Volume 50(8): 10051011, 2002

The Journal of Histochemistry & Cytochemistry

http://www.jhc.org

R A P I D C O M M U N I C A T I ON

DNA Extraction from Archival Formalin-fixed,

Paraffin-embedded Tissue Sections Based on the Antigen
Retrieval Principle: Heating Under the Influence of pH

Shan-Rong Shi, Richard J. Cote, Lin Wu, Cheng Liu, Ram Datar, Yan Shi, Dongxin Liu,
Hyoeun Lim, and Clive R. Taylor
Department of Pathology, University of Southern California Keck School of Medicine, Los Angeles, California
(SRS,RJC,CL,RD,YS,DL,HL,CRT), and Department of Human Genetics, Roche Molecular Systems, Inc., Alameda, California (LW)

SUMMARY During the course of diagnostic surgical pathology, pathologists have estab-
lished a large collection of formalin-fixed, paraffin-embedded tissues that form invaluable
resources for translational studies of cancer and a variety of other diseases. Accessibility of
macromolecules in the fixed tissue specimens is a critical issue as exemplified by heat-
induced antigen retrieval (AR) immunohistochemical (IHC) staining. On the basis of obser-
vations that heating may also enhance in situ hybridization (ISH) and the similarity of for-
malin-induced chemical modifications that occur in protein and in DNA, we designed a
study to examine the efficiency of DNA extraction from archival formalin-fixed, paraffin-
embedded tissues using an adaptation of the basic principles of the AR technique, i.e.,
heating the tissue under the influence of different pH values. Archival paraffin blocks of
lymph nodes, tonsil, and colon were randomly selected. Each paraffin block was prepared
in 34 microtubes. For each paraffin block, one tube was used as a control sample, using a
non-heating DNA extraction protocol. The other 33 tubes were tested using a heating pro-
tocol under 11 variable pH values (pH 2 to 12) under three different heating conditions (80,
100, and 120C). Evaluation of the results of DNA extraction was carried out by measuring
yields by photometry and PCR amplification, as well as kinetic thermocycling (KTC)-PCR
methods. In general, lower pH (acid) solutions gave inferior results to solutions at higher
pH (alkaline). Heating tissues at a higher temperature and at pH 69 gave higher yields of
DNA. There appeared to be a peak in terms of highest efficiency of extracted DNA at
around pH 9. The average ratios 260:280 of extracted DNA also showed better values for
samples heated at 120C. PCR products of three primers showed satisfactory results for DNA
extracted from archival paraffin-embedded tissues by heating protocols at pH 612, with
results that were comparable to the control sample subjected to the standard non-heating,
enzymatic DNA extraction method. This study is the first to document the use of heating at KEY WORDS
an alkaline pH for DNA extraction from archival formalin-fixed, paraffin-embedded tissues, antigen retrieval
a recommendation based on the principles of AR for protein IHC. These findings may lead DNA extraction
to a more effective protocol for DNA extraction from archival paraffin-embedded tissues and formalin-fixed,
may also provide enhanced understanding of changes that occur during formalin-induced paraffin-embedded tissue
modification of nucleic acids. (J Histochem Cytochem 50:10051011, 2002) PCR

Correspondence to: Clive R. Taylor, MD, PhD, Dept. of Pathol-
ogy, U. of Southern California School of Medicine, HMR 204, 2011
Zonal Avenue, Los Angeles, CA 90033. E-mail: taylor@pathfinder.
hsc.usc.edu
Received for publication March 29, 2002; accepted April 3,
2002 (2C5779).
Formalin has been used as a fixative in pathology for
more than a hundred years. The criteria employed by
pathologists for the diagnosis of many diseases have
been established in formalin-fixed, paraffin-embedded
tissue sections stained with hematoxylin and eosin.

The Histochemical Society, Inc. 0022-1554/02/$3.30 1005

Downloaded from jhc.sagepub.com by guest on July 12, 2016

1006
During more than a century of diagnostic practice, a
large number of archival paraffin-embedded tissue
banks have been established worldwide. These tissue
banks form invaluable resources of tissues for transla-
tional studies of cancer and various other diseases. Ac-
cessibility of macromolecules in the fixed tissue speci-
mens is a critical issue, as exemplified by the growth
of immunohistochemical (IHC) methods for the dem-
onstration of protein antigens (Taylor 1994,1996). A
simple and effective antigen retrieval (AR) technique
of boiling archival paraffin-embedded tissue sections
in water was shown to dramatically enhance the IHC
signal, in part circumventing the deleterious effects of
formalin fixation. The AR method has emerged as the
standard approach for pathologists attempting to
apply IHC staining to archival paraffin sections for
daily clinical practice or research (Shi et al. 1991).
Successful application of this heat-induced AR method
led to publication of many articles related to AR-IHC
(Shi et al. 2000a,2001b).
We developed the hypothesis that there may be
analogies between retrieval of proteins for IHC
and extraction of nucleic acids from archival paraffin-
embedded tissue sections. Extraction of DNA from ar-
chival formalin-fixed, paraffin-embedded tissue was
accomplished as early as 1985 using proteinase K and
SDS as the major reagents (Goelz et al. 1985; Dubeau
et al. 1986). High-temperature heating of the paraffin-
embedded tissue was not applied as the primary
means for extracting DNA, although heating the de-
waxed paraffin sections at 100C was used as a pri-
mary step of PCR after regular DNA extraction (Shi-
bata 1994). Subsequently, the heating AR technique
was used for enhancement of in situ hybridization
(ISH) methods applied to archival paraffin-embedded
tissue sections (Sibony et al. 1995). Several different
heating retrieval protocols have been documented to
produce an improvement of signal by ISH or by fluo-
rescence ISH (FISH) (Oliver et al. 1997; Bull and
Harnden 1999; Kitayama et al. 1999; Gu et al. 2000).
Successful application of the heat-induced retrieval
method for ISH and FISH suggested that the high-tem-
perature heating AR approach may perform in a simi-
lar manner for retrieval of nucleotides as for re-
trieval of antigens in the enhancement of IHC. In a
related but separate approach, high-temperature heat-
ing methods have been used to improve extraction of
nucleic acids from paraffin-embedded tissues (Baner-
jee et al. 1995; Faulkner and Leigh 1998). In this ap-
proach, in contrast to the AR technique, heat was not
employed as the primary retrieval procedure for DNA
extraction from archival paraffin-embedded tissue but
was only part of a complex digestion protocol. Aware-
ness that strong heating of tissue during DNA extrac-
tion could be used instead of enzyme digestion did not
develop until careful comparative studies were carried
Downloaded from jhc.sagepub.com by guest on July 12, 2016
Shi, Cote, Wu, Liu, Datar, Shi, Liu, Lim, Taylor
out in recent years (Sepp et al. 1994; Frank et al.
1996). For example, Frank et al. (1996) pointed out
that simple boiling gave results comparable with those
of proteinase K digestion plus detergents followed by
phenol-chloroform extraction of DNA from paraffin-
embedded tissue. In addition, Coombs et al. (1999) re-
ported a study that sought to optimize DNA/RNA ex-
traction by comparing 10 protocols. They concluded
that heating treatments at 9099C by a thermal cycler,
microwave, and simple boiling in solution [0.5%
Tween-20, Tris-EDTA and Chelex-100 from Bio-Rad
Laboratories (Hercules, CA)] significantly increased
the efficiency of extraction of nucleic acids for use in
molecular analysis.
The present study was designed to test the effi-
ciency of DNA extraction from archival formalin-
fixed, paraffin-embedded tissues based on application
of the basic principles of the AR technique for pro-
teins: heating the tissue under the influence of differ-
ent pH value as previously documented (Shi et al.
1995). The goals included (a) development of a sim-
pler and more effective protocol for DNA extraction
and (b) enhancing understanding of the potential ef-
fect of the two major factors in relation to formalin/
DNA interaction.
Materials and Methods
Tissues
Archival formalin-fixed, paraffin-embedded human tonsil,
lymph nodes, and normal colon tissues were obtained from
the Norris Cancer Hospital and Research Institute at the
University of Southern California Keck School of Medicine
(USC) from 1991 to 2000. Tissues had been processed as
follows. Immediately after removal from the patients, all
samples were routinely fixed in 10% neutral buffered for-
malin [average period of fixation was 24 hr at room temper-
ature (RT)]. Fixed tissues were processed routinely through
dehydration in graded ethanol, clearing in xylene, and em-
bedding in paraffin blocks using automatic processing and
embedding equipment (Tissue Tek VIP; Sakura Finetek, Tor-
rance, CA). Selection of paraffin blocks was based on exam-
ination of one hematoxylin and eosin-stained slide to esti-
mate the area of tissue and the total number of cells for
comparability among different tissue sections. The study of
human-derived tissue specimens has been exempted under
45 CFR 46.101 (b) and was approved by the Institutional
Review Board (IRB #009071) at USC.
Each paraffin block was cut at 10
m and collected in an
autoclaved plastic microtube (1.5 ml). For each microtube,
two sections of total 20-
m thickness were carefully col-
lected to ensure that an equivalent amount of tissue was
placed in each microtube.
Heating Procedure
A heat block (VWR Scientific Products; West Chester, PA)
was used to attain a boiling heating condition (100C105C).
DNA Extraction from Archival Tissue Based on AR
An autoclave for sterilization (Market Forge; New York,
NY) was used to achieve a super high temperature heating at
120C. A water bath (Precision Scientific Inc; Chicago, IL)
was used to maintain a temperature of 80C.
Universal Buffer Solution
A Britton and Robinson type of buffer was prepared for 11
buffer solutions ranging from pH 2.0 to 12.0. Briefly, the
principal solution was made of 28.6 mM of each chemical as
follows: citrate acid, KH2PO4, H3BO3, and diethylbarbituric
acid. A solution of 0.2 N sodium hydroxide was added ac-
cording to the original formula to reach the pH value dem-
onstrated by pH meter (Oakton pHTestr 3; Singapore).
Design of Test
Samples from each of six paraffin blocks were prepared in
34 microtubes as described above, i.e., every tube contained
an equal amount of two tissue sections of total 20
m. A to-
tal of 204 tubes of tissue was included in this study. For each
paraffin block, one tube was used as control sample by using
a non-heating DNA extraction protocol. The other 33 tubes
were tested using the heating protocol under 11 variable pH
values (pH 2 to 12), and three different heating conditions
(80, 100, and 120C). Evaluation of the results of DNA ex-
traction was carried out by measuring yields by photometry
(BioPhotometer; Eppendorf Scientific, Hamburg, Germany)
and PCR amplification as well as the kinetic thermocycling
(KTC)-PCR methods.
Non-heating DNA Extraction Protocol
Deparaffinization was carried out by adding 1 ml xylene to
the microtube containing tissue sections for 30 min for two
changes, followed by 100% and 75% ethanol for 30 min
with two changes. After a washing step with PBS for 15 min
in two changes 500
l of lysis buffer (proteinase K 20 mg/
ml, 50
l, 1 M Tris-HCl solution 10
l, 0.5 M EDTA 2
l,
10% SDS 100
l, and distilled water 838 ml) was added and
incubated at 52C overnight until all tissue fragments were
dissolved completely. Further extraction and purification
procedures were performed by the following steps: addition
of 500
l phenol:chloroform:isopropanol alcohol (Invitro-
gen Life Technologies; Carlsbad, CA) at 25:24:1 to the de-
waxed tissue, followed by mixing by vortex (Daigger Vor-
tex; Scientific Industries, Bohemia, NY), and centrifugation
(Eppendorf Scientific; Hamburg, Germany) at RT, 12,000 
g for 10 min. The supernatant fluid was removed to an auto-
claved microtube using a 100-
l pipette, and one volume of
chloroform was added, mixed by vortexing, and centrifuged
at 12,000  g for 5 min. The upper aqueous supernatant
was carefully removed to another fresh microtube, adding
0.1 volume of 3 M sodium acetate and again mixed by vor-
texing, followed by addition of 1 volume of isopropanol,
and incubation at 20C overnight. The precipitated DNA
was centrifuged at 12,000  g at 4C. The supernatant fluid
was discarded and the precipitate washed once with 75%
ethanol. The extracted DNA was collected after further cen-
trifugation. The final yield of DNA was dissolved in 50
l
distilled water after drying completely in a hood.
Downloaded from jhc.sagepub.com by guest on July 12, 2016
1007
Heating Protocol for DNA Extraction
A total of 500
l universal buffer solution at various pH val-
ues ranging from pH 2 to 12 was added to each microtube
containing a 20-
m tissue section and was heated at 80C,
100C, or 120C, respectively, using a water bath, heat block,
or autoclave as described above. The heating time was 20 min
for all temperatures. A cooling time of 5 min was allowed af-
ter heating. Further steps of extraction and purification were
exactly as used for non-heating DNA extraction described
above, except that enzyme digestion was omitted to compare
the efficiency of DNA extraction more accurately.
Evaluation of DNA Yields
Using a photometer, the amount of DNA yield was mea-
sured according to the standard protocol recommended by
the manufacturer.
The quality of DNA yields was evaluated by two labora-
tories [Drs. Datar and Shi, USC; Dr. Wu, Roche Molecular
Systems (Alameda, CA)] independently using the PCR am-
plification with three primers, and the kinetic thermocycling
(KTC)-PCR method.
PCR Analysis
Each DNA extract was used as a template for PCR amplifi-
cation, using three primer pairs as listed in Table 1. PCR
tests were carried out based on groups of DNA samples ex-
tracted from six paraffin blocks under side-by-side identical
conditions, i.e., each group consisted of 11 DNA samples
that were extracted by heating at defined temperatures in
buffer solutions of differing pH values, together with one
sample extracted by the non-heating method as a control.
Thus, for each paraffin block, three groups of heating at
80C, 100C, and 120C were tested, for a total of 36 PCR test
results that were evaluated by gel electrophoresis.
PCR was performed by standard methods. The DNA
sample diluted in 2
l of distilled water containing 100 ng as
template was added to 43
l of 1.1  ReddyMix PCR Mas-
ter Mix [1.25 U Taq DNA polymerase, 75 mM Tris-HCl,
pH 8.8, at 25C, 20 mM (NH4)2SO4 , 1.5 mM MgCl2, 0.01%
(v/v) Tween-20, 0.2 mM each of dATP, dCTP, dGTP, and
dTTP]. The PCR protocol was then carried out with an ini-
tial 5-min denaturation step at 94C coupled to a repeating
cycle of 1 min at 94C (denaturation), 1 min at 56C (anneal-
ing), and 1 min at 72C (extension) for 40 cycles, followed by
a 10-min completion step.
Kinetic Thermocycling (KTC)-PCR
Real-time KTC-PCR assays (Higuchi et al. 1993) were
carried out with the Applied Biosystems PE5700 instrument.
Table 1 Three primers used for PCR
Name of primer Forward primer Backward (reverse) primer
STS WI-7345 TGCACTGTGGGAT- AATCAATCCACTGTGTATAA-
GTGTTCT AGGAA
STS WI-7034 TGCCCAAACCCTT- CTTGGATGAACGATGGCC
AACTGAC
-actin CTCCTTAATGTCA- GTGGGGCGCCCCAGGCACCA
CGCACGAT
1008
Two
l of the genomic DNA was used for one PCR reac-
tion. The KTC-PCR reaction was carried out in a solution of
10 mM Tris-HCl, pH 8.3, 50 mM KCl, 2.5 mM MgCl2, 200

M dATP, 200
M dCTP, 200
M dGTP, 200
M dTTP,
10 U of AmpliTaq-Gold, 0.2  SYBR-Green (Molecular
Probes; Eugene, OR), and 200 nM of each forward and re-
verse primer. Three sets of primers were used for the KTC-
PCR assay, which amplify a 90-bp exon 3, a 168-bp exon 2,
or a 368-bp exon 4 amplicon of the human p53 gene, re-
spectively. The sequences of forward and reverse primers of
exon 2 are 5-TCATGCTGGATCCCCACTTTTCCTCTTG
and 5-TGGCCTGCCCTTCCAATGGATCCACTCA, re-
spectively. The sequence of the forward and reverse primers
of exon 3 are 5-AATTCATGGGACTGACTTTCTGCTCT-
TGTC and 5-TCCAGGTCCCAGCCCAACCCTTGCTCC,
respectively. The sequence of the forward and reverse prim-
ers of exon 4 are 5-GTCCTCTGACTGCTCTTTTCAC-
CCATCTAC and 5-GGGATACGGCCAGGCATTGA-
AGTCTC, respectively. The thermal cycling protocol was pro-
grammed as follows: an initial incubation at 95C for 10 min,
then 40 cycles of 95C for 30 sec, 60C for 30 sec, and 72C for
45 sec, followed by a final extension at 72C for 10 min. Puri-
fied human genomic DNA purchased from Roche Molecular
Biochemicals was used in the concentration range of 0.1100
ng for the standard curves with primers of exon 3, 2, or 4.
The copy number of the amplifiable genomic DNA ex-
tracted from archival tissue sections was measured by KTC-
PCR to examine the effect of pH of universal buffer solution
and heating temperature on the yield. Three pairs of primers
were used for KTC-PCR test. The first pair amplifies a 90-
bp fragment from the region covering exon 3 of the p53
gene; the second pair amplifies a 168-bp fragment from re-
gion of exon 2. The third pair amplifies a 368-bp fragment
from exon 4. A purified genomic DNA of a known copy
number from Roche Molecular Biochemicals was used as a
standard control. The experimental procedure was as de-
scribed above. The results are shown in Figure 3.
Statistical Analysis
Students t-test for paired samples was performed to com-
pare the effects of different temperatures on DNA yield at
pH 69. The results were considered significant when two-
sided p values were less than 0.05.
Results
Measurement of DNA Yields
Total yields of DNA extracted from paraffin blocks
correlated with the pH value of the buffer solution
Table 2 Average DNA yields (ng) extracted from archival paraffin-embedded tissue sections by heating protocols using buffer
solutions of pH 212a
pH 2 3 4 5 6 7
120C 1192 1208 2300 2142 19,575 19,308
100C 1040 930 1092 1367 11,092 11,675
80C 1208 1517 1475 2108 7258 12,158
aPaired t-test was done to compare the effects of temperatures on DNA yields achieved by buffer solutions of pH 69: 120C vs 80C, T value  7.899, p0.004;
120C vs 100C, T value  5.957, p0.0095; 100C vs 80C, T  2.499, p0.0877. The results are considered significant when p was less than 0.05.
Downloaded from jhc.sagepub.com by guest on July 12, 2016
Shi, Cote, Wu, Liu, Datar, Shi, Liu, Lim, Taylor
and the heating temperature, as summarized in Table
2 and Figure 1. Above pH 5, the amount of DNA
yield was significantly increased. A peak of highest ef-
ficiency of extracted DNA was present at pH 9. In
general, low pH (acid) was poorer than high pH (alka-
line). Heating tissues at higher temperature produced
greater yields of DNA, as shown in Figure 1 and Table
2. Figure 1 showed significant differences between
120C and 80C from pH 6 to pH 9 (T value  7.899;
p0.004) and between 120C and 100C from pH 6 to
pH 9 (T value  5.957; p0.0095). The average ra-
tios 260:280 of extracted DNA also showed better
values for samples heated at 120C. For example, the
average ratios 260:280 for 80C, 100C, and 120C in
buffer at pH 9 were 1.41, 1.44, and 1.60, respectively.
The control group, using the routine enzyme di-
gestion protocol for DNA extraction from archival
paraffin-embedded tissue sections, gave total yields for
six samples of 44,275 ng compared to the best re-
sult of heating extraction of approximately 30,000 ng
(Table 1). However, the quality of DNA extracted
from paraffin-embedded tissue sections was equiva-
lent based on comparable ratios 260:280 (1.58 for
control sample vs 1.60 for heating at 120C in buffer
solution of pH 9), as well as PCR products described
below.
PCR Products
PCR products of three primers showed satisfactory
results for DNA extracted from archival paraffin-
embedded tissues by heating protocols at pH 612
with higher temperatures. The findings were compara-
ble to those of the control sample obtained by a non-
heating enzymatic DNA extraction method, as shown
in Figure 2. In general, the better PCR products were
seen at higher pH and higher temperatures. Some
bands of PCR products were absent for samples ob-
tained at 80C heating conditions, particularly when
larger primers of 347 bp (STS WI-7034) and 541 bp
(actin) were used.
KTC-PCR Products
The yields of amplifiable genomic DNA measured by
Exon 3 primers to amplify a 90-bp fragment (Figure
3A) were affected by pH as well as heating tempera-
8 9 10 11 12
21,775 28,817 20,758 12,733 13,008
13,950 25,375 19,683 13,083 8108
10,508 20,658 17,583 18,267 11,592
DNA Extraction from Archival Tissue Based on AR
Figure 1 Comparison of DNA yields obtained by three heating
temperatures of 80C, 100C, and 120C under the influence of vari-
ous pHs ranging from 2 to 12. In general, low pH (acid) was poorer
than high pH (alkaline). A peak for highest efficiency of extracted
DNA was present at pH 9. Heating tissues at higher temperature
appears to produce greater yields of DNA with a buffer solution of
pH 69.
ture. If the pH was lower than 5, no amplifiable DNA
was recovered regardless of the temperature at which
the samples were heated. A heating temperature of
80C gave lower yields than either 100C or 120C in a
pH range from 6 to 12. The best condition for yields
of amplifiable genomic DNA by exon 3 primers was
heating at 120C in the universal buffer with a pH of
1012. Sections of 20
m gave about 10,000 copies/
l
measured by the exon 3 primer.
When the exon 2 primer was used to amplify a
168-bp fragment (Figure 3B), the results were consis-
tent. The best condition appeared to be 120C with a
pH of 1012. However, the yield of amplifiable ge-
nomic DNA was lower, about 5500 copies/
l, indicat-
ing that the amplification efficiency of exon 2 is lower
than that of exon 3 from the same genomic DNA iso-
lated from paraffin-embedded tissue.
When the exon 4 primer was used to amplify a
368-bp fragment (Figure 3C), the results were consis-
tent with those of both exon 3 and exon 2. The best
result was achieved by heating tissues at 120C in a
universal buffer solution at pH 11. However, the yield
of amplifiable genomic DNA was even lower, about
1200 copies/
l, indicating that the amplification effi-
ciency of exon 4 is lower than that of both exon 3 and
exon 2 from the same genomic DNA isolated from
paraffin-embedded tissue.
Discussion
Recent publications have demonstrated that high-
temperature heating may improve DNA extraction
from archival formalin-fixed, paraffin-embedded tis-
sues (Frank et al. 1996; Faulkner and Leigh 1998;
Downloaded from jhc.sagepub.com by guest on July 12, 2016
1009
Figure 2 Gel electrophoresis of PCR products with three primers
of STS WI-7345 (152 bp), STS WI-7034 (347 bp), and actin (541 bp)
under the influence of two factors: heating at 80C, 100C, or 120C
with various pH values ranging from 2 to 12. Because there are no
bands from samples in buffer solutions of pH 25 under three heat-
ing conditions, Figure 2 shows PCR products from samples in buffer
solutions ranging from pH 6 to 12 only. The pH values of buffer so-
lutions are adjusted to within  0.3. C, control sample (DNA ex-
tracted from archival paraffin-embedded tissue sections without
heating protocol); , negative control (no template for PCR); ,
positive control sample; M, GeneChoice DNA ladder.
Coombs et al. 1999). However, to date these observa-
tions have not been equated to the principles derived
from studies of heat-induced AR, which also is based
on high-temperature heating of formalin-fixed, paraf-
fin-embedded tissues (Shi et al. 1995). The present
study has demonstrated that the same factors that af-
fect the results of AR, i.e., heat and pH, may also in-
fluence the efficiency of DNA extraction from archival
paraffin-embedded tissue. In our study, higher-tem-
perature heating under an alkaline condition provided
the most satisfactory results, as indicated by both
quantity and quality of DNA yield (Table 2; Figures
13). One conclusion is that a simple heating method
can be used to achieve the goal of analyzing gene alter-
ations after PCR amplification. A recent article by Ya-
mashita and co-workers (2001) documented an inter-
esting method that could provide the basis for a
simple heat-induced retrieval method for both DNA
extraction and immunostaining simultaneously in a
single archival paraffin-embedded tissue section. Al-
though there is some evidence that the simple heating
method for DNA extraction can be used alone to yield
satisfactory results for detection of genomic alterations
in DNA recovered from archival paraffin-embedded
tissue sections, this approach has not been widely ap-
plied. One possible reason may relate to the finding
that the quantity of DNA extracted from archival par-
affin-embedded tissue by heating alone is lower than
1010
that extracted by an enzyme-based protocol. How-
ever, in our study the quantity was adequate and the
quality, evaluated by both three-primer PCR and KTC-
PCR methods, proved to be comparable, even supe-
rior for the heating as opposed to non-heat extraction
protocols. In particular, KTC-PCR products demon-
strated that higher-temperature heating at higher (al-
kaline) pH values may produce higher yields of high
quality genomic DNA for the exons studied (Table 2;
Figures 13). Further studies are required to validate
wider applications for various kinds of exons.
Downloaded from jhc.sagepub.com by guest on July 12, 2016
Shi, Cote, Wu, Liu, Datar, Shi, Liu, Lim, Taylor
Figure 3 Amplifiable genomic DNA
measured by KTC-PCR using exon 3
(A), exon 2 (B), and exon 4 (C) of the
human p53 gene. No amplifiable
DNA can be recovered below pH 5, as
shown in A (omitted in B and C).
Higher yields of amplifiable genomic
DNA are achieved by higher-tempera-
ture (120C) heating of tissues at
higher pH, with a peak at pH 11.
Compared to amplifiable genomic
DNA obtained by a non-heating pro-
tocol (control), the yields of genomic
DNA achieved by the heating proto-
cols are much higher, particularly un-
der higher-temperature heating con-
ditions.
Alkaline lysis methods (at RT or 95C) have been
used previously for DNA extraction from bacteria
(Birnboim and Doly 1979), plant tissue (Wang et al.
1993), whole blood (Klintschar and Neuhuber 2000),
or blood culture fluids and other fresh/frozen tissues
(Kulski and Pryce 1996; Rudbeck 1998; Valsecchi
1998). However, the combination of high-tempera-
ture heating and alkaline pH has not been docu-
mented for DNA extraction from archival formalin-
fixed, paraffin-embedded tissues. Furthermore, the
ranges of temperature and pH values that affect the ef-
DNA Extraction from Archival Tissue Based on AR
ficiency of the extraction process have not been previ-
ously explored.
The mechanism of action of heating in alkaline pH
solution for DNA extraction may be similar to a hy-
pothesis proposed for the mechanism of AR under dif-
ferent conditions of temperature and pH (Shi et al.
2000b). A strongly alkaline solution may denature
and hydrolyze proteins, resulting in rupture of cell and
nuclear membranes as well as breakage of crosslink-
ages caused by formalin fixation. Hydrolysis of pro-
teins in tissue may also contribute to improved DNA
extraction. Given the similarity of the chemical reac-
tions of formaldehyde with nucleic acid and protein
(antigen), it is perhaps not surprising that extraction
or retrieval of the two macromolecules should be
influenced by similar factors (Auerbach et al. 1977;
McGhee and von Hippel 1977a,b; Masuda et al.
1999; Shi et al. 2001a).
Acknowledgments
Supported by an NIH grant 1 R21 CA91249-01.
We greatly appreciate Dr Andy E. Sherrods kind help in
providing some paraffin blocks for study. We also thank Ms
Lillian Young for management of our laboratory.
Literature Cited
Auerbach C, MoutschenDahmen M, Moutschen J (1977) Genetic
and cytogenetical effects of formaldehyde and related com-
pounds. Mutation Res 39:317362
Banerjee SK, Makdisi WF, Weston AP, Mitchell SM, Campbell
DR (1995) Microwave-based DNA extraction from paraffin-
embedded tissue for PCR amplification. BioTechniques 18:
768773
Birnboim HC, Doly J (1979) A rapid alkaline extraction procedure
for screening recombinant plasmid DNA. Nucleic Acids Res
7:15131523
Bull JH, Harnden P (1999) Efficient nuclear FISH on paraffin-
embedded tissue sections using microwave pretreatment. Bio-
Techniques 26:416422
Coombs NJ, Gough AC, Primrose JN (1999) Optimisation of DNA
and RNA extraction from archival formalin-fixed tissue. Nucleic
Acids Res 27:e1217
Dubeau L, Chandler LA, Gralow JR, Nichols PW, Jones PA (1986)
Southern blot analysis of DNA extracted from formalin-fixed pa-
thology specimens. Cancer Res 46:29642969
Faulkner SW, Leigh DA (1998) Universal amplification of DNA iso-
lated from small regions of paraffin-embedded, formalin-fixed
tissue. BioTechniques 24:4750
Frank TS, SvobodaNewman SM, Hsi ED (1996) Comparison of
methods for extracting DNA from formalin-fixed paraffin sec-
tions for nonisotopic PCR. Diagn Mol Pathol 5:220224
Goelz SE, Hamilton SR, Vogelstein B (1985) Purification of DNA
from formaldehyde-fixed and paraffin-embedded tissue. Biochem
Biophys Res Commun 130:118126
Gu J, Farley R, Shi S-R, Taylor CR (2000) Target retrieval for in
situ hybridization. In Shi S-R, Gu J, Taylor CR, eds. Antigen Re-
trieval Techniques: Immunohistochemistry and Molecular Mor-
phology. Natick, MA, Eaton Publishing, 115128
Higuchi R, Fockler C, Dollinger G, Watson R (1993) Kinetic PCR
Downloaded from jhc.sagepub.com by guest on July 12, 2016
1011
analysis: real-time monitoring of DNA amplification reactions.
BioTechnology 11:10261030
Kitayama Y, Igarashi H, Sugimura H (1999) Amplification of FISH
signals using intermittent microwave irradiation for analysis of
chromosomal instability in gastric cancer. Mol Pathol 52:357359
Klintschar M, Neuhuber F (2000) Evaluation of an alkaline lysis
method for the extraction of DNA from whole blood and foren-
sic stains for STR analysis. J Forens Sci 45:669673
Kulski JK, Pryce T (1996) Preparation of mycobacterial DNA from
blood culture fluids by simple alkali wash and heat lysis method
for PCR detection. J Clin Microbiol 34:19851991
Masuda N, Ohnishi T, Kawamoto S, Monden M, Okubo K (1999)
Analysis of chemical modification of RNA from formalin-fixed
samples and optimization of molecular biologyy applications for
such samples. Nucleic Acids Res 27:44364443
McGhee JD, von Hippel PH (1977a) Formaldehyde as a probe of
DNA structure. 3. Equilibrium denaturation of DNA and syn-
thetic polynucleotides. Biochemistry 16:32673275
McGhee JD, von Hippel PH (1977b) Formaldehyde as a probe of
DNA structure. 4. Mechanism of the initial reaction of formalde-
hyde with DNA. Biochemistry 16:32763293
Oliver KR, Heavens RP, Sirinathsinghji DJS (1997) Quantitative
comparison of pretreatment regimens used to sensitive in situ hy-
bridization using oligonucleotide probes on paraffin-embedded
brain tissue. J Histochem Cytochem 45:17071713
Rudbeck LDJ (1998) Rapid, simple alkaline extraction of human
genomic DNA from whole blood, buccal epithelial cells, semen
and forensic stains for PCR. BioTechniques 25:588592
Sepp R, Szabo I, Uda H, Sakamoto H (1994) Rapid techniques for
DNA extraction from routinely processed archival tissue for use
in PCR. J Clin Pathol 47:318323
Shi S-R, Cote RJ, Taylor CR (2001a) Antigen retrieval immunohis-
tochemistry and molecular morphology in the year 2001. Appl
Immunohistochem Mol Morphol 9:107116
Shi S-R, Cote RJ, Taylor CR (2001b) Antigen retrieval techniques:
current perspectives. J Histochem Cytochem 49:931937
Shi S-R, Gu J, Taylor CR (2000a) Antigen Retrieval Techniques:
Immunohistochemistry and Molecular Morphology. Natick,
MA, Eaton Publishing
Shi S-R, Gu J, Turrens F, Cote RJ, Taylor CR (2000b) Development
of the antigen retrieval technique: philosophy and theoretical
base. In Shi SR, Gu J, Taylor CR, eds. Antigen Retrieval Tech-
niques: Immunohistochemistry and Molecular Morphology.
Natick, MA, Eaton Publishing, 1739
Shi SR, Imam SA, Young L, Cote RJ, Taylor CR (1995) Antigen re-
trieval immunohistochemistry under the influence of pH using
monoclonal antibodies. J Histochem Cytochem 43:193201
Shi SR, Key ME, Kalra KL (1991) Antigen retrieval in formalin-
fixed, paraffin-embedded tissues: an enhancement method for
immunohistochemical staining based on microwave oven heating
of tissue sections. J Histochem Cytochem 39:741748
Shibata D (1994) Extraction of DNA from paraffin-embedded tis-
sue for analysis by polymerase chain reaction: new tricks from an
old friend. Hum Pathol 25:561563
Sibony M, Commo F, Callard P, Gasc J-M (1995) Enhancement of
mRNA in situ hybridization signal by microwave heating. Lab
Invest 73:586591
Taylor CR (1994) The current role of immunohistochemistry in di-
agnostic pathology. Adv Pathol Lab Med 7:59105
Taylor CR (1996) Paraffin section immunocytochemistry for estro-
gen receptor. The time has come. Cancer 77:24192422
Valsecchi E (1998) Tissue boiling: a short-cut in DNA extraction
for large-scale population screenings. Mol Ecol 7:12431245
Wang H, Qi M, Cutler AJ (1993) A simple method of preparing
plant samples for PCR. Nucleic Acids Res 21:41534154
Yamashita K, Yoshida T, Shinoda H, Okayasu I (2001) Novel
method for simultaneous analysis of p53 and K-ras mutations
and p53 protein expression in single histologic sections. Arch
Pathol Lab Med 125:347352