Research Journal of Biotechnology
12 (4) April (2017)
Comparative diversity analysis in advanced breeding
lines of basmati rice (Oryza sativa L.) using
agro-morphological and SSR markers
Sharma Richa1, Salgotra Romesh Kumar1* and Bhat Javaid Akhter2
1. School of Biotechnology, Sher-e-Kashmir University of Agricultural Sciences & Technology of Jammu, Chatha, Jammu, J & K 180009, INDIA
2. Division of Genetics, Indian Agricultural Research Institute, Pusa Campus, New Delhi 110 012, INDIA
*rks_2959@rediffmail.com
Abstract
The basmati rice is natures gift to Indian sub-continent
and is an economic asset to the farmers of North-
western Himalayas. Basmati rice is known to have
narrow genetic base subjected to decreasing yield and
quality deterioration. In this regard, 30 advanced
breeding lines of basmati in F4 generation developed
through the crossing of diverse parents along with
three check varieties are comparatively evaluated for
diversity analysis using both agro-morphological and
SSR markers. Analysis of variance showed that all the
characters except grain breadth were significantly
different (P<0.01) among the genotypes. The first four
principal components (PCs) of the PCA analysis
contributed 78.14% of the variability.
The dendrogram obtained through both agro-
morphological and SSR analysis separated the
genotypes into four major clusters (I, II, III and IV)
each, with the Bray-Curtis distance and Jaccards
similarity coefficient ranging from 0.83-1.00 and 0.38-
0.92 respectively. Out of 36 SSR markers tested, only
14 primer pairs were found polymorphic and a total of
31 alleles were detected with an average of 2.2 alleles
per locus. The Mantel test revealed a significant
correlation (r = 0.24, p<0.01) between the agro-
morphological and SSR matrices. Both methods result
in diverse clustering of genotypes largely based on
their pedigree and origin, suggesting considerable
diversity among the studied genotypes. Hence, both
methods proved effective for the diversity analysis of
basmati rice and their combined study provides useful
information.
Keywords: Genetic diversity, agro-morphological, SSR
markers, basmati rice, cluster analysis.
Introduction
Rice (Oryza sativa L.) is a cereal food crop that belongs to
family Poaceae having chromosome number 2n = 24 under
the class Monocotyledon. It is life for more than half of
world population including most people living in Asia and
has shaped the cultures, diets and economies of thousands of
millions of people. By considering the importance of rice in
providing food security and poverty eradication, the 57th
85
Vol.
Res. J. Biotech
session of the United Nations General Assembly declared
the year 2004 as the International Year of Rice1. Basmati rice
distinguished itself as a result of natural and human selection
is a unique varietal group which found wider acceptance all
over the world as a specialty rice. It is blessed with
characteristics of extra-long slender grain, lengthwise
excessive elongation on cooking, soft and fluffy texture of
cooked rice and pleasant aroma which together determine
the uniqueness of basmati rice2.
The unique quality traits of basmati rice found their
expression only when they are grown in the north-western
foot hills of the Himalayas in the Indian subcontinent
comprising the states of Haryana, Punjab, Uttaranchal,
Western Uttar Pradesh, Jammu and Kashmir, Himachal
Pradesh and Delhi. And, because of its geographic specific
manifestation of quality features, basmati is now a
Geographical Indication (GI) belonging to a specific
geographical area in the Indian subcontinent.
The basmati rice is known to possess narrow genetic base,
intensified by modern plant breeding practices that resulted
in the loss of genetic diversity and subjected the crop to
genetic erosion as well as vulnerable to various biotic and
abiotic stresses. Hence, it necessitates the introduction of
diverse parents in the basmati breeding programme through
hybridization between diverse parents and subsequent
selection of transgressive segregants for yield and quality
traits. The choice of parents is the initial step in plant
breeding and directly benefits transgressive segregation
which is considered to be high by the parents that are
distantly related4. The diverse parents are observed to give
progeny with higher heterosis5,6.
Thus, genetic diversity estimation of crop species determines
its potential for improved efficiency and its use for breeding
which inevitably prompted increased food production. The
morphological traits have been used to assess genetic
diversity of rice genotypes in number of earlier studies.7-9
Among the variety of molecular markers available for
varietal identification and genetic characterization, simple
sequence repeats (SSRs) are the marker of choice being co-
dominant, multiple allelic, simple, reproducible and reliable
in nature. These markers have been used for studying the
genetic relationship in rice10-12 and many other crops
including Indian mustard14, faba bean15, soybean16 etc.
The combined analysis through morphological and
molecular marker is the best option to characterize
Research Journal of Biotechnology
germplasm giving an opportunity to comparatively analyze
the phenotypes from field experiments with molecular
phenotypes and genotypes from laboratory studies.
Comparison of different methods in genetic studies provides
researchers and plant breeders with more information in the
screening and selection process. Keeping this in view, the
present study is undertaken to estimate the genetic
divergence of 30 advanced breeding lines and three check
varieties of basmati using a combination of morphological
and SSR markers which will allow us to study the relative
efficacy of these two methods in cultivar differentiation as
well as identification of diverse genotypes that can be
utilized in creating valuable selectable variation.
Material and Methods
Plant material and experimental site: Thirty advanced
breeding lines of basmati in F4 generation developed through
crossing of different parents and three check varieties of
basmati rice provided by IIRI Hyderabad, IARI New Delhi
and SKUAST-J were cultivated at the Research Farm of
School of Biotechnology, Faculty of Agriculture, Sher-e-
Kashmir University of Agricultural Sciences and
Technology of Jammu, Chatha, Jammu, Jammu and
Kashmir, India during Kharif 2014 (Table 1). The detailed
information about the name, pedigree and source of
genotypes is given in table 1. The experimental site is
situated at an altitude of 332 m above mean sea level with
320 39 N latitude and 740 58 E longitudes with an annual
rainfall of 1000 mm and represents sub-tropical conditions.
Morphological characterization: The data on twelve agro-
morphological and quality traits are recorded from five
randomly selected representative plants in all the genotypes
in each replication. The standard method of DUS test
(Distinctiveness, Uniformity and Stability, Govt. of India)
was used for recording observation for each of the character
which includes plant height, days to 50% flowering, days to
maturity, effective tillers per plant, panicle length, 1000-
grain weight, spikelet fertility (%), yield per plant, grain
length, grain breadth, length-breadth ratio (L/B) and
amylose content (Biodiversity protocols:
www.bioversity.org). The mean values of the data obtained
were used for the various statistical analyses.
DNA extraction and SSR analysis: Total genomic DNA
was isolated from two-gram fresh leaf sample of each
genotype using CTAB method17. Quantification of DNA
samples was done by using Nanodrop (mySPEC, Scientific
GmbH, Germany) and quality was estimated by using 0.8 %
agarose gel electrophoresis. High concentration of DNA
samples was further diluted in 10:1 Tris-EDTA to a working
concentration of 50ng/l and stored at 40C for PCR based
marker analysis. A total of 36 pairs of SSR primers flanking
the microsatellite region previously developed and
published by McCouch et al18 were selected. After testing
the 36 primers, a total of 14 primers were found polymorphic
and used for further analysis. Detailed description of the
primers is available at www.gramene.org/markers/microsat/.
86
Vol. 12 (4) April (2017)
Res. J. Biotech
PCR reaction was prepared with 50 ng of rice genomic
DNA, 0.2 g of 3 and 5 end primers, 200 mM of each
dNTP, 1X PCR buffer containing 50 mM KCL, 10 mM Tris
HCl (pH8.9), 2.0 mM MgCl2 and one unit of Taq Polymerase
in a total of 25 L solution individually for all 14 primer
pairs. PCR thermal cycler was programmed for 1 min at 94
C, 1 min and 30 seconds at 55C, 1 min at 72C and a final
cycle of 10 min at 72C. Amplification product was
separated on 3.5% of agarose gel in 1X TBE buffer followed
by staining with ethidium bromide.
Data analysis: Analysis of variance was performed for all
agro-morphological and quality traits in order to test the
significance of variation among the genotypes using SPSS
16.0 software. Cluster analysis was done to yield a
dendrogram depicting the morphological relatedness of the
basmati rice genotypes. Principal component analysis (PCA)
was also used to detect underlying sources of morphological
variability and to investigate patterns of genetic diversity19.
Bray-Curtis distances and UPGMA (Unweighted pair group
method with arithmetic mean) in the clustering method and
all these analyses were done using the PAST software20.
For SSR data, the presence or absence of the band was
scored as 1 or 0 respectively. In order to determine the utility
of the SSR markers, number of alleles per marker,
Polymorphic Information Content (PIC), Resolving Power
(Rp) and Marker Index (MI) were calculated. Polymorphism
Information Content (PIC) values of individual primers were
calculated based on the formula PIC= 1- ni=1 P2ij21. Marker
Index, a product of information content, as measured by PIC
and Effective Multiplex Ratio (E), was calculated22.
Resolving Power (RP) of each primer combination was
calculated according to Wilkinson and Prevost23. The
Jaccards similarity index was calculated using NTSYS-pc
version 2.02e (Applied Bio-Statistics, Inc., Setauket, NY,
USA) package to compute pair wise Jaccards similarity
coefficients24 and this similarity matrix was used in cluster
analysis using an unweighted pair-group method with
arithmetic averages (UPGMA) and sequential,
agglomerative, hierarchical and nested (SAHN) clustering
algorithm to obtain a dendrogram.
Comparison between agro-morphological and SSR data was
performed by calculating the correlation between the agro-
morphological and SSR similarity matrices through mantel
test25 with 1000 permutations using XLSTAT software.
Results
Agro-morphological analysis: The analysis of variance
showed that mean squares due to genotypes were highly
significant ( 0.01) for all characters except grain breadth
which revealed non-significant variation (Table 2). Principle
component analysis (PCA) of the agro-morphological traits
showed that the first four principal components together
accounted for 78.14% of the total phenotypic variation
(Table 3; Fig. 1). The first principal component (PC1)
accounted for 36.31% of total variance and characters that
Research Journal of Biotechnology
contribute more positively to this component were days to
50% flowering, days to maturity and grain breadth. The
second component (PC2), which featured plant height,
panicle length and amylose content as the principal traits,
explained an additional 18.74% of the phenotypic variation.
Finally, third and fourth principal component (PC3 and PC4)
contributed around 13.68% and 9.40% respectively of the
variability present among the accessions for the traits used
in the present study. The PC3 explained the patterns of
variation in effective tillers per plant, 1000-grain weight,
grain yield per plant, grain length and L/B ratio and for PC4
the maximum variation is contributed by spikelet fertility.
The dendrogram obtained using phenotypic characters
separated the genotypes into four major clusters (I, II, III and
IV) consisting of 2, 24, 4 and 3 genotypes respectively with
Bray-Curtis distance ranging from 0.83 to 1.00 (Fig. 2). The
cluster I, II and III comprised of advanced breeding lines
while cluster IV consists of three check varieties viz. Pusa
Basmati 1, Pusa 1121 and Basmati 370.
Molecular marker analysis: All the 33 basmati rice
accessions were genotyped with 14 polymorphic SSR
markers and are selected for their ability to produce
amplified product at optimum concentration, polymorphism
level among the genotypes and consistency of the pattern.
Total 31 alleles were scored from these primer pairs and 100
percent were found polymorphic. The gel picture showing a
banding pattern of 33 genotypes of basmati rice with
RM2256 marker is presented in fig. 3. The respective values
of overall genetic variability for Polymorphism Information
Content (PIC), Resolving Power (Rp), Number of alleles per
locus and Marker Index (MI) across all the 33 genotypes are
given in table 4. Highest PIC value (0.59) was observed for
the primer RM1 and lowest PIC value (0.10) was recorded
for the primer RM520 (Table 4), with an average 0.39. The
MI values ranged from 1.77 to 0.20 with an average of 0.87.
Fig. 1: Scree plot of principal component analysis (PCA) showing the contribution of each principal
component (PC) to the total variance.
87
Vol. 12 (4) April (2017)
Res. J. Biotech
The RP is a feature of marker that indicates the
discriminatory potential of the primer and ranged from 1.51
to 0.22 with an average of 0.98. The allele number per locus
varied from 2 to 3 with an average of 2.2 alleles per locus
(Table 4). The SSR data were also subjected to genetic
cluster analysis to further elucidate the relationship among
the genotypes and the dendrogram generated through
UPGMA analysis has been presented in fig. 4 which also
grouped all genotypes into four major clusters I, II, III and
IV comprising of 1, 3, 26 and 3 respectively with Jaccards
similarity coefficient ranging from 0.38 to 0.92. Cluster I
consist of single check variety (Basmati 370) while cluster
III and IV comprise mostly advanced breeding lines except
each check varieties Pusa 1121 and Pusa Basmati 1
respectively in these respective groups. The cluster II
includes advanced breeding lines only (Fig. 4).
Comparison of agro-morphological and SSR markers:
The mantel test showed significant correlation (r = 0.24,
p<0.001) between the agro-morphological and SSR data.
Both methods allow separation of advanced basmati
breeding lines in four major clusters each. Despite the
significant correlation between agro-morphological and SSR
matrices, there were some discrepancies between the two
dendrograms. For instance, the three check varieties which
are morphological clustered in cluster IV were grouped into
three separate clusters (I, III and IV) in SSR analysis.
Similarly, genotypes that appeared similar in SSR analysis
had different morphological characters and are clustered in
different groups. An example of these genotypes included
Pusa Basmati 1, CSR36/IRGC4105//PUSA 1609 and CST-
7-1/IRGC11010//PUSA-44 which were grouped together in
cluster IV through SSR analysis (Fig. 4), but they exhibited
different morphological characters as indicated by their
grouping into three different morphological clusters viz. I, II
and IV (Fig. 2). Also, the range of agro-morphological data
based genetic distance between pairs of genotypes was
narrow (0.83-1.00) as compared to that of SSR based data
(0.38-0.92).
Research Journal of Biotechnology Vol. 12 (4) April (2017)
Res. J. Biotech
Table 1
List of advanced breeding lines used in the study along with their name and source of genotypes.
S. N. Genotypes Source
1. Pusa Basmati 1 IARI, Pusa, New Delhi
2. Pusa 1121 IARI, Pusa, New Delhi
3. Basmati 370 SKUAST-Jammu
4. CSR36/IRGC4105//PUSA 1601 IIRR, Hyderabad
5. CSR36/IRGC4105//PUSA 1609 IIRR, Hyderabad
6. CSR36/IRGC4105//PUSA 44 IIRR, Hyderabad
7. CSR36/IRGC25966//PUSA 1601 IIRR, Hyderabad
8. CSR36/IRGC69708//PUSA 1601 IIRR, Hyderabad
9. CSR36/IRGC69861//PUSA1601 IIRR, Hyderabad
10. CSR36/IRGC77840//PUSA 44 IIRR, Hyderabad
11. CSR36/IRGC1723//PUSA1601 IIRR, Hyderabad
12. CSR36/IRGC1723//PUSA1609 IIRR, Hyderabad
13. CST7-1/IRGC18196//PUSA1609 IIRR, Hyderabad
14. CST7-1/IRGC1819//PUSA1601 IIRR, Hyderabad
15. CST7-1/IRGC11010//PUSA1601 IIRR, Hyderabad
16. CST-7-1/IRGC69861//PUSA-1601 IIRR, Hyderabad
17. CST-7-1/IRGC11010//PUSA-44 IIRR, Hyderabad
18. CSR-36/IRGC69708//PUSA-44 IIRR, Hyderabad
19. CST-7-1/IRGC69861//PUSA-44 IIRR, Hyderabad
20. CSR-36/IRGC11010//PUSA-1601 IIRR, Hyderabad
21. CSR-36/IRGC11010//PUSA-1609 IIRR, Hyderabad
22. CSR-36/IRGC25966//PUSA-1609 IIRR, Hyderabad
23. CSR-36/IRGC25966//BT-2409 IIRR, Hyderabad
24. CSR-36/IRGC25966//BT-2410 IIRR, Hyderabad
25. CSR-36/IRGC11010//BT-2410 IIRR, Hyderabad
26. SWARNA/IRGC50531//BT-2409 IIRR, Hyderabad
27. CST-7-1/IRGC11010//BT-2409 IIRR, Hyderabad
28. CST-7-1/IRGC11010//BT-2410 IIRR, Hyderabad
29. CSR-36/IRGC1739//BT-2410 IIRR, Hyderabad
30. CSR-36/IRGC11010//BT-2410 IIRR, Hyderabad
31. CSR-36/IRGC25966//BT-2410 IIRR, Hyderabad
32. CSR-36/IRGC25966//BT-2409 IIRR, Hyderabad
33. CST-7-1/IRGC69862//BT-2409 IIRR, Hyderabad

Table 2
Analysis of variance and estimates of mean for twelve agro-morphological and
quality traits of advanced breeding lines.
Source of df Plant Days to Days to Panicle Effective Spikelet 1000- Yield Grain Grain L/B Amylose
variation height 50% maturity length tiller per fertility grain per length breadth ratio content
(cm) flowering (days) (cm) plant (%) weight plant (cm) (cm) (%)
(days) (nos.) (g) (g)
Genotype 32 1773.2 239.1** 306.77** 48.13* 9.89** 164.46* 63.15* 20.41 1.61** 2.33NS 0.38* 7.82**
7** * * * ** *
Error 64 1.97 9.23 16.77 0.59 3.27 3.92 2.75 0.19 0.06 2.28 0.14 0.87
CD(5%) 2.29 4.97 6.69 1.26 2.96 3.23 2.71 0.72 0.39 NS 0.61 1.53
Mean(X 111.2 91.843.2 119.682. 23.83 8.185.03 74.632. 25.83 13.62 7.733. 2.4478. 3.77 24.197.
SEm) 1.58 1 88 3.26 67 6.31 3.27 05 26 9.70 45
*, ** significant at 5% and 1% level, respectively, NS = non-significant

88
Research Journal of Biotechnology Vol. 12 (4) April (2017)
Res. J. Biotech
Table 3
Eigenvectors, Eigen values, total and cumulative variability (%) for 33 basmati genotypes
based on twelve agro-morphological and quality traits.
Principal component (axes) PC1 PC2 PC3 PC4
Eigen value 4.358 2.248 1.641 1.128
Variability (%) 36.318 18.741 13.682 9.403
Cumulative (%) 36.318 55.059 68.741 78.144
Traits Eigen vectors
Plant height (cm) 0.292 0.421 -0.233 0.209
Days to 50% flowering (days) 0.409 0.125 0.222 0.068
Days to maturity (days) 0.411 0.192 0.215 0.001
Panicle length (cm) -0.063 0.506 -0.406 -0.029
Effective tillers/plant 0.277 -0.374 0.337 0.195
Spikelet fertility (%) 0.289 -0.098 -0.176 0.456
1000 grain weight (g) -0.225 0.347 0.440 0.266
Grain yield per plant (g) 0.190 0.011 0.304 -0.613
Grain length (mm) -0.435 0.070 0.163 -0.081
Grain breadth (mm) 0.194 0.118 0.157 0.075
Length / breadth (L/B) ratio -0.210 0.363 0.450 0.224
Amylose content (%) 0.233 0.304 -0.015 -0.442

I II III IV

Fig. 2: Dendrogram based on agro-morphological traits showing four clusters (I, II, III and IV) of 33 basmati rice
genotypes using UPGAMA method and Bray-Curtis distance.

89
Research Journal of Biotechnology Vol. 12 (4) April (2017)
Res. J. Biotech
Table 4
List of markers used, forward and reverse primer sequence, chromosome number, number of alleles, resolving power
(RP), PIC values and marker index (MI).
S. N. Primer Sequence 5 3 Chromosome Number Resolving PIC MI
number of alleles power value

1 RM -1 F GCGAAAACACAATGCAAAAA 1 3 1.22 0.59 1.77

R GCGTTGGTTGGACCTGAC
2 RM-16 F CGCTAGGGCAGCATCTAAA 5 2 0.22 0.15 0.30
R AACACAGCAGGTACGCGC
3 RM-20 F ATCTTGTCCCTGCAGGTCAT 11 2 1.51 0.57 1.14
R GAAACAGAGGCACATTTCATT
G
4 RM- F CTCGTTTATTACCTACAGTAC 9 2 1.04 0.41 0.82
201 C
R CTACCTCCTTTCTAGACCGAT
A
5 RM- F CCCATGCGTTTAACTATTCT 11 2 0.98 0.43 0.86
206 R GTTCCATCGATCCGTATGG
6 RM- F CCACTTTCAGCTACTACCAG 1 3 1.21 0.58 1.74
212 R CACCCATTTGTCTCTCATTAT
G
7 RM- F CTGGCCATTAGTCCTTGG 10 2 1.15 0.49 0.98
228 R GCTTGCGGCTCTGCTTAC
8 RM- F TTCGCTGACGTGATAGGTTG 4 2 0.57 0.19 0.38
252 R ATGACTTGATCCCGAGAACG
9 RM- F GAAGCCGTCGTGAAGTTACC 4 2 1.33 0.42 0.84
273 R GTTTCCTACCTGATCGCGAC
10 RM- F TTCCATGGCACACAAGCC 5 2 0.62 0.25 0.50
289 R CTGTGCACGAACTTCCAAAG
11 RM- F TCATGTCATCTACCATCACAC 1 3 0.71 0.51 1.53
302 R TCATGTCATCTACCATCACAC
12 RM- F ACACCAACTCTTGCCTGCAT 3 2 0.92 0.19 0.38
411 R TGAAGCAAAAACATGGCTAG
G
13 RM- F AGGAGCAAGAAAAGTTCCCC 3 2 0.45 0.10 0.20
520 R GCCAATGTGTGACGCAATAG
14 RM- F GTGCTTGCATATAACCTATA 7 2 1.04 0.38 0.76
2256 R AGATCAACCTTCTTATTCAG
Averag 2.2 0.98 0.39 0.87
e

Fig. 3: Gel picture showing banding pattern in 33 basmati genotypes with RM2256 marker.
90
Research Journal of Biotechnology
Fig. 4: UPGMA dendrogram based on SSR data showing four clusters (I, II, III and IV)
of 33 basmati genotypes of rice.
Discussion
The Indian basmati rice is known to have narrow genetic
diversity and efforts are being made to create genetic
variability through hybridization. In this regard, 30 advanced
breeding lines of basmati developed by crossing of diverse
parents present in F4 generation along with three check
varieties of basmati are characterized using both agro-
morphological and molecular markers. The aim of our study
was to identify the divergent breeding lines that will be
subsequently used in convergent breeding to identify more
transgressive segregants for yield and quality traits of
basmati. The genetic diversity estimates are often biased by
the choice of data viz. phenotypic and molecular marker.
Therefore, in the current study both types of data have been
used to measure unbiased diversity estimation.
In the present study, all the agro-morphological traits except
grain breadth revealed significant ( 0.01) variations
indicating the presence of sufficient amount of genetic
variability among the breeding lines for all the traits. In rice,
significant variations were also reported earlier by other
researchers for various morphological traits.26-28 PCA is an
effective technique giving information about traits that are
more important for the breeder to conduct specific breeding
programs.29 In our study, first four PCs explained 78.14
91
Vol. 12 (4) April (2017)
Res. J. Biotech
IV
III
II
I
percent of variation among 33 basmati genotypes and these
results were supported by the earlier findings7,30-32 who
studied rice genotypes of India, Malaysia, Pakistan and
Benin respectively.
The morphological cluster analysis divided the 33 basmati
genotypes into four clusters with all the advanced breeding
lines clustered into cluster I, II and III and check varieties
into separate cluster IV. The morphological clustering of
breeding lines is to some extent in good agreement with their
pedigree. For example, two breeding lines (numbers 4 and
5) having similar pedigree are morphologically grouped into
same cluster IV and in contrast the breeding lines (numbers
8 and 9) which also possess similar pedigree are clustered
into separate cluster II and III respectively. This indicates
that some breeding lines cannot be discriminated clearly
based on morphological characteristics alone, as
morphological characteristics can easily be affected by the
environment.
In this study, a total of 31 alleles were detected by 14
polymorphic SSR markers among 33 basmati genotypes
with an average number of 2.2 alleles per locus and average
PIC value of 0.39 which was also observed in rice by Singh
et al33 and Shah et al34. The UPGAMA analysis based on
Research Journal of Biotechnology
SSR data also divided the genotypes into four major clusters
I, II, III and IV. The three check varieties do not form
separate cluster as in morphological analysis and are
clustered together with advanced breeding lines in cluster III
and IV whereas check variety Basmati 370 is grouped in
separate cluster I. It is because SSR provided more
information than morphological analysis distinguishing
some genotypes that are not morphologically distinguished.
The Mantel test revealed a significant correlation between
the agro-morphological and SSR matrices (r = 0.24,
p<0.001) of the 33 basmati genotypes also reported in rice
by other authors.35-37 The significant correlations indicate
that these two independent sets of data likely reflect the same
pattern of genetic diversity and validate the use of these
methods for diversity estimation and also in grouping of
genotypes. These results also indicate that the combination
of morphological and molecular markers may be useful in
studying genetic diversity as reported by Cortese et al38. The
few discrepancies in dendrogram clustering by two data sets
may be due to the influence of environment and cultural
practices on phenotypic expression of traits. The clustering
through both methods was largely based on the pedigree and
origin of genotypes.
Hence the present study showed that both morphological and
molecular analysis result in the diverse clustering of 33
breeding lines with the latter showing more diversity among
the studied genotypes as compared to morphological
analysis as indicated by similarity coefficient distribution.
Therefore, it is evident that the studied breeding lines
possess fair amount of genetic diversity and the diverse lines
identified can be effectively utilized in hybridization for
convergent improvement to identify transgressive
segregants for higher grain yield and quality traits in basmati
rice. In conclusion, both agro-morphological and SSR
markers proved to be useful in genetic diversity analysis of
basmati rice.
References
1. Gnanamanickam S.S., Rice and its importance to human life,
Biological Control of Rice Diseases, 8, 1-11 (2009)
2. Nagaraju J., Kathirvel M., Kumar R.R., Siddiq E.A. and Hasnain
S.E., Genetic analysis of traditional and evolved Basmati and non-
Basmati rice varieties by using fluorescence-based ISSR-PCR and
SSR markers, PNAS, 99, 5836-5841 (2002)
3. Siddiq E.A., Vemireddy L.R. and Nagaraju J., Basmati rices:
genetics, breeding and trade, Agric Res, 1, 25-36 (2012)
4. Joshi B.K., Mudwari A., Bhatta M.R. and Ferrara G.O., Genetic
diversity in Nepalese wheat cultivars based on agro morphological
traits and coefficients of parentage, Nepal Agric Res J, 5, 7-17
(2004)
5. Joshi A.B. and Dhawan N.L., Genetic improvement of yield with
special reference to self-fertilizing crops, Ind. J Genet Plant Breed,
26, 101-113 (1966)
92
Vol. 12 (4) April (2017)
Res. J. Biotech
6. Anand I.J. and Murrty B.R., Genetic divergence and hybrid
performance in linseed, Ind. J Genet Plant Breed, 28, 178-185
(1968)
7. Sinha A.K. and Mishra P.K., Agromorphological
characterization and morphology based genetic diversity analysis
of landraces of rice variety (Oryza sative) of Bankura district of
West Bengal, Int J Curr Res, 5, 2764-2769 (2013)
8. Rabara R.C., Ferrer M.C., Diaz C.L., Newingham M.C.V. and
Romero G.O., Phenotypic Diversity of Farmers Traditional Rice
Varieties in the Philippines, Agronomy, 4, 217-241 (2014)
9. Hien N.L., Sarhadi W.A., Oikawa Y. and Hirata Y., Genetic
diversity of morphological responses and the relationships among
Asia aromatic rice (Oryza sativa L.) cultivars, Tropics, 16, 343-
355 (2007)
10. Yadav S., Singh A., Singh M.R., Goel N., Vinod K.K.,
Mohapatra T. and Singh A.K., Assessment of genetic diversity in
Indian rice germplasm (Oryza sativa L.): use of random versus
trait-linked microsatellite markers, J Genet, 92, 545-557 (2013)
11. Pachauri V., Taneja N., Vikram P., Singh N.K. and Singh S.,
Molecular and morphological characterization of Indian farmers
rice varieties (Oryza sativa L.), Aust J Crop Sci, 7, 923 (2013)
12. Kunusoth K., Vadivel K., Sundaram R.M., Sultana R.,
Rajendra Kumar P., Maganti S., Subbarao L.V. and Chin-wo S.R.,
Assessment of Genetic Diversity of Elite Indian Rice Varieties
Using Agro-Morphological Traits and SSR Markers, Amer J Exp
Agric, 6, 384 (2015)
13. Arora A., Kundu S., Dilbaghi N., Sharma I. and Tiwari R.,
Population structure and genetic diversity among Indian wheat
varieties using microsatellite (SSR) markers, Aust J Crop Sci, 8,
1281-1289 (2014)
14. Thakur A.K., Singh K.H., Singh L., Nanjundan J., Rana M.K.
and Singh D., Transferability of SSR markers of Brassica species
to some popular varieties of Brassica juncea, Proc Natl Acad Sci,
India, Sect B Biol Sci, 85, 1001-1010 (2015)
15. Abid G., Mingeot D., Udupa S.M., Muhovski Y., Watillon B.,
Sassi K., MHamdi M., Souissi F., Mannai K., Barhoumi F. and
Jebara M., Genetic relationship and diversity analysis of faba bean
(Vicia faba L. var. Minor) genetic resources using morphological
and microsatellite molecular markers, Plant Mol Biol Rep, 33,
1755-1767 (2015)
16. Bisen A., Khare D., Nair P. and Tripathi N., SSR analysis of
38 genotypes of soybean (Glycine max (L.) Merr.) genetic
diversity in India, Physiol Mol Bio Plants, 21, 109-115 (2015)
17. Doyle J.J. and Doyle J.L., Isolation of plant DNA from fresh
tissue, BRL Focus, 12, 13-15 (1990)
18. Mccouch S.R., Teytelman L., Xu Y., Lobos K.B., Clare K.,
Walton M. and Stein L., Development and mapping of 2240 new
SSR markers for rice (Oryza sativa L.), DNA Res, 9, 199-207
(2002)
Research Journal of Biotechnology
19. Mohammadi S.A. and Prasanna B.M., Analysis of genetic
diversity in crop plants - salient statistical tools and considerations,
Crop Sci, 43, 1235-1248 (2003)
20. Hammer Q., Harper D.A.T. and Ryan P.D., PAST:
paleontological statistics software package for education and data
analysis, http://palaeo-electronica.org/2001_1/past/issue1_01.htm,
Accessed Aug. 20, 2009 (2001)
21. Anderson J.A., Churchill J.E., Autrique S.D., Tanksley S. and
Sorrells M.E., Optimizing parental selection for genetic linkage
maps, Genome, 36, 181-188 (1997)
22. Powell W., Marchray G.C. and Provan J., Polymorphism
revealed by simple sequence repeats, Trends Plant Sci, 1, 215-222
(1996)
23. Wilkinson M.J. and Prevost A., A new system of comparing
PCR primers applied to ISSR fingerprinting of potato cultivars,
Theor Appl Genet, 98, 107-112 (1999)
24. Jaccard P., Nouvelles recherches sur la distribution florale, Bull
Soc Vaud Sci Nat, 44, 223-270 (1980)
25. Mantel N., The detection of disease clustering and a
generalized regression approach, Cancer Res, 27, 209-220 (1967)
26. Nascimento W.F.D., Silva E.F.D. and Veasey E.A., Agro-
morphological characterization of upland rice accessions, Sci
Agric, 68, 652-660 (2011)
27. Allam C.R., Jaiswal H.K. and Qamar A., Divergence analysis
for yield and quality traits in some indigenous basmati rice
genotypes (Oryza sativa L.), IJABPT, 5, 257-263 (2014)
28. Sarwar G., Hossain M.S., Harun-ur-rashid M. and Parveen S.,
Assessment of Genetic Variability for Agro-Morphological
Important Traits in Aman Rice (Oryza Sativa L.), IJASBT, 3, 73-
79 (2015)
29. Salimi S., Lahiji H.S., Abadi G.M., Salimi S. and Moradi S.,
Genetic diversity in soybean genotypes under drought stress
condition using factor analysis and cluster analysis, Word Appl Sci
J, 16, 474-478 (2012)
93
Vol. 12 (4) April (2017)
Res. J. Biotech
30. Sohrabi M., Rafii M.Y., Hanafi M.M., Sitinorakmar A. and
Latif M.A., Genetic diversity of upland rice germplasm in
Malaysia based on quantitative traits, Scientific World J,
doi:10.1100/2012/416291 (2012)
31. Bibi A., Abbasi F.M., Rabbani M.A. and Bibi K., Genetic
diversity assessment of indigenous rice germplasm from Northern
Pakistan using agro morphometric traits, Pak J Bot, 47, 1061-1067
(2015)
32. Moukoumbi Y.D., Sie M., Vodouhe R., Ndri B., Toulou B.,
Ogunbayo S.A. and Ahanchede A., Assessing phenotypic diversity
of interspecific rice varieties using agro-morphological
characterization, J Plant Breed Crop Sci, 3, 74-86 (2011)
33. Singh N., Choudhury D.R., Singh A.K., Kumar S., Srinivasan
K., Tyagi R.K., Singh N.K. and Singh R., Comparison of SSR and
SNP Markers in Estimation of Genetic Diversity and Population
Structure of Indian Rice Varieties, PLoSOne, 8(12), e84136 (2013)
34. Shah S.M., Naveed S.A. and Arif M., Genetic diversity in
basmati and non-basmati rice varieties based on microsatellite
markers, Pak J Bot, 45, 423-431 (2013)
35. Beyene Y., Botha A.M. and Myburg A.A., A comparative
study of molecular and morphological methods of describing
genetic relationships in traditional Ethiopian highland maize, Afr J
Biotechnol, 4, 586-595 (2005)
36. Pfrender M.E., Spitze K., Hicks J., Morgan K., Latta L. and
Lynch M., Lack of concordance between genetic diversity
estimates at the molecular and quantitative-trait levels, Conserv
Genet, 1, 263-269 (2000)
37. Ghalmi N., Malice M., Jacquemin J.M., Ounane S.M.,
Mekliche L. and Baudoin J.P., Morphological and molecular
diversity within Algerian cowpea (Vigna unguiculata L.)
landraces, Genet Resour Crop Evol, 57, 371-386 (2010)
38. Cortese L., Honig J., Miller C. and Bonos S., Genetic diversity
of twelve switchgrass populations using molecular and
morphological markers, Bio Energy Res, 3, 262-271 (2010).
(Received 03rd October 2016, accepted 26th November 2016)