Biology 1202 Introduction to Biology II

Dr. Pomarico
Spring 2016
Supplemental Instruction

Anthony Domma
What is Supplemental Instruction?

Supplemental Instruction (SI) is a program set up at LSU by the Center for Academic Success that helps
students pass courses that have high drop/fail percentages. The major way that SI helps students is by holding
SI sessions. These sessions are led by an SI instructor who provide a fun study environment for students to peer
teach each other in various ways. This philosophy of students teaching each other has proven to help students
significantly with raising their GPA and learning the material to pass the class. Biology II is a class that offers
an SI that I was an SI for at LSU. The following is the portfolio of the SI instructor Anthony Domma which
provides his approach to the Spring of 2016 SI semester. All worksheets are on LSU CAS drive.

The Students:
Biology 1202 is a class generally offered to freshmen. This was a change for me coming from Organic 2 which
is a second semester sophomore class. Organic II students know what the SI program is, how it works, how it
can be used and how to communicate with the instructor and SI. However, the fall of freshman year is the first
exposure to this concept of SI. Not only is this the first exposure to SI but also life away from parents and
college in general. Several problems occurred during the semester listed below:

1. Students had knowledge of high school biology: This may seem like it is a good thing in that the
students would be building on knowledge instead of learning it from scratch. However, students who did
well often found that they already knew the material and did not need to spend excess time studying for
it. Depending on the high school, the results for this approach varied. If the high school had quality
biology teachers the students generally did well. Some of them came to my exam reviews and made sure
they knew it but did not come to my SI sessions. However, if the school had a poor science program,
then the students did not do as well. Some students did exceptionally well in these poor programs which
gave them the false pretense that they knew the material. Again, some of these students came to my
exam reviews and realized they did not know the material and panicked. Some did not go to anything
and did shockingly poorly on the exam. Other students were taught incorrectly and came in with false
information about biology. Correcting the misinformation is important for the success of the program. I
had several students who did not know about biology, came to class, my sessions, exam reviews and
office hours and did very well in the class.
2. Premed students: The overwhelming majority of students are premed or other grad school and do not
know what their track requires. Some students learn that they need to make certain grades and start
approaching information as a necessity of learning instead of learning the general principles of
knowledge. So I tell them you need to know (insert specific point) but if you just understand that (insert
general principle) then you will do well. They will then memorize the specific point instead of
understanding the material. Having students understand the material and principles of biology in
Biology 1201 is the aim of developing students and sometimes the students dont understand this and get
frustrated with me.
3. Living on their own: Some students need time and experience in living without parents. I had several
parents email me about the sessions and the attendance to which I responded have your child talk to me
and it will be dealt with. Also, some students would skip my sessions and go out to parties and lie to
me about it. Im cool with that and I always worked with them to get the information because I want
successful students. Freshman year is a time for growth in living and SIs get pulled into that.

Not all students were bad! I had several students who were very smart, tried very hard and did very well in the
class. I had several regulars to my sessions, exam reviews and office hours. There were many success stories in
the class and several of them are now my friends. I encouraged many of them to form study groups and I
became part of a How not to fail Newcomers class group me. Many students became friends in the class.
During the Semester:
Once the semester got started we went through the regular process of going to class, making SI worksheets and
lesson plans and performing exam reviews. The exams included tests on:

1. Chemistry of Life
2. Metabolism, Meiosis and Mitosis
3. Genetics
4. Transcription, Translation and Biotechnology

The lesson plans were made by what I believed to be

the best approach to studying the material. This varied each session to what the material was on but included an
assortment of graphs, charts, figures, outlines, questions, formulas, calculations Punnet squares ect. A sample
worksheet from each test is posted below in the next pages. The session had the general setup of a warm up,
main activity and a cool down that consisted of multiple choice reviewing the session material. The tests for this
class were all multiple choice and cool downs prepared the freshmen for the college tests.

Making the Worksheet:

The worksheets all corresponded to the SI model of having a
warm up activity (to review previous material or preview what
will be on the worksheet), 3-4 main activities (goes over the
material that will be on the test), and a closing activity (which
ties in the material to the overall picture and reiterates the
material as a review). This approach is a good way of making
sure they are mentally approaching the subject in the right
mindset. The warm up will focus the students on biology and
brings the material down to a level they can understand. The
main activity is the primary mechanism of understanding. And
the cool down reiterates the material to ensure they learned
something before leaving.

The problems in the worksheets not only went over the

material but also made the students think. If you look at the
examples you will see many different charts that the students
were never exposed to in the notes. They have to look at the
notes in a different view to twist the answer into those charts.
At the end of the session the students knew the material better
and had an organized approach to the material.

Biology I found was much more information based than problem based. This posed some problems that
conflicted with the SI model. In problem based sessions, a formula or reaction can be given that the student can
understand then another problem can be given that can test understanding. In biology, the thinking is very
systematic, so you cannot give a small portion of the map and test it. For example, to explain transcription, I
would have to explain the whole system, then go through it. If students did not understand from lecture, then
they could get a second way of looking at it at the SI session. The system that I set up was different in that it
was more lecturing by me than I did as an organic SI, but it was an affective system. I received much thanks and
the students said I was very helpful. However, this helpfulness roots itself in a very concentrated flow of logic
and very methodical explanation that does not slouch over any aspect of the subject matter.
 1. Chemistry of Life Test
Warm Up:
Label the functional groups of the following monomers, name what type of monomers it is and what its polymer
is called.

Types of Reactions
Perform a hydrolysis of the flowing molecules. Perform a dehydration of the monomers.

Main Activity 1: Carbohydrates

Carbohydrates are molecules made of equal parts of _________ and

__________. The monomer of carbohydrates is _____________ and always

end with the suffix ___________. They have 2 different forms depicted to

the right that are ______________ and _____________. The straight chain

of carbohydrates are unstable. Because of this, Carbohydrates primarily exist

in the _______________ form. They undergo a _____________ reaction to link the monomers together forming

a _________________ linkage. If 2 sugars link together it is called a ____________________ and a long chain

of sugars is called a _____________________. Three major polysaccharides are starch found in

_______________, glycogen found in ________________, and chitin found in __________________.

Main Activity 2: Lipids

1. Label the names, the composition and purpose of the lipids below.

2. Compare and contrast fats and Phospholipids

3. Describe the types of fatty acid chains.

Main Activity 3: Proteins
1. Label the amino acid below Primary

2. List the different levels of protein

structure.

Secondary

Tertiary

Quaternary
Multiple Choice
1. Polymerization is a process that
a. creates bonds between amino acids in the formation of a peptide chain
b. involves the removal of a water molecule
c. links sugars through glyosidic linkages
d. involves all of the above

2. Large organic molecules are usually assembled by polymerization of a few kinds of simple subunits. Which
is the following is an exception to this statement?
a. steroid
b. cellulose
c. DNA
d. phospholipid
e. protein

3. Altering which of the following levels of structural organization of a protein could alter its function?
a. primary
b. secondary
c. tertiary
d. only a and c
e. a, b and c

4. The element nitrogen is present in all of the following EXCEPT

a. proteins
b. nucleic acids
c. amino acids
d. DNA
e. lipids

5. Upon chemical analysis, a particular protein as found to contain 438 amino acids. How many peptide bonds
are present in the protein?
a. 20
b. 437
c. 438
d. 439
e. 876

6. The alpha helix of proteins is

a. part of the tertiary structure and is stabilized by disulfide bridges
b. stabilized by hydrogen bonds
c. stabilized by hydrophobic interactions
d. formed from the interaction of R groups
7. Beta sheets are characterized by
a. disulfide bridges between cysteine amino acids
b. back-and-forth folds of the polypeptide chain held together by hydrophobic interactions
c. folds stabilized by hydrogen bonds between segments of polypeptide chains
d. membrane sheets composed of phospholipids

8. Which of the following will increase the number of moles of water in solution?
a. Hydrolysis of a peptide bond
b. Cyclization of a carbohydrate
c. Dehydration reaction
d. both a and c

9. Not all proteins contain

a. a primary structure
b. a peptide bond
c. a quaternary structure
d. a tertiary structure

10. Which of following are true for both fats and phospholipids
a. they contain a glycerol and a fatty acid chain
b. they are found in the membrane of cells
c. they store energy
d. they have glycerol liked to both a chain of carbons and a phosphate

11. The molecular formula for glucose is C6H12O6. What could be the molecular formula for a polymer made by
linking ten glucose molecules together?
a. C60H120O60
b. C6H12O6
c. C60H102O51
d. C60H100O50
e. C60H111O51

12. Choose a pair of terms that completes the sentence: Sugars are to ________ as _______ are to proteins.
a. carbohydrates; starch
b. monosaccharides; amino acids
c. Carbon; Nitrogen
d. carbohydrates; amino acids
e. Proteins; Polysaccharides
2. Metabolism, Meiosis and Mitosis Test
Warm Up:
Label the phases of mitosis and give a brief description of that phase:

1. ___________________-

2. ___________________-

3. ___________________-

4. ___________________-

5. ___________________-

6. ___________________-

7. ___________________-
Main Activity 1:
1. How many chromosomes are in the body cells of humans?

2. Explain the human life cycle. What happens to the number of chromosomes in each step? Explain why.

Vocab:
Somatic cells-

Gametes-

Sexual reproduction-

Asexual reproduction-

Zygote-

Diploid-

Haploid-

Autosome-

Sex chromosome-

3. How does this relate to mitosis?

Main Activity 2:
Explain the process of Crossing over.

Vocab:
Non-sister chromatids-

Recombinant DNA-

Chiasmata-

Synapsis-
Main Activity 3:
Label the stages of Meiosis and describe what is happening in each stage.
Main Activity 4:
Describe the ways orgasms can have genetic variation
Independent Assortment:

Crossing over:

Random fertilization:

Main Activity 5:
Stage Number of Chromosomes Number of Chromatids Amount compared to G1
G1

G2

Prophase I

Metaphase I

Anaphase I

Telophase I/Cytokinesis

Prophase II

Metaphase II

Anaphase II

Telophase II/Cytokinesis

____ new cells with

Main Activity 6:
1. Label the following pictures as haploid or diploid.
2. Label the sister chromatids, homologous chromosomes.
3. Put how many chromosomes, chromatids and homologous chromosomes are in each picture.
4. List the potential stages that cell can be in (i.e. G1, G2, S, Prophase, Prometaphase..)
Main Activity 7:
Compare and contrast Mitosis and Meiosis:
Property Mitosis Meiosis
DNA Replication

Number of
Divisions

Synapsis of
Homologous
Chromosomes

Number of
Daughter Cells
and Genetic
Composition
Role in the Body
 1. In the human species, all somatic cells have 46 chromosomes. Which of the following can also be true?
a. A plant species (privet shrubs) has 46 chromosomes per cell.
b. Some adult humans have 69 chromosomes per cell.
c. Some adult humans have 23 chromosomes per cell
d. A certain fungal species has only one chromosome per cell.
e. A certain bacterial species has 23 chromosomes.

2. Which of the following is a true statement about sexual vs. asexual reproduction?
a. In asexual reproduction, offspring are produced by fertilization without meiosis.
b. Asexual reproduction produces only haploid offspring.
c. Bacteria cells replicate by asexual reproduction while human cells reproduce by sexual reproduction
d. In sexual reproduction, individuals transmit 50% of their genes to each of their offspring.
e. Asexual reproduction, but not sexual reproduction, is characteristic of plants and fungi.

3. Which of the following phases do mitosis and meiosis have exactly the same?
a. S phase before mitosis and S phase before meiosis
b. Prophase and Prophase I
c. Metaphase and Metaphase I
d. Anaphase and Anaphase I
e. Telophase and Telophase I

4. Which phase of meiosis does variation increase? (more than one)

a. Prophase I e. Prophase II
b. Metaphase I f. Metaphase II
c. Anaphase I g. Anaphase II
d. Telophase I h. Telophase II

5. Which phase of meiosis do cells have the same amount of DNA as the parent cell at G1? (more than one)
a. Prophase I e. Prophase II
b. Metaphase I f. Metaphase II
c. Anaphase I g. Anaphase II
d. Telophase I h. Telophase II

Stage Number of Chromosomes Number of Chromatids Amount compared to G1

G1
S
G2
Prophase I
Metaphase I
Anaphase I
Telophase I/Cytokinesis
Prophase II
Metaphase II
Anaphase II
Telophase II/Cytokinesis
____ new cells with
3. Genetics Test
Warm Up:
1. Label the traits in the 2 pictures: homologous pair of chromosomes and sister chromatids.
2. Vocab:
Gene-

Trait-

Character-

Alleles-

3. What phases do homologous chromosomes separate and what phase do sister chromosomes separate?

4. Draw the end result of meiosis if we were to exclude crossing over.

Main Activity 1:
Dominant allele-

Recessive allele-

Punnett square-

A A a a
a
A A
a
a

A A

Homozygous dominant-

Homozygous recessive-

Heterozygous-

Phenotype-

Genotype-
Practice:
1. Draw the correct Punnett squares for the following monohybrid crosses. Describe the phenotype
(whether it is B or b), and the genotype (homozygous or heterozygous). (Note: P, F1, F2..)

AA x AA Aa x AA aa x AA

AA x Aa Aa x Aa aa x Aa

AA x aa Aa x aa aa x aa

2. Preform a trihybid cross of AaBBcc x aabbcc

3. What laws are present in this cross?

4. Describe a testcross. Why is it useful?

Main Activity 2:
The way the genotype affects the phenotype is not always the same.

Complete dominance-

AA-
Aa-
aa-

Incomplete dominance-

AA-
Aa-
aa-

Codominance-

AA-
Aa-
aa-

Main Activity 3:
Multiple alleles-

Pleiotropy-

Dominance relationships, multiple alleles and pleiotropy all have to do with the effects on _________________

of a _____________________________.
Main Activity 4:

1. ______________________ is when a gene at one locus affects

the expression of a gene at another locus.

Epistasis Not Epistasis

2. ______________________________ is when 2 or more genes

add up to express a phenotypic character.
Main Activity 5:

Questions:

1. Gene _____ a. Has no effect on phenotype in a

2. Allele _____ heterozygote
b. A variant for a character
3. Character _____
c. Having two identical alleles for a gene
4. Trait _____ d. A cross between individuals heterozygous
5. Dominant allele _____ for a single character
e. Alternative version of a gene
6. Recessive allele _____
f. Having two different alleles for a gene
7. Genotype _____ g. A heritable feature that varies among
8. Phenotype _____ individuals
h. An organisms appearance or observable
9. Homozygous _____
traits
10. Heterozygous _____ i. A cross between an individual with an
11. Test cross _____ unknown genotype and a homozygous
12. Monohybrid cross _____ recessive individual
j. Determines phenotype in a heterozygote
k. The genetic makeup of an individual
l. A heritable unit that determines a character.
Can exist in different forms
1. A 1:1 phenotypic ratio from a test cross means that the organism is ____________
a. Monohybrid
b. Haploid
c. Homozygous dominant
d. Homozygous recessive
e. Heterozygous

2. Black fur in mice (B) is dominant to brown fur (b). Short tails (T) is
dominant to long tails (t). What proportion of the progeny of the
cross BbTt x BBtt will have black fur and long tails?
a. 1/2
b. 1/4
c. 1/8
d. 1/16

3. Sickle-cell anemia is the result of a single recessive gene in the homozygous state (ss), yet this disease
has a complex set of symptoms affecting many parts of the body. Which term is most applicable to this
example?
a. Pleiotropy
b. Epistasis
c. Multiple alleles
d. Codominance
e. incomplete dominance

4. How many unique gametes can be formed from an individual with the genotype TTiiGgEERrSs?
a. 4
b. 8
c. 16
d. 32
e. 64
f. 92
5. A computer is hooked up to a power strip. When the power strip is turned off the computer is off. When
the power strip is on the computer can either be on or off. What genetic phenomenon is this like?
a. Pleiotropy
b. Epistasis
c. Multiple alleles
d. Codominance
e. incomplete dominance

6. A cross is made between the individuals AaBbCc and AaBbCc. What is the percentage of offspring that
will be AABBCC?
a. 1/8
b. 1/16
c. 3/16
d. 1/64
e. 3/64

7. A rooster with gray feathers is mated with a hen of the same phenotype. Among their offspring, 15
chicks are gray, 6 are black, and 8 are white.

a. What is the simplest explanation for the inheritance of these colors in chickens?

b. What offspring would you predict from the mating of a gray rooster and a black hen?

8. A black guinea pig crossed with an albino guinea pig produced 12 black offspring. When the albino was
crossed with a second black one, 7 blacks and 5 albinos were obtained. What is the best explanation for
this genetic situation?

9. Are the following conditions dominant or recessive disorders?

4. Transcription, Translation and Biotechnology Test
Warm Up:
In the diagram below 1) label the directions of each strand 2) label each thing there is a line to 3) put the
nucleotides on each string.
Main Activity 2:
Steps of translation:

1. ___________________

2. ___________________

3. ___________________

Main Activity 3:
Explain the process of the use of tRNA.

Main Activity 4:
1. What are the 2 locations that ribosomes are found in the cell? How
does this relate to protein function?

2. Label the ribosome to the right

3. What types of RNA are there involved with the ribosome?

Main Activity 5:
Initiation:
The small subunit binds to the ________________ of the mRNA.

Elongation:
1.

2.

3.

4.

5.

6.

7.

8.

Termination:
Describe the process of termination
Main Activity 6:
1. Define a Polyribosome-

2. Posttranslational modification-

3. Signal-recognition particle-

4. Wobble-
Main Activity 7:

Silent-

Missense-

Nonsense-

Closing:
1. A particular triplet of bases in the template strand of DNA is 5' AGT 3'. The corresponding codon for
the mRNA transcribed is
a. 3' UCA 5'.
b. 3' UGA 5'.
c. 5' TCA 3'.
d. 3' ACU 5'.
e. either UCA or TCA, depending on wobble in the first base.
2. The genetic code is essentially the same for all organisms. From this, one can logically assume which of
the following?
a. A gene from an organism can theoretically be expressed by any other organism.
b. All organisms have experienced convergent evolution.
c. DNA was the first genetic material.
d. The same codons in different organisms translate into the different amino acids.
e. Different organisms have different numbers of different types of amino acids.
3. Translate the DNA sequence 3 CATTGTACGCTTATTCATCTAAAGGGTCATTAAC 5 found in
prokaryotes. (Be super careful)
4. A particular triplet of bases in the coding sequence of DNA is AAA. The anticodon on the tRNA that
binds the mRNA codon is
a. TTT.
b. UUA.
c. UUU.
d. AAA.
e. either UAA or TAA, depending on first base wobble.
5. There are 61 mRNA codons that specify an amino acid, but only 45 tRNAs. This is best explained by
the fact that
a. some tRNAs have anticodons that recognize four or more different codons.
b. the rules for base pairing between the third base of a codon and tRNA are flexible.
c. many codons are never used, so the tRNAs that recognize them are dispensable.
d. the DNA codes for all 61 tRNAs but some are then destroyed.
e. competitive exclusion forces some tRNAs to be destroyed by nucleases.
6. Which of the following is the first event to take place in translation in eukaryotes?
a. elongation of the polypeptide
b. base pairing of activated methionine-tRNA to AUG of the messenger RNA
c. binding of the larger ribosomal subunit to smaller ribosomal subunits
d. covalent bonding between the first two amino acids
e. the small subunit of the ribosome recognizes and attaches to the 5' cap of mRNA
7. What is the effect of a nonsense mutation in a gene?
a. It changes an amino acid in the encoded protein.
b. It has no effect on the amino acid sequence of the encoded protein.
c. It introduces a premature stop codon into the mRNA.
d. It alters the reading frame of the mRNA.
e. It prevents introns from being excised.
8. Which of the following statements is true about protein synthesis in prokaryotes?
a. Extensive RNA processing is required before prokaryotic transcripts can be translated.
b. Translation can begin while transcription is still in progress.
c. Prokaryotic cells have complicated mechanisms for targeting proteins to the appropriate cellular
organelles.
d. Translation requires antibiotic activity.
e. Unlike eukaryotes, prokaryotes require no initiation or elongation factors.
9. Of the following, which is the most current description of a gene?
a. a unit of heredity that causes formation of a phenotypic characteristic
b. a DNA subunit that codes for a single complete protein
c. a DNA sequence that is expressed to form a functional product: either RNA or polypeptide
d. a DNARNA sequence combination that results in an enzymatic product
e. a discrete unit of hereditary information that consists of a sequence of amino acids
10. When the genome of a particular species is said to include 20,000 protein-coding regions, what does
this imply?
a. There are 20,000 genes.
b. Each gene codes for one protein.
c. Any other regions are "junk" DNA.
d. There are also genes for RNAs other than mRNA.
e. The species is highly evolved.
11. Briefly describe the process of translation following transcription.
Best SI session:
My best SI session was a hard one to choose because I had so many SI sessions that prepared the students well
for the exam. My favorite session to do and one I though prepared the students the best is the session on
oxidative respiration the worksheet. The way I presented the information as though the students knew nothing
and brought them all the way to ATP synthase.

Warm up:
The session started with the general formula of respiration
Glucose + oxygen Carbon dioxide + water. We then did a
review of the previous SI session and looked at the
thermodynamics of the reaction and saw how it is exergonic.
Then we talked about how this makes sense in the light of
providing energy for the cell from glucose. I told them how the
reaction releases energy but the energy that is released is a
slow progressive release of energy that encompasses
glycolysis, pyruvate oxidation, citric acid cycle and oxidative
phosphorylation. Then we talked about energy within bonds and where the energy is within glucose and carbon
dioxide as the carbons in glucose gets oxidized. The warm up is a very good representation of how to both
review old information from the last session (thermodynamics of the reaction), give a brief intro to the terms
that will be talked about in the session (oxidation of glucose) and give a brief overview of the session (releasing
energy from glucose in a progressive manner). That is the mark of a great warm-up activity and should be the
aim of every session that it can be done for.

Main Activities:
1. In the first main activity we went over the oxidative phosphorylation in a general manner. We talked
about how glycolysis takes glucose and makes it into pyruvate, then the pyruvate goes into the
mitochondria to be oxidized. That oxidized pyruvate goes into the citric acid cycle and electron carriers
are generated. Those carriers then go to the electron transport chain where they deposit their electrons.
The electrons move through the chain creating a proton gradient. The protons flow through ATP synthase
to create ATP.
2. The second main activity talked about how electron carriers function and we reviewed how enzymes
worked. We talked about the 2 forms of phosphorylation: substrate level and oxidative. These brief
snippets allowed us to talk about the whole process in a specific manner.
3. We went through the process of glycolysis and kept track of the substrates, products, electron carriers
and energy yields. We did the same thing for pyruvate oxidation, citric acid cycle and oxidative
phosphorylation. We also kept track of where the reaction is occurring within the cell and took note of
examples of important terms like substrate level phosphorylation. This progression of keeping track of
the yields of the specific processes showed the students how the general reaction makes sense in that the
intermediates are used up and the overall reaction is Glucose + oxygen Carbon dioxide + water. And
they realize how it is a lot more complicated than originally proposed. This was a good lesson for them to
learn that I noted in the session in that biology is going to always be more complicated than what you
actually learn originally.

Cool Down:
I gave them very tricky and difficult questions for their cool down
multiple choice. I wanted to make it particularly challenging so to
ensure that they knew the information.

*The following pages is the worksheet for Session 11: Oxidative

Phosphorylation.
 Session 11: Oxidative Respiration
Warm Up:
1. Explain the general, overall process of respiration in a cell and why the knowledge of chemistry is
important for this process. Explain why this is called a catabolic process.

2. How does this relate to redox reactions and thermos dynamics?

3. After we release this energy, we are going to put it into ATP:

Main Activity 1:
So we are going to break down glucose using Oxygen. However, this is a very slow breakdown in the cell that
requires many molecules, enzymes and pathways. Fill in the chart below to show these processes

Main Activity 2:
Electron Carriers show a different form of redox reactions:

Oxidative Phosphorylation compared to Substrate-level Phosphorylation:

Main Activity 3: Glycolysis
This is not how glycolysis
actually works*
Main Activity 4:
What happens to pyruvate after glycolysis?

Main Activity 5: Krebs Cycle

Main Activity 6:

Multiple Choice:
1. Which of the following is not true of oxidative phosphorylation?
a. it uses oxygen as the ultimate electron donor
b. it involves the redox reactions of the electron transport chain
c. it involves an ATP synthase located in the inner mitochondrial membrane
d. it produces three ATP for every NADH that is oxidized

2. Which of the following are true of ATP synthase?

a. It is a channel protein
b. It is a form of active transport
c. It uses potential energy to generate ATP
d. Two of the above are true
e. None of the above

3. Which of the following is true of NADH?

a. It reduces pyruvate
b. It is an oxidizing agent
c. It carries electrons to the transport chain
d. It generates ATP though substrate level phosphorylation

4. Substrate-level phosphorylation
a. involves the shifting of a phosphate group from ATP to a substrate
b. can use NADH or FADH2
c. accounts for all the ATP formed from chemiosmosis
d. takes place both in the cytosol and in the mitochondrial matrix
5. How many molecules of CO2 are generated for each molecule of acetyl CoA introduced into the Krebs
cycle?
a. 2
b. 3
c. 4
d. 6

6. Which kind of metabolic poison would most directly interfere with glycolysis?
a. an agent that reacts with oxygen and depletes its concentration in the cell
b. an agent that binds to pyruvate and inactivates it
c. an agent that closely mimics the structure of glucose but is non-metabolic
d. an agent that reacts with NADH and oxidizes it to NAD+
e. an agent that inhibits the formation of acetyl coenzyme A

7. Which metabolic process is most closely associated with intracellular membranes?

a. substrate level phosphorylation
b. oxidative phosphorylation
c. glycolysis
d. Krebs cycle
e. alcohol fermentation

8. What does chemiosmosis involve?

a. the diffusion of water down an electrochemical gradient that drives ATP synthesis
b. a proton gradient that drives the redox reactions of electron transport
c. a proton-motive force that drives the synthesis of ATP
d. an ATP synthase that pumps protons across the inner mitochondria membrane
e. the uptake of NADH produced in glycolysis into the mitochondrion

9. Overall glucose is
a. Broken down slowly through progressive oxidation
b. Gains energy as it is broken down into CO2
c. Has very low energy bonds between carbons
d. Produces 1 molar equivalent of pyruvate

10. All of the following are final products of the overall process except
a. CO2 from the citric acid cycle
b. 30 or 32 ATP from ATP synthase
c. NADH from Krebs cycle
d. Co-enzyme A from pyruvate entering the mitochondria
e. H2O from the final accepting of e-

11. Which of the following is true of respiration?

a. Protons flow from the mitochondrial space into the intermembrane space
b. The ETC oxidizes NADH and FADH2
c. Pyruvate enters the citric acid cycle
d. I know this stuff
 Exam Reviews
There were exam reviews the day before each exam
to ensure the students knew the material and had any
last minute questions clarified. These reviews were
even more systematic than regular SI session, but
they had a lot of overlap in the questions. The exam
reviews had the hardest questions to really challenge
the students. They primarily consisted of multiple
choice questions. I typically had 5-8 pages of
multiple choice and I allowed the students to work on
them in groups and then we went over them together.
Office Hours:
Office Hours are a great way to give individual attention to students. I always had office hours at a regularly
scheduled time but if a student could not make it to that time, then we would find a time to schedule an
appointment. I could work with the students though a problem they struggled with, go through the notes if they
dont understand a concept or topic or help them with homework. I had a couple students not be able to make
my sessions either on a regular basis or miss one occasionally. One of the success stories of the semester was
with a girl that failed biology 1201 twice was in my class. She could not come to my sessions due to work. We
met every Tuesday for office hours and she passed the class, and it was very reassuring of the effects of office
hours.

Blooms Taxonomy:
Biology is very picture oriented but I often put short answer
questions that made them explain why that answer was the
answer. Almost no teacher or other SI makes the students write
paragraphs but I find that it is extremely helpful in going that
next step to understand the material. This corresponds to the
Blooms Taxonomy that was learned in training. Applying
knowledge by answering these questions is a solid way of
learning material but if a student analyzes and evaluates the
answer then they can have a higher level of mastery of the
material. Getting them to explain why and other approaches like
making them make their own questions is the highest goal of SI.

SI effecting studies:
SI does take up a good bit of time so I needed to stay on top of my studies. Naturally people want to help others
before they help themselves so academics took a backseat several times this semester. But I learned a way to be
successful with my academics and be a successful SI. Several times it expanded my knowledge of a particular
subject and taught me things that I will
learn later in other classes. For example,
the teacher I SI for is an X-ray
crystallographer and talked about it in
class. I then subsequently learned X-ray
crystallography in Biochemistry lab. This
is just one of dozens of crossovers with
other classes.
Tips for Success:
1. Learn how to deal with freshmen I hinted on this at the beginning of the portfolio but dealing with
freshmen in an academic sense is different than second semester sophomores for me. But if you instruct
them and guide them through how to study, I find they are very receptive to your expertise.
2. Be Prepared Not only is this a great Lion King song but also a great approach to SI sessions. Make sure
the worksheet has a flow and that it helps the student truly understand the material. This tip is pretty much
what all the portfolio has said up
to this point.
3. Learn names This tip is really
about being personable with the
students. Listen to them when they
talk. Dont always talk about just
biology but joke around and have
fun. I have a lot of students say
that it is sometimes awkward
going to SI sessions in other subjects because the SI leader is not approachable. They feel like they cant ask
questions and they are almost scared to go. If you can establish a connection and relationship with them, it
will make them excited about the subject and ready to learn.
4. Know the material- Make sure you know what the material is and how to explain it if you need to. If you
dont know the material, then the students will be deterred from coming to another session because it wastes
their time. Also if a student asks a question you dont know the answer to then say I dont know. Do not
make up something because that will result in confusion and distrust.
5. Take advantage of CAS This program can flourish if you
take advantage of the things the CAS provides to you. Take
advantage of the CAS inventory. If you give out prizes, like CAS
shirts, when they win a game you can maximize the efficiency of
learning. Take advantage of the SI drive where others have posted
their worksheets before. This can cut down the extreme workload
you will have first semester and get ideas about the session and
worksheets. Take advantage of the crew of smart people that come
into the office every day. You will get ideas, learn things and
make lasting friendships with very fun people.

Final Reflection:
The semester being a Biology 1201 SI was extremely successful. The students were very receptive to what I had
to say and were always very eager to learn the complicated material. The sessions themselves were the highlight
of the semester. I did have some bumps, like in the genetics sessions. My communication with my professor did
improve from last semester. I worked will with the students and built very solid relationships. Many of my
students will be with me next semester and I am looking forward to working with them. Where I need to
improve most is my encouragement of the students to come to my sessions.