported [24,37].
In spite of the biotechnological applications of bacteriocins
such as nisin and pediocin PA-1 in food preservation, the
emergence of bacteriocin resistance among bacterial patho-
gens makes identification of novel antimicrobials even more
important [12]. Since the bacteriocin produced by strain 4185
could inhibit not only L. monocytogenes but also B. cereus
strains, it may possess potential practical applications in the
food industry.
L. monocytogenes is a food-borne pathogen that causes
serious illness, such as listeriosis, meningitis and septicemia
[7]. B. cereus is a food poisoning bacterium, widespread in
nature and frequently isolated from soil and growing plants. It
is also well adapted for growth in the intestinal tract of insects
and mammals, where it may cause an emetic or diarrheal type
of food-associated illness [35].
A combination of different bacteriocins, such as Bac4185
and either nisin or pediocin PA-1, could enable more effective
control of undesirable bacteria in food. Moreover, the proper
use of these combined bacteriocins could prevent the emer-
gence of bacteriocin-resistant bacteria, which might occur due
to the continuous use of only a single antimicrobial agent.
Therefore, complementary experiments are currently in
progress aimed at purification of the bacteriocin produced by
strain 4185. Further studies will provide valuable information
on the properties of this bacteriocin, and an investigation of
mechanisms of its biosynthesis based on genetic information
will be of major importance for further applications of this
new staphylococcin.
Acknowledgements
We thank Dr. John Tagg for sending us strain S. aureus
C55. Hilana Ceotto is the recipient of a scholarship from
CNPq/Brazil. This study was supported by grants from CNPq,
PRONEX, and FAPERJ to M.C.F.B.
References
[1] Allgaier, H., Jung, G., Werner, R.G., Schneider, U., Zahener, H. (1986)
Epidermin: sequencing of a heterodetic tetracyclic 21-peptide amide
antibiotic. Eur. J. Biochem. 160, 9e22.
[2] Augustin, J., Rosenstein, R., Wieland, B., Schneider, U., Schnell, N.,
Engelke, G., Entian, K.D., Gotz, F. (1992) Genetic analysis of epidermin
biosynthesis genes and epidermin-negative mutants of Staphylococcus
epidermidis. Eur. J. Biochem. 204, 1149e1154.
[3] Bannerman, T.L., Peacock, S. (2007). In: P.R. Murray, E.J. Baron,
J.H. Jorgensen, M.L. Landry, & M.A. Pfaller (Eds.), Manual os clinical
microbiology (pp. 309e411). Washington: ASM Press.
[4] Barkema, H.W., Schukken, Y.H., Zadoks, R.N. (2006) The role of cow,
pathogen, and treatment regimen in the therapeutic success of bovine
Staphylococcus aureus mastitis. J. Dairy Sci. 89, 1877e1895.
[5] Bastos, M.C.F., Ceotto, H., Coelho, M.L.V., Nascimento, J.S. (2009)
Staphylococcal antimicrobial peptides: relevant properties and potential
biotechnological applications. Curr. Pharm. Biotechnol. 10, 38e61.
[6] Bierbaum, G., Gotz, F., Peschel, A., Kupke, T., van De Kamp, M.,
Sahl, H.-G. (1996) The biosynthesis of the lantibiotics epidermin, gal-
lidermin, Pep5, and epilancin K7. Antonie van Leeuwenhoek 69,
119e127.
[7] Bortolussi, R. (2008) Listeriosis: a primer. Can. Med. Assoc. J. 179,
795e797.
[8] Bradley, A.J. (2002) Bovine mastitis: an evolving disease. Vet. J. 164,
116e128.
[9] Call, D.R., Margaret, A., Davis, M.A., Sawant, A.A. (2008) Antimicro-
bial resistance in beef and dairy cattle production. Anim. Health Res.
Rev. 9, 159e167.
[10] Clinical and Laboratory Standards Institute. (2008) Performance stan-
dards for antimicrobial susceptibility testing: M100-S16. NCCLS.
Wayne, Pennsylvania: EUA.
[11] Coelho, M.L.V., Ceotto, H., Madureira, D.J., Nes, I.F., Bastos, M.C.F.
(2009) Mobilization functions of the bacteriocinogenic plasmid pRJ6 of
Staphylococcus aureus. J. Microbiol. 47(3), 327e336.
[12] Cotter, P.D., Hill, C., Ross, R.P. (2005) Bacteriocins: developing innate
immunity for food. Nat. Rev. Microbiol. 3, 777e788.
 H. Ceotto et al. / Research in Microbiology 160 (2009) 592e599
[13] Crupper, S.S., Gies, A.J., Iandolo, J.J. (1997) Purification and charac-
terization of staphylococcin BacR1, a broad-spectrum bacteriocin. Appl.
Environ. Microbiol. 63, 4185e4190.
[14] Ekkelenkamp, M.B., Hanssen, M., Hsu, S.D., Jong, A., Milatovic, D.,
Verhoef, J., van Nuland, N.A. (2005) Isolation and structural character-
ization of epilancin 15x, a novel lantibiotic from a clinical strain of
Staphylococcus epidermidis. FEBS Lett. 579, 1917e1922.
[15] Ersfeld-Dressen, H., Sahl, H.-G., Brandis, H. (1984) Plasmid involve-
ment in production of an immunity to the staphylococcin-like peptide
Pep5. J. Gen. Microbiol. 130, 3029e3035.
[16] Erskine, R.J., Walker, R.D., Bolin, C.A., Bartlett, P.C., White, D.G.
(2002) Trends in antibacterial susceptibility of mastitis pathogens during
a seven-year period. J. Dairy Sci. 85, 1111e1118.
[17] Gamon, M.R., Moreira, E.C., Oliveira, S.S., Teixeira, L.M.,
Bastos, M.C.F. (1999) Characterization of a novel bacteriocin-encoding
plasmid found in clinical isolates of Staphylococcus aureus. Antonie van
Leeuwenhoek 75, 233e243.
[18] Giambiagi-deMarval, M., Mafra, M.A., Penido, E.G.C., Bastos, M.C.F.
(1990) Distinct groups of plasmids correlated with bacteriocin produc-
tion in Staphylococcus aureus. J. Gen. Microbiol. 136, 1591e1599.
[19] Heidrich, C., Pag, U., Josten, M., Metzger, J., Jack, R.W., Bierbaum, G.,
Jung, G., Sahl, H.-G. (1998) Isolation, characterization and heterologous
expression of the novel lantibiotic epicidin 280 and analysis of its
biosynthetic gene cluster. Appl. Environ. Microbiol. 64, 3140e3146.
[20] Heng, N.C.K., Wescombe, P.A., Burton, J.P., Jack, R.W., Tagg, J.R.
(2007). In: M.A. Riley, & M.A. Chavan (Eds.), Bacteriocins: ecology and
evolution (pp. 45e92). Berlin: Springer.
[21] Jack, R.W., Bierbaum, G., Heidrich, C., Sahl, H.-G. (1995) The genetics
of lantibiotic biosynthesis. Bioessays 17, 793e802.
[22] Jack, R.W., Tagg, J.R., Ray, B. (1995) Bacteriocins of Gram-positive
bacteria. Microbiol. Rev. 59, 171e200.
[23] Kaletta, C., Entian, K.-D., Kellner, R., Jung, G., Reis, M., Sahl, H.-G.
(1989) Pep5, a new lantibiotic: structural gene isolation and prepeptide
sequence. Arch. Microbiol. 152, 16e19.
[24] Minamikawa, M., Inoue, K.N., Yamazaki, K. (2005) Purification and
characterization of warnericin RB4, anti- Alicyclobacillus bacteriocin,
produced by Staphylococcus warneri RB4. Curr. Microbiol. 51, 22e26.
[25] Nascimento, J.S., Fagundes, P.C., Brito, M.A.V.P., Bastos, M.C.F. (2005)
Production of bacteriocins by coagulase-negative staphylococci involved
in bovine mastitis. Vet. Microbiol. 106, 61e71.
[26] Nascimento, J.S., Santos, K.R.N., Gentilini, E., Sordelli, D.,
Bastos, M.C.F. (2002) Phenotypic and genetic characterization of
bacteriocin producing strains of Staphylococcus aureus involved in
bovine mastitis. Vet. Microbiol. 85, 133e144.
599
[27] Navaratna, M.A., Sahl, H.-G., Tagg, J.R. (1998) Two-component anti-
Staphylococcus aureus lantibiotic activity produced by Staphylococcus
aureus C55. Appl. Environ. Microbiol. 64, 4803e4808.
[28] Netz, D.J.A., Bastos, M.C.F., Sahl, H.-G. (2002) Mode of action of the
antimicrobial peptide aureocin A53 from Staphylococcus aureus. Appl.
Environ. Microbiol. 68, 5274e5280.
[29] Netz, D.J.A., Sahl, H.-G., Marcolino, R., Nascimento, J.S., Oliveira, S.S.,
Soares, M.B., Bastos, M.C.F. (2001) Molecular characterisation of aur-
eocin A70, a multipeptide bacteriocin isolated from Staphylococcus
aureus. J. Mol. Biol. 311, 939e949.
[30] Oliveira, S.S., Nascimento, J.S., Povoa, D.C., Araujo, S.A.,
Gamon, M.R., Bastos, M.C.F. (1998) Genetic analysis of the bacteriocin-
encoding plasmids pRJ6 and pRJ9 of Staphylococcus aureus by trans-
poson mutagenesis and cloning of genes involved in bacteriocin
production. J. Appl. Microbiol. 85, 792e814.
[31] Oliveira, S.S., Povoa, D.C., Nascimento, J.S., Pereira, M.S.V.,
Junior, J.P.S., Bastos, M.C.F. (1998) Antimicrobial substances produced
by Staphylococcus aureus strains isolated from cattle in Brazil. Lett.
Appl. Microbiol. 27, 229e234.
[32] Potter, A., Ceotto, H., Giambiagi-deMarval, M., Santos, K.R.N.,
Nes, I.F., Bastos, M.C.F. (2009) The gene bap, involved in biofilm
production, is present in Staphylococcus spp. strains from nosocomial
infections. J. Microbiol. 47(3), 319e326.
[33] Sambrock, J., Fritsch, E.F., Maniatis, T. (1989) Molecular cloning:
a laboratory manual. Cold Spring Harbor, NY: Cold Spring Harbor
Laboratory.
[34] Sashihara, T., Kimura, H., Higuchi, T., Adachi, A., Matsusaki, H.,
Sonomoto, K., Ishizaki, A. (2000) A novel lantibiotic, nukacin ISK-1, of
Staphylococcus warneri ISK-1: cloning of the structural gene and iden-
tification of the structure. Biosci. Biotechnol. Biochem. 64, 2420e2428.
[35] Stenfors-Arnesen, L.P., Fagerlund, A., Granum, P.E. (2008) From soil to
gut: Bacillus cereus and its food poisoning toxins. FEMS Microbiol. Rev.
32(4), 579e606.
[36] van de Kamp, M., Horstink, L.M., van den Hooven, H.W., Konings, R.N.,
Hilbers, C.W., Frey, A., Sahl, H.-G., Metzger, J.W., van de Vem, F.J.
(1995) Sequence analysis by NMR spectroscopy of the peptide lanti-
biotic epilancin K7 from Staphylococcus epidermidis K7. Eur. J. Bio-
chem. 227, 757e771.
[37] Wilaipun, P., Zendo, T., Okuda, K., Nakayama, J., Sonomoto, K. (2008)
Identification of the nukacin KQU-131, a new type-A (I) lantibiotic
produced by Staphylococcus hominis KQU-131 isolated from thai fermented
fish product (Pla-Ra). Biosci. Biotechnol. Biochem. 72, 2232e2235.
[38] Zhao, X., Lacasse, P. (2008) Mammary tissue damage during bovine
mastitis: causes and control. J. Anim. Sci. 86, 57e65.