RESEARCH ARTICLE

Biodiversity of non-Saccharomyces yeasts in distilleries of the

La Mancha region (Spain)

Juan Ubeda 1
 M. Guillamo
, Mara Maldonado Gil1, Rosana Chiva2, Jose  n2 & Ana Briones1
1
Tecnologa de los Alimentos, IRICA, Universidad de Castilla La Mancha, Ciudad Real, Spain; and 2Instituto de Agroqumica y Tecnologa de
Alimentos, IATA, Paterna, Valencia, Spain


Correspondence: Juan Ubeda, Tecnologa
de los Alimentos, IRICA, Universidad de
Castilla La Mancha, Avda. Camilo Jose Cela,
10, 13071 Ciudad Real, Spain. Tel.: +34
926295300; fax: +34 926295318; e-mail:
juan.ubeda@uclm.es
Received 29 October 2013; revised 14 March
2014; accepted 16 March 2014. Final version
published online 22 April 2014.
DOI: 10.1111/1567-1364.12152
Editor: Isak Pretorius
Keywords
non-Saccharomyces; distilleries; wine
byproducts.
Abstract
The aim of this pioneering study was to determine the biodiversity of non-
Saccharomyces yeasts in ancient distilleries located in the La Mancha region,
which is the principal area for the production of bioethanol and grape-based
distillates in Spain. In this study, the yeast populations that were present
during the process of extraction of alcohol and residual sugars from the
byproducts of vinification, such as piquettes, pomace and grape skins, were
studied. Non-Saccharomyces yeasts were identified by PCR-RFLP analysis of the
5.8S rRNA genes and, when necessary, by sequencing the D1/D2 domain of the
26S and/or 5.8S rRNA genes. Further, fermentation and the assimilation of
carbon compounds were studied, to identify potential industrial applications.
Phylogenetic trees and heat-maps were constructed for the genetic and pheno-
typic traits, respectively. Twenty yeast species belonging to eight genera were
identified (Torulaspora, Candida, Zygosaccharomyces, Pichia, Hanseniaspora,
Kluyveromyces, Ogataea and Saccharomycodes). Pichia galeiformis, Candida lactis-
condensi, Hanseniaspora osmophila and Torulaspora delbrueckii were the most
abundant species and were found principally in sweet and fermented piquettes.

for the production of bioethanol or distilled spirits such

Introduction
as cachaca, rum, bacanora and tequila, and a number of
Studying the microbial resources present in different eco- studies have focused on yeast populations in various
systems is of particular interest, not only because it dem- regions of Brazil (Morais et al., 1997; Pataro et al., 1998;
YEAST RESEARCH

onstrates their diversity but also because microorganisms
and/or their metabolites may have properties with techno-
logical applications, such as bioremediation, enzyme pro-
duction or the biological control of plant pathogens and
fungi. Non-Saccharomyces yeasts could be used as biocon-
trol agents against moulds and in the treatment of waste-
waters contaminated by heavy metals (Ubeda et al., 2014).
Yeast colonization is a feature of many ecosystems,
particularly in the plant world (Woody et al., 2007;
Ahansal et al., 2008; Bhadra et al., 2008). Some raw mate-
rials and processing plants constitute a suitable place for
yeast growth, such as musts, wines in cellars, piquettes,
bagasse, pomace, grape skins and yeast lees in the ethanol
industry provide an inexhaustible supply of yeasts (Iacumin
et al., 2012).
The residual juice, pomace and molasses from sugar
beet, sugar cane and agave processing are widely used
Basso et al., 2008; Vianna et al., 2008), Cuba (Fernandez
et al., 2008) and Mexico (Lachance, 1995; Gutirez-Coro-
nado et al., 2007; Lappe-Oliveras et al., 2008; Amaya-
Delgado et al., 2013). The various stages in the produc-
tion of ethanol from pomace are shown in Fig. 1. The
grape byproducts, fermented red skins and sweet pomace
(from white-wine vinification) are transported to the
distillery, where they are mixed and stored (generally
outdoors) for 1015 days. During this period, sweet
pomaces start to ferment spontaneously. Next, the
pomaces are washed in a continuous heat diffusion
system at a temperature near 50 C, to extract the resid-
ual alcohol and sugar. The liquid produced by this
process is known as the piquette, which is a mixture of
alcohol (34% v/v), water and sugar. The piquette is
mixed with the liquid that drained during the outdoor
storage-fermentation process and is fermented in stainless

FEMS Yeast Res 14 (2014) 663673 2014 Federation of European Microbiological Societies.
Published by John Wiley & Sons Ltd. All rights reserved
664
Red fermented skins and sweet pomaces
Washing/warm water
5055 C
PIQUETTES
Alcohol (34 w/v), sugars/water
Fermentation/
Distillation
+
SOLID FUEL
steel or iron tanks for 23 days without temperature
control, to obtain an alcohol content of 45% (v/v). The
fermented red skins without residual sugars are also
washed to extract the residual ethanol, but this is
performed at a lower temperature to avoid evaporation
(Alvinesa, Alcoholera vincola S.A., Daimiel, Ciudad Real,
Spain).
Thirty-three distilleries in Spain are licensed to pro-
duce ethanol from the byproducts of winemaking. Thir-
teen of these distilleries are located in the La Mancha
region, the worlds largest vine-growing region, with an
annual grape production of approximately 3.6 million
tonnes, which is comprised exclusively of winemaking
varieties. This process generates approximately 600 000
tonnes of grape byproducts, all with a certain content of
reducing sugars and ethanol. The pomace generally con-
tains plant tissue residue that includes the skins and pips
from the pressed red grapes and the stalks from the
pressed white grapes. In spontaneous fermentations, the
Saccharomyces and non-Saccharomyces yeast biota of
these environments are highly varied (Bovo et al., 2009,
2011).
Finally, the fermented piquettes are distilled to
obtain ethanol at a concentration of 93% (v/v),
which is then dehydrated until 99.9% is reached, where-
upon it is mainly used as bioethanol. The liquid residue
from the distillation process, which is known as the
vinasse, can be used as a fertilizer, while the solid resi-
due, the bagasse, is used as solid fuel in the distillery.
There are few published microbiological studies (Iacu-
min et al., 2012) on the biodiversity of yeast populations
in distillery plants, and no such study has been performed
in the La Mancha region. The purpose of this pioneering
work was to determine the biodiversity of the non-
Saccharomyces yeasts in different distilleries, using molec-
ular and physiological methods.
2014 Federation of European Microbiological Societies.
Published by John Wiley & Sons Ltd. All rights reserved

J. Ubeda et al.
Liquid drained off
Distillation
Ethanol 93
Spirits
Vinasse
Distillation
Fig. 1. Stages involved in the production of
Wine and lees
ethanol from skin grapes, lees and pomace.
Materials and methods
Sampling
Six of the largest distilleries in Europe were sampled; they
are located in the towns/areas of Argamasilla de Alba (A),
Campo de Criptana (B), Madridejos (C), Villarobledo
(D), Daimiel (E) and Tomelloso (F) in the La Mancha
region which is the principal area for the production of
bioethanol and distillates in Spain. Twenty-eight samples
were collected from different substrates: sweet piquettes
(11 samples), fermented piquettes (13), yeast lees (3) and
plant soil (1) and were transported to the laboratory
under aseptic, refrigerated conditions.
Yeast isolation and colony counts
YPD medium (1% yeast extract, 2% peptone, 2% glucose,
2% agar) was used, and ampicillin and sodium propionate
were added to inhibit the growth of bacteria and moulds,
respectively. The samples were incubated at 28 C for
3 days. Next, samples whose corresponding plates had
fewer than 30 colonies were centrifuged to concentrate the
cells, and the pellets were streaked on YPD agar. Plates
with sufficiently separated colonies were replicated onto
lysine agar medium (Oxoid, Basingstoke, UK) to distin-
guish between Saccharomyces spp. and non-Saccharomyces
isolates. All the non-Saccharomyces isolates were purified
by streaking on YPD agar.
Identification of the non-Saccharomyces yeasts
For genomic DNA extraction, each pure isolate was grown in
3 mL YPD broth for 24 h at 28 C with gentle shaking. The
DNA was extracted, and the concentrations were assessed
using a Low DNA Mass Ladder (Invitrogen SA, Madrid,
FEMS Yeast Res 14 (2014) 663673
Non-Saccharomyces in distilleries
Spain) by electrophoresis in a 1% agarose gel, stained with
ethidium bromide (0.5 lg mL
1) and visualized using a
GeneFlash documentation system. The extracted DNA was
purified using a commercial kit (High Pure PCR product;
Roche S.L. Applied Science, Barcelona, Spain) and stored at

20 C until it was used for the PCR amplification.
The non-Saccharomyces species were identified using
polymerase chain reaction/restriction fragment length
polymorphism (PCR-RFLP) analysis. The 5.8S rRNA gene
region was amplified using the internal transcribed spac-
ers, ITS1 and ITS4 (White et al., 1990), and a 50-lL reac-
tion mixture was set up (1 U of Taq polymerase
[Biotools B&M Labs, S.A. Madrid, Spain], 0.5 lM each
primer, 0.1 mM dNTPs, Buffer Taq 1 9 [2 mM MgCl2]
and 1 lL of genomic DNA as the template).
For identification of the isolates at the species level, the
amplified genes were treated with three restriction
enzymes (HinfI, HaeIII and CfoI). The final digestion
volume was 20 lL, which contained 8 lL of amplified
DNA, 0.25 lL of each enzyme (1 U lL
1) and 2 lL of
H, M, L buffer (10 9) (Roche). The samples were incu-
bated at 37 C for 7 h. The restriction fragments were
checked by electrophoresis in a 1.5% (w/v) agarose gel.
The 2000-bp molecular Low DNA MassTM Ladder (Invi-
trogen SA) and the 1031-bp molecular weight marker
(Biotools B&M Labs) were run on each gel.
All agarose gels were visualized under UV light and
processed using the GeneFlash documentation system.
The PCR and RFLP fragment lengths were used to iden-
tify the yeasts using www.yeast-id.com (University of
Valencia and CSIC, Spain).
For the isolates that could not be identified using the
PCR-RFLP technique, different regions of the D1/D2
domain of the 26S rRNA genes were sequenced using
the primers NL1 (GCATATCAATAAGCGGAGGAAAAG)
and NL4 (50 GGTCCGTGTTTCAAGACGG30 ). When this
amplification was not possible due to a variation in the
region bound by the NL4 primer, alternative primers
were used: LR6 (50 CGCCAGTTCTGCTTACC30 ), NL3A
(50 GAGACCGATAGCGAACAAG30 ) and NL2A (50 CTTGT
TCGCTATCGGTCTC30 ).
Finally, in cases where the percentage of similarity at
the species level was lower than 99%, the ITS of the
+5.8S rRNA region was sequenced using the primers ITS1
(50 TCCGTAGGTGAACCTGCGG30 ) and ITS4 (50 TC
CTCCGCTTATTGATATGC30 ). A 50-lL reaction mixture
was prepared with 1 U of Taq polymerase (Biotools B&M
Labs), 0.5 lM each primer, 0.1 mM dNTPs, Taq buffer
(1 9), 2 mM MgCl2 and 5 lL of genomic DNA.
The amplified products were purified (High Pure PCR
product; Roche) and separated on a 1.5% agarose gel
with a 2000-bp Low DNA MassTM Ladder (Invitrogen) to
estimate the DNA concentration of the sample.
FEMS Yeast Res 14 (2014) 663673
665
The amplicons were sequenced using the Applied
Biosystems ABI 3730x1 terminator cycle kit. For each reac-
tion, 5 mM of either specific primer and 1050 ng mL
1
of the purified PCR fragment were used (Unidad gen omica,
Parque Cientfico. UC, Madrid, Spain).
The DNA sequences were obtained using the SEQUENCE
SCANNER (version: 1.0. Applied Biosystems) and compared
with published sequences using the BLAST program (http://
blast.ncbi.nlm.nih.gov/Blast.cgi) (Altschul et al., 1997) for
species identification.
Fermentation of carbon compounds
The ability of the yeast samples to ferment sugars was
studied. The carbon compounds assayed were D-glucose,
D-galactose, L-arabinose, L-rhamnose, melibiose, lactose,
raffinose, xylose, maltose, mannose, saccharose and cello-
biose. These compounds were prepared at 15% (w/v), pH
7.5 and filter-sterilized through a 0.20-lm pore filter. The
fermentation tests were carried out in 96-well microtitre
plates. In each well, 80 lL of each sugar and 20 lL of a
bromocresol green stock solution (0.17 g L
1, pH 7.7)
were added. Before inoculation, the microtitre plates were
desiccated at 4050 C for 612 h.
The yeast isolates were grown in YPD broth (28 C,
36 h), and the biomass was normalized at 600 nm OD to
approx. 1.0. To exhaust the endogenous carbon com-
pound reserves, biomass content in 1 mL of broth was
transferred to 3 mL of minimal medium containing YNB
without amino acids (DifcoTM) and was incubated at 28
C for 6 h with gentle shaking. Eighty microlitres of the
inoculum suspension was placed in each well of the mic-
rotitre plates. As every yeast-sugar suspension possessed a
different pH, the pH was readjusted after the inoculation
using sterile NaOH (0.5 M). Finally, each well was sealed
with sterile Vaseline, and the plates were incubated at
28 C for 5 days and observed daily to detect any change
in the colour of the indicator, from blue to yellow or yel-
low green. Depending on the time of the change and the
intensity of coloration, a classification system was estab-
lished: (+) yellow in 24 h, (S) green at 24 h and yellow
on the 5th day, (D) blue at 24 h and yellow on the 5th
day, (d) green on the 5th day and (
) blue on the 5th
day (Barnett et al., 2000). The substratum without inoc-
ula and the YNB cell preculture without the substratum
were used as negative controls.
Assimilation of carbon compounds
The compounds used for this assay were 20 g L
1 mono-
and disaccharides (D-glucose, maltose, lactose, L-rham-
nose, xylose and cellobiose), 10 g L
1 polysaccharides
(starch, carboxymethylcellulose and lignin) and 10 g L
1
2014 Federation of European Microbiological Societies.
Published by John Wiley & Sons Ltd. All rights reserved
666 
J. Ubeda et al.

Table 1. Identification of yeast isolates in different distilleries

Accession
number
Species Isolates N0 **Ethanol plants/substrata NCBI bp
C. ethanolica 35*, 36, 40 D/FP 35, 36, 40, 41 35/JX880409 568
41*, 48*, A/L 48 40/JQ073769 768
41/JX880400 569
48/JQ410478 433
C. lactis-condensi 50, 51, 52 C/C 55/JN248610 480
53, 54, 55* 56/JN248614 507
56*, 57* 57/JN248611 493
C. sake 44* E/FP JX880410 571
C. viswanathii 39* D/FP JQ512833 562
H. meyeri 7* A/SP JN248602 580
H. osmophila 4, 26*, 58* A/SP 4 4/JQ073772 288
59*, 62*,, 65*, 66* B/SP 26 26/JQ512831 552
C/SP 58 59/JQ512840 587
C/SP 59, 62, 65, 66 58/JQ512840 577
62*/JQ410479 701
62/JQ410479
65/JQ512841 571
66/JQ780464 579
H. uvarum 11*, 28*, B/C 11 11/JN248600 590
B/SP 28 28/JN512834-9 469481
H. valbyensis 5* A/SP JN248613 580
H. vineae 2* A/SP JN248606 571
K. thermotolerans 25*,, 46* B/SP 25 25/JQ073770 *583, 788
A/FP 46 46/JN248601 575
O. polymorpha 19* B/SP JN248599 582
P. anomala 10, 20*, 21*, B/SP 20/JX880399 578
22*, 27*, 32* 21/JX880404 583
22/JN248608 581
27/JX880405 575
32/JX880406 573
P. bimundalis 43 D/FP JQ073768 784
P. galeiformis 9, 37*, 38*, B/C 9 37/JX880397 574
45, 47, 49, 68, 69, 70, D/FP 37, 38 38/JX880398 570
71, 74, 76 E/FP 45 45/JQ073767 403
A/L 47, 49 74/JQ073765 779
E/FP 68, 69, 70,
71, 74, 76
P. kudriavzevii 3*,, 8*, 13*, A/SP 3 3/JN248607 575
14, 24, B/C 8 8/JN248609 581
C/SP 13, 14 13/JX880402 576
B/SP 24 14/JQ073771 399
24/JQ073766 719
P. membranifaciens 23*, B/SP */JQ410476 446

/JQ410476 444
S. cerevisiae 16*, 29*, 30*, 31*, C/SP 16, 63 16/JQ512828 578
(controls) 33*,, 63* B/SP 29, 30, 31 29/JQ512832 581
B/L 33 30/JN248596 588
31/JN248598 586
33*/JQ410477 *587, 945
63/JQ512829 582
S0 codes 72*, 77* E/FP 72/JX880401 583
ludwigii 77/JQ512842 566

(continued)

2014 Federation of European Microbiological Societies. FEMS Yeast Res 14 (2014) 663673
Published by John Wiley & Sons Ltd. All rights reserved
Non-Saccharomyces in distilleries
Table 1. Continued
Species Isolates N0
T. delbrueckii 1*, 6*, 60*,
61*, 64*, 67*, 75*
Z. bailii 34*
Z. fermentati 15*
26S rRNA region sequences: *primers NL1/NL4; NL2A/LR6 and NL2A/NL3A primers; NL1/NL4 primers, not included in cluster analysis; PCR-RFLP;
1.8S5.8S rRNA region sequence with ITS1/ITS4 primers.
**Distillery plants: A (Argamasilla de Alba), B (Campo de Criptana), C (Madridejos), D (Villarrobledo) and E (Daimiel). Substratum: SP, sweet
piquettes; FP, fermented piquettes; C, plant soil; L, lees.
alcohol (ethanol and methanol). The tests were carried
out in plates containing the carbon source, YNB without
amino acids (DifcoTM) and agar (20 g L
1). Ten microli-
tres (106 cells mL
1) of each preinoculum was prepared
as described above, placed on agar plates and incubated
at 28 C for 4 days. The assimilation activity was detected
by comparing the observed colony sizes to the negative
control (inoculated plates without a carbon source). The
assimilation profile was documented as (++) abundant
growth, (+) normal growth and (
) absence of growth.
For the fermentation and assimilation tests, six Saccha-
romyces cerevisiae strains isolated from the distilleries
studied were used as controls.
The results of the fermentation and assimilation tests
were compared with those in the manuals of Barnett
et al. (2000) and Kurtzman et al. (2011).
Cluster analysis of the aligned sequences and
the phenotypic results
The sequences corresponding to the 26S rRNA region
amplified using the primers NL1/NL4 were aligned using
a cluster analysis (CLUSTALW, EMBL-EBI). To construct the
phylogenetic tree, the neighbour-joining algorithm
(Molecular Evolutionary Genetic Analysis, MEGA5.05) was
used, and a heat-map was generated (Multi Experiment
Viewer software, MEV 4.8, 2011) to group the phenotypic
results (Saeed et al., 2006). In both types of statistical
analyses, six S. cerevisiae strains were used as controls.
Results and discussion
Isolation of distillery yeasts
Isolates were obtained from 19 samples, and none was
obtained from distillery F, which is possibly due to the
FEMS Yeast Res 14 (2014) 663673
667
Accession
number
**Ethanol plants/substrata NCBI bp
A/SP 1, 6 1/JN248605 578
C/SP 60, 61, 64, 67 6/JQ780463 579
E/FP 75 60/JX880407 586
61/JQ512830 582
64/JX880408 584
67/JQ512843 582
75/JQ780465 579
B/L JN248597 589
C/SP JX880403 577
hot washing of the skins, which would drastically
decrease the number of cells. Those plates with between
14 and 100 colonies were replicated on lysine agar med-
ium, and all the colonies that grew were chosen for
identification. A total of 210 yeast colonies (144 Saccha-
romyces and 66 non-Saccharomyces) were obtained. In all
distilleries, the Saccharomyces spp. yeasts were predomi-
nant, whereas the number of non-Saccharomyces species
varied between distilleries. Similar results were obtained
by Bovo et al. (2009) and Lappe-Oliveras et al. (2008).
Non-Saccharomyces yeasts represented 14% of the iso-
lated species in distillery C and almost 47% in distillery
D. This may have been due to the difference in age of
the distilleries and the particular elaboration process
followed.
The distribution of non-Saccharomyces isolates by sam-
ple type shows that the largest percentage (45.5%) was
found in sweet piquettes without ethanol. In total, 43.3%
of the isolates came from fermented piquettes, where the
ethanol concentration varied between 4% and 5% (v/v);
18.2% were isolated from plant soil, and only 3% were
isolated from sedimented yeast lees.
Identification of non-Saccharomyces isolates
A total of 66 isolates of non-Saccharomyces yeasts were
identified, for which a staggered battery of molecular
tests was used, including PCR-RFLP analysis of the
5.8S+ITS rRNA region and, where necessary, sequencing
of the 26S and 5.8S rRNA regions using different sets of
primers.
The amplified 5.8S rRNA region was digested with
three restriction enzymes (HinfI, CofI and HaeIII), and
the Yeast-id database (CSIC, UV, CECT, Valencia, Spain)
was used for the identification. Of the 66 isolates analysed
using this method, only 15 belonging to the genera Pichia
2014 Federation of European Microbiological Societies.
Published by John Wiley & Sons Ltd. All rights reserved
668 
J. Ubeda et al.

and Candida were unambiguously assigned to the species

P. galeiformis, P. anomala, C. lactis-condensi and Z. fermentati
C. ethanolica.
Z. bailii
To identify the remaining isolates at the species level,
different regions of the rRNA were sequenced using the T. delbrueckii
primers NL1/NL4, RL6/NL3A and NL2A/NL1 (http://
www.ncbi.nlm.nih.gov). Scodes. ludwigii
The description at the species level with 99% similar-
P. membranifaciens
ity, the number of isolates identified, the place of isola-
tion, the NCBI accession number and the number of P. kudriavzevii
base pairs sequenced are shown in Table 1. In total, 44
isolates were identified using the NL1/NL4 primers, and P. galeiformis
the remaining seven isolates were identified using NL2A/
LR6 and NL3A/LR6. In the case of isolate 28, a double P. bimundalis
signal corresponding to Hanseniaspora uvarum/meyeri Sweet piquettes
P. anomala
was obtained. To disprove the possibility of contamina- Fermented piquettes
tion, six cells from a colony of this isolate were sepa- O. polymorpha Flocculated lees
rated by micromanipulation (Singer MS-400) and the
Soil plant
same genomic region was sequenced. Hence, the 5.8S K. thermotolerans
ITS rRNA region was resequenced using the primers Plant soil;

ITS1/ITS4 confirming the adscription of the isolates to H. vineae Sweet piquettes

H. uvarum. The observed phenomenon was not a conse- Fermented piquettes
H. valbyensis
quence of contamination; the region chosen for PCR Yeast lees
amplification and the length of reliable sequence H. uvarum
obtained have a significant influence on the adscription
to one or the other species. H. osmophila
A percentage of similarity lower than 99% was
H. meyeri
obtained with isolates 23, 33, 48 and 62 using the primers
NL1/NL4. Sequencing of the 5.8S rRNA + ITS region C. viswanathii
confirmed it with a similarity of 99% (Table 1).
The 66 isolates were assigned to eight genera and C. sake
twenty species, which mostly belonged to the genera
Pichia (38.0%), Candida (22.7%), Hanseniaspora (18.2%) C. lactis-condensi

and Torulaspora (10.6%). The remaining 10% belonged

to Zygosaccharomyces, Kluyveromyces, Ogataea and Sac-
charomycodes. The predominant species were Pichia galei-
formis, Torulaspora delbrueckii, Hanseniaspora osmophila
and Candida lactis-condensi. These results demonstrated
the considerable diversity present, unlike in grape must
fermentations (Jolly et al., 2013).
With regard to the substrata of isolation (Fig. 2),
T. delbrueckii, H. osmophila, Pichia kudriavzevii, C. lactis-
condensi and P. anomala were isolated from sweet pi-
quettes, while P. galeiformis and C. ethanolica were found
in fermented piquettes. Other species, S0 codes. ludwigii,
Pichia bimundalis, Zygosaccharomyces bailii and Candida
sake, were also isolated from fermented piquettes but at a
very low percentage. Only two species, Kluyveromyces
thermotolerans and T. delbrueckii, were isolated equally
frequently from sweet and fermented piquettes. Thus, a
large biodiversity of yeasts occurred in the studied sub-
strata, as was found in grape marc by Bovo et al. (2009,
2011).
C. ethanolica
0 5 10 15 20
Fig. 2. Percentage of yeast species isolated in sweet and fermented
piquettes, lees and plant soil.
Figure 3 shows the distribution of genus (Fig. 3a) and
species (Fig. 3b) in the distilleries studied. In two of the
five distilleries, A and B, high biodiversity of nine species
was observed. Candida and Pichia isolates were found in
almost all of the plants, and Torulaspora and Hansenias-
pora isolates were found in three of the five distilleries.
Species that were isolated in the majority of the distiller-
ies include P. galeiformis, P. kudriavzevii, T. delbrueckii
and H. osmophila. In plant A, there was no major species,
which is in contrast to the results for the other plants
(Fig. 3b). In distilleries located in Brazil, species of Can-
dida (e.g. C. sake, C. sorbosa, C. stellata, C. guilliermondii,
C. karawaiewii and C. citrea), Pichia (P. membranifaciens

2014 Federation of European Microbiological Societies. FEMS Yeast Res 14 (2014) 663673
Published by John Wiley & Sons Ltd. All rights reserved
Non-Saccharomyces in distilleries 669

(a) 100
90
80
70
60
50
40
30
20
10
0
A B C D E

Candida Torulaspora Kluyveromyces Pichia Zygosaccharomyces

Saccharomycodes Hanseniaspora Ogataea

(b) 100%
90%

80%

70%

60%

50%

40%

30%

20%

10%

0%
A B C D E

H. osmophila P. kudri avzevii O. polymorpha C. ethanolica H. vineae

C. lactis-condensi P. anomala T. delbrueckii Z. fermentati Z. bailii
K .thermotolerans C. viswanathii P. galeiformis P. membranifaciens
S codes. ludwigii H. meyeri H. uvarum C. sake H. valbyensis
Fig. 3. Distribution of genus (a) and species
(b) in the distilleries studied (A-E). P. bimundalis

and P. guilliermondii), Kluyveromyces marxianus and
large Saccharomyces spp. populations have been isolated
(Morais et al., 1997; Pataro et al., 1998), confirming that
the yeast profiles in the distilleries of the two regions are
very different. Some of these genera and species were
found by Lappe-Oliveras et al. (2008) and Amaya-Del-
gado et al. (2013) in tequila and agave beverages.
To construct the phylogenetic tree by sequence align-
ment, a few of the 66 isolates were discarded (as men-
tioned) because it was not always possible to amplify
and/or sequence the 26S rRNA region using the primers
NL1 and NL4 (24, 40, 43, 45 and 74) or because they had
already been identified by PCR-RFLP analysis (9, 10, 36,
38, 47, 49, 68, 69, 70, 71 and 76). Multiple sequence
comparison by log-expectation (Muscle) was chosen for
cluster analysis because five of the six Saccharomyces spp.
strains used as controls for the alignment were grouped
together (Fig. 4). In this cluster analysis, almost all the
P. galeiformis isolates that were obtained were excluded
because they had been previously identified by PCR-RFLP
analysis.
Cluster analysis to a level of 0.30 grouped the isolates
in two large groups, with one group containing the
majority of the species (17). The majority of the Pichia
and Candida species were grouped in one subcluster, and
the Hansenisapora, Torulaspora and Saccharomyces spp.
were grouped in the other subcluster. In another minority
cluster, C. lactis-condensi species and a Saccharomyces spp.
isolate that grouped very close to T. delbrueckii were
included. Due to the heterogeneity of this cluster, it is
easy to suggest that the aligned sequences were not suffi-
ciently discriminatory because the same species were

FEMS Yeast Res 14 (2014) 663673 2014 Federation of European Microbiological Societies.
Published by John Wiley & Sons Ltd. All rights reserved
670
Fig. 4. Cluster analysis of 26S rDNA sequences amplified with NL1/
NL4 primers. Hierarchical clustering of the sequences aligned was
performed using the neighbour-joining algorithm (CLUSTALW, EMBL-EBI).
2014 Federation of European Microbiological Societies.
Published by John Wiley & Sons Ltd. All rights reserved

J. Ubeda et al.
grouped in different subclusters. The similarity between
the Torulaspora and Saccharomyces spp. is revealed by the
proximity of the genera in both clusters. However, all of
the H. uvarum isolates (28-1 to 28-6) separated by micro-
manipulation were found to be related and were very
near to H. meyeri species, as shown by the phenotypic
analysis.
Fermentation of carbon compounds
Fermentation of carbon compounds is particularly useful
for identifying isolates with new fermentation profiles, for
potential applications in various fields. The majority of
the isolates (Torulaspora, Kluyveromyces and Saccharomy-
codes species and C. lactis-condensi) fermented D-glucose
in the first 12 h or on the 5th day. D-mannose and sac-
charose were fermented to a lesser extent. None of the
isolates fermented xylose, lactose, arabinose, melibiose
and rhamnnose, and some only weakly fermented galac-
tose, maltose and raffinose. Candida lactis-condensi fer-
mented the majority of the sugars at a major or minor
intensity. On the other hand, variability was observed in
T. delbrueckii, C. lactis-condensi and P. galeiformis isolates
for galactose fermentation, in T. delbrueckii and C. ethan-
olica for raffinose fermentation, and in P. galeiformis
and H. osmophila for saccharose fermentation (data not
shown). Only one H. uvarum isolate and one Hansenias-
pora vinae isolate weakly fermented cellobiose, which is a
sugar of great biotechnological interest in the production
of bioethanol from agricultural and forest byproducts.
Assimilation of carbon compounds
Glucose and maltose were the most commonly used sub-
strates, and to a lesser extent, xylose and methanol. Three
species of Candida, C. viswanathii, C. ethanolica and
C. sake, and one P. galeiformis isolate assimilated carb-
oxymethyl cellulose, while three Pichia isolates utilized
starch. The majority of the Torulaspora isolates and a few
isolates of P. kudriavzevii, P. galeiformis and H. osmophila
assimilated xylose. All of the H. osmophila, H. uvarum
and S0 codes ludwigii isolates effectively assimilated cellobi-
ose. Ethanol was assimilated by few P. galeiformis and
P. anomala isolates. Finally, only some K. thermotolerans,
P. kudriavzevii, C. sake and C. viswanathii isolates assimi-
lated methanol. Thus, difference between isolates of the
same species was observed, as seen in the fermentation
tests.
In Fig. 5, the heat-map obtained from the results of
the assimilation and fermentation tests is shown. In this
analysis, isolates 43 (P. bimundalis), 62 (H. osmophila)
and 71 and 76 (P. galeiformis) were excluded owing to
negative results in both the assimilation and fermentation
FEMS Yeast Res 14 (2014) 663673
Non-Saccharomyces in distilleries 671

1.0 2.0 4.0

CELLOBIOSE 2%
0.31973994

0.65986997

PHAMNOSE 2%

LACTOSE 2%

MALTOSE 2%

GLUCOSE 2%

LIGNINE 1%

CELLOBIOSE

SACCHAROSE
STARCH 1%

XYLOSE 2%

GALACTOSE

PAFFINOSE
MetOH 1%
EtOH 1%

GLUCOSE

MALTOSE

MANNOSE
CMC 1%
1.0
C. lactis-condensi 56
C. lactis-condensi 52
C. lactis-condensi 53
C. lactis-condensi 54
C. lactis-condensi 55
S. cerevisiae 33
S. cerevisiae 30
T. delbrueckii 67
P. galeiformes 68
T. delbrueckii 64
S. cerevisiae 63
T. delbrueckii 6
C. lactis-condensi 51
C. lactis-condensi 57
S. cerevisiae 31
S. cerevisiae 29
T. delbrueckii 60
T. delbrueckii 1
T. delbrueckii 75
H. osmophila 59
H. osmophila 65
Scodes ludwigii 72
Scodes ludwigii 77
T. delbrueckii 61
S. cerevisiae 16
K. thermotolerans 46
C. lactis-condensi 50
Z. bailii 34
P. galeiformes 9
P. galeiformes 70
P. galeiformes 74
P. anomala 27
C. ethanolica 48
P. galeiformes 47
P. galeiformes 49
Z. fermentati 15
K. thermotolerans 25
P. membranifaciens 23
P. galeiformis 37
P. galeiformis 38
P. galeiformis 69
C. ethanolica 35
H. osmophila 26
P. kudriavzevii 24
P. anomala 20
P. kudriavzevii 13
P. anomala 10
P. kudriavzevii 3
P. kudriavzevii 8
P. kudriavzevii 14
P. anomala 21
P. anomala 22
P. anomala 32
C. viswanathii 39
C. ethanolica 36
C. ethanolica 40
C. ethanolica 41
Fig. 5. Non-Saccharomyces phenotype P. galeiformes 45
C. sake 44
variation. A selection of different substrates H. osmophila 58
H. osmophila 4
for fermentative and assimilative tests. O. polymorpha 19
H. uvarum 11
Phenotypes were qualitatively measured. H. vineae 2
H. osmophila 66
Hierarchical clustering of phenotypes was H. meyeri 7
H. valbyensis 5
performed using a centred Pearson correlation H. uvarum 28
metric and average linkage mapping. Green,
poor assimilative or fermentative tests; red, A B
good assimilative or fermentative tests.

tests, with the exception of glucose, which was fermented and K. thermotolerans. In a second cluster, which was
weakly, but only on the 5th day. The majority of the extremely marginal, two Pichia species (P. galeiformis and
Pichia species assimilated almost all substrates, specifically P. anomalous) were grouped together. In the largest clus-
maltose, methanol, xylose, rhamnnose and carboxymeth- ter, species of Candida (C. ethanolica, C. sake, C. visw-
ylcellulose; nevertheless, they were only slightly active in anathii), Hanseniaspora (H. osmophila, H. vineae,
the fermentation tests. In contrast, galactose, maltose H. uvarum, H. valbyensis and H. meyeri), Pichia (P. galei-
and saccharose were fermented by almost all the C. lactis- formis, P. kudriavzevii, P. anomala, P. membranifaciens)
condensi, T. delbrueckii and K. thermotolerans isolates. and S0 codes. ludwigii appeared, among others.
The heat-maps show three clusters at the 0.36 level. All There was no concordance between the clusters
the species grouped together, and none appeared in more obtained in the two types of analyses, phenotypic and
than one cluster, with the exceptions of P. galeiformis, genetic. Sequencing of approximately 550 bp of the 26S
which was distributed in three clusters, K. thermotolerans rDNA region constituted a more reliable method in
in two and P. anomala in another two. comparison with the PCR-RFLP analysis for the identi-
The six S. cerevisiae strains used as controls were fication of the isolates at the species level due to the dif-
grouped together with C. lactis-condensi, T. delbrueckii ferent amounts and types of data generated. However,

FEMS Yeast Res 14 (2014) 663673 2014 Federation of European Microbiological Societies.
Published by John Wiley & Sons Ltd. All rights reserved
672
this did not offer a logical inclusion in the clusters in
comparison with the grouping based on the phenotypic
tests and heat-maps, possibly owing to the length of
the sequences compared and the discrepancy that some
of the phenotypic traits tested are strain-dependent.
Concluding remarks
This initial study of yeast populations isolated from
ancient distilleries reflects the great existing biodiversity
of this valuable yeast niche. This is in contrast to what
occurs in wine cellars, where the intra- and interspecific
variability of yeasts have been reduced drastically due to
the starter cultures that have been commonly used in the
last two decades (Ortiz et al., 2013).
Pichia and Candida species are found less commonly in
wine than in distilleries, which is possibly due to the low
degree of alcohol reached in a distillery plant before dis-
tillation that would allow the development of yeast more
sensitive to ethanol. On the other hand, some species
were only isolated for certain substrates, for example
T. delbrueckii in sweet piquettes and P. galeiformis in
fermented ones.
There was no agreement between the phenotypic and
genetic analysis. Sequencing approximately 500 bp of
the 26S rRNA region for the identification of isolates at
the species level constituted a more reliable method in
comparison with PCR-RFLP, but this did not provide
reliability for coherent adscription to the groups in
comparison with heat-map analysis based on phenotypic
profiles.
Acknowledgement
The authors are grateful to the Spanish government for
project funding (INIA-RM 2010-00011-00-00).
References
Ahansal L, Ben Sassi A, Martini A, Vaughan-Martini A &
Walker G (2008) Biodiversity of yeasts isolated from
the indigenous forest of Argan (Argania spinosa (L.)
Skeels) in Morocco. World J Microbiol Biotechnol 24:
777782.
Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z &
Miller W (1997) Gapped BLAST and PSI- BLAST: a new
generation of protein databases search programs. Nucleic
Acids Res 25: 33893402.
Amaya-Delgado L, Herrera-Lopez EJ, Arrizon J, Arellano-Plaza
M & Gschaedler A (2013) Performance evaluation of Pichia
kluyveri, Kluyveromyces marxianus and Saccharomyces
cerevisiae in industrial tequila fermentation. World J
Microbiol Biotechnol 29: 875881.
2014 Federation of European Microbiological Societies.
Published by John Wiley & Sons Ltd. All rights reserved

J. Ubeda et al.
Barnett JA, Payne RW & Yarrow D (2000) Yeasts:
Characteristics and Identification, 3rd edn. Cambridge
University Press, Cambridge.
Basso LC, De Amorim HV & De Oliveira AJ (2008) Yeast
selection for fuel ethanol production in Brazil. FEMS Yeast
Res 8: 11551163.
Bhadra B, Rao RS, Singh PK, Sarkar PK & Shivaji S (2008)
Yeasts and yeast-like fungi associated with tree bark:
diversity and identification of yeasts producing extracellular
endoxylanases. Curr Microbiol 56: 489494.
Bovo B, Andrighetto C, Carlot M, Corich V, Lonbardi A &
Giacomini A (2009) Yeast population dynamics during
pilot-scale storage of grape marcs for the production of
Grappa, a traditional Italian alcoholic beverage. Int J Food
Microbiol 129: 221228.
Bovo B, Giacomini A & Corich V (2011) Effects of grape
marcs acidification treatment on the evolution of
indigenous yeast populations during the production of
grappa. J Appl Microbiol 111: 382388.
Fernandez T, Marcet M, Olivera W & Martin C
(2008) Isolation and evaluation of thermotolerant
strains of Saccharomyces cerevisiae for aguardiente and
rum production. Ciencia y Tecnologa Alimentaria 6:
6470.
Gutirez-Coronado ML, Acedo-Felix E & Valenzuela-Quintanar
AI (2007) Bacanora industry and its process of production.
Ciencia y Tecnologa Alimentaria 5: 394404.
Iacumin L, Manzano M, Cecchini F, Orlic S, Zironi R & Comi
G (2012) Influence of specific fermentation on natural
microflora of pomace in Grappa production. World J
Microbiol Biotechnol 28: 17471759.
Jolly NP, Varela C & Pretorius IS (2013) Not your ordinary
yeast: non-Saccharomyces yeasts in wine production
uncovered. FEMS Yeast Research 14: 21052037.
Kurtzman CP & Fell JW & Boekhout T (2011) The Yeasts: A
Taxonomic Study, 5th edn. Elsevier Science Publisher,
Amsterdam.
Lachance MA (1995) Yeast communities in a natural tequila
fermentation. Antonie Van Leeuwenhoek 68: 151160.
Lappe-Oliveras P, Moreno-Terrazas R, Arrizon-Gavino J,
Herrera-Suarez T, Garca-Mendoza A & Gschaedler-Mathis
A (2008) Yeasts associated with the production of Mexican
alcoholic nondistilled and distilled Agave beverages. FEMS
Yeast Res 8: 10371052.
Morais PB, Rosa CA, Linardi VR, Pataro C & Maia ABRA
(1997) Characterisation and succession of yeast populations
associated with spontaneous fermentations during the
production of Brazilian sugar-cane aguardente. World J
Microbiol Biotechnol 13: 241243.
Ortiz M, Barrajon N, Alves-Baffi M, Arevalo Villena M &
Briones A (2013) Spontaneous must fermentation:
identification and biotechnological properties of wine yeasts.
LWT- Food Sci Technol 50: 371377.
Pataro C, Santos A, Correa SR, Morais PB, Linardi VR & Rosa
CA (1998) Physiological characterisation of yeasts isolated
FEMS Yeast Res 14 (2014) 663673
Non-Saccharomyces in distilleries
from artisanal fermentation in an aguardente distillery.
Revista de Microbiologa 29: 104108.
Saeed AI, Hagabati NK, Braisted JC, Liang W, Sharov V,
Howe EA, Li JW, Thiagarajan M, White JA & Quackenbush
J (2006) TM4: microarray software suite. Methods Enzymol
411: 134193.
Ubeda JF, Maldonado M, Briones AI & Gonzalez FJ (2014)
Bio-prospecting of Distillery Yeasts as Bio-control and Bio-
remediation Agents. Curr Microbiol 68: 594602.
Vianna CR, Silva CLC, Neves MJ & Rosa CA (2008)
Saccharomyces cerevisiae strains from traditional
FEMS Yeast Res 14 (2014) 663673
673
fermentations of Brazilian cachaca: trehalose metabolism,
heat and ethanol resistance. Antonie Van Leeuwenhoek 93:
205217.
White TJ, Bruns T, Lee S & Taylor J (1990) Amplification and
direct sequencing of fungal ribosomal RNA genes for
phylogenetics. PCR Protocols: A Guide to Methods and
Applications. (Innis MA, Gelfand DH, Sninsky JJ & White
TJ, eds), pp. 315322. Academic Press, London.
Woody ST, Ives AR, Nordheim EV & Andrews JH (2007)
Dispersal, density dependence, and population dynamics of
a fungal microbe on leaf surfaces. Ecology 88: 15131524.
2014 Federation of European Microbiological Societies.
Published by John Wiley & Sons Ltd. All rights reserved