Human genetics

Contents

1 Intro to Genetics 1
1.1 Introduction to genetics . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1
1.1.1 Inheritance in biology . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2
1.1.2 How genes work . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 3
1.1.3 Genes and evolution . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 5
1.1.4 Genetic engineering . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 5
1.1.5 See also . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 5
1.1.6 References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 6
1.1.7 External links . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 6

2 Cell Structure and Function 7

3 Molecular Genetics 8

4 Mendelian Inheritance 9
4.1 Mendelian inheritance . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 9
4.1.1 History . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 9
4.1.2 Mendels laws . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 10
4.1.3 Mendelian trait . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 12
4.1.4 Non-Mendelian inheritance . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 12
4.1.5 See also . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 13
4.1.6 Notes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 13
4.1.7 References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 13
4.1.8 Notes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 13
4.1.9 External links . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 14

5 Beyond Mendel 15
5.1 Non-Mendelian inheritance . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 15
5.1.1 Types . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 15
5.1.2 See also . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 17
5.1.3 References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 17
5.1.4 External links . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 18
5.2 Epistasis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 18
5.2.1 History . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 18

i
ii CONTENTS

5.2.2 Classication . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 18
5.2.3 Genetic and molecular causes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 20
5.2.4 Evolutionary consequences . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 21
5.2.5 Methods and model systems . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 22
5.2.6 See also . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 22
5.2.7 References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 22
5.2.8 External links . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 24
5.3 Epigenetics . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 24
5.3.1 Denitions . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 25
5.3.2 Molecular basis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 26
5.3.3 Mechanisms . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 27
5.3.4 Functions and consequences . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 30
5.3.5 Epigenetics in bacteria . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 31
5.3.6 Medicine . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 31
5.3.7 Research . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 33
5.3.8 Caution . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 33
5.3.9 In popular culture . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 33
5.3.10 See also . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 33
5.3.11 References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 34
5.3.12 External links . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 40
5.4 Cancer epigenetics . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 41
5.4.1 Mechanisms . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 41
5.4.2 MicroRNA and DNA repair . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 43
5.4.3 DNA repair pathways . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 44
5.4.4 Epigenetic carcinogens . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 46
5.4.5 Cancer subtypes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 46
5.4.6 Identication methods . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 47
5.4.7 Diagnosis and prognosis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 47
5.4.8 Treatment . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 47
5.4.9 References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 48

6 Human genetic diseases 55

6.1 Genetic disorder . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 55
6.1.1 Single-gene . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 55
6.1.2 Many genes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 56
6.1.3 Diagnosis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 57
6.1.4 Prognosis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 57
6.1.5 Treatment . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 57
6.1.6 See also . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 58
6.1.7 References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 58
6.1.8 External links . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 58
6.2 List of genetic disorders . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 58
CONTENTS iii

6.2.1 Most common disorders . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 58

6.2.2 Full list . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 59
6.2.3 See also . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 59
6.2.4 References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 59
6.3 Nijmegen breakage syndrome . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 59
6.3.1 Characteristics . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 59
6.3.2 Cause . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 59
6.3.3 References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 60
6.3.4 External links . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 60
6.4 Ataxia telangiectasia . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 60
6.4.1 Symptoms . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 60
6.4.2 Pathophysiology . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 63
6.4.3 Genetics and information about A-T carriers . . . . . . . . . . . . . . . . . . . . . . . . . 65
6.4.4 Diagnosis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 65
6.4.5 Dierential diagnosis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 66
6.4.6 Management . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 67
6.4.7 Clinics and support . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 70
6.4.8 Epidemiology . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 70
6.4.9 Prognosis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 70
6.4.10 Research directions . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 70
6.4.11 References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 70
6.4.12 External links . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 74
6.5 Cockayne syndrome . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 74
6.5.1 Forms . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 74
6.5.2 Physical appearance and diagnosis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 75
6.5.3 Genetics . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 75
6.5.4 Neurology . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 75
6.5.5 Treatment . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 76
6.5.6 See also . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 76
6.5.7 References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 76
6.5.8 External links . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 76
6.6 Xeroderma pigmentosum . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 76
6.6.1 Genetics . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 77
6.6.2 Types . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 78
6.6.3 Symptoms . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 78
6.6.4 Treatment . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 78
6.6.5 Prognosis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 78
6.6.6 In popular culture . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 78
6.6.7 See also . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 79
6.6.8 References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 79
6.6.9 External links . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 79
iv CONTENTS

6.7 Amyotrophic lateral sclerosis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 79

6.7.1 Classication . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 80
6.7.2 Signs and symptoms . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 80
6.7.3 Cause . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 81
6.7.4 Pathophysiology . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 83
6.7.5 Diagnosis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 83
6.7.6 Management . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 84
6.7.7 Epidemiology . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 85
6.7.8 History . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 85
6.7.9 Society and culture . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 86
6.7.10 Research . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 86
6.7.11 References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 86
6.7.12 External links . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 91

7 Pedigrees 92

8 Inheritance Patterns 93

9 Development 94

10 Text and image sources, contributors, and licenses 95

10.1 Text . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 95
10.2 Images . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 99
10.3 Content license . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 101
Chapter 1

Intro to Genetics

1.1 Introduction to genetics The complete set of genes in a particular organism.

Genetic engineering
This article is a non-technical introduction to the subject.
For the main encyclopedia article, see Genetics. When people change an organism by adding new genes,
Genetics glossary or deleting genes from its genome.
DNA
Mutation
A long molecule that looks like a twisted ladder. It is
made of four types of simple units and the sequence of An event that changes the sequence of the DNA in a gene.
these units carries information, just as the sequence of Genetics is the study of geneswhat they are, what they
letters carries information on a page. do, and how they work. Genes are made up of molecules
Nucleotides inside the nucleus of a cell that are strung together in such
a way that the sequence carries information: that informa-
tion determines how living organisms inherit phenotypic
They form the rungs of the DNA ladder and are the re- traits, (features) determined by the genes they received
peating units in DNA. There are four types of nucleotides from their parents and thereby going back through the
(A, T, G and C) and it is the sequence of these nucleotides generations. For example, ospring produced by sexual
that carries information. reproduction usually look similar to each of their parents
Chromosome because they have inherited some of each of their par-
ents genes. Genetics identies which features are inher-
ited, and explains how these features pass from generation
A package for carrying DNA in the cells. They contain a
to generation. In addition to inheritance, genetics stud-
single long piece of DNA that is wound up and bunched
ies how genes are turned on and o to control what sub-
together into a compact structure. Dierent species of
stances are made in a cellgene expression; and how a
plants and animals have dierent numbers and sizes of
cell dividesmitosis or meiosis.
chromosomes.
Some phenotypic traits can be seen, such as eye color
Gene
while others can only be detected, such as blood type or
intelligence. Traits determined by genes can be modied
A segment of DNA. Genes are like sentences made of the by the animals surroundings (environment): for exam-
letters of the nucleotide alphabet, between them genes ple, the general design of a tigers stripes is inherited, but
direct the physical development and behavior of an or- the specic stripe pattern is determined by the tigers sur-
ganism. Genes are like a recipe or instruction book, pro- roundings. Another example is a persons height: it is
viding information that an organism needs so it can build determined by both genetics and nutrition.
or do something - like making an eye or a leg, or repairing
Genes are made of DNA, which is divided into separate
a wound.
pieces called chromosomes. Humans have 46: 23 pairs,
Allele though this number varies between species, for exam-
ple many primates have 24 pairs. Meiosis creates special
The dierent forms of a given gene that an organism may cells, sperm in males and eggs in females, which only have
possess. For example, in humans, one allele of the eye- 23 chromosomes. These two cells merge into one during
color gene produces green eyes and another allele of the the fertilization stage of sexual reproduction, creating a
eye-color gene produces brown eyes. zygote in which a nucleic acid double helix divides, with
each single helix occupying one of the daughter cells, re-
Genome sulting in half the normal number of genes. The zygote

1
2 CHAPTER 1. INTRO TO GENETICS

then divides into four daughter cells by which time genetic

recombination has created a new embryo with 23 pairs of
chromosomes, half from each parent. Mating and resul-
tant mate choice result in sexual selection. In normal cell
division (mitosis) is possible when the double helix sepa-
rates, and a complement of each separated half is made,
resulting in two identical double helices in one cell, with
each occupying one of the two new daughter cells created
when the cell divides.
Chromosomes all contain four nucleotides, abbreviated
C (cytosine), G (guanine), A (adenine), or T (thymine),
which line up in a particular sequence and make a long
string. There are two strings of nucleotides coiled around
one another in each chromosome: a double helix. C on
one string is always opposite from G on the other string;
A is always opposite T. There are about 3.2 billion nu-
cleotide pairs on all the human chromosomes: this is the
human genome. The order of the nucleotides carries ge-
netic information, whose rules are dened by the genetic
code, similar to how the order of letters on a page of
text carries information. Three nucleotides in a rowa
tripletcarry one unit of information: a codon.
The genetic code not only controls inheritance: it also
controls gene expression, which occurs when a portion of
the double helix is uncoiled, exposing a series of the nu-
cleotides, which are within the interior of the DNA. This
series of exposed triplets (codons) carries the informa-
tion to allow machinery in the cell to read the codons on
the exposed DNA, which results in the making of RNA
molecules. RNA in turn makes either amino acids or
microRNA, which are responsible for all of the structure A section of DNA; the sequence of the plate-like units
and function of a living organism; i.e. they determine (nucleotides) in the center carries information.
all the features of the cell and thus the entire individual.
Closing the uncoiled segment turns o the gene.
Heritability means the information in a given gene is Genes and inheritance
not always exactly the same in every individual in that
species, so the same gene in dierent individuals does Genes are pieces of DNA that contain information for
not give exactly the same instructions. Each unique form synthesis of ribonucleic acids (RNAs) or polypeptides.
of a single gene is called an allele; dierent forms are col- Genes are inherited as units, with two parents dividing
lectively called polymorphisms. As an example, one al- out copies of their genes to their ospring. This pro-
lele for the gene for hair color and skin cell pigmentation cess can be compared with mixing two hands of cards,
could instruct the body to produce black pigment, produc- shuing them, and then dealing them out again. Humans
ing black hair and pigmented skin; while a dierent allele have two copies of each of their genes, and make copies
of the same gene in a dierent individual could give gar- that are found in eggs or spermbut they only include
bled instructions that would result in a failure to produce one copy of each type of gene. An egg and sperm join
any pigment, giving white hair and no pigmented skin: to form a complete set of genes. The eventually resulting
albinism. Mutations are random changes in genes creat- ospring has the same number of genes as their parents,
ing new alleles, which in turn produce new traits, which but for any gene one of their two copies comes from their
[1]
could help, harm, or have no new eect on the individ- father, and one from their mother.
uals likelihood of survival; thus, mutations are the basis The eects of this mixing depend on the types (the
for evolution. alleles) of the gene. If the father has two copies of an al-
lele for red hair, and the mother has two copies for brown
hair, all their children get the two alleles that give dif-
ferent instructions, one for red hair and one for brown.
The hair color of these children depends on how these
1.1.1 Inheritance in biology alleles work together. If one allele dominates the in-
structions from another, it is called the dominant allele,
1.1. INTRODUCTION TO GENETICS 3

end result. Tall people tend to have tall children because

their children get a package of many alleles that each con-
tribute a bit to how much they grow. However, there are
not clear groups of short people and tall people, like
there are groups of people with brown or red hair. This
is because of the large number of genes involved; this
makes the trait very variable and people are of many dif-
ferent heights.[3] Despite a common misconception, the
green/blue eye traits are also inherited in this complex in-
heritance model.[4] Inheritance can also be complicated
when the trait depends on interaction between genetics
and environment. For example, malnutrition does not
change traits like eye color, but can stunt growth.[5]

Inherited diseases

Some diseases are hereditary and run in families; oth-

ers, such as infectious diseases, are caused by the envi-
ronment. Other diseases come from a combination of
genes and the environment.[6] Genetic disorders are dis-
eases that are caused by a single allele of a gene and are
inherited in families. These include Huntingtons disease,
Cystic brosis or Duchenne muscular dystrophy. Cystic
Red hair is a recessive trait. brosis, for example, is caused by mutations in a single
gene called CFTR and is inherited as a recessive trait.[7]
Other diseases are inuenced by genetics, but the genes
and the allele that is overridden is called the recessive al- a person gets from their parents only change their risk of
lele. In the case of a daughter with alleles for both red getting a disease. Most of these diseases are inherited
and brown hair, brown is dominant and she ends up with in a complex way, with either multiple genes involved,
brown hair.[2] or coming from both genes and the environment. As an
example, the risk of breast cancer is 50 times higher in
Although the red color allele is still there in this brown-
the families most at risk, compared to the families least
haired girl, it doesn't show. This is a dierence between
at risk. This variation is probably due to a large number of
what you see on the surface (the traits of an organism,
alleles, each changing the risk a little bit.[8] Several of the
called its phenotype) and the genes within the organism
genes have been identied, such as BRCA1 and BRCA2,
(its genotype). In this example you can call the allele for
but not all of them. However, although some of the risk is
brown B and the allele for red b. (It is normal to write
genetic, the risk of this cancer is also increased by being
dominant alleles with capital letters and recessive ones
overweight, drinking a lot of alcohol and not exercising.[9]
with lower-case letters.) The brown hair daughter has the
A womans risk of breast cancer therefore comes from a
brown hair phenotype but her genotype is Bb, with one
large number of alleles interacting with her environment,
copy of the B allele, and one of the b allele.
so it is very hard to predict.
Now imagine that this woman grows up and has children
with a brown-haired man who also has a Bb genotype.
Her eggs will be a mixture of two types, one sort contain- 1.1.2 How genes work
ing the B allele, and one sort the b allele. Similarly, her
partner will produce a mix of two types of sperm con- Genes make proteins
taining one or the other of these two alleles. When the
transmitted genes are joined up in their ospring, these Main article: Genetic code
children have a chance of getting either brown or red hair,
since they could get a genotype of BB = brown hair, Bb The function of genes is to provide the information
= brown hair or bb = red hair. In this generation, there isneeded to make molecules called proteins in cells.[1] Cells
therefore a chance of the recessive allele showing itself in
are the smallest independent parts of organisms: the hu-
the phenotype of the childrensome of them may have man body contains about 100 trillion cells, while very
red hair like their grandfather.[2] small organisms like bacteria are just one single cell. A
Many traits are inherited in a more complicated way than cell is like a miniature and very complex factory that can
the example above. This can happen when there are sev- make all the parts needed to produce a copy of itself,
eral genes involved, each contributing a small part to the which happens when cells divide. There is a simple divi-
4 CHAPTER 1. INTRO TO GENETICS

sion of labor in cellsgenes give instructions and proteins

carry out these instructions, tasks like building a new copy
of a cell, or repairing damage.[10] Each type of protein is G C
a specialist that only does one job, so if a cell needs to C G
do something new, it must make a new protein to do this
C G
job. Similarly, if a cell needs to do something faster or
slower than before, it makes more or less of the protein A T
responsible. Genes tell cells what to do by telling them
which proteins to make and in what amounts.
G C

GTGCATCTGACTCCTGAGGAGAAG
T A
DNA
CACGTAGACTGAGGACTCCTCTTC T A
(transcription)
C G
GUGCAUCUGACUCCUGAGGAGAAG RNA
(translation) A T
V H L T P E E K protein G C
A T
Genes are expressed by being transcribed into RNA, and this RNA G C C
then translated into protein. T A T A
T A T A
Proteins are made of a chain of 20 dierent types of C C G
amino acid molecules. This chain folds up into a compact C
shape, rather like an untidy ball of string. The shape of
the protein is determined by the sequence of amino acids G C G
along its chain and it is this shape that, in turn, deter- A
T A
mines what the protein does.[10] For example, some pro- A T
A T
teins have parts of their surface that perfectly match the A T A T
shape of another molecule, allowing the protein to bind
to this molecule very tightly. Other proteins are enzymes,
which are like tiny machines that alter other molecules.[11] G C
G C
A T
The information in DNA is held in the sequence of the A T
repeating units along the DNA chain.[12] These units are T A
T A
four types of nucleotides (A,T,G and C) and the sequence G
G C
of nucleotides stores information in an alphabet called the
genetic code. When a gene is read by a cell the DNA se-
quence is copied into a very similar molecule called RNA DNA replication. DNA is unwound and nucleotides are matched
(this process is called transcription). Transcription is to make two new strands.
controlled by other DNA sequences (such as promoters),
which show a cell where genes are, and control how of-
ten they are copied. The RNA copy made from a gene ever, if the alleles for a particular protein have dierent
is then fed through a structure called a ribosome, which sequences and produce proteins that can't do their jobs,
translates the sequence of nucleotides in the RNA into no melanin is produced and the person has white skin and
the correct sequence of amino acids and joins these amino hair (albinism).[14]
acids together to make a complete protein chain. The new
protein then folds up into its active form. The process of
Genes are copied
moving information from the language of RNA into the
language of amino acids is called translation.[13]
Main article: DNA replication
If the sequence of the nucleotides in a gene changes, the
sequence of the amino acids in the protein it produces
may also changeif part of a gene is deleted, the protein Genes are copied each time a cell divides into two new
produced is shorter and may not work any more.[10] This cells. The process that copies DNA is called DNA repli-
is the reason why dierent alleles of a gene can have dif- cation.[12] It is through a similar process that a child inher-
ferent eects in an organism. As an example, hair color its genes from its parents, when a copy from the mother
depends on how much of a dark substance called melanin is mixed with a copy from the father.
is put into the hair as it grows. If a person has a normal DNA can be copied very easily and accurately because
set of the genes involved in making melanin, they make each piece of DNA can direct the creation of a new copy
all the proteins needed and they grow dark hair. How- of its information. This is because DNA is made of two
1.1. INTRODUCTION TO GENETICS 5

strands that pair together like the two sides of a zipper. to see the gray mice. Over time white mice would become
The nucleotides are in the center, like the teeth in the more and more frequent, while gray mice less and less.
zipper, and pair up to hold the two strands together. Im- Mutations create new alleles. These alleles have new
portantly, the four dierent sorts of nucleotides are dif- DNA sequences and can produce proteins with new
ferent shapes, so for the strands to close up properly, an properties.[18] So if an island was populated entirely by
A nucleotide must go opposite a T nucleotide, and a G black mice, mutations could happen creating alleles for
opposite a C. This exact pairing is called base pairing.[12]white fur. The combination of mutations creating new
When DNA is copied, the two strands of the old DNA are alleles at random, and natural selection picking out those
pulled apart by enzymes; then they pair up with new nu- that are useful, causes adaptation. This is when organisms
cleotides and then close. This produces two new pieces of change in ways that help them to survive and reproduce.
DNA, each containing one strand from the old DNA and
one newly made strand. This process is not predictably
perfect as proteins attach to a nucleotide while they are 1.1.4 Genetic engineering
building and cause a change in the sequence of that gene.
These changes in DNA sequence are called mutations.[15] Main article: Genetic engineering
Mutations produce new alleles of genes. Sometimes these
changes stop the functioning of that gene or make it serve Since traits come from the genes in a cell, putting a new
another advantageous function, such as the melanin genes piece of DNA into a cell can produce a new trait. This
discussed above. These mutations and their eects on the is how genetic engineering works. For example, rice can
traits of organisms are one of the causes of evolution.[16] be given genes from a maize and a soil bacteria so the
rice produces beta-carotene, which the body converts to
Vitamin A.[19] This can help children suering from Vi-
1.1.3 Genes and evolution tamin A deciency. Another gene being put into some
crops comes from the bacterium Bacillus thuringiensis;
Further information: Evolution, Introduction to evolu- the gene makes a protein that is an insecticide. The in-
tion, and History of evolutionary thought secticide kills insects that eat the plants, but is harmless
A population of organisms evolves when an inher- to people.[20] In these plants, the new genes are put into
the plant before it is grown, so the genes are in every part
of the plant, including its seeds.[21] The plants ospring
inherit the new genes, which has led to concern about the
spread of new traits into wild plants.[22]
The kind of technology used in genetic engineering is also
being developed to treat people with genetic disorders
in an experimental medical technique called gene ther-
apy.[23] However, here the new gene is put in after the
person has grown up and become ill, so any new gene is
not inherited by their children. Gene therapy works by
Mice with dierent coat colors. trying to replace the allele that causes the disease with an
allele that works properly.
ited trait becomes more common or less common over
time.[16] For instance, all the mice living on an island
would be a single population of mice: some with white 1.1.5 See also
fur, some gray. If over generations, white mice became
more frequent and gray mice less frequent, then the color Common misunderstandings of genetics
of the fur in this population of mice would be evolving.
Epigenetics
In terms of genetics, this is called an increase in allele
frequency. Full genome sequencing
Alleles become more or less common either by chance in
History of genetics
a process called genetic drift, or by natural selection.[17]
In natural selection, if an allele makes it more likely for Genetics in simple English
an organism to survive and reproduce, then over time this
allele becomes more common. But if an allele is harm- List of basic genetics topics
ful, natural selection makes it less common. In the above
Molecular genetics
example, if the island were getting colder each year and
snow became present for much of the time, then the allele Predictive medicine
for white fur would favor survival, since predators would
be less likely to see them against the snow, and more likely Timeline of the history of genetics
6 CHAPTER 1. INTRO TO GENETICS

1.1.6 References [23] Sta (November 18, 2005). Gene Therapy (FAQ). Hu-
man Genome Project Information. Oak Ridge National
[1] University of Utah Genetics Learning Center animated tour Laboratory. Retrieved 2006-05-28.
of the basics of genetics. Howstuworks.com. Retrieved
2008-01-24.
1.1.7 External links
[2] MELANOCORTIN 1 RECEPTOR, Accessed 27
November 2010
Introduction to Genetics, University of Utah
[3] Multifactorial Inheritance Health Library, Morgan Stan-
ley Childrens Hospital, Accessed 20 May 2008
Introduction to Genes and Disease, NCBI open
book
[4] Eye color is more complex than two genes, Athro Limited,
Accessed 27 November 2010 Genetics glossary, A talking glossary of genetic
terms.
[5] Low income kids height doesn't measure up by age 1.
University of Michigan Health System. Retrieved May 20, Animated guide to cloning
2008.
Khan Academy on YouTube
[6] requently Asked Questions About Genetic Disorders NIH,
Accessed 20 May 2008 What Color Eyes Would Your Children Have? Ge-
netics of human eye color: An interactive introduc-
[7] Cystic brosis Genetics Home Reference, NIH, Accessed tion
16 May 2008
Double Helix Game from the Nobel Prize web-
[8] Peto J (June 2002). Breast cancer susceptibility-A new
look at an old model. Cancer Cell. 1 (5): 411
site. Match CATG bases with each other, and other
2. doi:10.1016/S1535-6108(02)00079-X. ISSN 1535- games
6108. PMID 12124169.
Transcribe and translate a gene, University of Utah
[9] What Are the Risk Factors for Breast Cancer? American
Cancer Society, Accessed 16 May 2008 StarGenetics software simulates mating experiments
between organisms that are genetically dierent
[10] The Structures of Life National Institute of General Med- across a range of traits
ical Sciences, Accessed 20 May 2008

[11] Enzymes HowStuWorks, Accessed 20 May 2008

[12] What is DNA? Genetics Home Reference, Accessed 16

May 2008

[13] DNA-RNA-Protein Nobelprize.org, Accessed 20 May

2008

[14] What is Albinism? The National Organization for Al-

binism and Hypopigmentation, Accessed 20 May 2008

[15] Mutations The University of Utah, Genetic Science

Learning Center, Accessed 20 May 2008

[16] Brain, Marshall. How Evolution Works. How Stu

Works: Evolution Library. Howstuworks.com. Re-
trieved 2008-01-24.

[17] Mechanisms: The Processes of Evolution Understanding

Evolution, Accessed 20 May 2008

[18] Genetic Variation Understanding Evolution, Accessed 20

May 2008

[19] Sta Golden Rice Project Retrieved 5 November 2012

[20] Tifton, Georgia: A Peanut Pest Showdown USDA, ac-

cessed 16 May 2008

[21] Genetic engineering: Bacterial arsenal to combat chewing

insects GMO Safety, Jul 2010

[22] Genetically engineered organisms public issues education

Cornell University, Accessed 16 May 2008
Chapter 2

Cell Structure and Function

7
Chapter 3

Molecular Genetics

8
Chapter 4

Mendelian Inheritance

4.1 Mendelian inheritance The laws of inheritance were derived by Gregor Mendel,
a nineteenth-century Austrian monk, and later Prlet,[2]
For a non-technical introduction to the topic, see conducting hybridization experiments in garden peas
Introduction to genetics. (Pisum sativum) he planted in the backyard of the
[3]
Mendelian inheritance [help 1]
is inheritance of church. Between 1856 and 1863, he cultivated and
tested some 5,000 pea plants. From these experiments,
he induced two generalizations which later became
known as Mendels Principles of Heredity or Mendelian
inheritance. He described these principles in a two-part
paper, Versuche ber Panzen-Hybriden (Experiments on
Plant Hybridization), that he read to the Natural History
Society of Brno on 8 February and 8 March 1865, and
which was published in 1866.[4]
Mendels conclusions were largely ignored. Although
they were not completely unknown to biologists of the
time, they were not seen as generally applicable, even by
Mendel himself, who thought they only applied to certain
categories of species or traits. A major block to under-
standing their signicance was the importance attached
by 19th-century biologists to the apparent blending of in-
herited traits in the overall appearance of the progeny,
now known to be due to multigene interactions, in
contrast to the organ-specic binary characters stud-
ied by Mendel.[3] In 1900, however, his work was re-
Gregor Mendel, the German-speaking Augustinian monk who
discovered by three European scientists, Hugo de Vries,
founded the modern science of genetics. Carl Correns, and Erich von Tschermak. The exact
nature of the re-discovery has been somewhat de-
bated: De Vries published rst on the subject, mentioning
biological features that follows the laws proposed by
Mendel in a footnote, while Correns pointed out Mendels
Gregor Johann Mendel in 1865 and 1866 and re-
priority after having read De Vries paper and realizing
discovered in 1900. It was initially very controversial.
that he himself did not have priority. De Vries may not
When Mendels theories were integrated with the Boveri
have acknowledged truthfully how much of his knowl-
Sutton chromosome theory of inheritance by Thomas
edge of the laws came from his own work, or came only
Hunt Morgan in 1915, they became the core of classical
after reading Mendels paper. Later scholars have ac-
genetics while Ronald Fisher combined them with the
cused Von Tschermak of not truly understanding the re-
theory of natural selection in his 1930 book The Ge-
sults at all.[3]
netical Theory of Natural Selection, putting evolution
onto a mathematical footing and forming the basis for Regardless, the re-discovery made Mendelism an im-
Population genetics and the modern evolutionary synthe- portant but controversial theory. Its most vigorous pro-
sis.[1] moter in Europe was William Bateson, who coined the
terms "genetics" and "allele" to describe many of its
tenets. The model of heredity was highly contested by
4.1.1 History other biologists because it implied that heredity was dis-
continuous, in opposition to the apparently continuous
Main article: History of genetics variation observable for many traits. Many biologists also

9
10
dismissed the theory because they were not sure it would
apply to all species. However, later work by biologists and
statisticians such as Ronald Fisher showed that if mul-
tiple Mendelian factors were involved in the expression
of an individual trait, they could produce the diverse re-
sults observed, and thus showed that Mendelian genet-
ics is compatible with natural selection. Thomas Hunt
Morgan and his assistants later integrated the theoretical
model of Mendel with the chromosome theory of inher-
itance, in which the chromosomes of cells were thought
to hold the actual hereditary material, and created what
is now known as classical genetics, which was extremely
successful and cemented Mendels place in history.
Mendels ndings allowed scientists such as Fisher and
J.B.S. Haldane to predict the expression of traits on the
basis of mathematical probabilities. A large contribu-
tion to Mendels success can be traced to his decision to
start his crosses only with plants he demonstrated were
true-breeding. He also only measured absolute (binary)
characteristics, such as color, shape, and position of the
ospring, rather than quantitative characteristics. He ex-
pressed his results numerically and subjected them to sta-
tistical analysis. His method of data analysis and his large
sample size gave credibility to his data. He also had the
foresight to follow several successive generations (f2, f3)
of pea plants and record their variations. Finally, he per-
formed test crosses (back-crossing descendants of the
initial hybridization to the initial true-breeding lines) to
reveal the presence and proportion of recessive charac-
ters.
4.1.2 Mendels laws
pollen
B b
B fects of the recessive white ower allele. This is known as
BB Bb
pistil
b
Bb bb
A Punnett square for one of Mendels pea plant experiments. variety had two alleles for purple owers (PP) while the
Mendel discovered that, when he crossed purebred white fertilization, the F1 hybrids each inherited one allele for
ower and purple ower pea plants (the parental or P gen- purple owers and one for white. All the F1 hybrids (Pp)
eration), the result was not a blend. Rather than being a
CHAPTER 4. MENDELIAN INHERITANCE
mix of the two, the ospring (known as the F1 genera-
tion) was purple-owered. When Mendel self-fertilized
the F1 generation pea plants, he obtained a purple ower
to white ower ratio in the F2 generation of 3 to 1. The
results of this cross are tabulated in the Punnett square to
the right.
He then conceived the idea of heredity units, which he
called factors. Mendel found that there are alterna-
tive forms of factorsnow called genesthat account for
variations in inherited characteristics. For example, the
gene for ower color in pea plants exists in two forms,
one for purple and the other for white. The alternative
forms are now called alleles. For each biological trait,
an organism inherits two alleles, one from each parent.
These alleles may be the same or dierent. An organ-
ism that has two identical alleles for a gene is said to be
homozygous for that gene (and is called a homozygote).
An organism that has two dierent alleles for a gene is
said be heterozygous for that gene (and is called a het-
erozygote).
Mendel also hypothesized that allele pairs separate ran-
domly, or segregate, from each other during the produc-
tion of gametes: egg and sperm. Because allele pairs sep-
arate during gamete production, a sperm or egg carries
only one allele for each inherited trait. When sperm and
egg unite at fertilization, each contributes its allele, restor-
ing the paired condition in the ospring. This is called
the Law of Segregation. Mendel also found that each
pair of alleles segregates independently of the other pairs
of alleles during gamete formation. This is known as the
Law of Independent Assortment.
The genotype of an individual is made up of the many al-
leles it possesses. An individuals physical appearance, or
phenotype, is determined by its alleles as well as by its en-
vironment. The presence of an allele does not mean that
the trait will be expressed in the individual that possesses
it. If the two alleles of an inherited pair dier (the het-
erozygous condition), then one determines the organisms
appearance and is called the dominant allele; the other has
no noticeable eect on the organisms appearance and is
called the recessive allele. Thus, in the example above
dominant purple ower allele will hide the phenotypic ef-
the Law of Dominance but it is not a transmission law,
dominance has to do with the expression of the genotype
and not its transmission. The upper case letters are used
to represent dominant alleles whereas the lowercase let-
ters are used to represent recessive alleles.
In the pea plant example above, the capital P repre-
sents the dominant allele for purple owers and lower-
case p represents the recessive allele for white owers.
Both parental plants were true-breeding, and one parental
other had two alleles for white owers (pp). As a result of
4.1. MENDELIAN INHERITANCE 11

had purple owers, because the dominant P allele has its

full eect in the heterozygote, while the recessive p allele
has no eect on ower color. For the F2 plants, the ratio SS bb ss BB

of plants with purple owers to those with white owers Sb Sb sB sB

(3:1) is called the phenotypic ratio. The genotypic ratio,
as seen in the Punnett square, is 1 PP : 2 Pp : 1 pp.

F
Ss bB Ss bB Ss bB Ss bB
Law of Segregation of genes (the First Law)

SB Sb sB sb
F
1

SB
SS BB SS Bb Ss BB Ss Bb
w w R R
Sb
SS bB SS bb Ss bB Ss bb
2

sB
sS BB sS Bb ss BB ss Bb

w R w R w R w R
sb

3 w sS bB sS bb ss bB ss bb
R

Figure 2 Dihybrid cross. The phenotypes of two independent

R traits show a 9:3:3:1 ratio in the F2 generation. In this example,
w only show the dominant phenotypes (SsbB). If the children mate
Figure 1 Dominant and recessive phenotypes.
(1) Parental generation.
(2) F1 generation.
(3) F2 generation. Dominant (red) and recessive (white) pheno-
type look alike in the F1 (rst) generation and show a 3:1 ratio
in the F2 (second) generation.
The Law of Segregation states that every individual or-
ganism contains two alleles for each trait, and that these
alleles segregate (separate) during meiosis such that each
gamete contains only one of the alleles.[5] An ospring
thus receives a pair of alleles for a trait by inheriting
homologous chromosomes from the parent organisms:
one allele for each trait from each parent.[5]
Molecular proof of this principle was subsequently found
through observation of meiosis by two scientists indepen-
dently, the German botanist Oscar Hertwig in 1876, and
the Belgian zoologist Edouard Van Beneden in 1883. Pa-
ternal and maternal chromosomes get separated in meio-
sis and the alleles with the traits of a character are segre-
gated into two dierent gametes. Each parent contributes
a single gamete, and thus a single, randomly successful al-
lele copy to their ospring and fertilization.
coat color is indicated by B (brown, dominant) or b (white), while
tail length is indicated by S (short, dominant) or s (long). When
parents are homozygous for each trait (SSbb and ssBB), their
children in the F1 generation are heterozygous at both loci and
with each other, in the F2 generation all combinations of coat
color and tail length occur: 9 are brown/short (purple boxes), 3
are white/short (pink boxes), 3 are brown/long (blue boxes) and
1 is white/long (green box).
Law of Independent Assortment (the Second Law)
The Law of Independent Assortment states that alleles
for separate traits are passed independently of one an-
other from parents to ospring.[6] That is, the biologi-
cal selection of an allele for one trait has nothing to do
with the selection of an allele for any other trait. Mendel
found support for this law in his dihybrid cross experi-
ments (Fig. 1). In his monohybrid crosses, an idealized
3:1 ratio between dominant and recessive phenotypes re-
sulted. In dihybrid crosses, however, he found a 9:3:3:1
ratios (Fig. 2). This shows that each of the two alleles is
inherited independently from the other, with a 3:1 phe-
notypic ratio for each.
Independent assortment occurs in eukaryotic organisms
during meiotic prophase I, and produces a gamete with
a mixture of the organisms chromosomes. The physi-
cal basis of the independent assortment of chromosomes
is the random orientation of each bivalent chromosome
along the metaphase plate with respect to the other biva-
12 CHAPTER 4. MENDELIAN INHERITANCE

lent chromosomes. Along with crossing over, indepen- 4.1.3 Mendelian trait
dent assortment increases genetic diversity by producing
novel genetic combinations. A Mendelian trait is one that is controlled by a single locus
in an inheritance pattern. In such cases, a mutation in a
There are many violations of independent assortment due
single gene can cause a disease that is inherited according
to genetic linkage.
to Mendels laws. Examples include sickle-cell anemia,
Of the 46 chromosomes in a normal diploid human cell, Tay-Sachs disease, cystic brosis and xeroderma pigmen-
half are maternally derived (from the mothers egg) and tosa. A disease controlled by a single gene contrasts with
half are paternally derived (from the fathers sperm). This a multi-factorial disease, like arthritis, which is aected
occurs as sexual reproduction involves the fusion of two by several loci (and the environment) as well as those dis-
haploid gametes (the egg and sperm) to produce a new eases inherited in a non-Mendelian fashion.
organism having the full complement of chromosomes.
During gametogenesisthe production of new gametes
by an adultthe normal complement of 46 chromosomes 4.1.4 Non-Mendelian inheritance
needs to be halved to 23 to ensure that the resulting hap-
loid gamete can join with another gamete to produce a
diploid organism. An error in the number of chromo-
somes, such as those caused by a diploid gamete joining
with a haploid gamete, is termed aneuploidy.
In independent assortment, the chromosomes that result
are randomly sorted from all possible maternal and pa-
ternal chromosomes. Because zygotes end up with a ran-
dom mix instead of a pre-dened set from either par-
ent, chromosomes are therefore considered assorted in-
dependently. As such, the zygote can end up with any
combination of paternal or maternal chromosomes. Any
of the possible variants of a zygote formed from mater-
nal and paternal chromosomes will occur with equal fre-
quency. For human gametes, with 23 pairs of chromo-
somes, the number of possibilities is 223 or 8,388,608
possible combinations.[7] The zygote will normally end
up with 23 chromosomes pairs, but the origin of any par-
ticular chromosome will be randomly selected from pa-
ternal or maternal chromosomes. This contributes to the
genetic variability of progeny.

Law of Dominance (the Third Law)

Mendels Law of Dominance states that recessive alleles In four o'clock plants, the alleles for red and white owers show
will always be masked by dominant alleles. Therefore, incomplete dominance. As seen in the F1 generation, heterozy-
gous (wr) plants have pink owersa mix of red (rr) and
a cross between a homozygous dominant and a homozy-
white (ww) coloring. The F2 generation shows a 1:2:1 ratio of
gous recessive will always express the dominant pheno- red:pink:white
type, while still having a heterozygous genotype. Law
of Dominance can be explained easily with the help of a
mono hybrid cross experiment:- In a cross between two Main article: Non-Mendelian inheritance
organisms pure for any pair (or pairs) of contrasting traits
(characters), the character that appears in the F1 genera- Mendel explained inheritance in terms of discrete
tion is called dominant and the one which is suppressed factorsgenesthat are passed along from generation to
(not expressed) is called recessive. Each character is generation according to the rules of probability. Mendels
controlled by a pair of dissimilar factors. Only one of laws are valid for all sexually reproducing organisms,
the characters expresses. The one which expresses in the including garden peas and human beings. However,
F1 generation is called Dominant. It is important to note Mendels laws stop short of explaining some patterns of
however, that the law of dominance is signicant and true genetic inheritance. For most sexually reproducing or-
but is not universally applicable. ganisms, cases where Mendels laws can strictly account
According to the latest revisions, only two of these rules for the patterns of inheritance are relatively rare. Often,
are considered to be laws. The third one is considered as the inheritance patterns are more complex.
a basic principle but not a genetic law of Mendel. The F1 ospring of Mendels pea crosses always looked
4.1. MENDELIAN INHERITANCE 13

like one of the two parental varieties. In this situation of 4.1.5 See also
complete dominance, the dominant allele had the same
phenotypic eect whether present in one or two copies. List of Mendelian traits in humans
But for some characteristics, the F1 hybrids have an ap-
pearance in between the phenotypes of the two parental Mendelian diseases (monogenic disease)
varieties. A cross between two four o'clock (Mirabilis
Mendelian error
jalapa) plants shows this common exception to Mendels
principles. Some alleles are neither dominant nor reces- Particulate inheritance
sive. The F1 generation produced by a cross between red-
owered (RR) and white owered (WW) Mirabilis jalapa Punnett square
plants consists of pink-colored owers (RW). Which al-
lele is dominant in this case? Neither one. This third Introduction to genetics
phenotype results from owers of the heterzygote hav-
ing less red pigment than the red homozygotes. Cases
in which one allele is not completely dominant over an- 4.1.6 Notes
other are called incomplete dominance. In incomplete
[1] Pronunciation: /mndiljn/, /-dilin/.
dominance, the heterozygous phenotype lies somewhere
between the two homozygous phenotypes.
A similar situation arises from codominance, in which 4.1.7 References
the phenotypes produced by both alleles are clearly ex-
pressed. For example, in certain varieties of chicken, [1] Grafen, Alan; Ridley, Mark (2006). Richard Dawkins:
the allele for black feathers is codominant with the allele How A Scientist Changed the Way We Think. New York,
for white feathers. Heterozygous chickens have a color New York: Oxford University Press. p. 69. ISBN 0-19-
929116-0.
described as erminette, speckled with black and white
feathers. Unlike the blending of red and white colors in [2] E. B. Ford (1960). Mendelism and Evolution (seventh ed.).
heterozygous four o'clocks, black and white colors appear Methuen & Co (London), and John Wiley & Sons (New
separately in chickens. Many human genes, including one York). p. 1.
for a protein that controls cholesterol levels in the blood,
show codominance, too. People with the heterozygous [3] Henig, Robin Marantz (2009). The Monk in the Garden
form of this gene produce two dierent forms of the pro- : The Lost and Found Genius of Gregor Mendel, the Fa-
ther of Modern Genetics. Houghton Miin. ISBN 0-395-
tein, each with a dierent eect on cholesterol levels.
97765-7. The article, written by an Austrian monk named
In Mendelian inheritance, genes have only two alleles, Gregor Johann Mendel...
such as a and A. In nature, such genes exist in several dif-
ferent forms and are therefore said to have multiple alle- [4] See Mendels paper in English: Gregor Mendel (1865).
Experiments in Plant Hybridization.
les. A gene with more than two alleles is said to have mul-
tiple alleles. An individual, of course, usually has only [5] Bailey, Regina (5 November 2015). Mendels Law of
two copies of each gene, but many dierent alleles are Segregation. about education. About.com. Retrieved 2
often found within a population. One of the best-known February 2016.
examples is coat color in rabbits. A rabbits coat color is
determined by a single gene that has at least four dierent [6] Bailey, Regina. Independent Assortment. about educa-
alleles. The four known alleles display a pattern of simple tion. About.com. Retrieved 24 February 2016.
dominance that can produce four coat colors. Many other [7] Perez, Nancy. Meiosis. Retrieved 15 February 2007.
genes have multiple alleles, including the human genes for
ABO blood type.
Furthermore, many traits are produced by the interaction 4.1.8 Notes
of several genes. Traits controlled by two or more genes
are said to be polygenic traits. Polygenic means many Peter J. Bowler (1989). The Mendelian Revolution:
genes. For example, at least three genes are involved in The Emergence of Hereditarian Concepts in Mod-
making the reddish-brown pigment in the eyes of fruit ern Science and Society. Johns Hopkins University
ies. Polygenic traits often show a wide range of pheno- Press.
types. The variety of skin color in humans comes about
Atics, Jean. Genetics: The life of DNA. ANDRNA
partly because more than four dierent genes probably
press.
control this trait.
Reece, Jane B., and Neil A. Campbell. Mendel and
the Gene Idea. Campbell Biology. 9th ed. Boston:
Benjamin Cummings / Pearson Education, 2011.
265. Print.
14 CHAPTER 4. MENDELIAN INHERITANCE

4.1.9 External links

Khan Academy, video lecture
Probability of Inheritance

principles of Inheritance
Mendelian genetics
Chapter 5

Beyond Mendel

5.1 Non-Mendelian inheritance

Mirabilis jalapa

Non-Mendelian inheritance is a general term that refers

to any pattern of inheritance in which traits do not seg-
regate in accordance with Mendels laws. These laws de-
scribe the inheritance of traits linked to single genes on
chromosomes in the nucleus. In Mendelian inheritance,
each parent contributes one of two possible alleles for a
trait. If the genotypes of both parents in a genetic cross
are known, Mendels laws can be used to determine the Carl Correns
distribution of phenotypes expected for the population of
ospring. There are several situations in which the pro-
portions of phenotypes observed in the progeny do not transmitted through a character present in the cytoplasm
match the predicted values. of the ovule. Later research by Ruth Sager and others
identied DNA present in chloroplasts as being respon-
Non-Mendelian inheritance plays a role in several disease
sible for the unusual inheritance pattern observed. Work
processes.[1]
on the poky strain of the mold Neurospora crassa begun
by Mary and Hershel Mitchell[3] ultimately led to the dis-
covery of genetic material in mitochondria as well.
5.1.1 Types
According to the endosymbiont theory, mitochondria and
Extranuclear inheritance chloroplasts were once free living organisms that were
each taken up by a eukaryotic cell.[4] Over time, mito-
Extranuclear inheritance (also known as cytoplasmic in- chondria and chloroplasts formed a symbiotic relation-
heritance) is a form of non-Mendelian inheritance rst ship with their eukaryotic hosts. Although the transfer
discovered by Carl Correns in 1908.[2] While working of a number of genes from these organelles to the nu-
with Mirabilis jalapa Correns observed that leaf color cleus prevents them from living independently, each still
was dependent only on the genotype of the maternal par- possesses genetic material in the form of double stranded
ent. Based on these data, he determined that the trait was DNA.

15
16 CHAPTER 5. BEYOND MENDEL

It is the transmission of this organellar DNA that is re- the killer phenotype will be passed down to all progeny.
sponsible for the phenomenon of extranuclear inheri- Heritable traits that result from infection with foreign par-
tance. Both chloroplasts and mitochondria are present ticles have also been identied in Drosophila. Wild type
in the cytoplasm of maternal gametes only. Paternal ga- ies normally full recover after being anesthetized with
metes (sperm for example) do not have cytoplasmic mi- carbon dioxide. Certain lines of ies have been identi-
tochondria. Thus, the phenotype of traits linked to genes ed that die o after exposure to the compound. This
found in either chloroplasts or mitochondria are deter- carbon dioxide sensitivity is passed down from mothers
mined exclusively by the maternal parent. to their progeny. This sensitivity is due to infection with
In humans, mitochondrial diseases are a class of diseases, (Sigma) virus, a rhabdovirus only capable of infecting
many of which aect the muscles and the eye. Drosophila.[8]
Although this process is usually associated with viruses,
Gene conversion recent research has shown that the Wolbachia bacterium
is also capable of inserting its genome into that of its
[9][10]
Gene conversion can be one of the major forms of non- host.
Mendelian inheritance. Gene conversion is a reparation
process in DNA recombination, by which a piece of DNA
sequence information is transferred from one DNA helix
(which remains unchanged) to another DNA helix, whose
sequence is altered. This may occur as a mismatch repair
between the strands of DNA which are derived from dif-
Genomic imprinting
ferent parents. Thus the mismatch repair can convert one
allele into the other. This phenomenon can be detected
through the ospring non-Mendelian ratios, and is fre- Main article: Genomic imprinting
quently observed, e.g., in fungal crosses.[5]
Genomic imprinting represents yet another example of
Infectious heredity non-Mendelian inheritance. Just as in conventional in-
heritance, genes for a given trait are passed down to
Another form of non-Mendelian inheritance is known as progeny from both parents. However, these genes are
infectious heredity. Infectious particles such as viruses epigenetically marked before transmission, altering their
may infect host cells and continue to reside in the cyto- levels of expression. These imprints are created before
plasm of these cells. If the presence of these particles re- gamete formation and are erased during the creation of
sults in an altered phenotype, then this phenotype may be germ line cells. Therefore, a new pattern of imprinting
subsequently transmitted to progeny.[6] Because this phe- can be made with each generation.
notype is dependent only on the presence of the invader in Genes are imprinted dierently depending on the
the host cells cytoplasm, inheritance will be determined parental origin of the chromosome that contains them. In
only by the infected status of the maternal parent. This
mice, the insulin-like growth factor 2 gene undergoes im-
will result in a uniparental transmission of the trait, just printing. The protein encoded by this gene helps to reg-
as in extranuclear inheritance.
ulate body size. Mice that possess two functional copies
One of the most well studied examples of infectious of this gene are larger than those with two mutant copies.
heredity is the killer phenomenon exhibited in yeast. Two The size of mice that are heterozygous at this locus de-
double-stranded RNA viruses, designated L and M, are pends on the parent from which the wild type allele came.
responsible for this phenotype.[7] The L virus codes for If the functional allele originated from the mother, the
the capsid proteins of both viruses, as well as an RNA ospring will exhibit dwarsm, whereas a paternal allele
polymerase. Thus the M virus can only infect cells al- will generate a normal sized mouse. This is because the
ready harboring L virus particles. The M viral RNA en- maternal Igf2 gene is imprinted. Imprinting results in the
codes a toxin which is secreted from the host cell. It kills inactivation of the Igf2 gene on the chromosome passed
susceptible cells growing in close proximity to the host. down by the mother.[11]
The M viral RNA also renders the host cell immune to Imprints are formed due to the dierential methylation
the lethal eects of the toxin. For a cell to be susceptible of paternal and maternal alleles. This results in diering
it must therefore be either uninfected, or harbor only the expression between alleles from the two parents. Sites
L virus. with signicant methylation are associated with low lev-
The L and M viruses are not capable of exiting their host els of gene expression. Higher gene expression is found at
cell through conventional means. They can only transfer unmethylated sites.[12] In this mode of inheritance, phe-
from cell to cell when their host undergoes mating. All notype is determined not only by the specic allele trans-
progeny of a mating involving a doubly infected yeast cell mitted to the ospring, but also by the sex of the parent
will also be infected with the L and M viruses. Therefore, that transmitted it.
5.1. NON-MENDELIAN INHERITANCE
Mosaicism
Individuals who possess cells with genetic dierences
from the other cells in their body are termed mosaics.
These dierences can result from mutations that occur
in dierent tissues and at dierent periods of develop-
ment. If a mutation happens in the non-gamete forming
tissues, it is characterized as somatic. Germline muta-
tions occur in the egg or sperm cells and can be passed
on to ospring.[13] Mutations that occur early on in de-
velopment will aect a greater number of cells and can
result in an individual that can be identied as a mosaic
strictly based on phenotype.
Mosaicism also results from a phenomenon known as X-
inactivation. All female mammals have two X chromo-
somes. To prevent lethal gene dosage problems, one of
these chromosomes is inactivated following fertilization.
This process occurs randomly for all of the cells in the
organisms body. Because a given females two X chro-
mosomes will almost certainly dier in their specic pat-
tern of alleles, this will result in diering cell phenotypes
depending on which chromosome is silenced. Calico
cats, which are almost all female,[14] demonstrate one
of the most commonly observed manifestations of this
process.[15]
Trinucleotide repeat disorders
Main article: Trinucleotide repeat disorder
Trinucleotide repeat disorders also follow a non-
Mendelian pattern of inheritance. These diseases are all
caused by the expansion of microsatellite tandem repeats
consisting of a stretch of three nucleotides.[16] Typically
[9] University of Rochester Press Releases. Retrieved
in individuals, the number of repeated units is relatively
low. With each successive generation, there is a chance
that the number of repeats will expand. As this occurs, [10] Dunning Hotopp JC, Clark ME, Oliveira DC, et al.
progeny can progress to premutation and ultimately af-
fected status. Individuals with a number of repeats that
falls in the premutation range have a good chance of hav-
ing aected children. Those who progress to aected
status will exhibit symptoms of their particular disease.
[11] Bell, A.C.; G. Felsenfeld (2000). Methylation of a
Prominent trinucleotide repeat disorders include Fragile
X syndrome and Huntingtons disease. In the case of
Fragile X syndrome it is thought that the symptoms re-
sult from the increased methylation and accompanying
reduced expression of the fragile X mental retardation [12] Lewin, Benjamin (2004). Genes VIII. Upper Saddle River,
gene in individuals with a sucient number of repeats.[17]
5.1.2 See also
CoRR Hypothesis
Epigenetic inheritance
Gene drive
Intragenomic conict
17
5.1.3 References
[1] Van Heyningen V, Yeyati PL (2004). Mechanisms
of non-Mendelian inheritance in genetic disease.
Hum. Mol. Genet. 13 Spec No 2: R22533.
doi:10.1093/hmg/ddh254. PMID 15358729.
[2] Klug, William S.; Michael R. Cummings; Charlotte A.
Spencer (2006). Concepts of Genetics. Upper Saddle
River, NJ: Pearson Education Inc. p. 215.
[3] Mitchell MB, Mitchell HK (1952). A case of maternal
inheritance in Neurospora crassa". Proc. Natl. Acad. Sci.
U.S.A. 38 (5): 4429. doi:10.1073/pnas.38.5.442. PMC
1063583 . PMID 16589122.
[4] Embley, T. Martin; William Martin (March 2006). Eu-
karyotic evolution, changes and challenges. Nature. 440
(7084): 623630. doi:10.1038/nature04546. PMID
16572163.
[5] Stacey K. A. (1994). Recombination. In: Kendrew John,
Lawrence Eleanor (eds.
[6] Klug, William S.; Michael R. Cummings; Charlotte A.
Spencer (2006). Concepts of Genetics. Upper Saddle
River, NJ: Pearson Education Inc. p. 223.
[7] Russell, Peter J. (2006). iGenetics: A Mendelian Ap-
proach. San Francisco: Pearson Education, Inc. pp. 649
650.
[8] Teninges, Danielle; Francoise Bras-Herreng (July 1987).
Rhabdovirus Sigma, the Hereditary CO2 Sensitivity
Agent of Drosophila:Nucleotide Sequence of a cDNA
Clone Encoding the Glycoprotein. Journal of General
Virology. 68 (10): 26252638. doi:10.1099/0022-1317-
68-10-2625. PMID 2822842.
2007-10-16.
(2007). Widespread lateral gene transfer from intracel-
lular bacteria to multicellular eukaryotes. Science. 317
(5845): 17536. doi:10.1126/science.1142490. PMID
17761848.
CTCF-dependent boundar control imprinted expression
of the Igf2 gene. Nature. 405 (6785): 482485.
doi:10.1038/35013100. PMID 10839546.
NJ: Pearson Education Inc. pp. 680684.
[13] Lesson 3: Mosaicism. Retrieved 2007-10-16.
[14] Genetics of Calico Color.
[15] Genetic Mosaicism. Retrieved 2007-10-28.
[16] Lesson 1: Triplet Repeat Expansion. Retrieved 2007-
10-16.
[17] FMR1-Related Disorders. Retrieved 2007-10-29.
18 CHAPTER 5. BEYOND MENDEL

5.1.4 External links the gene A mutation, then gene A is epistatic and gene
B is hypostatic. For example, the gene for male pat-
non-Mendelian inheritance at Duke University tern baldness is epistatic to the gene for red hair. In
this sense, epistasis can be contrasted with genetic domi-
nance, which is an interaction between alleles at the same
5.2 Epistasis gene locus. As the study of genetics developed, and with
the advent of molecular biology, epistasis started to be
studied in relation to Quantitative Trait Loci (QTL) and
Not to be confused with epistaxis, epitaxis, or epitasis.
polygenic inheritance.
Epistasis is the phenomenon of the eect of one gene
The eects of genes are now commonly quantiable by
assaying the magnitude of a phenotype (e.g. height,
pigmentation or growth rate) or by biochemically assay-
ing protein activity (e.g. binding or catalysis). Increas-
ingly sophisticated computational and evolutionary biol-
ogy models aim to describe the eects of epistasis on
a genome-wide scale and the consequences of this for
evolution.[1][2]
Since identication of epistatic pairs is challenging in
terms of computationally and also statistical, there are
also some studies which tries to prioritize epistatic
pairs.[3][4]

5.2.2 Classication
The gene for total baldness is epistatic to those for blond hair
or red hair. The baldness phenotype supersedes genes for hair
colour and so the eects are non-additive.

being dependent on the presence of one or more 'mod-

ier genes, the genetic background. Thus, epistatic
mutations have dierent eects in combination than in-
dividually. It was originally a concept from genetics but
is now used in biochemistry, computational biology and
evolutionary biology. It arises due to interactions, either
between genes, or within them, leading to non-additive
eects. Epistasis has a large inuence on the shape of
evolutionary landscapes, which leads to profound conse-
quences for evolution and evolvability of phenotype traits.

5.2.1 History
Understanding of epistasis has changed considerably Quantitative trait values after two mutations either alone (Ab and
aB) or in combination (AB). Bars contained in the grey box in-
through the history of genetics and so too has the use of
dicate the combined trait value under dierent circumstances of
the term. In early models of natural selection devised in epistasis. Upper panel indicates epistasis between benecial mu-
the early 20th century, each gene was considered to make tations (blue).[5][6] Lower panel indicates epistasis between dele-
its own characteristic contribution to tness, against an terious mutations (red).[7][8]
average background of other genes. Some introductory
courses still teach population genetics this way. BecauseTerminology about epistasis can vary between scientic
of the way that the science of population genetics was de-
elds. Geneticists often refer to wild type and mu-
veloped, evolutionary geneticists have tended to think oftant alleles where the mutation is implicitly deleterious
epistasis as the exception. However, in general, the ex- and may talk in terms of genetic enhancement, syn-
pression of any one allele depends in a complicated way thetic lethality and genetic suppressors. Conversely, a
on many other alleles. biochemist may more frequently focus on benecial mu-
In classical genetics, if genes A and B are mutated, and tations and so explicitly state the eect of a mutation and
each mutation by itself produces a unique phenotype but use terms such as reciprocal sign epistasis and compen-
the two mutations together show the same phenotype as satory mutation.[11] Additionally, there are dierences
5.2. EPISTASIS
Since, on average, mutations are deleterious, random mutations
to an organism cause a decline in tness. If all mutations are ad-
ditive, tness will fall proportionally to mutation number (black
line). When deleterious mutations display negative (synergistic)
epistasis, they are more deleterious in combination than individ-
ually and so tness falls with the number of mutations at an
increasing rate (upper, red line). When mutations display pos-
itive (antagonistic) epistasis, eects of mutations are less severe
in combination than individually and so tness falls at a decreas-
ing rate (lower, blue line).[7][8][9][10]
when looking at epistasis within a single gene (biochem-
istry) and epistasis within a haploid or diploid genome
(genetics). In general, epistasis is used to denote the de-
parture from 'independence' of the eects of dierent ge-
netic loci. Confusion often arises due to the varied inter-
pretation of 'independence' among dierent branches of
biology.[12] The classications below attempt to cover the
various terms and how they relate to one another.
Additivity
Two mutations are considered to be purely additive if
the eect of the double mutation is the sum of the ef-
fects of the single mutations. This occurs when genes
do not interact with each other, for example by acting
through dierent metabolic pathways. Simple, additive
traits were studied early on in the history of genetics, how-
ever they are relatively rare, with most genes exhibiting at
least some level of epistatic interaction.[13][14]
Magnitude epistasis
When the double mutation has a tter phenotype than
expected from the eects of the two single mutations,
it is referred to as positive epistasis. Positive epistasis
between benecial mutations generates greater improve-
ments in function than expected.[5][6] Positive epistasis
between deleterious mutations protects against the neg-
ative eects to cause a less severe tness drop.[8]
Conversely, when two mutations together lead to a less t
phenotype than expected from their eects when alone, it
19
is called negative epistasis.[15][16] Negative epistasis be-
tween benecial mutations causes smaller than expected
tness improvements, whereas negative epistasis between
deleterious mutations causes greater-than-additive tness
drops.[7]
Independently, when the eect on tness of two muta-
tions is more radical than expected from their eects
when alone, it is referred to as synergistic epistasis.
The opposite situation, when the tness dierence of the
double mutant from the wild type is smaller than ex-
pected from the eects of the two single mutations, it is
called antagonistic epistasis.[10] Therefore, for deleteri-
ous mutations, negative epistasis is also synergistic, while
positive epistasis is antagonistic; conversely, for advan-
tageous mutations, positive epistasis is synergistic, while
negative epistasis is antagonistic.
The term genetic enhancement is sometimes used when
a double (deleterious) mutant has a more severe phe-
notype than the additive eects of the single mutants.
Strong positive epistasis is sometimes referred to by
creationists as irreducible complexity (although most ex-
amples are misidentied).
Sign epistasis
Sign epistasis[17] occurs when one mutation has the op-
posite eect when in the presence of another mutation.
This occurs when a mutation that is deleterious on its
own can enhance the eect of a particular benecial
mutation.[12] For example, a large and complex brain is
a waste of energy without a range of sense organs, how-
ever sense organs can be more useful if the organisms
brain is better able to process the information.
At its most extreme, reciprocal sign epistasis[18] oc-
curs when two deleterious genes are benecial when to-
gether. For example, producing a toxin alone can kill
a bacterium, and producing a toxin exporter alone can
waste energy, but producing both can improve tness by
killing competing organisms.
Reciprocal sign epistasis also leads to genetic suppres-
sion whereby two deleterious mutations are less harmful
together than either one on its own, i.e. one compensates
for the other. This term can also apply sign epistasis
where the double mutant has a phenotype intermediate
between those of the single mutants, in which case the
more severe single mutant phenotype is suppressed by
the other mutation or genetic condition. For example,
in a diploid organism, a hypomorphic (or partial loss-of-
function) mutant phenotype can be suppressed by knock-
ing out one copy of a gene that acts oppositely in the
same pathway. In this case, the second gene is described
as a dominant suppressor of the hypomorphic mutant;
dominant because the eect is seen when one wild-type
copy of the suppressor gene is present (i.e. even in a het-
erozygote). For most genes, the phenotype of the het-
erozygous suppressor mutation by itself would be wild
20 CHAPTER 5. BEYOND MENDEL

type (because most genes are not haplo-insucient), so transcription factor network. For example, the gene en-
that the double mutant (suppressed) phenotype is inter- coding the enzyme that synthesizes penicillin is of no use
mediate between those of the single mutants. to a fungus without the enzymes that synthesize the nec-
When two mutations are viable alone but lethal in combi- essary precursors in the metabolic pathway.
nation, it is called Synthetic lethality or unlinked non-
complementation.[19]
Epistasis within genes

Haploid organisms Just as mutations in two separate genes can be non-

additive if those genes interact, mutations in two codons
In a haploid organism with genotypes (at two loci) ab, within a gene can be non-additive. In genetics this is
Ab, aB or AB, we can think of dierent forms of epistasis sometimes called intragenic complementation when
as aecting the magnitude of a phenotype upon mutation one deleterious mutation can be compensated for by a
individually (Ab and aB) or in combination (AB). second mutation within that gene. This occurs when the
amino acids within a protein interact. Due to the com-
plexity of protein folding and activity, additive mutations
Diploid organisms are rare.
Proteins are held in their tertiary structure by a dis-
Epistasis in diploid organisms is further complicated by tributed, internal network of cooperative interactions
the presence of two copies of each gene. Epistasis can oc- (hydrophobic, polar and covalent).[22] Epistatic interac-
cur between loci, but additionally, interactions can occur tions occur whenever one mutation alters the local envi-
between the two copies of each locus in heterozygotes. ronment of another residue (either by directly contact-
For a two locus, two allele system, there are eight inde- ing it, or by inducing changes in the protein structure).[23]
pendent types of gene interaction.[20] For example, in a disulphide bridge, a single cysteine has
no eect on protein stability until a second is present
at the correct location at which point the two cys-
5.2.3 Genetic and molecular causes teines form a chemical bond which enhances the stabil-
ity of the protein.[24] This would be observed as pos-
Additivity
itive epistasis where the double-cysteine variant had a
much higher stability than either of the single-cysteine
This can be the case when multiple genes act in paral-
variants. Conversely, when deleterious mutations are
lel to achieve the same eect. For example, when an
introduced, proteins often exhibit mutational robustness
organism is in need of phosphorus, multiple enzymes
whereby as stabilising interactions are destroyed the pro-
that break down dierent phosphorylated components
tein still functions until it reaches some stability thresh-
from the environment may act additively to increase the
old at which point further destabilising mutations have
amount of phosphorus available to the organism. How-
large, detrimental eects as the protein can no longer
ever, there inevitably comes a point where phosphorus is
fold. This leads to negative epistasis whereby mutations
no longer the limiting factor for growth and reproduction
that have little eect alone have a large, deleterious eect
and so further improvements in phosphorus metabolism
together.[25][26]
have smaller or no eect (negative epistasis). Some sets
of mutations within genes have also been specically In enzymes, the protein structure orients a few, key amino
acids into precise geometries to form an active site to per-
found to be additive.[21] It is now considered that strict
additivity is the exception, rather than the rule, sinceform chemistry.[27] Since these active site networks fre-
most genes interact with hundreds or thousands of other quently require the cooperation of multiple components,
genes.[13][14] mutating any one of these components massively compro-
mises activity, and so mutating a second component has a
relatively minor eect on the already inactivated enzyme.
Epistasis between genes For example, removing any member of the catalytic triad
of many enzymes will reduce activity to levels low enough
Epistasis within the genomes of organisms occurs due to that the organism is no longer viable.[28][29][30]
interactions between the genes within the genome. This
interaction may be direct if the genes encode proteins
that, for example, are separate components of a multi- Heterozygotic epistasis Diploid organisms contain
component protein (such as the ribosome), inhibit each two copies of each gene. If these are dierent
others activity, or if the protein encoded by one gene (heterozygous / heteroallelic), the two dierent copies of
modies the other (such as by phosphorylation). Al- the allele may interact with each other to cause epistasis.
ternatively the interaction may be indirect, where the This is sometimes called allelic complementation, or in-
genes encode components of a metabolic pathway or terallelic complementation. It may be caused by sev-
network, developmental pathway, signalling pathway or eral mechanisms, for example transvection, where an en-
5.2. EPISTASIS 21

hancer from one allele acts in trans to activate transcrip- accumulation of benecial mutations in any order. Con-
tion from the promoter of the second allele. Alternately, versely, if mutations interact with one another by epista-
trans-splicing of two non-functional RNA molecules may sis, the tness landscape becomes rugged as the eect of
produce a single, functional RNA. Similarly, at the pro- a mutation depends on the genetic background of other
tein level, proteins that function as dimers may form a mutations.[32] At its most extreme, interactions are so
heterodimer composed of one protein from each alter- complex that the tness is uncorrelated with gene se-
nate gene and may display dierent properties to the quence and the topology of the landscape is random. This
homodimer of one or both variants. is referred to as a rugged tness landscape and has pro-
found implications for the evolutionary optimisation of
organisms. If mutations are deleterious in one combina-
5.2.4 Evolutionary consequences tion but benecial in another, the ttest genotypes can
only be accessed by accumulating mutations in one spe-
Fitness landscapes and evolvability cic order. This makes it more likely that organisms will
get stuck at local maxima in the tness landscape hav-
ing acquired mutations in the 'wrong' order.[26][33] For
example, a variant of TEM1 -lactamase with 5 mu-
tations is able to cleave cefotaxime (a third generation
antibiotic).[34] However, of the 120 possible pathways to
this 5-mutant variant, only 7% are accessible to evolu-
tion as the remainder passed through tness valleys where
the combination of mutations reduces activity. In con-
trast, changes in environment (and therefore the shape
of the tness landscape) have been shown to provide es-
cape from local maxima.[26] In this example, selection
in changing antibiotic environments resulted in a gate-
way mutation which epistatically interacted in a posi-
tive manner with other mutations along an evolutionary
pathway, eectively crossing a tness valley. This gate-
way mutation alleviated the negative epistatic interactions
of other individually benecial mutations, allowing them
The top row indicates interactions between two genes that are ei- to better function in concert. Complex environments or
ther additive (a), show positive epistasis (b) or reciprocal sign selections may therefore bypass local maxima found in
epistasis (c). Below are tness landscapes which display greater models assuming simple positive selection.
and greater levels of global epistasis between large numbers of
genes. Purely additive interactions lead to a single smooth peak High epistasis is usually considered a constraining fac-
(d), as increasing numbers of genes exhibit epistasis, the land- tor on evolution, and improvements in a highly epistatic
scape becomes more rugged (e) and when all genes interact trait are considered to have lower evolvability. This is
epistatically the landscape becomes so rugged that mutations have because, in any given genetic background, very few mu-
seemingly random eects (f). tations will be benecial, even though many mutations
may need to occur to eventually improve the trait. The
See also: tness landscape and evolvability lack of a smooth landscape makes it harder for evolu-
tion to access tness peaks. In highly rugged landscapes,
In evolutionary genetics, the sign of epistasis is usually tness valleys block access to some genes, and even if
more signicant than the magnitude of epistasis. This is ridges exist that allow access, these may be rare or pro-
because magnitude epistasis (positive and negative) sim- hibitively long.[35] Moreover, adaptation can move pro-
ply aects how benecial mutations are together, how- teins into more precarious or rugged regions of the tness
ever sign epistasis aects whether mutation combinations landscape.[36] These shifting tness territories may act
are benecial or deleterious.[31] to decelerate evolution and could represent tradeos for
adaptive traits.
A tness landscape is a representation of the tness where
all genotypes are arranged in 2D space and the tness of Rugged, epistatic tness landscapes also aect the
each genotype is represented by height on a surface. It 'predictability' of evolution. When a mutation has a large
is frequently used as a visual metaphor for understand- number of epistatic eects, each accumulated mutation
ing evolution as the process of moving uphill from one drastically changes the set of available benecial muta-
genotype to the next, nearby, tter genotype.[13] tions. Therefore, the evolutionary trajectory followed de-
pends highly on which early mutations were accepted.
If all mutations are additive, they can be acquired in any Thus, repeats of evolution from the same starting point
order and still give a continuous uphill trajectory. The tend to diverge to dierent local maxima rather than con-
landscape is perfectly smooth, with only one peak (global verge on a single global maximum as they would in a
maximum) and all sequences can evolve uphill to it by the
22
smooth, additive landscape.[37][38]
Evolution of sex
Main article: evolution of sexual reproduction
Negative epistasis and sex are thought to be intimately
correlated. Experimentally, this idea has been tested in Statistical coupling analysis
using digital simulations of asexual and sexual popula-
tions. Over time, sexual populations move towards more Computational prediction
negative epistasis, or the lowering of tness by two inter-
acting alleles. It is thought that negative epistasis allows
individuals carrying the interacting deleterious mutations
5.2.6 See also
to be removed from the populations eciently. This re-
moves those alleles from the population, resulting in an
overall more t population. This hypothesis was pro-
posed by Alexey Kondrashov, and is sometimes known
as the deterministic mutation hypothesis[39] and has also
[15]
been tested using articial gene networks.
However, the evidence for this hypothesis has not always
been straightforward and the model proposed by Kon-
drashov has been criticized for assuming mutation pa-
rameters far from real world observations.[40] In addition,
in those tests which used articial gene networks, neg-
ative epistasis is only found in more densely connected
networks,[15] whereas empirical evidence indicates that
[41]
natural gene networks are sparsely connected, and the-
ory shows that selection for robustness will favor more
sparsely connected and minimally complex networks.[41]
5.2.5 Methods and model systems
Regression analysis
Quantitative genetics focuses on genetic variance due to
genetic interactions. Any two locus interactions at a par-
ticular gene frequency can be decomposed into eight in-
dependent genetic eects using a weighted regression. In
this regression, the observed two locus genetic eects are
treated as dependent variables and the pure genetic ef-
fects are used as the independent variables. Because the
regression is weighted, the partitioning among the vari-
ance components will change as a function of gene fre-
quency. By analogy it is possible to expand this system
to three or more loci, or to cytonuclear interactions[42]
Double mutant cycles
When assaying epistasis within a gene, site-directed mu-
tagenesis can be used to generate the dierent genes, and
their protein products can be assayed (e.g. for stability or
catalytic activity). This is sometimes called a double mu-
tant cycle and involves producing and assaying the wild
type protein, the two single mutants and the double mu-
tant. Epistasis is measured as the dierence between the
CHAPTER 5. BEYOND MENDEL
eects of the mutations together versus the sum of their
individual eects.[43] This can be expressed as a free en-
ergy of interaction. The same methodology can be used
to investigate the interactions between larger sets of mu-
tations but all combinations have to be produced and as-
sayed. For example, there are 120 dierent combinations
of 5 mutations, some or all of which may show epistasis...
Co-adaptation
Epistasis and functional genomics
Mutation
Synthetic viability
Synthetic Lethality
Quantitative trait locus
Interactome (Genetic interaction network)
Fitness landscape
Evolvability
Pleiotropy
Evolution of sexual reproduction
5.2.7 References
[1] Szendro, Ivan G; Schenk, Martijn F; Franke, Jasper;
Krug, Joachim; de Visser, J Arjan G M (16 January
2013). Quantitative analyses of empirical tness land-
scapes. Journal of Statistical Mechanics: Theory and
Experiment. 2013 (01): P01005. doi:10.1088/1742-
5468/2013/01/P01005.
[2] Edlund, JA; Adami, C (Spring 2004). Evolution of
robustness in digital organisms.. Articial Life. 10
(2): 16779. doi:10.1162/106454604773563595. PMID
15107229.
[3] Ayati, Marzieh; Koyutrk, Mehmet (2014-01-01).
Prioritization of Genomic Locus Pairs for Testing Epis-
tasis. Proceedings of the 5th ACM Conference on Bioin-
formatics, Computational Biology, and Health Informat-
ics. BCB '14. New York, NY, USA: ACM: 240
248. doi:10.1145/2649387.2649449. ISBN 978-1-4503-
2894-4.
[4] Piriyapongsa, Jittima; Ngamphiw, Chumpol; Intara-
panich, Apichart; Kulawonganunchai, Supasak; Assawa-
makin, Anunchai; Bootchai, Chaiwat; Shaw, Philip J.;
Tongsima, Sissades (2012-12-13). iLOCi: a SNP inter-
action prioritization technique for detecting epistasis in
5.2. EPISTASIS
genome-wide association studies. BMC Genomics. 13
(Suppl 7): S2. doi:10.1186/1471-2164-13-S7-S2. ISSN
1471-2164. PMC 3521387 . PMID 23281813.
[5] Phillips, PC (November 2008). Epistasis--the essential
role of gene interactions in the structure and evolution
of genetic systems.. Nature Reviews Genetics. 9 (11):
85567. doi:10.1038/nrg2452. PMC 2689140 . PMID
18852697.
[6] Domingo, E; Sheldon, J; Perales, C (June 2012). Vi-
ral quasispecies evolution.. Microbiology and molec-
ular biology reviews : MMBR. 76 (2): 159216.
doi:10.1128/mmbr.05023-11. PMID 22688811.
[7] Tokuriki, N; Tawk, DS (October 2009). Stability
eects of mutations and protein evolvability.. Cur-
rent Opinion in Structural Biology. 19 (5): 596604.
doi:10.1016/j.sbi.2009.08.003. PMID 19765975.
[8] He, X; Qian, W; Wang, Z; Li, Y; Zhang, J (March 2010).
Prevalent positive epistasis in Escherichia coli and Sac-
charomyces cerevisiae metabolic networks.. Nature Ge-
netics. 42 (3): 2726. doi:10.1038/ng.524. PMID
20101242.
[9] Ridley M (2004) Evolution, 3rd edition. Blackwell Pub-
lishing.
[10] Charlesworth B, Charlesworth D (2010) Elements of Evo-
lutionary Genetics. Roberts and Company Publishers.
[11] Ortlund, EA; Bridgham, JT; Redinbo, MR; Thornton, JW
(Sep 14, 2007). Crystal structure of an ancient pro-
tein: evolution by conformational epistasis.. Science. 317
(5844): 15448. doi:10.1126/science.1142819. PMC
2519897 . PMID 17702911.
[12] Cordell, Heather J. (2002). Epistasis: what it means,
what it doesn't mean, and statistical methods to detect it in
humans. Human Molecular Genetics. 11 (20): 24638.
doi:10.1093/hmg/11.20.2463. PMID 12351582.
[13] Kauman, Stuart A. (1993). The origins of order : self-
organization and selection in evolution ([Repr.]. ed.). New
York: Oxford University Press. ISBN 0195079515.
[14] Bornscheuer, U. T.; Huisman, G. W.; Kazlauskas, R.
J.; Lutz, S.; Moore, J. C.; Robins, K. (9 May 2012).
Engineering the third wave of biocatalysis. Nature.
485 (7397): 185194. doi:10.1038/nature11117. PMID
22575958.
[15] Azevedo R, Lohaus R, Srinivasan S, Dang K, Burch C
(2006). Sexual reproduction selects for robustness and
negative epistasis in articial gene networks. Nature.
440 (7080): 8790. doi:10.1038/nature04488. PMID
16511495.
[16] Bonhoeer S, Chappey C, Parkin NT, Whitcomb JM,
Petropoulos CJ (2004). Evidence for positive epis-
tasis in HIV-1. Science. 306 (5701): 154750.
doi:10.1126/science.1101786. PMID 15567861.
23
[17] Weinreich, Daniel M.; Watson, Richard A.; Chao, Lin
(June 2005). Perspective: Sign Epistasis and Ge-
netic Constraint on Evolutionary Trajectories. Evo-
lution. 59 (6): 11651174. doi:10.1111/j.0014-
3820.2005.tb01768.x. JSTOR 3448895. PMID
16050094.
[18] Poelwijk, Frank J.; Kiviet, Daniel J.; Weinreich, Daniel
M.; Tans, Sander J. (January 2007). Empirical tness
landscapes reveal accessible evolutionary paths.. Nature.
445 (7126): 383386. doi:10.1038/nature05451. PMID
17251971.
[19] http://www.sci.sdsu.edu/~{}smaloy/MicrobialGenetics/
topics/rev-sup/synthetic.html Synthetic Lethal Muta-
tions. Retrieved on 2010-01-27.
[20] https://books.google.com/books/about/An_
introduction_to_genetic_statistics.html?id=
ouVMaaaaMaaJ
[21] Lunzer, M; Miller, SP; Felsheim, R; Dean, AM (Oct
21, 2005). The biochemical architecture of an ancient
adaptive landscape.. Science. 310 (5747): 499501.
doi:10.1126/science.1115649. PMID 16239478.
[22] Shakhnovich, BE; Deeds, E; Delisi, C; Shakhnovich, E
(Mar 2005). Protein structure and evolutionary his-
tory determine sequence space topology.. Genome Re-
search. 15 (3): 38592. doi:10.1101/gr.3133605. PMID
15741509.
[23] Harms, MJ; Thornton, JW (Aug 2013). Evolutionary
biochemistry: revealing the historical and physical causes
of protein properties.. Nature Reviews Genetics. 14 (8):
55971. doi:10.1038/nrg3540. PMID 23864121.
[24] Witt, D. (2008). Recent developments in disulde
bond formation. Synthesis. 2008 (16): 24912509.
doi:10.1055/s-2008-1067188.
[25] Bershtein, S; Segal, M; Bekerman, R; Tokuriki, N; Taw-
k, DS (Dec 14, 2006). Robustness-epistasis link shapes
the tness landscape of a randomly drifting protein.. Na-
ture. 444 (7121): 92932. doi:10.1038/nature05385.
PMID 17122770.
[26] Steinberg, Barrett; Ostermeier, Marc (2016-01-
01). Environmental changes bridge evolution-
ary valleys. Science Advances. 2 (1): e1500921.
doi:10.1126/sciadv.1500921. ISSN 2375-2548. PMC
4737206 . PMID 26844293.
[27] Halabi, N; Rivoire, O; Leibler, S; Ranganathan, R (Aug
21, 2009). Protein sectors: evolutionary units of
three-dimensional structure.. Cell. 138 (4): 774
86. doi:10.1016/j.cell.2009.07.038. PMC 3210731 .
PMID 19703402.
[28] Neet, KE; Koshland DE, Jr (Nov 1966). The conver-
sion of serine at the active site of subtilisin to cysteine:
a chemical mutation.". Proceedings of the National
Academy of Sciences of the United States of America.
56 (5): 160611. doi:10.1073/pnas.56.5.1606. PMID
5230319.
24 CHAPTER 5. BEYOND MENDEL

[29] A theoretical study of the active sites of papain and
S195C rat trypsin: implications for the low reactivity of
mutant serine proteinases.. Protein Sci. 5 (7): 1355
65. Jul 1996. doi:10.1002/pro.5560050714. PMC
2143470 . PMID 8819168.
[30] Sigal, IS; Harwood, BG; Arentzen, R (Dec 1982).
Thiol-beta-lactamase: replacement of the active-site ser-
ine of RTEM beta-lactamase by a cysteine residue..
Proceedings of the National Academy of Sciences of
the United States of America. 79 (23): 715760.
doi:10.1073/pnas.79.23.7157. PMID 6818541.
[31] Phillips PC (November 2008). Epistasis--the essential
role of gene interactions in the structure and evolution
of genetic systems. Nat. Rev. Genet. 9 (11): 855
67. doi:10.1038/nrg2452. PMC 2689140 . PMID
18852697.
[32] Poelwijk, Frank J.; Tnase-Nicola, Sorin; Kiviet, Daniel
J.; Tans, Sander J. (March 2011). Reciprocal sign epista-
sis is a necessary condition for multi-peaked tness land-
scapes.. Journal of Theoretical Biology. 272 (1): 141
144. doi:10.1016/j.jtbi.2010.12.015. PMID 21167837.
[33] Reetz, MT; Sanchis, J (Sep 22, 2008). Construct-
ing and analyzing the tness landscape of an experi-
mental evolutionary process.. Chembiochem : a Eu-
ropean journal of chemical biology. 9 (14): 22607.
doi:10.1002/cbic.200800371. PMID 18712749.
[41] Leclerc R. (August 2008). Survival of the sparsest: ro-
bust gene networks are parsimonious. Mol Syst Biol. 4
(213): 213. doi:10.1038/msb.2008.52. PMC 2538912 .
PMID 18682703.
[42] Wade, MJ; Goodnight, CJ (Apr 2006). Cyto-
nuclear epistasis: two-locus random genetic drift in
hermaphroditic and dioecious species.. Evolution; inter-
national journal of organic evolution. 60 (4): 64359.
doi:10.1554/05-019.1. PMID 16739448.
[43] Horovitz, A (1996). Double-mutant cycles: a powerful
tool for analyzing protein structure and function.. Fold-
ing and Design. 1 (6): R1216. doi:10.1016/s1359-
0278(96)00056-9. PMID 9080186.
5.2.8 External links
INTERSNP - a software for genome-wide interac-
tion analysis (GWIA) of case-control and case-only
SNP data, including analysis of quantitative traits.
Science Aid: Epistasis High school (GCSE, Alevel)
resource.
GeneticInteractions.org
Epistasis.org

[34] Weinreich, DM; Delaney, NF; Depristo, MA; Hartl, DL

(Apr 7, 2006). Darwinian evolution can follow only very 5.3 Epigenetics
few mutational paths to tter proteins.. Science. 312
(5770): 1114. doi:10.1126/science.1123539. PMID
16601193. For the development of an organism, see Epigenesis (bi-
ology). For epigenetics in robotics, see Developmental
[35] Gong, LI; Suchard, MA; Bloom, JD (2013). Stability- robotics. For the scientic journal, see Epigenetics (jour-
mediated epistasis constrains the evolution of an inuenza nal). For earth science concepts labelled epigenetic, see
protein.. eLife. 2: e00631. doi:10.7554/eLife.00631. Epigenetic (earth sciences).
PMID 23682315.
Epigenetics studies genetic eects not encoded in the
[36] Steinberg, Barrett; Ostermeier, Marc. Shifting t-
ness and epistatic landscapes reect tradeos along an
evolutionary pathway. Journal of Molecular Biology.
doi:10.1016/j.jmb.2016.04.033.

[37] Lobkovsky, AE; Wolf, YI; Koonin, EV (Dec 2011).

Predictability of evolutionary trajectories in tness
landscapes.. PLOS Computational Biology. 7 (12):
e1002302. doi:10.1371/journal.pcbi.1002302. PMID
22194675.

[38] Bridgham, JT; Ortlund, EA; Thornton, JW (Sep 24,

2009). An epistatic ratchet constrains the direction of
glucocorticoid receptor evolution.. Nature. 461 (7263):
5159. doi:10.1038/nature08249. PMID 19779450.

[39] A. S. Kondrashov (1988). Deleterious mutations and the Epigenetic mechanisms

evolution of sexual reproduction. Nature. 336 (6198):
435440. doi:10.1038/336435a0. PMID 3057385.
[40] MacCarthy T, Bergman A (July 2007). Coevolution of
robustness, epistasis, and recombination favors asexual re-
production. Proc Natl Acad Sci U S A. 104 (31): 12801
6. doi:10.1073/pnas.0705455104. PMC 1931480 .
PMID 17646644.
DNA sequence of an organism, hence the prex epi-
(Greek: - over, outside of, around).[1][2] Such eects
on cellular and physiological phenotypic traits may result
from external or environmental factors that switch genes
on and o and aect how cells express genes.[3][4] These
alterations may or may not be heritable, although the use
5.3. EPIGENETICS 25

of the term epigenetic to describe processes that are heri- biological development. Waddington held that cell fates
table is controversial.[5] were established in development much like a marble rolls
The term also refers to the changes themselves: function- down to the point of lowest local elevation.
ally relevant changes to the genome that do not involve a
change in the nucleotide sequence. Examples of mech-
anisms that produce such changes are DNA methylation
and histone modication, each of which alters how genes
are expressed without altering the underlying DNA se-
quence. Gene expression can be controlled through the
action of repressor proteins that attach to silencer re-
gions of the DNA. These epigenetic changes may last
through cell divisions for the duration of the cells life,
and may also last for multiple generations even though
they do not involve changes in the underlying DNA se-
quence of the organism;[6] instead, non-genetic factors
cause the organisms genes to behave (or express them-
selves) dierently.[7]
One example of an epigenetic change in eukaryotic bi-
ology is the process of cellular dierentiation. During
morphogenesis, totipotent stem cells become the various
pluripotent cell lines of the embryo, which in turn become
fully dierentiated cells. In other words, as a single fertil-
ized egg cell the zygote continues to divide, the result-
ing daughter cells change into all the dierent cell types in
an organism, including neurons, muscle cells, epithelium,
endothelium of blood vessels, etc., by activating some
genes while inhibiting the expression of others.[8]
5.3.1 Denitions
The term epigenetics in its contemporary usage emerged
in the 1990s, but for some years has been used in some-
what variable meanings.[3] A consensus denition of the
concept of epigenetic trait as stably heritable phenotype
resulting from changes in a chromosome without alter-
ations in the DNA sequence was formulated at a Cold
Spring Harbor meeting in 2008.
Historical
[12]
Waddington suggested visualising increasing irreversibil-
ity of cell type dierentiation as ridges rising between
the valleys where the marbles (cells) are travelling.[13] In
recent times Waddingtons notion of the epigenetic land-
scape has been rigorously formalized in the context of
the systems dynamics state approach to the study of cell-
fate.[14][15] Cell-fate determination is predicted to exhibit
certain dynamics, such as attractor-convergence (the at-
tractor can be an equilibrium point, limit cycle or strange
attractor) or oscillatory.[15]
The term epigenetic has also been used in
developmental psychology to describe psychological
development as the result of an ongoing, bi-directional
interchange between heredity and the environment.[16]
Interactivist ideas of development have been discussed
in various forms and under various names throughout the
19th and 20th centuries. An early version was proposed,
among the founding statements in embryology, by Karl
Ernst von Baer and popularized by Ernst Haeckel. A
radical epigenetic view (physiological epigenesis) was
developed by Paul Wintrebert. Another variation, prob-
abilistic epigenesis, was presented by Gilbert Gottlieb
in 2003.[17] This view encompasses all of the possible
developing factors on an organism and how they not
only inuence the organism and each other, but how the
organism also inuences its own development.
The developmental psychologist Erik Erikson used the
term epigenetic principle in his book Identity: Youth and
Crisis (1968), and used it to encompass the notion that
we develop through an unfolding of our personality in
predetermined stages, and that our environment and sur-
rounding culture inuence how we progress through these
stages. This biological unfolding in relation to our socio-
cultural settings is done in stages of psychosocial devel-
opment, where progress through each stage is in part de-
termined by our success, or lack of success, in all the pre-
vious stages.[18][19][20]

The term epigenesis has a generic meaning extra Contemporary

growth, taken directly from Koine Greek ,
used in English since the 17th century.[9] Robin Holliday dened epigenetics as the study of the
From this, and the associated adjective epigenetic, the mechanisms of temporal and spatial control of gene ac-
term epigenetics was coined by C. H. Waddington in tivity during the development of complex organisms.[21]
1942 as pertaining to epigenesis in parallel to Valentin Thus epigenetic can be used to describe anything other
Haecker's 'phenogenetics (Pnogenetik).[10] Epigenesis than DNA sequence that inuences the development of
in the context of biology refers to the dierentiation an organism.
of cells from their initial totipotent state in embryonic The more recent usage of the word in science has a stricter
development.[11] denition. It is, as dened by Arthur Riggs and col-
When Waddington coined the term the physical nature leagues, the study of mitotically and/or meiotically her-
of genes and their role in heredity was not known; he itable changes in gene function that cannot be explained
used it as a conceptual model of how genes might inter- by changes in DNA sequence.[22] The Greek prex epi-
act with their surroundings to produce a phenotype; he in epigenetics implies features that are on top of or in
used the phrase epigenetic landscape as a metaphor for addition to genetics; thus epigenetic traits exist on top
26 CHAPTER 5. BEYOND MENDEL

of or in addition to the traditional molecular basis for vidual organisms lifetime; however, if gene inactivation
inheritance.[23] occurs in a sperm or egg cell that results in fertilization,
The term epigenetics, however, has been used to de- then some epigenetic [26]
changes can be transferred to the
scribe processes which have not been demonstrated to be next generation. This raises the question of whether or
heritable such as histone modication; there are therefore not epigenetic changes in an organism can alter the basic
attempts to redene it in broader terms that would avoid structure of its DNA (see Evolution, below), a form of
the constraints of requiring heritability. For example, Sir Lamarckism.
Adrian Bird dened epigenetics as the structural adapta- Specic epigenetic processes include paramutation,
tion of chromosomal regions so as to register, signal or per- bookmarking, imprinting, gene silencing, X chromo-
petuate altered activity states. [6] This denition would be some inactivation, position eect, reprogramming,
inclusive of transient modications associated with DNA transvection, maternal eects, the progress of
repair or cell-cycle phases as well as stable changes main- carcinogenesis, many eects of teratogens, regula-
tained across multiple cell generations, but exclude others tion of histone modications and heterochromatin,
such as templating of membrane architecture and prions and technical limitations aecting parthenogenesis and
unless they impinge on chromosome function. Such re- cloning.
denitions however are not universally accepted and are DNA damage can also cause epigenetic
still subject to dispute.[5] The NIH Roadmap Epige- changes.[27][28][29] DNA damage is very frequent,
nomics Project, ongoing as of 2016, uses the following occurring on average about 60,000 times a day per
denition: "...For purposes of this program, epigenetics cell of the human body (see DNA damage (naturally
refers to both heritable changes in gene activity and ex- occurring)). These damages are largely repaired, but
pression (in the progeny of cells or of individuals) and also at the site of a DNA repair, epigenetic changes can
stable, long-term alterations in the transcriptional potential remain.[30] In particular, a double strand break in DNA
of a cell that are not necessarily heritable. [24] can initiate unprogrammed epigenetic gene silencing
In 2008, a consensus denition of the epigenetic trait, both by causing DNA methylation as well as by promot-
stably heritable phenotype resulting from changes in a ing silencing types of histone modications (chromatin
chromosome without alterations in the DNA sequence, remodeling - see next section).[31] In addition, the
was made at a Cold Spring Harbor meeting.[25] enzyme Parp1 (poly(ADP)-ribose polymerase) and its
product poly(ADP)-ribose (PAR) accumulate at sites of
The similarity of the word to genetics has generated
many parallel usages. The epigenome is a parallel to the DNA damage as part of a repair process.[32] This accu-
word "genome", referring to the overall epigenetic state mulation, in turn, directs recruitment and activation of
of a cell, and epigenomics refers to more global analy- the chromatin remodeling protein ALC1 that can cause
ses of epigenetic changes across the entire genome.[24] nucleosome remodeling.[33] Nucleosome remodeling has
The phrase "genetic code" has also been adaptedthe been found to cause, for instance, epigenetic silencing of
"epigenetic code" has been used to describe the set of epi- DNA repair gene MLH1.[22][34] DNA damaging chem-
genetic features that create dierent phenotypes in dif- icals, such as benzene, hydroquinone, styrene, carbon
ferent cells. Taken to its extreme, the epigenetic code tetrachloride and trichloroethylene, cause considerable
could represent the total state of the cell, with the po- hypomethylation of DNA, some through the activation
sition of each molecule accounted for in an epigenomic of oxidative stress pathways.[35]
map, a diagrammatic representation of the gene expres- Foods are known to alter the epigenetics of rats on dif-
sion, DNA methylation and histone modication status ferent diets.[36] Some food components epigenetically in-
of a particular genomic region. More typically, the term crease the levels of DNA repair enzymes such as MGMT
is used in reference to systematic eorts to measure spe- and MLH1[37] and p53.[38][39] Other food components
cic, relevant forms of epigenetic information such as the can reduce DNA damage, such as soy isoavones[40][41]
histone code or DNA methylation patterns. and bilberry anthocyanins.[42]
Epigenetic research uses a wide range of molecular bi-
ologic techniques to further our understanding of epi-
5.3.2 Molecular basis genetic phenomena, including chromatin immunoprecip-
itation (together with its large-scale variants ChIP-on-
Epigenetic changes modify the activation of certain chip and ChIP-Seq), uorescent in situ hybridization,
genes, but not the genetic code sequence of DNA. The methylation-sensitive restriction enzymes, DNA adenine
microstructure (not code) of DNA itself or the associ- methyltransferase identication (DamID) and bisulte
ated chromatin proteins may be modied, causing acti- sequencing. Furthermore, the use of bioinformatic meth-
vation or silencing. This mechanism enables dierenti- ods is playing an increasing role (computational epigenet-
ated cells in a multicellular organism to express only the ics).
genes that are necessary for their own activity. Epige-
Computer simulations and molecular dynamics ap-
netic changes are preserved when cells divide. Most epi-
proaches revealed the atomistic motions associated with
genetic changes only occur within the course of one indi-
5.3. EPIGENETICS 27

the molecular recognition of the histone tail through an
allosteric mechanism.[43]
5.3.3 Mechanisms
Several types of epigenetic inheritance systems may play
a role in what has become known as cell memory,[44] note
however that not all of these are universally accepted to
be examples of epigenetics.
Covalent modications
Covalent modications of either DNA (e.g. cytosine
methylation and hydroxymethylation) or of histone pro-
teins (e.g. lysine acetylation, lysine and arginine methy-
lation, serine and threonine phosphorylation, and ly-
sine ubiquitination and sumoylation) play central roles
in many types of epigenetic inheritance. Therefore, the
word epigenetics is sometimes used as a synonym for
these processes. However, this can be misleading. Chro-
matin remodeling is not always inherited, and not all epi-
genetic inheritance involves chromatin remodeling.[45]
acids. If the amino acids that are in the chain are
changed, the shape of the histone might be modied.
DNA is not completely unwound during replication.
It is possible, then, that the modied histones may
be carried into each new copy of the DNA. Once
there, these histones may act as templates, initiat-
ing the surrounding new histones to be shaped in
the new manner. By altering the shape of the his-
tones around them, these modied histones would
ensure that a lineage-specic transcription program
is maintained after cell division.
2. The second way is the addition of methyl groups to
the DNA, mostly at CpG sites, to convert cytosine to
5-methylcytosine. 5-Methylcytosine performs much
like a regular cytosine, pairing with a guanine in
double-stranded DNA. However, some areas of the
genome are methylated more heavily than others,
and highly methylated areas tend to be less transcrip-
tionally active, through a mechanism not fully un-
derstood. Methylation of cytosines can also persist
from the germ line of one of the parents into the
zygote, marking the chromosome as being inherited
from one parent or the other (genetic imprinting).

Mechanisms of heritability of histone state are not well

understood; however, much is known about the mecha-
nism of heritability of DNA methylation state during cell
division and dierentiation. Heritability of methylation
state depends on certain enzymes (such as DNMT1) that
have a higher anity for 5-methylcytosine than for cyto-
sine. If this enzyme reaches a hemimethylated portion
of DNA (where 5-methylcytosine is in only one of the
two DNA strands) the enzyme will methylate the other
half.
Although histone modications occur throughout the en-
tire sequence, the unstructured N-termini of histones
(called histone tails) are particularly highly modied.
These modications include acetylation, methylation,
ubiquitylation, phosphorylation, sumoylation, ribosyla-
tion and citrullination. Acetylation is the most highly
studied of these modications. For example, acetylation
of the K14 and K9 lysines of the tail of histone H3 by hi-
DNA associates with histone proteins to form chromatin.
stone acetyltransferase enzymes (HATs) is generally re-
lated to transcriptional competence.
Because the phenotype of a cell or individual is af-
fected by which of its genes are transcribed, heritable One mode of thinking is that this tendency of acetyla-
transcription states can give rise to epigenetic eects.tion to be associated with active transcription is bio-
physical in nature. Because it normally has a positively
There are several layers of regulation of gene expression.
One way that genes are regulated is through the remodel-charged nitrogen at its end, lysine can bind the negatively
ing of chromatin. Chromatin is the complex of DNA and charged phosphates of the DNA backbone. The acetyla-
tion event converts the positively charged amine group on
the histone proteins with which it associates. If the way
that DNA is wrapped around the histones changes, gene the side chain into a neutral amide linkage. This removes
expression can change as well. Chromatin remodeling is the positive charge, thus loosening the DNA from the hi-
accomplished through two main mechanisms: stone. When this occurs, complexes like SWI/SNF and
other transcriptional factors can bind to the DNA and al-
1. The rst way is post translational modication of low transcription to occur. This is the cis model of epi-
the amino acids that make up histone proteins. Hi- genetic function. In other words, changes to the histone
stone proteins are made up of long chains of amino tails have a direct eect on the DNA itself.
28
Another model of epigenetic function is the trans
model. In this model, changes to the histone tails act
indirectly on the DNA. For example, lysine acetylation
may create a binding site for chromatin-modifying en-
zymes (or transcription machinery as well). This chro-
matin remodeler can then cause changes to the state of
the chromatin. Indeed, a bromodomain a protein do-
main that specically binds acetyl-lysine is found in
many enzymes that help activate transcription, including
the SWI/SNF complex. It may be that acetylation acts in
this and the previous way to aid in transcriptional activa-
tion.
The idea that modications act as docking modules for re-
lated factors is borne out by histone methylation as well.
Methylation of lysine 9 of histone H3 has long been as-
sociated with constitutively transcriptionally silent chro-
matin (constitutive heterochromatin). It has been de-
termined that a chromodomain (a domain that speci-
cally binds methyl-lysine) in the transcriptionally repres-
sive protein HP1 recruits HP1 to K9 methylated regions.
One example that seems to refute this biophysical model
for methylation is that tri-methylation of histone H3 at
lysine 4 is strongly associated with (and required for full)
transcriptional activation. Tri-methylation in this case
would introduce a xed positive charge on the tail.
It has been shown that the histone lysine methyltrans-
ferase (KMT) is responsible for this methylation activity
in the pattern of histones H3 & H4. This enzyme utilizes
a catalytically active site called the SET domain (Suppres-
sor of variegation, Enhancer of zeste, Trithorax). The
SET domain is a 130-amino acid sequence involved in
modulating gene activities. This domain has been demon-
strated to bind to the histone tail and causes the methyla-
tion of the histone.[46]
Diering histone modications are likely to function in
diering ways; acetylation at one position is likely to
function dierently from acetylation at another position.
Also, multiple modications may occur at the same time,
and these modications may work together to change
the behavior of the nucleosome. The idea that multi-
ple dynamic modications regulate gene transcription in
a systematic and reproducible way is called the histone
code, although the idea that histone state can be read lin-
early as a digital information carrier has been largely de-
bunked. One of the best-understood systems that orches-
trates chromatin-based silencing is the SIR protein based
silencing of the yeast hidden mating type loci HML and
HMR.
DNA methylation frequently occurs in repeated se-
quences, and helps to suppress the expression and
mobility of 'transposable elements':[47] Because 5-
methylcytosine can be spontaneously deaminated (replac-
ing nitrogen by oxygen) to thymidine, CpG sites are fre-
quently mutated and become rare in the genome, except
at CpG islands where they remain unmethylated. Epi-
genetic changes of this type thus have the potential to
CHAPTER 5. BEYOND MENDEL
direct increased frequencies of permanent genetic muta-
tion. DNA methylation patterns are known to be estab-
lished and modied in response to environmental factors
by a complex interplay of at least three independent DNA
methyltransferases, DNMT1, DNMT3A, and DNMT3B,
the loss of any of which is lethal in mice.[48] DNMT1 is
the most abundant methyltransferase in somatic cells,[49]
localizes to replication foci,[50] has a 1040-fold pref-
erence for hemimethylated DNA and interacts with the
proliferating cell nuclear antigen (PCNA).[51]
By preferentially modifying hemimethylated DNA,
DNMT1 transfers patterns of methylation to a
newly synthesized strand after DNA replication,
and therefore is often referred to as the mainte-
nance' methyltransferase.[52] DNMT1 is essential for
proper embryonic development, imprinting and X-
inactivation.[48][53] To emphasize the dierence of this
molecular mechanism of inheritance from the canonical
Watson-Crick base-pairing mechanism of transmission
of genetic information, the term 'Epigenetic templating'
was introduced.[54] Furthermore, in addition to the
maintenance and transmission of methylated DNA
states, the same principle could work in the maintenance
and transmission of histone modications and even
cytoplasmic (structural) heritable states.[55]
Histones H3 and H4 can also be manipulated through
demethylation using histone lysine demethylase (KDM).
This recently identied enzyme has a catalytically active
site called the Jumonji domain (JmjC). The demethyla-
tion occurs when JmjC utilizes multiple cofactors to hy-
droxylate the methyl group, thereby removing it. JmjC is
capable of demethylating mono-, di-, and tri-methylated
substrates.[56]
Chromosomal regions can adopt stable and heritable al-
ternative states resulting in bistable gene expression with-
out changes to the DNA sequence. Epigenetic control is
often associated with alternative covalent modications
of histones.[57] The stability and heritability of states of
larger chromosomal regions are suggested to involve pos-
itive feedback where modied nucleosomes recruit en-
zymes that similarly modify nearby nucleosomes.[58] A
simplied stochastic model for this type of epigenetics is
found here.[59][60]
It has been suggested that chromatin-based transcrip-
tional regulation could be mediated by the eect of small
RNAs. Small interfering RNAs can modulate transcrip-
tional gene expression via epigenetic modulation of tar-
geted promoters.[61]
RNA transcripts
Sometimes a gene, after being turned on, transcribes a
product that (directly or indirectly) maintains the activ-
ity of that gene. For example, Hnf4 and MyoD en-
hance the transcription of many liver- and muscle-specic
genes, respectively, including their own, through the
5.3. EPIGENETICS 29

transcription factor activity of the proteins they encode. in pathogens and are viewed as new targets in the ght
RNA signalling includes dierential recruitment of a hi- against drug-resistant bacteria.[72] They play an important
erarchy of generic chromatin modifying complexes and role in many biological processes, binding to mRNA and
DNA methyltransferases to specic loci by RNAs dur- protein targets in prokaryotes. Their phylogenetic anal-
ing dierentiation and development.[62] Other epigenetic yses, for example through sRNAmRNA target interac-
changes are mediated by the production of dierent splice tions or protein binding properties, are used to build com-
forms of RNA, or by formation of double-stranded RNA prehensive databases.[73] sRNA-gene maps based on their
(RNAi). Descendants of the cell in which the gene was targets in microbial genomes are also constructed.[74]
turned on will inherit this activity, even if the original
stimulus for gene-activation is no longer present. These
genes are often turned on or o by signal transduction,
Prions
although in some systems where syncytia or gap junc-
tions are important, RNA may spread directly to other
cells or nuclei by diusion. A large amount of RNA and For more details on this topic, see Fungal prions.
protein is contributed to the zygote by the mother during
oogenesis or via nurse cells, resulting in maternal eect Prions are infectious forms of proteins. In general, pro-
phenotypes. A smaller quantity of sperm RNA is trans- teins fold into discrete units that perform distinct cellular
mitted from the father, but there is recent evidence that functions, but some proteins are also capable of forming
this epigenetic information can lead to visible changes in an infectious conformational state known as a prion. Al-
several generations of ospring.[63] though often viewed in the context of infectious disease,
prions are more loosely dened by their ability to cat-
alytically convert other native state versions of the same
MicroRNAs protein to an infectious conformational state. It is in this
latter sense that they can be viewed as epigenetic agents
MicroRNAs (miRNAs) are members of non-coding capable of inducing a phenotypic change without a mod-
RNAs that range in size from 17 to 25 nucleotides. miR- ication of the genome.[75]
NAs regulate a large variety of biological functions in
plants and animals.[64] So far, in 2013, about 2000 miR- Fungal prions are considered by some to be epigenetic
NAs have been discovered in humans and these can be because the infectious phenotype caused by the prion can
found online in a miRNA database.[65] Each miRNA ex- be inherited without modication of the genome. PSI+
pressed in a cell may target about 100 to 200 messenger and URE3, discovered in yeast in 1965 and 1971, are the
[76][77]
RNAs that it downregulates.[66] Most of the downregula- two best studied of this type of prion. Prions can
tion of mRNAs occurs by causing the decay of the tar- have a phenotypic eect through the sequestration of pro-
geted mRNA, while some downregulation occurs at the tein in aggregates, thereby reducing that proteins activ-
level of translation into protein.[67] ity. In PSI+ cells, the loss of the Sup35 protein (which is
involved in termination of translation) causes ribosomes
It appears that about 60% of human protein coding genes to have a higher rate of read-through of stop codons, an
are regulated by miRNAs.[68] Many miRNAs are epige- eect that results in suppression of nonsense mutations
netically regulated. About 50% of miRNA genes are as- in other genes.[78] The ability of Sup35 to form prions
sociated with CpG islands,[64] that may be repressed by may be a conserved trait. It could confer an adaptive ad-
epigenetic methylation. Transcription from methylated vantage by giving cells the ability to switch into a PSI+
CpG islands is strongly and heritably repressed.[69] Other state and express dormant genetic features normally ter-
miRNAs are epigenetically regulated by either histone minated by stop codon mutations.[79][80][81][82]
modications or by combined DNA methylation and hi-
stone modication.[64]

Structural inheritance
mRNA
For more details on this topic, see Structural inheritance.
In 2011, it was demonstrated that the methylation of
mRNA plays a critical role in human energy homeostasis.
The obesity-associated FTO gene is shown to be able to In ciliates such as Tetrahymena and Paramecium, genet-
demethylate N6-methyladenosine in RNA.[70][71] ically identical cells show heritable dierences in the
patterns of ciliary rows on their cell surface. Experi-
mentally altered patterns can be transmitted to daughter
sRNAs cells. It seems existing structures act as templates for new
structures. The mechanisms of such inheritance are un-
sRNAs are small (50250 nucleotides), highly struc- clear, but reasons exist to assume that multicellular or-
tured, non-coding RNA fragments found in bacteria. ganisms also use existing cell structures to assemble new
They control gene expression including virulence genes ones.[83][84][85]
30 CHAPTER 5. BEYOND MENDEL

Nucleosome positioning Epigenetic changes can occur in response to environmen-

tal exposurefor example, mice given some dietary sup-
Eukaryotic genomes have numerous nucleosomes. Nu- plements have epigenetic changes aecting expression of
cleosome position is not random, and determine the ac- the agouti gene, which aects their fur color, weight, and
cessibility of DNA to regulatory proteins. This deter- propensity to develop cancer.[90][91]
mines dierences in gene expression and cell dierentia- Controversial results from one study suggested that trau-
tion. It has been shown that at least some nucleosomes are matic experiences might produce an epigenetic signal that
retained in sperm cells (where most but not all histones is capable of being passed to future generations. Mice
are replaced by protamines). Thus nucleosome position- were trained, using foot shocks, to fear a cherry blossom
ing is to some degree inheritable. Recent studies have odor. The investigators reported that the mouse ospring
uncovered connections between nucleosome positioning had an increased aversion to this specic odor.[92][93]
and other epigenetic factors, such as DNA methylation They suggested epigenetic changes that increase gene ex-
and hydroxymethylation [86] pression, rather than in DNA itself, in a gene, M71, that
governs the functioning of an odor receptor in the nose
that responds specically to this cherry blossom smell.
5.3.4 Functions and consequences There were physical changes that correlated with olfac-
tory (smell) function in the brains of the trained mice and
Development their descendants. Several criticisms were reported, in-
cluding the studys low statistical power as evidence of
Developmental epigenetics can be divided into prede- some irregularity such as bias in reporting results.[94] Due
termined and probabilistic epigenesis. Predetermined to limits of sample size, there is a probability that an ef-
epigenesis is a unidirectional movement from structural fect will not be demonstrated to within statistical signif-
development in DNA to the functional maturation of icance even if it exists. The criticism suggested that the
the protein. Predetermined here means that develop- probability that all the experiments reported would show
ment is scripted and predictable. Probabilistic epigene- positive results if an identical protocol was followed, as-
sis on the other hand is a bidirectional structure-function suming the claimed eects exist, is merely 0.4%. The
development with experiences and external molding authors also did not indicate which mice were siblings,
development.[87] and treated all of the mice as statistically independent.[95]
Somatic epigenetic inheritance, particularly through The original researchers pointed out negative results in
DNA and histone covalent modications and nucleosome the papers appendix that the criticism omitted in its cal-
repositioning, is very important in the development of culations, and undertook to track which mice were sib-
multicellular eukaryotic organisms.[86] The genome se- lings in the future.[96]
quence is static (with some notable exceptions), but cells
dierentiate into many dierent types, which perform
dierent functions, and respond dierently to the envi- Transgenerational
ronment and intercellular signalling. Thus, as individuals
develop, morphogens activate or silence genes in an epi- Main article: Transgenerational epigenetic inheritance
genetically heritable fashion, giving cells a memory. In Epigenetics can aect evolution when epigenetic changes
mammals, most cells terminally dierentiate, with only are heritable.[3] A sequestered germ line or Weismann
stem cells retaining the ability to dierentiate into sev- barrier is specic to animals, and epigenetic inheritance
eral cell types (totipotency and multipotency). In is more common in plants and microbes. Eva Jablonka,
mammals, some stem cells continue producing new dif- Marion J. Lamb and tienne Danchin have argued that
ferentiated cells throughout life, such as in neurogenesis, these eects may require enhancements to the standard
but mammals are not able to respond to loss of some tis- conceptual framework of the modern synthesis and have
sues, for example, the inability to regenerate limbs, which called for an extended evolutionary synthesis.[97][98][99]
some other animals are capable of. Epigenetic modi- Other evolutionary biologists have incorporated epige-
cations regulate the transition from neural stem cells to netic inheritance into population genetics models and
glial progenitor cells (for example, dierentiation into are openly skeptical, stating that epigenetic mechanisms
oligodendrocytes is regulated by the deacetylation and such as DNA methylation and histone modication are
methylation of histones.[88] Unlike animals, plant cells do genetically inherited under the control of natural selec-
not terminally dierentiate, remaining totipotent with the tion.[100][101][102]
ability to give rise to a new individual plant. While plants Two important ways in which epigenetic inheritance
do utilise many of the same epigenetic mechanisms as an- can be dierent from traditional genetic inheritance,
imals, such as chromatin remodeling, it has been hypoth- with important consequences for evolution, are that
esised that some kinds of plant cells do not use or require rates of epimutation can be much faster than rates
cellular memories, resetting their gene expression pat- of mutation[103] and the epimutations are more easily
terns using positional information from the environment reversible.[104] In plants heritable DNA methylation mu-
and surrounding cells to determine their fate.[89] tations are 100.000 times more likely to occur compared
5.3. EPIGENETICS
Escherichia coli bacteria
to DNA mutations.[105] An epigenetically inherited ele-
ment such as the PSI+ system can act as a stop-gap,
good enough for short-term adaptation that allows the lin-
eage to survive for long enough for mutation and/or re-
combination to genetically assimilate the adaptive phe-
notypic change.[106] The existence of this possibility in-
creases the evolvability of a species.
More than 100 cases of transgenerational epigenetic
inheritance phenomena have been reported in a wide
range of organisms, including prokaryotes, plants, and
animals.[107] For instance, Mourning Cloak butteries
will change color through hormone changes in response
to experimentation of varying temperatures.[108]
The lamentous fungus Neurospora crassa is a prominent
model system for understanding the control and func-
tion of cytosine methylation. In this organisms, DNA
methylation is associated with relics of a genome de-
fense system called RIP (repeat-induced point mutation)
and silences gene expression by inhibiting transcription
elongation.[109]
The yeast prion PSI is generated by a conformational
change of a translation termination factor, which is then
inherited by daughter cells. This can provide a survival
advantage under adverse conditions. This is an example
of epigenetic regulation enabling unicellular organisms to
respond rapidly to environmental stress. Prions can be
viewed as epigenetic agents capable of inducing a pheno-
31
typic change without modication of the genome.[110]
Direct detection of epigenetic marks in microorganisms
is possible with single molecule real time sequencing, in
which polymerase sensitivity allows for measuring methy-
lation and other modications as a DNA molecule is be-
ing sequenced.[111] Several projects have demonstrated
the ability to collect genome-wide epigenetic data in
bacteria.[112][113][114][115]
5.3.5 Epigenetics in bacteria
While epigenetics is of fundamental importance in
eukaryotes, especially metazoans, it plays a dierent
role in bacteria. Most importantly, eukaryotes use
epigenetic mechanisms primarily to regulate gene ex-
pression which bacteria rarely do. However, bacteria
make widespread use of postreplicative DNA methyla-
tion for the epigenetic control of DNA-protein inter-
actions. Bacteria also use DNA adenine methylation
(rather than DNA cytosine methylation) as an epige-
netic signal. DNA adenine methylation is important in
bacteria virulence in organisms such as Escherichia coli,
Salmonella, Vibrio, Yersinia, Haemophilus, and Brucella.
In Alphaproteobacteria, methylation of adenine regulates
the cell cycle and couples gene transcription to DNA
replication. In Gammaproteobacteria, adenine methy-
lation provides signals for DNA replication, chromo-
some segregation, mismatch repair, packaging of bac-
teriophage, transposase activity and regulation of gene
expression.[110][116] There exists a genetic switch control-
ling Streptococcus pneumoniae (the pneumococcus) that
allows the bacterium to randomly change its characteris-
tics into six alternative states that could pave the way to
improved vaccines. Each form is randomly generated by
a phase variable methylation system. The ability of the
pneumococcus to cause deadly infections is dierent in
each of these six states. Similar systems exist in other
bacterial genera.[117]
5.3.6 Medicine
Epigenetics has many and varied potential medical
applications.[118] In 2008, the National Institutes of
Health announced that $190 million had been earmarked
for epigenetics research over the next ve years. In an-
nouncing the funding, government ocials noted that
epigenetics has the potential to explain mechanisms of ag-
ing, human development, and the origins of cancer, heart
disease, mental illness, as well as several other conditions.
Some investigators, like Randy Jirtle, PhD, of Duke Uni-
versity Medical Center, think epigenetics may ultimately
turn out to have a greater role in disease than genetics.[119]
32 CHAPTER 5. BEYOND MENDEL

Twins Genomic imprinting

Some human disorders are associated with genomic im-

printing, a phenomenon in mammals where the father
and mother contribute dierent epigenetic patterns for
specic genomic loci in their germ cells.[126] The best-
Direct comparisons of identical twins constitute an op- known case of imprinting in human disorders is that
timal model for interrogating environmental epigenet- of Angelman syndrome and Prader-Willi syndrome
ics. In the case of humans with dierent environmen- both can be produced by the same genetic mutation,
tal exposures, monozygotic (identical) twins were epige- chromosome 15q partial deletion, and the particular syn-
netically indistinguishable during their early years, while drome that will develop depends on whether the muta-
older twins had remarkable dierences in the overall con- tion is inherited from the childs mother or from their
tent and genomic distribution of 5-methylcytosine DNA father.[127] This is due to the presence of genomic im-
and histone acetylation.[3] The twin pairs who had spent printing in the region. Beckwith-Wiedemann syndrome
less of their lifetime together and/or had greater dier- is also associated with genomic imprinting, often caused
ences in their medical histories were those who showed by abnormalities in maternal genomic imprinting of a re-
the largest dierences in their levels of 5-methylcytosine gion on chromosome 11.
DNA and acetylation of histones H3 and H4.[120] Rett syndrome is underlain by mutations in the MECP2
Dizygotic (fraternal) and monozygotic (identical) gene despite no large-scale changes in expression of
twins show evidence of epigenetic inuence in MeCP2 being found in microarray analyses. BDNF is
humans.[120][121][122] DNA sequence dierences that downregulated in the MECP2 mutant resulting in Rett
would be abundant in a singleton-based study do not syndrome.
interfere with the analysis. Environmental dierences In the verkalix study, paternal (but not maternal)
can produce long-term epigenetic eects, and dierent grandsons[128] of Swedish men who were exposed dur-
developmental monozygotic twin subtypes may be dif- ing preadolescence to famine in the 19th century were
ferent with respect to their susceptibility to be discordant less likely to die of cardiovascular disease. If food was
from an epigenetic point of view.[123] plentiful, then diabetes mortality in the grandchildren in-
A high-throughput study, which denotes technology that creased, suggesting that this was a transgenerational epi-
looks at extensive genetic markers, focused on epige- genetic inheritance.[129] The opposite eect was observed
netic dierences between monozygotic twins to compare for femalesthe paternal (but not maternal) granddaugh-
global and locus-specic changes in DNA methylation ters of women who experienced famine while in the
and histone modications in a sample of 40 monozygotic womb (and therefore while their eggs were being formed)
twin pairs.[120] In this case, only healthy twin pairs were lived shorter lives on average.[130]
studied, but a wide range of ages was represented, be-
tween 3 and 74 years. One of the major conclusions from Cancer
this study was that there is an age-dependent accumula-
tion of epigenetic dierences between the two siblings of For more details on this topic, see Cancer epigenetics.
twin pairs. This accumulation suggests the existence of
epigenetic drift.
A variety of epigenetic mechanisms can be perturbed
A more recent study, where 114 monozygotic twins and in dierent types of cancer. Epigenetic alterations of
80 dizygotic twins were analyzed for the DNA methyla- DNA repair genes or cell cycle control genes are very fre-
tion status of around 6000 unique genomic regions, con- quent in sporadic (non-germ line) cancers, being signi-
cluded that epigenetic similarity at the time of blasto- cantly more common than germ line (familial) mutations
cyst splitting may also contribute to phenotypic similar- in these sporadic cancers.[131][132] Epigenetic alterations
ities in monozygotic co-twins. This supports the notion are important in cellular transformation to cancer, and
that microenvironment at early stages of embryonic de- their manipulation holds great promise for cancer preven-
velopment can be quite important for the establishment tion, detection, and therapy.[133][134] Several medications
of epigenetic marks.[124] Congenital genetic disease is which have epigenetic impact are used in several of these
well understood and it is clear that epigenetics can play diseases. These aspects of epigenetics are addressed in
a role, for example, in the case of Angelman syndrome cancer epigenetics.
and Prader-Willi syndrome. These are normal genetic
diseases caused by gene deletions or inactivation of the
genes, but are unusually common because individuals are Addiction
essentially hemizygous because of genomic imprinting,
and therefore a single gene knock out is sucient to cause Addiction is a disorder of the brains reward system
the disease, where most cases would require both copies which arises through transcriptional and neuroepige-
to be knocked out.[125] netic mechanisms and occurs over time from chroni-
5.3. EPIGENETICS 33

cally high levels of exposure to an addictive stimulus stem cells have also shown a potential to dierentiate into
(e.g., morphine, cocaine, sexual intercourse, gambling, cardiac competent cells when treated with G9a histone
etc.).[135][136][137][138] Transgenerational epigenetic inher- methyltransferase inhibitor BIX01294.[145][146]
itance of addictive phenotypes has been noted to occur in
preclinical studies.[139][140]
5.3.8 Caution
Anxiety
Due to the early stages of epigenetics as a science and
to the sensationalism surrounding it, surgical oncolo-
Transgenerational epigenetic inheritance of anxiety-
gist David Gorski and geneticist Adam Rutherford cau-
related phenotypes has been reported in a preclinical
tion against the drawing and proliferation of false and
study using mice.[141] In this investigation, transmission
pseudoscientic conclusions from new age authors such
of paternal stress-induced traits across generations in-
as Deepak Chopra and Bruce Lipton.[147][148]
volved small non-coding RNA signals transmitted via the
male germline.
5.3.9 In popular culture
Depression
In Neal Stephensons 2015 novel Seveneves, survivors of a
Epigenetic inheritance of depression-related phenotypes worldwide holocaust are tasked with seeding new life on
has also been reported in a preclinically.[141] Inheritance a dormant Earth. Rather than create specic breeds of
of paternal stress-induced traits across generations in- animals to be hunters, scavengers, or prey, species like
volved small non-coding RNA signals transmitted via the canids are developed with mutable epigenetic traits,
paternal germline. with the intention that the animals would quickly trans-
form into the necessary roles that would be required for
an ecosystem to rapidly evolve. Additionally, a race of
Freaks humans, Moirans, are created to survive in space, with
the hope that this subspecies of human would be able to
In a podcast interview, Prof. Mark Blumberg talked adapt to unforeseeable dangers and circumstances, via an
about how epigenetic variance can change our perspec- epigenetic process called going epi.
tive of normal vs freaks. He argued that individuals with
extreme characteristics compared to the generally wide
spread set of phenotypes, should not be considered un-
5.3.10 See also
natural. Instead, according to him, they are individuals
carrying characteristics which belong to both ends of the
Baldwin eect
distribution curve, rather to the middle of it. In his view,
epigenetics is the major argument against the determin-
Behavioral epigenetics
istic, absolute views that genes and only genes determine
[142]
the development of each organism. Computational epigenetics

Contribution of epigenetic modications to evolu-

5.3.7 Research tion
The two forms of heritable information, namely genetic
Epigenetic therapy
and epigenetic, are collectively denoted as dual inheri-
tance. Members of the APOBEC/AID family of cytosine Epigenetics of neurodegenerative diseases
deaminases may concurrently inuence genetic and epi-
genetic inheritance using similar molecular mechanisms, Lamarckism
and may be a point of crosstalk between these conceptu-
ally compartmentalized processes.[143] Nutriepigenomics
Fluoroquinolone antibiotics induce epigenetic changes in
mammalian cells through iron chelation. This leads to Position-eect variegation
epigenetic eects through inhibition of -ketoglutarate-
dependent dioxygenases that require iron as a co- Preformationism
factor.[144]
Somatic epitype
Various pharmacological agents are applied for the pro-
duction of induced pluripotent stem cells (iPSC) or main- Synthetic genetic array
tain the embryonic stem cell (ESC) phenotypic via epi-
genetic approach. Adult stem cells like bone marrow Weismann barrier
34
5.3.11 References
[1] Spector, Tim (2012). Identically Dierent: Why You Can
Change Your Genes. London: Weidenfeld & Nicolson. p.
8. Just over ten years ago researchers found that the diets
of pregnant mothers could alter the behaviour of genes in
their children and that these changes could last a lifetime
and then be passed on in turn to their children. The genes
were literally being switched on or o by a new mech-
anism we call epigenetics meaning in Greek 'around
the gene'. Contrary to traditional genetic dogma, these
changes could be transferred to the next generation. In
this case the mothers just happened to be rats, but recent
similar ndings in humans have created a revolution in our
thinking.
[2] Carey N. (2011): Epigenetics revolution: How modern
biology is rewriting our understanding of genetics, dis-
ease and inheritance. Icon Books, London, ISBN 978-
1-84831-315-6; ISBN 978-1-84831-316-3.
[3] Moore, David S. (2015). The Developing Genome: An
Introduction to Behavioral Epigenetics (1st ed.). Oxford
University Press. ISBN 978-0199922345.
[4] Epigenetics. Icahn School of Medicine at Mount Sinai.
Retrieved 26 May 2015.
[5] Ledford H (2008). Disputed denitions. Nature.
455 (7216): 10238. doi:10.1038/4551023a. PMID
18948925.
[6] Bird A (May 2007). Perceptions of epigenetics. Nature.
447 (7143): 3968. Bibcode:2007Natur.447..396B.
doi:10.1038/nature05913. PMID 17522671.
[7] Special report: 'What genes remember' by Philip
Hunter | Prospect Magazine May 2008 issue 146.
Web.archive.org. 1 May 2008. Archived from the origi-
nal on 1 May 2008. Retrieved 26 July 2012.
[8] Reik W (May 2007). Stability and exi-
bility of epigenetic gene regulation in mam-
malian development. Nature. 447 (7143):
42532. Bibcode:2007Natur.447..425R.
doi:10.1038/nature05918. PMID 17522676.
[9] Oxford English Dictionary: The word is used by W.
Harvey, Exercitationes 1651, p. 148, and in the English
Anatomical Exercitations 1653, p. 272. It is explained
to mean partium super-exorientium additamentum, the
additament of parts budding one out of another.
[10] Waddington CH (1942). The epigenotype. Endeavour.
1: 1820. For the purpose of a study of inheritance,
the relation between phenotypes and genotypes [...] is,
from a wider biological point of view, of crucial impor-
tance, since it is the kernel of the whole problem of de-
velopment. Many geneticists have recognized this and at-
tempted to discover the processes involved in the mecha-
nism by which the genes of the genotype bring about phe-
notypic eects. The rst step in such an enterprise is
or rather should be, since it is often omitted by those with
an undue respect for the powers of reason to describe
what can be seen of the developmental processes. For en-
quiries of this kind, the word phenogenetics was coined
CHAPTER 5. BEYOND MENDEL
by Haecker [1918, Phnogenetik]. The second and more
important part of the task is to discover the causal mecha-
nisms at work, and to relate them as far as possible to what
experimental embryology has already revealed of the me-
chanics of development. We might use the name epige-
netics for such studies, thus emphasizing their relation to
the concepts, so strongly favourable to the classical theory
of epigenesis, which have been reached by the experimen-
tal embryologists. We certainly need to remember that
between genotype and phenotype, and connecting them to
each other, there lies a whole complex of developmental
processes. It is convenient to have a name for this com-
plex: epigenotype seems suitable.
[11] See preformationism for historical background. Oxford
English Dictionary: the theory that the germ is brought
into existence (by successive accretions), and not merely
developed, in the process of reproduction. [...] The op-
posite theory was formerly known as the theory of evolu-
tion; to avoid the ambiguity of this name, it is now spo-
ken of chiey as the theory of preformation, sometimes
as that of encasement or embotement.
[12] C. H. Waddington (1953). The Epigenetics of Birds. Cam-
bridge University Press. pp. 1. ISBN 978-1-107-44047-
0. (2014 edition)
[13] Hall BK (15 January 2004). In search of evolu-
tionary developmental mechanisms: the 30-year gap
between 1944 and 1974. 302. 302 (1): 518.
doi:10.1002/jez.b.20002. PMID 14760651.
[14] Alvarez-Buylla ER, Chaos A, Aldana M, Bentez M,
Cortes-Poza Y, Espinosa-Soto C, Hartasnchez DA, Lotto
RB, Malkin D, Escalera Santos GJ, Padilla-Longoria P
(November 3, 2008). Floral Morphogenesis: Stochastic
Explorations of a Gene Network Epigenetic Landscape..
PLoS ONE. 3: e3626. Bibcode:2008PLoSO...3.3626A.
doi:10.1371/journal.pone.0003626. PMID 18978941.
[15] Rabajante JF, Babierra AL (January 30,
2015). Branching and oscillations in the epi-
genetic landscape of cell-fate determination.
Progress in Biophysics and Molecular Biology.
doi:10.1016/j.pbiomolbio.2015.01.006. PMID
25641423.
[16] Gottlieb G (1991). Epigenetic systems view of human
development. Developmental Psychology. 27 (1): 33
34. doi:10.1037/0012-1649.27.1.33.
[17] Gilbert Gottlieb. Probabilistic epigenesis, Developmental
Science 10:1 (2007), 111
[18] Boeree, C. George, (1997/2006), Personality Theories,
Erik Erikson
[19] Erikson, Erik (1968). Identity: Youth and Crisis. Chapter
3: W.W. Norton and Company, Inc. p. 92.
[20] Epigenetics. Bio-Medicine.org. Retrieved 21 May
2011.
[21] Holliday R (Jan 30, 1990). DNA Methylation and Epi-
genetic Inheritance. Philosophical Transactions of the
Royal Society of London. Series B, Biological Sciences.
326 (1235): 329338. Bibcode:1990RSPTB.326..329H.
doi:10.1098/rstb.1990.0015.
5.3. EPIGENETICS
[22] Riggs AD, Russo VE, Martienssen RA (1996). Epigenetic
mechanisms of gene regulation. Plainview, N.Y.: Cold
Spring Harbor Laboratory Press. ISBN 0-87969-490-4.
[23] Beware the pseudo gene genies Beware the pseudo gene
genies The Guardian
[24] Overview. NIH Roadmap Epigenomics Project.
[25] Berger SL, Kouzarides T, Shiekhattar R, Shilatifard A
(2009). An operational denition of epigenetics. Genes
Dev. 23 (7): 7813. doi:10.1101/gad.1787609. PMC
3959995 . PMID 19339683.
[26] Chandler VL (February 2007). Paramutation:
from maize to mice. Cell. 128 (4): 6415.
doi:10.1016/j.cell.2007.02.007. PMID 17320501.
[27] Kovalchuk O, Baulch JE (January 2008). Epigenetic
changes and nontargeted radiation eectsis there a
link?". Environ. Mol. Mutagen. 49 (1): 1625.
doi:10.1002/em.20361. PMID 18172877.
[28] Ilnytskyy Y, Kovalchuk O (September 2011).
Non-targeted radiation eects-an epigenetic con-
nection. Mutat. Res. 714 (12): 11325.
doi:10.1016/j.mrfmmm.2011.06.014. PMID 21784089.
[29] Friedl AA, Mazurek B, Seiler DM (2012). Radiation-
induced alterations in histone modication patterns and
their potential impact on short-term radiation eects.
Front Oncol. 2: 117. doi:10.3389/fonc.2012.00117.
PMC 3445916 . PMID 23050241.
[30] Cuozzo C, Porcellini A, Angrisano T, Morano A, Lee
B, Di Pardo A, Messina S, Iuliano R, Fusco A, Santillo
MR, Muller MT, Chiariotti L, Gottesman ME, Avved-
imento EV (July 2007). DNA damage, homology-
directed repair, and DNA methylation. PLoS Genet.
3 (7): e110. doi:10.1371/journal.pgen.0030110. PMC
1913100 . PMID 17616978.
[31] O'Hagan HM, Mohammad HP, Baylin SB (2008). Lee
JT, ed. Double strand breaks can initiate gene silenc-
ing and SIRT1-dependent onset of DNA methylation in
an exogenous promoter CpG island. PLoS Genet. 4 (8):
e1000155. doi:10.1371/journal.pgen.1000155. PMC
2491723 . PMID 18704159.
[32] Malanga M, Althaus FR (2005). The role of poly(ADP-
ribose) in the DNA damage signaling network. Biochem
Cell Biol. 83 (3): 354364. doi:10.1139/o05-038. PMID
15959561.
[33] Gottschalk AJ, Timinszky G, Kong SE, Jin J, Cai
Y, Swanson SK, Washburn MP, Florens L, Ladurner
AG, Conaway JW, Conaway RC (August 2009).
Poly(ADP-ribosyl)ation directs recruitment and
activation of an ATP-dependent chromatin re-
modeler. Proc. Natl. Acad. Sci. U.S.A. 106
(33): 137704. Bibcode:2009PNAS..10613770G.
doi:10.1073/pnas.0906920106. PMC 2722505 . PMID
19666485.
35
[34] Lin JC, Jeong S, Liang G, Takai D, Fatemi M, Tsai
YC, Egger G, Gal-Yam EN, Jones PA (November 2007).
Role of nucleosomal occupancy in the epigenetic silenc-
ing of the MLH1 CpG island. Cancer Cell. 12 (5): 432
44. doi:10.1016/j.ccr.2007.10.014. PMID 17996647.
[35] Tabish AM, Poels K, Hoet P, Godderis L (2012).
Chiariotti L, ed. Epigenetic factors in cancer risk:
eect of chemical carcinogens on global DNA methy-
lation pattern in human TK6 cells. PLoS ONE.
7 (4): e34674. Bibcode:2012PLoSO...734674T.
doi:10.1371/journal.pone.0034674. PMC 3324488 .
PMID 22509344.
[36] Burdge GC, Hoile SP, Uller T, Thomas NA,
Gluckman PD, Hanson MA, Lillycrop KA (2011).
Imhof A, ed. Progressive, transgenerational
changes in ospring phenotype and epigenotype
following nutritional transition. PLoS ONE. 6
(11): e28282. Bibcode:2011PLoSO...628282B.
doi:10.1371/journal.pone.0028282. PMC 3227644 .
PMID 22140567.
[37] Fang M, Chen D, Yang CS (January 2007). Dietary
polyphenols may aect DNA methylation. J. Nutr. 137
(1 Suppl): 223S228S. PMID 17182830.
[38] Olaharski AJ, Rine J, Marshall BL, Babiarz J, Zhang
L, Verdin E, Smith MT (December 2005). The a-
voring agent dihydrocoumarin reverses epigenetic silenc-
ing and inhibits sirtuin deacetylases. PLoS Genet. 1
(6): e77. doi:10.1371/journal.pgen.0010077. PMC
1315280 . PMID 16362078.
[39] Kikuno N, Shiina H, Urakami S, Kawamoto K, Hi-
rata H, Tanaka Y, Majid S, Igawa M, Dahiya R (Au-
gust 2008). Genistein mediated histone acetylation
and demethylation activates tumor suppressor genes in
prostate cancer cells. Int. J. Cancer. 123 (3): 55260.
doi:10.1002/ijc.23590. PMID 18431742.
[40] Davis JN, Kucuk O, Djuric Z, Sarkar FH (June 2001).
Soy isoavone supplementation in healthy men prevents
NF-kappa B activation by TNF-alpha in blood lympho-
cytes. Free Radic. Biol. Med. 30 (11): 1293302.
doi:10.1016/S0891-5849(01)00535-4. PMID 11368927.
[41] Djuric Z, Chen G, Doerge DR, Heilbrun LK, Kucuk
O (October 2001). Eect of soy isoavone supple-
mentation on markers of oxidative stress in men and
women. Cancer Lett. 172 (1): 16. doi:10.1016/S0304-
3835(01)00627-9. PMID 11595123.
[42] Kropat C, Mueller D, Boettler U, Zimmermann K,
Heiss EH, Dirsch VM, Rogoll D, Melcher R, Rich-
ling E, Marko D (March 2013). Modulation of Nrf2-
dependent gene transcription by bilberry anthocyanins
in vivo. Mol Nutr Food Res. 57 (3): 54550.
doi:10.1002/mnfr.201200504. PMID 23349102.
[43] Baron R, Vellore NA (2012). LSD1/CoREST is an
allosteric nanoscale clamp regulated by H3-histone-tail
molecular recognition. Proc Natl Acad Sci U S A.
109 (31): 1250914. Bibcode:2012PNAS..10912509B.
doi:10.1073/pnas.1207892109. PMC 3411975 . PMID
22802671.
36
[44] Jablonka E, Lamb MJ, Lachmann M (September 1992).
Evidence, mechanisms and models for the inheritance of
acquired characteristics. J. Theor. Biol. 158 (2): 245
268. doi:10.1016/S0022-5193(05)80722-2.
[45] Ptashne M (April 2007). On the use of the word
'epigenetic'". Curr. Biol. 17 (7): R2336.
doi:10.1016/j.cub.2007.02.030. PMID 17407749.
[46] Jenuwein T, Laible G, Dorn R, Reuter G (January 1998).
SET domain proteins modulate chromatin domains in eu-
and heterochromatin. Cell. Mol. Life Sci. 54 (1): 8093.
doi:10.1007/s000180050127. PMID 9487389.
[47] Slotkin RK, Martienssen R (April 2007). Trans-
posable elements and the epigenetic regulation of the
genome. Nature Reviews Genetics. 8 (4): 27285.
doi:10.1038/nrg2072. PMID 17363976.
[48] Li E, Bestor TH, Jaenisch R (June 1992). Targeted muta-
tion of the DNA methyltransferase gene results in embry-
onic lethality. Cell. 69 (6): 91526. doi:10.1016/0092-
8674(92)90611-F. PMID 1606615.
[49] Robertson KD, Uzvolgyi E, Liang G, Talmadge C,
Sumegi J, Gonzales FA, Jones PA (June 1999). The hu-
man DNA methyltransferases (DNMTs) 1, 3a and 3b: co-
ordinate mRNA expression in normal tissues and overex-
pression in tumors. Nucleic Acids Res. 27 (11): 2291
8. doi:10.1093/nar/27.11.2291. PMC 148793 . PMID
10325416.
[50] Leonhardt H, Page AW, Weier HU, Bestor TH (Novem-
ber 1992). A targeting sequence directs DNA methyl-
transferase to sites of DNA replication in mammalian
nuclei. Cell. 71 (5): 86573. doi:10.1016/0092-
8674(92)90561-P. PMID 1423634.
[51] Chuang LS, Ian HI, Koh TW, Ng HH, Xu G,
Li BF (September 1997). Human DNA-(cytosine-
5) methyltransferase-PCNA complex as a target for
p21WAF1. Science. 277 (5334): 19962000.
doi:10.1126/science.277.5334.1996. PMID 9302295.
[52] Robertson KD, Wole AP (October 2000). DNA
methylation in health and disease. Nature Reviews Ge-
netics. 1 (1): 119. doi:10.1038/35049533. PMID
11262868.
[53] Li E, Beard C, Jaenisch R (November 1993). Role
for DNA methylation in genomic imprinting. Na-
ture. 366 (6453): 3625. Bibcode:1993Natur.366..362L.
doi:10.1038/366362a0. PMID 8247133.
[54] Viens A, Mechold U, Brouillard F, Gilbert C, Leclerc
P, Ogryzko V (July 2006). Analysis of human histone
H2AZ deposition in vivo argues against its direct role in
epigenetic templating mechanisms. Mol. Cell. Biol.
26 (14): 532535. doi:10.1128/MCB.00584-06. PMC
1592707 . PMID 16809769.
[55] Ogryzko VV (2008). Erwin Schroedinger, Francis
Crick and epigenetic stability. Biol. Direct. 3: 15.
doi:10.1186/1745-6150-3-15. PMC 2413215 . PMID
18419815.
CHAPTER 5. BEYOND MENDEL
[56] Nottke A, Colaicovo MP, Shi Y (March 2009).
Developmental roles of the histone lysine
demethylases. Development. 136 (6): 87989.
doi:10.1242/dev.020966. PMC 2692332 . PMID
19234061.
[57] Rosenfeld JA, Wang Z, Schones DE, Zhao K, DeSalle
R, Zhang MQ (2009). Determination of enriched hi-
stone modications in non-genic portions of the human
genome. BMC Genomics. 10: 143. doi:10.1186/1471-
2164-10-143. PMC 2667539 . PMID 19335899.
[58] Sneppen K, Micheelsen MA, Dodd IB (April 15, 2008).
Ultrasensitive gene regulation by positive feedback loops
in nucleosome modication. Molecular systems biology.
4 (1): 182. doi:10.1038/msb.2008.21. PMC 2387233 .
PMID 18414483. Retrieved 5 May 2014.
[59] Epigenetic cell memory. Cmol.nbi.dk. Retrieved 26
July 2012.
[60] Dodd IB, Micheelsen MA, Sneppen K, Thon G (May
2007). Theoretical analysis of epigenetic cell memory
by nucleosome modication. Cell. 129 (4): 81322.
doi:10.1016/j.cell.2007.02.053. PMID 17512413.
[61] Morris KL (2008). Epigenetic Regulation of Gene Ex-
pression. RNA and the Regulation of Gene Expression: A
Hidden Layer of Complexity. Norfolk, England: Caister
Academic Press. ISBN 1-904455-25-5.
[62] Mattick JS, Amaral PP, Dinger ME, Mercer TR,
Mehler MF (January 2009). RNA regulation of
epigenetic processes. BioEssays. 31 (1): 519.
doi:10.1002/bies.080099. PMID 19154003.
[63] Choi, Charles Q. (25 May 2006). RNA can be hereditary
molecule. The Scientist. Archived from the original on 8
February 2007.
[64] Bernal JE, Duran C, Papiha SS (2012). Transcriptional
and epigenetic regulation of human microRNAs. Cancer
Lett. 331 (1): 110. doi:10.1016/j.canlet.2012.12.006.
PMID 23246373.
[65] Browse miRBase by species
[66] Lim LP, Lau NC, Garrett-Engele P, Grimson A, Schelter
JM, Castle J, Bartel DP, Linsley PS, Johnson JM (2005).
Microarray analysis shows that some microRNAs down-
regulate large numbers of target mRNAs. Nature.
433 (7027): 769773. Bibcode:2005Natur.433..769L.
doi:10.1038/nature03315. PMID 15685193.
[67] Lee D, Shin C (2012). MicroRNA-target interac-
tions: new insights from genome-wide approaches. Ann
N Y Acad Sci. 1271: 11828. doi:10.1111/j.1749-
6632.2012.06745.x. PMID 23050973.
[68] Friedman RC, Farh KK, Burge CB, Bartel DP (2009).
Most mammalian mRNAs are conserved targets of
microRNAs. Genome Res. 19 (1): 92105.
doi:10.1101/gr.082701.108. PMC 2612969 . PMID
18955434.
5.3. EPIGENETICS
[69] Goll MG, Bestor TH (2005). Eukaryotic cytosine
methyltransferases. Annu Rev Biochem. 74: 481
514. doi:10.1146/annurev.biochem.74.010904.153721.
PMID 15952895.
[70] Guifang Jia; Ye Fu; Xu Zhao; Qing Dai; Guanqun
Zheng; Ying Yang; Chengqi Yi; Lindahl, Tomas; Tao
Pan; Yun-Gui Yang; Chuan He (16 October 2011). N6-
Methyladenosine in nuclear RNA is a major substrate
of the obesity-associated FTO. Nature Chemical Biol-
ogy. 7 (12): 885887. doi:10.1038/nchembio.687. PMC
3218240 . PMID 22002720.
[71] New research links common RNA modication to obe-
sity. Physorg.com. Retrieved 26 July 2012.
[72] Howden BP, Beaume M, Harrison PF, Hernandez D,
Schrenzel J, Seemann T, Francois P, Stinear TP (Au-
gust 2013). Analysis of the Small RNA Transcriptional
Response in Multidrug-Resistant Staphylococcus aureus
after Antimicrobial Exposure. Antimicrob. Agents
Chemother. 57 (8): 386474. doi:10.1128/AAC.00263-
13. PMC 3719707 . PMID 23733475.
[73] sRNATarBase 2.0 A comprehensive database of bacterial
SRNA targets veried by experiments
[74] Genomics maps for small non-coding RNAs and their tar-
gets in microbial genomes
[75] Yool A, Edmunds WJ (1998). Epigenetic inheritance
and prions. Journal of Evolutionary Biology. 11 (2):
241242. doi:10.1007/s000360050085.
[76] Cox BS (1965). "[PSI], a cytoplasmic suppressor of
super-suppression in yeast. Heredity. 20 (4): 505521.
doi:10.1038/hdy.1965.65.
[77] Lacroute F (May 1971). Non-Mendelian mutation allow-
ing ureidosuccinic acid uptake in yeast. J. Bacteriol. 106
(2): 51922. PMC 285125 . PMID 5573734.
[78] Liebman SW, Sherman F (September 1979).
Extrachromosomal psi+ determinant suppresses
nonsense mutations in yeast. J. Bacteriol. 139 (3):
106871. PMC 218059 . PMID 225301.
[79] True HL, Lindquist SL (September 2000). A yeast
prion provides a mechanism for genetic variation and
phenotypic diversity. Nature. 407 (6803): 47783.
doi:10.1038/35035005. PMID 11028992.
[80] Shorter J, Lindquist S (June 2005). Prions as adaptive
conduits of memory and inheritance. Nature Reviews
Genetics. 6 (6): 43550. doi:10.1038/nrg1616. PMID
15931169.
[81] Giacomelli MG, Hancock AS, Masel J (2007).
The conversion of 3 UTRs into coding regions.
Molecular Biology & Evolution. 24 (2): 457464.
doi:10.1093/molbev/msl172. PMC 1808353 . PMID
17099057.
[82] Lancaster AK, Bardill JP, True HL, Masel J (2010).
The Spontaneous Appearance Rate of the Yeast Prion
37
PSI+ and Its Implications for the Evolution of the Evolv-
ability Properties of the PSI+ System. Genetics. 184
(2): 393400. doi:10.1534/genetics.109.110213. PMC
2828720 . PMID 19917766.
[83] Sapp J (1991). Concepts of organization. The lever-
age of ciliate protozoa. Dev. Biol. (NY). 7: 22958.
doi:10.1007/978-1-4615-6823-0_11. PMID 1804215.
[84] Sapp J (2003). Genesis: the evolution of biology. Ox-
ford [Oxfordshire]: Oxford University Press. ISBN 0-19-
515619-6.
[85] Gray RD, Oyama S, Griths PE (2003). Cycles of Con-
tingency: Developmental Systems and Evolution (Life and
Mind: Philosophical Issues in Biology and Psychology).
Cambridge, Mass: The MIT Press. ISBN 0-262-65063-0.
[86] Teif VB, Beshnova DA, Vainshtein Y, Marth C, Mallm
JP, Hfer T, Rippe K (8 May 2014). Nucleosome
repositioning links DNA (de)methylation and dierential
CTCF binding during stem cell development. Genome
Research. 24: 12851295. doi:10.1101/gr.164418.113.
PMID 24812327.
[87] Griesemer J, Haber MH, Yamashita G, Gannett L (March
2005). Critical Notice: Cycles of Contingency Devel-
opmental Systems and Evolution. Biology & Philosophy.
20 (23): 517544. doi:10.1007/s10539-004-0836-4.
[88] Chapter: Nervous System Development in Epigenet-
ics, by Benedikt Hallgrimsson and Brian Hall
[89] Costa S, Shaw P (March 2007). "'Open minded' cells:
how cells can change fate (PDF). Trends Cell Biol.
17 (3): 1016. doi:10.1016/j.tcb.2006.12.005. PMID
17194589. This might suggest that plant cells do not use
or require a cellular memory mechanism and just respond
to positional information. However, it has been shown that
plants do use cellular memory mechanisms mediated by
PcG proteins in several processes, ... (p.104)
[90] Cooney CA, Dave AA, Wol GL (August 2002). Ma-
ternal methyl supplements in mice aect epigenetic vari-
ation and DNA methylation of ospring. J. Nutr. 132 (8
Suppl): 2393S2400S. PMID 12163699.
[91] Waterland RA, Jirtle RL (August 2003). Transposable
elements: targets for early nutritional eects on epige-
netic gene regulation. Mol. Cell. Biol. 23 (15): 5293
300. doi:10.1128/MCB.23.15.5293-5300.2003. PMC
165709 . PMID 12861015.
[92] Fearful Memories Passed Down to Mouse Descen-
dants: Genetic imprint from traumatic experiences carries
through at least two generations, By Ewen Callaway and
Nature magazine | Sunday, 1 December 2013.
[93] Mice can 'warn' sons, grandsons of dangers via sperm, by
Mariette Le Roux, 12/1/13.
[94] G. Francis, Too Much Success for Recent Ground-
breaking Epigenetic Experiments http://www.genetics.
org/content/198/2/449.abstract
 38 CHAPTER 5. BEYOND MENDEL

[95] Dias BG, Ressler KJ (2014). Parental olfactory ex- [107] Jablonka E, Raz G (June 2009). Transgenerational epi-
perience inuences behavior and neural structure in genetic inheritance: prevalence, mechanisms, and impli-
subsequent generations. Nat. Neurosci. 17: 89 cations for the study of heredity and evolution. Q Rev
96. doi:10.1038/nn.3594. PMC 3923835 . PMID Biol. 84 (2): 13176. doi:10.1086/598822. PMID
24292232. (see comment by Gonzalo Otazu) 19606595.

[96] http://www.the-scientist.com/?articles.view/articleNo/ [108] Davies, Hazel (2008). Do Butteries Bite?: Fascinating

41239/title/Epigenetics-Paper-Raises-Questions/
[97] Lamb MJ, Jablonka E (2005). Evolution in four dimen-
sions: genetic, epigenetic, behavioral, and symbolic varia- [109] Lewis ZA, Honda S, Khlafallah TK, Jeress JK, Fre-
tion in the history of life. Cambridge, Mass: MIT Press.
ISBN 0-262-10107-6.
[98] See also Denis Noble The Music of Life see esp pp. 938
and p. 48 where he cites Jablonka & Lamb and Massimo
Pigliucci's review of Jablonka and Lamb in Nature 435,
565566 (2 June 2005)
[99] Danchin , Charmantier A, Champagne FA, Mesoudi
A, Pujol B, Blanchet S (2011). Beyond DNA: inte-
grating inclusive inheritance into an extended theory of
evolution. Nature Reviews Genetics. 12: 475486.
doi:10.1038/nrg3028. PMID 21681209.
[100] Maynard Smith J (1990). Models of a Dual Inheritance
System. Journal of Theoretical Biology. 143 (1): 4153.
doi:10.1016/S0022-5193(05)80287-5. PMID 2359317.
[101] Lynch M (2007). The frailty of adaptive hypotheses for
the origins of organismal complexity. PNAS. 104 (suppl. [112] Davis BM, Chao MC, Waldor MK (2013). Entering
1): 85978604. Bibcode:2007PNAS..104.8597L.
doi:10.1073/pnas.0702207104. PMC 1876435 . PMID
17494740.
[102] Thomas Dickens, Qazi Rahman. (2012). The extended
evolutionary synthesis and the role of soft inheritance in [113] Lluch-Senar M, Luong K, Llorns-Rico V, Delgado
evolution. Proceedings of the Royal Society: B biological
sciences, 279 (1740). pp. 2913-2921.
[103] Rando OJ, Verstrepen KJ (February 2007). Timescales
of genetic and epigenetic inheritance. Cell. 128
(4): 65568. doi:10.1016/j.cell.2007.01.023. PMID
17320504.
[104] Lancaster AK, Masel J (1 September 2009). The
evolution of reversible switches in the presence of [114] Murray IA, Clark TA, Morgan RD, Boitano M, Anton BP,
irreversible mimics. Evolution. 63 (9): 2350
2362. doi:10.1111/j.1558-5646.2009.00729.x. PMC
2770902 . PMID 19486147.
[105] Graaf, Adriaan van der; Wardenaar, Ren; Neumann,
Drexel A.; Taudt, Aaron; Shaw, Ruth G.; Jansen, Ritsert [115] Fang G, Munera D, Friedman DI, Mandlik A, Chao
C.; Schmitz, Robert J.; Colom-Tatch, Maria; Johannes,
Frank (2015-05-11). Rate, spectrum, and evolution-
ary dynamics of spontaneous epimutations. Proceedings
of the National Academy of Sciences. 112: 201424254.
doi:10.1073/pnas.1424254112. ISSN 0027-8424. Re-
trieved 2015-05-12.
[106] Griswold CK, Masel J (2009). beda F, ed.
Complex Adaptations Can Drive the Evolution
of the Capacitor PSI+, Even with Realistic Rates [116] Casadess J, Low D (September 2006). Epigenetic gene
of Yeast Sex. PLoS Genetics. 5 (6): e1000517.
doi:10.1371/journal.pgen.1000517. PMC 2686163 .
PMID 19521499.
Answers to Questions about Butteries and Moths (Ani-
mals Q&A). Rutgers University Press.
itag M, Mohn F, Schbeler D, Selker EU (March 2009).
Relics of repeat-induced point mutation direct hete-
rochromatin formation in Neurospora crassa. Genome
Res. 19 (3): 42737. doi:10.1101/gr.086231.108. PMC
2661801 . PMID 19092133.
[110] Jorg Tost (2008). Epigenetics. Norfolk, England: Caister
Academic Press. ISBN 1-904455-23-9.
[111] Schadt EE, Banerjee O, Fang G, Feng Z, Wong WH,
Zhang X, Kislyuk A, Clark TA, Luong K, Keren-Paz A,
Chess A, Kumar V, Chen-Plotkin A, Sondheimer N, Ko-
rlach J, Kasarskis A (2012). Modeling kinetic rate vari-
ation in third generation DNA sequencing data to de-
tect putative modications to DNA bases. Genome Re-
search. 23 (1): 12941. doi:10.1101/gr.136739.111.
PMC 3530673 . PMID 23093720.
the era of bacterial epigenomics with single molecule real
time DNA sequencing. Current Opinion in Microbiology.
16 (2): 1928. doi:10.1016/j.mib.2013.01.011. PMC
3646917 . PMID 23434113.
J, Fang G, Spittle K, Clark TA, Schadt E, Turner
SW, Korlach J, Serrano L (2013). Richardson PM,
ed. Comprehensive Methylome Characterization of
Mycoplasma genitalium and Mycoplasma pneumoniae
at Single-Base Resolution. PLoS Genetics. 9 (1):
e1003191. doi:10.1371/journal.pgen.1003191. PMC
3536716 . PMID 23300489.
Luong K, Fomenkov A, Turner SW, Korlach J, Roberts RJ
(2012). The methylomes of six bacteria. Nucleic Acids
Research. 40 (22): 1145062. doi:10.1093/nar/gks891.
PMC 3526280 . PMID 23034806.
MC, Banerjee O, Feng Z, Losic B, Mahajan MC, Jabado
OJ, Deikus G, Clark TA, Luong K, Murray IA, Davis
BM, Keren-Paz A, Chess A, Roberts RJ, Korlach J,
Turner SW, Kumar V, Waldor MK, Schadt EE (2012).
Genome-wide mapping of methylated adenine residues
in pathogenic Escherichia coli using single-molecule real-
time sequencing. Nature Biotechnology. 30 (12): 1232
9. doi:10.1038/nbt.2432. PMID 23138224.
regulation in the bacterial world. Microbiol. Mol. Biol.
Rev. 70 (3): 83056. doi:10.1128/MMBR.00016-06.
PMC 1594586 . PMID 16959970.
 5.3. EPIGENETICS
[117] Manso AS, Chai MH, Atack JM, Furi L, De Ste Croix M,
Haigh R, Trappetti C, Ogunniyi AD, Shewell LK, Boi-
tano M, Clark TA, Korlach J, Blades M, Mirkes E, Gor-
ban AN, Paton JC, Jennings MP, Oggioni MR (September
2014). A random six-phase switch regulates pneumococ- [128] A persons paternal grandson is the son of a son of that
cal virulence via global epigenetic changes. Nature Com-
munications. 5: 5055. doi:10.1038/ncomms6055. PMC
4190663 . PMID 25268848.
[118] Chahwan R, Wontakal SN, Roa S (March 2011). The
multidimensional nature of epigenetic information and its
role in disease. Discov Med. 11 (58): 23343. PMID
21447282.
[119] Beil, Laura (Winter 2008). Medicines New Epicenter?
Epigenetics: New eld of epigenetics may hold the secret [130] NOVA | Transcripts | Ghost in Your Genes. PBS. 16
to ipping cancers o switch.. CURE (Cancer Up-
dates, Research and Education).
[120] Fraga MF, Ballestar E, Paz MF, Ropero S, Setien F,
Ballestar ML, Heine-Suer D, Cigudosa JC, Urioste M,
Benitez J, Boix-Chornet M, Sanchez-Aguilera A, Ling
C, Carlsson E, Poulsen P, Vaag A, Stephan Z, Spec-
tor TD, Wu YZ, Plass C, Esteller M (July 2005).
Epigenetic dierences arise during the lifetime of
monozygotic twins. Proc. Natl. Acad. Sci. U.S.A.
102 (30): 106049. Bibcode:2005PNAS..10210604F.
doi:10.1073/pnas.0500398102. PMC 1174919 . PMID
16009939.
[121] Kaminsky ZA, Tang T, Wang SC, Ptak C, Oh GH, Wong
AH, Feldcamp LA, Virtanen C, Halfvarson J, Tysk C,
McRae AF, Visscher PM, Montgomery GW, Gottes-
man II, Martin NG, Petronis A (February 2009). DNA
methylation proles in monozygotic and dizygotic twins.
Nat. Genet. 41 (2): 2405. doi:10.1038/ng.286. PMID
19151718.
[122] O'Connor, Anahad (11 March 2008). The Claim: Iden-
tical Twins Have Identical DNA. New York Times. Re-
trieved 2 May 2010.
[123] Ballestar E (2010). Epigenetics lessons from twins:
prospects for autoimmune disease. Clin Rev Allergy Im-
munol. 39 (1): 3041. doi:10.1007/s12016-009-8168-4.
PMID 19653134.
[124] Kaminsky ZA, Tang T, Wang SC, Ptak C, Oh GH, Wong
AH, Feldcamp LA, Virtanen C, Halfvarson J, Tysk C,
McRae AF, Visscher PM, Montgomery GW, Gottesman [135] Robison AJ, Nestler EJ (November 2011).
II, Martin NG, Petronis A (2009). DNA methylation
proles in monozygotic and dizygotic twins. Nat Genet.
41 (2): 240245. doi:10.1038/ng.286. PMID 19151718.
[125] Online 'Mendelian Inheritance in Man' (OMIM) 105830
[136] Nestler EJ (December 2013). Cellular basis of memory
[126] Wood AJ, Oakey RJ (November 2006). Genomic
imprinting in mammals: emerging themes and es-
tablished theories. PLoS Genet. 2 (11): e147.
doi:10.1371/journal.pgen.0020147. PMC 1657038 . [137] Rue JK (November 2014). Molecular neurobiol-
PMID 17121465.
[127] Knoll JH, Nicholls RD, Magenis RE, Graham JM, La-
lande M, Latt SA (February 1989). Angelman and
Prader-Willi syndromes share a common chromosome
39
15 deletion but dier in parental origin of the dele-
tion. Am. J. Med. Genet. 32 (2): 28590.
doi:10.1002/ajmg.1320320235. PMID 2564739.
person; a maternal grandson is the son of a daughter.
[129] Pembrey ME, Bygren LO, Kaati G, Edvinsson S, North-
stone K, Sjstrm M, Golding J (February 2006). Sex-
specic, male-line transgenerational responses in hu-
mans. Eur. J. Hum. Genet. 14 (2): 15966.
doi:10.1038/sj.ejhg.5201538. PMID 16391557. Robert
Winston refers to this study in a lecture; see also discus-
sion at Leeds University, here
October 2007. Retrieved 26 July 2012.
[131] Wood LD, Parsons DW, Jones S, Lin J, Sjblom T,
Leary RJ, Shen D, Boca SM, Barber T, Ptak J, Sil-
liman N, Szabo S, Dezso Z, Ustyanksky V, Nikol-
skaya T, Nikolsky Y, Karchin R, Wilson PA, Kaminker
JS, Zhang Z, Croshaw R, Willis J, Dawson D, Ship-
itsin M, Willson JK, Sukumar S, Polyak K, Park BH,
Pethiyagoda CL, Pant PV, Ballinger DG, Sparks AB,
Hartigan J, Smith DR, Suh E, Papadopoulos N, Buck-
haults P, Markowitz SD, Parmigiani G, Kinzler KW, Vel-
culescu VE, Vogelstein B (2007). The genomic land-
scapes of human breast and colorectal cancers. Science.
318 (5853): 11081113. Bibcode:2007Sci...318.1108W.
doi:10.1126/science.1145720. PMID 17932254.
[132] Jasperson KW, Tuohy TM, Neklason DW, Burt
RW (2010). Hereditary and familial colon can-
cer. Gastroenterology. 138 (6): 20442058.
doi:10.1053/j.gastro.2010.01.054. PMID 20420945.
[133] Novak, Kris (20 December 2004). Epigenetics Changes
in Cancer Cells. Medscape General Medicine. 6 (4): 17.
PMC 1480584 . PMID 15775844.
[134] Banno K, Kisu I, Yanokura M, Tsuji K, Masuda K,
Ueki A, Kobayashi Y, Yamagami W, Nomura H, Tom-
inaga E, Susumu N, Aoki D (2012). Epimutation and
cancer: a new carcinogenic mechanism of Lynch syn-
drome (Review)". Int. J. Oncol. 41 (3): 7937.
doi:10.3892/ijo.2012.1528. PMC 3582986 . PMID
22735547.
Transcriptional and epigenetic mechanisms of ad-
diction. Nat. Rev. Neurosci. 12 (11): 623637.
doi:10.1038/nrn3111. PMC 3272277 . PMID
21989194.
for addiction. Dialogues Clin. Neurosci. 15 (4): 431
443. PMC 3898681 . PMID 24459410.
ogy of addiction: whats all the ()FosB about?".
Am J Drug Alcohol Abuse. 40 (6): 428437.
doi:10.3109/00952990.2014.933840. PMID 25083822.
Conclusions
FosB is an essential transcription factor implicated in the
 40
molecular and behavioral pathways of addiction follow-
ing repeated drug exposure. The formation of FosB in
multiple brain regions, and the molecular pathway leading
to the formation of AP-1 complexes is well understood.
The establishment of a functional purpose for FosB has
allowed further determination as to some of the key as-
pects of its molecular cascades, involving eectors such
as GluR2 (87,88), Cdk5 (93) and NFkB (100). More-
over, many of these molecular changes identied are now
directly linked to the structural, physiological and behav-
ioral changes observed following chronic drug exposure
(60,95,97,102). New frontiers of research investigating
the molecular roles of FosB have been opened by epi-
genetic studies, and recent advances have illustrated the
role of FosB acting on DNA and histones, truly as a
molecular switch (34). As a consequence of our im-
proved understanding of FosB in addiction, it is possible
to evaluate the addictive potential of current medications
(119), as well as use it as a biomarker for assessing the ef-
cacy of therapeutic interventions (121,122,124). Some
of these proposed interventions have limitations (125) or
are in their infancy (75). However, it is hoped that some
of these preliminary ndings may lead to innovative treat-
ments, which are much needed in addiction.
[138] Biliski P, Wojtya A, Kapka-Skrzypczak L, Chwe-
dorowicz R, Cyranka M, Studziski T (2012). Epige- [146] yang, jinpu; kaur, keerat; ong, lilin; eisenberg, carol;
netic regulation in drug addiction. Ann. Agric. Environ.
Med. 19 (3): 491496. PMID 23020045. For these rea-
sons, FosB is considered a primary and causative tran-
scription factor in creating new neural connections in the
reward centre, prefrontal cortex, and other regions of the
limbic system. This is reected in the increased, stable
and long-lasting level of sensitivity to cocaine and other [147] Beware the pseudo gene genies. The Guardian.
drugs, and tendency to relapse even after long periods [148] Epigenetics: It doesnt mean what quacks think it means.
of abstinence. These newly constructed networks func-
tion very eciently via new pathways as soon as drugs of
abuse are further taken ... In this way, the induction of
CDK5 gene expression occurs together with suppression 5.3.12 External links
of the G9A gene coding for dimethyltransferase acting on
the histone H3. A feedback mechanism can be observed
in the regulation of these 2 crucial factors that determine
the adaptive epigenetic response to cocaine. This depends
on FosB inhibiting G9a gene expression, i.e. H3K9me2
synthesis which in turn inhibits transcription factors for
FosB. For this reason, the observed hyper-expression of
G9a, which ensures high levels of the dimethylated form
of histone H3, eliminates the neuronal structural and plas-
ticity eects caused by cocaine by means of this feedback
which blocks FosB transcription
[139] Vassoler FM, Sadri-Vakili G (2014). Mechanisms
of transgenerational inheritance of addictive-
like behaviors. Neuroscience. 264: 198206.
doi:10.1016/j.neuroscience.2013.07.064. PMC
3872494 . PMID 23920159.
[140] Yuan TF, Li A, Sun X, Ouyang H, Campos C, Rocha
NB, Arias-Carrin O, Machado S, Hou G, So KF
(2015). Transgenerational Inheritance of Paternal Neu-
robehavioral Phenotypes: Stress, Addiction, Ageing and
Metabolism. Mol. Neurobiol. doi:10.1007/s12035-015-
9526-2. PMID 26572641.
CHAPTER 5. BEYOND MENDEL
[141] Short, A. K.; Fennell, K. A.; Perreau, V. M.; Fox, A.;
OBryan, M. K.; Kim, J. H.; Bredy, T. W.; Pang, T. Y.;
Hannan, A. J. (2016-06-14). Elevated paternal gluco-
corticoid exposure alters the small noncoding RNA pro-
le in sperm and modies anxiety and depressive phe-
notypes in the ospring. Translational Psychiatry. 6
(6): e837. doi:10.1038/tp.2016.109. PMC 4931607 .
PMID 27300263.
[142] Brumberk, Mark. Freaks of Nature. Point of Inquiry.
Center for Inquiry. Retrieved 24 July 2009.
[143] Chahwan R, Wontakal SN, Roa S (October 2010).
Crosstalk between genetic and epigenetic information
through cytosine deamination. Trends Genet. 26
(10): 4438. doi:10.1016/j.tig.2010.07.005. PMID
20800313.
[144] Nonantibiotic Eects of Fluoroquinolones in Mam-
malian Cells.. J Biol Chem. 290: 2228797. Sep 2015.
doi:10.1074/jbc.M115.671222. PMID 26205818.
[145] mezentseva, nadejda; yang, jinpu; kaur, keerat; eisenberg,
carol; eisenberg, leonard (2012). The histone methyl-
transferase inhibitor BIX01294 enhances the cardiac po-
tential of bone marrow cells.. Stem Cells Dev. 22: 654
67. doi:10.1089/scd.2012.0181. PMID 22994322.
eisenberg, leonard (2015). Inhibition of G9a Histone
Methyltransferase Converts Bone Marrow Mesenchymal
Stem Cells to Cardiac Competent Progenitors.. stem cell
international. 2015: 270428. doi:10.1155/2015/270428.
PMID 26089912.
Science-Based Medicine.
Haque FN, Gottesman II, Wong AH (May 2009).
Not really identical: epigenetic dierences in
monozygotic twins and implications for twin
studies in psychiatry. American Journal of
Medical Genetics Part C. 151C (2): 13641.
doi:10.1002/ajmg.c.30206. PMID 19378334.
The Human Epigenome Project (HEP)
The Epigenome Network of Excellence (NoE)
Canadian Epigenetics, Environment and Health Re-
search Consortium (CEEHRC)
The Epigenome Network of Excellence (NoE)- pub-
lic international site
DNA Is Not Destiny Discover Magazine cover
story
BBC Horizon 2005 The Ghost In Your Genes
Epigenetics article at Hopkins Medicine
Towards a global map of epigenetic variation
5.4. CANCER EPIGENETICS 41

5.4 Cancer epigenetics

Cancer epigenetics is the study of epigenetic modi-
cations to the genome of cancer cells that do not in-
volve a change in the nucleotide sequence. Epigenetic
alterations are as important as genetic mutations in a
cells transformation to cancer, and their manipulation
holds great promise for cancer prevention, detection, and
therapy.[1][2] In dierent types of cancer, a variety of epi-
genetic mechanisms can be perturbed, such as silencing
of tumor suppressor genes and activation of oncogenes by
altered CpG island methylation patterns, histone modi-
cations, and dysregulation of DNA binding proteins. Sev-
eral medications which have epigenetic impact are now
used in several of these diseases. A DNA molecule fragment that is methylated at two cytosines

methylation prole is often inverted in cells that become

tumorigenic.[3] In normal cells, CpG islands preceding
gene promoters are generally unmethylated, and tend to
be transcriptionally active, while other individual CpG
dinucleotides throughout the genome tend to be methy-
lated. However, in cancer cells, CpG islands preceding
tumor suppressor gene promoters are often hypermethy-
lated, while CpG methylation of oncogene promoter re-
gions and parasitic repeat sequences is often decreased.[4]
Hypermethylation of tumor suppressor gene promoter re-
gions can result in silencing of those genes. This type of
epigenetic mutation allows cells to grow and reproduce
uncontrollably, leading to tumorigenesis.[3] Genes com-
monly found to be transcriptionally silenced due to pro-
moter hypermethylation include: Cyclin-dependent ki-
nase inhibitor p16, a cell-cycle inhibitor; MGMT, a DNA
repair gene; APC, a cell cycle regulator; MLH1, a DNA-
repair gene; and BRCA1, another DNA-repair gene.[3][5]
Indeed, cancer cells can become addicted to the tran-
Epigenetics patterns in a normal and cancer cells scriptional silencing, due to promoter hypermethylation,
of some key tumor suppressor genes, a process known as
epigenetic addiction[6]
Hypomethylation of CpG dinucleotides in other parts
normal tissue hyperplasia neoplasia

basement membrane invasion

of the genome leads to chromosome instability due to
5mC mechanisms such as loss of imprinting and reactivation
CpG-island methylation
of transposable elements.[7][8][9][10] Loss of imprinting
of insulin-like growth factor gene (IGF2) increases risk
altered histone modication pattern
of colorectal cancer and is associated with Beckwith-
Wiedemann syndrome which signicantly increases the
Epigenetic alterations in tumour progression risk of cancer for newborns.[11] In healthy cells, CpG
dinucleotides of lower densities are found within coding
and non-coding intergenic regions. Parasitic repetitive
5.4.1 Mechanisms sequences and centromeres are repressed through methy-
lation.
DNA methylation The entire genome of a cancerous cell contains sig-
nicantly less methylcytosine than the genome of a
In somatic cells, patterns of DNA methylation are in gen- healthy cell. In fact, cancer cell genomes have 20-
eral transmitted to daughter cells with high delity. How- 50% less methylation at individual CpG dinucleotides
ever, epigenetic DNA methylation diers between nor- across the genome.[7][8][9][10] In cancer cells global hy-
mal cells and tumor cells in humans. The normal CpG pomethylation due to disruption in DNA methyltrans-
42 CHAPTER 5. BEYOND MENDEL

ferases (DNMTs) may promote mitotic recombination BRD4 on acetylated histones, which has been shown to
and chromosome rearrangement, ultimately resulting in increase the expression of the Myc protein, implicated in
aneuploidy when the chromosomes fail to separate prop- several cancers. The development process of the drug to
erly during mitosis.[7][8][9][10] bind to BRD4 is noteworthy for the collaborative, open
[17]
CpG island methylation is important in regulation of gene approach the team is taking.
expression, yet cytosine methylation can lead directly to The tumor suppressor gene p53 regulates DNA repair and
destabilizing genetic mutations and a precancerous cel- can induce apoptosis in dysregulated cells. E Soto-Reyes
lular state. Methylated cytosines make hydrolysis of and F Recillas-Targa elucidated the importance of the
the amine group and spontaneous conversion to thymine CTCF protein in regulating p53 expression.[18] CTCF, or
more favorable. They can cause aberrant recruitment CCCTC binding factor, is a zinc nger protein that insu-
of chromatin proteins. Cytosine methylations change lates the p53 promoter from accumulating repressive hi-
the amount of UV light absorption of the nucleotide stone marks. In certain types of cancer cells, the CTCF
base, creating pyrimidine dimers. When mutation re- protein does not bind normally, and the p53 promoter ac-
sults in loss of heterozygosity at tumor suppressor gene cumulates repressive histone marks, causing p53 expres-
sites, these genes may become inactive. Single base pair sion to decrease.[18]
mutations during replication can also have detrimental Mutations in the epigenetic machinery itself may occur
eects.[5] as well, potentially responsible for the changing epige-
netic proles of cancerous cells. The histone variants of
the H2A family are highly conserved in mammals, play-
Histone modication
ing critical roles in regulating many nuclear processes by
altering chromatin structure. One of the key H2A vari-
Eukaryotic DNA has a complex structure. It is generally
ants, H2A.X, marks DNA damage, facilitating the re-
wrapped around special proteins called histones to form
cruitment of DNA repair proteins to restore genomic in-
a structure called a nucleosome. A nucleosome consists
tegrity. Another variant, H2A.Z, plays an important role
of 2 sets of 4 histones: H2A, H2B, H3, and H4. Addi-
in both gene activation and repression. A high level of
tionally, histone H1 contributes to DNA packaging out-
H2A.Z expression is detected in many cancers and is sig-
side of the nucleosome. Certain histone modifying en-
nicantly associated with cellular proliferation and ge-
zymes can add or remove functional groups to the his-
nomic instability.[4] Histone variant macroH2A1 is im-
tones, and these modications inuence the level of tran-
portant in the pathogenesis of many types of cancers, for
scription of the genes wrapped around those histones and
instance in hepatocellular carcinoma.[19] Other mecha-
the level of DNA replication. Histone modication pro-
nisms include a decrease in H4K16ac may be caused by
les of healthy and cancerous cells tend to dier.
either a decrease in activity of a histone acetyltransferases
In comparison to healthy cells, cancerous cells exhibit (HATs) or an increase in deacetylation by SIRT1.[3] Like-
decreased monoacetylated and trimethylated forms of wise, an inactivating frameshift mutation in HDAC2, a
histone H4 (decreased H4ac and H4me3).[12] Addition- histone deacetylase that acts on many histone-tail lysines,
ally, mouse models have shown that a decrease in hi- has been associated with cancers showing altered histone
stone H4R3 asymmetric dimethylation (H4R3me2a) of acetylation patterns.[20] These ndings indicate a promis-
the p19ARF promoter is correlated with more advanced ing mechanism for altering epigenetic proles through en-
cases of tumorigenesis and metastasis.[13] In mouse mod- zymatic inhibition or enhancement.
els, the loss of histone H4 acetylation and trimethylation
DNA damage, caused by UV light, ionizing radiation,
increases as tumor growth continues.[12] Interestingly,
environmental toxins, and metabolic chemicals, can also
loss of histone H4 Lysine 16 acetylation (H4K16ac),
lead to genomic instability and cancer. The DNA dam-
which is a mark of aging at the telomeres, specically
age response to double strand DNA breaks (DSB) is
loses its acetylation. Some scientists hope this partic-
mediated in part by histone modications. At a DSB,
ular loss of histone acetylation might be battled with a
MRE11-RAD50-NBS1 (MRN) protein complex recruits
histone deacetylase (HDAC) inhibitor specic for SIRT1,
ataxia telangiectasia mutated (ATM) kinase which phos-
an HDAC specic for H4K16.[3][14]
phorylates Serine 129 of Histone 2A. MDC1, mediator
Other histone marks associated with tumorigenesis in- of DNA damage checkpoint 1, binds to the phospho-
clude increased deacetylation (decreased acetylation) of peptide, and phosphorylation of H2AX may spread by
histones H3 and H4, decreased trimethylation of histone a positive feedback loop of MRN-ATM recruitment and
H3 Lysine 4 (H3K4me3), and increased monomethyla- phosphorylation. TIP60 acetylates the H2AX, which is
tion of histone H3 Lysine 9 (H3K9me) and trimethyla- then polyubiquitylated. RAP80, a subunit of the DNA
tion of histone H3 Lysine 27 (H3K27me3). These hi- repair breast cancer type 1 susceptibility protein com-
stone modications can silence tumor suppressor genes plex (BRCA1-A), binds ubiquitin attached to histones.
despite the drop in methylation of the genes CpG island BRCA1-A activity arrests the cell cycle at the G2/M
(an event that normally activates genes).[15][16] checkpoint, allowing time for DNA repair, or apoptosis
Some research has focused on blocking the action of may be initiated.[21]
5.4. CANCER EPIGENETICS
MicroRNA gene silencing
In mammals, microRNA (miRNA) regulates about
60% of the transcriptional activity of protein-encoding
genes.[22] Some miRNAs also undergo methylation-
associated silencing in cancer cells.[23][24] Let-7 and
miR15/16 play important roles in down-regulating RAS
and BCL2 oncogenes, and their silencing occurs in cancer
cells.[11] Decreased expression of miR-125b1, a miRNA
that functions as a tumor suppressor, was observed in
prostate, ovarian, breast and glial cell cancers. In vitro ex-
periments have shown that miR-125b1 targets two genes,
HER2/neu and ESR1, that are linked to breast cancer.
DNA methylation, specically hypermethylation, is one
of the main ways that the miR-125b1 is epigenetically
silenced. In patients with breast cancer, hypermethyla-
tion of CpG islands located proximal to the transcrip-
tion start site was observed. Loss of CTCF binding and
an increase in repressive histone marks, H3K9me3 and
H3K27me3, correlates with DNA methylation and miR-
125b1 silencing. Mechanistically, CTCF may function as
a boundary element to stop the spread of DNA methyla-
tion. Results from experiments conducted by Soto-Reyes
et al.[25] indicate a negative eect of methylation on the
function and expression of miR-125b1. Therefore, they
concluded that DNA methylation has a part in silenc-
ing the gene. Furthermore, some miRNAs are epige-
netically silenced early on in breast cancer, and there-
fore these miRNAs could potentially be useful as tumor
markers.[25] The epigenetic silencing of miRNA genes
by aberrant DNA methylation is frequent event in can-
cer cells; almost one third of miRNA promoters active in
normal mammary cells were found hypermethylated in
breast cancer cells - that is several fold greater proportion
than is usually observed for protein coding genes.[26]
See also: Cancer biomarkers Risk assessment
5.4.2 MicroRNA and DNA repair
DNA damage appears to be the primary underlying cause
of cancer.[27][28] If DNA repair is decient, DNA dam-
age tends to accumulate. Such excess DNA damage can
increase mutational errors during DNA replication due
to error-prone translesion synthesis. Excess DNA dam-
age can also increase epigenetic alterations due to errors
during DNA repair.[29][30] Such mutations and epigenetic
alterations can give rise to cancer (see malignant neo-
plasms).
Germ line mutations in DNA repair genes cause only 2
5% of colon cancer cases.[31] However, altered expression
of microRNAs, causing DNA repair deciencies, are fre-
quently associated with cancers and may be an important
causal factor for these cancers.
Over-expression of certain miRNAs may directly reduce neoplasias, including thyroid, prostatic, cervical, colorec-
expression of specic DNA repair proteins. Wan et al.[32]
43
referred to 6 DNA repair genes that are directly targeted
by the miRNAs indicated in parentheses: ATM (miR-
421), RAD52 (miR-210, miR-373), RAD23B (miR-
373), MSH2 (miR-21), BRCA1 (miR-182) and P53 (miR-
504, miR-125b). More recently, Tessitore et al.[33] listed
further DNA repair genes that are directly targeted by ad-
ditional miRNAs, including ATM (miR-18a, miR-101),
DNA-PK (miR-101), ATR (miR-185), Wip1 (miR-16),
MLH1, MSH2 and MSH6 (miR-155), ERCC3 and ERCC4
(miR-192) and UNG2 (mir-16, miR-34c and miR-199a).
Of these miRNAs, miR-16, miR-18a, miR-21, miR-
34c, miR-125b, miR-101, miR-155, miR-182, miR-185
and miR-192 are among those identied by Schneken-
burger and Diederich[34] as over-expressed in colon can-
cer through epigenetic hypomethylation. Over expression
of any one of these miRNAs can cause reduced expres-
sion of its target DNA repair gene.
Up to 15% of the MLH1-deciencies in sporadic
colon cancers appeared to be due to over-expression
of the microRNA miR-155, which represses MLH1
expression.[35] However, the majority of 68 sporadic
colon cancers with reduced expression of the DNA mis-
match repair protein MLH1 were found to be decient
due to epigenetic methylation of the CpG island of the
MLH1 gene.[36]
In 28% of glioblastomas, the MGMT DNA repair protein
is decient but the MGMT promoter is not methylated.[37]
In the glioblastomas without methylated MGMT promot-
ers, the level of microRNA miR-181d is inversely cor-
related with protein expression of MGMT and the direct
target of miR-181d is the MGMT mRNA 3UTR (the
three prime untranslated region of MGMT mRNA).[37]
Thus, in 28% of glioblastomas, increased expression of
miR-181d and reduced expression of DNA repair en-
zyme MGMT may be a causal factor. In 2966%[37][38]
of glioblastomas, DNA repair is decient due to epige-
netic methylation of the MGMT gene, which reduces pro-
tein expression of MGMT.
High mobility group A (HMGA) proteins, character-
ized by an AT-hook, are small, nonhistone, chromatin-
associated proteins that can modulate transcription. Mi-
croRNAs control the expression of HMGA proteins, and
these proteins (HMGA1 and HMGA2) are architectural
chromatin transcription-controlling elements. Palmieri
et al.[39] showed that, in normal tissues, HGMA1 and
HMGA2 genes are targeted (and thus strongly reduced in
expression) by miR-15, miR-16, miR-26a, miR-196a2
and Let-7a.
HMGA expression is almost undetectable in dierenti-
ated adult tissues but is elevated in many cancers. HGMA
proteins are polypeptides of ~100 amino acid residues
characterized by a modular sequence organization. These
proteins have three highly positively charged regions,
termed AT hooks, that bind the minor groove of AT-
rich DNA stretches in specic regions of DNA. Human
44 CHAPTER 5. BEYOND MENDEL

tal, pancreatic and ovarian carcinoma, show a strong in-

crease of HMGA1a and HMGA1b proteins.[40] Trans-
genic mice with HMGA1 targeted to lymphoid cells de-
velop aggressive lymphoma, showing that high HMGA1
expression is not only associated with cancers, but that the
HMGA1 gene can act as an oncogene to cause cancer.[41]
Baldassarre et al.,[42] showed that HMGA1 protein binds
to the promoter region of DNA repair gene BRCA1 and
inhibits BRCA1 promoter activity. They also showed that
while only 11% of breast tumors had hypermethylation of
the BRCA1 gene, 82% of aggressive breast cancers have
low BRCA1 protein expression, and most of these reduc-
tions were due to chromatin remodeling by high levels of
HMGA1 protein.
HMGA2 protein specically targets the promoter of
ERCC1, thus reducing expression of this DNA repair
gene.[43] ERCC1 protein expression was decient in
100% of 47 evaluated colon cancers (though the extent
to which HGMA2 was involved is unknown).[44]
Palmieri et al.[39] showed that each of the miRNAs that
target HMGA genes are drastically reduced in almost all
human pituitary adenomas studied, when compared with
the normal pituitary gland. Consistent with the down-
regulation of these HMGA-targeting miRNAs, an in- A chart of common DNA damaging agents, examples of lesions
crease in the HMGA1 and HMGA2-specic mRNAs was they cause in DNA, and pathways used to repair these lesions.
Also shown are many of the genes in these pathways, an indica-
observed. Three of these microRNAs (miR-16, miR-
tion of which genes are epigenetically regulated to have reduced
196a and Let-7a)[34][45] have methylated promoters and
(or increased) expression in various cancers. It also shows genes
therefore low expression in colon cancer. For two of in the error prone microhomology-mediated end joining pathway
these, miR-15 and miR-16, the coding regions are epi- with increased expression in various cancers.
genetically silenced in cancer due to histone deacetylase
activity.[46] When these microRNAs are expressed at a
low level, then HMGA1 and HMGA2 proteins are ex- Red-highlighted genes are frequently reduced or silenced
pressed at a high level. HMGA1 and HMGA2 target by epigenetic mechanisms in various cancers. When
(reduce expression of) BRCA1 and ERCC1 DNA repair these genes have low or absent expression, DNA dam-
genes. Thus DNA repair can be reduced, likely contribut- ages can accumulate. Replication errors past these dam-
ing to cancer progression.[28] ages (see translesion synthesis) can lead to increased mu-
tations and, ultimately, cancer. Epigenetic repression of
DNA repair genes in accurate DNA repair pathways ap-
5.4.3 DNA repair pathways pear to be central to carcinogenesis.
The two gray-highlighted genes RAD51 and BRCA2, are
The chart in this section shows some frequent DNA dam- required for homologous recombinational repair. They
aging agents, examples of DNA lesions they cause, and are sometimes epigenetically over-expressed and some-
the pathways that deal with these DNA damages. At least times under-expressed in certain cancers. As indicated
169 enzymes are either directly employed in DNA repair in the Wikipedia articles on RAD51 and BRCA2, such
or inuence DNA repair processes.[47] Of these, 83 are cancers ordinarily have epigenetic deciencies in other
directly employed in repairing the 5 types of DNA dam- DNA repair genes. These repair deciencies would likely
ages illustrated in the chart. cause increased unrepaired DNA damages. The over-
Some of the more well studied genes central to these re- expression of RAD51 and BRCA2 seen in these cancers
pair processes are shown in the chart. The gene desig- may reect selective pressures for compensatory RAD51
nations shown in red, gray or cyan indicate genes fre- or BRCA2 over-expression and increased homologous re-
quently epigenetically altered in various types of can- combinational repair to at least partially deal with such
cers. Wikipedia articles on each of the genes high-lighted excess DNA damages. In those cases where RAD51 or
by red, gray or cyan describe the epigenetic alteration(s) BRCA2 are under-expressed, this would itself lead to in-
and the cancer(s) in which these epimutations are found. creased unrepaired DNA damages. Replication errors
Three review articles,[48][49][50] and two broad experi- past these damages (see translesion synthesis) could cause
mental survey articles[51][52] also document most of these increased mutations and cancer, so that under-expression
epigenetic DNA repair deciencies in cancers. of RAD51 or BRCA2 would be carcinogenic in itself.
5.4. CANCER EPIGENETICS 45

Cyan-highlighted genes are in the microhomology- of interest, and the frequency shown is the frequency with
mediated end joining (MMEJ) pathway and are up- which the cancers had an epigenetic deciency of gene
regulated in cancer. MMEJ is an additional error-prone expression. Such epigenetic deciencies likely arise early
inaccurate repair pathway for double-strand breaks. In in carcinogenesis, since they are also frequently found
MMEJ repair of a double-strand break, an homology (though at somewhat lower frequency) in the eld defect
of 5-25 complementary base pairs between both paired surrounding the cancer from which the cancer likely arose
strands is sucient to align the strands, but mismatched (see Table).
ends (aps) are usually present. MMEJ removes the ex- It appears that cancers may frequently be initiated by an
tra nucleotides (aps) where strands are joined, and then
epigenetic reduction in expression of one or more DNA
ligates the strands to create an intact DNA double helix. repair enzymes. Reduced DNA repair likely allows accu-
MMEJ almost always involves at least a small deletion, so
mulation of DNA damages. Error prone translesion syn-
that it is a mutagenic pathway.[53] FEN1, the ap endonu- thesis past some of these DNA damages may give rise to a
clease in MMEJ, is epigenetically increased by promoter
mutation with a selective advantage. A clonal patch with a
hypomethylation and is over-expressed in the majority selective advantage may grow and out-compete neighbor-
of cancers of the breast,[54] prostate,[55] stomach,[56][57]
ing cells, forming a eld defect. While there is no obvious
neuroblastomas,[58] pancreas,[59] and lung.[60] PARP1 is selective advantage for a cell to have reduced DNA repair,
also over-expressed when its promoter region ETS site the epimutation of the DNA repair gene may be carried
is epigenetically hypomethylated, and this contributes along as a passenger when the cells with the selectively
to progression to endometrial cancer,[61] BRCA-mutated advantageous mutation are replicated. In the cells car-
ovarian cancer,[62] and BRCA-mutated serous ovarian rying both the epimutation of the DNA repair gene and
cancer.[63] Other genes in the MMEJ pathway are also the mutation with the selective advantage, further DNA
over-expressed in a number of cancers (see MMEJ for damages will accumulate, and these could, in turn, give
summary), and are also shown in blue. rise to further mutations with still greater selective advan-
tages. Epigenetic defects in DNA repair may thus con-
Frequencies of epimutations in DNA repair genes tribute to the characteristic high frequency of mutations
in the genomes of cancers, and cause their carcinogenic
Deciencies in DNA repair proteins that function in accu- progression.
rate DNA repair pathways increase the risk of mutation. Cancers have high levels of genome instability, associated
Mutation rates are strongly increased in cells with mu- with a high frequency of mutations. A high frequency of
tations in DNA mismatch repair[64][65] or in homologous genomic mutations increases the likelihood of particular
recombinational repair (HRR).[66] Individuals with inher- mutations occurring that activate oncogenes and inacti-
ited mutations in any of 34 DNA repair genes are at in- vate tumor suppressor genes, leading to carcinogenesis.
creased risk of cancer (see DNA repair defects and in- On the basis of whole genome sequencing, cancers are
creased cancer risk). found to have thousands to hundreds of thousands of mu-
[79]
In sporadic cancers, a deciency in DNA repair is oc- tations in their whole genomes. (Also see Mutation
casionally found to be due to a mutation in a DNA re- frequencies in cancers.) By comparison, the mutation
pair gene, but much more frequently reduced or absent frequency in the whole genome between generations for
expression of DNA repair genes is due to epigenetic al- humans (parent to child) is about 70 new mutations per
[80][81]
terations that reduce or silence gene expression. For ex- generation. In the protein coding regions of the
ample, for 113 colorectal cancers examined in sequence, genome, there are only about 0.35 mutations between
only four had a missense mutation in the DNA repair parent/child generations (less than one mutated protein
[82]
gene MGMT, while the majority had reduced MGMT ex- per generation). Whole genome sequencing in blood
pression due to methylation of the MGMT promoter re- cells for a pair of identical twin 100-year-old centenarians
gion (an epigenetic alteration).[67]
Similarly, out of 119 only found 8 somatic dierences, though somatic varia-
cases of mismatch repair-decient colorectal cancers that tion occurring in less than 20% of blood cells would be
[83]
lacked DNA repair gene PMS2 expression, PMS2 protein undetected.
was decient in 6 due to mutations in the PMS2 gene, While DNA damages may give rise to mutations through
while in 103 cases PMS2 expression was decient be- error prone translesion synthesis, DNA damages can also
cause its pairing partner MLH1 was repressed due to give rise to epigenetic alterations during faulty DNA re-
promoter methylation (PMS2 protein is unstable in the pair processes.[29][30][84][85] The DNA damages that ac-
absence of MLH1).[68] In the other 10 cases, loss of cumulate due to epigenetic DNA repair defects can be
PMS2 expression was likely due to epigenetic overexpres-a source of the increased epigenetic alterations found in
sion of the microRNA, miR-155, which down-regulates many genes in cancers. In an early study, looking at a lim-
MLH1.[69] ited set of transcriptional promoters, Fernandez et al.[86]
Epigenetic defects in DNA repair genes are frequent in examined the DNA methylation proles of 855 primary
cancers. In the Table, multiple cancers were evaluated tumors. Comparing each tumor type with its correspond-
for reduced or absent expression of the DNA repair gene ing normal tissue, 729 CpG island sites (55% of the 1322
46 CHAPTER 5. BEYOND MENDEL

CpG sites evaluated) showed dierential DNA methy- and lifestyle changes.[97]
lation. Of these sites, 496 were hypermethylated (re-
pressed) and 233 were hypomethylated (activated). Thus,
there is a high level of epigenetic promoter methylation Cervical cancer
alterations in tumors. Some of these epigenetic alter-
ations may contribute to cancer progression. The second most common malignant tumor in women is
invasive cervical cancer (ICC) and more than 50% of all
invasive cervical cancer (ICC) is caused by oncongenic
5.4.4 Epigenetic carcinogens human papillomavirus 16 (HPV16).[98] Furthermore,
cervix intraepithelial neoplasia (CIN) is primarily caused
[98]
A variety of compounds are considered as epigenetic by oncogenic HPV16. As in many cases, the causative
carcinogensthey result in an increased incidence of tu- factor for cancer does not always take a direct route from
mors, but they do not show mutagen activity (toxic com- infection to the development of cancer. Genomic methy-
pounds or pathogens that cause tumors incident to in- lation patterns have been associated with invasive cervical
creased regeneration should also be excluded). Examples cancer. Within the HPV16L1 region, 14 tested CpG sites
include diethylstilbestrol, arsenite, hexachlorobenzene, have signicantly higher methylation in CIN3+ than in
[98]
and nickel compounds. HPV16 genomes of women without CIN3. Only 2/16
CpG sites tested in HPV16 upstream regulatory region
Many teratogens exert specic eects on the fetus by epi- were found to have association with increased methyla-
genetic mechanisms.[87][88] While epigenetic eects may tion in CIN3+.[98] This suggests that the direct route from
preserve the eect of a teratogen such as diethylstilbestrol infection to cancer is sometimes detoured to a precancer-
throughout the life of an aected child, the possibility of ous state in cervix intraepithelial neoplasia. Additionally,
birth defects resulting from exposure of fathers or in sec- increased CpG site methylation was found in low levels in
ond and succeeding generations of ospring has gener- most of the ve host nuclear genes studied, including 5/5
ally been rejected on theoretical grounds and for lack of TERT, 1/4 DAPK1, 2/5 RARB, MAL, and CADM1.[98]
evidence.[89] However, a range of male-mediated abnor- Furthermore, 1/3 of CpG sites in mitochondrial DNA
malities have been demonstrated, and more are likely to were associated with increased methylation in CIN3+.[98]
exist.[90] FDA label information for Vidaza, a formula- Thus, a correlation exists between CIN3+ and increased
tion of 5-azacitidine (an unmethylatable analog of cyti- methylation of CpG sites in the HPV16 L1 open read-
dine that causes hypomethylation when incorporated into ing frame.[98] This could be a potential biomarker for
DNA) states that men should be advised not to father future screens of cancerous and precancerous cervical
a child while using the drug, citing evidence in treated disease.[98]
male mice of reduced fertility, increased embryo loss,
and abnormal embryo development.[91] In rats, endocrine
dierences were observed in ospring of males exposed Leukemia
to morphine.[92] In mice, second generation eects of di-
ethylstilbesterol have been described occurring by epige- Recent studies have shown that the mixed-lineage
netic mechanisms.[93] leukemia (MLL) gene causes leukemia by rearranging
and fusing with other genes in dierent chromosomes,
which is a process under epigenetic control.[99]
5.4.5 Cancer subtypes

Prostate cancer Sarcoma

Prostate cancer kills around 35,000 men yearly, and
about 220,000 men are diagnosed with prostate cancer
per year, in North America alone.[94] Prostate cancer is
the second leading cause of cancer-caused fatalities in
men, and within a mans lifetime, one in six men will
have the disease.[94] Alterations in histone acetylation
and DNA methylation occur in various genes inuenc-
ing prostate cancer.[95] More than 90% of prostate can-
cers show gene silencing by CpG island hypermethyla-
tion of the GSTP1 gene promoter, which protects prostate
cells from genomic damage that is caused by dier-
ent oxidants or carcinogens.[96] Real-time methylation-
specic polymerase chain reaction (PCR) suggests that
many other genes are also hypermethylated.[96] Gene ex-
pression in the prostate may be modulated by nutrition
They are about 15,000 new cases of sarcoma in the US
each year, and about 6,200 people were projected to die
of sarcoma in the US in 2014.[100] Sarcomas comprise
a large number of rare, histogenetically heterogeneous
mesenchymal tumors that for example include chon-
drosarcoma, Ewings sarcoma, leiomyosarcoma, liposar-
coma, osteosarcoma, synovial sarcoma, and (alveolar
and embryonal) rhabdomyosarcoma. Several oncogenes
and tumor suppressor genes are epigenetically altered in
sarcomas. These include APC, CDKN1A, CDKN2A,
CDKN2B, Ezrin, FGFR1, GADD45A, MGMT, STK3,
STK4, PTEN, RASSF1A, WIF1, as well as several
miRNAs.[101] Expression of epigenetic modiers such as
that of the BMI1 component of the PRC1 complex is
deregulated in chondrosarcoma, Ewings sarcoma, and
5.4. CANCER EPIGENETICS 47

osteosarcoma, and expression of the EZH2 component 5.4.7 Diagnosis and prognosis
of the PRC2 complex is altered in Ewings sarcoma and
rhabdomyosarcoma. Similarly, expression of another Researchers are hoping to identify specic epigenetic
epigenetic modier, the LSD1 histone demethylase, is in- proles of various types and subtypes of cancer with the
creased in chondrosarcoma, Ewings sarcoma, osteosar- goal of using these proles as tools to diagnose individu-
coma, and rhabdomyosarcoma. Drug targeting and inhi- als more specically and accurately.[3] Since epigenetic
bition of EZH2 in Ewings sarcoma,[102] or of LSD1 in proles change, scientists would like to use the dier-
several sarcomas,[103] inhibits tumor cell growth in theseent epigenomic proles to determine the stage of devel-
sarcomas. opment or level of aggressiveness of a particular cancer
in patients. For example, hypermethylation of the genes
coding for Death-Associated Protein Kinase (DAPK),
5.4.6 Identication methods p16, and Epithelial Membrane Protein 3 (EMP3) have
been linked to more aggressive forms of lung, colorectal,
[10]
Previously, epigenetic proles were limited to individual and brain cancers. This type of knowledge can aect
genes under scrutiny by a particular research team. Re- the way that doctors will diagnose and choose to treat
cently, however, scientists have been moving toward a their patients.
more genomic approach to determine an entire genomic Another factor that will inuence the treatment of pa-
prole for cancerous versus healthy cells.[3] tients is knowing how well they will respond to certain
Popular approaches for measuring CpG methylation in treatments. Personalized epigenomic proles of cancer-
cells include: ous cells can provide insight into this eld. For ex-
ample, MGMT is an enzyme that reverses the addition
of alkyl groups to the nucleotide guanine.[104] Alkylat-
Bisulte sequencing ing guanine, however, is the mechanism by which sev-
eral chemotherapeutic drugs act in order to disrupt DNA
Combined bisulte restriction analysis (COBRA) and cause cell death.[105][106][107][108] Therefore, if the
gene encoding MGMT in cancer cells is hypermethylated
MethyLight and in eect silenced or repressed, the chemotherapeutic
drugs that act by methylating guanine will be more ef-
Pyrosequencing fective than in cancer cells that have a functional MGMT
enzyme.
Restriction landmark genomic scanning
Epigenetic biomarkers can also be utilized as tools for
molecular prognosis. In primary tumor and mediastinal
Arbitrary primed PCR
lymph node biopsy samples, hypermethylation of both
CDKN2A and CDH13 serves as the marker for increased
HELP assay (HpaII tiny fragment enrichment by
risk of faster cancer relapse and higher death rate of
ligation-mediated PCR)
patients.[109]
Chromatin immunoprecipitation ChIP-Chip using
antibodies specic for methyl-CpG binding domain 5.4.8 Treatment
proteins
Epigenetic control of the proto-onco regions and the
Methylated DNA immunoprecipitation Methyl-DIP tumor suppressor sequences by conformational changes
in histones plays a role in the formation and progres-
Gene-expression proles via DNA microarray : sion of cancer.[110] Pharmaceuticals that reverse epi-
comparing mRNA levels from cancer cell lines be- genetic changes might have a role in a variety of
fore and after treatment with a demethylating agent cancers.[95][110][111]
Recently, it is evidently known that associations between
Since bisulte sequencing is considered the gold standard specic cancer histotypes and epigenetic changes can
for measuring CpG methylation, when one of the other facilitate the development of novel epi-drugs.[112] Drug
methods is used, results are usually conrmed using bisul- development has focused mainly on modifying DNA
te sequencing[1]. Popular approaches for determining methyltransferase, histone acetyltransferase (HAT) and
histone modication proles in cancerous versus healthy histone deacetylase (HDAC).[113]
cells include:[3]
Drugs that specically target the inverted methy-
lation pattern of cancerous cells include the DNA
Mass spectrometry methyltransferase inhibitors azacitidine[114][115] and
decitabine.[116][117] These hypomethylating agents are
Chromatin Immunoprecipitation Assay used to treat myelodysplastic syndrome,[118] a blood
48
NH2
N N
HO N O
O [5] Jones PA, Baylin SB (June 2002). The fundamental role
OH
decitabine
cancer produced by abnormal bone marrow stem cells.[5]
These agents inhibit all three types of active DNA
methyltransferases, and had been thought to be highly
toxic, but proved to be eective when used in low dosage,
reducing progression of myelodysplastic syndrome to
leukemia.[119]
Histone deacetylase (HDAC) inhibitors show ecacy in
treatment of T cell lymphoma. two HDAC inhibitors, [9] Egger G, Liang G, Aparicio A, Jones PA (May
vorinostat and romidepsin, have been approved by the
[120][121]
Food and Drug Administration. However, since
these HDAC inhibitors alter the acetylation state of many
proteins in addition to the histone of interest, knowl-
edge of the underlying mechanism at the molecular level [10] Esteller M (2005).
of patient response is required to enhance the eciency
[11]
of using such inhibitors as treatment. Treatment with
HDAC inhibitors has been found to promote gene re-
activation after DNA methyl-transferases inhibitors have
[122]
repressed transcription. Panobinostat is approved for [11] Baylin SB, Jones PA (October 2011). A decade of ex-
certain situations in myeloma.[123]
Other pharmaceutical targets in research are histone
lysine methyltransferases (KMT) and protein arginine
methyltransferases (PRMT). [124]
Preclinical study has
suggested that lunasin may have potentially benecial epi- [12] Fraga MF, Ballestar E, Villar-Garea A, et al. (April
genetic eects.[125]
5.4.9 References
[1] Novak, Kris (20 December 2004). Epigenetics Changes
in Cancer Cells. Medscape General Medicine. 6 (4): 17.
PMC 1480584 . PMID 15775844.
[2] Banno K, Kisu I, Yanokura M, Tsuji K, Masuda K,
Ueki A, Kobayashi Y, Yamagami W, Nomura H, Tom-
inaga E, Susumu N, Aoki D (2012). Epimutation and
CHAPTER 5. BEYOND MENDEL
cancer: a new carcinogenic mechanism of Lynch syn-
drome (Review)". Int. J. Oncol. 41 (3): 7937.
doi:10.3892/ijo.2012.1528. PMC 3582986 . PMID
22735547.
[3] Esteller M (April 2007). Cancer epigenomics: DNA
methylomes and histone-modication maps. Nature Re-
views Genetics. 8 (4): 28698. doi:10.1038/nrg2005.
PMID 17339880.
[4] Wong NC, Craig JM (2011). Epigenetics: A Reference
Manual. Norfolk, England: Caister Academic Press.
ISBN 1-904455-88-3.
of epigenetic events in cancer. Nature Reviews Genetics.
3 (6): 41528. doi:10.1038/nrg816. PMID 12042769.
[6] De Carvalho DD, Sharma S, You JS, Su SF, Taberlay PC,
Kelly TK, Yang X, Liang G, Jones PA (2012). DNA
methylation screening identies driver epigenetic events
of cancer cell survival.. Cancer Cell. 21 (5): 65567.
doi:10.1016/j.ccr.2012.03.045. PMC 3395886 . PMID
22624715.
[7] Herman JG, Baylin SB (November 2003). Gene silenc-
ing in cancer in association with promoter hypermethy-
lation. The New England Journal of Medicine. 349
(21): 204254. doi:10.1056/NEJMra023075. PMID
14627790.
[8] Feinberg AP, Tycko B (February 2004). The history of
cancer epigenetics. Nature Reviews: Cancer. 4 (2): 143
53. doi:10.1038/nrc1279. PMID 14732866.
2004). Epigenetics in human disease and
prospects for epigenetic therapy. Nature. 429
(6990): 45763. Bibcode:2004Natur.429..457E.
doi:10.1038/nature02625. PMID 15164071.
Aberrant DNA methylation
as a cancer-inducing mechanism. Annual Review
of Pharmacology and Toxicology. 45: 62956.
doi:10.1146/annurev.pharmtox.45.120403.095832.
PMID 15822191.
ploring the cancer epigenome - biological and transla-
tional implications. Nature Reviews: Cancer. 11 (10):
72634. doi:10.1038/nrc3130. PMC 3307543 . PMID
21941284.
2005). Loss of acetylation at Lys16 and trimethyla-
tion at Lys20 of histone H4 is a common hallmark of
human cancer. Nature Genetics. 37 (4): 391400.
doi:10.1038/ng1531. PMID 15765097.
[13] Aprelikova O, Chen K, El Touny LH, Brignatz-Guittard
C, Han J, Qiu T, Yang HH, Lee MP, Zhu M, Green
JE (Apr 2016). The epigenetic modier JMJD6 is
amplied in mammary tumors and cooperates with c-
Myc to enhance cellular transformation, tumor pro-
gression, and metastasis. Clin Epigenetics. 8 (38).
doi:10.1186/s13148-016-0205-6.
5.4. CANCER EPIGENETICS
[14] Dang W, Steen KK, Perry R, et al. (June
2009). Histone H4 lysine 16 acetylation
regulates cellular lifespan. Nature. 459
(7248): 8027. Bibcode:2009Natur.459..802D.
doi:10.1038/nature08085. PMC 2702157 . PMID
19516333.
[15] Vir E, Brenner C, Deplus R, et al. (February
2006). The Polycomb group protein EZH2 di-
rectly controls DNA methylation. Nature. 439
(7078): 8714. Bibcode:2006Natur.439..871V.
doi:10.1038/nature04431. PMID 16357870.
[16] Richon VM, Sandho TW, Rifkind RA, Marks PA
(August 2000). Histone deacetylase inhibitor selec-
tively induces p21WAF1 expression and gene-associated
histone acetylation. Proceedings of the National
Academy of Sciences of the United States of America.
97 (18): 100149. Bibcode:2000PNAS...9710014R.
doi:10.1073/pnas.180316197. JSTOR 123305. PMC
27656 . PMID 10954755.
[17] Maxmen, Amy (August 2012). Cancer re-
search: Open ambition. Nature. 488: 14850.
Bibcode:2012Natur.488..148M. doi:10.1038/488148a.
[18] Soto-Reyes E, Recillas-Targa F (April 2010). Epigenetic
regulation of the human p53 gene promoter by the CTCF
transcription factor in transformed cell lines. Oncogene.
29 (15): 221727. doi:10.1038/onc.2009.509. PMID
20101205.
[19] Rappa F, Greco A, Podrini C, Cappello F, Foti
M, Bourgoin L, Peyrou M, Marino A, Scibetta N,
Williams R, Mazzoccoli G, Federici M, Pazienza V,
Vinciguerra M (2013). Folli F, ed. Immunopositivity
for histone macroH2A1 isoforms marks steatosis-
associated hepatocellular carcinoma. PLoS ONE.
8 (1): e54458. Bibcode:2013PLoSO...854458R.
doi:10.1371/journal.pone.0054458. PMC 3553099 .
PMID 23372727.
[20] Ropero S, Fraga MF, Ballestar E, et al. (May 2006). A
truncating mutation of HDAC2 in human cancers con-
fers resistance to histone deacetylase inhibition. Nature
Genetics. 38 (5): 5669. doi:10.1038/ng1773. PMID
16642021.
[21] van Attikum H, Gasser SM (May 2009). Crosstalk
between histone modications during the DNA damage
response. Trends in Cell Biology. 19 (5): 20717.
doi:10.1016/j.tcb.2009.03.001. PMID 19342239.
[22] Friedman, RC; Farh, KK; Burge, CB; Bartel, DP (Jan-
uary 2009). Most mammalian mRNAs are conserved
targets of microRNAs. Genome Res. 19 (1): 92105.
doi:10.1101/gr.082701.108. PMC 2612969 . PMID
18955434.
[23] Saito Y, Liang G, Egger G, et al. (June 2006). Spe-
cic activation of microRNA-127 with downregulation of
the proto-oncogene BCL6 by chromatin-modifying drugs
in human cancer cells. Cancer Cell. 9 (6): 43543.
doi:10.1016/j.ccr.2006.04.020. PMID 16766263.
49
[24] Lujambio A, Ropero S, Ballestar E, et al. (February
2007). Genetic unmasking of an epigenetically silenced
microRNA in human cancer cells. Cancer Research.
67 (4): 14249. doi:10.1158/0008-5472.CAN-06-4218.
PMID 17308079.
[25] Soto-Reyes E, Gonzlez-Barrios R, Cisneros-Soberanis F,
et al. (2012). Disruption of CTCF at the miR-125b1
locus in gynecological cancers. BMC Cancer. 12: 40.
doi:10.1186/1471-2407-12-40. PMC 3297514 . PMID
22277129.
[26] Vrba, L; Muoz-Rodrguez, JL; Stampfer, MR; Futscher,
BW (2013). miRNA Gene Promoters Are Fre-
quent Targets of Aberrant DNA Methylation in Hu-
man Breast Cancer.. PLOS ONE. 8 (1): e54398.
doi:10.1371/journal.pone.0054398. PMC 3547033 .
PMID 23342147.
[27] Kastan MB (2008). DNA damage responses: mecha-
nisms and roles in human disease: 2007 G.H.A. Clowes
Memorial Award Lecture. Mol. Cancer Res. 6 (4):
51724. doi:10.1158/1541-7786.MCR-08-0020. PMID
18403632.
[28] Bernstein, C; Prasad, AR; Nfonsam, V; Bernstein, H.
(2013). Chapter 16: DNA Damage, DNA Repair and
Cancer. In Chen, Clark. New Research Directions in
DNA Repair,. p. 413. ISBN 978-953-51-1114-6.
[29] O'Hagan HM, Mohammad HP, Baylin SB (2008).
Double strand breaks can initiate gene silencing and
SIRT1-dependent onset of DNA methylation in an ex-
ogenous promoter CpG island. PLoS Genetics. 4 (8):
e1000155. doi:10.1371/journal.pgen.1000155. PMC
2491723 . PMID 18704159.
[30] Cuozzo C, Porcellini A, Angrisano T, et al. (July
2007). DNA damage, homology-directed repair, and
DNA methylation. PLoS Genetics. 3 (7): e110.
doi:10.1371/journal.pgen.0030110. PMC 1913100 .
PMID 17616978.
[31] Jasperson KW, Tuohy TM, Neklason DW, Burt
RW (2010). Hereditary and familial colon can-
cer. Gastroenterology. 138 (6): 20442058.
doi:10.1053/j.gastro.2010.01.054. PMID 20420945.
[32] Wan G, Mathur R, Hu X, Zhang X, Lu X (Septem-
ber 2011). miRNA response to DNA dam-
age. Trends Biochem. Sci. 36 (9): 47884.
doi:10.1016/j.tibs.2011.06.002. PMC 3532742 .
PMID 21741842.
[33] Tessitore A, Cicciarelli G, Del Vecchio F, Gaggiano A,
Verzella D, Fischietti M, Vecchiotti D, Capece D, Zazze-
roni F, Alesse E (2014). MicroRNAs in the DNA Dam-
age/Repair Network and Cancer. Int J Genomics. 2014:
820248. doi:10.1155/2014/820248. PMC 3926391 .
PMID 24616890.
[34] Schnekenburger M, Diederich M (March 2012).
Epigenetics Oer New Horizons for Colorectal Cancer
Prevention. Curr Colorectal Cancer Rep. 8 (1): 6681.
doi:10.1007/s11888-011-0116-z. PMC 3277709 .
PMID 22389639.
50
[35] Valeri N, Gasparini P, Fabbri M, et al. (April 2010).
Modulation of mismatch repair and genomic stabil-
ity by miR-155. Proc. Natl. Acad. Sci. U.S.A.
107 (15): 69827. Bibcode:2010PNAS..107.6982V.
doi:10.1073/pnas.1002472107. JSTOR 25665289. PMC
2872463 . PMID 20351277.
[36] Truninger K, Menigatti M, Luz J, et al. (May 2005).
Immunohistochemical analysis reveals high frequency of
PMS2 defects in colorectal cancer. Gastroenterology.
128 (5): 116071. doi:10.1053/j.gastro.2005.01.056.
PMID 15887099.
[37] Zhang W, Zhang J, Hoadley K, et al. (June 2012). miR-
181d: a predictive glioblastoma biomarker that downreg-
ulates MGMT expression. Neuro-oncology. 14 (6): 712
9. doi:10.1093/neuonc/nos089. PMC 3367855 . PMID
22570426.
[38] Spiegl-Kreinecker S, Pirker C, Filipits M, et al. (Jan-
uary 2010). O6-Methylguanine DNA methyltransferase
protein expression in tumor cells predicts outcome of
temozolomide therapy in glioblastoma patients. Neuro-
oncology. 12 (1): 2836. doi:10.1093/neuonc/nop003.
PMC 2940563 . PMID 20150365.
[39] Palmieri D, D'Angelo D, Valentino T, et al. (Au-
gust 2012). Downregulation of HMGA-targeting
microRNAs has a critical role in human pituitary
tumorigenesis. Oncogene. 31 (34): 385765.
doi:10.1038/onc.2011.557. PMID 22139073.
[40] Sgarra R, Rustighi A, Tessari MA, et al. (September
2004). Nuclear phosphoproteins HMGA and their re-
lationship with chromatin structure and cancer. FEBS
Lett. 574 (13): 18. doi:10.1016/j.febslet.2004.08.013.
PMID 15358530.
[41] Xu Y, Sumter TF, Bhattacharya R, et al. (May 2004).
The HMG-I oncogene causes highly penetrant, aggres-
sive lymphoid malignancy in transgenic mice and is over-
expressed in human leukemia. Cancer Res. 64 (10):
33715. doi:10.1158/0008-5472.CAN-04-0044. PMID
15150086.
[42] Baldassarre G, Battista S, Belletti B, et al. (April
2003). Negative regulation of BRCA1 gene expression
by HMGA1 proteins accounts for the reduced BRCA1
protein levels in sporadic breast carcinoma. Mol. Cell.
Biol. 23 (7): 222538. doi:10.1128/MCB.23.7.2225-
2238.2003. PMC 150734 . PMID 12640109.
[43] Borrmann L, Schwanbeck R, Heyduk T, et al. (December
2003). High mobility group A2 protein and its deriva-
tives bind a specic region of the promoter of DNA repair
gene ERCC1 and modulate its activity. Nucleic Acids
Res. 31 (23): 684151. doi:10.1093/nar/gkg884. PMC
290254 . PMID 14627817.
[44] Facista A, Nguyen H, Lewis C, et al. (2012). Decient
expression of DNA repair enzymes in early progression
to sporadic colon cancer. Genome Integrity. 3 (1): 3.
doi:10.1186/2041-9414-3-3. PMC 3351028 . PMID
22494821.
CHAPTER 5. BEYOND MENDEL
[45] Malumbres M (2013). miRNAs and cancer: an epi-
genetics view. Mol. Aspects Med. 34 (4): 86374.
doi:10.1016/j.mam.2012.06.005. PMID 22771542.
[46] Sampath D, Liu C, Vasan K, et al. (February 2012).
Histone deacetylases mediate the silencing of miR-15a,
miR-16, and miR-29b in chronic lymphocytic leukemia.
Blood. 119 (5): 116272. doi:10.1182/blood-2011-05-
351510. PMC 3277352 . PMID 22096249.
[47] Human DNA Repair Genes, 15 April 2014, MD Ander-
son Cancer Center, University of Texas
[48] Carol Bernstein and Harris Bernstein (2015). Epigenetic
Reduction of DNA Repair in Progression to Cancer,
Advances in DNA Repair, Prof. Clark Chen (Ed.),
ISBN 978-953-51-2209-8, InTech, Available from: http:
//www.intechopen.com/books/advances-in-dna-repair/
epigenetic-reduction-of-dna-repair-in-progression-to-cancer
[49] Bernstein C, Prasad AR, Nfonsam V, Bernstein H. (2013).
"Chapter 16: DNA Damage, DNA Repair and Cancer".
New Research Directions in DNA Repair. Prof. Clark
Chen (ed.), ISBN 978-953-51-1114-6, InTechOpen.com.
[50] Xinrong Chen and Tao Chen (2011). "Chapter 18: Roles
of MicroRNA in DNA Damage and Repair", DNA Repair,
Inna Kruman (ed.), ISBN 978-953-307-697-3, InTech.
[51] Krishnan K, Steptoe AL, Martin HC, et al. (Febru-
ary 2013). MicroRNA-182-5p targets a network of
genes involved in DNA repair. RNA. 19 (2): 23042.
doi:10.1261/rna.034926.112. PMC 3543090 . PMID
23249749.
[52] Chaisaingmongkol J, Popanda O, Warta R, et al. (De-
cember 2012). Epigenetic screen of human DNA repair
genes identies aberrant promoter methylation of NEIL1
in head and neck squamous cell carcinoma. Oncogene.
31 (49): 510816. doi:10.1038/onc.2011.660. PMID
22286769.
[53] Liang L, Deng L, Chen Y, Li GC, Shao C, Tischeld
JA (2005). Modulation of DNA end joining by nu-
clear proteins. J. Biol. Chem. 280 (36): 314429.
doi:10.1074/jbc.M503776200. PMID 16012167.
[54] Singh P, Yang M, Dai H, Yu D, Huang Q, Tan W,
Kernstine KH, Lin D, Shen B (2008). Overexpression
and hypomethylation of ap endonuclease 1 gene in
breast and other cancers. Mol. Cancer Res. 6 (11):
17107. doi:10.1158/1541-7786.MCR-08-0269. PMC
2948671 . PMID 19010819.
[55] Lam JS, Seligson DB, Yu H, Li A, Eeva M, Pantuck
AJ, Zeng G, Horvath S, Belldegrun AS (2006). Flap
endonuclease 1 is overexpressed in prostate cancer and
is associated with a high Gleason score. BJU Int. 98
(2): 44551. doi:10.1111/j.1464-410X.2006.06224.x.
PMID 16879693.
[56] Kim JM, Sohn HY, Yoon SY, Oh JH, Yang JO, Kim
JH, Song KS, Rho SM, Yoo HS, Yoo HS, Kim YS, Kim
JG, Kim NS (2005). Identication of gastric cancer-
related genes using a cDNA microarray containing novel
expressed sequence tags expressed in gastric cancer cells.
Clin. Cancer Res. 11 (2 Pt 1): 47382. PMID 15701830.
5.4. CANCER EPIGENETICS
[57] Wang K, Xie C, Chen D (2014). Flap endonuclease 1 is
a promising candidate biomarker in gastric cancer and is
involved in cell proliferation and apoptosis. Int. J. Mol.
Med. 33 (5): 126874. doi:10.3892/ijmm.2014.1682.
PMID 24590400.
[58] Krause A, Combaret V, Iacono I, Lacroix B, Com-
pagnon C, Bergeron C, Valsesia-Wittmann S, Leissner
P, Mougin B, Puisieux A (2005). Genome-wide anal-
ysis of gene expression in neuroblastomas detected by
mass screening. Cancer Lett. 225 (1): 11120.
doi:10.1016/j.canlet.2004.10.035. PMID 15922863.
[59] Iacobuzio-Donahue CA, Maitra A, Olsen M, Lowe AW,
van Heek NT, Rosty C, Walter K, Sato N, Parker A, Ash-
faq R, Jaee E, Ryu B, Jones J, Eshleman JR, Yeo CJ,
Cameron JL, Kern SE, Hruban RH, Brown PO, Goggins
M (2003). Exploration of global gene expression patterns
in pancreatic adenocarcinoma using cDNA microarrays.
Am. J. Pathol. 162 (4): 115162. doi:10.1016/S0002-
9440(10)63911-9. PMC 1851213 . PMID 12651607.
[60] Sato M, Girard L, Sekine I, Sunaga N, Ramirez RD,
Kamibayashi C, Minna JD (2003). Increased expres-
sion and no mutation of the Flap endonuclease (FEN1)
gene in human lung cancer. Oncogene. 22 (46): 72436.
doi:10.1038/sj.onc.1206977. PMID 14562054.
[61] Bi FF, Li D, Yang Q (2013). Hypomethylation of
ETS transcription factor binding sites and upregulation of
PARP1 expression in endometrial cancer. Biomed Res
Int. 2013: 946268. doi:10.1155/2013/946268. PMC
3666359 . PMID 23762867.
[62] Li D, Bi FF, Cao JM, Cao C, Li CY, Liu B, Yang Q
(2014). Poly (ADP-ribose) polymerase 1 transcriptional
regulation: a novel crosstalk between histone modication
H3K9ac and ETS1 motif hypomethylation in BRCA1-
mutated ovarian cancer. Oncotarget. 5 (1): 2917.
doi:10.18632/oncotarget.1549. PMC 3960209 . PMID
24448423.
[63] Bi FF, Li D, Yang Q (2013). Promoter hypomethy-
lation, especially around the E26 transformation-specic
motif, and increased expression of poly (ADP-ribose)
polymerase 1 in BRCA-mutated serous ovarian cancer.
BMC Cancer. 13: 90. doi:10.1186/1471-2407-13-90.
PMC 3599366 . PMID 23442605.
[64] Narayanan L, Fritzell JA, Baker SM, Liskay RM, Glazer
PM (April 1997). Elevated levels of mutation in
multiple tissues of mice decient in the DNA mis-
match repair gene Pms2. Proceedings of the National
Academy of Sciences of the United States of Amer-
ica. 94 (7): 31227. Bibcode:1997PNAS...94.3122N.
doi:10.1073/pnas.94.7.3122. JSTOR 41786. PMC
20332 . PMID 9096356.
[65] Hegan DC, Narayanan L, Jirik FR, Edelmann W, Liskay
RM, Glazer PM (December 2006). Diering patterns of
genetic instability in mice decient in the mismatch repair
genes Pms2, Mlh1, Msh2, Msh3 and Msh6. Carcinogen-
esis. 27 (12): 24028. doi:10.1093/carcin/bgl079. PMC
2612936 . PMID 16728433.
51
[66] Tutt AN, van Oostrom CT, Ross GM, van Steeg H,
Ashworth A (March 2002). Disruption of Brca2 in-
creases the spontaneous mutation rate in vivo: synergism
with ionizing radiation. EMBO Reports. 3 (3): 255
60. doi:10.1093/embo-reports/kvf037. PMC 1084010 .
PMID 11850397.
[67] Halford S, Rowan A, Sawyer E, Talbot I, Tomlinson I
(June 2005). O(6)-methylguanine methyltransferase in
colorectal cancers: detection of mutations, loss of expres-
sion, and weak association with G:C>A:T transitions.
Gut. 54 (6): 797802. doi:10.1136/gut.2004.059535.
PMC 1774551 . PMID 15888787.
[68] Truninger K, Menigatti M, Luz J, et al. (May 2005).
Immunohistochemical analysis reveals high frequency of
PMS2 defects in colorectal cancer. Gastroenterology.
128 (5): 116071. doi:10.1053/j.gastro.2005.01.056.
PMID 15887099.
[69] Valeri N, Gasparini P, Fabbri M, et al. (April
2010). Modulation of mismatch repair and genomic
stability by miR-155. Proceedings of the National
Academy of Sciences of the United States of America.
107 (15): 69827. Bibcode:2010PNAS..107.6982V.
doi:10.1073/pnas.1002472107. JSTOR 25665289. PMC
2872463 . PMID 20351277.
[70] Shen L, Kondo Y, Rosner GL, Xiao L, Hernandez NS, Vi-
laythong J, Houlihan PS, Krouse RS, Prasad AR, Einspahr
JG, Buckmeier J, Alberts DS, Hamilton SR, Issa JP
(September 2005). MGMT promoter methylation and
eld defect in sporadic colorectal cancer. J. Natl. Cancer
Inst. 97 (18): 13308. doi:10.1093/jnci/dji275. PMID
16174854.
[71] Lee KH, Lee JS, Nam JH, Choi C, Lee MC, Park CS,
Juhng SW, Lee JH (October 2011). Promoter methy-
lation status of hMLH1, hMSH2, and MGMT genes in
colorectal cancer associated with adenoma-carcinoma se-
quence. Langenbecks Arch Surg. 396 (7): 101726.
doi:10.1007/s00423-011-0812-9. PMID 21706233.
[72] Svrcek M, Buhard O, Colas C, Coulet F, Dumont S, Mas-
saoudi I, Lamri A, Hamelin R, Cosnes J, Oliveira C,
Seruca R, Gaub MP, Legrain M, Collura A, Lascols O,
Tiret E, Fljou JF, Duval A (November 2010). Methyla-
tion tolerance due to an O6-methylguanine DNA methyl-
transferase (MGMT) eld defect in the colonic mucosa:
an initiating step in the development of mismatch repair-
decient colorectal cancers. Gut. 59 (11): 151626.
doi:10.1136/gut.2009.194787. PMID 20947886.
[73] Paluszczak J, Misiak P, Wierzbicka M, Woniak A, Baer-
Dubowska W (February 2011). Frequent hyperme-
thylation of DAPK, RARbeta, MGMT, RASSF1A and
FHIT in laryngeal squamous cell carcinomas and ad-
jacent normal mucosa. Oral Oncol. 47 (2): 104
7. doi:10.1016/j.oraloncology.2010.11.006. PMID
21147548.
[74] Zuo C, Zhang H, Spencer HJ, Vural E, Suen JY, Schich-
man SA, Smoller BR, Kokoska MS, Fan CY (October
2009). Increased microsatellite instability and epigenetic
52
inactivation of the hMLH1 gene in head and neck squa-
mous cell carcinoma. Otolaryngol Head Neck Surg. 141
(4): 48490. doi:10.1016/j.otohns.2009.07.007. PMID
19786217.
[75] Tawk HM, El-Maqsoud NM, Hak BH, El-Sherbiny YM
(2011). Head and neck squamous cell carcinoma: mis-
match repair immunohistochemistry and promoter hyper-
methylation of hMLH1 gene. Am J Otolaryngol. 32
(6): 52836. doi:10.1016/j.amjoto.2010.11.005. PMID
21353335.
[76] Zou XP, Zhang B, Zhang XQ, Chen M, Cao J, Liu WJ
(November 2009). Promoter hypermethylation of mul-
tiple genes in early gastric adenocarcinoma and precan-
cerous lesions. Hum. Pathol. 40 (11): 153442.
doi:10.1016/j.humpath.2009.01.029. PMID 19695681.
[77] Wani M, Afroze D, Makhdoomi M, Hamid I, Wani
B, Bhat G, Wani R, Wani K (2012). Promoter
methylation status of DNA repair gene (hMLH1) in
gastric carcinoma patients of the Kashmir valley.
Asian Pac. J. Cancer Prev. 13 (8): 417781.
doi:10.7314/APJCP.2012.13.8.4177. PMID 23098428.
[78] Agarwal A, Polineni R, Hussein Z, Vigoda I, Bhagat TD,
Bhattacharyya S, Maitra A, Verma A (2012). Role
of epigenetic alterations in the pathogenesis of Barretts
esophagus and esophageal adenocarcinoma. Int J Clin
Exp Pathol. 5 (5): 38296. PMC 3396065 . PMID
22808291.
[79] Tuna M, Amos CI (November 2013). Genomic se-
quencing in cancer. Cancer Lett. 340 (2): 16170.
doi:10.1016/j.canlet.2012.11.004. PMID 23178448.
[80] Roach JC, Glusman G, Smit AF, et al. (April
2010). Analysis of genetic inheritance in a fam-
ily quartet by whole-genome sequencing. Science.
328 (5978): 6369. Bibcode:2010Sci...328..636R.
doi:10.1126/science.1186802. PMC 3037280 . PMID
20220176.
[81] Campbell CD, Chong JX, Malig M, et al. (November
2012). Estimating the human mutation rate using au-
tozygosity in a founder population. Nat. Genet. 44
(11): 127781. doi:10.1038/ng.2418. PMC 3483378 .
PMID 23001126.
[82] Keightley PD (February 2012). Rates and tness con-
sequences of new mutations in humans. Genetics. 190
(2): 295304. doi:10.1534/genetics.111.134668. PMC
3276617 . PMID 22345605.
[83] Ye K; Beekman M; Lameijer EW; Zhang Y; Moed MH;
van den Akker EB; Deelen J; Houwing-Duistermaat JJ;
Kremer D; Anvar SY; Laros JF; Jones D; Raine K; Black-
burne B; Potluri S; Long Q; Guryev V; van der Breggen R;
Westendorp RG; 't Hoen PA; den Dunnen J; van Ommen
GJ; Willemsen G; Pitts SJ; Cox DR; Ning Z; Boomsma
DI; Slagboom PE (December 2013). Aging as accel-
erated accumulation of somatic variants: whole-genome
sequencing of centenarian and middle-aged monozygotic
twin pairs. Twin Res Hum Genet. 16 (6): 102632.
doi:10.1017/thg.2013.73. PMID 24182360.
CHAPTER 5. BEYOND MENDEL
[84] Shanbhag NM, Rafalska-Metcalf IU, Balane-Bolivar C,
Janicki SM, Greenberg RA (June 2010). ATM-
dependent chromatin changes silence transcription in cis
to DNA double-strand breaks. Cell. 141 (6): 970
81. doi:10.1016/j.cell.2010.04.038. PMC 2920610 .
PMID 20550933.
[85] Morano A, Angrisano T, Russo G, Landi R, Pezone
A, Bartollino S, Zuchegna C, Babbio F, Bonapace IM,
Allen B, Muller MT, Chiariotti L, Gottesman ME, Por-
cellini A, Avvedimento EV (January 2014). Targeted
DNA methylation by homology-directed repair in mam-
malian cells. Transcription reshapes methylation on the
repaired gene. Nucleic Acids Res. 42 (2): 804
21. doi:10.1093/nar/gkt920. PMC 3902918 . PMID
24137009.
[86] Fernandez AF, Assenov Y, Martin-Subero JI, Balint B,
Siebert R, Taniguchi H, Yamamoto H, Hidalgo M, Tan
AC, Galm O, Ferrer I, Sanchez-Cespedes M, Villanueva
A, Carmona J, Sanchez-Mut JV, Berdasco M, Moreno
V, Capella G, Monk D, Ballestar E, Ropero S, Martinez
R, Sanchez-Carbayo M, Prosper F, Agirre X, Fraga MF,
Graa O, Perez-Jurado L, Mora J, Puig S, Prat J, Badi-
mon L, Puca AA, Meltzer SJ, Lengauer T, Bridgewater
J, Bock C, Esteller M (2012). A DNA methylation n-
gerprint of 1628 human samples. Genome Res. 22 (2):
40719. doi:10.1101/gr.119867.110. PMC 3266047 .
PMID 21613409.
[87] Bishop JB, Witt KL, Sloane RA (December 1997). Ge-
netic toxicities of human teratogens. Mutat. Res. 396 (1
2): 943. doi:10.1016/S0027-5107(97)00173-5. PMID
9434858.
[88] Gurvich N, Berman MG, Wittner BS, Gentleman RC,
Klein PS, Green JB (July 2005). Association of
valproate-induced teratogenesis with histone deacety-
lase inhibition in vivo. FASEB J. 19 (9): 11668.
doi:10.1096/fj.04-3425fje. PMID 15901671.
[89] Smithells D (November 1998). Does thalidomide cause
second generation birth defects?". Drug Saf. 19 (5): 339
41. doi:10.2165/00002018-199819050-00001. PMID
9825947.
[90] Friedler G (December 1996). Paternal exposures: im-
pact on reproductive and developmental outcome. An
overview. Pharmacol. Biochem. Behav. 55 (4):
691700. doi:10.1016/S0091-3057(96)00286-9. PMID
8981601.
[91] WebCite query result
[92] Cicero TJ, Adams ML, Giordano A, Miller BT, O'Connor
L, Nock B (March 1991). Inuence of morphine expo-
sure during adolescence on the sexual maturation of male
rats and the development of their ospring. J. Pharma-
col. Exp. Ther. 256 (3): 108693. PMID 2005573.
[93] Newbold RR, Padilla-Banks E, Jeerson WN (June
2006). Adverse eects of the model environmental
estrogen diethylstilbestrol are transmitted to subsequent
generations. Endocrinology. 147 (6 Suppl): S117.
doi:10.1210/en.2005-1164. PMID 16690809.
 5.4. CANCER EPIGENETICS 53

[94] Collins CC, Volik SV, Lapuk AV, et al. (March [105] Esteller M, Garcia-Foncillas J, Andion E, et al. (Novem-
2012). Next generation sequencing of prostate can- ber 2000). Inactivation of the DNA-repair gene MGMT
cer from a patient identies a deciency of methylth- and the clinical response of gliomas to alkylating agents.
ioadenosine phosphorylase, an exploitable tumor tar- The New England Journal of Medicine. 343 (19):
get. Molecular Cancer Therapeutics. 11 (3): 775 13504. doi:10.1056/NEJM200011093431901. PMID
83. doi:10.1158/1535-7163.MCT-11-0826. PMC 11070098.
3691697 . PMID 22252602.
[106] Hegi ME, Diserens AC, Gorlia T, et al. (March 2005).
[95] Li LC, Carroll PR, Dahiya R (January 2005). Epige- MGMT gene silencing and benet from temozolomide
netic changes in prostate cancer: implication for diagno- in glioblastoma. The New England Journal of Medicine.
sis and treatment. J. Natl. Cancer Inst. 97 (2): 10315. 352 (10): 9971003. doi:10.1056/NEJMoa043331.
doi:10.1093/jnci/dji010. PMID 15657340. PMID 15758010.
[96] Gurel B, Iwata T, Koh CM, Yegnasubramanian S, Nelson
[107] Esteller M, Gaidano G, Goodman SN, et al. (January
WG, De Marzo AM (November 2008). Molecular al-
2002). Hypermethylation of the DNA repair gene O(6)-
terations in prostate cancer as diagnostic, prognostic, and
methylguanine DNA methyltransferase and survival of
therapeutic targets. Advances in Anatomic Pathology.
patients with diuse large B-cell lymphoma. Jour-
15 (6): 31931. doi:10.1097/PAP.0b013e31818a5c19.
nal of the National Cancer Institute. 94 (1): 2632.
PMC 3214657 . PMID 18948763. doi:10.1093/jnci/94.1.26. PMID 11773279.
[97] Ornish D, Magbanua MJ, Weidner G, Weinberg V, Kemp
[108] Glasspool RM, Teodoridis JM, Brown R (April 2006).
C, Green C, Mattie MD, Marlin R, Simko J, Shinohara K,
Epigenetics as a mechanism driving polygenic clinical
Haqq CM, Carroll PR (June 2008). Changes in prostate
drug resistance. British Journal of Cancer. 94 (8):
gene expression in men undergoing an intensive nutrition
and lifestyle intervention. Proc. Natl. Acad. Sci. U.S.A. 108792. doi:10.1038/sj.bjc.6603024. PMC 2361257 .
105 (24): 836974. Bibcode:2008PNAS..105.8369O. PMID 16495912.
doi:10.1073/pnas.0803080105. PMC 2430265 . PMID
[109] Brock MV, Hooker CM, Ota-Machida E, et al. (March
18559852.
2008). DNA methylation markers and early re-
[98] Sun C, Reimers LL, Burk RD (April 2011). Methylation currence in stage I lung cancer. The New Eng-
of HPV16 genome CpG sites is associated with cervix land Journal of Medicine. 358 (11): 111828.
precancer and cancer. Gynecologic Oncology. 121 doi:10.1056/NEJMoa0706550. PMID 18337602.
(1): 5963. doi:10.1016/j.ygyno.2011.01.013. PMC
[110] Iglesias-Linares A, Yaez-Vico RM, Gonzlez-Moles
3062667 . PMID 21306759.
MA (May 2010). Potential role of HDAC in-
[99] Mandal SS (April 2010). Mixed lineage leukemia: ver- hibitors in cancer therapy: insights into oral squa-
satile player in epigenetics and human disease. FEBS J. mous cell carcinoma. Oral Oncol. 46 (5): 323
277 (8): 1789. doi:10.1111/j.1742-4658.2010.07605.x. 9. doi:10.1016/j.oraloncology.2010.01.009. PMID
PMID 20236314. 20207580.

[100] http://www.cancer.gov/research/progress/snapshots/ [111] Wang LG, Chiao JW (September 2010). Prostate can-
sarcoma cer chemopreventive activity of phenethyl isothiocyanate
through epigenetic regulation (review)". Int. J. On-
[101] Bennani-Baiti IM (Dec 2011). Epigenetic and epige-
col. 37 (3): 5339. doi:10.3892/ijo_00000702. PMID
nomic mechanisms shape sarcoma and other mesenchy-
20664922.
mal tumor pathogenesis. Epigenomics. 3 (6): 715732.
doi:10.2217/epi.11.93. [112] Gherardini, Lisa; Sharma, Ankush; Capobianco, Enrico;
[102] Richter GH, Plehm S, Fasan A, Rssler S, Unland R, Cinti, Caterina (2016-05-27). Targeting cancer with
Bennani-Baiti IM, et al. (Mar 2009). EZH2 is a me- epi-drugs: a precision medicine perspective. Current
diator of EWS/FLI1 driven tumor growth and metasta- Pharmaceutical Biotechnology. ISSN 1873-4316. PMID
sis blocking endothelial and neuro-ectodermal dieren- 27229488.
tiation. Proc Natl Acad Sci U S A. 106 (13): 53249.
[113] Spannho A, Sippl W, Jung M (January 2009). Can-
doi:10.1073/pnas.0810759106.
cer treatment of the future: inhibitors of histone methyl-
[103] Bennani-Baiti IM; et al. (Aug 2012). Lysine- transferases. Int. J. Biochem. Cell Biol. 41 (1): 411.
specic demethylase 1 (LSD1/KDM1A/AOF2/BHC110) doi:10.1016/j.biocel.2008.07.024. PMID 18773966.
is expressed and is an epigenetic drug target in chon-
drosarcoma, Ewings sarcoma, osteosarcoma, and rhab- [114] Garcia-Manero G, Stoltz ML, Ward MR, Kantarjian H,
domyosarcoma. Hum Pathol. 43 (8): 13001307. Sharma S (September 2008). A pilot pharmacokinetic
doi:10.1016/j.humpath.2011.10.010. study of oral azacitidine. Leukemia. 22 (9): 16804.
doi:10.1038/leu.2008.145. PMID 18548103.
[104] Esteller M, Herman JG (January 2004). Generating mu-
tations but providing chemosensitivity: the role of O6- [115] Garcia-Manero G (November 2008). Demethylating
methylguanine DNA methyltransferase in human cancer. agents in myeloid malignancies. Curr Opin Oncol. 20 (6):
Oncogene. 23 (1): 18. doi:10.1038/sj.onc.1207316. 70510. doi:10.1097/CCO.0b013e328313699c. PMC
PMID 14712205. 3873866 . PMID 18841054.
 54 CHAPTER 5. BEYOND MENDEL

[116] Aribi A, Borthakur G, Ravandi F, et al. (February

2007). Activity of decitabine, a hypomethylating agent,
in chronic myelomonocytic leukemia. Cancer. 109 (4):
7137. doi:10.1002/cncr.22457. PMID 17219444.

[117] De Padua Silva L, de Lima M, Kantarjian H, et al. (Jan-

uary 2009). Feasibility of allo-SCT after hypomethy-
lating therapy with decitabine for myelodysplastic syn-
drome. Bone Marrow Transplant. 43 (11): 83943.
doi:10.1038/bmt.2008.400. PMID 19151791.

[118] Hambach L, Ling KW, Pool J, et al. (December 2008).

Hypomethylating drugs convert HA-1 negative solid tu-
mors into targets for stem cell based immunotherapy.
Blood. 113 (12): 271522. doi:10.1182/blood-2008-05-
158956. PMID 19096014.

[119] Fenaux P, Mufti GJ, Hellstrom-Lindberg E, et al. (March

2009). Ecacy of azacitidine compared with that of
conventional care regimens in the treatment of higher-risk
myelodysplastic syndromes: a randomised, open-label,
phase III study. The Lancet: Oncology. 10 (3): 22332.
doi:10.1016/S1470-2045(09)70003-8. PMC 4086808 .
PMID 19230772.

[120] Duvic M, Talpur R, Ni X, et al. (January 2007). Phase

2 trial of oral vorinostat (suberoylanilide hydroxamic
acid, SAHA) for refractory cutaneous T-cell lymphoma
(CTCL)". Blood. 109 (1): 319. doi:10.1182/blood-
2006-06-025999. PMC 1785068 . PMID 16960145.

[121] Olsen EA, Kim YH, Kuzel TM, et al. (July 2007).
Phase IIb multicenter trial of vorinostat in patients with
persistent, progressive, or treatment refractory cutaneous
T-cell lymphoma. Journal of Clinical Oncology. 25
(21): 310915. doi:10.1200/JCO.2006.10.2434. PMID
17577020.

[122] Cameron EE, Bachman KE, Myhnen S, Herman JG,

Baylin SB (January 1999). Synergy of demethylation
and histone deacetylase inhibition in the re-expression of
genes silenced in cancer. Nature Genetics. 21 (1): 1037.
doi:10.1038/5047. PMID 9916800.

[123] http://www.accessdata.fda.gov/drugsatfda_docs/nda/
2015/205353Orig1s000MedR.pdf

[124] Dowden J, Hong W, Parry RV, Pike RA, Ward SG (April

2010). Toward the development of potent and selec-
tive bisubstrate inhibitors of protein arginine methyltrans-
ferases. Bioorg. Med. Chem. Lett. 20 (7): 21035.
doi:10.1016/j.bmcl.2010.02.069. PMID 20219369.

[125] Galvez AF, Chen N, Macasieb J, de Lumen BO (October

15, 2001). Chemopreventive Property of a Soybean Pep-
tide (Lunasin) That Binds to Deacetylated Histones and
Inhibits Acetylation. Cancer Research. 61.
Chapter 6

Human genetic diseases

6.1 Genetic disorder increased resistance to malaria in early childhood, which

could be described as a related dominant condition.[5]
For a non-technical introduction to the topic, see When a couple where one partner or both are suerers
Introduction to genetics. or carriers of a single-gene disorder wish to have a child,
they can do so through in vitro fertilization, which means
they can then have a preimplantation genetic diagnosis to
A genetic disorder is a genetic problem caused by one check whether the embryo has the genetic disorder.[6]
or more abnormalities in the genome, especially a condi-
tion that is present from birth (congenital). Most genetic
disorders are quite rare and aect one person in every Autosomal dominant
several thousands or millions.
Genetic disorders may be hereditary, passed down from Main article: Autosomal dominant Autosomal domi-
the parents genes. In other genetic disorders, defects may nant gene
be caused by new mutations or changes to the DNA. In
such cases, the defect will only be passed down if it oc-
Only one mutated copy of the gene will be necessary for a
curs in the germ line. The same disease, such as someperson to be aected by an autosomal dominant disorder.
Each aected person usually has one aected parent.[7]
forms of cancer, may be caused by an inherited genetic
condition in some people, by new mutations in other peo-
The chance a child will inherit the mutated gene is 50%.
ple, and mainly by environmental causes in other people.
Autosomal dominant conditions sometimes have reduced
Whether, when and to what extent a person with the ge-
penetrance, which means although only one mutated copy
netic defect or abnormality will actually suer from the
is needed, not all individuals who inherit that mutation go
disease is almost always aected by the environmentalon to develop the disease. Examples of this type of disor-
factors and events in the persons development. der are Huntingtons disease,[8] neurobromatosis type 1,
Some types of recessive gene disorders confer an neurobromatosis type 2, Marfan syndrome, hereditary
advantage in certain environments when only one copy nonpolyposis colorectal cancer, hereditary multiple exos-
of the gene is present.[1] toses (a highly penetrant autosomal dominant disorder),
Tuberous sclerosis, Von Willebrand disease, and acute in-
termittent porphyria. Birth defects are also called con-
6.1.1 Single-gene genital anomalies.

A single-gene disorder is the result of a single mutated

gene. Over 4000 human diseases are caused by single-
gene defects.[4] Single-gene disorders can be passed on
to subsequent generations in several ways. Genomic im-
printing and uniparental disomy, however, may aect
inheritance patterns. The divisions between recessive
and dominant types are not hard and fast, although
the divisions between autosomal and X-linked types are
(since the latter types are distinguished purely based on
the chromosomal location of the gene). For example,
achondroplasia is typically considered a dominant disor-
der, but children with two genes for achondroplasia have
a severe skeletal disorder of which achondroplasics could
be viewed as carriers. Sickle-cell anemia is also consid-
ered a recessive condition, but heterozygous carriers have
Autosomal recessive
Main article: Autosomal dominant Autosomal reces-
sive allele
Two copies of the gene must be mutated for a person to
be aected by an autosomal recessive disorder. An af-
fected person usually has unaected parents who each
carry a single copy of the mutated gene (and are referred
to as carriers). Two unaected people who each carry
one copy of the mutated gene have a 25% risk with each
pregnancy of having a child aected by the disorder. Ex-
amples of this type of disorder are Acrodermatitis En-
teropathica,[9] Albinism, Medium-chain acyl-CoA dehy-

55
56
drogenase deciency, cystic brosis, sickle-cell disease, sive conditions can sometimes manifest in females due
Tay-Sachs disease, Niemann-Pick disease, spinal muscu- to skewed X-inactivation or monosomy X (Turner syn-
lar atrophy, and Roberts syndrome. Certain other pheno- drome).
types, such as wet versus dry earwax, are also determined
in an autosomal recessive fashion.[10][11]
Y-linked
X-linked dominant
Main article: X-linked dominant
X-linked dominant disorders are caused by mutations in
genes on the X chromosome. Only a few disorders have
this inheritance pattern, with a prime example being X-
linked hypophosphatemic rickets. Males and females
are both aected in these disorders, with males typi-
cally being more severely aected than females. Some
X-linked dominant conditions, such as Rett syndrome,
incontinentia pigmenti type 2, and Aicardi syndrome, are
usually fatal in males either in utero or shortly after birth,
and are therefore predominantly seen in females. Excep-
tions to this nding are extremely rare cases in which boys
with Klinefelter syndrome (47,XXY) also inherit an X-
linked dominant condition and exhibit symptoms more
similar to those of a female in terms of disease sever-
ity. The chance of passing on an X-linked dominant dis-
order diers between men and women. The sons of a
man with an X-linked dominant disorder will all be unaf-
fected (since they receive their fathers Y chromosome),
and his daughters will all inherit the condition. A woman
with an X-linked dominant disorder has a 50% chance of
having an aected fetus with each pregnancy, although it
should be noted that in cases such as incontinentia pig-
menti, only female ospring are generally viable. In ad-
dition, although these conditions do not alter fertility per
se, individuals with Rett syndrome or Aicardi syndrome
rarely reproduce.
X-linked recessive
Main article: X-linked recessive inheritance
X-linked recessive conditions are also caused by muta-
tions in genes on the X chromosome. Males are more
frequently aected than females, and the chance of pass-
ing on the disorder diers between men and women. The
sons of a man with an X-linked recessive disorder will
not be aected, and his daughters will carry one copy of
the mutated gene. A woman who is a carrier of an X-
linked recessive disorder (XR Xr ) has a 50% chance of
having sons who are aected and a 50% chance of hav-
ing daughters who carry one copy of the mutated gene and
are therefore carriers. X-linked recessive conditions in-
clude the serious diseases hemophilia A, Duchenne mus-
cular dystrophy, and Lesch-Nyhan syndrome, as well as
common and less serious conditions such as male pattern
baldness and red-green color blindness. X-linked reces-
CHAPTER 6. HUMAN GENETIC DISEASES
Main article: Y linkage
Y-linked disorders, also called holandric disorders, are
caused by mutations on the Y chromosome. These condi-
tions display may only be transmitted from the heteroga-
metic sex (e.g. male humans) to ospring of the same
sex. More simply, this means that Y-linked disorders in
humans can only be passed from men to their sons; fe-
males can never be aected because they do not possess
Y-allosomes.
Y-linked disorders are exceedingly rare but the most well-
known examples typically cause infertility. Reproduction
in such conditions is only possible through the circumven-
tion of infertility by medical intervention.
Mitochondrial
Main article: Mitochondrial disease
This type of inheritance, also known as maternal inher-
itance, applies to genes in mitochondrial DNA. Because
only egg cells contribute mitochondria to the developing
embryo, only mothers can pass on mitochondrial condi-
tions to their children. An example of this type of disor-
der is Lebers hereditary optic neuropathy.
6.1.2 Many genes
Genetic disorders may also be complex, multifactorial,
or polygenic, meaning they are likely associated with the
eects of multiple genes in combination with lifestyles
and environmental factors. Multifactorial disorders in-
clude heart disease and diabetes. Although complex dis-
orders often cluster in families, they do not have a clear-
cut pattern of inheritance. This makes it dicult to de-
termine a persons risk of inheriting or passing on these
disorders. Complex disorders are also dicult to study
and treat, because the specic factors that cause most
of these disorders have not yet been identied. Stud-
ies which aim to identify the cause of complex disor-
ders can use several methodological approaches to de-
termine genotype-phenotype associations. One method,
the genotype-rst approach, starts by identifying genetic
variants within patients and then determining the asso-
ciated clinical manifestations. This is opposed to the
more traditional phenotype-rst approach, and may iden-
tify causal factors that have previously been obscured by
clinical heterogeneity, penetrance, and expressivity.
6.1. GENETIC DISORDER 57

On a pedigree, polygenic diseases do tend to run in fam- 6.1.4 Prognosis

ilies, but the inheritance does not t simple patterns as
with Mendelian diseases. But this does not mean that the
genes cannot eventually be located and studied. There is
also a strong environmental component to many of them
(e.g., blood pressure).
asthma
autoimmune diseases such as multiple sclerosis
cancers
ciliopathies
Not all genetic disorders directly result in death, however
there are no known cures for genetic disorders. Many
genetic disorders aect stages of development such as
Downs Syndrome. While others result in purely phys-
ical symptoms such as Muscular Dystrophy. Other dis-
orders, such as Huntingtons Disease show no signs until
adulthood. During the active time of a genetic disorder,
patients mostly rely on maintaining or slowing the degra-
dation of quality of life and maintain patient autonomy.
This includes physical therapy, pain management, and
may include a selection of alternative medicine programs.

cleft palate 6.1.5 Treatment

diabetes

heart disease

hypertension

inammatory bowel disease

intellectual disability

mood disorder

obesity

refractive error

infertility

6.1.3 Diagnosis

See also: Prenatal diagnosis

Due to the wide range of genetic disorders that are From personal genomics to gene therapy
presently known, diagnosis of a genetic disorder is widely
varied and dependent of the disorder. Most genetic dis-
orders are diagnosed at birth or during early childhood, See also: Gene therapy
however some, such as Huntingtons disease, can escape
detection until the patient is well into adulthood. The treatment of genetic disorders is an ongoing bat-
The basic aspects of a genetic disorder rests on the in- tle with over 1800 gene therapy clinical trials having
heritance of genetic material. With an in depth family been completed,[14]
are ongoing, or have been approved
history, it is possible to anticipate possible disorders worldwide. Despite this, most treatment options re-
in children which direct medical professionals to spe- volve around treating the symptoms of the disorders in
cic tests depending on the disorder and allow parents an attempt to improve patient quality of life.
the chance to prepare for potential lifestyle changes, Gene therapy refers to a form of treatment where a
anticipate the possibility of stillbirth, or contemplate healthy gene is introduced to a patient. This should al-
termination.[12] Prenatal diagnosis can detect the pres- leviate the defect caused by a faulty gene or slow the pro-
ence of characteristic abnormalities in fetal development gression of disease. A major obstacle has been the de-
through ultrasound, or detect the presence of character- livery of genes to the appropriate cell, tissue, and organ
istic substances via invasive procedures which involve aected by the disorder. How does one introduce a gene
inserting probes or needles into the uterus such as in into the potentially trillions of cells which carry the defec-
amniocentesis.[13] tive copy? This question has been the roadblock between
58 CHAPTER 6. HUMAN GENETIC DISEASES

understanding the genetic disorder and correcting the ge- [12] Milunsky, edited by Aubrey (2004). Genetic disorders
netic disorder.[15] and the fetus : diagnosis, prevention, and treatment (5th
ed.). Baltimore: Johns Hopkins University Press. ISBN
0801879280.
6.1.6 See also
[13] Diagnostic Tests Amniocentesis. Harvard Medical
FINDbase (the Frequency of Inherited Disorders School. Retrieved 2008-07-15.
database)
[14] Ginn, Samantha L.; Alexander, Ian E.; Edelstein, Michael
Genetic epidemiology L.; Abedi, Mohammad R.; Wixon, Jo (February 2013).
Gene therapy clinical trials worldwide to 2012 - an up-
Inborn errors of metabolism date. The Journal of Gene Medicine. 15 (2): 6577.
doi:10.1002/jgm.2698.
List of genetic disorders
[15] Verma, I. M. (22 August 2013). Gene Therapy
Population groups in biomedicine
That Works. Science. 341 (6148): 853855.
Mendelian error doi:10.1126/science.1242551.

6.1.7 References 6.1.8 External links

[1] WGBH Educational Foundation Public Health Genomics at CDC
[2] Keane MG; Pyeritz RE (May 2008). Medical manage-
ment of Marfan syndrome. Circulation. 117 (21): 2802 OMIM Online Mendelian Inheritance in Man, a
13. doi:10.1161/CIRCULATIONAHA.107.693523. catalog of human genes and genetic disorders
PMID 18506019.
Genetic and Rare Diseases Information Center
[3] Walker FO (2007). Huntingtons disease. Lancet. (GARD) Oce of Rare Diseases (ORD), National
369 (9557): 21828 [221]. doi:10.1016/S0140- Institutes of Health (NIH)
6736(07)60111-1. PMID 17240289.

[4] Genetic link to 4,000 diseases. CDCs National Center on Birth Defects and Devel-
opmental Disabilities
[5] Williams T. N.; Obaro S. K. (2011). Sickle cell disease
and malaria morbidity: a tale with two tails. Trends in Genetic Disease Information from the Human
Parasitology. 27 (7): 315320. Genome Project
[6] Kuliev A; Verlinsky Y (2005). Preimplantation diagno-
sis: A realistic option for assisted reproduction and genetic Global Genes Project, Genetic and Rare Diseases
practice. Curr. Opin. Obstet. Gynecol. 17 (2): 179 Organization
83. doi:10.1097/01.gco.0000162189.76349.c5. PMID
15758612. Retrieved 2009-04-01.

[7] Griths, Anthony J.F.; Wessler, Susan R.; Carroll, Sean 6.2 List of genetic disorders
B.; Doebley, John (2012). 2: Single-Gene Inheritance.
Introduction to Genetic Analysis (10th ed.). New York:
The following is a list of genetic disorders and if known,
W.H. Freeman and Company. p. 57. ISBN 978-1-4292-
type of mutation and the chromosome involved. The list
2943-2.
of human genes includes genes not listed here, which also
[8] Griths, Anthony J.F.; Wessler, Susan R.; Carroll, Sean aect predisposition toward certain diseases.
B.; Doebley, John (2012). Introduction to Genetic Analysis
(10th ed.). New York: W.H. Freeman and Company. p.
58. ISBN 978-1-4292-2943-2. 6.2.1 Most common disorders
[9] Khan Mohammad Beigi, Pooya; Maverakis, Emanual.
http://link.springer.com/10.1007/978-3-319-17819-6. P Point mutation, or any insertion/deletion entirely
doi:10.1007/978-3-319-17819-6. External link in |title= inside one gene
(help)
D Deletion of a gene or genes
[10] Wade, Nicholas (January 29, 2006). Japanese Scientists
Identify Ear Wax Gene. New York Times.
C Whole chromosome extra, missing, or both (see
[11] Yoshiura K; Kinoshita A; Ishida T; et al. (March 2006). Chromosome abnormality)
A SNP in the ABCC11 gene is the determinant of
human earwax type. Nat. Genet. 38 (3): 32430. T Trinucleotide repeat disorders: gene is extended
doi:10.1038/ng1733. PMID 16444273. in length
6.3. NIJMEGEN BREAKAGE SYNDROME 59

6.2.2 Full list

6.2.3 See also

List of cutaneous conditions

6.2.4 References

[1] http://www.cdc.gov/genomics/gtesting/ACCE/FBR/

[2] http://www.ctv.ca/servlet/ArticleNews/story/CTVNews/
20081204/Mutated_Gene_081204/20081204?hub=
Health

[3] http://www.eurekalert.org/pub_releases/2008-12/
plos-an120308.php

6.3 Nijmegen breakage syndrome

Nijmegen breakage syndrome (NBS), also known as

Berlin breakage syndrome, ataxia telangiectasia vari-
ant 1 (AT-V1) and Seemanova syndrome,[1] is a rare
autosomal recessive[2] congenital disorder causing chro-
mosomal instability, probably as a result of a defect in
the Double Holliday junction DNA repair mechanism
and/or the Synthesis Dependent Strand Annealing mech-
anism for repairing double strand breaks in DNA (see
Homologous recombination).[3] Nijmegen breakage syndrome has an autosomal recessive pattern
NBS1 codes for a protein that has two major functions: of inheritance.
(1) to stop the cell cycle in the S phase, when there are
errors in the cell DNA (2) to interact with FANCD2 that
can activate the BRCA1/BRCA2 pathway of DNA re-
pair. This explains why mutations in the NBS1 gene lead
6.3.2 Cause
to higher levels of cancer (see Fanconi anemia, Cockayne
syndrome.) NBS is caused by a mutation in the NBS1 gene, located
at human chromosome 8q21.[7][8] The disease is inher-
The name derives from the Dutch city Nijmegen where
ited in an autosomal recessive manner.[2] This means the
the condition was rst described.[4]
defective gene responsible for the disorder is located on
Most people with NBS have West Slavic origins. The an autosome (chromosome 8 is an autosome), and two
largest number of them live in Poland. copies of the defective gene (one inherited from each par-
ent) are required in order to be born with the disorder.
The parents of an individual with an autosomal recessive
6.3.1 Characteristics disorder both carry one copy of the defective gene, but
usually do not experience any signs or symptoms of the
It is characterized by microcephaly, a distinct facial disorder.
appearance, short stature, immunodeciency, radia- Two adult siblings, both heterozygous for two particu-
tion sensitivity and a strong predisposition to lymphoid lar NBS1 nonsense mutations displayed cellular sensitivity
malignancy.[5][6] NBS is caused by a mutation in the NBS1 to radiation, chromosome instability and fertility defects,
gene. It is thus not surprising that many of the features but not the developmental defects that are typically found
are similar to ataxia telangiectasia (AT), and this syn- in other NBS patients.[9] These individuals appear to be
drome is sometimes termed AT-variant 1; in AT, an ab- primarily defective in homologous recombination, a pro-
normal ATM protein, the normal correlate of which inter- cess that accurately repairs double-strand breaks, both in
acts with the MRE11/RAD50/NBS1 (MRN) complex.[3] somatic cells and during meiosis.
60
6.3.3 References
[1] Seemanova, E., Passarge, E., Beneskova, D., Houstek,
J., Kasal, P., Sevcikova, M. Familial microcephaly with
normal intelligence, immunodeciency, and risk of lym-
phoreticular malignancies: a new autosomal recessive dis-
order. Am. J. Med. Genet. 20: 639-648, 1985. PMID
3857858
[2] Cheung, V. G.; Ewens, W. J. (August 2006).
Heterozygous carriers of Nijmegen Breakage Syn-
drome have a distinct gene expression phenotype.
Genome Research (Free full text). 16 (8): 973979.
doi:10.1101/gr.5320706. PMC 1524869 . PMID
16809669.
[3] http://omim.org/entry/251260
[4] Weemaes CM, Hustinx TW, Scheres JM, van Mun-
ster PJ, Bakkeren JA, Taalman RD (1981). A new
chromosomal instability disorder: the Nijmegen break-
age syndrome. Acta Paediatr Scand. 70 (4): 557
64. doi:10.1111/j.1651-2227.1981.tb05740.x. PMID
7315300.
[5] Digweed M, Sperling K (2004). Nijmegen breakage
syndrome: clinical manifestation of defective response to
DNA double-strand breaks. DNA Repair (Amst). 3 (8-
9): 120717. doi:10.1016/j.dnarep.2004.03.004. PMID
15279809.
[6] Nijmegen breakage syndrome. The International Ni-
jmegen Breakage Syndrome Study Group. Arch Dis
Child. 82 (5): 4006. 2000. doi:10.1136/adc.82.5.400.
PMC 1718318 . PMID 10799436. Full text
[7] Iijima K, Komatsu K, Matsuura S, Tauchi H (2004).
The Nijmegen breakage syndrome gene and its role
in genome stability. Chromosoma. 113 (2): 5361.
doi:10.1007/s00412-004-0298-0. PMID 15258809.
[8] Online 'Mendelian Inheritance in Man' (OMIM) 602667
[9] Warcoin M, Lespinasse J, Despouy G, Dubois d'Enghien
C, Laug A, Portno MF, Christin-Maitre S, Stoppa-
Lyonnet D, Stern MH (2009). Fertility defects revealing
germline biallelic nonsense NBN mutations. Hum. Mu-
tat. 30 (3): 42430. doi:10.1002/humu.20904. PMID
19105185.
6.3.4 External links
nijmegen at NIH/UW GeneTests
http://www.nijmegenbreakagesyndrome.net/
homepage.htm
Nijmegen Breakage Syndrome at NIH's Oce of
Rare Diseases
CHAPTER 6. HUMAN GENETIC DISEASES
6.4 Ataxia telangiectasia
Ataxia telangiectasia (A-T) (also referred to as
LouisBar syndrome[1] ) is a rare, neurodegenerative,
autosomal recessive disease causing severe disability.
Ataxia refers to poor coordination and telangiectasia to
small dilated blood vessels, both of which are hallmarks
of the disease.[2]
A-T aects many parts of the body:
It impairs certain areas of the brain including the
cerebellum, causing diculty with movement and
coordination.
It weakens the immune system, causing a predispo-
sition to infection.
It prevents repair of broken DNA, increasing the risk
of cancer.
Symptoms most often rst appear in early childhood (the
toddler stage) when children begin to walk. Though they
usually start walking at a normal age, they wobble or sway
when walking, standing still or sitting, and may appear
almost as if they are drunk. In late pre-school and early
school age, they develop diculty moving their eyes in
a natural manner from one place to the next (oculomotor
apraxia). They develop slurred or distorted speech, and
swallowing problems. Some have an increased number
of respiratory tract infections (ear infections, sinusitis,
bronchitis, and pneumonia). Because not all children de-
velop in the same manner or at the same rate, it may be
some years before A-T is properly diagnosed. Most chil-
dren with A-T have stable neurologic symptoms for the
rst 45 years of life, but begin to show increasing prob-
lems in early school years.
A-T is caused by a defect in the ATM gene,[3] which is
responsible for managing the cells response to multiple
forms of stress including double-strand breaks in DNA.
In simple terms, the protein produced by the ATM gene
recognizes that there is a break in DNA, recruits other
proteins to x the break, and stops the cell from making
new DNA until the repair is complete.[4]
6.4.1 Symptoms
There is substantial variability in the severity of features
of A-T among aected individuals, and at dierent ages.
The following symptoms or problems are either common
or important features of A-T:
Ataxia (diculty with control of movement) that
is apparent early but worsens in school to pre-teen
years
Oculomotor apraxia (diculty with coordination of
head and eye movement when shifting gaze from one
place to the next)
6.4. ATAXIA TELANGIECTASIA
Involuntary movements
Telangiectasia (dilated blood vessels) over the white
(sclera) of the eyes, making them appear bloodshot.
These are not apparent in infancy and may rst ap-
pear at age 58 years. Telangiectasia may also ap-
pear on sun-exposed areas of skin.
Problems with infections, especially of the ears, si-
nuses and lungs
Increased incidence of cancer (primarily, but not ex-
clusively, lymphomas and leukemias) Telangiectasia
Delayed onset or incomplete pubertal development,
and very early menopause
Slowed rate of growth (weight and/or height)
Drooling particularly in young children when they
are tired or concentrating on activities
Dysarthria (slurred, slow, or distorted speech
sounds)
Diabetes in adolescence or later
Premature changes in hair and skin
Many children are initially misdiagnosed as having ataxic
cerebral palsy. The diagnosis of A-T may not be made
until the preschool years when the neurologic symptoms
of impaired gait, hand coordination, speech and eye
movement appear or worsen, and the telangiectasia rst
appear. Because A-T is so rare, doctors may not be famil-
iar with the symptoms, or methods of making a diagnosis.
The late appearance of telangiectasia may be a barrier to
the diagnosis. It may take some time before doctors con-
sider A-T as a possibility because of the early stability of
symptoms and signs.
Ataxia and other neurologic problems
The rst indications of A-T usually occur during the tod-
dler years.[5][6] Children start walking at a normal age,
but may not improve much from their initial wobbly gait.
Sometimes they have problems standing or sitting still and
tend to sway backward or from side to side. In primary
school years, walking becomes more dicult, and chil-
dren will use doorways and walls for support. Children
with A-T often appear better when running or walking
quickly in comparison to when they are walking slowly or
standing in one place. Around the beginning of their sec-
ond decade, children with typical forms of A-T start us-
ing a wheelchair for long distances. During school years,
children may have increasing diculty with reading be-
cause of impaired coordination of eye movement. At
the same time, other problems with ne-motor functions
(writing, coloring, and using utensils to eat), and with
slurring of speech (dysarthria) may arise. Most of these
neurologic problems stop progressing after the age of
61
about 12 15 years, though involuntary movements may
start at any age and may worsen over time. These extra
movements can take many forms, including small jerks
of the hands and feet that look like dgeting (chorea),
slower twisting movements of the upper body (athetosis),
adoption of sti and twisted postures (dystonia), occa-
sional uncontrolled jerks (myoclonic jerks), and various
rhythmic and non-rhythmic movements with attempts at
coordinated action (tremors).
Ocular telangiectasia in a person with A-T
Prominent blood vessels (telangiectasia) over the white
(sclera) of the eyes usually occur by the age of 58 years,
but sometimes later or not at all.[7] The absence of telang-
iectasia does not exclude the diagnosis of A-T. Poten-
tially a cosmetic problem, the ocular telangiectasia do not
bleed or itch, though they are sometimes misdiagnosed
as chronic conjunctivitis. It is their constant nature, not
changing with time, weather or emotion, that marks them
as dierent from other visible blood vessels. Telangiec-
tasia can also appear on sun-exposed areas of skin, espe-
cially the face and ears. They occur in the bladder as a late
complication of chemotherapy with cyclophosphamide,
have been seen deep inside the brain of older people with
A-T, and occasionally arise in the liver and lungs.
Immune problems
About two-thirds of people with A-T have abnormal-
ities of the immune system.[8] The most common ab-
normalities are low levels of one or more classes of
immunoglobulins (IgG, IgA, IgM or IgG subclasses), not
making antibodies in response to vaccines or infections,
and having low numbers of lymphocytes (especially T-
lymphocytes) in the blood. Some people have frequent
infections of the upper (colds, sinus and ear infections)
and lower (bronchitis and pneumonia) respiratory tract.
All children with A-T should have their immune systems
evaluated to detect those with severe problems that re-
quire treatment to minimize the number or severity of
infections. Some people with A-T need additional im-
munizations (especially with pneumonia and inuenza
vaccines), antibiotics to provide protection (prophylaxis)
62 CHAPTER 6. HUMAN GENETIC DISEASES

from infections, and/or infusions of immunoglobulins of recurrent lung infections due to immunodeciency.
(gamma globulin). The need for these treatments should Individuals with this problem are at risk of developing
be determined by an expert in the eld of immunode- bronchiectasis, a condition in which bronchial tubes are
ciency or infectious diseases. permanently damaged, resulting in recurrent lower airway
infections. Gamma globulin for people with antibody de-
ciency and/or chronic antibiotic treatment may reduce
Cancer the problems of infection. Other individuals with A-T
have diculty with taking deep breaths and may have
People with A-T have a highly increased incidence (ap- an ineective cough, making it dicult to clear oral and
proximately 25% lifetime risk) of cancers, particularly bronchial secretions. This can lead to prolonged respi-
lymphomas and leukemia, but other cancers can occur.[9] ratory symptoms following common viral respiratory ill-
When possible, treatment should avoid the use of ra- nesses. Techniques that allow clearance of mucus can be
diation therapy and chemotherapy drugs that work in a helpful in some individuals during respiratory illnesses.
way that is similar to radiation therapy (radiomimetic Some people will develop swallowing problems as they
drugs), as these are particularly toxic for people with A- age, increasing their risk of aspiration pneumonia. Re-
T. The special problems of managing cancer are su- current injury to the lungs caused by chronic infections
ciently complicated that treatment should be done only or aspiration may cause lung brosis and scarring. This
in academic oncology centers and after consultation with process may be enhanced by inadequate tissue repair in
physicians who have specic expertise in A-T. Unfortu- ATM-decient cells. A small number of individuals de-
nately, there is no way to predict which individuals will velop interstitial lung disease. They have decreased pul-
develop cancer. Because leukemia and lymphomas dif- monary reserve, trouble breathing, a need for supplemen-
fer from solid tumors in not progressing from solitary to tal oxygen and chronic cough in the absence of lung in-
metastatic stages, there is less need to diagnose them early fections. They may respond to systemic steroid treatment
in their appearance. Surveillance for leukemia and lym- or other drugs to reduce inammation.
phoma is thus not helpful, other than considering cancer
as a diagnostic possibility whenever possible symptoms Lung function tests (spirometry) should be performed at
of cancer (e.g. persistent swollen lymph glands, unex- least annually in children old enough to perform them, in-
plained fever) arise. uenza and pneumococcal vaccines given to eligible in-
dividuals, and sinopulmonary infections treated aggres-
Women who are A-T carriers (who have one mutated sively to limit the development of chronic lung disease.
copy of the ATM gene), have approximately a two-fold
increased risk for the development of breast cancer com-
pared to the general population.[10][11] This includes all
Feeding, swallowing, and nutrition
mothers of A-T children and some female relatives. Cur-
rent consensus is that special screening tests are not help-
ful, but all women should have routine cancer surveil- Feeding and swallowing can [14]
become dicult for people
lance. with A-T as they get older. Feeding refers to all aspects
of eating and drinking, including getting food and liquids
to the mouth; swallowing refers to ingestion or what hap-
Skin pens after food or liquids enter the mouth. Primary goals
for feeding and swallowing are safe, adequate, and enjoy-
A-T can cause features of early aging such as premature able mealtimes.
graying of the hair. It can also cause vitiligo (an auto- Involuntary movements may make feeding dicult or
immune disease causing loss of skin pigment resulting in messy and may excessively prolong mealtimes. It may
a blotchy bleach-splashed look), and warts which can be be easier to nger feed than use utensils (e.g., spoon or
extensive and recalcitrant to treatment. A small number fork). For liquids, it is often easier to drink from a closed
of people develop a chronic inammatory skin disease container with a straw than from an open cup. Caregivers
(granulomas).[12] may need to provide foods or liquids so that self-feeding
is possible, or they may need to feed the person with A-
T. In general, meals should be completed within approx-
Lung disease
imately 30 minutes. Longer meals may be stressful, in-
Chronic lung disease develops in more than 25% of peo- terfere with other daily activities, and limit the intake of
ple with A-T.[13] Three major types of lung disease can necessary liquids and nutrients.
develop: (1) recurrent and chronic sinopulmonary infec- If swallowing problems (dysphagia) occur, they typically
tions; (2) lung disease caused by ineective cough, swal- present during the second decade of life. Dysphagia is
lowing dysfunction, and impaired airway clearance; and common because of the neurological changes that inter-
(3) restrictive interstitial lung disease. It is common for fere with coordination of mouth and pharynx (throat)
individuals with A-T to have more than one of these movements that are needed for safe and ecient swal-
lung conditions. Chronic lung disease can occur because lowing. Coordination problems involving the mouth
6.4. ATAXIA TELANGIECTASIA 63

may make chewing dicult and increase the duration of 6.4.2 Pathophysiology
meals. Problems involving the pharynx may cause liq-
uid, food, and saliva to be inhaled into the airway (aspi- How does loss of the ATM protein create a multisys-
ration). People with dysphagia may not cough when they tem disorder?
aspirate (silent aspiration). Swallowing problems and es-
pecially swallowing problems with silent aspiration may
cause lung problems due to inability to cough and clear
food and liquids from the airway.

Warning signs of a swallowing problem

Choking or coughing when eating or drinking

Poor weight gain (during ages of expected growth)
or weight loss at any age
Excessive drooling
Mealtimes longer than 40 45 minutes, on a regular
basis
Characteristics of the ATM protein[16][17][18][19][20][21][22][23][24]
Foods or drinks previously enjoyed are now refused
or dicult A-T has been described as a genome instability syn-
drome, a DNA repair disorder and a DNA damage re-
Chewing problems sponse (DDR) syndrome. ATM, the gene responsible
Increase in the frequency or duration of breathing or for this multi-system disorder, encodes a protein of the
respiratory problems same name which coordinates the cellular response to
DNA double strand breaks (DSBs).[17] Radiation ther-
Increase in lung infections apy, chemotherapy that acts like radiation (radiomimetic
drugs) and certain biochemical processes and metabolites
can cause DSBs. When these breaks occur, ATM stops
Eye and vision
the cell from making new DNA (cell cycle arrest) and
recruits and activates other proteins to repair the dam-
Most people develop telangiectasia (prominent
age. Thus, ATM allows the cell to repair its DNA before
blood vessels) in the membrane that covers the white
the completion of cell division. If DNA damage is too
part (sclera) of the eye.
severe, ATM will mediate the process of programmed
Vision (ability to see objects in focus) is normal.[15] cell death (apoptosis) to eliminate the cell and prevent
genomic instability.[18]
Control of eye movement is often impaired, aect-
ing visual functions that require fast, accurate eye
movements from point to point (e.g. reading). Cancer and radiosensitivity

Eye misalignments (strabismus) are common, but In the absence of the ATM protein, cell-cycle check-
may be treatable. point regulation and programmed cell death in response
There may be diculty in coordinating eye position to DSBs are defective. The result is genomic [25]
instability
and shaping the lens to see objects up close. which can lead to the development of cancers.
Irradiation and radiomimetic compounds induce DSBs
which are unable to be repaired appropriately when ATM
Orthopedics is absent. Consequently, such agents can prove especially
cytotoxic to A-T cells and people with A-T.
Many individuals with A-T develop deformities of the
feet that compound the diculty they have with walk-
ing due to impaired coordination. Early treatment may Delayed pubertal development (gonadal dysgenesis)
slow progression of this deformity. Bracing or surgical
correction sometimes improves stability at the ankle suf- Infertility is often described as a characteristic of A-T.
cient to enable an individual to walk with support, or Whereas this is certainly the case for the mouse model
bear weight during assisted standing transfers from one of A-T,[26] in humans it may be more accurate to char-
seat to another. Severe scoliosis is relatively uncommon, acterize the reproductive abnormality as gonadal atrophy
but probably does occur more often than in those without or dysgenesis characterized by delayed pubertal develop-
A-T. Spinal fusion is only rarely indicated. ment. Because programmed DSBs are generated to initi-
64 CHAPTER 6. HUMAN GENETIC DISEASES

ate genetic recombinations involved in the production of Increased alpha-fetoprotein (AFP) levels
sperm and eggs in reproductive organs (a process known
as meiosis), meiotic defects and arrest can occur when Approximately 95% of people with A-T have elevated
ATM is not present.[26][27][28] serum AFP levels after the age of two, and measured lev-
els of AFP appear to increase slowly over time.[39] AFP
levels are very high in the newborn, and normally descend
Immune system defects and immune-related cancers to adult levels over the rst year to 18 months. The rea-
son for why individuals with A-T have elevated levels of
AFP is not yet known.

Neurodegeneration

A-T is one of several DNA repair disorders which result

ATM and the immune system [29][30][31][32]
in neurological abnormalities or degeneration. Arguably
some of the most devastating symptoms of A-T are a
result of progressive cerebellar degeneration, character-
ized by the loss of Purkinje cells and, to a lesser extent,
granule cells (located exclusively in the cerebellum).[5]
The cause of this cell loss is not known, though many hy-
potheses have been proposed based on experiments per-
formed both in cell culture and in the mouse model of
A-T. Current hypotheses explaining the neurodegenera-
tion associated with A-T include the following:

As lymphocytes develop from stem cells in the bone mar-
row into mature lymphocytes in the periphery, they re-
arrange special segments of their DNA [V(D)J recom-
bination process]. This process requires them to make
DSBs, which are dicult to repair in the absence of
ATM.[33][34][35][36] As a result, most people with A-T
have reduced numbers of lymphocytes and some impair-
ment of lymphocyte function (such as an impaired abil-
ity to make antibodies in response to vaccines or infec-
tions). In addition, broken pieces of DNA in chromo-
somes involved in the above-mentioned rearrangements
have a tendency to recombine with other genes (translo-
cation), making the cells prone to the development of can-
cer (lymphoma and leukemia).
Defective DNA damage response in neurons[19][40]
which can lead to
Failed clearance of genomically damaged neu-
rons during development[41][42]
Transcription stress and abortive transcription
including topoisomerase 1 cleavage complex
(TOP1cc) dependent lesions[43][44]
Aneuploidy[45]
Defective response to oxidative stress charac-
terized by elevated ROS and altered cellular
metabolism[46][47][48][49]
Mitochondrial dysfunction[50][51][52]

Progeric changes Defects in neuronal function:

Cells from people with A-T demonstrate genomic in-
stability, slow growth and premature senescence in cul-
ture, shortened telomeres and an ongoing, low-level
stress response.[4][37] These factors may contribute to the
progeric (signs of early aging) changes of skin and hair
sometimes observed in people with A-T. For example,
DNA damage and genomic instability cause melanocyte
stem cell (MSC) dierentiation which produces graying.
Thus, ATM may be a stemness checkpoint protecting
against MSC dierentiation and premature graying of the These hypotheses may not be mutually exclusive and
hair.[38]
Telangiectasia
The cause of telangiectasia or dilated blood vessels in the deciency on the other areas of the brain outside of the
absence of the ATM protein is not yet known.
Inappropriate cell cycle re-entry of post-
mitotic (mature) neurons[53]
Synaptic/vesicular dysregulation[54]
HDAC4 dysregulation[55][56]
Histone hypermethylation and altered epige-
netics [57][58]
Altered protein turnover[59]
more than one of these mechanisms may underlie neu-
ronal cell death when there is an absence or deciency of
ATM. Further, cerebellar damage and loss of Purkinje
and granule cells do not explain all of the neurologic ab-
normalities seen in people with A-T. The eects of ATM
cerebellum are being actively investigated.
6.4. ATAXIA TELANGIECTASIA 65

Radiation exposure presents signicant challenges. Genes often have vari-

ant spellings (polymorphisms) which do not aect func-
People with A-T have an increased sensitivity to ioniz- tion. In a gene as large as ATM, such variant spellings are
ing radiation (X-rays and gamma rays). Therefore, X-ray likely to occur and doctors cannot always predict whether
exposure should be limited to times when it is medically a specic variant will or will not cause disease. Genetic
necessary, as exposing an A-T patient to ionizing radia- counseling can help family members of an A-T patient
tion can damage cells in such a way that the body can- understand what can or cannot be tested, and how the test
not repair them. The cells can cope normally with other results should be interpreted.
forms of radiation, such as ultraviolet light, so there is no
Carriers of A-T, such as the parents of a person with A-T,
need for special precautions from sunlight exposure.
have one mutated copy of the ATM gene and one nor-
mal copy. They are generally healthy, but there is an
6.4.3 Genetics and information about A-T increased risk of breast cancer in women. This nding
has been conrmed in a variety of dierent ways, and is
carriers
the subject of current research. Standard surveillance (in-
cluding monthly breast self-exams and mammography at
the usual schedule for age) is recommended, unless addi-
tional tests are indicated because the individual has other
risk factors (e.g., family history of breast cancer).
Unaected Unaected
"Carrier" "Carrier"
Father Mother
6.4.4 Diagnosis

R r R r The diagnosis of A-T is usually suspected by the com-

bination of neurologic clinical features (ataxia, abnormal
control of eye movement, and postural instability) with
R R R r R r r r telangiectasia and sometimes increased infections, and
conrmed by specic laboratory abnormalities (elevated
alpha-fetoprotein levels, increased chromosomal break-
age or cell death of white blood cells after exposure to
X-rays, absence of ATM protein in white blood cells, or
mutations in each of the persons ATM genes).
A variety of laboratory abnormalities occur in most peo-
ple with A-T, allowing for a tentative diagnosis to be
Unaected Unaected "Carrier" Aected made in the presence of typical clinical features. Not all
1 in 4 chance 2 in 4 chance 1 in 4 chance
abnormalities are seen in all patients. These abnormali-
ties include:
A-T is inherited in an autosomal recessive fashion
Elevated and slowly increasing alpha-fetoprotein
A-T is caused by mutations in the ATM (Ataxia Telang- levels in serum after 2 years of age
iectasia Mutated) gene which was cloned in 1995.[3] ATM
is located on human chromosome 11 (11q22.3) and is Immunodeciency with low levels of
made up of 69 exons spread across 150kb of genomic immunoglobulins (especially IgA, IgG subclasses,
DNA.[60] and IgE) and low number of lymphocytes in the
blood
The mode of inheritance for A-T is autosomal recessive.
Each parent is a carrier, meaning that they have one nor- Chromosomal instability (broken pieces of chromo-
mal copy of the A-T gene (ATM) and one copy which is somes)
mutated. A-T occurs if a child inherits the mutated A-T
gene from each parent, so in a family with two carrier par- Increased sensitivity of cells to x-ray exposure (cells
ents, there is 1 chance in 4 that a child born to the parents die or develop even more breaks and other damage
will have the disorder. Prenatal diagnosis (and carrier de- to chromosomes)[61]
tection) can be carried out in families if the errors (mu- Cerebellar atrophy on MRI scan
tation) in an aected childs two ATM genes have been
identied. The process of getting this done can be com- The diagnosis can be conrmed in the laboratory by nd-
plicated and, as it requires time, should be arranged be- ing an absence or deciency of the ATM protein in cul-
fore conception. tured blood cells,[62][63] an absence or deciency of ATM
Looking for mutations in the ATM gene of an unrelated function (kinase assay), or mutations in both copies of
person (for example, the spouse of a known A-T carrier) the cells ATM gene. These more specialized tests are
66 CHAPTER 6. HUMAN GENETIC DISEASES

not always needed, but are particularly helpful if a childs ataxia appears between 10 and 15 years of age, and dif-
symptoms are atypical. fers from A-T by the absence of telangiectasia and ocu-
lomotor apraxia, a normal alpha fetalprotein, and the fre-
quent presence of scoliosis, absent tendon reexes, and
6.4.5 Dierential diagnosis abnormal features on the EKG. Individuals with FA man-
ifest diculty standing in one place that is much en-
There are several other disorders with similar symptoms hanced by closure of the eyes (Romberg sign) that is not
or laboratory features that physicians may consider when so apparent in those with A-T even though those with
diagnosing A-T.[64] The three most common disorders A-T may have greater diculty standing in one place with
that are sometimes confused with A-T are: their eyes open.
There are other rare disorders that can be confused with
Cerebral palsy A-T, either because of similar clinical features, a similar-
ity of some laboratory features, or both. These include:
Friedreich ataxia

Cogan oculomotor apraxia. Ataxia oculomotor apraxia type 1 (AOA1)

Ataxia oculomotor apraxia type 2 (AOA2 also
Each of these can be distinguished from A-T by the neu- known as SCAR1)
rologic exam and clinical history.
Ataxia telangiectasia like disorder (ATLD)
Cerebral palsy (CP) describes a non-progressive disorder
of motor function stemming from malformation or early Nijmegen breakage syndrome (NBS)
damage to the brain. CP can manifest in many ways,
given the dierent manner in which brain can be dam-
aged; in common to all forms is the emergence of signs
and symptoms of impairment as the child develops. How-
ever, milestones that have been accomplished and neuro-
logic functions that have developed do not deteriorate in
CP as they often do in children with A-T in the late pre-
school years. Most children with ataxia caused by CP do
not begin to walk at a normal age, whereas most children
with A-T start to walk at a normal age even though they
often wobble from the start. Pure ataxia is a rare man-
ifestation of early brain damage or malformation, how-
ever, and the possibility of an occult genetic disorder of
brain should be considered and sought for those in whom
ataxia is the chief manif estation of CP. Children with
ataxic CP will not manifest the laboratory abnormalities
Comparison of clinical and laboratory features of rare genetic
associated with A-T.
disorders than can be confused with A-T
Cogan occulomotor apraxia is a rare disorder of develop-
ment. Aected children have diculty moving their eyes Ataxia oculomotor apraxia type 1 (AOA1) is an auto-
only to a new visual target, so they will turn their head somal recessive disorder similar to A-T in manifesting
past the target to drag the eyes to the new object of in- increasing problems with coordination and oculomotor
terest, then turn the head back. This tendency becomes apraxia, often at a similar age to those having A-T. It
evident in late infancy and toddler years, and mostly im- is caused by mutation in the gene coding for the protein
proves with time. This contrasts to the oculomotor di- aprataxin. Aected individuals dier from those with A-
culties evident in children with A-T, which are not evident T by the early appearance of peripheral neuropathy, early
in early childhood but emerge over time. Cogans oculo- in their course manifest diculty with initiation of gaze
motor apraxia is generally an isolated problem, or may be shifts, and the absence of ocular telangiectasia, but labo-
associated with broader developmental delay. ratory features are of key importance in the dierentia-
Friedreich ataxia (FA) is the most common genetic cause tion of the two. Individuals with AOA1 have a normal
of ataxia in children. Like A-T, FA is a recessive dis- AFP, normal measures of immune function, and after
ease, appearing in families without a history of the dis- 1015 years have low serum levels of albumin. Genetic
order. FA is caused by mutation in the frataxin gene, testing of the aprataxin gene can conrm the diagnosis.
most often an expansion of a naturally occurring repe- There is no enhanced risk for cancer.
tition of the three nucleotide bases GAA from the usual Ataxia oculomotor apraxia type 2 (AOA2) is an autoso-
5-33 repetitions of this trinucleotide sequence to greater mal recessive disorder also similar to A-T in manifest-
than 65 repeats on each chromosome. Most often the ing increasing problems with coordination and peripheral
6.4. ATAXIA TELANGIECTASIA
neuropathy, but oculomotor apraxia is present in only half
of aected individuals. Ocular telangiectasia do not de-
velop. Laboratory abnormalities of AOA2 are like A-T,
and unlike AOA1, in having an elevated serum AFP level,
but like AOA1 and unlike A-T in having normal mark-
ers of immune function. Genetic testing of the senataxin
gene (SETX) can conrm the diagnosis. There is no en-
hanced risk for cancer.
Ataxia-telangiectasia like disorder (ATLD) is an ex-
tremely rare condition, caused by mutation in the hMre11
gene, that could be considered in the dierential diag-
nosis of A-T. Patients with ATLD are very similar to
those with A-T in showing a progressive cerebellar ataxia,
hypersensitivity to ionizing radiation and genomic insta-
bility. Those rare individuals with ATLD who are well
described dier from those with A-T by the absence of
telangiectasia, normal immunoglobulin levels, a later on-
set, and a slower progression of the symptoms. Because
of its rarity, it is not yet known whether or not ATLD
carries an increased risk to develop cancer. Because those
mutations of Mre11 that severely impair the MRE11 pro-
tein are incompatible with life, individuals with ATLD
all have some partial function of the Mre11 protein, and
hence likely all have their own levels of disease severity.
Nijmegen breakage syndrome (NBS) is a rare genetic
disorder that has similar chromosomal instability to that
seen in people with A-T, but the problems experienced
are quite dierent. Children with NBS have signicant
microcephaly, a distinct facial appearance, short stature,
and moderate cognitive impairment, but do not experi-
ence any neurologic deterioration over time. Like those
with A-T, children with NBS have enhanced sensitivity
to radiation, disposition to lymphoma and leukemia, and
some laboratory measures of impaired immune function,
but do not have ocular telangiectasia or an elevated level
of AFP.
Interestingly, the proteins expressed by the hMre11 (de-
fective in ATLD) and Nbs1 (defective in NBS) genes ex-
ist in the cell as a complex, along with a third protein
expressed by the hRad50 gene. This complex, known as
the MRN complex, plays an important role in DNA dam-
age repair and signaling and is required to recruit ATM
to the sites of DNA double strand breaks. Mre11 and
Nbs1 are also targets for phosphorylation by the ATM ki-
nase. Thus, the similarity of the three diseases can be ex-
plained in part by the fact that the protein products of the
three genes mutated in these disorders interact in com-
mon pathways in the cell.
Dierentiation of these disorders is often possible with
clinical features and selected laboratory tests. In cases
where the distinction is unclear, clinical laboratories can
identify genetic abnormalities of ATM, aprataxin and
senataxin, and specialty centers can identify abnormal-
ity of the proteins of potentially responsible genes, such
as ATM, MRE11, nibrin, TDP1, aprataxin and senataxin
as well as other proteins important to ATM function such
67
as ATR, DNA-PK, and RAD50.
6.4.6 Management
Ataxia and other neurologic problems
There is no treatment known to slow or stop the progres-
sion of the neurologic problems. Treatment of A-T is
symptomatic and supportive. Physical, occupational and
speech therapies and exercise may help maintain function
but will not slow the course of neurodegeneration. Thera-
peutic exercises should not be used to the point of fatigue
and should not interfere with activities of daily life. Cer-
tain anti-Parkinson and anti-epileptic drugs maybe use-
ful in the management of symptoms, but should be pre-
scribed in consultation with a neurologist.
Immune problems
All individuals with A-T should have at least one compre-
hensive immunologic evaluation that measures the num-
ber and type of lymphocytes in the blood (T-lymphocytes
and B-lymphocytes), the levels of serum immunoglobu-
lins (IgG, IgA, and IgM) and antibody responses to T-
dependent (e.g., tetanus, Hemophilus inuenzae b) and
T-independent (23-valent pneumococcal polysaccharide)
vaccines. For the most part, the pattern of immunode-
ciency seen in an A-T patient early in life (by age ve)
will be the same pattern seen throughout the lifetime of
that individual. Therefore, the tests need not be repeated
unless that individual develops more problems with in-
fection. Problems with immunity sometimes can be over-
come by immunization. Vaccines against common bac-
terial respiratory pathogens such as Hemophilus inuen-
zae, pneumococci and inuenza virus (the u) are com-
mercially available and often help to boost antibody re-
sponses, even in individuals with low immunoglobulin
levels. If the vaccines do not work and the patient con-
tinues to have problems with infections, gamma globu-
lin therapy (IV or subcutaneous infusions of antibodies
collected from normal individuals) may be of benet. A
small number of people with A-T develop an abnormal-
ity in which one or more types of immunoglobulin are in-
creased far beyond the normal range. In a few cases, the
immunoglobulin levels can be increased so much that the
blood becomes thick and does not ow properly. Therapy
for this problem must be tailored to the specic abnormal-
ity found and its severity.
If an individual patients susceptibility to infection in-
creases, it is important to reassess immune function in
case deterioration has occurred and a new therapy is in-
dicated. If infections are occurring in the lung, it is also
important to investigate the possibility of dysfunctional
swallow with aspiration into the lungs (see above sec-
tions under Symptoms: Lung Disease and Symptoms:
Feeding, Swallowing and Nutrition.)
68
Most people with A-T have low lymphocyte counts in the
blood. This problem seems to be relatively stable with
age, but a rare number of people do have progressively
decreasing lymphocyte counts as they get older. In the
general population, very low lymphocyte counts are as-
sociated with an increased risk for infection. Such in-
dividuals develop complications from live viral vaccines
(measles, mumps, rubella and chickenpox), chronic or
severe viral infections, yeast infections of the skin and
vagina, and opportunistic infections (such as pneumocys-
tis pneumonia). Although lymphocyte counts are often
as low in people with A-T, they seldom have problems
with opportunistic infections. (The one exception to that
rule is that problems with chronic or recurrent warts are
common.) The number and function of T-lymphocytes
should be re-evaluated if a person with A-T is treated with
corticosteroid drugs such as prednisone for longer than a
few weeks or is treated with chemotherapy for cancer. If
lymphocyte counts are low in people taking those types of
drugs, the use of prophylactic antibiotics is recommended
to prevent opportunistic infections.
If the tests show signicant abnormalities of the immune
system, a specialist in immunodeciency or infectious
diseases will be able to discuss various treatment op-
tions. Absence of immunoglobulin or antibody responses
to vaccine can be treated with replacement gamma globu-
lin infusions, or can be managed with prophylactic antibi-
otics and minimized exposure to infection. If antibody
function is normal, all routine childhood immunizations
including live viral vaccines (measles, mumps, rubella
and varicella) should be given. In addition, several spe-
cial vaccines (that is, licensed but not routine for other-
wise healthy children and young adults) should be given
to decrease the risk that an A-T patient will develop lung
infections. The patient and all household members should
receive the inuenza (u) vaccine every fall. People with
A-T who are less than two years old should receive three
(3) doses of a pneumococcal conjugate vaccine (Prevnar)
given at two month intervals. People older than two years
who have not previously been immunized with Prevnar
should receive two (2) doses of Prevnar. At least 6 months
after the last Prevnar has been given and after the child
is at least two years old, the 23-valent pneumococcal vac-
cine should be administered. Immunization with the 23-
valent pneumococcal vaccine should be repeated approx-
imately every ve years after the rst dose.
In people with A-T who have low levels of IgA, further
testing should be performed to determine whether the IgA
level is low or completely absent. If absent, there is a
slightly increased risk of a transfusion reaction. Medi-
cal Alert bracelets are not necessary, but the family and
primary physician should be aware that if there is elective
surgery requiring red cell transfusion, the cells should be Children and adults with chronic dry cough, increased
washed to decrease the risk of an allergic reaction.
People with A-T also have an increased risk of develop- tious process to explain respiratory symptoms should be
ing autoimmune or chronic inammatory diseases. This evaluated for interstitial lung disease or another intrapul-
risk is probably a secondary eect of their immunode- monary process. Evaluation by a Pulmonologist and a
CHAPTER 6. HUMAN GENETIC DISEASES
ciency and not a direct eect of the lack of ATM protein.
The most common examples of such disorders in A-T in-
clude immune thrombocytopenia (ITP), several forms of
arthritis, and vitiligo.
Lung disease
Recurrent sinus and lung infections can lead to the de-
velopment of chronic lung disease.[13] Such infections
should be treated with appropriate antibiotics to pre-
vent and limit lung injury. Administration of antibi-
otics should be considered when children and adults have
prolonged respiratory symptoms (greater than 7 days),
even following what was presumed to have been a vi-
ral infection. To help prevent respiratory illnesses from
common respiratory pathogens, annual inuenza vaccina-
tions should be given and pneumococcal vaccines should
be administered when appropriate. Antibiotic treatment
should also be considered in children with chronic coughs
that are productive of mucous, those who do not respond
to aggressive pulmonary clearance techniques and in chil-
dren with muco-purulent secretions from the sinuses or
chest. A wet cough can also be associated with chronic
aspiration which should be ruled out through proper di-
agnostic studies, however aspiration and respiratory in-
fections are not necessarily exclusive of each other. In
children and adults with bronchiectasis, chronic antibi-
otic therapy should be considered to slow chronic lung
disease progression.
Culturing of the sinuses may be needed to direct antibi-
otic therapy. This can be done by an Ear Nose and Throat
(ENT) specialist. In addition, diagnostic bronchoscopy
may be necessary in people who have recurrent pneumo-
nias, especially those who do not respond or respond in-
completely to a course of antibiotics.
Clearance of bronchial secretions is essential for good
pulmonary health and can help limit injury from acute
and chronic lung infections. Children and adults with
increased bronchial secretions can benet from routine
chest therapy using the manual method, an a cappella de-
vice or a chest physiotherapy vest. Chest physiotherapy
can help bring up mucous from the lower bronchial tree,
however an adequate cough is needed to remove secre-
tions. In people who have decreased lung reserve and
a weak cough, use of an insuator-exsuator (cough-
assist) device may be useful as a maintenance ther-
apy or during acute respiratory illnesses to help remove
bronchial secretions from the upper airways. Evaluation
by a Pulmonology specialist however, should rst be done
to properly assess patient suitability.
work of breathing (fast respiratory rate, shortness of
breath at rest or with activities) and absence of an infec-
6.4. ATAXIA TELANGIECTASIA
CT scan of the chest should be considered in individuals
with symptoms of interstitial lung disease or to rule other
non-infectious pulmonary processes. People diagnosed
with interstitial lung disease may benet from systemic
steroids.
Feeding, swallowing and nutrition
Oral intake may be aided by teaching persons with A-T
how to drink, chew and swallow more safely. The pro-
priety of treatments for swallowing problems should be
determined following evaluation by an expert in the eld
of speech-language pathology. Dieticians may help treat
nutrition problems by recommending dietary modica-
tions, including high calorie foods or food supplements.
A feeding (gastrostomy) tube is recommended when any
of the following occur:[65]
A child cannot eat enough to grow or a person of any
age cannot eat enough to maintain weight;
Aspiration is problematic;
Mealtimes are stressful or too long, interfering with
other activities.
Feeding tubes can decrease the risk of aspiration by en-
abling persons to avoid liquids or foods that are dicult to
swallow and provide adequate calories without the stress
and time commitment of prolonged meals. Gastrostomy
tubes do not prevent people from eating by mouth. Once
a tube is in place, the general goal should be to maintain
weight at the 10-25th percentile.
Education and socialization
Most children with A-T have diculty in school because
of a delay in response time to visual, verbal or other cues,
slurred and quiet speech (dysarthria), abnormalities of
eye control (oculomotor apraxia), and impaired ne mo-
tor control. Despite these problems, children with A-T
often enjoy school if proper accommodations to their dis-
ability can be made. The decision about the need for spe-
cial education classes or extra help in regular classes is
highly inuenced by the local resources available. Deci-
sions about proper educational placement should be re-
visited as often as circumstances warrant. Despite their
many neurologic impairments, most individuals with A-T
are very socially aware and socially skilled, and thus ben-
et from sustained peer relationships developed at school.
Some individuals are able to function quite well despite
their disabilities and a few have graduated from commu-
nity colleges.
Many of the problems encountered will benet from spe-
cial attention, as problems are often related more to in-
put and output issues than to intellectual impairment.
Problems with eye movement control make it dicult for
69
people with A-T to read, yet most fully understand the
meaning and nuances of text that is read to them. Delays
in speech initiation and lack of facial expression make it
seem that they do not know the answers to questions. Re-
duction of the skilled eort needed to answer questions,
and an increase of the time available to respond, is often
rewarded by real accomplishment. It is important to rec-
ognize that intellectual disability is not regularly a part of
the clinical picture of A-T although school performance
may be suboptimal because of the many diculties in
reading, writing, and speech. Children with A-T are of-
ten very conscious of their appearance, and strive to ap-
pear normal to their peers and teachers. Life within the
ataxic body can be tiring. The enhanced eort needed
to maintain appearances and increased energy expended
in abnormal tone and extra movements all contribute to
physical and mental fatigue. As a consequence, for some
a shortened school day yields real benets.
General recommendations
All children with A-T need special attention to the
barriers they experience in school. In the United
States, this takes the form of a formal IEP (Individ-
ualized Education Program).
Children with A-T tend to be excellent problem
solvers. Their involvement in how to best perform
tasks should be encouraged.
Speech-language pathologists may facilitate com-
munication skills that enable persons with A-T to get
their messages across (using key words vs. complete
sentences) and teach strategies to decrease frustra-
tion associated with the increase time needed to
respond to questions (e.g., holding up a hand and
others about the need to allow more time for re-
sponses). Rarely helpful are traditional speech ther-
apies that focus on the production of specic sounds
and strengthening of the lip and tongue muscles.
Classroom aides may be appropriate, especially
to help with scribing, transportation through the
school, mealtimes and toileting. The impact of an
aide on peer relationships should be monitored care-
fully.
Physical therapy is useful to maintain strength and
general cardiovascular health. Horseback therapy
and exercises in a swimming pool are often well-
tolerated and fun for people with A-T. However, no
amount of practice will slow the cerebellar degen-
eration or improve neurologic function. Exercise to
the point of exhaustion should be avoided.
Hearing is normal throughout life. Books on tape
may be a useful adjunct to traditional school mate-
rials.
Early use of computers (preschool) with word com-
pletion software should be encouraged.
70
Practicing coordination (e.g. balance beam or cur- 6.4.11
sive writing exercises) is not helpful.
Occupational therapy is helpful for managing daily
living skills.
Allow rest time, shortened days, reduced class
schedule, reduced homework, modied tests as nec-
essary.
Like all children, those with A-T need to have goals
to experience the satisfaction of making progress.
Social interactions with peers are important, and
should be taken into consideration for class place-
ment. For everyone long-term peer relationships
can be the most rewarding part of life; for those with
A-T establishing these connections in school years
can be helpful.
6.4.7 Clinics and support
The US, UK, Australia, Israel, The Netherlands, Ger-
many, Poland, Norway and Japan have specialized clin-
ics for patients with A-T. These clinics house multidisci-
plinary medical teams, including neurologists, immunol-
ogists, pulmonologists and therapists, capable of dealing
with the many facets of this disease.
6.4.8 Epidemiology
Individuals of all races and ethnicities are aected
equally. The incidence world-wide is estimated to be be-
tween 1 in 40,000 and 1 in 100,000 people.[4][66]
6.4.9 Prognosis
The life expectancy of people with A-T is highly variable.
The average is approximately 25 years, but continues to
improve with advances in care. The two most common
causes of death are chronic lung disease (about one-third
of cases) and cancer (about one-third of cases).
6.4.10 Research directions
An open-label Phase II clinical trial studying the use of
red blood cells (erythrocytes) loaded with dexametha-
sone sodium phosphate found that this treatment im-
proved symptoms and appeared to be well tolerated.[67]
This treatment uses a unique delivery system for medica-
tion by using the patients own red blood cells as the deliv-
ery vehicle for the drug.[68] Given the other immunologic
decits present in individuals with A-T, there remains a
need to evaluate the therapeutic potential of steroids fur-
ther, particularly with respect to the duration of any ben-
et and its long-term safety.
CHAPTER 6. HUMAN GENETIC DISEASES
References
[1] Louis-Bar D (1941). Sur un syndrome progressif corm-
prenant des tlangiectasies capillaires cutanes et conjonc-
tivales symtriques, disposition naevode et des troubles
crbelleux. Connia Neurologica. 4: 3242.
[2] Boder, E. (1985). Ataxia-telangiectasia: an overview..
Kroc Foundation series. 19: 163. PMID 2415689.
[3] Savitsky, K.; Bar-Shira, A.; Gilad, S.; Rotman, G.; Ziv,
Y.; Vanagaite, L.; Tagle, D. A.; Smith, S.; Uziel, T.; Sfez,
S.; Ashkenazi, M.; Pecker, I.; Frydman, M.; Harnik, R.;
Patanjali, S. R.; Simmons, A.; Clines, G. A.; Sartiel, A.;
Gatti, R. A.; Chessa, L.; Sanal, O.; Lavin, M. F.; Jaspers,
N. G.; Taylor, A. M.; Arlett, C. F.; Miki, T.; Weissman, S.
M.; Lovett, M.; Collins, F. S.; Shiloh, Y. (Jun 23, 1995).
A single ataxia telangiectasia gene with a product sim-
ilar to PI-3 kinase.. Science. 268 (5218): 174953.
doi:10.1126/science.7792600. PMID 7792600.
[4] Shiloh, Y.; Kastan, M. B. (2001). ATM: genome
stability, neuronal development, and cancer cross
paths.. Advances in cancer research. 83: 20954.
doi:10.1016/s0065-230x(01)83007-4. PMID 11665719.
[5] Crawford, T. O. (December 1998). Ataxia telangiec-
tasia.. Seminars in pediatric neurology. 5 (4): 28794.
doi:10.1016/s1071-9091(98)80007-7. PMID 9874856.
[6] Crawford, T. O.; Mandir, A. S.; Lefton-Greif, M. A.;
Goodman, S. N.; Goodman, B. K.; Sengul, H.; Lederman,
H. M. (Apr 11, 2000). Quantitative neurologic assess-
ment of ataxia-telangiectasia.. Neurology. 54 (7): 1505
9. doi:10.1212/wnl.54.7.1505. PMID 10751267.
[7] Cabana, M. D.; Crawford, T. O.; Winkelstein, J. A.;
Christensen, J. R.; Lederman, H. M. (July 1998).
Consequences of the delayed diagnosis of ataxia-
telangiectasia.. Pediatrics. 102 (1 Pt 1): 98100.
doi:10.1542/peds.102.1.98. PMID 9651420.
[8] Nowak-Wegrzyn, A.; Crawford, T. O.; Winkelstein,
J. A.; Carson, K. A.; Lederman, H. M. (April
2004). Immunodeciency and infections in ataxia-
telangiectasia. The Journal of Pediatrics. 144 (4): 505
11. doi:10.1016/j.jpeds.2003.12.046. PMID 15069401.
[9] Reiman, A.; Srinivasan, V.; Barone, G.; Last, J. I.; Woot-
ton, L. L.; Davies, E. G.; Verhagen, M. M.; Willemsen,
M. A.; Weemaes, C. M.; Byrd, P. J.; Izatt, L.; Easton,
D. F.; Thompson, D. J.; Taylor, A. M. (Aug 9, 2011).
Lymphoid tumours and breast cancer in ataxia telang-
iectasia; substantial protective eect of residual ATM ki-
nase activity against childhood tumours.. British Journal
of Cancer. 105 (4): 58691. doi:10.1038/bjc.2011.266.
PMC 3170966 . PMID 21792198.
[10] Thompson, D.; Duedal, S.; Kirner, J.; McGuog, L.;
Last, J.; Reiman, A.; Byrd, P.; Taylor, M.; Eas-
ton, D. F. (Jun 1, 2005). Cancer risks and mor-
tality in heterozygous ATM mutation carriers.. Jour-
nal of the National Cancer Institute. 97 (11): 81322.
doi:10.1093/jnci/dji141. PMID 15928302.
6.4. ATAXIA TELANGIECTASIA
[11] Renwick, A.; Thompson, D.; Seal, S.; Kelly, P.; Chag-
tai, T.; Ahmed, M.; North, B.; Jayatilake, H.; Barfoot,
R.; Spanova, K.; McGuog, L.; Evans, D. G.; Eccles, D.;
Breast Cancer Susceptibility Collaboration, (UK); Easton,
D. F.; Stratton, M. R.; Rahman, N. (August 2006). ATM
mutations that cause ataxia-telangiectasia are breast can-
cer susceptibility alleles.. Nature Genetics. 38 (8): 873
5. doi:10.1038/ng1837. PMID 16832357.
[12] Paller, A. S.; Massey, R. B.; Curtis, M. A.; Pelachyk,
J. M.; Dombrowski, H. C.; Leickly, F. E.; Swift, M.
(December 1991). Cutaneous granulomatous lesions
in patients with ataxia-telangiectasia.. The Journal
of Pediatrics. 119 (6): 91722. doi:10.1016/s0022-
3476(05)83043-4. PMID 1960607.
[13] McGrath-Morrow, S. A.; Gower, W. A.; Rothblum-
Oviatt, C.; Brody, A. S.; Langston, C.; Fan, L. L.; Lefton-
Greif, M. A.; Crawford, T. O.; Troche, M.; Sandlund, J.
T.; Auwaerter, P. G.; Easley, B.; Loughlin, G. M.; Car-
roll, J. L.; Lederman, H. M. (September 2010). Eval-
uation and management of pulmonary disease in ataxia-
telangiectasia.. Pediatric pulmonology. 45 (9): 84759.
doi:10.1002/ppul.21277. PMID 20583220.
[14] Lefton-Greif, M. A.; Crawford, T. O.; Winkelstein,
J. A.; Loughlin, G. M.; Koerner, C. B.; Zahurak,
M.; Lederman, H. M. (February 2000). Oropharyn-
geal dysphagia and aspiration in patients with ataxia-
telangiectasia.. The Journal of Pediatrics. 136 (2):
22531. doi:10.1016/s0022-3476(00)70106-5. PMID
10657830.
[15] Farr, A. K.; Shalev, B.; Crawford, T. O.; Lederman,
H. M.; Winkelstein, J. A.; Repka, M. X. (December
2002). Ocular manifestations of ataxia-telangiectasia..
American journal of ophthalmology. 134 (6): 8916.
doi:10.1016/s0002-9394(02)01796-8. PMID 12470759.
[16] Savitsky, K.; Bar-Shira, A.; Gilad, S.; Rotman, G.; Ziv,
Y.; Vanagaite, L.; Tagle, D. A.; Smith, S.; Uziel, T.; Sfez,
S.; Ashkenazi, M.; Pecker, I.; Frydman, M.; Harnik, R.;
Patanjali, S. R.; Simmons, A.; Clines, G. A.; Sartiel, A.;
Gatti, R. A.; Chessa, L.; Sanal, O.; Lavin, M. F.; Jaspers,
N. G.; Taylor, A. M.; Arlett, C. F.; Miki, T.; Weissman, S.
M.; Lovett, M.; Collins, F. S.; Shiloh, Y. (Jun 23, 1995).
A single ataxia telangiectasia gene with a product sim-
ilar to PI-3 kinase.. Science. 268 (5218): 174953.
doi:10.1126/science.7792600. PMID 7792600.
[17] Derheimer, F. A.; Kastan, M. B. (Sep 10, 2010).
Multiple roles of ATM in monitoring and maintain-
ing DNA integrity.. FEBS Letters. 584 (17): 3675
81. doi:10.1016/j.febslet.2010.05.031. PMC 2950315 .
PMID 20580718.
[18] Kurz, E. U.; Lees-Miller, S. P. (AugSep 2004). DNA
damage-induced activation of ATM and ATM-dependent
signaling pathways.. DNA repair. 3 (8-9): 889900.
doi:10.1016/j.dnarep.2004.03.029. PMID 15279774.
[19] Dar, I.; Biton, S.; Shiloh, Y.; Barzilai, A. (Jul 19,
2006). Analysis of the ataxia telangiectasia mutated-
mediated DNA damage response in murine cerebellar
neurons.. The Journal of neuroscience : the ocial
71
journal of the Society for Neuroscience. 26 (29): 7767
74. doi:10.1523/JNEUROSCI.2055-06.2006. PMID
16855104.
[20] Gorodetsky, E.; Calkins, S.; Ahn, J.; Brooks, P. J.
(November 2007). ATM, the Mre11/Rad50/Nbs1
complex, and topoisomerase I are concentrated in
the nucleus of Purkinje neurons in the juvenile hu-
man brain.. DNA repair. 6 (11): 1698707.
doi:10.1016/j.dnarep.2007.06.011. PMC 2797317 .
PMID 17706468.
[21] Valentin-Vega, Y. A.; Maclean, K. H.; Tait-Mulder,
J.; Milasta, S.; Steeves, M.; Dorsey, F. C.; Cleveland,
J. L.; Green, D. R.; Kastan, M. B. (Feb 9, 2012).
Mitochondrial dysfunction in ataxia-telangiectasia..
Blood. 119 (6): 1490500. doi:10.1182/blood-2011-08-
373639. PMC 3286212 . PMID 22144182.
[22] Guo, Z.; Kozlov, S.; Lavin, M. F.; Person, M. D.;
Paull, T. T. (Oct 22, 2010). ATM activation by
oxidative stress.. Science. 330 (6003): 51721.
doi:10.1126/science.1192912. PMID 20966255.
[23] Bakkenist, C. J.; Kastan, M. B. (Jan 30, 2003). DNA
damage activates ATM through intermolecular autophos-
phorylation and dimer dissociation.. Nature. 421 (6922):
499506. doi:10.1038/nature01368. PMID 12556884.
[24] Kanu, N.; Behrens, A. (Nov 15, 2008). ATMIN-
istrating ATM signalling: regulation of ATM by AT-
MIN.. Cell cycle (Georgetown, Tex.). 7 (22): 34836.
doi:10.4161/cc.7.22.7044. PMID 19001856.
[25] Shiloh, Y. (March 2003). ATM and related protein ki-
nases: safeguarding genome integrity.. Nature Reviews
Cancer. 3 (3): 15568. doi:10.1038/nrc1011. PMID
12612651.
[26] Barlow, C.; Hirotsune, S.; Paylor, R.; Liyanage, M.; Eck-
haus, M.; Collins, F.; Shiloh, Y.; Crawley, J. N.; Ried,
T.; Tagle, D.; Wynshaw-Boris, A. (Jul 12, 1996). Atm-
decient mice: a paradigm of ataxia telangiectasia.. Cell.
86 (1): 15971. doi:10.1016/S0092-8674(00)80086-0.
PMID 8689683.
[27] Plug, A. W.; Peters, A. H.; Xu, Y.; Keegan, K. S.; Hoek-
stra, M. F.; Baltimore, D.; de Boer, P.; Ashley, T. (De-
cember 1997). ATM and RPA in meiotic chromosome
synapsis and recombination.. Nature Genetics. 17 (4):
45761. doi:10.1038/ng1297-457. PMID 9398850.
[28] Barchi, M.; Roig, I.; Di Giacomo, M.; de Rooij,
D. G.; Keeney, S; Jasin, M. (May 23, 2008).
ATM promotes the obligate XY crossover and both
crossover control and chromosome axis integrity on
autosomes.. PLOS Genetics. 4 (5): e1000076.
doi:10.1371/journal.pgen.1000076. PMC 2374915 .
PMID 18497861.
[29] Lumsden, J. M.; McCarty, T.; Petiniot, L. K.; Shen, R.;
Barlow, C.; Wynn, T. A.; Morse III, H. C.; Gearhart,
P. J.; Wynshaw-Boris, A.; Max, E. E.; Hodes, R.
J. (Nov 1, 2004). Immunoglobulin class switch re-
combination is impaired in Atm-decient mice.. The
Journal of Experimental Medicine. 200 (9): 111121.
72
doi:10.1084/jem.20041074. PMC 2211853 . PMID
15504820.
[30] Franco, S.; Alt, F. W.; Manis, J. P. (Sep 8,
2006). Pathways that suppress programmed DNA
breaks from progressing to chromosomal breaks and
translocations.. DNA repair. 5 (9-10): 103041.
doi:10.1016/j.dnarep.2006.05.024. PMID 16934538.
[31] Calln, E.; Jankovic, M.; Wong, N.; Zha, S.; Chen,
H. T.; Dilippantonio, S.; Di Virgilio, M.; Heidkamp,
G.; Alt, F. W.; Nussenzweig, A.; Nussenzweig, M.
(May 15, 2009). Essential role for DNA-PKcs in
DNA double-strand break repair and apoptosis in ATM-
decient lymphocytes.. Molecular Cell. 34 (3): 28597.
doi:10.1016/j.molcel.2009.04.025. PMC 2709792 .
PMID 19450527.
[32] Bagley, J.; Singh, G.; Iacomini, J. (Apr 15, 2007). Regu-
lation of oxidative stress responses by ataxia-telangiectasia
mutated is required for T cell proliferation.. Journal of
Immunology (Baltimore, Md. : 1950). 178 (8): 475763.
doi:10.4049/jimmunol.178.8.4757. PMID 17404255.
[33] Bredemeyer, A. L.; Sharma, G. G.; Huang, C. Y.;
Helmink, B. A.; Walker, L. M.; Khor, K. C.; Nuskey,
B.; Sullivan, K. E.; Pandita, T. K.; Bassing, C. H.; Sleck-
man, B. P. (Jul 27, 2006). ATM stabilizes DNA double-
strand-break complexes during V(D)J recombination..
Nature. 442 (7101): 46670. doi:10.1038/nature04866.
PMID 16799570.
[34] Bredemeyer, A. L.; Huang, C. Y.; Walker, L. M.;
Bassing, C. H.; Sleckman, B. P. (Aug 15, 2008).
Aberrant V(D)J recombination in ataxia telangiectasia
mutated-decient lymphocytes is dependent on nonho-
mologous DNA end joining.. Journal of Immunol-
ogy (Baltimore, Md. : 1950). 181 (4): 26205.
doi:10.4049/jimmunol.181.4.2620. PMID 18684952.
[35] Bredemeyer, A. L.; Helmink, B. A.; Innes, C. L.;
Calderon, B.; McGinnis, L. M.; Mahowald, G. K.; Ga-
pud, E. J.; Walker, L. M.; Collins, J. B.; Weaver, B. K.;
Mandik-Nayak, L.; Schreiber, R. D.; Allen, P. M.; May,
M. J.; Paules, R. S.; Bassing, C. H.; Sleckman, B. P. (Dec
11, 2008). DNA double-strand breaks activate a multi-
functional genetic program in developing lymphocytes..
Nature. 456 (7223): 81923. doi:10.1038/nature07392.
PMC 2605662 . PMID 18849970.
[36] Calln, E.; Jankovic, M.; Dilippantonio, S.; Daniel, J.
A.; Chen, H. T.; Celeste, A.; Pellegrini, M.; McBride, K.;
Wangsa, D.; Bredemeyer, A. L.; Sleckman, B. P.; Ried,
T.; Nussenzweig, M.; Nussenzweig, A. (Jul 13, 2007).
ATM prevents the persistence and propagation of chro-
mosome breaks in lymphocytes.. Cell. 130 (1): 6375.
doi:10.1016/j.cell.2007.06.016. PMID 17599403.
[37] Shiloh, Y.; Tabor, E.; Becker, Y. (July 1982). Colony-
forming ability of ataxia-telangiectasia skin broblasts is
an indicator of their early senescence and increased de-
mand for growth factors.. Experimental Cell Research.
140 (1): 1919. doi:10.1016/0014-4827(82)90169-0.
PMID 6213420.
CHAPTER 6. HUMAN GENETIC DISEASES
[38] Inomata, K.; Aoto, T.; Binh, N. T.; Okamoto, N.; Tan-
imura, S.; Wakayama, T.; Iseki, S.; Hara, E.; Masunaga,
T.; Shimizu, H.; Nishimura, E. K. (Jun 12, 2009). Geno-
toxic stress abrogates renewal of melanocyte stem cells by
triggering their dierentiation.. Cell. 137 (6): 108899.
doi:10.1016/j.cell.2009.03.037. PMID 19524511.
[39] Stray-Pedersen, A.; Borresen-Dale, A. L.; Paus, E.; Lind-
man, C. R.; Burgers, T.; Abrahamsen, T. G. (November
2007). Alpha fetoprotein is increasing with age in ataxia-
telangiectasia.. European Journal of Paediatric Neurol-
ogy. 11 (6): 37580. doi:10.1016/j.ejpn.2007.04.001.
PMID 17540590.
[40] Biton, S.; Dar, I.; Mittelman, L.; Pereg, Y.; Barzilai, A.;
Shiloh, Y. (Jun 23, 2006). Nuclear ataxia-telangiectasia
mutated (ATM) mediates the cellular response to DNA
double strand breaks in human neuron-like cells.. The
Journal of Biological Chemistry. 281 (25): 1748291.
doi:10.1074/jbc.M601895200. PMID 16627474.
[41] Herzog, K. H.; Chong, M. J.; Kapsetaki, M.; Morgan, J. I.;
McKinnon, P. J. (May 15, 1998). Requirement for Atm
in ionizing radiation-induced cell death in the developing
central nervous system.. Science. 280 (5366): 108991.
doi:10.1126/science.280.5366.1089. PMID 9582124.
[42] Lee, Y.; Chong, M. J.; McKinnon, P. J. (Sep 1, 2001).
Ataxia telangiectasia mutated-dependent apoptosis after
genotoxic stress in the developing nervous system is deter-
mined by cellular dierentiation status.. The Journal of
neuroscience : the ocial journal of the Society for Neu-
roscience. 21 (17): 668793. PMID 11517258.
[43] Sordet, O.; Redon, C. E.; Guirouilh-Barbat, J.; Smith, S.;
Solier, S.; Douarre, C.; Conti, C.; Nakamura, A. J.; Das,
B. B.; Nicolas, E.; Kohn, K. W.; Bonner, W. M.; Pom-
mier, Y. (August 2009). Ataxia telangiectasia mutated
activation by transcription- and topoisomerase I-induced
DNA double-strand breaks.. EMBO Reports. 10 (8):
88793. doi:10.1038/embor.2009.97. PMC 2726680 .
PMID 19557000.
[44] Das, B. B.; Antony, S.; Gupta, S.; Dexheimer, T. S.; Re-
don, C. E.; Gareld, S.; Shiloh, Y.; Pommier, Y. (Dec
2, 2009). Optimal function of the DNA repair en-
zyme TDP1 requires its phosphorylation by ATM and/or
DNA-PK.. The EMBO Journal. 28 (23): 366780.
doi:10.1038/emboj.2009.302. PMC 2790489 . PMID
19851285.
[45] Iourov, I. Y.; Vorsanova, S. G.; Liehr, T.; Kolotii, A.
D.; Yurov, Y. B. (Jul 15, 2009). Increased chro-
mosome instability dramatically disrupts neural genome
integrity and mediates cerebellar degeneration in the
ataxia-telangiectasia brain.. Human Molecular Genet-
ics. 18 (14): 265669. doi:10.1093/hmg/ddp207. PMID
19414482.
[46] Guo, Z; Kozlov, S; Lavin, MF; Person, MD; Paull,
TT (22 October 2010). ATM activation by ox-
idative stress.. Science. 330 (6003): 51721.
doi:10.1126/science.1192912. PMID 20966255.
[47] Alexander, A; Cai, SL; Kim, J; Nanez, A; Sahin, M;
MacLean, KH; Inoki, K; Guan, KL; Shen, J; Person,
6.4. ATAXIA TELANGIECTASIA
MD; Kusewitt, D; Mills, GB; Kastan, MB; Walker, CL
(2 March 2010). ATM signals to TSC2 in the cy-
toplasm to regulate mTORC1 in response to ROS..
Proceedings of the National Academy of Sciences of
the United States of America. 107 (9): 41538.
doi:10.1073/pnas.0913860107. PMC 2840158 . PMID
20160076.
[48] Cosentino, C; Grieco, D; Costanzo, V (2 February 2011).
ATM activates the pentose phosphate pathway promot-
ing anti-oxidant defence and DNA repair.. The EMBO
Journal. 30 (3): 54655. doi:10.1038/emboj.2010.330.
PMC 3034007 . PMID 21157431.
[49] Biton, S.; Barzilai, A.; Shiloh, Y. (Jul 1, 2008). The
neurological phenotype of ataxia-telangiectasia: solving
a persistent puzzle.. DNA repair. 7 (7): 102838.
doi:10.1016/j.dnarep.2008.03.006. PMID 18456574.
[50] Valentin-Vega, YA; Maclean, KH; Tait-Mulder, J; Mi-
lasta, S; Steeves, M; Dorsey, FC; Cleveland, JL; Green,
DR; Kastan, MB (9 February 2012). Mitochondrial
dysfunction in ataxia-telangiectasia.. Blood. 119 (6):
1490500. doi:10.1182/blood-2011-08-373639. PMC
3286212 . PMID 22144182.
[51] D'Souza, AD; Parish, IA; Krause, DS; Kaech, SM;
Shadel, GS (January 2013). Reducing mitochondrial
ROS improves disease-related pathology in a mouse
model of ataxia-telangiectasia.. Molecular therapy : the
journal of the American Society of Gene Therapy. 21
(1): 428. doi:10.1038/mt.2012.203. PMC 3538311 .
PMID 23011031.
[52] Sharma, NK; Lebedeva, M; Thomas, T; Kovalenko,
OA; Stumpf, JD; Shadel, GS; Santos, JH (January
2014). Intrinsic mitochondrial DNA repair defects
in Ataxia Telangiectasia.. DNA repair. 13: 2231.
doi:10.1016/j.dnarep.2013.11.002. PMID 24342190.
[53] Yang, Y.; Herrup, K. (Mar 9, 2005). Loss of neu-
ronal cell cycle control in ataxia-telangiectasia: a uni-
ed disease mechanism.. The Journal of neuroscience
: the ocial journal of the Society for Neuroscience. 25
(10): 25229. doi:10.1523/JNEUROSCI.4946-04.2005.
PMID 15758161.
[54] Li, J.; Han, Y. R.; Plummer, M. R.; Herrup, K. (Dec
29, 2009). Cytoplasmic ATM in neurons modulates
synaptic function.. Current Biology. 19 (24): 2091
6. doi:10.1016/j.cub.2009.10.039. PMC 2805770 .
PMID 19962314.
[55] Nuclear accumulation of HDAC4 in ATM de-
ciency promotes neurodegeneration in ataxia telangiec-
tasia.. Nat Med. 18 (5): 78390. May 2012.
doi:10.1038/nm.2709. PMID 22466704.
[56] ATM and the epigenetics of the neuronal genome..
Mech Ageing Dev. 134 (10): 4349. Oct 2013.
doi:10.1016/j.mad.2013.05.005. PMID 23707635.
[57] Li, J; Hart, RP; Mallimo, EM; Swerdel, MR; Kus-
necov, AW; Herrup, K (December 2013). EZH2-
mediated H3K27 trimethylation mediates neurodegener-
ation in ataxia-telangiectasia.. Nature Neuroscience. 16
73
(12): 174553. doi:10.1038/nn.3564. PMC 3965909 .
PMID 24162653.
[58] Jiang, D; Zhang, Y; Hart, RP; Chen, J; Herrup,
K; Li, J (December 2015). Alteration in 5-
hydroxymethylcytosine-mediated epigenetic regulation
leads to Purkinje cell vulnerability in ATM deciency..
Brain : a journal of neurology. 138 (Pt 12): 352036.
doi:10.1093/brain/awv284. PMID 26510954.
[59] Wood, LM; Sankar, S; Reed, RE; Haas, AL; Liu,
LF; McKinnon, P; Desai, SD (26 January 2011). A
novel role for ATM in regulating proteasome-mediated
protein degradation through suppression of the ISG15
conjugation pathway.. PLOS ONE. 6 (1): e16422.
doi:10.1371/journal.pone.0016422. PMC 3027683 .
PMID 21298066.
[60] Gatti, R. A.; Berkel, I.; Boder, E.; Braedt, G.; Charm-
ley, P.; Concannon, P.; Ersoy, F.; Foroud, T.; Jaspers, N.
G.; Lange, K.; et al. (1988). Localization of an ataxia-
telangiectasia gene to chromosome 11q22-23. Nature.
336 (6199): 577580. doi:10.1038/336577a0. PMID
3200306.
[61] Sun, X.; Becker-Catania, S. G.; Chun, H. H.; Hwang,
M. J.; Huo, Y.; Wang, Z.; Mitui, M.; Sanal, O.; Chessa,
L.; Crandall, B.; Gatti, R. A. (June 2002). Early diag-
nosis of ataxia-telangiectasia using radiosensitivity test-
ing.. The Journal of Pediatrics. 140 (6): 72431.
doi:10.1067/mpd.2002.123879. PMID 12072877.
[62] Chun, H. H.; Sun, X.; Nahas, S. A.; Teraoka, S.; Lai,
C. H.; Concannon, P.; Gatti, R. A. (December 2003).
Improved diagnostic testing for ataxia-telangiectasia by
immunoblotting of nuclear lysates for ATM protein ex-
pression.. Molecular genetics and metabolism. 80 (4):
43743. doi:10.1016/j.ymgme.2003.09.008. PMID
14654357.
[63] Taylor, A. M.; Byrd, P. J. (October 2005).
Molecular pathology of ataxia telangiectasia..
Journal of clinical pathology. 58 (10): 100915.
doi:10.1136/jcp.2005.026062. PMC 1770730 . PMID
16189143.
[64] Anheim, M.; Tranchant, C.; Koenig, M. (Feb 16,
2012). The autosomal recessive cerebellar ataxias.. The
New England Journal of Medicine. 366 (7): 63646.
doi:10.1056/NEJMra1006610. PMID 22335741.
[65] Lefton-Greif, M. A.; Crawford, T. O.; McGrath-Morrow,
S.; Carson, K. A.; Lederman, H. M. (May 15, 2011).
Safety and caregiver satisfaction with gastrostomy in pa-
tients with Ataxia Telangiectasia.. Orphanet journal of
rare diseases. 6: 23. doi:10.1186/1750-1172-6-23. PMC
3116459 . PMID 21569628.
[66] Swift, M.; Morrell, D.; Cromartie, E.; Chamberlin, A. R.;
Skolnick, M. H.; Bishop, D. T. (November 1986). The
incidence and gene frequency of ataxia-telangiectasia in
the United States.. American Journal of Human Genetics.
39 (5): 57383. PMC 1684065 . PMID 3788973.
74 CHAPTER 6. HUMAN GENETIC DISEASES

[67] Chessa, L; Leuzzi, V; Plebani, A; Soresina, A; Micheli, R; 6.5 Cockayne syndrome

D'Agnano, D; Venturi, T; Molinaro, A; Fazzi, E; Marini,
M; Ferremi Leali, P; Quinti, I; Cavaliere, FM; Girelli,
For other uses, see Cockayne (disambiguation).
G; Pietrogrande, MC; Finocchi, A; Tabolli, S; Abeni,
D; Magnani, M (Jan 9, 2014). Intra-erythrocyte infu-
Cocaine syndrome redirects here as a possible mis-
sion of dexamethasone reduces neurological symptoms spelling. Or see cocaine.
in ataxia teleangiectasia patients: results of a phase 2
trial.. Orphanet journal of rare diseases. 9 (1): 5. Cockayne syndrome (CS), also called Neill-Dingwall
doi:10.1186/1750-1172-9-5. PMID 24405665. syndrome, is a rare fatal autosomal recessive
[68] Yousefpour, P; Chilkoti, A (Sep 2014). Co-opting bi- neurodegenerative disorder characterized by growth
ology to deliver drugs.. Biotechnology and Bioengineer- failure, impaired development of the nervous system,
ing. 111 (9): 1699716. doi:10.1002/bit.25307. PMID abnormal sensitivity to sunlight (photosensitivity), eye
24916780. disorders and premature aging.[1][2][3] Failure to thrive
and neurological disorders are criteria for diagnosis,
while photosensitivity, hearing loss, eye abnormali-
6.4.12 External links ties, and cavities are other very common features.[3]
Problems with any or all of the internal organs are
The A-T Childrens Project possible. It is associated with a group of disorders called
leukodystrophies, which are conditions characterized by
Wobbly Feet Foundation, Inc. degradation of neurological white matter. The underly-
ing disorder is a defect in a DNA repair mechanism.[4]
The UK AT Society Unlike other defects of DNA repair, patients with CS
are not predisposed to cancer or infection.[5] Cockayne
Action for A-T Charity
syndrome is a rare but destructive disease usually re-
Asociacion Espanola Familia Ataxia-Telangiectasia sulting in death within the rst or second decade of life.
(AEFAT) The mutation of specic genes in Cockayne syndrome
is known, but the widespread eects and its relationship
BrAshA-T, Australia with DNA repair is yet to be well understood.[5]
It is named after English physician Edward Alfred Cock-
Projeto AT/Brasil
ayne (18801956) who rst described it in 1936 and
[6]
Association Pour la Recherche sur l'A-T (APRAT) re-described in 1946. Neill-Dingwall syndrome was
named after Mary M. Dingwall and Catherine A. Neill.[6]
AT Europe These women described the case of two brothers with
Cockayne syndrome and asserted it was the same dis-
AT Info, Germany ease described by Cockayne. In their article the women
contributed to the symptoms of the disease through their
Un Vero Sorriso Onlus (A-True Smile Association) discovery of calcications in the brain. They also com-
pared Cockayne syndrome to what is now known as
Gli Amici di Valentina (Friends of Valentina)
HutchinsonGilford progeria syndrome (HGPS), then
Team A-T, Japan called progeria, due to the advanced aging that charac-
terizes both disorders.[6]
Stichting A-T, Netherlands

Twan Foundation, Netherlands 6.5.1 Forms

Razem Zdazymy (Together We are in Time)
FEAT An independent documentary to raise aware-
ness for A-T
About A-T from the NINDS
Orphanet for A-T
GeneReviews for Ataxia-Telangiectasia
Replication-Independent Double-Strand Breaks
(DSBs) Discusses importance of the ATM kinase
Cancer.Net: Ataxia-Telangiectasia
CS Type I, the classic form, is characterized by
normal fetal growth with the onset of abnormalities
in the rst two years of life. Vision and hearing grad-
ually decline.[7] The central and peripheral nervous
systems progressively degenerate until death in the
rst or second decade of life as a result of serious
neurological degradation. Cortical atrophy is less
severe in CS Type I.[8]
CS Type II is present from birth (congenital) and
is much more severe than CS Type 1.[7] It in-
volves very little neurological development after
birth. Death usually occurs by age seven. This spe-
cic type has also been designated as cerebro-oculo-
6.5. COCKAYNE SYNDROME 75

facio-skeletal (COFS) syndrome or Pena-Shokeir associated with an increased risk of cancer.[5]

syndrome Type II.[7] COFS syndrome is named so
due to the eects it has on the brain, eyes, face,
and skeletal system, as the disease frequently causes 6.5.3 Genetics
brain atrophy, cataracts, loss of fat in the face, and
osteoporosis. COFS syndrome can be further sub-
divided into several conditions (COFS types 1, 2, 3
(associated with xeroderma pigmentosum) and 4).[9]
Typically patients with this early-onset form of the Unaected Unaected
"Carrier" "Carrier"
disorder show more severe brain damage, includ- Father Mother
ing reduced myelination of white matter, and more
widespread calcications, including in the cortex
and basal ganglia.[8] R r R r

CS Type III, characterized by late onset, is typically

milder than Types I and II.[7] Often patients with R R R r R r r r
Type III will live into adulthood.

Xeroderma pigmentosum-Cockayne syndrome

(XP-CS) occurs when an individual also suers
from xeroderma pigmentosum, another DNA
repair disease. Some symptoms of each disease
are expressed. For instance, freckling and pigment
abnormalities characteristic of XP are present. The
neurological disorder, spasticity, and underdevelop- Unaected
1 in 4 chance
Unaected "Carrier"
2 in 4 chance
Aected
1 in 4 chance
ment of sexual organs characteristic of CS are seen.
However, hypomyelination and the facial features
of typical CS patients are not present.[10] Cockayne syndrome has an autosomal recessive pattern of
inheritance.

6.5.2 Physical appearance and diagnosis
Persons with this syndrome have smaller than nor-
mal head sizes (microcephaly), are of short stature
(dwarsm), their eyes appear sunken, and they have an
aged look. They often have long limbs with joint con-
tractures (inability to relax muscle at a joint), a hunched
back (kyphosis), and they may be very thin (cachetic),
due to a loss of subcutaneous fat. Their small chin,
large ears, and pointy, thin nose often give an aged
appearance.[8] The skin of those with Cockayne syn-
drome is also frequently aected. Hyperpigmentation,
varicose or spider veins (telangiectasia),[8] and serious
sensitivity to sunlight are common, even in individuals
without XP-CS. Often patients with Cockayne Syndrome
will severely burn or blister with very little exposure. The
eyes of patients can be aected in various ways and eye
abnormalities are common in CS. Cataracts and cloudi-
ness of the cornea (corneal opacity) are common. The
loss of and damage to nerves of the optic nerve, caus-
ing optic atrophy can occur.[3] Nystagmus, or involun-
tary eye movement, and pupils that fail to dilate demon-
strate a loss of control of voluntary and involuntary mus-
cle movement.[8] A salt and pepper retinal pigmentation
is also a visible symptom. Diagnosis is determined by a
specic test for DNA repair, which measures the recovery
of RNA after exposure to UV radiation. Despite being
associated with genes involved in nucleotide excision re-
pair (NER), unlike xeroderma pigmentosum, CS is not
Cockayne syndrome is classied genetically as follows:
Mutations in the ERCC8 (also known as CSA) gene or
the ERCC6 (also known as CSB) gene are the cause of
Cockayne syndrome.[7] Mutations in the ERCC6 gene
mutation makes up ~70% of cases. The proteins made
by these genes are involved in repairing damaged DNA
via the transcription-coupled repair mechanism, particu-
larly the DNA in active genes. DNA damage is caused
by ultraviolet rays from sunlight, radiation, or free rad-
icals in the body. A normal cell can repair damage to
DNA easily before it collects. If either the ERCC6 or
the ERCC8 gene is altered (as in Cockayne Syndrome),
DNA damage is not repaired. As this damage accumu-
lates, it can lead to malfunctioning cells or cell death.
This cell death and malfunctioning likely contributes to
the symptoms of Cockayne Syndrome such as premature
aging and hypomyelination of neurons.[7]
6.5.4 Neurology
Imaging studies reveal widespread absence of the myelin
sheaths of the neurons in the white matter of the brain,
and general atrophy of the cortex.[5] Calcications have
also been found in the putamen, an area of the forebrain
that regulates movements and aids in some forms of
learning,[8] along with in the cortex.[6] Additionally, at-
rophy of the central area of the cerebellum found in pa-
tients with Cockayne syndrome could also result in the
76 CHAPTER 6. HUMAN GENETIC DISEASES

lack of muscle control, particularly involuntary, and poor [6] Neill CA, Dingwall MM. A Syndrome Resembling Proge-
posture typically seen. ria: A Review of Two Cases. Archives of Disease in
Childhood. 1950;25(123):213-223.

6.5.5 Treatment [7] Cockayne Syndrome. Genetics Home Reference

http://ghr.nlm.nih.gov/condition/cockayne-syndrome
Published April 28, 2015. Reviewed May 2010.
There is no permanent cure for this syndrome, although
Accessed April 30, 2015.
patients can be treated according to their specic symp-
toms. The prognosis for those with Cockayne syndrome [8] Javadzadeh M. Cockayne Syndrome. Iran J Child Neurol.
is poor, as death typically occurs by the individuals Autumn 2014;8;4(Suppl.1):18-19.
twenties. Treatment usually involves physical therapy
[9] Cerebrooculofacioskeletal Syndrome 2. On-
and minor surgeries to the aected organs, like cataract line Mendelian Inheritance in Man. https:
removal.[3] Also wearing high-factor sunscreen and pro- //omim.org/entry/610756. Published 2/12/2007.
tective clothing is recommended as patients with Cock-
ayne syndrome are very sensitive to UV radiation.[11] Op- [10] Laugel V. Cockayne Syndrome. 2000 Dec 28 [Updated
timal nutrition can also help. Genetic counseling for 2012 Jun 14]. In: Pagon RA, Adam MP, Ardinger HH,
the parents is recommended, as the disorder has a 25% et al., editors. GeneReviews [Internet]. Seattle (WA):
chance of being passed to any future children, and pre- University of Washington, Seattle; 1993-2015. Available
[3] from:
natal testing is also a possibility. Another important as-
pect is prevention of recurrence of CS in other sibling. [11] Kyllermen, Marten. Cockayne Syndrome. Swedish
Identication of gene defects involved makes it possible Information Centre for Rare Diseases. 2012:
to oer genetic counseling and antenatal diagnostic test- 4.0. http://www.socialstyrelsen.se/rarediseases/
ing to the parents who already have one aected child.[12] cockaynesyndrome#anchor_17

[12] Title: Cockayne Syndrome Authors: Dr Nita R Su-

tay, Dr Md Ashfaque Tinmaswala, Dr Manjiri Karlekar,
6.5.6 See also
Dr Swati Jhahttp://jmscr.igmpublication.org/v3-i7/35%
20jmscr.pdf
Accelerated aging disease
Biogerontology [13] http://www.orpha.net/consor/cgi-bin/OC_Exp.php?
Lng=GB&Expert=1317
Degenerative disease
Genetic disorder 6.5.8 External links
CAMFAK syndrome thought to be a form (or
subset) of Cockayne syndrome[13] 'Amy and Friends a friendly charity based in the
UK supporting children with Cockayne Syndrome
Share and Care Cockayne Syndrome Network
6.5.7 References
cockayne at NIH/UW GeneTests
[1] Bertola,; Cao, H; Albano, Lm; Oliveira, Dp; Kok, F;
Marques-Dias, Mj; Kim, Ca; Hegele, Ra (2006). Cock- This article incorporates some public domain text
ayne syndrome type A: novel mutations in eight typical from The U.S. National Library of Medicine
patients. Journal of Human Genetics. 51 (8): 7015.
doi:10.1007/s10038-006-0011-7. PMID 16865293.
[2] James, William; Berger, Timothy; Elston, Dirk (2005). 6.6 Xeroderma pigmentosum
Andrews Diseases of the Skin: Clinical Dermatology (10th
ed.). Saunders. p. 575. ISBN 0-7216-2921-0.
Xeroderma pigmentosum (XP) is a rare autosomal re-
[3] Bender M, Potocki L, Metry D. What syndrome is this? cessive genetic disorder of DNA repair in which the abil-
Cockayne syndrome. Pediatric Dermatology [serial on- ity to repair damage caused by ultraviolet (UV) light is
line]. November 2003;20(6):538-540. Available from: decient.[2]:574 In extreme cases, all exposure to sunlight
MEDLINE with Full Text, Ipswich, MA. Accessed April
must be forbidden, no matter how small; as such, indi-
30, 2015.
viduals with the disease are often colloquially referred
[4] Hoeijmakers JH (October 2009). DNA damage, aging, to as Moon child.[3] Multiple basal cell carcinomas
and cancer. N. Engl. J. Med. 361 (15): 147585. (basaliomas) and other skin malignancies frequently oc-
doi:10.1056/NEJMra0804615. PMID 19812404. cur at a young age in those with XP; metastatic malig-
[4]
[5] Nance M, Berry S. Cockayne syndrome: review of 140 nant melanoma and squamous cell carcinoma are the
cases. American Journal of Medical Genetics. January 1, two most common causes of death in XP victims. This
1992;42(1):68-84. Available from: MEDLINE with Full disease is present in both genders and in all races, with
Text, Ipswich, MA. Accessed April 30, 2015. an incidence of 1:250,000 in the United States.[5] XP is
6.6. XERODERMA PIGMENTOSUM 77

6-4-pyrimidone photoproducts. In a healthy, normal hu-

man being, the damage is rst excised by endonucleases.
DNA polymerase then repairs the missing sequence, and
ligase seals the transaction. This process is known as
nucleotide excision repair.

6.6.1 Genetics

One of the most frequent defects in xeroderma pigmen-

tosum is an autosomal recessive genetic defect in which
nucleotide excision repair (NER) enzymes are mutated,
leading to a reduction in or elimination of NER.[6] If left
unchecked, damage caused by ultraviolet light can cause
mutations in individual cells DNA. The causes of the
neurological abnormalities are poorly understood and are
not connected with exposure to ultraviolet light. The most
current theories suggest that oxidative DNA damage is
generated during normal metabolism in the central ner-
vous system, and that some types of this damage must be
repaired by NER[7]
Since DNA repair is under genetic control, it can easily
Child suering from xeroderma pigmentosum in Rukum, Nepal undergo mutations. Many genetic disorders such as xe-
roderma pigmentosum (XP; MIM 278700) are caused by
mutations in genes that repair DNA.[7] If the gene was not
repaired correctly it could cause xeroderma pigmentosum
in individuals. The autosomal recessive disorder xero-
Unaected Unaected derma pigmentosum or XP has a frequency of 1 in ev-
"Carrier" "Carrier" ery 250,000 individuals of all races and ethnic groups.[8]
Father Mother Those aected with the autosomal recessive disorder XP
are extremely sensitive to UV light produced by the sun
and even with a short exposure to it causes dry, aking
R r R r skin and pigmented spots that can develop into skin can-
cer. Individuals with XP are about 1,000 times more
likely to develop skin cancer than individuals without the
R R R r R r r r
disorder.
The molecular defects in XP cells result in a greatly ele-
vated induction of mutations in sun-exposed skin of af-
fected individuals. This increased mutation frequency
probably accounts for the pigmentation changes and the
skin cancers. Examination of mutations in the p53 gene
in tumors from XP patients reveal p53 mutations char-
acteristic of UV exposure in the majority of tumors[8]
Unaected Unaected "Carrier" Aected
1 in 4 chance 2 in 4 chance 1 in 4 chance As with all genetic disorders, genetic counseling and psy-
chological support is appropriate for the families, to dis-
cuss probability of occurrence in future pregnancies, feel-
Xeroderma pigmentosum has an autosomal recessive pattern of ings of isolation and concern about career prospects. Al-
inheritance.
though there is no cure for xeroderma pigmentosum, the
eects can be minimized by getting protection from the
sunlight and if possible early removal of precancerous le-
roughly six times more common in Japanese people[4] sions. The most common fate for individuals with XP is
than in other groups. early death from cancer due to the fact that they need to
Normally, damage to DNA in epidermal cells occurs dur- take outstanding measures to protect themselves from the
ing exposure to UV light. The absorption of the high- dangers of the UV light. But if there is an absence of neu-
energy light leads to the formation of pyrimidine dimers, rological problems and the individual is always protected
namely cyclobutane-pyrimidine dimers and pyrimidine- or away from sunlight, the prognosis is good.
78 CHAPTER 6. HUMAN GENETIC DISEASES

6.6.2 Types Luke in the 2002 novel Going Out by Scarlett

There are seven complementation groups, plus one vari-
ant form:
6.6.3 Symptoms
Symptoms include:
Severe sunburn when exposed to only small amounts
of sunlight. These often occur during a childs rst
exposure to sunlight.
Development of many freckles at an early age
Rough-surfaced growths (solar keratoses), and skin
cancers
Eyes that are painfully sensitive to the sun and may
easily become irritated, bloodshot and clouded
Blistering or freckling on minimum sun exposure
Spider Veins
Limited growth of hair on chest and legs
Scaly skin
Thomas
In the Channel 4 series Ultraviolet, one of the hu-
mans is mistaken for a vampire because he avoids
sunlight, when in fact he has XP.
In the book The Lucifer Code (originally published
in 1997 as Lucifer) the character Bradley Soames
suers from XP, and wears an all-encompassing
suit complete with mask, hood and heavily tinted
lenses in order to venture outdoors.
In the independent lm Dark Side of the Sun (1988)
with Brad Pitt as the main character suering from
XP.
In the 2001 lm The Others, the two children, Anne
and Nicholas, suer from XP.
In the 2003 novel Second Glance by Jodi Picoult,
Ethan Wakeman, the 9-year-old nephew of Ross
Wakeman (the main protagonist) has XP.
The 2003 Angela Johnson novel, A Cool Moonlight,
centers on a girl who has XP and can never be in
the sun. The family has gone to drastic measures to
help make her life easier, and to make her feel like
a normal 8-year-old.

Dry skin The 2006 Japanese drama "Taiyou no uta" (A Song

Irregular dark spots on the skin
Corneal ulcerations
6.6.4 Treatment
The most obvious, and often important part of treat-
ment, is avoiding exposure to sunlight. This includes
wearing protective clothing and using sunscreen (physi-
cal and chemical).[9] Keratoses can also be treated using
cryotherapy or uorouracil.[1]
to the Sun) centers around a girl with XP who
dreams of being a singer.
The 2006 German lm Mondscheinkinder (Chil-
dren of the Moonlight) features 12-year-old Lisa
who creates a fantasy world for her 6-year-old
brother Paul, who has XP and cannot leave the
house. Their special relationship is threatened when
Lisa gets her rst boyfriend, facing her with hard
choices.[10]
The Spanish lm "Eskalofro" or Shiver released
in 2008 featured a main character named Santi who
is ostracized as he suers from the condition.

6.6.5 Prognosis The 2011 lm La permission de minuit by French

Fewer than 40% of individuals with the disease survive
beyond the age of 20. Some XP victims with less severe
cases do manage to live well into their 40s.
6.6.6 In popular culture
These ctional characters have XP:
Christopher Snow in Dean Koontz's Moonlight Bay
Trilogy
1994 CBS-TV movie Children of the Dark is based
on XP.
director Delphine Gleize centers on a teenage boy
with XP.
The 2012 documentary "Sun Kissed" explores the
XP problem on the Navajo Indian Reservation.
The 2013 young adult novel What We Saw at
Night by Jacquelyn Mitchard tells the story of three
teenagers who are suering from this disease, go out
only when dark and witness something strange one
night.
The 2013 middle grade novel Doom & Gloom by
M. J. Shaughnessy tells the story of a twelve-year-
old boy who triumphs over his disease by donning a
protective solar suit and becoming a superhero.
6.7. AMYOTROPHIC LATERAL SCLEROSIS
The 2014 adult ction book The Deepest Secret by
Carla Buckley tells the story of a mother with a son
who has XP and the lengths she will go to in order
to protect him from a crisis that threatens to tear the
community apart.[11]
In the 2016 horror lm Lights Out (2016 lm), the
villain, Diana had this condition. She was killed
when the doctors at the mental institution she and
Sophie stayed at tried treating the condition, but it [10] See the website of the movie, in German: http://www.
went awry.
6.6.7 See also
Biogerontology
Cockayne syndrome
List of cutaneous conditions
List of cutaneous conditions associated with in-
creased risk of nonmelanoma skin cancer
Photophobia
Senescence
6.6.8 References
[1] Halpern, J.; Hopping, B.; Brosto, J. (2008).
Photosensitivity, corneal scarring and developmen-
tal delay: Xeroderma Pigmentosum in a tropical
country. Cases journal. 1 (1): 254. doi:10.1186/1757-
1626-1-254. PMC 2577106 . PMID 18937855.
[2] James, William; Berger, Timothy; Elston, Dirk (2005).
Andrews Diseases of the Skin: Clinical Dermatology.
(10th ed.). Saunders. ISBN 0-7216-2921-0.
[3] Medical Biochemistry at a Glance. John Wiley & Sons.
28 November 2011. ISBN 1118292405. Retrieved 17
June 2011. Xeroderma pigmentosa is a rare, autosomal
recessive disease caused by a defective UV-specic en-
donuclease. Patients with mutations are unable to repair
DNA damage caused by sunlight and have been described
as children of the night.
[4] Li, Lei (January 8, 2007). Chapter 3 Nucleotide Excision
Repair. DNA REPAIR, GENETIC INSTABILITY, AND
CANCER. World Scientic Publishing. pp. 7576. ISBN
981-270-014-5.
[5] Lehmann AR, McGibbon D, Stefanini M (2011).
Xeroderma pigmentosum. Orphanet J Rare Dis. 6: 70.
doi:10.1186/1750-1172-6-70. PMC 3221642 . PMID
22044607.
[6] E. C. Friedberg; G. C. Walker; W. Siede; R. D. Wood;
R. A. Schultz; T. Ellenberger (2006). DNA repair and
mutagenesis. Washington: ASM Press. p. 1118. ISBN
978-1-55581-319-2.
79
[7] Brooks PJ DNA Repair (Amst). 2014 March 2;
7(7):1168-79.
[8] Daya-Grosjean L, Sarasin A Mutat Res. 2014 March 2;
571(1-2):43-56
[9] Nussbaum, Robert; McInnes, Roderick; Willard, Hunt-
ington. Genetics in Medicine. Elsevier. ISBN 978-14377-
0696-3.
mondscheinkinder-der-film.de/
[11] https://www.goodreads.com/book/show/
18248415-the-deepest-secret?ac=1
6.6.9 External links
Information
GeneReviews/NCBI/NIH/UW entry on xeroderma
pigmentosum
An article about this disorder from DigiLander.iol.it
(in English and Italian)
Cancer.Net Xeroderma Pigmentosum
DermNet systemic/xeroderma-pigmentosum
Charities
XP Society
XP Family Support Group
UK Patient Support Group
Short lms
Sloan Science and Film / Short Films / XP by David
Barba 10 minutes
Web Site of a Short Film about an xeroderma pig-
mentosum (XP) Patient. Film is directed by Kim-
berly Williams-Paisley
6.7 Amyotrophic lateral sclerosis
ALS redirects here. For other uses, see ALS (disam-
biguation).
Motor neurone disease redirects here. For the broader
group of diseases, see Motor neuron disease.
Amyotrophic lateral sclerosis (ALS), also known as
Lou Gehrigs disease and motor neurone disease
(MND), is a specic disease that causes the death of
neurons which control voluntary muscles.[1][2][3] Some
also use the term "motor neuron disease" for a group
80 CHAPTER 6. HUMAN GENETIC DISEASES

of conditions of which ALS is the most common.[4] 5% of cases muscles in the trunk of the body are aected
ALS is characterized by sti muscles, muscle twitching, rst. In all cases the disease spreads and aects other
and gradually worsening weakness due to muscles de- regions.[5]
creasing in size.[4] This results in diculty in speaking,
swallowing, and eventually breathing.[2][4]
The cause is not known in 90% to 95% of cases.[1] About 6.7.2 Signs and symptoms
510% of cases are inherited from a persons parents.[5]
About half of these genetic cases are due to one of two The disorder causes muscle weakness and atrophy
specic genes. The diagnosis is based on a persons signs throughout the body due to the degeneration of the upper
and symptoms with testing done to rule out other potential and lower motor neurons. Individuals aected by the dis-
causes.[1] order may ultimately lose the ability to initiate and con-
trol all voluntary movement, although bladder and bowel
No cure for ALS is known.[1] A medication called riluzole function and the muscles responsible for eye movement
may extend life by about two to three months.[6] Non- are usually spared until the nal stages of the disorder.[8]
invasive ventilation may result in both improved quality
and length of life.[7] The disease usually starts around Cognitive and/or behavioural dysfunction is present in up
the age of 60 and in inherited cases around the age of to half of individuals with ALS. Around half of peo-
50.[5] The average survival from onset to death is two to ple with ALS will experience mild changes in cogni-
four years.[8] About 10% survive longer than 10 years.[1] tion and behaviour, and [8] 10 - 15% will show signs of
Most die from respiratory failure. In much of the world, frontotemporal dementia. Repeating phrases or ges-
[5]
rates of ALS are unknown. In Europe and the United tures, apathy, and loss of inhibition are frequently re-
[14]
States the disease aects about two people per 100,000 ported behavioural features of ALS. Language dys-
per year.[5][9] function, executive dysfunction, and troubles with social
cognition and verbal memory are the most commonly
Descriptions of the disease date back to at least 1824 reported cognitive symptoms in ALS; a meta-analysis
by Charles Bell.[10] In 1869, the connection between the found no relationship between dysfunction and disease
symptoms and the underlying neurological problems was severity.[15] However, cognitive and behavioral dysfunc-
rst described by Jean-Martin Charcot, who in 1874 be- tions have been found to correlate with reduced survival
gan using the term amyotrophic lateral sclerosis.[10] It be- in people with ALS and increased caregiver burden; this
came well known in the United States in the 20th century may be due in part to decits in social cognition.[15] About
when in 1939 it aected the baseball player Lou Gehrig half the people who have ALS experience emotional la-
and later worldwide when physicist Stephen Hawking, di- bility, in which they cry or laugh for no reason.[8]
agnosed in 1963 and expected to die within two years,
became famous.[11][12] In 2014 videos of the ice bucket Sensory nerves and the autonomic nervous system are
challenge went viral on the Internet and increased public generally unaected, meaning the majority of people
awareness.[13] with ALS maintain hearing, sight, touch, smell, and
taste.[1]

6.7.1 Classication
Initial symptoms
ALS is a motor neuron disease, also spelled motor neu-
rone disease which is a group of neurological disorders The start of ALS may be so subtle that the symptoms are
overlooked.[1] The earliest symptoms of ALS are muscle
that selectively aect motor neurons, the cells that control
voluntary muscles of the body, including amyotrophic lat- weakness and/or muscle atrophy. Other presenting symp-
toms include trouble swallowing or breathing, cramping,
eral sclerosis (ALS), primary lateral sclerosis, progressive
muscular atrophy, progressive bulbar palsy, pseudobulbar or stiness of aected muscles; muscle weakness aect-
palsy, and spinal muscular atrophy.[4] ing an arm or a leg; and/or slurred and nasal speech. The
parts of the body aected by early symptoms of ALS de-
ALS itself can be classied a few dierent ways - by pend on which motor neurons in the body are damaged
how fast the disease progresses (slow vs fast progressors), rst.[16]
by whether it is inherited or sporadic, and by where it
starts.[1] Most commonly (~70% of the time) the limbs In limb onset ALS people rst experience awkwardness
are aected rst - in this case neurons in the brain (upper when walking or running or even tripping over or stum-
motor neurons) and in the spinal cord (lower motor neu- bling may be experienced and often this is marked by
rons) are dying and this form is called limb onset. In walking with a "dropped foot" which drags gently on the
about 25% of cases, muscles in the face, mouth, and ground. Or if arm-onset, diculty with tasks requiring
throat are aected rst because motor neurons in the part manual dexterity such as buttoning a shirt,[16]writing, or
of the brain stem called the Medulla oblongata (formerly turning a key in a lock may be experienced.
called the bulb) start to die rst along with lower mo- In bulbar-onset ALS, initial symptoms will mainly be of
tor neurons - this form is called bulbar onset. In about diculty speaking clearly or swallowing. Speech may be-
6.7. AMYOTROPHIC LATERAL SCLEROSIS 81

come slurred, nasal in character, or quieter. There may Late stages

be diculty in swallowing and loss of tongue mobility.
A smaller proportion of people experience respiratory- Diculty in chewing and swallowing makes eating very
onset ALS, where the intercostal muscles that support dicult and increases the risk of choking or of aspi-
breathing are aected rst.[5] rating food into the lungs. In later stages of the disor-
Over time, people experience increasing diculty mov- der, aspiration pneumonia can develop, and maintaining
ing, swallowing (dysphagia), and speaking or forming a healthy weight can become a signicant problem that
words (dysarthria). Symptoms of upper motor neuron in- may require the insertion of a feeding tube. As the di-
volvement include tight and sti muscles (spasticity) and aphragm and intercostal muscles of the rib cage that sup-
exaggerated reexes (hyperreexia) including an overac- port breathing weaken, measures of lung function such
tive gag reex. An abnormal reex commonly called as vital capacity and inspiratory pressure diminish. In
Babinskis sign also indicates upper motor neuron dam- respiratory-onset ALS, this may occur before signicant
age. Symptoms of lower motor neuron degeneration in- limb weakness is apparent. Most people with ALS die of
clude muscle weakness and atrophy, muscle cramps, and respiratory failure or pneumonia.[5]
eeting twitches of muscles that can be seen under the Although respiratory support can ease problems with
skin (fasciculations) although twitching is not a diagnos- breathing and prolong survival, it does not aect the pro-
tic symptom and more of a side eect so twitching would gression of ALS. Most people with ALS die between 2
either occur after or accompany weakness and atrophy.[1] and four years after the diagnosis.[8] Around half of peo-
ple with ALS die within 30 months of their symptoms
beginning, and about 20% of people with ALS live be-
tween 5 years and 10 years after symptoms begin.[5] Gui-
tarist Jason Becker has lived since 1989 with the disorder,
while physicist Stephen Hawking has survived for more
Progression than 50 years, but they are considered unusual cases.[24]
Most people with ALS die in their own home, with their
Although the order and rate of symptoms varies from breath[3]failing while they sleep; people rarely choke to
person to person, the disease eventually spreads to un- death.
aected regions and the aected regions become more
aected. Most people eventually are not able to walk or
use their hands and arms, lose the ability to speak and 6.7.3 Cause
swallow food and their own saliva, and begin to lose the
ability to cough and to breathe on their own.[8] Genetics
The rate of progression can be measured using an out-
come measure called the ALS Functional Rating Scale About 510% of cases are directly inherited from a
Revised (ALSFRS-R)", a 12-item instrument adminis- persons parents.[5] Overall, rst-degree relatives of an
tered as a clinical interview or self-reported questionnaire individual with ALS have a 1% risk of developing
that produces a score between 48 (normal function) and ALS.[25][26]
0 (severe disability);[17] it is the most commonly used A defect on chromosome 21, which codes for superoxide
outcome measure in clinical trials and is used by doc- dismutase, is associated with about 20% of familial cases
tors to track disease progression.[18] Though the degree of of ALS, or about 2% of ALS cases overall.[27][28][29] This
variability is high and a small percentage of people have mutation is believed to be transmitted in an autosomal
a much slower disorder, on average, people with ALS dominant manner, and has over a hundred dierent forms
lose about 0.9 FRS points per month. A survey-based of mutation. The most common ALS-causing mutation is
study amongst clinicians showed that they rated a 20% a mutant SOD1 gene, seen in North America; this is char-
change in the slope of the ALSFRS-R as being clinically acterized by an exceptionally rapid progression from on-
meaningful.[19] set to death. The most common mutation found in Scan-
Disorder progression tends to be slower in people who dinavian countries, D90A-SOD1, is more slowly progres-
are younger than 40 at onset,[20] are mildly obese,[21] sive than typical ALS, and people with this[30] form of the
have disorder restricted primarily to one limb, and those disorder survive for an average of 11 years.
with primarily upper motor neuron symptoms.[22] Con- In 2011, a genetic abnormality known as a hexanucleotide
versely, progression is faster and prognosis poorer in peo- repeat was found in a region called C9orf72, which is
ple with bulbar-onset disorder, respiratory-onset disor- associated with ALS combined with frontotemporal de-
der, and frontotemporal dementia.[22] mentia ALS-FTD,[31] and accounts for some 6% of cases
[32]
The CX3CR1 allelic variants have also been shown to of ALS among white Europeans.
have an eect on the disorders progression and life The UBQLN2 gene encodes production of the protein
expectancy.[23] ubiquilin 2 in the cell, which is a member of the ubiquilin
82 CHAPTER 6. HUMAN GENETIC DISEASES

family and controls the degradation of ubiquitinated pro- may also occur more often among the US military veter-
teins. Mutations in UBQLN2 interfere with protein ans however the reason is unknown.[47] This may be due
degradation, leading to neurodegeneration and causing to head injury.[48]
dominantly inherited, chromosome X-linked ALS and
ALS/dementia.[33]
To date, a number of genetic mutations have been asso-
ciated with various types of ALS. The currently known
associations are:
Other factors

SOD1 In 1993, scientists discovered that mutations Where no family history of the disease is present i.e.,
in the gene (SOD1) that produces the Cu-Zn superoxide in around 90% of cases no cause is known for ALS.
dismutase (SOD1) enzyme were associated with around Possible associations for which evidence is inconclusive
20% of familial ALS. This enzyme is a powerful include military service, frequent drug use, and partici-
antioxidant that protects the body from damage caused pation in contact sports.
by superoxide, a toxic free radical generated in the mi-
Studies also have focused on the role of glutamate in
tochondria. Free radicals are highly reactive molecules
motor neuron degeneration. Glutamate is one of the
produced by cells during normal metabolism. Free radi-
neurotransmitters in the brain. Scientists have found,
cals can accumulate and cause damage to DNA and pro-
compared with healthy people, people with ALS have
teins within cells. To date, over 110 dierent mutations in
higher levels of glutamate in their serum and spinal
SOD1 have been linked with the disorder, some of which
uid.[28] Riluzole is currently the only FDA-approved
(such as H46R) have a very long clinical course, while
drug for ALS and targets glutamate transporters. It only
others, such as A4V, are exceptionally aggressive. When
has a modest eect on survival, however, suggesting that
the defenses against oxidative stress fail, programmed cell
excess glutamate is not the sole cause of the disease.
death (apoptosis) is upregulated.
Certain studies suggested a link between sporadic
A defect in SOD1 could be a loss or gain of function. A
ALS, specically in athletes, and a diet enriched with
loss of SOD1 function could lead to an accumulation of
branched-chain amino acids, a common dietary supple-
free radicals. A gain of SOD1 function could be toxic in
[40][41] ment among athletes, which cause cell hyperexcitability
other ways.
resembling that usually observed in people with ALS.
Aggregate accumulation of mutant SOD1 is suspected to The proposed underlying mechanism is that cell hy-
play a role in disrupting cellular functions by damaging perexcitability results in increased calcium absorption
mitochondria, proteasomes, protein folding chaperones, by the cell, and thus brings about cell death of neu-
or other proteins.[42] Any such disruption, if proven, ronal cells, which have particularly low calcium buering
would lend signicant credibility to the theory that aggre- capabilities.[49]
gates are involved in mutant SOD1 toxicity. Critics have
Some evidence supports superoxide dismutase 1 (SOD1)
noted that in humans, SOD1 mutations cause only 2% or
protein misfolding propagates between molecules in a
so of overall cases and the etiological mechanisms may
similar fashion to prions.[50] Similarly, it has been pro-
be distinct from those responsible for the sporadic form
posed that incorporation of the cyanobacterial toxin -
of the disease. To date, the ALS-SOD1 mice remain the
methylamino-l-alanine (BMAA) leads to another prion-
best model of the disease for preclinical studies, but it is
like protein misfolding propagation.[51][52]
hoped that more useful models will be developed.
Another very common factor associated with ALS is a
lesion to the motor system in areas such as the frontotem-
Head injury poral lobes.[53] Lesions in these areas often show signs
of early decit, which can be used to predict the loss of
While moderate to severe traumatic brain injury is a risk motor function, and result in the spread of ALS.[53] The
for ALS, it is unclear if mild traumatic brain injury in- mechanisms of ALS are present long before any signs or
creases rates.[43][44] symptoms become apparent.[54] Before any muscular at-
In 1994 the National Institute for Occupational Safety rophy becomes apparent during ALS, roughly [54]
one-third
and Health (NIOSH) reported a nonsignicant increase of the motor neurons must be destroyed.
in nervous system disorders due to four cases of ALS Other potential risk factors including chemical expo-
among NFL football players. It was unclear if this sure, electromagnetic eld exposure, occupation, physi-
was due to chance or not.[45] Another study from 2012 cal trauma, and electric shock, have been investigated,
also found a possible increase in ALS in NFL football but are without consistent ndings.[55][56] There is a ten-
players.[46] An older study did not nd an increased risk tative association with exposure to a number of pesticides
among high school football players.[43] A 2007 review including the organochlorine insecticides aldrin, dieldrin,
found an increased risk among soccer players.[44] ALS DDT, and toxaphene.[57][58][59]
6.7. AMYOTROPHIC LATERAL SCLEROSIS 83

6.7.4 Pathophysiology Another common test measures nerve conduction veloc-

ity (NCV).[1] Specic abnormalities in the NCV results
The dening feature of ALS is the death of both upper may suggest, for example, that the person has a form
and lower motor neurons in the motor cortex of the brain, of peripheral neuropathy (damage to peripheral nerves)
the brain stem, and the spinal cord. Prior to their de- or myopathy (muscle disease) rather than ALS. While
struction, motor neurons develop protein-rich inclusions a magnetic resonance imaging (MRI) is often normal in
in their cell bodies and axons. This may be partly due people with early stage ALS, they can reveal evidence of
to defects in protein degradation.[33] These inclusions of- other problems that may be causing the symptoms, such
ten contain ubiquitin, and generally incorporate one of as a spinal cord tumor, multiple sclerosis, a herniated disk
the ALS-associated proteins: SOD1, TAR DNA binding in the neck, syringomyelia, or cervical spondylosis.[1]
protein (TDP-43, or TARDBP), and/or FUS.[60]
Based on the persons symptoms and ndings from the ex-
amination and from these tests, the physician may order
6.7.5 Diagnosis tests on blood and urine samples to eliminate the possibil-
ity of other diseases, as well as routine laboratory tests.[1]
In some cases, for example, if a physician suspects the
person may have a myopathy rather than ALS, a muscle
biopsy may be performed.[1]
Viral infectious diseases such as human immunode-
ciency virus (HIV), human T-cell leukaemia virus
(HTLV), Lyme disease,[61] syphilis[62] and tick-borne
encephalitis[63] can in some cases cause ALS-like
symptoms.[1] Neurological disorders such as multiple
sclerosis, post-polio syndrome, multifocal motor neu-
ropathy, CIDP, spinal muscular atrophy, and spinal and
bulbar muscular atrophy can also mimic certain aspects
of the disease and should be considered.[1]
ALS must be dierentiated from the ALS mimic syn-
dromes which are unrelated disorders that may have a
similar presentation and clinical features to ALS or its
variants.[64] Because of the prognosis carried by this di-
agnosis and the variety of diseases or disorders that can
resemble ALS in the early stages of the disease, peo-
ple should always obtain a specialist neurological opinion,
MRI (axial FLAIR) demonstrates increased T2 signal within the so alternative diagnoses are clinically ruled out. Benign
posterior part of the internal capsule, consistent with the diagno- fasciculation syndrome is another condition that mimics
sis of ALS. many of the symptoms of ALS, but is accompanied by
normal EMG readings and no major disablement.
No test can provide a denite diagnosis of ALS, although
the presence of upper and lower motor neuron signs in However, most cases of ALS are readily diagnosed and
a single limb is strongly suggestive.[1] Instead, the diag-the error rate of diagnosis in large ALS clinics is less
nosis of ALS is primarily based on the symptoms and than 10%.[65][66] In one study, 190 people who met the
signs the physician observes in the person and a series of MND/ALS diagnostic criteria, complemented with lab-
tests to rule out other diseases.[1] Physicians obtain the oratory research in compliance with both research pro-
persons full medical history and usually conduct a neu- tocols and regular monitoring. Thirty of these people
rologic examination at regular intervals to assess whether (16%) had their diagnosis completely changed during
symptoms such as muscle weakness, atrophy of muscles, the clinical observation development period.[67] In the
hyperreexia, and spasticity are worsening.[1] same study, three people had a false negative diagnosis,
myasthenia gravis (MG), an autoimmune disease. MG
can mimic ALS and other neurological disorders leading
Dierential diagnosis to a delay in diagnosis and treatment. MG is eminently
treatable; ALS is not.[68] Myasthenic syndrome, also
Because symptoms of ALS can be similar to those of known as Lambert-Eaton syndrome, can mimic ALS and
a wide variety of other, more treatable diseases or dis- its initial presentation can be similar to that of MG.[69][70]
orders, appropriate tests must be conducted to exclude
the possibility of other conditions.[1] One of these tests
is electromyography (EMG), a special recording tech-
nique that detects electrical activity in muscles.[1] Cer-
tain EMG ndings can support the diagnosis of ALS.[1]
84 CHAPTER 6. HUMAN GENETIC DISEASES

6.7.6 Management long survival, it does not aect the progression of ALS.
People need to be fully informed about these consider-
Management of ALS attempts to relieve symptoms and ations and the long-term eects of life without move-
extend life expectancy. This supportive care is best pro- ment before they make decisions about ventilation sup-
vided by multidisciplinary teams of health care profes- port and have deep discussions on quality of life. Some
sionals working with the person and their caregivers to persons under long-term tracheotomy intermittent pos-
keep them as mobile and comfortable as possible. itive pressure ventilation with deated cus or cuess
tracheotomy tubes (leak ventilation) are able to speak,
provided their bulbar muscles are strong enough, though
Medications in all cases speech will be lost as the disease progresses.
This technique preserves speech in some persons with
Riluzole (Rilutek) has been found to modestly improve long-term mechanical ventilation. Other persons may be
survival.[71] It lengthens survival by several months, and able to use a speaking valve such as a Passey-Muir speak-
may have a greater survival benet for those with a bulbar ing valve with the assistance and guidance of a speech-
onset. It also extends the time before a person needs ven- language pathologist.
tilation support. People taking it must be monitored for
External ventilation machines that use the ventilation
liver damage (occurring in about 10% of people taking
mode of BiPAP are frequently used to support breathing,
the drug).[72] It is approved by Food and Drug Adminis-
initially at night, and later during the daytime, as well.
tration (US) and recommended by the National Institute
The use of BPAP (more often referred to as noninva-
for Clinical Excellence (UK). Riluzole does not reverse
sive ventilation, NIV) is only a temporary remedy, how-
damage already done to motor neurons.[73]
ever, and long before BPAP stops being eective, persons
Other medications may be used to help reduce fatigue, should decide whether to have a tracheotomy and long-
ease muscle cramps, control spasticity, and reduce ex- term mechanical ventilation. At this point, some persons
cess saliva and phlegm. Drugs also are available to help choose palliative hospice care.
people with pain, depression, sleep disturbances, dyspha-
gia, and constipation. Baclofen and diazepam are often
prescribed to control the spasticity caused by ALS, and Therapy
trihexyphenidyl or amitriptyline may be prescribed when
people with ALS begin having trouble swallowing their
saliva.[8]

Breathing support

When the muscles that assist in breathing weaken, use

of ventilatory assistance (intermittent positive pressure
ventilation, bilevel positive airway pressure (BiPAP), or
biphasic cuirass ventilation (BCV) may be used to aid
breathing. Such devices articially inate the persons
lungs from various external sources that are applied di-
rectly to the face or body. When muscles are no longer
able to maintain oxygen and carbon dioxide levels, these
devices may be used full-time. BCV has the added advan-
tage of being able to assist in clearing secretions by using
high-frequency oscillations followed by several positive
expiratory breaths.[74] People may eventually consider
forms of mechanical ventilation (respirators) in which a
machine inates and deates the lungs. To be eective,
this may require a tube that passes from the nose or mouth
to the windpipe (trachea) and for long-term use, an oper-
ation such as a tracheotomy, in which a plastic breathing
tube is inserted directly in the persons windpipe through
an opening in the neck.
Persons and their families should consider several factors
when deciding whether and when to use one of these op-
tions. Ventilation devices dier in their eect on the
persons quality of life and in cost. Although ventila-
tion support can ease problems with breathing and pro-
Using low tech to communicate. A man with ALS communicates
by pointing to letters and words using an head mounted laser
pointer.
Physical therapy plays a large role in rehabilitation for in-
dividuals with ALS. Specically, physical and occupa-
tional therapists can set goals and promote benets for
individuals with ALS by delaying loss of strength, main-
taining endurance, limiting pain, preventing complica-
tions, and promoting functional independence.[75]
Occupational therapy and special equipment such as
assistive technology can also enhance peoples indepen-
dence and safety throughout the course of ALS. Gentle,
low-impact aerobic exercise such as performing activities
of daily living, walking, swimming, and stationary bicy-
6.7. AMYOTROPHIC LATERAL SCLEROSIS 85

cling can strengthen unaected muscles, improve cardio- End of life care
vascular health, and help people ght fatigue and depres-
sion. Range of motion and stretching exercises can help Social workers and home care and hospice nurses help
prevent painful spasticity and shortening (contracture) of people with ALS, their families, and caregivers with the
muscles. Physical and occupational therapists can rec- medical, emotional, and nancial challenges of coping,
ommend exercises that provide these benets without particularly during the nal stages of the disease. Social
overworking muscles. They can suggest devices such workers provide support such as assistance in obtaining -
as ramps, braces, walkers, bathroom equipment (shower nancial aid, arranging durable power of attorney, prepar-
chairs, toilet risers, etc.), and wheelchairs that help peo- ing a living will, and nding support groups for patients
ple remain mobile. Occupational therapists can provide and caregivers. Home nurses are available not only to
or recommend equipment and adaptations to enable peo- provide medical care, but also to teach caregivers about
ple to retain as much safety and independence in activities tasks such as maintaining respirators, giving feedings, and
of daily living as possible. moving people to avoid painful skin problems and con-
People with ALS who have diculty speaking may ben- tractures. Home hospice nurses work in consultation with
et from working with a speech-language pathologist. physicians to ensure proper medication, pain control, and
These health professionals can teach people adaptive other care aecting the quality of life of people with ALS
strategies such as techniques to help them speak louder who wish to remain at home. The home hospice team can
and more clearly. As ALS progresses, speech-language also counsel people with ALS and caregivers about end-
pathologists can recommend the use of augmentative of-life issues.
and alternative communication such as voice ampliers,
speech-generating devices (or voice output communica-
tion devices) and/or low tech communication techniques 6.7.7 Epidemiology
such as head mounted laser pointers, alphabet boards or
yes/no signals. In much of the world, rates of ALS are unknown.[5] In
Europe, the disease aects about 2.2 people per 100,000
per year.[5] In the United States, more than 5,600 are di-
agnosed every year, and up to 30,000 Americans are cur-
rently aected. ALS is responsible for two deaths per
100,000 people per year.[81]
Nutrition ALS is classied as a rare disease, designated by the FDA
as an orphan disease (aecting fewer than 200,000
People with ALS and caregivers can learn from dieticians people in the United States), but is the most common
how to plan and prepare numerous small meals through- motor neuron disease. People of all races and eth-
out the day that provide enough calories, ber and uid, nic backgrounds are aected. One or two of 100,000
and how to avoid foods that are dicult to swallow. Peo- people develop ALS each year.[82] Amyotrophic lat-
ple may begin using suction devices to remove excess u- eral sclerosis aects around 30,000 Americans.[83] ALS
ids or saliva and prevent choking. Occupational thera- cases are estimated at 1.24.0 per 100,000 individuals
pists can assist with recommendations for adaptive equip- in Caucasian populations with a lower rate in other eth-
ment to ease the physical task of self-feeding. Speech- nic populations.[84] Filipinos are second to Caucasians
language pathologists make food choice recommenda- in terms of ALS prevalence with 1.1-2.8 per 100,000
tions that are more conducive to their unique decits individuals.[83]
and abilities. When people with ALS can no longer get Reports have been made of several clusters includ-
enough nourishment from eating, doctors may advise in- ing three American football players from the San Fran-
serting a feeding tube into the stomach. The use of a cisco 49ers, more than 50 association football players in
feeding tube also reduces the risk of choking and pneu- Italy,[85] three association football-playing friends in the
monia that can result from inhaling liquids into the lungs. south of England,[86] and conjugal (husband and wife)
The tube is not painful and does not prevent people from cases in the south of France.[87][88][89][90][91] Although
eating food orally if they wish. many authors consider ALS to be caused by a combina-
Researchers have stated, ALS patients have a chroni- tion of genetic and environmental risk factors, so far the
cally decient intake of energy and recommended aug- latter have not been rmly identied, other than a higher
mentation of energy intake[76] and have a severe loss of risk with increasing age.
appetite.[77] Both animal[78] and human research[76] [79]
suggest that ALS patients should be encouraged to con-
sume as many calories as possible and not to restrict their 6.7.8 History
caloric intake. As of 2012, a lack of robust evidence for
interventions remained for the management of weight Descriptions of the disease date back to at least 1824 by
loss.[80] Charles Bell.[10]
86 CHAPTER 6. HUMAN GENETIC DISEASES

English scientist Augustus Waller described the appear- sociation in the UK. Any contestants who refuse to have
ance of shriveled nerve bers in 1850. In 1869, the con- the ice and water dumped on them are expected to do-
nection between the symptoms and the underlying neu- nate at least US$100 to ALS research. As of July 2015,
rological problems were rst described by Jean-Martin the Ice Bucket Challenge had raised $115 million for the
Charcot, who introduced the term amyotrophic lateral ALS Association.[95] Many celebrities have taken part in
sclerosis in his 1874 paper.[10] In 1881, the article was the challenge.[96] The Ice Bucket Challenge was credited
translated into English and published in a three-volume with helping to raise funds that contributed to the discov-
edition of Lectures on the Diseases of the Nervous System. ery that the gene NEK1 may potentially contribute to the
development for ALS.[97][98]
ALS became a cause clbre in the United States in 1939
when baseball legend Lou Gehrig's career, and two years ALS is the central topic of the 2014 movie You're Not
later, his life, were ended by the disease.[92] You, directed by George C. Wolfe, with Hilary Swank,
In the 1950s, an epidemic occurred among the Chamorro Emmy Rossum [99]
and Josh Duhamel playing the main
people on Guam which bore similarities to many condi- characters.
tions, including ALS.[93]
By 1991, researchers had linked chromosome 21 to fa- American football
milial ALS (FALS). In 1993, the SOD1 gene on chromo-
some 21 was found to play a role in some cases of FALS. After this 2012 report was released, some NFL players
In 1996, riluzole became the rst FDA-approved drug for involved in the legal settlement with the NFL complained
ALS. that the NFL, which initially agreed to pay $765 mil-
In 1998, the El Escorial criteria were developed as the lion, was not doing enough to help players. The judge
standard for classifying people with ALS in clinical re- in the case concurred, and the NFL then agreed to pay
search. The next year, the revised ALS Functional Rat- an unlimited amount of damages for players found to
ing Scale was published and soon becomes a gold stan- have ALS, Parkinsons disease, Alzheimers disease and
dard for clinical research. Noncoding repeat expansions dementia.[100]
in C9ORF72 were found to be a major cause of ALS and
frontotemporal dementia in 2011.
6.7.10 Research

Name A number of clinical trials are underway globally for

ALS; a comprehensive listing of trials in the US can be
Amyotrophic comes from the Greek word amyotrophia: found at ClinicalTrials.gov. A large genetic study, called
a- means no, myo refers to muscle, and trophia means project MinE, initiated by two people with ALS is going
nourishment"; amyotrophia therefore means no muscle on currently. It is a crowdfunded research project with
nourishment, which describes the characteristic atrophy many countries involved to discover more genes.[101] A
of the suerers disused muscle tissue. Lateral identies division of the US Centers for Disease Control and Pre-
the areas in a persons spinal cord where aected portions vention maintains a registry of Americans with ALS.[102]
of the nerve cells are located. Degeneration in this area Creatine has been well studied as a treatment for ALS; it
leads to scarring or hardening ("sclerosis"). has no eect.[103]
In Commonwealth countries the term motor neurone dis- As of 2013 repetitive transcranial magnetic stimulation
ease (MND) is commonly used.[3] had been studied in ALS in small and poorly designed
clinical trials; as of 2013 there was insucient evidence
to know if rTMS is safe or eective for ALS.[104]
6.7.9 Society and culture

See also: Category:People with motor neurone disease 6.7.11 References

In August 2014, a challenge went viral online which was
commonly known as the "ALS Ice Bucket Challenge".[94]
Contestants ll a bucket full of ice and water, then state
who nominated them to do the challenge, and nominate
three other individuals of their choice to take part in it.
The contestants then dump the buckets of ice and water
onto themselves. However, it can be done in a dierent
order. The contestants then donate at least US $10 (or a
similar amount in their local currency) to ALS research
at the ALS Association, or Motor Neurone Disease As-
[1] Amyotrophic Lateral Sclerosis (ALS) Fact Sheet.
National Institute of Neurological Disorders and Stroke.
19 September 2014. Retrieved 2 January 2015.
[2] Zarei, Sara; Carr, Karen; Reiley, Luz; Diaz, Kelvin;
Guerra, Orleiquis; Altamirano, Pablo Fernandez; Pa-
gani, Wilfredo; Lodin, Daud; Orozco, Gloria (2015-
11-16). A comprehensive review of amyotrophic lat-
eral sclerosis. Surgical Neurology International. 6:
171. doi:10.4103/2152-7806.169561. ISSN 2229-5097.
PMC 4653353 . PMID 26629397.
6.7. AMYOTROPHIC LATERAL SCLEROSIS
[3] Motor neurone disease. NHS Choices. Retrieved 2 Jan-
uary 2015.
[4] Motor Neuron Diseases Fact Sheet. National Insti-
tute of Neurological Disorders and Stroke. Retrieved 7
November 2010.
[5] Kiernan, MC; Vucic, S; Cheah, BC; Turner, MR; Eisen,
A; Hardiman, O; Burrell, JR; Zoing, MC (12 March
2011). Amyotrophic lateral sclerosis.. Lancet. 377
(9769): 94255. doi:10.1016/s0140-6736(10)61156-7.
PMID 21296405.
[6] Miller, RG; Mitchell, JD; Moore, DH (14 March
2012). Riluzole for amyotrophic lateral sclerosis
(ALS)/motor neuron disease (MND).. The Cochrane
database of systematic reviews. 3: CD001447.
doi:10.1002/14651858.CD001447.pub3. PMID
22419278.
[7] McDermott, CJ; Shaw, PJ (22 March 2008). Diagnosis
and management of motor neurone disease.. BMJ
(Clinical research ed.). 336 (7645): 65862.
doi:10.1136/bmj.39493.511759.be. PMC 2270983 .
PMID 18356234.
[8] Hobson, EV; McDermott, CJ (September 2016). Sup-
portive and symptomatic management of amyotrophic lat-
eral sclerosis.. Nature reviews. Neurology. 12 (9): 526
38. PMID 27514291.
[9] Epidemiology of Sporadic ALS. Retrieved 2 January
2015.
[10] Rowland LP (March 2001). How amyotrophic lateral
sclerosis got its name: the clinical-pathologic genius of
Jean-Martin Charcot. Arch. Neurol. 58 (3): 5125.
doi:10.1001/archneur.58.3.512. PMID 11255459.
[11] Kelly, Evelyn B. (2013). Encyclopedia of human genetics
and disease. Santa Barbara, Calif.: Greenwood. pp. 79
80. ISBN 978-0-313-38713-5.
[12] Youngson, David B. Jacoby, Robert M. (2004).
Encyclopedia of family health (3rd ed.). Tarrytown, NY:
Marshall Cavendish. p. 1256. ISBN 978-0-7614-7486-9.
[13] Song, P (August 2014). The Ice Bucket Challenge: The
public sector should get ready to promptly promote the
sustained development of a system of medical care for and
research into rare diseases.. Intractable & rare diseases
research. 3 (3): 946. doi:10.5582/irdr.2014.01015.
PMID 25364651.
[14] Raaphorst, Joost; Beeldman, Emma; De Visser, Mari-
anne; De Haan, Rob J.; Schmand, Ben (2012-10-01). A
systematic review of behavioural changes in motor neu-
ron disease. Amyotrophic Lateral Sclerosis: Ocial Pub-
lication of the World Federation of Neurology Research
Group on Motor Neuron Diseases. 13 (6): 493501.
doi:10.3109/17482968.2012.656652. ISSN 1471-180X.
PMID 22424127.
[15] Beeldman, Emma; Raaphorst, Joost; Twennaar, Michelle
Klein; Visser, Marianne de; Schmand, Ben A.; Haan,
Rob J. de (2015-08-17). The cognitive prole of ALS:
87
a systematic review and meta-analysis update. Jour-
nal of Neurology, Neurosurgery & Psychiatry: 6119.
doi:10.1136/jnnp-2015-310734. PMID 26283685.
[16] Motor neurone disease - Symptoms (Page last reviewed:
Jan 15, 2015). NHS Choices. Retrieved 18 September
2016.
[17] Gordon, PH; Miller, RG; Moore, DH (September 2004).
ALSFRS-R.. Amyotrophic lateral sclerosis and other
motor neuron disorders : ocial publication of the World
Federation of Neurology, Research Group on Motor Neu-
ron Diseases. 5 Suppl 1: 903. PMID 15512883.
[18] Creemers, H; et al. (June 2015). Prognostic factors for
the course of functional status of patients with ALS: a sys-
tematic review.. Journal of neurology. 262 (6): 1407
23. PMID 25385051.
[19] Castrillo-Viguera C, Grasso DL, Simpson E, Shefner
J, Cudkowicz ME (2010). Clinical signicance in
the change of decline in ALSFRS-R. Amyotroph
Lateral Scler (Journal Article). 11 (12): 17880.
doi:10.3109/17482960903093710. PMID 19634063.
[20] Sabatelli M, Madia F, Conte A, Luigetti M, Zollino
M, Mancuso I, Lo Monaco M, Lippi G, Tonali P (16
September 2008). Natural history of young-adult amy-
otrophic lateral sclerosis. Neurology. 71 (12): 876
81. doi:10.1212/01.wnl.0000312378.94737.45. PMID
18596241.
[21] Paganoni, Sabrina; Deng, Jing; Jaa, Matthew; Cudkow-
icz, Merit E.; Wills, Anne-Marie (2011). Body mass in-
dex, not dyslipidemia, is an independent predictor of sur-
vival in amyotrophic lateral sclerosis. Muscle & Nerve.
44 (1): 204. doi:10.1002/mus.22114. PMC 4441750 .
PMID 21607987. Lay summary Massachusetts General
Hospital (May 11, 2011).
[22] Chi A, Calvo A, Moglia C, Mazzini L, Mora G (2011).
Phenotypic heterogeneity of amyotrophic lateral scle-
rosis: A population based study. Journal of Neu-
rology, Neurosurgery & Psychiatry. 82 (7): 740746.
doi:10.1136/jnnp.2010.235952. PMID 21402743.
[23] Lopez-Lopez A, Gamez J, Syriani E, Morales M, Salvado
M, Rodrguez MJ, Mahy N, Vidal-Taboada JM (2014).
CX3CR1 Is a Modifying Gene of Survival and Progres-
sion in Amyotrophic Lateral Sclerosis. PLoS ONE. 9
(5): e96528. doi:10.1371/journal.pone.0096528. PMC
4013026 . PMID 24806473.
[24] Stephen Hawking serves as role model for ALS patients.
CNN. 2009-04-20.
[25] Cookson, Mark R.; Wingo, Thomas S.; Cutler, David
J.; Yarab, Nicole; Kelly, Crystal M.; Glass, Jonathan
D. (2011). The Heritability of Amyotrophic Lat-
eral Sclerosis in a Clinically Ascertained United States
Research Registry. PLoS ONE. 6 (11): e27985.
doi:10.1371/journal.pone.0027985. ISSN 1932-6203.
[26] Sontheimer, Harald (2015). Diseases of the Nervous Sys-
tem. Academic Press. p. 170. ISBN 978-0-12-800403-6.
Retrieved 2015-05-02.
88
[27] Conwit RA (December 2006). Preventing familial ALS:
A clinical trial may be feasible but is an ecacy trial war-
ranted?". Journal of the Neurological Sciences. 251 (12):
12. doi:10.1016/j.jns.2006.07.009. ISSN 0022-510X.
PMID 17070848.
[28] Al-Chalabi A, Leigh PN (August 2000). Recent ad-
vances in amyotrophic lateral sclerosis. Current Opinion
in Neurology. 13 (4): 397405. doi:10.1097/00019052-
200008000-00006. ISSN 1473-6551. PMID 10970056.
[29] Battistini S, Ricci C, Lotti EM, Benigni M, Gagliardi S,
Zucco R, Bondavalli M, Marcello N, Ceroni M, Cereda
C (June 2010). Severe familial ALS with a novel
exon 4 mutation (L106F) in the SOD1 gene. Jour-
nal of the Neurological Sciences. 293 (1): 112115.
doi:10.1016/j.jns.2010.03.009. PMID 20385392.
[30] Andersen PM, Forsgren L, Binzer M, Nilsson P, Ala-
Hurula V, Kernen ML, Bergmark L, Saarinen A, Haltia
T, Tarvainen I, Kinnunen E, Udd B, Marklund SL (1996).
Autosomal recessive adult-onset amyotrophic lateral
sclerosis associated with homozygosity for Asp90Ala
CuZn-superoxide dismutase mutation, A clinical and ge-
nealogical study of 36 patients. Brain. 119 (4): 1153
1172. doi:10.1093/brain/119.4.1153. PMID 8813280.
[31] DeJesus-Hernandez, Mariely; Mackenzie, Ian R.; Boeve,
Bradley F.; Boxer, Adam L.; Baker, Matt; Rutherford,
Nicola J.; Nicholson, Alexandra M.; Finch, NiCole A.;
Flynn, Heather; Adamson, Jennifer; Kouri, Naomi; Wo-
jtas, Aleksandra; Sengdy, Pheth; Hsiung, Ging-Yuek
R.; Karydas, Anna; Seeley, William W.; Josephs, Keith
A.; Coppola, Giovanni; Geschwind, Daniel H.; Ws-
zolek, Zbigniew K.; Feldman, Howard; Knopman, David
S.; Petersen, Ronald C.; Miller, Bruce L.; Dickson,
Dennis W.; Boylan, Kevin B.; Gra-Radford, Neill R.;
Rademakers, Rosa (2011). Expanded GGGGCC Hex-
anucleotide Repeat in Noncoding Region of C9ORF72
Causes Chromosome 9p-Linked FTD and ALS. Neu-
ron. 72 (2): 24556. doi:10.1016/j.neuron.2011.09.011.
PMC 3202986 . PMID 21944778.
[32] Majounie, Elisa; Renton, Alan E; Mok, Kin; Dopper,
Elise GP; Waite, Adrian; Rollinson, Sara; Chi, Adriano;
Restagno, Gabriella; Nicolaou, Nayia; Simon-Sanchez,
Javier; van Swieten, John C; Abramzon, Yevgeniya; John-
son, Janel O; Sendtner, Michael; Pamphlett, Roger; Or-
rell, Richard W; Mead, Simon; Sidle, Katie C; Houlden,
Henry; Rohrer, Jonathan D; Morrison, Karen E; Pall,
Hardev; Talbot, Kevin; Ansorge, Olaf; Hernandez, Dena
G; Arepalli, Sampath; Sabatelli, Mario; Mora, Gabriele;
Corbo, Massimo; Giannini, Fabio; Calvo, Andrea; En-
glund, Elisabet; Borghero, Giuseppe; Floris, Gian Luca;
Remes, Anne M; Laaksovirta, Hannu; McCluskey, Leo;
Trojanowski, John Q; Van Deerlin, Vivianna M; Schel-
lenberg, Gerard D; Nalls, Michael A; Drory, Vivian E;
Lu, Chin-Song; Yeh, Tu-Hsueh; Ishiura, Hiroyuki; Taka-
hashi, Yuji; Tsuji, Shoji; Le Ber, Isabelle; Brice, Alexis;
Drepper, Carsten; Williams, Nigel; Kirby, Janine; Shaw,
Pamela; Hardy, John; Tienari, Pentti J; Heutink, Pe-
ter; Morris, Huw R; Pickering-Brown, Stuart; Traynor,
Bryan J (2012). Frequency of the C9orf72 hexanu-
cleotide repeat expansion in patients with amyotrophic
CHAPTER 6. HUMAN GENETIC DISEASES
lateral sclerosis and frontotemporal dementia: a cross-
sectional study. The Lancet Neurology. 11 (4): 32330.
doi:10.1016/S1474-4422(12)70043-1. PMC 3322422 .
PMID 22406228.
[33] Deng, Han-Xiang; Chen, Wenjie; Hong, Seong-Tshool;
Boycott, Kym M.; Gorrie, George H.; Siddique, Nailah;
Yang, Yi; Fecto, Faisal; Shi, Yong; Zhai, Hong; Jiang, Hu-
jun; Hirano, Makito; Rampersaud, Evadnie; Jansen, Ger-
ard H.; Donkervoort, Sandra; Bigio, Eileen H.; Brooks,
Benjamin R.; Ajroud, Kaouther; Sut, Robert L.; Haines,
Jonathan L.; Mugnaini, Enrico; Pericak-Vance, Margaret
A.; Siddique, Teepu (2011). Mutations in UBQLN2
cause dominant X-linked juvenile and adult-onset ALS
and ALS/dementia. Nature. 477 (7363): 2115.
doi:10.1038/nature10353. PMC 3169705 . PMID
21857683.
[34] Johnson JO, Mandrioli J, Benatar M, Abramzon Y, Van
Deerlin VM, Trojanowski JQ, Gibbs JR, Brunetti M,
Gronka S, Wuu J, Ding J, McCluskey L, Martinez-Lage
M, Falcone D, Hernandez DG, Arepalli S, Chong S,
Schymick JC, Rothstein J, Landi F, Wang YD, Calvo
A, Mora G, Sabatelli M, Monsurr MR, Battistini S,
Salvi F, Spataro R, Sola P, Borghero G, Galassi G,
Scholz SW, Taylor JP, Restagno G, Chi A, Traynor BJ
(2010). Exome Sequencing Reveals VCP Mutations as
a Cause of Familial ALS. Neuron. 68 (5): 857864.
doi:10.1016/j.neuron.2010.11.036. PMC 3032425 .
PMID 21145000.
[35] Buchan JR, Kolaitis RM, Taylor JP, Parker R (20 June
2013). Eukaryotic stress granules are cleared by au-
tophagy and Cdc48/VCP function. Cell. 153 (7): 1461
74. doi:10.1016/j.cell.2013.05.037. PMC 3760148 .
PMID 23791177.
[36] Al-Saif A, Al-Mohanna F, Bohlega S (2011). A muta-
tion in sigma-1 receptor causes juvenile amyotrophic lat-
eral sclerosis. Annals of Neurology. 70 (6): 913919.
doi:10.1002/ana.22534. PMID 21842496.
[37] Wu CH, Fallini C, Ticozzi N, Keagle PJ, Sapp PC, Pi-
otrowska K, Lowe P, Koppers M, McKenna-Yasek D,
Baron DM, Kost JE, Gonzalez-Perez P, Fox AD, Adams
J, Taroni F, Tiloca C, Leclerc AL, Chafe SC, Mangroo
D, Moore MJ, Zitzewitz JA, Xu ZS, van den Berg LH,
Glass JD, Siciliano G, Cirulli ET, Goldstein DB, Salachas
F, Meininger V, Rossoll W, Ratti A, Gellera C, Bosco DA,
Bassell GJ, Silani V, Drory VE, Brown RH, Landers JE
(2012). Mutations in the prolin 1 gene cause familial
amyotrophic lateral sclerosis. Nature. 488 (7412): 499
503. doi:10.1038/nature11280. PMC 3575525 . PMID
22801503.
[38] Takahashi Y, Fukuda Y, Yoshimura J, Toyoda A, Kurppa
K, Moritoyo H, Belzil VV, Dion PA, Higasa K, Doi K,
Ishiura H, Mitsui J, Date H, Ahsan B, Matsukawa T,
Ichikawa Y, Moritoyo T, Ikoma M, Hashimoto T, Kimura
F, Murayama S, Onodera O, Nishizawa M, Yoshida M,
Atsuta N, Sobue G, Fita JA, Williams KL, Blair IP,
Nicholson GA, Gonzalez-Perez P, Brown RH, Nomoto
M, Elenius K, Rouleau GA, Fujiyama A, Morishita S,
Goto J, Tsuji S (2013). ERBB4 mutations that disrupt
6.7. AMYOTROPHIC LATERAL SCLEROSIS
the neuregulin-ErbB4 pathway cause amyotrophic lateral
sclerosis type 19. Am. J. Hum. Genet. 93 (5): 900
5. doi:10.1016/j.ajhg.2013.09.008. PMC 3824132 .
PMID 24119685.
[39] Kim HJ, Kim NC, Wang YD, Scarborough EA, Moore
J, Diaz Z, MacLea KS, Freibaum B, Li S, Molliex A,
Kanagaraj AP, Carter R, Boylan KB, Wojtas AM, Rade-
makers R, Pinkus JL, Greenberg SA, Trojanowski JQ,
Traynor BJ, Smith BN, Topp S, Gkazi AS, Miller J, Shaw
CE, Kottlors M, Kirschner J, Pestronk A, Li YR, Ford
AF, Gitler AD, Benatar M, King OD, Kimonis VE, Ross
ED, Weihl CC, Shorter J, Taylor JP (28 March 2013).
Mutations in the prion-like domains of hnRNPA2B1 and
hnRNPA1 cause multisystem proteinopathy and ALS.
Nature. 495 (7442): 46773. doi:10.1038/nature11922.
PMC 3756911 . PMID 23455423.
[40] Bruijn LI, Houseweart MK, Kato S, Anderson KL, An-
derson SD, Ohama E, Reaume AG, Scott RW, Cleve-
land DW (1998). Aggregation and motor neuron tox-
icity of an ALS-linked SOD1 mutant independent from
wild-type SOD1. Science. 281 (5384): 18514.
doi:10.1126/science.281.5384.1851. PMID 9743498.
[41] Reaume AG, Elliott JL, Homan EK, Kowall NW,
Ferrante RJ, Siwek DF, Wilcox HM, Flood DG, Beal
MF, Brown RH, Scott RW, Snider WD (1996). Mo-
tor neurons in Cu/Zn superoxide dismutase-decient
mice develop normally but exhibit enhanced cell death
after axonal injury. Nat Genet. 13 (1): 437.
doi:10.1038/ng0596-43. PMID 8673102.
[42] Boille S, Vande Velde C, Cleveland DW (2006).
ALS: a disease of motor neurons and their non-
neuronal neighbors. Neuron. 52 (1): 3959.
doi:10.1016/j.neuron.2006.09.018. PMID 17015226.
[43] Gardner, RC; Yae, K (May 2015). Epidemiology
of mild traumatic brain injury and neurodegenerative
disease.. Molecular and cellular neurosciences. 66
(Pt B): 7580. doi:10.1016/j.mcn.2015.03.001. PMC
4461453 . PMID 25748121.
[44] Chen, H; Richard, M; Sandler, DP; Umbach, DM; Kamel,
F (1 October 2007). Head injury and amyotrophic lat-
eral sclerosis.. American Journal of Epidemiology. 166
(7): 8106. doi:10.1093/aje/kwm153. PMC 2239342 .
PMID 17641152.
[45] Concussion in professional football: helmet testing to as-
sess impact performance--part 11. (PDF). United States
Public Health Service Centers for Disease Control and
Prevention National Institute for Occupational Safety and
Health. 2004-01-10. Retrieved 2013-09-03.
[46] Lehman, EJ (2013). Epidemiology of neurodegen-
eration in American-style professional football play-
ers.. Alzheimers research & therapy. 5 (4):
34. doi:10.1186/alzrt188. PMC 3978683 . PMID
23876143.
[47] Beard, John D.; Kamel, Freya (1 January 2015). Military
service, deployments, and exposures in relation to amy-
otrophic lateral sclerosis etiology and survival. Epidemi-
89
ologic Reviews. 37: 5570. doi:10.1093/epirev/mxu001.
ISSN 1478-6729. PMC 4325667 . PMID 25365170.
[48] Gardner, Raquel C.; Yae, Kristine (2015-05-
01). Epidemiology of mild traumatic brain in-
jury and neurodegenerative disease. Molecular
and Cellular Neurosciences. 66 (Pt B): 7580.
doi:10.1016/j.mcn.2015.03.001. ISSN 1095-9327.
PMC 4461453 . PMID 25748121.
[49] Manuel M, Heckman CJ (March 2011). Stronger is not
always better: could a bodybuilding dietary supplement
lead to ALS?". Exp Neurol (Review). 228 (1): 58.
doi:10.1016/j.expneurol.2010.12.007. PMC 3049458 .
PMID 21167830.
[50] Fernndez-Borges N, Eraa H, Elezgarai SR, Harrathi C,
Gayosso M, Castilla J (25 September 2013). Infectivity
versus seeding in neurodegenerative diseases sharing a
prion-like mechanism. Int J Cell Biol. 2013: 583498.
doi:10.1155/2013/583498. PMC 3800648 . PMID
24187553.
[51] Holtcamp, W. (2012). The emerging science of
BMAA: do cyanobacteria contribute to neurodegenera-
tive disease?". Environmental Health Perspectives. 120
(3): a110a116. doi:10.1289/ehp.120-a110. PMC
3295368 . PMID 22382274.
[52] Rodgers KJ (March 2014). Non-protein
amino acids and neurodegeneration: The enemy
within. Experimental Neurology. 253: 192196.
doi:10.1016/j.expneurol.2013.12.010. PMID 24374297.
[53] Rosenbohm A.; Kassubek J.; Weydt P.; Marroquin
N.; Volk A.; Kubisch C.; Huppertz H.; Weber M.
(2014). Can lesions to the motor cortex induce amy-
otrophic lateral sclerosis?". J Neurol. 261: 283290.
doi:10.1007/s00415-013-7185-7.
[54] Walling, Anne D. (1999). Amyotrophic lateral sclerosis:
Lou Gehrigs disease. American Family Physician. 59
(6): 148996. PMID 10193591.
[55] Sutedja NA, Fischer K, Veldink JH, van der Heijden GJ,
Kromhout H, Heederik D, Huisman MH, Wokke JJ, van
den Berg LH (2009). What we truly know about occupa-
tion as a risk factor for ALS: a critical and systematic re-
view. Amyotrophic Lateral Sclerosis. 10 (56): 295301.
doi:10.3109/17482960802430799. PMID 19922116.
[56] Fang, Fang; Ingre, Caroline; Roos, Per; Kamel, Freya;
Piehl, Fredrik (2015). Risk factors for amyotrophic
lateral sclerosis. Clinical Epidemiology. 7: 18193.
doi:10.2147/CLEP.S37505. PMC 4334292 . PMID
25709501.
[57] Kamel, F; Umbach, DM; Bedlack, RS; Richards, M; Wat-
son, M; Alavanja, MC; Blair, A; Hoppin, JA; Schmidt, S;
Sandler, DP (June 2012). Pesticide exposure and amy-
otrophic lateral sclerosis. Neurotoxicology. 33 (3): 457
62. doi:10.1016/j.neuro.2012.04.001. PMC 3358481 .
PMID 22521219.
90
[58] Bozzoni, V; Pansarasa, O; Diamanti, L; Nosari, G;
Cereda, C; Ceroni, M (2016). Amyotrophic lateral scle-
rosis and environmental factors.. Functional neurology.
31 (1): 719. PMC 4819821 . PMID 27027889.
[59] Malek, AM; Barchowsky, A; Bowser, R; Youk, A; Tal-
bott, EO (August 2012). Pesticide exposure as a risk
factor for amyotrophic lateral sclerosis: a meta-analysis
of epidemiological studies: pesticide exposure as a risk
factor for ALS.. Environmental research. 117: 1129.
doi:10.1016/j.envres.2012.06.007. PMID 22819005.
[60] Deng, Han-Xiang; Zhai, Hong; Bigio, Eileen H.; Yan,
Jianhua; Fecto, Faisal; Ajroud, Kaouther; Mishra, Man-
jari; Ajroud-Driss, Senda; Heller, Scott; Sut, Robert;
Siddique, Nailah; Mugnaini, Enrico; Siddique, Teepu
(2010). FUS-immunoreactive inclusions are a common
feature in sporadic and non-SOD1 familial amyotrophic
lateral sclerosis. Annals of Neurology. 67 (6): 739
48. doi:10.1002/ana.22051. PMC 4376270 . PMID
20517935.
[61] Hnsel Y, Ackerl M, Stanek G (1995). ALS-like seque-
lae in chronic neuroborreliosis. Wien Med Wochenschr.
145 (78): 1868. PMID 7610670.
[62] el Alaoui-Faris M, Medejel A, al Zemmouri K, Yahyaoui
M, Chkili T (1990). Amyotrophic lateral sclerosis syn-
drome of syphilitic origin. 5 cases. Rev Neurol (Paris).
146 (1): 414. PMID 2408129.
[63] Umaneki KG, Dekonenko EP (1983). Structure of pro-
gressive forms of tick-borne encephalitis. Zh Nevropa-
tol Psikhiatr Im S S Korsakova. 83 (8): 11739. PMID
6414202.
[64] Silani V, Messina S, Poletti B, Morelli C, Doretti A,
Ticozzi N, Maderna L (2011). The diagnosis of Amy-
otrophic lateral sclerosis in 2010. Archives italiennes de
biologie. 149 (1): 527. doi:10.4449/aib.v149i1.1260.
PMID 21412713.
[65] Eisen, A. (2002). Amyotrophic lateral sclerosis: A re-
view. BCMJ. 44 (7): 362366.
[66] Davenport RJ, Swingler RJ, Chancellor AM, Warlow CP
(1996). Avoiding false positive diagnoses of motor neu-
ron disease: lessons from the Scottish Motor Neuron Dis-
ease Register. J. Neurol. Neurosurg. Psychiatr. 60 (2):
14751. doi:10.1136/jnnp.60.2.147. PMC 1073793 .
PMID 8708642.
[67] Chieia, Marco A.; Oliveira, Acary S.B.; Silva, Helga C.A.;
Gabbai, Alberto Alain (2010). Amyotrophic lateral scle-
rosis: considerations on diagnostic criteria. Arquivos de
Neuro-Psiquiatria. 68 (6): 83742. doi:10.1590/S0004-
282X2010000600002. PMID 21243238.
[68] Al-Asmi A, Nandhagopal R, Jacob PC, Gujjar A (2012).
Misdiagnosis of Myasthenia Gravis and Subsequent
Clinical Implication: A case report and review of liter-
ature. Sultan Qaboos University medical journal. 12
(1): 103108. doi:10.12816/0003095. PMC 3286704 .
PMID 22375266.
CHAPTER 6. HUMAN GENETIC DISEASES
[69] Lambert-Eaton Myasthenic Syndrome (LEMS)".
Misc.medscape.com. Retrieved 18 April 2013.
[70] LEMS.com, Lambert-Eaton Myasthenic Syndrome:
About. Lems.com. Retrieved 18 April 2013.
[71] Carlesi C, Pasquali L, Piazza S, Lo Gerfo A, Caldarazzo
Ienco E, Alessi R, Fornai F, Siciliano G (March 2011).
Strategies for clinical approach to neurodegeneration in
Amyotrophic lateral sclerosis. Archives italiennes de bi-
ologie. 149 (1): 15167. doi:10.4449/aib.v149i1.1267.
PMID 21412722.
[72] Miller RG, Mitchell JD, Lyon M, Moore DH (2007).
Miller RG, ed. Riluzole for amyotrophic lateral scle-
rosis (ALS)/motor neuron disease (MND)". Cochrane
Database of Systematic Reviews (1): CD001447.
doi:10.1002/14651858.CD001447.pub2. PMID
17253460.
[73] Russell P, Harrison R (2014). What is amyotrophic lat-
eral sclerosis. Clinical Pharmacist. 6 (7).
[74] Sviri S, Linton DM, van Heerden PV (Jun 2005). Non-
invasive Mechanical Ventilation Enhances Patient Auton-
omy in Decision-Making Regarding Chronic Ventilation.
Critical Care and Resuscitation. 7 (2): 116118. PMID
16548804.
[75] Lewis M, Rushanan S (2007). The role of physical ther-
apy and occupational therapy in the treatment of Amy-
otrophic Lateral Sclerosis. NeuroRehabilitation. 22 (6):
451461. PMID 18198431.
[76] Kasarskis EJ, Berryman S, Vanderleest JG, Schneider
AR, McClain CJ (Jan 1996). Nutritional status of pa-
tients with amyotrophic lateral sclerosis: relation to the
proximity of death. Am J Clin Nutr. 63 (1): 1307.
PMID 8604660.
[77] Holm T, Maier A, Wicks P, Lang D, Linke P, Mnch C,
Steinfurth L, Meyer R, Meyer T (Apr 2013). Severe
Loss of Appetite in Amyotrophic Lateral Sclerosis Pa-
tients: Online Self-Assessment Study. Interact J Med
Res. 2 (1): e8. doi:10.2196/ijmr.2463. PMC 3632382 .
PMID 23608722.
[78] Hamadeh MJ, Rodriguez MC, Kaczor JJ, Tarnopolsky
MA (Feb 2005). Caloric restriction transiently improves
motor performance but hastens clinical onset of disease in
the Cu/Zn-superoxide dismutase mutant G93A mouse.
Muscle Nerve. 31 (2): 21420. doi:10.1002/mus.20255.
PMID 15625688.
[79] Slowie LA, Paige MS, Antel JP (Jul 1983). Nutritional
considerations in the management of patients with amy-
otrophic lateral sclerosis (ALS)". J Am Diet Assoc. 83
(1): 447. PMID 6863783.
[80] Payne, C; Wien, PJ; Martin, S (18 January 2012).
Interventions for fatigue and weight loss in adults
with advanced progressive illness.. The Cochrane
database of systematic reviews. 1: CD008427.
doi:10.1002/14651858.cd008427.pub2. PMID
22258985.
6.7. AMYOTROPHIC LATERAL SCLEROSIS 91

[81] ALS Association. Quick Facts About ALS & The ALS [96] Alexander, Ella. Ice Bucket Challenge: Lady Gaga,
Association. Justin Bieber, G-Dragon and Oprah the most entertain-
ing reactions so far.
[82] ALS Topic Overview. Archived from the original on 1
May 2008. Retrieved 2008-05-01. [97] Ice Bucket Challenge funds discovery of gene linked to
ALS. Retrieved 2016-07-27.
[83] Walling AD (1999). Amyotrophic lateral sclerosis: Lou
Gehrigs disease. American Family Physician. 59 (6): [98] Kenna, Kevin P; Doormaal, Perry T C van; Dekker, An-
14891496. PMID 10193591. nelot M; Ticozzi, Nicola; Kenna, Brendan J; Diekstra,
Frank P; Rheenen, Wouter van; Eijk, Kristel R van; Jones,
[84] Gordon Paul (2011). Amyotrophic Lateral Sclero- Ashley R. NEK1 variants confer susceptibility to amy-
sis. Pathophysiology, Diagnosis and Management. otrophic lateral sclerosis. Nature Genetics. 48 (9): 1037
CNS Drugs. 25 (1): 115. doi:10.2165/11586000- 1042. doi:10.1038/ng.3626.
000000000-00000.
[99] You're Not You at the Internet Movie Database
[85] Sla, indagini nei club. Pesticidi nel mirino. Archived
from the original on 3 October 2008. Retrieved 2008-10- [100] Kevin Turner, N.F.L. Player Who Later Fought the
02. League, Dies at 46. New York Times. March 24, 2016.
Retrieved 2016-03-27.
[86] Wicks P, Abrahams S, Masi D, Hejda-Forde S, Leigh
PN, Goldstein LH (2005). The Prevalence of Depression [101] Press release project MinE, june 21st 2013 : Archived
and Anxiety in MND. Amyotrophic Lateral Sclerosis and copy (PDF). Archived from the original (PDF) on 3 De-
Other Motor Neuron Disorders. 6 (Supplement 1): 147. cember 2013. Retrieved 2014-05-09.
ISSN 1466-0822.
[102] National Amyotrophic Lateral Sclerosis (ALS) Reg-
[87] Rachele MG, Mascia V, Tacconi P, Dessi N, Mar- istry. Dec 15, 2014. Retrieved 25 August 2015.
rosu F, Giagheddu M (April 1998). Conjugal amy-
otrophic lateral sclerosis: a report on a couple from [103] Pastula, DM; Moore, DH; Bedlack, RS (12 December
Sardinia, Italy. Ital J Neurol Sci. 19 (2): 97100. 2012). Creatine for amyotrophic lateral sclerosis/motor
doi:10.1007/BF02427565. PMID 10935845. neuron disease.. The Cochrane database of systematic re-
views. 12: CD005225. PMID 23235621.
[88] Poloni M, Micheli A, Facchetti D, Mai R, Ceriani F,
Cattalini C (April 1997). Conjugal amyotrophic lat- [104] Fang, J; Zhou, M; Yang, M; Zhu, C; He, L (31 May 2013).
eral sclerosis: toxic clustering or change?". Ital J Neurol Repetitive transcranial magnetic stimulation for the treat-
Sci. 18 (2): 10912. doi:10.1007/BF01999572. PMID ment of amyotrophic lateral sclerosis or motor neuron dis-
9239532. ease.. The Cochrane database of systematic reviews (5):
CD008554. PMID 23728676.
[89] Camu W, Cadilhac J, Billiard M (March 1994). Conju-
gal amyotrophic lateral sclerosis: a report on two couples
from southern France. Neurology. 44 (3 Pt 1): 5478. This article incorporates text from the United States De-
doi:10.1212/WNL.44.3_Part_1.547. PMID 8145930. partment of Health and Human Services (), which is in the
public domain.
[90] Cornblath DR, Kurland LT, Boylan KB, Morrison L,
Radhakrishnan K, Montgomery M (November 1993).
Conjugal amyotrophic lateral sclerosis: report of a 6.7.12 External links
young married couple. Neurology. 43 (11): 237880.
doi:10.1212/WNL.43.11.2378. PMID 8232960. Amyotrophic lateral sclerosis at DMOZ
[91] Corcia P, Jafari-Schluep HF, Lardillier D, Mazyad H,
Giraud P, Clavelou P, Pouget J, Camu W (November
2003). A clustering of conjugal amyotrophic lateral scle-
rosis in southeastern France. Neurol. 60 (4): 5537.
doi:10.1001/archneur.60.4.553. PMID 12707069.

[92] Farewell Speech. lougehrig.com. 4 July 1939.

Archived from the original on 12 April 2008. Retrieved
16 April 2008.

[93] McAulie, Kathleen (July 22, 2011). Are Toxins in

Seafood Causing ALS, Alzheimers, and Parkinsons?".
Discover Magazine.

[94] George Bush delivers possibly the best ALS ice bucket
challenge yet. Independent. Retrieved 20 August 2014.

[95] Ice Bucket Challenge funds gene discovery in ALS

(MND) research. BBC News. 2016-07-27. Retrieved
2016-07-27.
Chapter 7

Pedigrees

92
Chapter 8

Inheritance Patterns

93
Chapter 9

Development

94
Chapter 10

Text and image sources, contributors, and

licenses

10.1 Text
Introduction to genetics Source: https://en.wikipedia.org/wiki/Introduction_to_genetics?oldid=743042160 Contributors: RodC, Alan
Liefting, Nunh-huh, JohnArmagh, Bender235, Reinyday, Arcadian, Gary, Etxrge, Diego Moya, Woohookitty, Benhocking, WadeSimMiser,
Mandarax, RichardWeiss, Nihiltres, Wavelength, Huw Powell, Brec, Shanel, Matriak, Yoninah, RUL3R, Werdna, Zzuuzz, Snalwibma, Fed-
eralist51, TestPilot, BiT, Timotheus Canens, Richard001, DMacks, Aaker, 16@r, Dl2000, Leevanjackson, AshLin, Thijs!bot, Horologium,
Wmasterj, Widefox, TimVickers, Labongo, Lklundin, Professor marginalia, Kuyabribri, Engineman, Jim.henderson, Vox Rationis, Vic-
tor Blacus, J.delanoy, Filll, Nbauman, Uncle Dick, Dr d12, Ryan Postlethwaite, Juliancolton, Tokenhost, Butwhatdoiknow, Z.E.R.O.,
Locogato, Sintaku, Jackfork, Lova Falk, SylviaStanley, SieBot, Graham Beards, ConfuciusOrnis, Andrewjlockley, Bentogoa, Flyer22 Re-
born, Nk.sheridan, Naturespace, Forluvoft, ClueBot, Antarctic-adventurer, XmaceX, Artichoker, The Thing That Should Not Be, Sting
au, Jaums, Niceguyedc, GoEThe, Aua, Deselliers, Excirial, Rhododendrites, Sun Creator, Htddler, Jonverve, Johnuniq, Little Mountain
5, Little Stupid, Addbot, Idkmybjill27, Seipjere, DOI bot, ContiAWB, Ccacsmss, Gail, Ettrig, Luckas-bot, Yobot, Azcolvin429, Back-
slash Forwardslash, Kristen Eriksen, Starproject, Materialscientist, Citation bot, La comadreja, Xqbot, The Roman Candle, Brandon5485,
Sesu Prime, DoctorDNA, Mark Renier, HRoestBot, Tom.Reding, Pedromelcop, Vkil, Lotje, Mtinker86, Eurye, RenamedUser01302013,
Dcirovic, James.harris.anderson, Ysulaiman, Biosicherheit, ClueBot NG, Harold Web, Wetzelman, Encyclopedant, Luceth, TheProfes-
sor, Minorview, YFdyh-bot, T. Reule, Isarra (HG), Me, Myself, and I are Here, Dave Braunschweig, Epicgenius, CsDix, Konijnvalstrik,
JaconaFrere, Chaya5260, Monkbot, GinAndChronically, IiKkEe, Slawzkii, DatGuy and Anonymous: 92
Mendelian inheritance Source: https://en.wikipedia.org/wiki/Mendelian_inheritance?oldid=745818422 Contributors: AxelBoldt, Mag-
nus Manske, Arvindn, PierreAbbat, Heron, Rbrwr, Michael Hardy, Lexor, DopeshJustin, Ahoerstemeier, Angela, Tristanb, Stismail,
Tpbradbury, Samsara, J D, Bloodshedder, Renato Caniatti~enwiki, Qertis, PuzzletChung, Robbot, Astronautics~enwiki, RedWolf,
Mintleaf~enwiki, Tom harrison, Fastssion, Duncharris, Cap601, PDH, Taka, H Padleckas, ClockworkTroll, Rich Farmbrough, Vsmith,
Eric Shalov, Hayabusa future, Edward Z. Yang, WhiteTimberwolf, Bobo192, Smalljim, Brim, Slicky, MPerel, Alansohn, Riana, Wt-
mitchell, BaronLarf, ClockworkSoul, Amorymeltzer, Sciurin, Ajpratt56, Abanima, Woohookitty, Mpatel, Tabletop, Cyberman, Prashan-
thns, Alan Canon, MarcoTolo, RichardWeiss, Magister Mathematicae, DanielAmelang, Sj, Sohmc, Elmer Clark, Chobot, DVdm, Bgwhite,
Roboto de Ajvol, The Rambling Man, YurikBot, RobotE, Epolk, SpuriousQ, Dysmorodrepanis~enwiki, Snek01, RazorICE, Taco325i,
Bobbo, Larry laptop, Moe Epsilon, Lipothymia, DeadEyeArrow, Jeremy Visser, DRosenbach, Donbert, WikiFew, That Guy, From
That Show!, Eog1916, SmackBot, AndyZ, AndreasJS, Evanreyes, Apers0n, Yamaguchi , Gilliam, Portillo, Ohnoitsjamie, Chaojoker,
MalafayaBot, SchftyThree, Miguel Andrade, Baa, DHN-bot~enwiki, Xchbla423, Shalom Yechiel, Nabokovian, Addshore, Pax85, Rada-
gast83, Jgrahamc, TedE, Richard001, Clean Copy, Humpeluch, TCorp, Zeamays, Rpferdner, Kashmiri, Bjankuloski06en~enwiki, Fang-
fufu, Spook`, Darry2385, Iridescent, Sander Sde, Tawkerbot2, Talono, Shrimp wong, Patho~enwiki, Ale jrb, Mattbr, Agathman, Avel2,
Markwtatom, Funnyfarmofdoom, Mikewax, Cancun771, Spookpadda, Thijs!bot, Theclassical, Headbomb, Marek69, Tocharianne, Escar-
bot, AntiVandalBot, Seaphoto, TimVickers, Danger, JAnDbot, Fetchcomms, Hut 8.5, .anacondabot, Vudicarus, Twisted86, CTF83!, Cyk-
tsui, Amadalvarez, Glen, Patstuart, Arsivis, MartinBot, STBot, Vigyani, Akamp85, Keith D, Vox Rationis, Genetics411, Conundrumer,
J.delanoy, Eliz81, Janeanne, Dr d12, Janus Shadowsong, Anonywiki, SmilesALot, Domminico, Cmichael, Joshua Issac, Juliancolton,
Bonadea, Daimore, VolkovBot, Ipso2, Philip Trueman, TXiKiBoT, Technopat, NPrice, Rei-bot, JhsBot, Jackfork, Raymondwinn, Rjm at
sleepers, Mangersz, Earthdirt, Bwentriding, Why Not A Duck, Teenagedramaqueen9, Slash8~enwiki, AS, Soccerlover91, Bumpusjames,
Aabicus, Dawn Bard, Sheldonhlynn, Sbowers3, Allmightyduck, Thegeorgebush, Bfx0, Gamall Wednesday Ida, Mygerardromance, Clue-
Bot, The Thing That Should Not Be, Sting au, Mild Bill Hiccup, Boneyard90, Hystrix, Killidude, Weltuntergang, Manderson198, Aitias,
Versus22, Johnuniq, Matthias M., Ano-User, Skunkboy74, Oldekop, Jsquared71, NellieBly, Profmafzal, U-146, Cunard, Addbot, Willk-
ing1979, Captain-tucker, TutterMouse, Jncraton, MrOllie, CarsracBot, FiriBot, Quercus solaris, Lightbot, Gail, Ettrig, Luckas-bot, Jason
Recliner, Esq., Pt1104, Azcolvin429, Backslash Forwardslash, AnomieBOT, Rubinbot, Sonia, Jim1138, AdjustShift, Qwertycua456, Ma-
terialscientist, 45Factoid44, LilHelpa, Anjani kumar, BalajiRamasubramanian, Xqbot, Capricorn42, Paig duhat09, Smim90, Proquence,
Cyphoidbomb, AbigailAbernathy, Jezhotwells, Mathonius, Noejesusjose, Lqin, FrescoBot, LucienBOT, Lrhino6, Redrose64, DrilBot,
Symplectic Map, I dream of horses, Rainbowofknowledge, Serols, Fluxions1643, Stevesmith1983, Melara..., Lotje, Callanecc, Powerdraw,
Fastilysock, Jbd12, Grow60, Onel5969, Avenue X at Cicero, Yupyupyupyuppers, Dewritech, JamesHilt62, Slightsmile, K6ka, Solomon-
fromnland, JSquish, John Cline, Kevin Palmer94, Fintelia, Makecat, Donner60, Clementina, NTox, DASHBotAV, Rocketrod1960, Petrb,
ClueBot NG, Rich Smith, Jack Greenmaven, MelbourneStar, Frangel, Widr, Aznriceboi1234, Electriccatsh2, Slowsand, HMSSolent, Tito-
dutta, BG19bot, DavyCrockettJones, Pineali, Fallacy of the Masses, Snow Blizzard, Maharding, Thegreatgrabber, Wonderlamb, Rob Hurt,
Kingsocarso, Jonadin93, Puppy87685, Mrt3366, ChrisGualtieri, YFdyh-bot, Ctlin.Frncu, Ptrw08, Wywin, Mambawarrior, CsDix, I am

95
96 CHAPTER 10. TEXT AND IMAGE SOURCES, CONTRIBUTORS, AND LICENSES

One of Many, Gildednarwhal, DavidLeighEllis, Avi8tor, ReconditeRodent, Howcanyou, Lizia7, Scientist3456789, Quigend, Library Guy,
Yofemale69, Shubhavatar, Maniacq, Mahusha, Elephantsofearth, Elenceq, Pratha naik, Acagastya, SCHAPPY, AsusparkyEP, Pain96,
Crystallizedcarbon, Sneufeld, HealthyVara, Shebinabdulmuneer, Vinaykumar.yadav12346, KasparBot, Diesvitae, Hannahluvsyou, HexAr-
mageddon, Alec1020, Joshualouie711, Gezza44, MackanB123, John13mcdonald, Ismailbangis.iia, HanyGhazy and Anonymous: 532
Non-Mendelian inheritance Source: https://en.wikipedia.org/wiki/Non-Mendelian_inheritance?oldid=745713659 Contributors: Sam-
sara, PDH, Atemperman, Rich Farmbrough, Arcadian, Woohookitty, DavidMendoza, BD2412, Rjwilmsi, Isaac Rabinovitch, Kerowyn,
WriterHound, YurikBot, SmackBot, Lankenau, Skizzik, Bluebot, TedE, CmdrObot, Robotsintrouble, Leevanjackson, Peter Znamenskiy,
Nadiatalent, Pdcook, TXiKiBoT, BotKung, Sunrise, Norkish, Bretsam, Deselliers, Excirial, Porchcorpter, Oldekop, Aquatech, Addbot,
DOI bot, Tassedethe, Yobot, Materialscientist, Citation bot, Jdhotopp, Xqbot, Gigemag76, Nasnema, Corrigen, Citation bot 1, TjBot,
Dcirovic, Brandmeister, ClueBot NG, Thegreatgrabber, Sminthopsis84, Monkbot, Led Shandon and Anonymous: 31
Epistasis Source: https://en.wikipedia.org/wiki/Epistasis?oldid=736230546 Contributors: Maproom, Yahadzija, Hoksok and Anonymous:
2
Epigenetics Source: https://en.wikipedia.org/wiki/Epigenetics?oldid=745977927 Contributors: AxelBoldt, Marj Tiefert, Bryan Derksen,
Jeronimo, RK, William Avery, Anthere, Michael Hardy, Lexor, Shyamal, Menchi, Ellywa, KAMiKAZOW, EdH, Charles Matthews,
Greenrd, Steinsky, Sboehringer, Dogface, VeryVerily, Samsara, Khym Chanur, Robbot, Plehn, Peak, Shimon~enwiki, Graeme Bartlett,
DocWatson42, Polsmeth, Wolfkeeper, Bensaccount, Jason Quinn, Christopherlin, PDH, Taka, DragonySixtyseven, John Foley, PFH-
Lai, Sam Hocevar, Ukexpat, Chris Howard, D6, Discospinster, Rich Farmbrough, TedPavlic, Guanabot, H0riz0n, Vsmith, Dbachmann,
Bender235, Andrejj, Zaslav, JustinWick, Robert P. O'Shea, Irrbloss, R. S. Shaw, Lenov, Arcadian, A-Day, Espoo, Terrycojones, Eric
Kvaalen, Keenan Pepper, Plumbago, SlimVirgin, Seans Potato Business, Snowolf, Velella, H2g2bob, Sylvain Mielot, Joriki, Woohookitty,
Mindmatrix, Duncan.france, Zzyzx11, RichardWeiss, BD2412, JamesHenstridge, Edison, Mlewan, Rjwilmsi, KYPark, FlaBot, Ian Pitch-
ford, Pete.Hurd, Don Gosiewski, Chobot, Gdrbot, WriterHound, YurikBot, Wavelength, Whoisjohngalt, Chris Capoccia, Ogai, Gaius
Cornelius, Eleassar, O^O, Pseudomonas, Dysmorodrepanis~enwiki, Davidnortman, ErkDemon, Badagnani, Kkmurray, Mike Serfas, Stu-
Rat, Jules.LT, Arthur Rubin, Modify, Heathhunnicutt, GrinBot~enwiki, Cmglee, Finell, Snalwibma, SmackBot, InverseHypercube, Mar-
tin.Budden, Lankenau, Wolf ODonnell, Eaglizard, Delldot, Kintetsubualo, Apers0n, Yamaguchi , Gilliam, Amatulic, Bluebot, Jethero,
Jjalexand, RDBrown, Tito4000, Thumperward, Sbharris, Polyhedron, A. B., OrphanBot, Stuckinkiel, EPM, T-borg, Drphilharmonic,
DMacks, Daniel.Cardenas, Ronald.snijder, Madeleine Price Ball, AThing, Werlop, Rigadoun, Poa, Fd88ar, SvenskaJohannes, Mgigan-
teus1, NYCJosh, Capmo, RomanSpa, Ckatz, AdultSwim, Rubywine, Iridescent, Paul venter, Twas Now, JForget, Agathman, Lighthead,
Nightwriter50, Pgr94, Ervinn, A876, Anthonyhcole, Ttiotsw, Tenbergen, Matthew of Hamburg, Christian75, Hwttdz, Narayanese, Lu-
narian, JohnInDC, Thijs!bot, Marooned Morlock, Headbomb, Electron9, Vala M, David D., Yonatan, TimVickers, Smartse, Tlabshier,
Dougher, AubreyEllenShomo, NBeale, Gondola~enwiki, Bencherlite, VoABot II, Dentren, WhatamIdoing, Cgingold, Gomm, DerHexer,
Squidonius, STBot, Nikpapag, Sm8900, Bus stop, R'n'B, Nbauman, Boghog, MistyMorn, OttoMkel, Hodja Nasreddin, Tdadamemd,
KDSKDS, Mikael Hggstrm, Memestream, Chiswick Chap, Arms & Hearts, Trilobitealive, DadaNeem, 83d40m, Id711, Merzul, Dorgan-
Bot, StoptheDatabaseState, Ale2006, Butwhatdoiknow, Mcewan, Rambatino, Vitund, WatchAndObserve, TraumB~enwiki, Antoni Barau,
Guillaume2303, Qxz, FleetingJoy, Nazar, Wikipolonius, Lova Falk, Nouse4aname, Laoris, Travis Martin, Reesei, Danielgrad, Flyer22 Re-
born, Alexbrn, Mdsam2~enwiki, Adina cappell, Hzh, Eyoste, Oxymoron83, Danscher313, Alex.muller, DeknMike, Mauritsmaartende-
jong, Mike2vil, MarkinBoston, Ptr123, ShelleyAdams, Slaporte, Forluvoft, EPadmirateur, Touchstone42, ClueBot, Excentrifuge, Mild
Bill Hiccup, Niceguyedc, Lensicon~enwiki, Leadwind, Peteruetz, Jetspeed11, Philo-sofa, Deselliers, Tambone, Strangecow, Agor153,
Gpokela, Galapah, Johnuniq, Cbock, DumZiBoT, John0101ddd, Jytdog, Oldekop, Ost316, Osirus1701, Kembangraps, Passportguy, Ad-
dbot, Mortense, DOI bot, Fgnievinski, IMKatgrrl, Looie496, Bernstein0275, Charles walsh, Johannordholm, Ettrig, Ben Ben, Luckas-bot,
Yobot, Der Zeitgeist, Dumpster mun, Reindra, Universal Life, Fat Cigar, Hambleton, AnomieBOT, Eahd201, Jim1138, Pseudomyrmex,
Citation bot, Obersachsebot, Xqbot, Psytranscience, Erud, Wapondaponda, DSisyphBot, TAConsta, Dhfreedman, Dr Oldekop, Grou-
choBot, Jhbdel, False vacuum, Satirev, SassoBot, FrescoBot, Redpillbluepill, RoyGoldsmith, Bojo-is-the-man, D taz R, Citation bot 1, Win-
terst, Jonesey95, Pjozsi, Trappist the monk, Animalparty, Jonkerz, Semple1994, Arkelweis, Todash61, Adrin.jalali, Watcher0911, Rjwilm-
siBot, 7mike5000, Beyond My Ken, RustineS, John of Reading, Bobfreshwater, Dcirovic, K6ka, Jakecarver2010, ZroBot, Zacharylewis,
MuteRussian, Ex gratia, AManWithNoPlan, TijanaP, Tobeprecise, Joannamasel, Hazard-Bot, Jrae0404, FeatherPluma, Dbregister, Will
Beback Auto, Nomaddna, ClueBot NG, Teamcytostorm, Symbiogenesis, Joekingbling, Osterluzei, Billman119, Braincricket, Helpful Pixie
Bot, Bibcode Bot, NizoDino, BG19bot, Woodrowvitz, Stevetihi, CatPath, Jhd2, Srasher, CitationCleanerBot, Tomcorsonknowles, Mbolcar,
Nhhswm, Kevin Luethy, Jcmg1964, BattyBot, M farouk2000, Owleye769, Szwedkowski, Stigmatella aurantiaca, Jimw338, Cyberbot II,
Diracseawave, YFdyh-bot, Electricmun11, Dcherub, TylerDurden8823, JYBot, Mwsal, , Raymond1922A, Pianomanje, Car-
oline1981, Br'er Rabbit, Sms0610, Ashraf boss, Ibennani~enwiki, Jon the id, Faizan, SattvaBodhi, Wuming77, HansPopper, Eric WVGG,
Everymorning, Aadharm, Richjoo, Sleepdoc1, LudicrousTripe, Ichooxu, Kyrsjo, Seppi333, AnnieWoo, Wiki.vbs.redlof, AddWittyName-
Here, Anrnusna, Balzamon85, Michael K. Duke, Unsaunsa, Somecdnguy4, Chaya5260, Yahadzija, 22merlin, Monkbot, Gschliss, Ttam25,
Mama meta modal, Naysteam, Qwerty53, DrKenHo, Thundergodz, Sociocerebral, Benrusholme, MJeznach, KasparBot, Couchds, Jfraba-
jante, De la Marck, Epigeneticz, Adriaan van der Graaf, Araethusa, A little angry, Zwirko, Kaurkeerat, Sandyanne, SwagBucks101101,
MolecularPlant, SodaPup, DFinlaysonMD and Anonymous: 307
Cancer epigenetics Source: https://en.wikipedia.org/wiki/Cancer_epigenetics?oldid=744335074 Contributors: Graeme Bartlett, Chris
Howard, Kazvorpal, Rjwilmsi, Bgwhite, Wavelength, Chris Capoccia, Chris the speller, SandyGeorgia, Timtrent, Wikid77, Spin-
ningspark, France3470, XLinkBot, Bernstein0275, Yobot, AnomieBOT, LilHelpa, JWBE, Jonesey95, Trappist the monk, John of Reading,
Wes1138, Dcirovic, Hazard-Bot, Wakebrdkid, FeatherPluma, Frietjes, Bibcode Bot, BG19bot, CatPath, MrBill3, ArticlesForCreationBot,
Kabir1019, BRIGITTEBRI, Ibennani~enwiki, Bkgjkd, Phupe1, Tymiller.4, Chaya5260, Monkbot, Mama meta modal, Pishcal, Epi-1000,
Butterisoy, ElmonstruodeGila and Anonymous: 4
Genetic disorder Source: https://en.wikipedia.org/wiki/Genetic_disorder?oldid=740367625 Contributors: AxelBoldt, Malcolm Farmer,
JDG, JohnOwens, Michael Hardy, Llywrch, Lexor, Kku, Menchi, Ixfd64, Paul Benjamin Austin, Karada, Skysmith, Alo, NuclearWinner,
Ahoerstemeier, Jimmer, Dcoetzee, Dogface, Samsara, PuzzletChung, Robbot, SoLando, Giftlite, Lupin, CyborgTosser, Spooky, Kan-
dar, Gadum, Utcursch, Ran, Antandrus, PDH, Icairns, JavaTenor, Discospinster, Rich Farmbrough, Vsmith, KSlayer, RoyBoy, Triona,
Bobo192, Shenme, .:Ajvol:., ZayZayEM, Arcadian, Microtony, Jjron, Danski14, Alansohn, Thebeginning, Riana, AzaToth, Snowolf,
Wtmitchell, Melaen, L33th4x0rguy, Knowledge Seeker, Mikeo, Dan100, Pixie, 2004-12-29T22:45Z, Miss Madeline, Dolfrog, Isnow,
GoldRingChip, Galwhaa, FreplySpang, Lord.lucan, Sjakkalle, Rjwilmsi, Jake Wartenberg, Thirdgen, RobertG, Nihiltres, Nivix, TeaD-
rinker, Alphachimp, Mordicai, JesseGarrett, SujinYH, The Rambling Man, YurikBot, Wavelength, Borgx, TexasAndroid, Neitherday,
Petiatil, Arado, SpuriousQ, Artur Lion~enwiki, Gordie, Wiki alf, Birney, Mccready, Retired username, RUL3R, TDogg310, Syrthiss,
Black Falcon, Wknight94, CharlesHBennett, JuJube, Alias Flood, GrinBot~enwiki, CIreland, Luk, SmackBot, Unschool, Comicsubver-
sion, Paranthaman, Hydrogen Iodide, Ccreitz, WookieInHeat, KVDP, Fnfd, Apers0n, Macintosh User, Gilliam, Skizzik, Chris the speller,
10.1. TEXT 97

RDBrown, NCurse, Darth Panda, Rlevse, Can't sleep, clown will eat me, Chelsea99, Xiner, Khoikhoi, TedE, RandomP, RichAromas, Pi-
lotguy, Kukini, BozoTheScary, Abi79, Celen, Kuru, Fanx, Vgy7ujm, Solon.KR, Freewol, CClio333, Sir Nicholas de Mimsy-Porpington,
Minglex, IronGargoyle, Extremophile, Terzett, Beetstra, SQGibbon, SandyGeorgia, Dean1970, Iridescent, V111P, J Di, Igoldste, Raet-
zsch, Courcelles, Tawkerbot2, Uq, Rustavo, Patho~enwiki, CmdrObot, Leevanjackson, N2e, SRK~enwiki, MrFish, Simeon, Slazenger,
Cydebot, Kanags, Herd of Swine, MC10, Mato, TicketMan, JFreeman, Chiller1800, Chasingsol, Carstensen, DumbBOT, Lewisskinner,
Thijs!bot, Epbr123, FromanylanD, Kablammo, Mojo Hand, Marek69, John254, JustAGal, Rhrad, Escarbot, AntiVandalBot, Luna Santin,
Seaphoto, Doc Tropics, TimVickers, Danger, Mrabcx, Menosn, JAnDbot, Husond, Sharon.Silver, Instinct, Barbpf, Hut 8.5, Magioladitis,
VoABot II, Thomasiscool, Farquaadhnchmn, Rivertorch, Midgrid, WhatamIdoing, Uniblitz, Animum, Zagubov, ArmadilloFromHell, Der-
Hexer, Edward321, Cicero225, Bjoram11@yahoo.co.in, MartinBot, Charlie MacKenzie, Lid6, Ron2, Burnedthru, Per Hedetun, PrestonH,
Obscurans, Judderman85, J.delanoy, Trusilver, Learnthesigns, Alec - U.K., Anas Salloum, Peter Chastain, AlanWolfe, Nebes, Shanu.wiki,
Mikael Hggstrm, Physcopath09, SteveChervitzTrutane, BlGene, Juliancolton, STBotD, Koasful, Supergnome2.0, Guyzero, Gtg204y,
Travisbuchanan, Spellcast, Wikieditor06, LLcopp, Lights, X!, HamatoKameko, Deor, AlnoktaBOT, Stefan Kruithof, VasilievVV, Philip
Trueman, Pcampeau, Qxz, Someguy1221, Albval, Seraphim, Noor151995, Thomas1617, Lady0sheep, Wya 7890, Lord Kralon, Mad-
hero88, Enigmaman, Falcon8765, Wikineer, Brianga, Doc James, Nouse4aname, FlyingLeopard2014, Macdonald-ross, SieBot, Moon-
riddengirl, Ori, RJaguar3, Archer1234, Flyer22 Reborn, Oxymoron83, Explicit, Forluvoft, Sosa2, Elassint, ClueBot, The Thing That
Should Not Be, Mild Bill Hiccup, Auntof6, Excirial, Eeekster, Gwguey, Maser Fletcher, Cenarium, Dekisugi, Thehelpfulone, Aitias,
Qwfp, Darkicebot, Jytdog, Rror, Alexius08, Noctibus, Airplaneman, Nickwtts, Addbot, Cxz111, Slothario, Jojhutton, Ronhjones, Cst17,
Emcn822, SoSaysChappy, Glane23, Bjohanne, F Notebook, Krano, Lion Info, QuadrivialMind, Gail, Spread da love lyk nutella, Luckas-bot,
Yobot, II MusLiM HyBRiD II, Medical geneticist, R500Mom, AnomieBOT, Br1answanson, Dwayne, Kingpin13, Sz-iwbot, Drprashan-
thm, Bluerasberry, Materialscientist, Rtyq2, Citation bot, Roux-HG, Tito.is, SwamiLCR, Xqbot, Cureden, Addihockey10, Capricorn42,
Gigemag76, Midnight Meerkat, Mkolberg, GrouchoBot, RibotBOT, Amaury, Auntieruth55, PM800, Sesu Prime, FrescoBot, LucienBOT,
HJ Mitchell, Craig Pemberton, Kwiki, DivineAlpha, Citation bot 1, Pinethicket, I dream of horses, Tom.Reding, Piandcompany, Recon-
sider the static, Raksidelic, Mannumboy, Aytrus, Gaeruk, WikiTome, Grow60, Reach Out to the Truth, Jesse V., DARTH SIDIOUS
2, Bento00, Alph Bot, Regancy42, Chris Rocen, EmausBot, WikitanvirBot, Immunize, Mordgier, DesmondSteppe, Tommy2010, Mat-
tywattyhatty, Dudewithagun, ZroBot, Bamyers99, Emmasisti, Tolly4bolly, Donner60, Whoop whoop pull up, ClueBot NG, This lousy
T-shirt, 123Hedgehog456, Muy Interesante, Muhammedthebear, Widr, Frk.bustad, WNYY98, BG19bot, Wiki13, Rm1271, MrBill3,
WikiHannibal, Minsbot, Scanbre, David.moreno72, LianneAnna, Cimorcus, Cyberbot II, EuroCarGT, SamLinscho, BrightStarSky, Bs-
bbs, Jennes83, CaSJer, Graphium, Luciferjaxhouston, MuddledMeggie, Nolanne555, Alfrew, Iztwoz, PhantomTech, DavidLeighEllis,
Babitaarora, Uie098, Hogwild13, Doctorani bright, Oguntimehiin funmilayo, Monkbot, EdgarCabreraFaria, Gbrandies34, NutshellPer-
son, Tammycorbett, KH-1, Kitty Hazel, Jdkov, Esquivalience, Marcar244, Jf19283, Gamingforfun365, Echitchcock, Bad ReligionRX1,
Sasquatchwithalopecia, CAPTAIN RAJU, Charlotte135, Misdiagnosisassociation and Anonymous: 674
List of genetic disorders Source: https://en.wikipedia.org/wiki/List_of_genetic_disorders?oldid=744360878 Contributors: Mav, Bryan
Derksen, The Anome, PierreAbbat, JDG, D, Zashaw, Karada, Skysmith, Thue, Topbanana, SD6-Agent, Peak, Diberri, Pengo, Pabouk,
Niteowlneils, Saaga, Jackol, Gadum, Utcursch, Beland, PDH, Jokestress, Fuzlyssa, Spiy sperry, Discospinster, Geoking66, Sietse Snel,
Rpresser, Bobo192, AmosWolfe, Smalljim, Brim, Stephen Bain, Alansohn, Mykej, RoySmith, Redfarmer, SteinbDJ, Ceyockey, RHa-
worth, Thivierr, Eras-mus, Kralizec!, VerballyInsane, Graham87, Jclemens, Search4Lancer, Ketiltrout, Durin, Pruneau, DVdm, Bgwhite,
YurikBot, Neitherday, DanMS, Grafen, Welsh, BeverlyCrusher, CptnMisc, Zzuuzz, Open2universe, Spondoolicks, Natgoo, Curpsbot-
unicodify, Bluezy, Alexandrov, GrinBot~enwiki, InvictaHOG, Blue520, Eskimbot, Apers0n, Gilliam, Chris the speller, Aristiana, NCurse,
Deli nk, Colonies Chris, Mexcellent, Akhtar Ali Khan, Can't sleep, clown will eat me, Nick Levine, Chelsea99, Rrburke, Addshore,
Krich, Virgil Vaduva, Jwelby, Guroadrunner, Kashmiri, Werdan7, Martinp23, George The Dragon, Waggers, Mwmcl, W0w00r, Irides-
cent, Wjejskenewr, Beno1000, Courcelles, Jaeger5432, Leevanjackson, ShelfSkewed, Kate Moose, Cydebot, Gogo Dodo, Anthonyh-
cole, B, NorthernThunder, Epbr123, Lord Hawk, Dr Aaron, Paragon12321, Marek69, Vanished user knviue9823itjwoehijw3rjg, Men-
tisto, AntiVandalBot, Yuanchosaan, Dbrodbeck, Jj137, Farosdaughter, Leuqarte, Erxnmedia, Davewho2, Kaobear, Instinct, Robina Fox,
Mark Rizo, Bongwarrior, VoABot II, JPG-GR, Ahecht, ArmadilloFromHell, Just James, Baristarim, DancingPenguin, MartinBot, Lid6,
Wylve, Jargon777, J.delanoy, Adavidb, Bogey97, Rhinestone K, Antaldewaij~enwiki, Apokorny, Gtg204y, HighKing, TheNewPhobia,
Funandtrvl, My Core Competency is Competency, VolkovBot, Je G., Philip Trueman, Andrew Su, Oshwah, 99DBSIMLR, Mark v1.0,
Ndaniels, ElinorD, Seraphim, Bjorn9800991, Leafyplant, GeneralBelly, Eubulides, Cmcnicoll, Ziakra, Copenhagis, WereSpielChequers,
Jauerback, Belinrahs, Momo san, Granf, Oxymoron83, Faradayplank, Tazpa, Alex.muller, Danelo, WikiLaurent, EmanWilm, Forluvoft,
Atif.t2, Stcobb, ClueBot, The Thing That Should Not Be, Helenabella, Lyonharted, Puchiko, Excirial, -Midorihana-, Jusdafax, Omarslx,
Homiehoms, Versus22, Dana boomer, Egmontaz, BarretB, Spitre, Gnowor, Rror, Little Mountain 5, Avoided, HarlandQPitt, Cheer-
girl122, Addbot, Willking1979, Robertpjameson, Healthgeek, GeneralAtrocity, Fieldday-sunday, Ka Faraq Gatri, 5 albert square, Quadriv-
ialMind, LuK3, Yobot, Fraggle81, Sarrus, SwisterTwister, AnomieBOT, Jim1138, Br1answanson, Kingpin13, Materialscientist, Rtyq2,
Cureden, Drilnoth, Quintus314, Shirik, SD5, Lovemybooty1, Dougofborg, Grinofwales, FrescoBot, Trphilly, DivineAlpha, Forrestswift,
Pinethicket, I dream of horses, MJ94, Calmer Waters, Serols, Mystykmoo, Vrenator, 21user, Whisky drinker, Noommos, Ajraddatz,
Mordgier, Ezhang17, Wikipelli, Dcirovic, K6ka, Cosmiccow4life, Caspertheghost, Vanished user v8h34tjnadjwk2k5, Mlang.Finn, Clue-
Bot NG, Jack Greenmaven, Satellizer, Yourmom546, QtheAllmighty, Spamber, Widr, Calabe1992, 2001:db8, MusikAnimal, Harizotoh9,
Glacialfox, Adityamohangupta, Pratyya Ghosh, DiseaseAction5844, Mediran, InsaneInnerMembrane, Webclient101, Frosty, Luciferjax-
houston, Wywin, Epicgenius, Karlaesc1, Trinder2, Qfang, NYBrook098, Rattlingtalion, RuleTheWiki, Goshgurl95, Wintereu, HMSLaven-
der, Amsill89, Eteethan, Ajchanceley, Joseph Stalin the Grammar Communist, Valozhen and Anonymous: 386
Nijmegen breakage syndrome Source: https://en.wikipedia.org/wiki/Nijmegen_breakage_syndrome?oldid=722113699 Contributors:
Radomil, Jfdwol, Arcadian, Wouterstomp, Mandarax, Rjwilmsi, Koavf, Rewster, Jellytussle, Apers0n, RDBrown, JonHarder, Ligulem-
bot, Kashmiri, Jetman, CmdrObot, Thijs!bot, Rcej, Temporaluser, Hrf, Forest Ash, Addbot, DOI bot, Yobot, Citation bot 1, Skyerise,
Dcirovic, ZroBot, Mayur, FeatherPluma, BG19bot, Dexbot, Chrishallberg, Chaya5260 and Anonymous: 10
Ataxia telangiectasia Source: https://en.wikipedia.org/wiki/Ataxia_telangiectasia?oldid=745321902 Contributors: Ronz, Donarreiskof-
fer, Diberri, Jfdwol, Pascal666, Gadum, Discospinster, Rich Farmbrough, KillerChihuahua, Arcadian, Tycho, RJFJR, Hugo PangUCSB,
Woohookitty, EvilOverlordX, Rjwilmsi, YurikBot, Draeco, Mrwriter, Open2universe, K8, Banus, SmackBot, Apers0n, Bloomingdedalus,
Roadnottaken, Niels Olson, SashatoBot, Sbmehta, IronGargoyle, Hu12, Phatom87, Dancter, Thijs!bot, Anupam, Headbomb, Johngor-
donboyle, PhilKnight, Gfmer, Esanchez7587, Yobol, Chelmian, R'n'B, CommonsDelinker, Nbauman, Mike V, My Core Competency
is Competency, DrMicro, Bsmith281, Road runner92117, Hrf, Graham Beards, Danierrr, Keenkim, Linforest, Icarusgeek, Hemr, Pig-
cowbellman, DragonBot, Carninia, Abrech, Iohannes Animosus, Addbot, DOI bot, Diptanshu.D, Looie496, Orlandoturner, Tassedethe,
Lightbot, 55, Luckas-bot, Yobot, Glittery88, Materialscientist, Emmaross, LilHelpa, CXCV, Drchazz, GrouchoBot, Erik9, Kids Neuro
Doc, McMan007, Fuzbaby, A412, RedBot, Kgrad, Trappist the monk, 564dude, Angelito7, RjwilmsiBot, EmausBot, WikitanvirBot,
98 CHAPTER 10. TEXT AND IMAGE SOURCES, CONTRIBUTORS, AND LICENSES

Dewritech, Cpl3024, GoingBatty, Bdkelly78, Med Chaos, FeatherPluma, ClueBot NG, A3i3b3, Frietjes, Karmalater, Paula.pe, Gitchelg,
Calabe1992, Cynthiajro, MrBill3, Lizziecb, ConradMayhew, Fuse809, BattyBot, Iamozy, Mmh526, Everything Is Numbers, Anrnusna,
Suelru, Monkbot, BeckyLuck, Kiewch, JJMC89, Angrybirds707, InternetArchiveBot and Anonymous: 78
Cockayne syndrome Source: https://en.wikipedia.org/wiki/Cockayne_syndrome?oldid=740007249 Contributors: The Anome, William
Avery, MichaK, Varlaam, Jfdwol, Pascal666, PDH, Ukexpat, Discospinster, Rich Farmbrough, Shanes, Renice, Bobo192, Arca-
dian, Alansohn, Anthony Appleyard, Arthena, Wouterstomp, Richard Arthur Norton (1958- ), GregorB, YurikBot, Zzuuzz, Fang Aili,
KnightRider~enwiki, Federalist51, Chris the speller, RDBrown, Moshe Constantine Hassan Al-Silverburg, Can't sleep, clown will eat me,
JonHarder, Calicat, Flyguy649, Tiki2099, Pissant, Vgnessvg, SashatoBot, Dhp1080, Hu12, Jetman, Ljlego, TeonSoul, Vladaig, Cydebot,
Epbr123, Headbomb, Dfrg.msc, Sturm55, Transhumanist, Calaka, AntiVandalBot, CZmarlin, Rcej, Joe Schmedley, Savant13, Commons-
Delinker, Nono64, Nbauman, My Core Competency is Competency, DrMicro, RingtailedFox, Chienlit, Insanity Incarnate, Flymo racer,
ImageRemovalBot, ClueBot, Cenarium, Eingangskontrolle, Filip en, Aitias, MystBot, Addbot, DOI bot, Jarble, LPROCKS 14, LilHelpa,
Gigemag76, Erik9, Maria Larsson, RjwilmsiBot, EmausBot, Dcirovic, Emily Jensen, Hazard-Bot, FeatherPluma, Kinkreet, ClueBot NG,
Jdperkins, BG19bot, Nen, Jediknightelectro1997, Greatyu, Everything Is Numbers, DoubleZeroUK, Anrnusna, Monkbot, Gamingfor-
fun365, Themidget17, Becky.lavictoire, Ashfaquememon and Anonymous: 51
Xeroderma pigmentosum Source: https://en.wikipedia.org/wiki/Xeroderma_pigmentosum?oldid=744164266 Contributors: Christian
List, Frecklefoot, Nine Tail Fox, Skysmith, Dale Arnett, Sander123, Quadalpha, Lee J Haywood, Varlaam, Jfdwol, Pascal666, Bo-
ism, M1ss1ontomars2k4, CheekyMonkey, Shanes, AmosWolfe, Arcadian, Ricky81682, Iothiania, Wouterstomp, Gippersh, SeanDug-
gan, Ronark, MissParker~enwiki, Sfacets, Benbest, Jcomp489, BD2412, Vary, Camdic, Billjeerys, FlaBot, Nihiltres, Ewlyahoocom,
YurikBot, Wavelength, RobotE, Draeco, NawlinWiki, Marshall, StuRat, JQF, Modify, Ray Chason, Patiwat, Hal peridol, Crystallina,
SmackBot, KnowledgeOfSelf, Hatto, CmdrGuard, EncycloPetey, Delldot, Edgar181, Gary2863, Gilliam, Ohnoitsjamie, Kazkaskazkasako,
Bluebot, NCurse, Da Vynci, Calicat, Inuyasha20985, Dougmc, Smokefoot, A10203040, DMacks, RoquefortRaider, DO11.10, Jaganath,
Stattouk, Bolt Vanderhuge, Hu12, Lady6String, Superwad, Jetman, Cbrown1023, Agathman, Scohoust, Vladaig, Michaelas10, Hopping,
Brad101, Calvero JP, Thijs!bot, Opheicus, Pajz, Anupam, Vertium, A3RO, Transhumanist, Dawnseeker2000, Calaka, AntiVandalBot,
Rcej, Koshaku, Acroterion, Magioladitis, Bakilas, VoABot II, QuizzicalBee, Avicennasis, WhatamIdoing, DerHexer, Scottalter, S3000,
Yobol, Equipothy, MartinBot, Senthryl, Xris0, Strobilus, AntiSpamBot, Sleepeeg3, KylieTastic, My Core Competency is Competency,
VolkovBot, Phi.c, Filip kocha magosi, Warko, Rei-bot, Candy sweet, Ilkali, Seresin, Seraphita~enwiki, Xpsg, Coee, Athe1, Knick-
fan18, Doctoruy, Alex.muller, Fratrep, Pinkadelica, ImageRemovalBot, ClueBot, The Thing That Should Not Be, Mild Bill Hiccup,
UrsoBR, Thehelpfulone, Fromme2yui, Loranchet, NellieBly, Momo1994, Mm40, Addbot, CanadianLinuxUser, Brian Laishes, Tide
rolls, , Zorrobot, Yobot, Fraggle81, Rubinbot, Piano non troppo, Materialscientist, Citation bot, Gigemag76, Dumbledorelives93,
R1ZENTyDE, RibotBOT, Erik9bot, FrescoBot, Doremo, Baakal01, Fuzbaby, Soderick, Himynameislax, Fixer88, Meaghan, Tim1357,
Lb.at.wiki, D arckangel, Mhagir, EmausBot, Dcirovic, Kiatdd, A2soup, Allforrous, FeatherPluma, Kinkreet, Petrb, ClueBot NG, Edi-
tor randy, Helpful Pixie Bot, BG19bot, Signor clock, Ajay62, Onewhohelps, Altar, Achowat, Jeremy112233, Geofreeman32, Hmokjg,
ChrisGualtieri, ZappaOMati, Dobie80, Dexbot, Charlotefrances, Mmh526, Leoncyclist2012, Everything Is Numbers, Pjc0131, Glaisher,
Chaya5260, NosyWriter, Mr. Smart LION, Alejandromaganah, Eteethan, Gamingforfun365, Madness In The Method, Angrybirds707,
Fabdalle, MOD500, Bender the Bot and Anonymous: 242
Amyotrophic lateral sclerosis Source: https://en.wikipedia.org/wiki/Amyotrophic_lateral_sclerosis?oldid=746056721 Contributors:
Mintguy, Fxmastermind, Kerberos, Bdesham, Dominus, Sannse, Nina, Delirium, Jpatokal, JWSchmidt, Julesd, Timwi, Janko, Andrew-
man327, AHands, Furrykef, Ed g2s, Nightsky, Slawojarek, Robbot, Ke4roh, Dale Arnett, Adamahill, Chris 73, Jooler, Nagelfar, Giftlite,
Lproven, Bork, Jfdwol, Fak119, Jackol, Bobblewik, MusiCitizen, Gadum, Sonjaaa, Antandrus, Amesville, Icairns, B.d.mills, Chao, Es-
perant, Mike Rosoft, Discospinster, Rich Farmbrough, Luqui, LindsayH, Bender235, Mashford, CDN99, Peter Greenwell, Bobo192, Mz,
John Vandenberg, Wisdom89, Arcadian, Kjkolb, Gigano, Raja99, JustJuthan, Alansohn, Anthony Appleyard, Keenan Pepper, Wouter-
stomp, Great Scott, Calton, Viridian, Seans Potato Business, Wdfarmer, Melaen, Velella, ReyBrujo, Stephan Leeds, TenOfAllTrades,
Zawersh, Versageek, Netkinetic, Kitch, Ceyockey, Richwales, Nilloc, Bstandley, Stemonitis, Mwalco, Velho, Woohookitty, LOL,
Mazca, Pol098, Polycarp, Je3000, Robmelone, GregorB, Zzyzx11, Wayward, Prashanthns, BD2412, Christidy, RingbearerNZ, Ketil-
trout, Rjwilmsi, Nightscream, Koavf, Amire80, SeanMack, Ucucha, Rangek, Winhunter, Ysangkok, Nihiltres, Nivix, Kerowyn, Drsamir,
RexNL, Gurch, Madambaster, PaulWicks, Diza, Sbrools, DVdm, VolatileChemical, Bgwhite, Turtlemouth, Kummi, Wavelength, Crotalus
horridus, Hairy Dude, Gyre, RussBot, Hede2000, Pigman, Chris Capoccia, Hydrargyrum, Spaghettibones, CambridgeBayWeather, Alex
Bakharev, Rsrikanth05, Aaronwinborn, Abarry, Wimt, GeeJo, Thane, NawlinWiki, Wiki alf, Kvn8907, Justin Eiler, Circumspect, Rave-
dave, Doctorindy, Moe Epsilon, Tony1, Syrthiss, Dbrs, WMarsh, Samir, Ilmaisin, Richardcavell, Light current, Colin, Ojii-san, JoanneB,
GinaDana, Richar4034, Garion96, Pstermeister, TrustTruth, RG2, Thomas Blomberg, Andrew73, Mardus, Je Silvers, Knowledgeum,
Burnwelk, SmackBot, Brian1979, Ckaiserca, Slashme, Masparasol, Mscuthbert, Delldot, Jab843, Floydspinky71, Kslays, BiT, Apers0n,
Yamaguchi , Gilliam, Finduilas 09, WikiPier, Daysleeper47, Camden7, Avanze, Chris the speller, RDBrown, Postoak, Thumperward,
Dingno, Bazonka, Mattweng, Nbarth, Mkamensek, Thief12, DocJohnny, Salmar, Can't sleep, clown will eat me, WorldWide Update,
OrphanBot, Liisamackey, Snowmanradio, Kaimiddleton, Vmulligan, Jtbobwaysf, JohnJHenderson, Lapisphil, New World Man, Whpq,
Mr.Z-man, SundarBot, Brainhell, Hateless, Decltype, Patrickbowman, T-borg, Dreadstar, Pwjb, RandomP, Ildkugle, Ckim2, SpiderJon,
MMX, Richardjames444, Soames, Raggaga, Lambiam, Esrever, Nishkid64, Ser Amantio di Nicolao, Srgregson, JzG, Kingsh, Wfbyan-
kee, Freewol, Gobonobo, NewTestLeper79, Kashmiri, Mgiganteus1, Capmo, Ocatecir, IronGargoyle, Gbutler77, TheHYPO, Noah Salz-
man, SandyGeorgia, GhostInTheMachine, Skinsmoke, Sasata, Eastfrisian, Dl2000, Hu12, BranStark, WilliamJE, Ulape, Sjb72, Twas
Now, Theyer, Velocipedia, James pic, Postmodern Beatnik, CmdrObot, Iced Kola, Colinportnu, Mauricev, W guice, Wutime, Drinibot,
Jamoche, Viper h, MatthewMain, Ian Goddard, Leujohn, Moreschi, Casper2k3, Fordmadoxfraud, Gunitkaratemasta, J-boogie, LaFoib-
lesse, Cydebot, Slp1, A876, Robinatron, Anthonyhcole, Lugnuts, Jeriaska, Jonathansamuel, Randall222, B, Tawkerbot4, Dynaow, Per-
roboy, Chachilongbow, Hawesinsky, Ebyabe, Btharper1221, Kuang Eleven, Busiken, Orphu of io, Epbr123, Lord Hawk, Faigl.ladislav,
Headbomb, Mchtegern, Frank, HelenKMarks, Leon7, Omnipotent person, M0s6p, KrakatoaKatie, AntiVandalBot, Word31, Egwess,
QuiteUnusual, Postlewaight, Luxomni, Manushand, Neutrall, Dawgsplayinpoka, Markthemac, Karyyk, ThomasO1989, Barek, MER-C,
Skomorokh, Fetchcomms, Cole.je, Ph.eyes, Albany NY, OhanaUnited, Andonic, Greensburger, Yamamoto 15, PhilKnight, Acrote-
rion, Magioladitis, WolfmanSF, Bennybp, VoABot II, Alstdf, Barwick Joans, Nelly Furtado~enwiki, Wikidudeman, Monkey features,
Georgethe23rd, Yandman, JamesBWatson, Jbaylor, Cadsuane Melaidhrin, Nyttend, Dr Geurnice, Twsx, Gfmer, Froid, Cat-ve, Catgut,
WhatamIdoing, Shocking Blue, JaGa, Posidonious, Phnix, Otvaltak, Bmf 51, Yobol, MartinBot, FlieGerFaUstMe262, MarxistRevolu-
tionary, STBot, Mermaid from the Baltic Sea, Kiore, DanAtNR, CalendarWatcher, CommonsDelinker, PrestonH, LedgendGamer, Tgeairn,
Etaicq, J.delanoy, Trusilver, Wilsongirl00, Nbauman, Boghog, HistoryMan22, Sirnoze, Jonpro, Mike.lifeguard, Fifth Rider, RoyBatty42,
Adrealtor, Rod57, Michael Daly, Katalaveno, Carolfrog, Thomas Larsen, Mikael Hggstrm, 144Bob, Floateruss, Mrceleb2007, El monty,
Free smyrnan, Aervanath, MKoltnow, KylieTastic, Juliancolton, Kidlittle, S (usurped also), Sfdavide, Sam Blacketer, VolkovBot, Califor-
niaLyme, Jmrowland, Complexitydaemon, Katydidit, Philip Trueman, Oshwah, Marskuzz, Tumblingsky, Cjman546, Oanjao, Gcgmd,
10.2. IMAGES 99

Qxz, Someguy1221, JHUbme24, Sintaku, BeIsKr, Leafyplant, Cootiequits, Junocola, Brightguy88, Natg 19, Wiae, Ben.Spaetzel, Mimich,
Madhero88, Empyre720, Enigmaman, 2112 rush, Jlawilliams, Mjp202, Are1981, Art8641, Temporaluser, Aok82, Doc James, K4948,
Lary Walker, SylviaStanley, Iolathe, SieBot, Raymax, Markmc, Mastergurosp, Dawn Bard, Cwkmail, Doug4422, Cheryl Mason, Lead-
SongDog, Sidcool1234, Raulthepoolboy, Flyer22 Reborn, Tiptoety, JSpung, Aruton, Ashbury305, Oxymoron83, Haikaa, Bagatelle, Steven
Crossin, Matthew Chi Lee, Khvalamde, Princesschickencat, Gtadoc, Tinabtw, Sean.hoyland, Literaturegeek, Eddy23, Mr. Granger, Mar-
tarius, ClueBot, Antarctic-adventurer, Gjensendk, Yaleks, The Thing That Should Not Be, Fadesga, Mild Bill Hiccup, OccamzRazor,
Alandmanson, Blanchardb, Fminow, Puchiko, Thisglad, Excirial, Gnome de plume, Jumbolino, Sanjpatel1, Teh newbie, Zigzag1~enwiki,
BG56789, Geo12a, Dave seer, Thingg, Sunshynesupaman, Save tha sasquatchas, Dylan38, DoctorEric, Berean Hunter, SoxBot III, DumZ-
iBoT, Against the current, Jax 0677, XLinkBot, Jytdog, Siennadog, Kasper2006, Rreagan007, Npnunda, SilvonenBot, Inchiquin, Air-
planeman, Dgonzales138, Mnkyho92, Albambot, Addbot, Crazy2be, JimmyOrangeSeed, DOI bot, Cwcollier, Tukkeramn, Older and ...
well older, TutterMouse, MartinezMD, Kate Carter, Spariant, Mac Dreamstate, Megadude45, Looie496, LaaknorBot, Glane23, Makel-
elecba, Beveleig, SpBot, Phorbol, Guydrawers, Wikieditorforversailles, Distantsuns, Tide rolls, Krano, 55 ,, Nodar95, MissAlyx,
Legobot, Luckas-bot, Yobot, Robert Treat, DiverDave, AnomieBOT, 1exec1, Jim1138, Renamed vandal 85, Mamatz, Shambalala, Je
Muscato, Materialscientist, The High Fin Sperm Whale, Citation bot, Teeninvestor, Vivil, Michael Chidester, Bebestooge44, SuperDave-
Music, LilHelpa, Xqbot, Wikiman208, Cureden, The Banner, Crookesmoor, Gigemag76, Fenwickswimmer, Hirschn, Toa Nidhiki05, Ml-
pearc, OJSlaughter, ProtectionTaggingBot, Wiki emma johnson, Poule, Prezbo, Khmir2467, Dougofborg, Crazynanny, Hillsbro, Fingerz,
Samantha1961, FrescoBot, Dmartin969, Drewigg, Mistakender, D'ohBot, Strongbadmanofme, Craig Pemberton, Kimberstrike, Fourthy,
Meta09, Mrvaughan, Fid, Dr Dextrous, Commalz, Citation bot 1, Takamine45, DrilBot, I dream of horses, Ruthiedee, Jonesey95, Mek-
eretrig, Foxhound66, Calmer Waters, Torkel.bjornson, Wannabe13, Stoiko Stoilov, RedBot, Danste182, Trappist the monk, Aytrus, Lotje,
Stevechimo, Nickyus, Vrenator, , Ratinator939, 564dude, Peacedance, DARTH SIDIOUS 2, Between My Ken, Rjwilmsi-
Bot, Jegh88, Gould363, HopeCenterWustl, CompassionateCareALS, Skamecrazy123, DASHBot, Steve03Mills, Indian1970, John of
Reading, Dr.Milnkovits, Orphan Wiki, Qdiderot, MrFawwaz, Heracles31, Quantanew, JosephCatrambone, RA0808, Aj911, Sgtmacdon-
ald102079, Lostlogicx, Winner 42, Uploadvirus, Wikipelli, Dcirovic, K6ka, AsceticRose, Jasonanaggie, Lizzieb904, AvicBot, Josve05a,
Alpha Quadrant (alt), AManWithNoPlan, Alecabio497, Wayne Slam, Timlev37, Leejabramson, Aarp65, Hudson Stern, Donner60, Puf-
n, Chriscrockford, ALAUK, Llightex, DASHBotAV, ClueBot NG, Jack Greenmaven, Chickennugget1234567890000, David.s.hollman,
DrGregMaguire, Joefromrandb, Wdchk, Anne.erickson, Aristote33, Asukite, Lshanahan, Widr, Syleth, Oddbodz, Helpful Pixie Bot, Lu-
vkush4210, RaspberryKlonopin, Titodutta, Nashhinton, DBigXray, BZTMPS, Kirkrules, BG19bot, Wolf under rain, Anilakeo, Yornanelat,
Braum, Mohamed CJ, TeeVeeed, Lientje111, Cbrittain10, Merrymairi, MusikAnimal, Livingat45north, AvocatoBot, Dwimble1, Compf-
reak7, Rm1271, John Rendor, Pekingduck888, A phone with appeal!, THEGR814EVER, Musicmansuperman, Aliiisha, MrBill3, NotWith,
Sparntez, WikiHannibal, Radamanthe81, Jamorel, Dr. Interesting, BattyBot, Millennium bug, Ethanwarshow, ~riley, Gio69, Pratyya
Ghosh, NYC Financial Analyst, GoShow, ZappaOMati, TylerDurden8823, Illia Connell, Engkjt, Qxukhgiels, Dexbot, EdwardsQueen-
sPT2013, Gus Tuck, Jeromeleonard, EmetHodge, Derbyjames, AleksanderVatov, Lugia2453, Frosty, Andyhowlett, Athomeinkobe, GabeI-
glesia, Lacertuslecti, Reatlas, Yannako, Ozzie10aaaa, Fetor Beltez, Epicgenius, DrRachie, EricaValtory, Eric.laporta, I am One of Many,
Iztwoz, Flaviench, Jodosma, Everymorning, Saivittalb, Wuerzele, BCAAs, Anujraut, ChrisCuber123, Kharkiv07, LT910001, Ginsuloft,
Killerdog690, Tchanders, Programmer06, Cognoscent, Aevertts, Carola O, Stamptrader, Flues2003, MustDotEveryi, Bernardusmuller,
Pmehtamd, JaconaFrere, Pktlaurence, Carlos Rojas77, Colin1980, Zadorok, Monkbot, DERVISCH, Neurologicalinstitute, Bassaintlau-
rent, RJANKA, SantiLak, Banclark3, BigRed2356, Ian E, Gigglemeboots, Klew89, Orellana90, ZinnChomsky91, Angelica.jacob, Shau-
rya619, Jtf2014, Yoda9, AlexAltois, Pharmacyuk, Suckmyturd69, Jesuschristfarts101, MichaelSeiDavis, Lisali1377888, Drfeelgood0496,
Bokkie73, Nadjagoertz, Akhb28, Divadsays, Kia Jorpani, Granitewhite, BlakeButera, Stefanvonimhof, Rubbish computer, Pvt.P Stacker,
Jsreznick, Lolamarie57, Gamingforfun365, KasparBot, Continentaleurope, 9ai99isj, AusLondonder, Maria easterling, Intelegent-
guy1, Syed Yasir Ali Naqvi, Studentaccountantghost4, McortNGHH, Barbara (WVS), Saksham dahiya, Strange Sea Mist, FortissimusVeri-
tatis, Thejavis86, Qzd, InternetArchiveBot, Wasd2333, All The Whiskey In Ireland, DrJanaOcial, Koshie334, GreenC bot, NerakanDrac,
Noconnell, Happysad12344321, Bastiano2, Fezcat and Anonymous: 1207

10.2 Images
File:1axc_tricolor.png Source: https://upload.wikimedia.org/wikipedia/commons/6/61/1axc_tricolor.png License: CC-BY-SA-3.0
Contributors: Self created from PDB entry 1AXC using the freely available visualization and analysis package VMD

Credits (as required by the license):

Original artist: Opabinia regalis
File:ADN_animation.gif Source: https://upload.wikimedia.org/wikipedia/commons/8/81/ADN_animation.gif License: Public domain
Contributors: Own work Original artist: brian0918™
File:ALS_Coronal.jpg Source: https://upload.wikimedia.org/wikipedia/commons/7/75/ALS_Coronal.jpg License: CC BY-SA 3.0 Con-
tributors: http://radiopaedia.org/uploads/radio/0001/2754/ALS_Coronal.jpg Original artist: Frank Gaillard
File:ALS_cross.jpg Source: https://upload.wikimedia.org/wikipedia/commons/6/6d/ALS_cross.jpg License: CC BY-SA 3.0 Contribu-
tors: http://radiopaedia.org/uploads/radio/0001/2685/ALS_12.jpg?1254955756 Original artist: Frank Gaillard
File:Ambox_important.svg Source: https://upload.wikimedia.org/wikipedia/commons/b/b4/Ambox_important.svg License: Public do-
main Contributors: Own work, based o of Image:Ambox scales.svg Original artist: Dsmurat (talk contribs)
File:Autorecessive.svg Source: https://upload.wikimedia.org/wikipedia/commons/3/3e/Autorecessive.svg License: CC-BY-SA-3.0 Con-
tributors: Own work in Inkscape Original artist: en:User:Cburnett
File:Autosomal_recessive_-_en.svg Source: https://upload.wikimedia.org/wikipedia/commons/f/f1/Autosomal_recessive_-_en.svg Li-
cense: CC BY-SA 3.0 Contributors: Own work based on Autosomal dominant - en.svg and Autorecessive.jpg Original artist: Kashmiri,
based on earlier work by Domaina
File:Carl_Correns.jpg Source: https://upload.wikimedia.org/wikipedia/commons/0/09/Carl_Correns.jpg License: Public domain Con-
tributors: ? Original artist: ?
File:Child_suffering_from_Xeroderma_Pigmentosum_in_Rukum,Nepal.jpg Source: https://upload.wikimedia.org/wikipedia/
commons/0/0f/Child_suffering_from_Xeroderma_Pigmentosum_in_Rukum%2CNepal.jpg License: CC BY-SA 3.0 Contributors: Shot
this picture of a young girl suering with XP at a medical camp in Rukum,Nepal. Original artist: Himynameislax
100 CHAPTER 10. TEXT AND IMAGE SOURCES, CONTRIBUTORS, AND LICENSES

File:Commons-logo.svg Source: https://upload.wikimedia.org/wikipedia/en/4/4a/Commons-logo.svg License: CC-BY-SA-3.0 Contribu-

tors: ? Original artist: ?
File:DNA_damage,_repair,_alteration_of_repair_in_cancer.png Source: https://upload.wikimedia.org/wikipedia/commons/a/a2/
DNA_damage%2C_repair%2C_alteration_of_repair_in_cancer.png License: CC BY-SA 4.0 Contributors: Own work Original artist:
Bernstein0275
File:DNA_methylation.jpg Source: https://upload.wikimedia.org/wikipedia/commons/8/80/DNA_methylation.jpg License: CC BY-SA
3.0 Contributors: Own work Original artist: Christoph Bock (Max Planck Institute for Informatics)
File:DNA_replication_split.svg Source: https://upload.wikimedia.org/wikipedia/commons/7/70/DNA_replication_split.svg License:
CC-BY-SA-3.0 Contributors: Own work Original artist: Madprime
File:Decitabine.svg Source: https://upload.wikimedia.org/wikipedia/commons/4/44/Decitabine.svg License: Public domain Contributors:
Own work Original artist: Fvasconcellos 15:47, 3 October 2007 (UTC)
File:Dihybrid_cross.svg Source: https://upload.wikimedia.org/wikipedia/commons/3/3a/Dihybrid_cross.svg License: Public domain
Contributors: PNG version Original artist: Tocharianne (PNG version), WhiteTimberwolf (SVG version)
File:Drill.jpg Source: https://upload.wikimedia.org/wikipedia/commons/b/b1/Drill.jpg License: CC-BY-SA-3.0 Contributors: en:Image:
Drill.jpg Original artist: Rob Kay (en:User:Excalibur)
File:Epigenetic_alterations_in_tumour_progression.svg Source: https://upload.wikimedia.org/wikipedia/commons/2/28/Epigenetic_
alterations_in_tumour_progression.svg License: CC BY-SA 3.0 Contributors: Emmanuel Barillot, Laurence Calzone, Philippe Hup, Jean-
Philippe Vert, Andrei Zinovyev, Computational Systems Biology of Cancer Chapman & Hall/CRC Mathematical & Computational Biology
, 2012 Original artist: Philippe Hup
File:Epigenetic_mechanisms.jpg Source: https://upload.wikimedia.org/wikipedia/commons/d/dd/Epigenetic_mechanisms.jpg License:
Public domain Contributors: http://commonfund.nih.gov/epigenomics/figure.aspx Original artist: National Institutes of Health
File:Epistasis_and_landscapes.png Source: https://upload.wikimedia.org/wikipedia/commons/9/94/Epistasis_and_landscapes.png Li-
cense: CC BY 4.0 Contributors: Own work Original artist: Thomas Shafee
File:Epistasis_bars.png Source: https://upload.wikimedia.org/wikipedia/commons/6/69/Epistasis_bars.png License: CC BY 4.0 Con-
tributors: Own work Original artist: Thomas Shafee
File:Epistatic_hair.png Source: https://upload.wikimedia.org/wikipedia/commons/5/58/Epistatic_hair.png License: CC BY 4.0 Contrib-
utors: Own work Original artist: Thomas Shafee
File:Escherichia_coli_flagella_TEM.png Source: https://upload.wikimedia.org/wikipedia/commons/e/eb/Escherichia_coli_flagella_
TEM.png License: Public domain Contributors: This media comes from the Centers for Disease Control and Prevention's Public Health
Image Library (PHIL), with identication number #9995. Original artist: E. H. White, Content Provider: Peggy S. Hayes
File:Esculaap4.svg Source: https://upload.wikimedia.org/wikipedia/commons/6/66/Esculaap4.svg License: GFDL Contributors: self-
made, SVG-version of Image:Esculaap3.png by Evanherk, GFDL Original artist: .Koen
File:Folder_Hexagonal_Icon.svg Source: https://upload.wikimedia.org/wikipedia/en/4/48/Folder_Hexagonal_Icon.svg License: Cc-by-
sa-3.0 Contributors: ? Original artist: ?
File:Free-to-read_lock_75.svg Source: https://upload.wikimedia.org/wikipedia/commons/8/80/Free-to-read_lock_75.svg License: CC0
Contributors: Adapted from 9px|Open_Access_logo_PLoS_white_green.svg Original artist: This version:Trappist_the_monk (talk)
(Uploads)
File:Genetic_code.svg Source: https://upload.wikimedia.org/wikipedia/commons/3/37/Genetic_code.svg License: CC-BY-SA-3.0 Con-
tributors: Own work Original artist: Madprime
File:Gregor_Mendel.png Source: https://upload.wikimedia.org/wikipedia/commons/d/d3/Gregor_Mendel.png License: Public domain
Contributors: NIH Original artist: Unknown<a href='//www.wikidata.org/wiki/Q4233718' title='wikidata:Q4233718'><img alt='wikidata:
Q4233718' src='https://upload.wikimedia.org/wikipedia/commons/thumb/f/ff/Wikidata-logo.svg/20px-Wikidata-logo.svg.png'
width='20' height='11' srcset='https://upload.wikimedia.org/wikipedia/commons/thumb/f/ff/Wikidata-logo.svg/30px-Wikidata-logo.
svg.png 1.5x, https://upload.wikimedia.org/wikipedia/commons/thumb/f/ff/Wikidata-logo.svg/40px-Wikidata-logo.svg.png 2x'
data-le-width='1050' data-le-height='590' /></a>
File:Gul-Abas-4-O'clock_plant.JPG Source: https://upload.wikimedia.org/wikipedia/commons/6/63/Gul-Abas-4-O%27clock_plant.
JPG License: Public domain Contributors: ? Original artist: Khalid Mahmood at English Wikipedia
File:Hybridogenesis_in_water_frogs_gametes.gif Source: https://upload.wikimedia.org/wikipedia/commons/7/7f/Hybridogenesis_
in_water_frogs_gametes.gif License: CC BY-SA 4.0 Contributors: Own work Original artist: Darekk2
File:Issoria_lathonia.jpg Source: https://upload.wikimedia.org/wikipedia/commons/2/2d/Issoria_lathonia.jpg License: CC-BY-SA-3.0
Contributors: ? Original artist: ?
File:Kepler-solar-system-2.gif Source: https://upload.wikimedia.org/wikipedia/commons/1/1d/Kepler-solar-system-2.gif License:
Public domain Contributors: ? Original artist: ?
File:Mendelian_inheritance.svg Source: https://upload.wikimedia.org/wikipedia/commons/f/fe/Mendelian_inheritance.svg License:
Public domain Contributors: http://de.wikipedia.org/wiki/Datei:Mendelian_inheritance_3_1.png Original artist: Benutzer:Magnus Manske
File:Mendelian_inheritance_1_2_1.png Source: https://upload.wikimedia.org/wikipedia/commons/8/82/Mendelian_inheritance_1_2_
1.png License: CC-BY-SA-3.0 Contributors: Originally from en.wikipedia; description page is (was) here Original artist: Magnus Manske
File:Normal-cancer-epigenome.png Source: https://upload.wikimedia.org/wikipedia/commons/2/22/Normal-cancer-epigenome.png
License: CC BY-SA 3.0 Contributors: Emmanuel Barillot, Laurence Calzone, Philippe Hup, Jean-Philippe Vert, Andrei Zinovyev,
Computational Systems Biology of Cancer Chapman & Hall/CRC Mathematical & Computational Biology , 2012 Original artist: Philippe
Hup
File:Nucleosome_1KX5_2.png Source: https://upload.wikimedia.org/wikipedia/commons/d/db/Nucleosome_1KX5_2.png License:
CC-BY-SA-3.0 Contributors: Transferred from en.wikipedia Original artist: By Richard Wheeler (Zephyris) 2005.
10.3. CONTENT LICENSE 101

File:Open_Access_logo_PLoS_transparent.svg Source: https://upload.wikimedia.org/wikipedia/commons/7/77/Open_Access_logo_

PLoS_transparent.svg License: CC0 Contributors: http://www.plos.org/ Original artist: art designer at PLoS, modied by Wikipedia users
Nina, Beao, and JakobVoss
File:PCWmice1.jpg Source: https://upload.wikimedia.org/wikipedia/commons/0/04/PCWmice1.jpg License: Public domain Contribu-
tors: NIH Planning Meeting for Knockout Mouse Project at genome.gov Original artist: User FloNight on en.wikipedia
File:People_icon.svg Source: https://upload.wikimedia.org/wikipedia/commons/3/37/People_icon.svg License: CC0 Contributors: Open-
Clipart Original artist: OpenClipart
File:Personal_genomics_gene_therapy_flowchart.png Source: https://upload.wikimedia.org/wikipedia/commons/4/4d/Personal_
genomics_gene_therapy_flowchart.png License: CC0 Contributors: Own work Original artist: KVDP
File:Photo_Ocular_telangiectasia_in_a_person_with_A-T.jpg Source: https://upload.wikimedia.org/wikipedia/commons/f/f3/
Photo_Ocular_telangiectasia_in_a_person_with_A-T.jpg License: CC BY-SA 3.0 Contributors: Was sent to me personally. Original
artist: Thomas O. Crawford
File:Portal-puzzle.svg Source: https://upload.wikimedia.org/wikipedia/en/f/fd/Portal-puzzle.svg License: Public domain Contributors: ?
Original artist: ?
File:Punnett_square_mendel_flowers.svg Source: https://upload.wikimedia.org/wikipedia/commons/1/17/Punnett_square_mendel_
flowers.svg License: CC-BY-SA-3.0 Contributors: Own work Original artist: Madprime
File:Question_book-new.svg Source: https://upload.wikimedia.org/wikipedia/en/9/99/Question_book-new.svg License: Cc-by-sa-3.0
Contributors: ? Original artist: ?
File:Red_Headed_Young_Man.jpg Source: https://upload.wikimedia.org/wikipedia/commons/0/04/Red_Headed_Young_Man.jpg Li-
cense: CC-BY-SA-3.0 Contributors: Transferred from en.wikipedia to Commons by Xenocidic. Original artist: Schwingy at English
Wikipedia
File:Rod_of_Asclepius2.svg Source: https://upload.wikimedia.org/wikipedia/commons/e/e3/Rod_of_Asclepius2.svg License: CC BY-
SA 3.0 Contributors: This le was derived from: Rod of asclepius.png
Original artist:
Original: CatherinMunro
File:Symbol_book_class2.svg Source: https://upload.wikimedia.org/wikipedia/commons/8/89/Symbol_book_class2.svg License: CC
BY-SA 2.5 Contributors: Mad by Lokal_Prol by combining: Original artist: Lokal_Prol
File:Symbol_template_class.svg Source: https://upload.wikimedia.org/wikipedia/en/5/5c/Symbol_template_class.svg License: Public
domain Contributors: ? Original artist: ?
File:Synergistic_versus_antagonistic_epistasis.svg Source: https://upload.wikimedia.org/wikipedia/commons/8/86/Synergistic_
versus_antagonistic_epistasis.svg License: CC-BY-SA-3.0 Contributors:
Evolsex-dia3a.png Original artist: Evolsex-dia3a.png: Original uploader was MykReeve at en.wikipedia
File:Table_ATM_and_the_immune_system.jpg Source: https://upload.wikimedia.org/wikipedia/commons/0/0f/Table_ATM_and_
the_immune_system.jpg License: CC BY-SA 3.0 Contributors: This table was created by scratch from already puplished information.
Original artist: Cynthiajro
File:Table_Characteristics_of_the_ATM_protein.jpg Source: https://upload.wikimedia.org/wikipedia/commons/2/2b/Table_
Characteristics_of_the_ATM_protein.jpg License: CC BY-SA 3.0 Contributors: The table was created from scratch using already
published information. Original artist: Cynthiajro
File:Table_Comparison_of_rare_genetic_disorders_that_can_be_confused_with_A-T_revised.jpg Source: https://upload.
wikimedia.org/wikipedia/commons/e/ef/Table_Comparison_of_rare_genetic_disorders_that_can_be_confused_with_A-T_revised.jpg
License: CC BY-SA 3.0 Contributors: This table was created from scratch from already published informaiton; then revised Original artist:
Cynthiajro
File:Using_a_head_mounted_laser_to_point_to_a_communication_board.jpg Source: https://upload.wikimedia.org/wikipedia/
commons/3/36/Using_a_head_mounted_laser_to_point_to_a_communication_board.jpg License: CC BY-SA 4.0 Contributors: Own
work Original artist: Fezcat
File:Wiki_letter_w_cropped.svg Source: https://upload.wikimedia.org/wikipedia/commons/1/1c/Wiki_letter_w_cropped.svg License:
CC-BY-SA-3.0 Contributors: This le was derived from Wiki letter w.svg: <a href='//commons.wikimedia.org/wiki/File:
Wiki_letter_w.svg' class='image'><img alt='Wiki letter w.svg' src='https://upload.wikimedia.org/wikipedia/commons/thumb/6/6c/Wiki_
letter_w.svg/50px-Wiki_letter_w.svg.png' width='50' height='50' srcset='https://upload.wikimedia.org/wikipedia/commons/thumb/6/6c/
Wiki_letter_w.svg/75px-Wiki_letter_w.svg.png 1.5x, https://upload.wikimedia.org/wikipedia/commons/thumb/6/6c/Wiki_letter_w.svg/
100px-Wiki_letter_w.svg.png 2x' data-le-width='44' data-le-height='44' /></a>
Original artist: Derivative work by Thumperward
File:Wikiversity-logo.svg Source: https://upload.wikimedia.org/wikipedia/commons/9/91/Wikiversity-logo.svg License: CC BY-SA 3.0
Contributors: Snorky (optimized and cleaned up by verdy_p) Original artist: Snorky (optimized and cleaned up by verdy_p)
File:Wiktionary-logo-v2.svg Source: https://upload.wikimedia.org/wikipedia/commons/0/06/Wiktionary-logo-v2.svg License: CC BY-
SA 4.0 Contributors: Own work Original artist: Dan Polansky based on work currently attributed to Wikimedia Foundation but originally
created by Smurrayinchester
File:Xeroderma_pigmentosum_02.jpg Source: https://upload.wikimedia.org/wikipedia/commons/4/4b/Xeroderma_pigmentosum_02.
jpg License: CC BY-SA 3.0 Contributors: James Halpern, Bryan Hopping and Joshua M Brosto: <a data-x-rel='nofollow' class='external
text' href='http://www.casesjournal.com/content/1/1/254'>Photosensitivity, corneal scarring and developmental delay: Xeroderma Pigmen-
tosum in a tropical country.</a> In: Cases Journal 2008, 1:254 doi:10.1186/1757-1626-1-254 published under CC-by-2.0 Original artist:
James Halpern, Bryan Hopping and Joshua M Brosto

10.3 Content license

Creative Commons Attribution-Share Alike 3.0