You are on page 1of 271

Biologa de 2 de bachillerato

Robert Hooke

Jos Luis Snchez Guilln


IES PANDO

Oviedo 2010
2010 I.E.S. PANDO
Departamento de Biologa-Geologa
OVIEDO-Asturias (ESPAA).
NDICE

BLOQUE I: BIOMOLCULAS
1. Mtodos de estudio de la clula......................... 6 pags
1. Bioelementos y biomolculas: Generalidades............. 10 pags
2. El agua y las sales minerales........................... 7 pags
3. Los glcidos.......................................... 12 pags
4. Los lpidos........................................... 10 pags
5. Las protenas......................................... 14 pags

BLOQUE II: LA CLULA (ESTRUCTURA Y METABOLISMO)


1. Origen de los seres vivos y Teora celular............. 11 pags
2. Membranas y transporte.................................11 pags
3. El medio interno celular................................3 pags
4. Sistemas de membranas...................................7 pags
5. Metabolismo: Enzimas....................................8 pags
5a. Fotosntesis y quimiosntesis....................... 15 pags
5b. Respiracin celular y fermentaciones................ 17 pags

BLOQUE III: INFORMACIN CELULAR


1. El ncleo celular...................................... 5 pags
2. Los cidos nuclicos...................................10 pags
3. El ADN como portador de la informacin gentica......... 3 pags
4. Trascripcin y traduccin de la informacin gentica... 11 pags
5. La replicacin del ADN..................................3 pags
6. El ciclo celular: Mitosis...............................8 pags
7. Los cromosomas metafsicos..............................4 pags
8. La meiosis............................................. 7 pags
9. Las mutaciones........................................ 10 pags
10. La herencia gentica: Mendelismo...................... 17 pags
11. Gentica aplicada......................................5 pags

BLOQUE IV: MICROBIOLOGA Y BIOTECNOLOGA


1. Microbiologa y biotecnologa.......................... 29 pags

BLOQUE V: INMUNOLOGA
1. Inmunologa........................................... 22 pags
I) Biomolculas 1) Mtodos de estudio de la clula

1-1

MTODOS DE ESTUDIO DE LA CLULA

CLASIFICACIN

Clasificaremos los mtodos que se utilizan para el estudio de la clula en dos grandes
grupos:

I) Tcnicas para el estudio fisicoqumico: sirven para conocer la composicin y relacionar esta
composicin con las estructuras celulares. Estos mtodos son:

a) Centrifugacin

b) Cromatografa

c) Electroforesis

d) Cultivos "in vitro"

II) Tcnicas para el estudio morfolgico de la clula. Nos permiten conocer cmo es su forma,
su tamao y su estructura. Son, fundamentalmente:

a) Microscopa ptica

b) Microscopa electrnica

1) Microscopio electrnico de Trasmisin (MET)

2) Microscopio electrnico de barrido (MEB)

I) TCNICAS PARA EL ESTUDIO FISICOQUMICO DE LA CLULA

Este tipo de mtodos se utilizan para el aislamiento, localizacin e identificacin de las


sustancias que constituyen la materia viva.

Presentan dos problemas principalmente:

a) Los componentes de un ser vivo se encuentran formando mezclas muy complejas.

b) La mayora de las sustancias que encontramos en los seres vivos son, a su vez, de una
gran complejidad.

Pensemos,por ejemplo, que una sola de los varios miles de protenas que contiene una clula
puede estar formada por ms 5000 aminocidos.

Pasemos a continuacin al estudio de cada uno de estos mtodos.

J. L. Snchez Guilln Pgina I-1-1


I) Biomolculas 1) Mtodos de estudio de la clula

A) CENTRIFUGACIN

Consiste en la separacin de los componentes


de una mezcla en funcin de las diferencias entre
las velocidades que presentan al someterlos a
elevadas aceleraciones (g). Esto se consigue
haciendo girar la mezcla en un rotor a un gran
nmero de vueltas por minuto. Los aparatos
empleados con este fin se denominan
ultracentrfugas.

Esta tcnica requiere los siguientes pasos:


Fig. 1 Homogeneizador.
1) FRACCIONAMIENTO U HOMOGENEI-
ZACIN: El material biolgico, por ejemplo: un
fragmento de tejido del hgado, es triturado para
disgregarlo y romper las membranas celulares.

La rotura de las membranas deja en libertad los


orgnulos celulares y el contenido del
hialoplasma. Si la homogeneizacin se realiza
suavemente, los orgnulos permanecern
intactos. Obtendremos as una "papilla" que
estar compuesta de restos de membranas,
orgnulos celulares, ncleos, molculas libres y
agua.
Fig. 2 Centrfuga.
2) CENTRIFUGACIN: Las ultracentrfugas son
mquinas que consiguen velocidades de rotacin
muy elevadas, hasta 500.000 v/mn. En el interior
de estos aparatos se alcanzan grandes
aceleraciones que se miden en g (1g=9,8 m/s2).
En una ultracentrfuga pueden alcanzarse hasta
100.000 g. Los materiales biolgicos sometidos a
estas aceleraciones se desplazan hacia el fondo
de los recipientes que los contienen con
velocidades que dependen de su masa, de su
forma y volumen, y de la naturaleza del medio en
el que se realice la centrifugacin.
Fig. 3 Cromatografa de papel.
B) CROMATOGRAFA

Se fundamenta en la separacin de los


componentes de una mezcla por sus diferencias
de absorcin. stas diferencias van a ser debidas
a las fuerzas de Van der Wals que se establecen
entre los componentes de la mezcla y una
sustancia que acta de fase estacionaria. Segn
la naturaleza de la fase estacionaria, tendremos
los siguientes tipos de cromatografa:

1) CROMATOGRAFA SOBRE PAPEL: Se


emplea para la separacin de sustancias
qumicas que presenten propiedades muy
parecidas. Se opera de la siguiente manera. Una Fig. 4 Cromatografa de gases.
pequea cantidad de la mezcla a separar se
deposita sobre un fragmento de papel poroso en el que quedar embebida. A continuacin se

J. L. Snchez Guilln Pgina I-1-2


I) Biomolculas 1) Mtodos de estudio de la clula

introduce el borde del papel en una sustancia en la que sean solubles los componentes de la
mezcla que queremos separar. El disolvente se desplazar por capilaridad y los ir
arrastrando. Los componentes de la mezcla viajarn ms o menos rpido segn establezcan
fuerzas ms o menos grandes con las molculas del papel. Para observar los componentes
ya separados se emplean reacciones coloreadas especficas.

2) CROMATOGRAFA DE GASES: El aparato consiste en un serpentn largo y delgado cuyas


paredes estn impregnadas de un lquido (fase estacionaria). La mezcla a separar se vaporiza
y atraviesa el serpentn transportada por un gas. La fase estacionaria retiene ms o menos los
diferentes componentes de la mezcla. stos se detectan cuando al atravesar una llama entran
en combustin, lo que aumenta la conductividad elctrica del detector. Este mtodo tiene la
ventaja de necesitar pequesimas cantidades (0,05 mg) y es capaz de separar sustancias
muy parecidas qumicamente; por ejemplo: cidos grasos,azcares u hormonas.

C) ELECTROFORESIS

En este mtodo, la mezcla a separar se


deposita en una cubeta sobre un soporte de tipo
poroso (acetato de celulosa o tambin gel de
almidn). A continuacin se establece una
diferencia de potencial entre los extremos del
soporte. Las sustancias que componen la mezcla
se desplazarn en funcin de su carga elctrica.

Naturalmente este mtodo se emplear con


sustancias que presenten cargas elctricas
(protenas y cidos nuclicos)
Fig. 5 Cubeta para electroforesis.
D) CULTIVOS IN VITRO

Estos mtodos nos van a permitir mantener


lneas celulares en el exterior de un organismo en
condiciones favorables a su multiplicacin. La
gran ventaja va a ser la facilidad para el
tratamiento del material biolgico y su
estandarizacin.

Las clulas extradas deben mantenerse para


su cultivo en un medio con las condiciones fsicas
y qumicas adecuadas y suministrarles aquellas
sustancias que ellas no son capaces de
sintetizar. En la actualidad se venden medios de
cultivo concretos para cada tipo celular y que Fig. 6 Cultivo de bacterias en
cpsula de petri.
permiten mantener los cultivos durante largos
perodos de tiempo.

II) MTODOS MORFOLGICOS

Los mtodos morfolgicos nos van a permitir la observacin directa de la estructura celular.

El ojo humano puede distinguir a 25 cm dos objetos separados entre s 0,2 mm. ste es el
poder separador o poder de resolucin del ojo. Las clulas de mamfero suelen tener unos
0,01 mm, por lo que no es posible verlas a simple vista y mucho menos observar en ellas
detalles estructurales. El microscopio va a permitir su observacin al aumentar el poder de
resolucin del ojo.

J. L. Snchez Guilln Pgina I-1-3


I) Biomolculas 1) Mtodos de estudio de la clula

CLASES DE MICROSCOPIOS

A) MICROSCOPIO PTICO O FOTNICO

1) FUNDAMENTO: Funciona de la siguiente


manera: Una fuente luminosa enva rayos de luz ocular
a una primera lente, llamada condensador, que
concentra los rayos de luz sobre el objeto a
observar. Estos rayos atraviesan el objeto y una revolver
lente denominada objetivo da una imagen
objetivo
aumentada de ste. Una segunda lente, el pinzas
ocular, vuelve a aumentar la imagen dada por el
objetivo. Esta ltima imagen es la que ser macromtrico platina

recibida por el observador. micromtrico Fuente de


iluminacin

2) PREPARACIN DEL MATERIAL: En el


microscopio ptico la luz atraviesa el objeto a
observar. Si ste es muy grueso, la luz no lo
atravesar y el objeto aparecer demasiado Fig. 7 Partes del miccroscopio
oscuro; adems se superpondrn los diferentes ptico.
planos dando una imagen borrosa. Si el objeto es
demasiado delgado o muy transparente, no se
observarn sus estructuras. En cualquier caso, 16 ocular
deberemos realizar una preparacin.

En general, una preparacin requiere las


siguientes etapas
revolver

1- CORTE. Los objetos demasiado 10 objetivos


gruesos son cortados mediante aparatos
denominados microtomos. stos permiten macromtrico
platina

realizar cortes de apenas unas micras de diafragma


micromtrico lmpara
grosor, corrientemente entre 3 y 20 .
El tejido destinado al corte debe
congelarse o incluirse en parafina para Fig. 8 Partes del miccroscopio
darle una mayor consistencia y que se ptico.
pueda cortar con facilidad.

2- FIJACIN. Su fin es matar a las clulas con la menor alteracin de las estructuras
posible, para evitar las modificaciones que pudiesen producirse posteriormente por el
metabolismo celular o por la descomposicin. Como fijadores se emplean
determinadas sustancias qumicas (por ejemplo: formaldehdo y tetrxido de osmio).

3- DESHIDRATACIN. La extraccin del agua del interior de las clulas permitir


tambin una mejor conservacin y la penetracin de los colorantes. Para deshidratar el
material a observar se le sumerge en alcoholes de cada vez mayor graduacin que por
dilucin irn extrayendo el agua.4- TINCIN. Es la coloracin de las clulas o de partes
de stas para que resalten y posibilitar as su observacin. Algunos colorantes son
selectivos pues tien partes concretas de la clula.

Existen dos clases de colorantes:

a) Los colorantes vitales. Que tien las estructuras celulares pero sin matar a las
clulas (por ejemplo: el verde jano, el rojo neutro, el azul tripn, el azul de metileno).

b) Los colorantes no vitales. Que matan a las clulas (eosina, hematoxilina).

J. L. Snchez Guilln Pgina I-1-4


I) Biomolculas 1) Mtodos de estudio de la clula

5- MONTAJE. Una vez realizadas las anteriores operaciones el material se coloca entre
un porta-objetos y un cubre-objetos. Para un montaje no definitivo, se coloca entre
"porta" y "cubre" una gota de glicerina. Este tipo de preparaciones tiene una duracin
limitada y slo sirven para la observacin momentnea o a lo sumo de unos das. Si se
desea una mayor duracin debe realizarse el montaje en gelatina-glicerina o en
euparal.

B) EL MICROSCOPIO ELECTRNICO

Existen dos clases de microscopios electrnicos:

B1) Microscopio electrnico de trasmisin (MET).

B2) Microscopio electrnico de barrido (MEB).

Fig. 9 Fundamento del microscopio ptico. Fig. 10 Fundamento del microscopio


electrnico de trasmisin (MET).

B1) EL MICROSCOPIO ELECTRNICO DE TRANSMISIN (MET)

1) FUNDAMENTO:

El microscopio electrnico fue puesto a punto en 1931 a partir de los trabajos tericos de De
Broglie. Los electrones pueden comportarse como ondas o como partculas. Como ondas
pueden llegar a tener una longitud 100.000 veces menor que la luz visible. Al ser partculas
negativas pueden ser desviadas por campos elctricos que actan como lentes.

En esencia su funcionamiento es similar al del microscopio ptico. Un ctodo emite un haz


de electrones que son acelerados por la aplicacin de una diferencia de potencial entre el
ctodo y el nodo. El flujo de electrones es concentrado sobre el objeto por una primera lente
magntica que hace las veces de condensador. Los electrones atraviesan la muestra. Una
segunda lente magntica, el objetivo, da una imagen aumentada del objeto. Una tercera lente,
el ocular, aumenta de nuevo la imagen dada por la anterior. La imagen final es proyectada
sobre una pantalla o fotografiada.

Los microscopios electrnicos permiten aumentos tiles que van de 2000 a 100.000 pudiendo
llegar hasta 600.000. Los microscopios electrnicos son aparatos de hasta 2 m de alto y
llegan a pesar 500 kg.

J. L. Snchez Guilln Pgina I-1-5


I) Biomolculas 1) Mtodos de estudio de la clula

2) PREPARACIN del MATERIAL

Los electrones necesitan desplazarse en el vaco, esta es la razn por la que no es posible la
observacin de clulas vivas al microscopio electrnico.

2-1) FIJACIN. Las clulas son fijadas mediante fijadores no coagulantes. Los ms
corrientes son el tetrxido de osmio (OsO4), el formaldehdo (HCHO) y el
permanganato potsico (MnO4K). Los metales pesados que algunos contienen se fijan
selectivamente a las diferentes estructuras celulares. Aquellas que retengan ms los
metales aparecern ms oscuras. Es por esto que la imagen depende mucho del tipo
de fijador utilizado.

2-2) DESHIDRATACIN e INCLUSIN. La pieza es deshidratada e infiltrada mediante


una resina o plstico para darle una mayor consistencia y facilitar su corte.

2-3) CORTE. Los cortes se realizan mediante ultramicrotomos de cuchilla de vidrio o de


diamante. Los cortes ms finos (0,03) son depositados sobre un tamiz y dispuestos
para su observacin al microscopio.

B2) MICROSCOPIO ELECTRNICO DE BARRIDO (MEB)

Este tipo de microscopio permite obtener imgenes tridimensionales del objeto a estudiar.
Primero se efecta un sombreado metlico de la superficie de la muestra, y la rplica obtenida
es barrida por un haz de electrones. Los electrones secundarios que se forman son captados y
convertidos en imgenes sobre una pantalla de televisin. Estos microscopio son muy tiles
para revelar estructuras anatmicas submicroscpicas, sin embargo su aumento no suele
pasar de 20.000.

Microscopio ptico Microscopio electrnico

Fuente de iluminacin: La luz Fuente de iluminacin: electrones

Se pueden ver seres vivos No se pueden ver los seres vivos

Poco aumento (X1000) Mucho aumento (X300 000)

Se observa la estructura Se observa la ultraestructura

Preparaciones sencillas Preparaciones complejas

Aparato relativamente barato Instrumento muy caro

J. L. Snchez Guilln Pgina I-1-6


I) Biomolculas 2) Biomolculas

I-2

BIOELEMENTOS Y BIOMOLCULAS

LOS BIOELEMENTOS: CONCEPTO Y CLASES

Los bioelementos son los elementos qumicos que constituyen los seres vivos.

De los aproximadamente 100 elementos qumicos que existen en la naturaleza, unos 70


se encuentran en los seres vivos. De estos slo unos 22 se encuentran en todos en cierta
abundancia y cumplen una cierta funcin.

Clasificaremos los bioelementos en:

>Bioelementos primarios: O, C, H, N, P y S. Representan en su conjunto el 96,2%


del total.

>Bioelementos secundarios: Na+ , K+ , Ca2+ , Mg 2 + , Cl-. Aunque se encuentran en


menor proporcin que los primarios, son tambin imprescindibles para los seres
vivos. En medio acuoso se encuentran siempre ionizados.

Oligoelementos o elementos vestigiales: Son aquellos bioelementos que se


encuentran en los seres vivos en un porcentaje menor del 0.1%. Algunos, los
indispensables, se encuentran en todos los seres vivos, mientras que otros,
variables, solamente los necesitan algunos organismos.

TABLA

BIOELEMENTOS OLIGOELEMENTOS
Primarios Secundarios Indispensables Variables
O Na+ Mn B
C K+ Fe Al
H Mg 2 + Co V
N Ca2 + Cu Mo
P Cl- Zn I
S Si

J. L. Snchez Guilln Pgina I-2-1


I) Biomolculas 2) Biomolculas

PRINCIPALES CARACTERSTICAS DE LOS BIOELEMENTOS PRIMARIOS

El hecho de que los bioelementos primarios sean tan abundantes en los seres vivos se
debe a que presentan ciertas caractersticas que los hacen idneos para formar las
molculas de los seres vivos. As:

* Aunque no son de los ms abundantes, todos ellos se encuentran con cierta


facilidad en las capas ms externas de la Tierra (corteza, atmsfera e
hidrosfera).

TABLA
Los elementos qumicos ms abundantes en la corteza terrestre y en los
seres vivos (en % en peso).
Elementos Corteza (%) Elementos Seres vivos (%)
Oxgeno 47 Oxgeno 63
Silicio 28 Carbono 20
Aluminio 8 Hidrgeno 9,5
Hierro 5 Nitrgeno 3

* Sus compuestos presentan polaridad por lo que fcilmente se disuelven en el


agua, lo que facilita su incorporacin y eliminacin.

Tabla de los Bioelementos

H He

Li Be B C N O F Ne

Na Mg Al Si P S Cl Ar

K Ca Sc Ti V Cr Mn Fe Co Ni Cu Zn Ga Ge As Se Br Kr

Rb Sr Y Zr Nb Mo Tc Ru Rh Pd Ag Cd In Sn Sb Te I Xe

Cs Ba La Hf Ta W Re Os Ir Pt Au Hg Tl Pb Bi Po At Rn

Fr Ra Ac

Cs Pr Nd Pm Sm Eu Gd Tb Dy Ho Er Tm Yb Lu

Th Pa U Np Pu Am Cm Bk Cf Es Fm Md No Lw

Primarios Indispensables
Bioelementos Oligoelementos
Secundarios Variables 15

* El C y el N presentan la misma afinidad para unirse al oxgeno o al hidrgeno,


por lo que pasan con la misma facilidad del estado oxidado al reducido. Esto es de
gran importancia, pues los procesos de oxidacin-reduccin son la base de muchos
procesos qumicos muy importantes y en particular de los relacionados con la
obtencin de energa como la fotosntesis y la respiracin celular.

J. L. Snchez Guilln Pgina I-2-2


I) Biomolculas 2) Biomolculas

* El C, el H, el O y el N son elementos de pequea masa atmica y tienen


variabilidad de valencias, por lo que pueden formar entre s enlaces covalentes
fuertes y estables. Debido a esto dan lugar a una gran variedad de molculas y de
gran tamao. De todos ellos el carbono es el ms importante. Este tomo es la
base de la qumica orgnica y de la qumica de los seres vivos.

LAS BIOMOLCULAS: CLASIFICACIN

Los bioelementos se unen entre s para formar molculas que llamaremos biomolculas:
Las molculas que constituyen los seres vivos. Estas molculas se han clasificado
tradicionalmente en los diferentes principios inmediatos, llamados as porque podan
extraerse de la materia viva con cierta facilidad, inmediatamente, por mtodos fsicos
sencillos, como : evaporacin, filtracin, destilacin, disolucin, etc.

Los diferentes grupos de principios inmediatos son:

Inorgnicos Orgnicos
-Agua -Glcidos
-CO2 -Lpidos
-Sales minerales -Prtidos o protenas
-cidos nucleicos

LOS COMPUESTOS ORGNICOS DE LOS SERES VIVOS.

Son compuestos orgnicos los compuestos de carbono. Esto es, aquellos en los que el
tomo de carbono es un elemento esencial en la molcula y forma en ella la cadena bsica
a la que estn unidos los dems elementos qumicos.

Los seres vivos contienen compuestos orgnicos. Son stos los que caracterizan a la
materia viva y la causa de las peculiares funciones que realiza. La gran variedad de
compuestos orgnicos que contienen los seres vivos no se clasifican desde un punto de
vista qumico, sino a partir de criterios muy simples, tales como su solubilidad o no en
agua, u otros. Siguiendo estos criterios se clasifican en :

-Glcidos o hidratos de carbono


-Lpidos
-Prtidos (protenas)
-cidos nucleicos

Las funciones que cumplen estos compuestos en los seres vivos son muy variadas,

J. L. Snchez Guilln Pgina I-2-3


I) Biomolculas 2) Biomolculas

as:

-Glcidos y lpidos tienen esencialmente funciones energticas y estructurales.


-Las protenas: enzimticas y estructurales.
-Los cidos nucleicos son los responsables de la informacin gentica.

Algunas sustancias son de gran importancia para los seres vivos pero estos las necesitan
en muy pequea cantidad y nunca tienen funciones energticas ni estructurales. Por esta
causa reciben el nombre de biocatalizadores. Son biocatalizadores las vitaminas, las
enzimas y las hormonas.

REPARTICIN DE LOS COMPONENTES MOLECULARES


DE LA CLULA
(en % sobre masa total)
Principios inmediatos PROCARIOTAS EUCARIOTAS
Glcidos 3 3
Lpidos 2 4,5
Prtidos 15 18
cidos Nucleicos
ARN 6 1,25
ADN 2 0,25
Precursores 1 2
Agua 70 70
Sales minerales 1 1

EL ENLACE COVALENTE

Los tomos que forman las molculas


orgnicas estn unidos mediante enlaces
H O H
covalentes. Se trata de un enlace muy
resistente cuando la molcula est en H C C C S H
disolucin acuosa, lo que es el caso de los
seres vivos. H H
Fig. 1 Unin mediante enlaces covalentes de
Este tipo de enlace se forma cuando dos los diferentes tomos que constituyen una
tomos comparten uno o ms pares de biomolcula.
electrones. Si comparten 2 electrones, uno
cada tomo, diremos que ambos estn unidos mediante un enlace simple; si comparten 4,
aportando dos cada uno, el enlace ser doble, y si son seis tendremos un enlace triple.
Los enlaces se representan mediante trazo entre los tomos a los que une. As, por

J. L. Snchez Guilln Pgina I-2-4


I) Biomolculas 2) Biomolculas

ejemplo: -C-C-, para el enlace simple carbono-carbono o -C=C- , para el doble. Es de


destacar que el enlace simple permite el giro, lo que no sucede con los enlaces doble y el
triple.

El enlace covalente se da entre elementos no


metlicos de electronegatividad similar: C-C, +

C-O, C-N, C-H. Si existe una mayor diferencia


- - +
de electronegatividad, como ocurre entre el
oxgeno y el nitrgeno con el hidrgeno, el
Polaridad del enlace N-H
elemento ms electronegativo (el oxgeno y el Polaridad del enlace O-H

nitrgeno, respectivamente) atrae hacia s los


electrones crendose una polaridad. Esto es, la Fig. 2 Polaridad del enlace-O-H y del enlace
molcula tendr zonas cor carga elctrica >N- H.
positiva y otras con carga negativa.

CARACTERSTICAS DEL TOMO DE CARBONO

El carbono es el elemento nmero 6 de la tabla peridica (Z=6 y A =12). Su estructura


electrnica es 1s 2 2s 2 2p 2 .

Como ya se ha dicho, es el elemento ms


importante de los seres vivos, aunque no sea
C C C C
el que se encuentra en ms abundancia. En la
corteza terrestre es un elemento relativamente Cuatro simples Uno doble y dos
simples
Dos dobles. Uno triple y uno
simple.

raro. Lo encontramos en la atmsfera en forma


de CO2 , disuelto en las aguas formando Fig. 3 Enlaces covalentes que puede tener el
carbonatos y en la corteza constituyendo las tomo de carbono al unirse a otros bioelementos.
rocas calizas (CO3 Ca) el carbn y el petrleo.

LOS ENLACES COVALENTES DEL CARBONO Y DE OTROS BIOELEMENTOS

El tomo de carbono tiene 4 electrones en la


ltima capa. Esto hace que pueda unirse a H O S N
otros tomos mediante cuatro enlaces cova-
N
lentes pudindose formar tres estructuras O S
N
distintas. Estas son:
El hidrgeno tiene El oxgeno tiene dos El azufre tiene dos El nitrgeno tiene
electrones de electrones de tres electrones de

-La hibridacin tetradrica. En la que el tomo


un electrn de
valencia. valencia. valencia. valencia.

de carbono est unido mediante cuatro enlaces


Fig. 4 Enlaces covalentes que pueden tener el
covalentes simples a otros cuatro tomos. En resto de los bioelementos primarios.
este tipo de hibridacin el tomo de carbono
ocupa el centro de un tetraedro y los cuatro
enlaces simples se dirigen hacia sus vrtices.

J. L. Snchez Guilln Pgina I-2-5


I) Biomolculas 2) Biomolculas

-La hibridacin trigonal. En la que el tomo de


carbono se une a otros tres tomos mediante
C C C
dos enlaces simples y uno doble. En este caso C

los cuatro tomos forman un tringulo con el


H. tetradrica H. trigonal H. digonal H. digonal
tomo de carbono situado en el centro. Debe
tenerse en cuenta que el enlace doble es algo Fig. 5 Hibridaciones del tomo de carbono.
ms corto que los enlaces simples, por lo que
el tringulo no ser equiltero sino issceles.

-La hibridacin digonal. Cuando el tomo de carbono est unido a otros dos tomos
mediante un enlace simple y uno triple o mediante dos dobles.

Los dems bioelementos van a poder formar, bien con el carbono o entre s, los enlaces
covalentes que pueden verse en el recuadro.

LOS ESQUELETOS DE LAS MOLCULAS Tipos de esqueletos de las molculas orgnicas

ORGNICAS
-C- C- C- C- C- C- C- C-
1) Cadena lineal saturada

Las diferentes biomolculas van a estar


constitudas bsicamente por tomos de -C- C- C=C- C- C=C- C-

carbono unidos entre s mediante enlaces


2) Cadena lineal insaturada 4) Doble ciclo mixto.

covalentes. La resistencia y versatilidad de los -C- C- C-


-C- C- C- C- C-
enlaces carbono-carbono y del carbono con -C- C- C-
otros elementos: oxgeno, nitrgeno o azufre, 3) Cadena ramificada.
5) Ciclo mixto.

va a posibilitar el que se puedan formar


estructuras que sern el esqueleto de las Fig. 6 Ejemplos de esqueletos carbonados de
las biomolculas.
principales molculas orgnicas.

FUNCIONES ORGNICAS

Las molculas orgnicas van a tener FUNCIONES ORGNICAS

determinadas agrupaciones caracters ticas de Concepto: Agrupaciones caractersticas de tomos


tomos que reciben el nombre de funciones o Alcohol: -O-H
grupos funcionales. Las principales funciones Cetona:
Aldehdo:
>C=O
-CHO
son: cido: -COOH
Amino: -NH2
Amida: -CONH2
Tiol: -S-H
-Alcohol o hidroxilo
-Aldehdo
Fig. 7 Los principales frupos funcionales.
-Cetona
-cido orgnico o carboxilo
-Amina
-Amida
-Tiol o sulfidrilo

J. L. Snchez Guilln Pgina I-2-6


I) Biomolculas 2) Biomolculas

Las cuatro primeras estn formadas por C, H,


y O (funciones oxigenadas); las dos siguientes, H O
C O H
por tener nitrgeno, se denominan funciones C O C C C
Funcin alcohol
nitrogenadas. Funcin aldehdo Funcin cetona

O Funcin cido

C S H
Los aldehdos se diferencian de las cetonas C O H
Funcin tiol
por estar siempre en un carbono situado en el
extremo de la molcula; esto es, el carbono que H O Funcin amida

C N H
lleva una funcin aldehdo se encuentra unido H C N
Funcin amina H
a otro carbono o a un hidrgeno. * En los enlaces libres slo puede haber o carbonos o hidrgenos.

Entre las funciones con azufre la ms Fig. 8 Los principales grupos funcionales.

importante en los compuestos de los seres


vivos es la funcin tiol (-SH). Encontraremos
esta funcin en algunos aminocidos. El
fsforo se encuentra sobre todo en los cidos
nucleicos y sus derivados en forma de cido
fosfrico (H3 PO4 ) o sus iones (iones fosfato).

Las diferentes funciones pueden


representarse de una manera simplificada tal y
como se indica en la figura.
Fig. 9 Representacin en un modelo de esferas
de una biomolcula: un aminocido.

ALGUNAS PROPIEDADES QU MICAS DE LAS FUNCIONES ORGNICAS

Los alcoholes por deshidrogenacin (oxidacin) se transforman en aldehdos o cetonas y


estos por una nueva oxidacin dan cidos. Por el contrario, los cidos por reduccin dan
aldehdos y estos a su vez dan alcoholes. Estos procesos son de gran importancia en el
metabolismo de los seres vivos, en particular en los procesos de obtencin de energa.

FORMULACIN DE LAS BIOMOLCULAS

Las sustancias orgnicas pueden CH3-CH3


representarse mediante diferentes tipos de H H Frmula semidesarrollada

frmulas. Estas pueden ser: H C C H


a) Frmulas desarrolladas o estructurales: En H H C2H6
ellas se indican todos los tomos que forman la Frmula desarrollada
Frmula emprica

molcula y todos los enlaces covalentes los


unen. Este tipo de frmulas da la mxima Fig. 10 Frmulas desarrollada,
informacin pero las molculas complejas es semidesarrollada y emprica del etano.
laborioso representarlas.

b) Frmulas semidesarrolladas: en las que se indican nicamente los enlaces de la cadena

J. L. Snchez Guilln Pgina I-2-7


I) Biomolculas 2) Biomolculas

carbonada. El resto de los tomos que estn


CH2OH
unidos a un determinado carbono se agrupan
segn ciertas normas (ejemplo: CH3 -, -CH2 - , C O
H OH
CH2 OH-, -CHOH-, CHO-, -CO-, -COOH, H
C C
-CHNH2 -).
OH OH H H
C C
c) Frmulas empricas: En ellas se indican
nicamente el nmero de tomos de cada H OH

elemento que hay en la molcula; as, frmula


Fig. 11 Ejemplo de representacin entre
emprica de la glucosa: C6 H12 O6 . desarrollada y semidesarrollada de la glucosa,
en la que algunas funciones se han agrupado.
Es de destacar que las frmulas empricas no
dan una idea de la estructura de la molcula y
que puede haber muchos compuestos que, CH2OH CHO C CO C
Funcin aldehdo Funcin cetona
siendo diferentes, tengan la misma frmula Funcin alcohol

emprica y diferente frmula estructural. Funcin cido

CHSH COOH
En ciertos casos, por ejemplo, si la molcula es Funcin tiol

muy compleja, se recurre a determinadas Funcin amida

simplificaciones. As, las largas cadenas CH2NH2 CONH2


carbonadas de los cidos grasos pueden
representarse mediante una lnea quebrada en Fig. 12 Representacin semidesarrollada de
la que no se indican ni los carbonos ni los los principales grupos funcionales.
hidrgenos pero s se indican las funciones,
los dobles enlaces u otras variaciones que O
COOH

posea la molcula. Tambin se simplifican las


cadenas cclicas, en las que a veces tampoco
se indican ni los carbonos ni los hidrgenos. OH
OH

Fig. 13 Representacin simplificada de una


biomolcula.

CONCEPTOS DE POLMERO Y MONMERO

Frecuentemente los compuestos que constituyen los seres vivos estn formados por la
unin ms o menos repetitiva de molculas menores. Por ejemplo, el almidn y la celulosa
estn formados por la unin de miles de molculas de glucosa. Las protenas por decenas,
centenares o miles de aminocidos, y la unin de miles o millones de nucletidos forma
los cidos nucleicos. Cada una de las unidades menores que forman estas grandes
molculas es un monmero y el compuesto que resulta de la unin se llama polmero. Los
polmeros son, a su vez, macromolculas, molculas de elevado peso molecular.

Pequeas molculas.........................................................................de 100 u a 1000 u


Grandes molculas (macromolculas)..................................... de 10 4 u a ms de 10 6 u

Unidad de masa molecular: unidad de masa atmica (u) o dalton (da).


1u = 1da = 1,660*10 -24 g

J. L. Snchez Guilln Pgina I-2-8


I) Biomolculas 2) Biomolculas

monmero

Fig. 14 Fragmento de la molcula de almidn. El almidn es un polmero formado por el monmero


glucosa.

ENLACES INTRA E INTERMOLECULARES

Los medios biolgicos son una mezcla compleja de compuestos qumicos, tanto org-
nicos como inorgnicos. Unos son de pequeo tamao: como el in H+ (1da). Otros,
como los cidos nucleicos, pueden tener 10 8 da o incluso ms. Todas estas molculas van
a interaccionar entre s. La principal de estas interacciones es la reaccin qumica en la
que se produce una trasformacin qumica de las sustancias que intervienen en ella.
Otros tipos de interaccin son los diferentes enlaces que pueden darse entre molculas o
entre partes de una misma molcula. Estos enlaces van a dar una mayor estabilidad a las
macromolculas por la formacin de agregados o de molculas de mayor tamao. Estas
uniones pueden ser, entre otras:

1-Enlaces inicos. Se suelen dar preferentemente en molculas que contienen grupos


-COOH y -NH2 . Estos grupos en agua se encuentran ionizados:

-COOH -COO- + H+
-NH2 + H+ -NH3 +

El enlace se debe a las fuerzas de carcter elctrico que se establecen entre las cargas
negativas de los grupos -COO- y las positivas de los grupos -NH+ 3 , bien dentro de una
misma molcula o entre molculas prximas. Estos enlaces en medio acuoso son muy
dbiles.

2- Los puentes disul fu ro. Se llama as a los enlaces covalentes que se forman al
reaccionar entre s dos grupos -S-H para dar -S-S- . Este tipo de enlaces son extraor-
dinariamente resistentes. Los encontraremos en las protenas uniendo las subunidades

J. L. Snchez Guilln Pgina I-2-9


I) Biomolculas 2) Biomolculas

que componen algunas molculas proteicas.

3-Enlaces o puentes de hidrgeno. Se trata de


enlaces dbiles pero que si se dan en gran
nmero pueden llegar a dar una gran esta-
bilidad a las molculas. - +
Los enlaces de hidrgeno se deben a la mayor
Grupo -COOH Grupo H2N-C-
o menor electronegatividad de los elementos
que participan en un enlace covalente. As,
Fig. 15 Enlaces inicos entre grupos -COOH y
por ejemplo, en los grupos -C-O-H, el oxge no H2N-
es ms electronegativo que el hidrgeno y
atrae hacia s el par de electrones que forma el
enlace covalente. En las proximidades del
oxge no habr un exceso de carga negativa y,
por el contrario, el hidrgeno estar cargado
positivamente. Lo mismo sucede con los
grupos -C-N-H, u otros, en los que tambin se
produce una diferencia de electronegatividad.
Como consecuencia se generarn fuerzas
elctricas entre tomos que presentan un
exceso de carga positiva (H) y otros con
exceso de carga negativa (O, por ejemplo).
Estos enlaces son de gran importancia en
determinados compuestos y, en particular, en
las protenas y en los cidos nucleicos.
Fig. 16 Puentes disulfuro (4) entre las
4-Fuerzas de Van der Waals. Se trata de subunidades de una protena.
fuerzas de carcter elctrico debidas a peque-
as fluctuaciones en la carga de los tomos.
Actan cuando las molculas se encuentran
muy prximas unas a otras.

5- Uniones hidrofbicas. Ciertas sustancias


insolubles en agua cuando estn en un medio
acuoso van a mantenerse unidas entre s por
su repulsin al medio en el que se encuentran.
Estas uniones, aunque son muy dbiles, van a
ser de gran importancia en el mantenimiento
de los componentes lipdicos de la Fig. 17 Puentes o enlaces de hidrgeno entre
membranas celulares y en la configuracin de las bases nitrogenadas del ADN.
muchas protenas.

Es de destacar que los enlaces ms dbiles, inicos y de hidrgeno, particularmente,


pueden contribuir en gran manera a la estabilidad de la configuracin de una molcula
cuando se dan en gran nmero.

J. L. Snchez Guilln Pgina I-2-10


I) Biomolculas 3) El agua

I-3

EL AGUA

IMPORTANCIA DEL AGUA PARA LOS SERES VIVOS

El agua es el lquido ms abundante de la corteza y uno de los pocos lquidos naturales.


No es de extraar entonces que el agua sea una sustancia esencial en los seres vivos. El
agua es el componente ms abundante en los medios orgnicos, los seres vivos contienen
por trmino medio un 70% de agua. No todos tienen la misma cantidad, los vegetales tienen
ms agua que los animales y ciertos tejidos (por ejemplo: el tejido graso) contienen menos
agua -tiene entre un 10% a un 20% de agua- que otros como, por ejemplo: el nervioso, con
un 90% de agua. Tambin vara con la edad, as, los individuos jvenes tienen ms agua
que los adultos (la carne de ternera es ms tierna que la de vaca).

El agua en los seres vivos se encuentra tanto intra como extracelularmente. El agua
intracelular, la que est en el interior de las clulas, representa 2/3, aproximadamente, del
agua que contiene un ser vivo y el agua extracelular representa el tercio restante. Esta
ltima se encuentra baando las clulas o circulando en forma de sangre, linfa, savia, etc.

En los seres unicelulares y en los organismos acuticos el agua es adems su medio


ambiente.

El agua no es un simple medio ni una mera fase inerte, es un lquido muy reaccionable.
Interviene en muchas reacciones qumicas, bien como reactivo o como producto de la
reaccin, y resulta imprescindible para la estabilidad de muchas sustancias biolgicas, por
ejemplo, las protenas.

Por ltimo diremos que la vida se origin hace ms de 3500 millones de aos en el medio
acutico y las condiciones de aquel ambiente primitivo imprimieron un sello permanente en
la qumica de los seres vivos. Todos los seres vivos han sido diseados alrededor de las
propiedades caractersticas del agua, tales como su carcter polar, sus enlaces de
hidrgeno y sus elevados puntos de fusin, ebullicin, calor especfico y tensin
superficial.

J. L. Snchez Guilln Pgina I-3-1


I) Biomolculas 3) El agua

ALGUNAS PROPIEDADES DEL AGUA

Masa molecular.......... 18 da
Punto de fusin......... 0 oC (a 1 atm)
Punto de ebullicin .... 100 oC (a 1 atm)
Densidad (a 4 0 C)........ 1g/cm 3
Densidad (00 C).......... 0'97g/cm 3 Fig. 1 Modelo de la molcula de agua

ESTRUCTURA QUMICA DEL AGUA

La molcula de agua est formada por dos


tomos de hidrgeno y uno de oxgeno. En el
agua existen tambin los productos resultantes oxgeno =
de la disociacin de algunas de sus molculas: el
in H3 O+ y el OH-.

H
En la molcula de H2 O los enlaces covalentes H
+
+
entre el oxgeno y los dos tomos de hidrgeno
forman un ngulo de 104'5 0 . Adems, el tomo
de oxgeno atrae hacia s los electrones del Fig. 2 Representacin de la molcula de agua.

enlace covalente. Esto hace que la molcula


presente un exceso de carga negativa en las proximidades del tomo de oxgeno y un
exceso de carga positiva en los tomos de hidrgeno. Por lo tanto, cada molcula de agua
es un dipolo elctrico.

ESTRUCTURA QUMICA DEL AGUA COMO SUBSTANCIA

Al ser las molculas de agua dipolos elctricos se


establecen enlaces de hidrgeno entre el tomo + =
de oxgeno de una molcula y los tomos de
hidrgeno de las molculas vecinas. Estos enlaces
de hidrgeno se forman y se escinden a gran
+
velocidad, aunque su estabilidad disminuye al
elevarse la temperatura.

Debido a estos enlaces las molculas de agua se


mantienen unidas - cohesividad - y el agua es
=
lquida a temperaturas a las que otras sustancias
de masas moleculares similares como el CH4 y el +
H2 S son gaseosas. De la cohesividad dependen +
tambin una serie de propiedades del agua de gran
Fig. 3 Formacin de enlaces de hidrgeno
importancia para los seres vivos.
entre molculas de agua.

J. L. Snchez Guilln Pgina I-3-2


I) Biomolculas 3) El agua

COHESIVIDAD DEL AGUA

La cohesividad, debida a los puentes de


=
hidrgeno entre las molculas de agua, es
responsable de importantes caractersticas del O = H
+

+ +
agua y de muchas de las funciones que el agua
cumple en los seres vivos. As, son debidas a H H O +
la cohesividad:
Enlace de hidrgeno
H
- Fenmenos como el de la capilaridad, que Fig. 4 Los enlaces de hidrgeno entre
permite la ascensin de la savia a travs molculas de agua son los responsables de la
cohesividad de sus molculas.
de los finsimos conductos que forman
los vasos leosos en las plantas.

- Es tambin responsable de que el agua sea un


lquido prcticamente incompresible
capaz de dar volumen y turgencia a
muchos seres vivos (p.e.:gusanos) y por
ejemplo, es la responsable del esqueleto
hidrosttico de las plantas.

- Tambin es responsable de la elevada tensin


superficial del agua; propiedad que
Fig. 5 Los enlaces de hidrgeno entre
permite las deformaciones del molculas de agua son los responsables de la
cohesividad de sus molculas.
citoplasma celular y los movimientos
internos en la clula.

- Como ya se ha dicho es la responsable de los elevados puntos de fusin y ebullicin del


agua. Otras sustancias de masas moleculares parecidas son gaseosas a
temperaturas en las que el agua es lquida. El hecho de que el agua sea lquida en
su mayor parte a las temperaturas que se dan en la Tierra ha posibilitado el
desarrollo de la vida en nuestro planeta.

- De su elevado calor especfico: cantidad de calor necesaria para elevar la temperatura de


una cierta masa de agua. Esto hace que el agua almacene o libere una gran cantidad
de calor al calentarse o al enfriarse; lo que permite que el agua acte como
amortiguador trmico, evitando bruscas alteraciones de la temperatura y evitando de
esta forma que, por ejemplo, algunas molculas como las protenas, muy sensibles
a los cambios trmicos, se alteren.

- Su elevado calor de vaporizacin: cantidad de calor necesario para evaporar un gramo de


agua es tambin debido a la cohesividad, pues para pasar del estado lquido al

J. L. Snchez Guilln Pgina I-3-3


I) Biomolculas 3) El agua

gaseoso es necesario romper los enlaces CO- O-CH2


de hidrgeno entre las molculas de
CO- O-CH
agua.
CO- O-CH2

Estas dos ltimas propiedades son de gran


Fig. 6 Los triacilglicridos (grasas neutras)
importancia a la hora de regular la son sustancias muy insolubles en agua.
temperatura en muchos seres vivos, por
ejemplo: la sudoracin.

SOLUBILIDAD

El agua es un buen disolvente de los


compuestos inicos. Esto es debido a que el
agua es una sustancia polar. Las molculas de
agua se disponen alrededor de los iones
positivos con la parte negativa de su molcula
hacia ellos y en el caso de los iones negativos
les enfrentan la parte positiva. Tambin son Fig. 7 Modelo de triacilglicrido (grasa
neutra). Estas sustancias tienen pocos grupos
solubles en agua las sustancias polares, por polares y una gran proporcin de -CH- y poco
ejemplo: los glcidos; normalmente, estas oxgeno.
sustancias tienen una elevada proporcin de
oxgeno. Por el contrario, aquellas sustancias
O
orgnicas que presentan una elevada proporcin C O- CH 2

de hidrgeno y pocos tomos de oxgeno son O


C O- CH
poco solubles en agua; por ejemplo: los lpidos. O CH3
H2COPOCHCHNCH3

OH CH3
Algunas sustancias tienen una parte de su
molcula que es soluble en agua (hidrfila) y otra Fig. 8 Los fosfoglicridos son sustancias
parte insoluble (hidrfoba). Estas sustancias se anfipticas.
dice que son anfipticas. Las sustancias
anfipticas, cuando estn en un medio acuoso,
orientan su molcula y dan lugar a la formacin
de micelas, monocapas o bicapas.

Las grandes molculas, como las protenas, si


son solubles en agua, forman un tipo especial
de disoluciones denominadas disoluciones
coloidales. Las disoluciones coloidales van a
Estado de sol Estado de gel
poder estar en dos estados: sol y gel. En el
estado de sol predomina la fase dispersante, el macromolcula agua u otro disolvente

agua, por ejemplo, sobre la fase dispersa y la


solucin es ms fluida. En estado de gel
predomina la fase dispersa, por ejemplo: la Fig. 9 Estados de sol y de gel de una
protena, sobre la fase dispersante, y la disolucin coloidal.
solucin es ms viscosa. El paso de un estado a

J. L. Snchez Guilln Pgina I-3-4


I) Biomolculas 3) El agua

otro es reversible y diversos factores fsicos y


qumicos pueden hacer que una solucin pase
de un estado a otro sin necesidad de variar la
concentracin de soluto. Estos factores pueden
ser: el pH, la temperatura o una alteracin en la
concentracin de determinados iones presentes
en el medio. Los soluciones coloidales pueden
separarse por dilisis por medio de membranas
cuyos poros slo permiten pasar las molculas
de pequeo tamao y no las partculas
Fig. 10 Hemodilisis.
coloidales.

IONIZACIN Y pH
Parte polar Parte apolar

Parte de las molculas (10 -7 moles por litro de


agua, 1 mol=6 '023x10 23 molculas) estn
disociadas (ver en la figura 13 la ecuacin de
ionizacin del agua).

Las sustancias cidas al disolverse en agua se


disocian y producen iones H+ que aumentan la
concentracin de iones H3 O+ del medio. Las
Fig. 11 Los lpidos anfipticos forman
sustancias bsicas se disocian tambin monocapas sobre una superficie acuosa.
produciendo iones OH- que se unen a los iones
H3 O+ formndose dos molculas de agua, por lo
que la concentracin de iones H3 O+ del agua
disminuye.

La concentracin de iones H3 O+ del agua se


puede tomar, por lo tanto, como una medida de
su acidez, si es alta, o de su basicidad, si es
baja. El pH se define como el logaritmo decimal
negativo de la concentracin de iones H3 O+ de
una disolucin. En el agua pura (neutra) la Fig. 12 Bicapa formada por un lpido
concentracin de protones es de 10 -7 moles por anfiptico.
litro (pH=7). Por lo tanto:

si el pH < 7, la disolucin ser cida;


H2O + H2O H3O+ + OH-
si el pH = 7, ser neutra;
si el pH > 7, ser bsica.
+ + + -

Puede decirse, a modo de ejemplo, que el pH


de la sangre es ligeramente bsico (pH=7'37)
Fig. 13 Ionizacin del agua.
mientras que el del estmago es fuertemente
cido (pH=1).

J. L. Snchez Guilln Pgina I-3-5


I) Biomolculas 3) El agua

Las variaciones del pH son de gran importancia H2O + HA H3O+ + A-


en muchos procesos biolgicos de la clula.
As, por ejemplo, en los procesos de
acumulacin de energa en el ATP o en la
activacin de las enzimas de los lisosomas.

EL AGUA COMO SUSTANCIA REACCIONABLE


Fig. 14 Ionizacin de un cido en agua.

El agua participa activamente en los procesos qumicos que se dan en la clula, pues es en
s misma una sustancia muy reaccionable. As:

- En las reacciones de hidrlisis. Se trata de la rotura de un enlace covalente por la


adicin de H y OH a los tomos que estn unidos entre s. De esta manera se
separan, por ejemplo, los aminocidos que forman las protenas cuando estas se
hidrolizan; el H y el OH se unen al nitrgeno y al carbono que forman el enlace
peptdico en un proceso similar, pero inverso, al de la formacin del enlace. Algo
parecido ocurre con otros enlaces como con el glicosdico o con el enlace ster.

- El agua puede ser adicionada a un doble enlace formndose una funcin alcohol.

- El agua tiene tambin una gran importancia en la fotosnte sis por ser la sustancia
que repone los electrones que se utilizan en los procesos de sntesis de sustancias
orgnicas.

SOLUCIONES AMORTIGUADORAS1

Los procesos qumicos que se dan en la clula producen sustancias que alteran el pH del medio
celular. Ciertas sustancias actan como amortiguadores del pH o tampones evitando que ste sufra
grandes variaciones. As, por ejemplo, el in bicarbonato (HCO3 -) acta como tampn en los medios
orgnicos. Si el pH es cido habr un exceso de iones H3 O+ . Estos sern captados por el in HCO-3
que se transformar en H2 CO3 y H2 O, con lo que el pH aumentar. El H2 CO3 , a su vez, se descompo-
ndr en CO2 y H2 O. El proceso se desarrolla a la inversa si hay pocos iones H3 O+ . El in bicarbonato
acta como un tampn eficaz para valores de pH en las proximidades de 7, que es el pH de la
sangre. En los medios intracelulares el tampn ms frecuente es el in fosfato(H 2 PO4 -).

1
Los textos en letra itlica suelen ser textos de ampliacin o de aclaracin y no entran en los
exmenes.

J. L. Snchez Guilln Pgina I-3-6


I) Biomolculas 3) El agua

LAS SALES MINERALES

gramos/litro
Podemos encontrarlas disueltas en los medios
Cloruro de sodio 8,0
celulares internos o externos, o precipitadas en
huesos y caparazones. Cuando estn disueltas se Cloruro de potasio 0,2

encuentran disociadas en cationes y aniones. Los Cloruro de calcio 0,2

principales cationes y aniones presentes en los Cloruro magnsico 0,1


medios orgnicos son:
Bicarbonato de sodio 1,0

Fosfato monosdico 0,05


Cationes: Na+ , K+ , Ca+ 2 y Mg +2 .
Aniones:Cl-, SO4 -2 , PO4 -3 , CO3 -2 , HCO3 - y NO3 - Glucosa 1,0

Agua destilada Hasta 1000 cm3

La proporcin de iones, y sobre todo de cationes,


Fig. 15 Solucin de Tyrode, utilizada para
debe mantenerse constante en los medios orgnicos cultivos de tejidos, preservado de rganos e
pues ciertos cationes tienen efectos antagnicos. irrigaciones de la cavidad peritoneal.
Por ejemplo, el Ca+ + y el K+ tienen funciones
antagnicas en el funcionamiento del msculo
cardaco .

PRINCIPALES FUNCIONES DE LAS SALES


MINERALES

- Esqueletos y caparazones.
- Mantener la salinidad.
- Estabilizar las disoluciones. Por ejemplo, los
amortiguadores del pH.
Fig. 16 Las conchas de los moluscos estn
- Especficas: Movimiento muscular, impulso formadas por una matriz orgnica de naturaleza
nervioso etc. fundamentalmente protenica (conquiolina) y un
depsito inorgnico de carbonato clcico.

J. L. Snchez Guilln Pgina I-3-7


I) Biomolculas 3) El agua

J. L. Snchez Guilln Pgina I-3-8


I) Biomolculas 4) Glcidos

I-4

GLCIDOS

CONCEPTO, CARACTERSTICAS Y FUNCIONES GENERALES DE LOS GLCIDOS

Los glcidos son compuestos orgnicos constituidos H


por carbono, hidrgeno y oxgeno; en algunos casos
C=O
pueden tener adems otros elementos qumicos
H-C-O-H
como nitrgeno o azufre.
H-O-C-H

Se les ha llamado hidratos de carbono porque H-C-O-H


algunos responden a la frmula general Cn(H2 O)m y H-C-O-H
azcares por su sabor dulce, aunque slo los de baja H-C-O-H
masa molecular lo tienen. H

Concepto: Qumicamente son polihidroxialdehdos, Fig. 1 Frmula lineal de la D-


glucosa.
polihidroxicetonas, sus derivados o sus polmeros
(ms adelante se explicarn estos conceptos).
CH2OH
Algunos son molculas de relativamente baja masa
O
molecular; la glucosa tiene una Mm=180 da. Otros, H OH
como el almidn, tienen masas moleculares de ms H

de 100 000 da y son grandes molculas,


macromolculas. OH OH H H

Sus propiedades fsicas y qumicas son muy varia-


H OH
das. Y en cuanto a sus funciones biolgicas:
Fig. 2 Frmula cclica de la D-
-La glucosa, sacarosa, glucgeno y almidn glucosa.
son sustancias energticas. Los seres vivos
obtienen energa de ellas o las usan para almacenar energa. Esta energa est
contenida en determinados enlaces que unen los tomos de estas molculas.

-Celulosa y quitina son estructurales. Forman parte de las paredes de las clulas
vegetales (celulosa) o de las cubiertas de ciertos animales (quitina).

-Ribosa y desoxirribosa forman parte de los cidos nucleicos.

J. L. Snchez Guilln Pgina I-4-1


I) Biomolculas 4) Glcidos

Estos son slo algunos ejemplos que nos pueden ilustrar sobre las funciones que cumplen
los glcidos.

CLASIFICACIN DE LOS GLCIDOS

Atendiendo a su complejidad se clasifican en:

A) Monosacridos u osas: Son los ms sencillos. No son hidrolizables; esto es, no se


pueden descomponer por hidrlisis en otros glcidos ms simples.
Constituyen los monmeros a partir de los cuales se forman los dems
glcidos.

B) sidos: Formados por la unin de varios monosacridos mediante enlaces "O-


glicosdicos", pudiendo poseer en su molcula otros compuestos diferentes
de los glcidos. Son hidrolizables, descomponindose en los monosacridos y
dems compuestos que los constituyen. Se dividen en:

* Holsidos. Son aquellos que estn constituidos por carbono, hidrgeno y


oxgeno, exclusivamente. A su vez se subclasifican en:

-Oligosacridos, formados por entre 2 y 10 monosacridos unidos.


-Polisacridos, formados por un gran nmero de monosacridos.

* Hetersidos. Formados por osas y otros compuestos que no son glcidos.


Por lo tanto, adems de carbono, hidrgeno y oxgeno,
contienen otros elementos qumicos.

LOS MONOSACRIDOS

CONCEPTO Y NATURALEZA QUMICA

Concepto: Qumicamente son polihidroxialdehdos, polihidroxicetonas o sus derivados. Se


caracterizan por no ser hidrolizables.

Un polihidroxialdehdo es un compuesto orgnico que tiene una funcin aldehdo en el


primer carbono y en los restantes carbonos una funcin alcohol. Las polihidroxicetonas en
lugar de una funcin aldehdo tienen una funcin cetona, normalmente en el carbono 2. Los
monosacridos que tienen funcin aldehdo se llaman aldosas y cetosas los que tienen una
funcin cetona.

Los monosacridos responden a la frmula emprica Cn(H2 O)n, de aqu proviene el nombre
de hidratos de carbono. El valor de n normalmente est comprendido entre 3 y 7.

J. L. Snchez Guilln Pgina I-4-2


I) Biomolculas 4) Glcidos

Segn el nmero de tomos de carbono se


H
clasifican en : H
C=O
H-C-O-H
H-C-O-H
Triosas........n = 3 C=O
H-O-C-H
Tetrosas.......n = 4 H-C-O-H
Pentosas.......n =5 H-C-O-H
H-C-O-H
Hexosas........n = 6 H-C-O-H
H-C-O-H
Heptosas.......n = 7 H-C-O-H
H
H
As, un monosacrido con 6 tomos de A B
carbono y con la funcin aldehdo ser una
Fig. 3 A) La glucosa, una aldohexosa; B) la
aldohexosa; si tiene cuatro tomos de carbono
ribulosa. , una cetopentosa.
y una funcin cetona, ser una cetotetrosa, y
as sucesivamente.

PROPIEDADES FSICAS Y QU MICAS DE LOS MONOSACRIDOS

- Propiedades fsicas: Los monosacridos son slidos, cristalinos, incoloros o blancos, de


sabor dulce. Como los grupos hidroxilo son polares, los monosacridos son muy solubles en
agua, pues se establecen enlaces polares con las molculas de agua.

- Propiedades qumicas: El grupo carbonilo reduce fcilmente los compuestos de cobre


(licor Fehling) y de plata oxidndose y pasando a grupo cido. Esta propiedad es carac-
terstica de estas sustancias y permite reconocer su presencia, pues la reduccin de las
sales cpricas del licor de Fehling a cuprosas hace virar el reactivo del azul al rojo ladrillo.

Cu+ + ------- Cu+


azul rojo

H
1 H
C=O 1
2 H-C-O-H
H-C-O-H 2
3 C=O
H-O-C-H 3
FRMULA LINEAL DE LOS MONOSACRIDOS 4 H-C-O-H
H-C-O-H 4
5 H-C-O-H
H-C-O-H 5
6 H-C-O-H
DIASTEREOISOMERA H-C-O-H
H
H
Las frmulas lineales de los monosacridos se A B

escriben con el carbono 1, el carbono que lleva


Fig. 4 Numeracin de los tomos de carbono
la funcin aldehdo o el carbono ms prximo a en A) una aldosa y en B) una cetosa.
la funcin cetona, en la parte superior y el resto

J. L. Snchez Guilln Pgina I-4-3


I) Biomolculas 4) Glcidos

de los carbonos en orden descendente.

Los monosacridos tienen tomos de carbono


-C- -C-
asimtricos (carbonos que tienen 4 sus- H-C-O-H H-O-C-H
tituyentes diferentes) por lo que presentan
-C- -C-
diastereoisomera (ismeros pticos). Los
diastereoismeros se diferencian en su
Fig. 5 Diferenciacin en la posicin de los
formulacin en la colocacin de los H y OH de
-OH en los carbonos asimtricos de los
cada carbono asimtrico a un lado u otro del monosacridos.
esqueleto carbonado de la molcula.

El nmero de ismeros pticos, para un mono-


sacrido dado, es de 2 n, siendo n el nmero de
tomos de carbono asimtricos que tenga. La
glucosa con cuatro tomos de carbono asimtri-
cos tendr 2 4 = 16 ismeros pticos. De los 2 n
ismeros posibles de un monosacrido, la mitad Fig. 6 Disposicin de los sustituyentes
pertenecen a la serie D, y la otra mitad son sus alrededor de un carbono asimtrico.
imgenes especulares y pertenecen a la serie L.
Los monosacridos que tienen el OH del ltimo tomo de carbono asimtrico a la derecha
pertenecen a la serie D, los de la serie L lo tienen a la izquierda. En los seres vivos nor-
malmente slo aparece una de las formas. Por convenio, se ha decidido que esta forma es
la D.

H H H H
C O C O C O C O
H C OH HO C H H C OH HO C H
H C OH H C OH HO C H HO C H
H C OH H C OH H C OH H C OH
H H H H

1 2 3 4

Fig. 7 Diastereoismeros de una aldotetrosa. Las formas 1 y 2 son D; las formas 3 y 4 son L. 1 y 4 son
enantimeras al se una la imagen especular de la otra. Lo mismo ocurre con 2 y 3.

EL HEMIACETAL INTRAMOLECULAR.
CICLACIN DE LA MOLCULA

Si las aldopentosas y las hexosas se disuelven en agua, o si forman parte de los disac-
ridos o polisacridos, el grupo carbonilo (-C=O) reacciona con el grupo hidroxilo ( -C-O-H)
del carbono 4, en las aldopentosas, o del carbono 5, en las hexosas, formndose un hemia-
cetal (reaccin entre un alcohol y un aldehdo) o un hemicetal (reaccin entre un alcohol y
una cetona) y la molcula forma un ciclo.

J. L. Snchez Guilln Pgina I-4-4


I) Biomolculas 4) Glcidos

Las frmulas c clicas de la hexosas se repre-


sentan, segn la proyeccin de Haworth, con el
plano del anillo perpendicular al plano de es-
critura, los carbonos 2 y 3 dirigidos hacia delan-
te, el carbono 5 y el oxge no del anillo hacia
detrs.

Los OH que en la frmula lineal estaban a la de-


Fig. 8 Pirano y furano.
recha se ponen por debajo del plano y los que
estaban a la izquierda se ponen hacia arriba. En
la formas D el -CH2 OH se pone por encima y en H H
las L por debajo. C O H-O C

H C O H H C O H

Si las frmulas c clicas forman un anillo penta- H O C H H O C H


O
gonal reciben el nombre de furanosas, mientras H C O H H C O H

que si ste es hexagonal se denominan pirano- H C O H H C

sas. En stas ltimas, a su vez, el anillo puede H C O H H C O H

H H
adoptar dos disposiciones diferentes: de silla, si
el carbono 1 y el 4 estn a ambos lados del Fig. 9 Formacin de un hemiacetal en una
plano formado por los carbonos 2, 3 y 5, y de aldohexosa. Dentro del crculo el OH
bote o nave si estn a un mismo lado. hemiacetlico.

FORMAS y H
HO H
CH2OH OH

HO CH2OH H
O
Cuando se produce la ciclacin de la molcula H
H O
HO H
aparece un nuevo tomo de carbono asimtrico, H HO OH
HO H

el carbono 1 en las aldosas o el 2 en las ceto- H


H OH

sas. Este carbono recibe el nombre de carbono Fig. 10 Formas de bote o silla de la glucosa.
anomrico. El OH de este carbono, -OH hemia-
cetlico, puede estar a uno u otro lado del plano
de la molcula originndose dos nuevos isme-
CH2OH
ros pticos. Cada uno de estos ismeros se
distingue mediante los smbo los y (formas C O
H OH
y ). H
C C
OH OH H
La forma se representa situando el OH H
C C
hemiacetlico por debajo del plano de la
molcula; en la forma se sita por encima. Las H OH

formas y de un monosacrido reciben el


Fig. 11 Forma cclica de la D glucosa.
nombre de formas anmeras1 .
1
Curiosidad: Al aparecer un nuevo tomo de carbono asimtrico cambia el ngulo con el que el monosacrido desva el
plano de la luz polarizada. Por ejemplo:

D-glucosa a 201C desva el plano +112.21


D-glucosa a 201C " " +18.7 1

J. L. Snchez Guilln Pgina I-4-5


I) Biomolculas 4) Glcidos

NOMENCLATURA DE LAS FORMAS CH2OH


O CH2OH
CCLICAS
C C
Para nombrar la forma cclica de un H
H OH
OH
monosacrido, se indica en primer lugar si es C C
o , a continuacin, si es D o L y, por ltimo, el
OH H
nombre del monosacrido y el tipo de anillo. Por
ejemplo: -D-glucopiranosa, -D-fructofuranosa
Fig. 12 Frmula de la D fructofuranosa.

ORIENTACIN DE LAS FRMULAS CCLICAS DE LOS MONOSACRIDOS

Normalmente, las frmulas cclicas de los monosacridos se representan con el carbono


anomrico hacia la derecha, el resto de los carbonos del ciclo por orden en el sentido de las
agujas del reloj. No obstante, la molcula puede representarse bien girada (giro de 180 o
segn el eje Y) o volteada (giro de 180 o segn el eje Z). En los esquemas se ha representado
la -D-fructofuranosa en posicin normal (a), girada (b) y volteada (c).

OH H
O 1 CH OH
O H
6 CH2OH 2
4 OH
3
C C
5
C C HOH2C CH2OH
2
C C
5

2
H OH H H
CH2OH
H OH
HOH2C
H OH 2 C C5
C C
C C OH H 3 4
4 3 O OH HO
HO H

a) b) c)

La mezcla de y " " +52.7 1

J. L. Snchez Guilln Pgina I-4-6


I) Biomolculas 4) Glcidos

EJEMPLOS DE MONOSACRIDOS DE INTERSBIOLGICO

CH2OH
CH2OH
O CH2OH
C O
H OH
H C C
C C H OH
H OH
OH OH H H
C
C C
C
OH H
H OH

Glucosa: Sustancia muy difundida tanto entre los Fructosa: Cetohexosa. Sustancia muy difundida
vegetales (uvas) como entre los animales. Forma entre las plantas, sobre todo en sus frutos, y en la
parte de muchos disacridos y polisacridos. miel. En el hgado se transforma en glucosa. Junto
Importante fuente de energa de las clulas. En la con la glucosa forma el disacrido sacarosa.
sangre hay un uno por mil de glucosa procedente de
la digestin.

CH2OH
O CH2OH
O
OH OH

C C C C
H H H H
H H
H H
C C C C
OH OH OH H

Ribosa: Aldopentosa. Forma parte de muchas Desoxirribosa: Derivada de la ribosa. Le falta el


sustancias orgnicas de gran inters biolgico, como grupo alcohol en el carbono 2. Forma parte del ADN.
el ATP o el ARN.
CH2OH
CH2OH

C O C O
HO H H H
H H
C C C C
H OH H OH
OH OH H OH
C C
C C
H OH
H NH

CO
CH3

Galactosa: Junto con la glucosa forma la lactosa, N-acetilglucosamina: Derivado de la glucosa. Se


disacrido de la leche. encuentra en las paredes de las bacterias y es
tambin el monmero que forma el polisacrido
quitina presente en el exoesqueleto de los insectos y
las paredes celulares de muchos hongos.

J. L. Snchez Guilln Pgina I-4-7


I) Biomolculas 4) Glcidos

LOS OLIGOSACRIDOS. EL ENLACE O-GLICOSDICO.

Los oligosacridos estn formados por la unin de 10 o menos de 10 monosacridos


mediante un enlace O-glicosdico.

As, si reaccionan el -OH del carbono anomrico de un monosacrido con otro -OH de otro
monosacrido, ambas sustancias quedarn unidas mediante un enlace O-glicosdico. Como
consecuencia de la unin se forman un disacrido y una molcula de agua.

C6 H12 O6 + C6 H12 O6 C12 H22 O11 + H2 O

El -OH o los -OHs que intervienen en la unin pueden encontrarse bien en forma o , lo
que dar lugar a sustancias diferentes.

CH2OH CH2OH
O O
H H H
H H
H

OH OH H OH OH H
OH OH

H OH H OH
H2O

CH2OH CH2OH
O O
H H H H
H H

OH OH H H
O OH OH

H OH H OH

Fig. 13 Formacin de maltosa, disacrido reductor, mediante la unin 14 de dos molculas de glucosa.

Los disacridos son sustancias de propiedades


similares a las de los monosacridos. Ahora
bien, si los -OH de los carbonos anomricos de
ambos monosacridos intervienen en el enlace
O-glicosdico, enlace dicarbonlico, el
disacrido no ser reductor, pues no tiene
ningn OH hemiacetlico/hemicetlico libre y es
este OH el que les da las propiedades
reductoras.

Los oligosacridos se encuentran, junto a Fig. 14 Modelo de esferas de la sacarosa, un


lpidos y protenas, en la membrana disacrido.
plasmtica donde actan como receptores de
muchas sustancias y como molculas que sirven para que las clulas se reconozcan entre s.

La hidrlisis de los oligosacridos proporciona los correspondientes monosacridos:

C12 H22 O11 + H2 O C6 H12 O6 + C6 H12 O6

J. L. Snchez Guilln Pgina I-4-8


I) Biomolculas 4) Glcidos

EJEMPLOS DE DISACRIDOS DE INTERSBIOLGICO

OH H
CH2OH
O H
H
H HO CH2OH
H
O
OH H
OH
H
HOCH2 O

H OH

Sacarosa: Formada por -D-glucosa y -D-fructosa (enlace 12), unidas por los OH de los carbonos anomricos y
por lo tanto no reductor. Es el azcar de mesa. Se encuentra en la caa de azcar y en la remolacha.

CH2OH CH2OH
O O
HO H
H
H H
O

OH H H
H OH OH
H

H OH H OH

Lactosa: Formada por -D-galactosa y D-glucosa, unidas 1 4 . Reductor. Se encuentra en la leche de los mamferos.

CH2OH CH2OH
O O
H H H H
H H

OH H H
OH O OH OH

H OH H OH

Maltosa: Formada por dos D-glucosas unidas por un enlace 1 4. Reductor. Se obtiene por hidrlisis del almidn y del
glucgeno. Aparece en la germinacin de la cebada empleada en la fabricacin de la cerveza. Tostada se emplea como
sucedneo del caf (malta).
CH2OH CH2OH
O O
H H OH
H H
O

OH H H
OH OH
H H

H OH H OH

Celobiosa: Formada por dos D-glucosas unidas por un enlace 1 4. Reductor. Se obtiene por hidrlisis de la celulosa.

J. L. Snchez Guilln Pgina I-4-9


I) Biomolculas 4) Glcidos

POLISACRIDOS

Uno de los monosacridos de la maltosa presenta libre su OH hemiacetlico y podr unirse


mediante un nuevo enlace O-glicosdico al OH alcohlico de otro monosacrido. Este
proceso puede repetirse y formarse un compuesto constituido por la unin de muchos
monosacridos al que llamaremos polisacrido.

O O

HO O O
OH
O O HO
OH
HO O O
O
OH
HO O O
OH
HO
OH

Fig. 15 Fragmento de almidn. El almidn es un polisacrido compuesto por molculas de glucosa.

Los polisacridos son sustancias inspidas, amorfas e insolubles en agua, algunos, como el
almidn, pueden formar dispersiones coloidales.

Aunque los polisacridos podran estar constituidos por diferentes monosacridos, lo


normal es que sea un slo monosacrido el que forma la molcula. Los polisacridos son
macromolculas, molculas de elevada masa molecular, miles o centenares de miles de dal-
tons. Por ejemplo, cada molcula de celulosa, polisacrido vegetal, contiene de 300 a 3 000
molculas de glucosa y tiene un peso molecular que oscila entre 54 000 y 540 000 da.
Algunos polisacridos presentan ramificaciones.

Es de destacar que los polisacridos, al tener un slo -OH hemiacetlico por molcula libre,
presentan un carcter reductor tan pequeo que se puede considerar como que no son
reductores.

POLISACRIDOS DE INTERSBIOLGICO

Los polisacridos de mayor importancia biolgica estn formados por un slo tipo de
monosacrido. Se trata, por lo tanto de homopolisacridos. Veamos algunos ejemplos:

Fig. 16 Fragmento de amilosa. La amilosa es uno de los componentes del almidn.

El almidn: polisacrido con funcin energtica. Es sintetizado por los vegetales. Est

J. L. Snchez Guilln Pgina I-4-10


I) Biomolculas 4) Glcidos

formado por miles de molculas de glucosa en


unin 1 -- 4. La molcula adopta una
disposicin en hlice, dando una vuelta por cada
6 molculas de glucosa, adems, cada 12
glucosas, presenta ramificaciones por uniones
1 -- 6. El almidn se reconoce fcilmente por
teirse de violeta con disoluciones de iodo
(solucin de Lugol).

El glucgeno: Polisacrido de reserva energtica


en los animales. Se encuentra en el hgado y en Fig. 17 Estructura helicoidal del almidn y
los msculos donde se hidroliza del glucgeno. 1) Ramificaciones producidas por
transformandose en glucosa. Su estructura es las uniones 1-6.
similar a la del almidn, aunque ms ramificado
y su masa molecular es mucho mayor.

La celulosa: Sintetizada por los vegetales, tiene funcin estructural, formando parte
importante de la pared celular. Est formada por la unin 1 -- 4 de varios millares de
molculas de glucosa. Debido al tipo de enlace cada molcula de glucosa est girada 180 o
respecto a la anterior, lo que le da a la celulosa una estructura lineal pero "retorcida". Esta
disposicin permite que se formen gran cantidad de puentes de hidrgeno entre cadenas
yuxtapuestas, lo que produce muy fibras resistentes.

H OH H OH
CH2OH CH2OH
H O O H H O O H
HO HO
H H
H H

H H
OH H OH H
O
H H O H H O

OH
H
OH
CH2OH H CH2OH

celobiosa

Fig. 18 Fragmento de celulosa.

La quitina. Formada por un derivado nitrogenado de la glucosa: la N-acetil-glucosamina).


Constituye los exoesqueletos de los artrpodos.

CH2OH CH2OH CH2OH CH2OH

O O O O
H H H H
H H H H
O O O
OH H OH H OH H OH H
OH
H H H H

H NH H NH H NH H
C=O C=O C=O
CH3 CH3 CH3

quitobiosa

Fig. 19 Fragmento de quitina.

J. L. Snchez Guilln Pgina I-4-11


I) Biomolculas 4) Glcidos

Tambin podemos encontrar en los seres vivos


otros polisacridos ms complejos. Por ejemplo:

- Las pectinas, de las paredes celulsicas de los


vegetales, formadas por la
polimerizacin del cido galacturnico,
un derivado cido de la galactosa

- Los pptidoglucanos de las paredes


bacterianas, formados por polisacridos
asociados a cadenas peptdicas.

Fig. 20 Los exoesqueletos de los artrpodos


estn formados por quitina y otras sustancias.

J. L. Snchez Guilln Pgina I-4-12


I) Biomolculas 5) Lpidos

I-5

LPIDOS

CONCEPTO, PROPIEDADES Y FUNCIONES GENERALES

Concepto: Los lpidos son sustancias qumicamente muy diversas. Slo tienen en comn
el ser insolubles en agua u otros disolventes polares y solubles en disolventes no polares u
orgnicos, como el benceno, el ter, la acetona, el cloroformo, etc

Propiedades fsicas: Son sustancias untosas al tacto, tienen brillo graso, son menos densas
que el agua y malas conductoras del calor.

Funciones en los seres vivos: Los lpidos desempean importantes funciones en los seres
vivos. Estas son, entre otras, las siguientes:

- Estructural: Son componentes estructurales PROTECTORA TRANSPORTE


fundamentales de las membranas
celulares.
FUNCIONES

- Energtica: Al ser molculas poco oxidadas


sirven de reserva energticapues
proporcionan una gran cantidad de REGULADORA
ESTRUCTURAL
energa; la oxidacin de un gramo de ENERGTICA

grasa libera 9,4 Kcal, ms del doble que


Fig. 1 Funciones de los lpidos en los seres
la que se consigue con 1 gramo de
vivos.
glcido o de protena (4,1 Kcal).

- Protectora: Las ceras impermeabilizan las


paredes celulares de los vegetales y de
las bacterias y tienen tambin funciones
protectoras en los insectos y en los ver-
tebrados.

- Transportadora: Sirven de transportadores de


sustancias en los medios orgnicos.

- Reguladora del metabolismo: Contribuyen al


normal funcionamiento del organismo.
Desempean esta funcin las vitaminas
(A,D, K y E). Las hormonas sexuales y
las de la corteza suprarrenal tambin son
lpidos. Fig. 2 Modelo de esferas de un lpido, un
acilglicrido.
- Reguladora de la temperatura: Tambin sirven
para regular la temperatura. Por ejemplo, las capas de grasa de los mamferos
acuticos de los mares de aguas muy fras.

J. L. Snchez Guilln Pgina I-5-1


I) Biomolculas 5) Lpidos

SAPONIFICACIN DE LOS LPIDOS

Muchos lpidos, como por ejemplo: los cidos grasos, reaccionan con bases fuertes, NaOH
o KOH, dando sales sdicas o potsicas que reciben el nombre de jabones. Esta reaccin se
denomina de saponificacin. Son saponificables los cidos grasos o los lpidos que poseen
cidos grasos en su estructura.

R1-COOH + NaOH R1-COONa + H2O


cido orgnico hidrxido sdico Sal sdica (jabn) agua

Fig. 3 Reaccin de saponificacin entre un cido orgnico y el hidrxido sdico.

CLASIFICACIN

Segn den o no la reaccin de saponificacin, clasificaremos los lpidos en:

Saponificables No saponificables
cidos grasos Esteroides
Acilglicridos
Ceras
Fosfolpidos

Es de destacar que, adems de estas, que son las que estudiaremos, existen otras clases
de lpidos, como: los carotenoides, los terpenos, las prostaglandinas, etc.

LOS CIDOS GRASOS

Concepto. Son cidos orgnicos de


elevado nmero de tomos de carbono.
Este nmero es siempre par y oscila,
normalmente, entre 12 y 22.

Descripcin: La cadena carbonada puede


o no tener dobles enlaces. En el primer
caso, diremos que el cido graso es in-
saturado y en el segundo, saturado. Los
cidos grasos se diferencian por el
nmero de tomos de carbono y por el
nmero y la posicin de los dobles Tabla I: Los principales cidos grasos.
enlaces. A veces, por comodidad,
representaremos la cadena hidrocarbonada de los cidos grasos como una simple lnea

J. L. Snchez Guilln Pgina I-5-2


I) Biomolculas 5) Lpidos

quebrada.

La cadena de los cidos grasos saturado puede


disponerse totalmente extendida, mientras que
la cadena de los cidos grasos insaturados al
tener dobles enlaces adopta una disposicin
doblada.

Los cidos grasos no suelen encontrarse en


estado libre y se obtienen por hidrlisis cida o
enzimtica de los lpidos saponificables.
Fig. 4 1) Acido graso saturado (ac.
Palmtico) 2) cido graso insaturado (ac. Olico).

Propiedades qumicas

a) Reaccin de esterificacin: El grupo cido de los cidos grasos va a poder reaccionar con
los alcoholes para formar steres y agua.

R1-COOH + HOCH2-R2 R1-COO-CH2-R2 + H2O


cido orgnico alcohol ster agua

Fig. 5 Reaccin de esterificacin entre un cido graso y un alcohol para dar un ster y agua.

b) Reaccin de saponificacin: Como se ha dicho anteriormente, con bases fuertes como la


sosa (NaOH) o la potasa (KOH), dan las correspondientes sales sdicas o potsicas del
cido graso que reciben el nombre de jabones.

ACILGLICRIDOS O GRASAS
cidos grasos Glicerina

Son steres de la glicerina y de cidos grasos. COOH


HO-CH2
Si un cido graso esterifica uno de los grupos COOH + HO-CH

alcohol de la glicerina tendremos un COOH HO-CH2

monoacilglicrido, si son dos, un diacilglicrido, y


3H2O
si son tres, un triacilglicrido, triglicrido, tambin
llamados: grasas neutras. Estas sustancias por CO- O-CH2
saponificacin dan jabones y glicerina. CO- O-CH
Los acilglicridos sencillos contienen un slo CO- O-CH2
tipo de cido graso, mientras que los mixtos
Triacilglicrido
tienen cidos grasos diferentes.
Fig. 6 Reaccin de formacin de un
Los acilglicridos saponifican dando los triacilglicrido.
correspondientes jabones y glicerina.

J. L. Snchez Guilln Pgina I-5-3


I) Biomolculas 5) Lpidos

PROPIEDADES FSICAS DE LAS GRASAS Y


FUCIN BIOLGICA

Las propiedades fsicas de estas sustancias


son de gran importancia pues en cierto modo
determinan su funcin biolgica. Estas
propiedades se deben, en gran medida, a la
longitud y al grado de insaturacin de la cadena
Fig. 7 Las grasas animales y los aceites
hidrocarbonada de los cidos grasos que las vegetales son mezclas complejas de acilglicridos y
forman. otros lpidos.

* Solubilidad: Los cidos grasos son sustancias


anfipticas ya que la cadena hidrocarbonada es
apolar mientras que el grupo carboxilo es polar.
Esta propiedad ser ms ampliamente tratada
ms adelante.

Los triglicridos son sustancias apolares,


prcticamente insolubles en agua. Los
monoacilglicridos y los diacilglicridos, al tener
la glicerina radicales OH- libres, tienen cierta
polaridad.
Fig. 8 Monoacilglicrido.
* Punto de fusin: Los cidos grasos saturados,
al poderse disponer la cadena hidrocarbonada
totalmente extendida, pueden empaquetarse C-O-H
O
estrechamente lo que permite que se unan
=
=

O
C-O-H

mediante fuerzas de Van der Waals con tomos O


C-O-H
=

C-O-H
O

de cadenas vecinas (el nmero de enlaces, O


C-O-H
=

adems, est en relacin directa con la longitud C-O-H


O
C-O-H
O
de la cadena). Por el contrario, los cidos
=
=

O
C-O-H

grasos insaturados, al tener la cadena doblada


por los dobles enlaces no pueden empaquetarse
tan fuertemente. Es por esto que los cidos Fig. 9 Las grasas que contienen cidos
grasos saturados son slidas; pues sus
grasos saturados tienen puntos de fusin mas componentes pueden empaquetarse ms
altos que los insaturados y son slidos (sebos) densamente, lo que aumenta el punto de fusin.
a temperaturas a las que los insaturados son
lquidos (aceites). En los animales poiquilotermos y en los vegetales hay aceites y en los
animales homeotermos hay sebos. Los sebos y los aceites estn formados por mezclas ms
o menos complejas de acilglicridos.

Las grasas tienen sobre todo funciones energticas. En los vegetales se almacenan en las
vacuolas de las clulas vegetales (las semillas y frutos oleaginosos) y en el tejido graso o
adiposo de los animales. Contienen en proporcin mucha ms energa que otras sustancias
orgnicas, como por ejemplo el glucgeno, pues pueden almacenarse en grandes

J. L. Snchez Guilln Pgina I-5-4


I) Biomolculas 5) Lpidos

cantidades y en forma deshidratada, con lo que ocupan un menor volumen. En el intestino,


las lipasas hidrolizan los acilglicridos liberando glicerina y cidos grasos.

3NaOH
CO- O-CH2 COONa HO-CH2

CO- O-CH COONa + HO-CH

CO- O-CH2 COONa HO-CH2

Triacilglicrido jabn Glicerina

Fig. 10 Saponificacin de un triacilglicrido.

En algunos animales las grasas acumuladas bajo la piel sirven como aislante trmico o para
regular la flotabilidad, pues son malas conductoras del calor y menos densas que el agua.

Algunos cidos grasos de cadena muy larga son esenciales en la dieta y se les conoce bajo
el nombre genrico de vitaminas F.

LAS CERAS

Son steres de un monoalcohol lineal y de un cido graso, ambos de cadena larga.

Palmitato de miricilo (cera de abeja)

cido graso (C18)


Enlace
ster

Alcohol de cadena larga (C30)

Fig. 11 Palmitato de miricilo, cera de abejas.

LOS FOSFOLPIDOS

Son lpidos que forman parte de las membranas celulares. Derivan de la glicerina o de la
esfingosina, un alcohol ms complejo. Los derivados de la glicerina se llaman
fosfoglicridos y los que derivan de la esfingosina: esfingolpidos.

I) FOSFOGLICRIDOS

Se trata de una de las clases de fosfolpidos, lpidos con cido fosfrico. Qumicamente
podemos definirlos como steres del cido fosfatdico y un compuesto polar, generalmente

J. L. Snchez Guilln Pgina I-5-5


I) Biomolculas 5) Lpidos

un aminoalcohol. El cido fosfat dico es, a su vez, un ster de un diacilglicrido y del cido
fosfrico. El alcohol es siempre una sustancia polar, soluble en agua, muy variada
qumicamente (aminocido, base nitrogenada, etc). Como ejemplo de fosfoglicrido
podemos ver en la Fig.12 la estructura de la lecitina (fosfatidilcolina).

O
C O- CH 2

O
C O- CH

O CH3
+
H2COPOCHCHNCH3
X
OH CH3
Y Z W

cido fosfatdico (apolar) alcohol (polar)

Fig. 12 Lecitina. X) cidos grasos. Y) Glicerina. Z) cido fosfrico. W) Colina. X y Y estn unidos por enlaces
ster; Y y Z, y Z y W lo estn por enlaces ster fosfato.

Otros ejemplos de fosfoglicridos segn sea w son:

Alcohol (W) Fosfoglicrido


Colina Fosfatidilcolina
Serina Fosfatidilserina

ESFINGOLPIDOS

Su estructura molecular deriva de la unin del


alcohol esfingosina y una sustancia polar que
puede ser un aminoalcohol o un glcido. El ms
conocido es la esfingomielina. Fig. 13 Esfingonielina.

IMPORTANCIA BIOLGICA DE LOS FOSFOLPIDOS

Los fosfolpidos compuestos anfipticos y debido a esto desempean un papel estructural


de gran importancia en los seres vivos pues constituyen las membranas celulares. stas
estn formadas por una doble capa de fosfolpidos en la que estn integrados otros lpidos
(colesterol, por ejemplo) y protenas. En el caso de la membrana plasmtica hay tambin
oligosacridos.

J. L. Snchez Guilln Pgina I-5-6


I) Biomolculas 5) Lpidos

LOS ESTEROIDES

Son lpidos no saponificables derivados del


ciclo del esterano (ciclopentano-perhidrofenan-
treno).

Muchas sustancias importantes en los seres


vivos son esteroides o derivados de esteroides. Fig. 14 Esterano.
Por ejemplo: el colesterol, los cidos biliares, las
hormonas sexuales, las hormonas de la corteza
suprarrenal, muchos alcaloides, etc. En la tabla
de la pgina 9 se dan algunos ejemplos de
esteroides presentes en los seres vivos.

CARCTER ANFIPTICO DE LOS LPIDOS Fig. 15 Colesterol.

MICELAS, MONOCAPAS Y BICAPAS

Ciertos lpidos, y en particular los fosfolpi -


dos, tienen una parte de la molcula que es
polar: hidrfila y otra (la correspondiente a los
cidos grasos) que es no polar: hidrfoba. Las
molculas que presentan estas caractersticas Fig. 16 Representacin de un lpido
reciben el nombre de anfipticas. A partir de anfiptico.

ahora y por comodidad, representaremos la


parte polar (hidrfila) y la no polar (hidrfoba)
de un fosfolpido como se indica en la Fig. 16.

Cuando los fosfolpidos se dispersan en agua


forman micelas. Los grupos hidrfilos se
disponen hacia la parte acuosa y la parte
hidrfoba de cada molcula hacia el interior. Las
suspensiones que contienen este tipo de
micelas son muy estables.

Los lpidos anfipticos pueden tambin disper-


sarse por una superficie acuosa pudindose
formar, si la cantidad es la adecuada, una capa
de una molcula de espesor: monocapa. En este
caso las partes hidrfilas se disponen hacia el
interior y los grupos hidrfobos hacia el exterior Fig. 17 Monocapa y bicapa formada por un
de la superficie acuosa. Pueden tambin lpido anfiptico.

formarse bicapas, en particular entre dos

J. L. Snchez Guilln Pgina I-5-7


I) Biomolculas 5) Lpidos

compartimientos acuosos. Entonces, las partes


hidrfobas se disponen enfrentadas y las partes
hidrfilas se colocan hacia la solucin acuosa.
Los lpidos anfipticos forman este tipo de
estructuras espontneamente. Las bicapas
pueden formar compartimientos cerrados
denominados liposomas. La bicapas lipdicas
poseen caractersticas similares a las de las
membranas celulares: son permeables al agua Fig. 18 Micelas.
pero impermeables a los cationes y aniones y
son tambin malas conductoras elctricas. En
realidad, las membranas celulares son,
esencialmente, bicapa lipdi cas.

Fig. 19 Las membranas celulares estn


constitudas por bicapas lipdicas en la que se
encuentran insertadas protenas.

J. L. Snchez Guilln Pgina I-5-8


I) Biomolculas 5) Lpidos

EJEMPLOS DE ESTEROIDES

Colesterol: El OH confiere un carcter polar a esta Cortisona: Hormona de la corteza de las glndulas
parte de la molcula. Precursor de otras muchas suprarrenales. Acta favoreciendo la formacin de
sustancias. Presente en las membranas celulares de glucosa y glucgeno.
las clulas animales a las que confiere estabilidad.

Progesterona: Una de las hormonas sexuales fe- Testosterona: Hormona sexual masculina.
meninas.

Vitamina D: Regula el metabolismo del calcio y del Solanina: Alcaloide presente en la patata. Ob-
fsforo. srvese que tiene un oligosacrido unido al anillo
del esterano.

J. L. Snchez Guilln Pgina I-5-9


I) Biomolculas 5) Lpidos

J. L. Snchez Guilln Pgina I-5-10


I) Biomolculas 6) Protenas

I-6

PROTENAS

CONCEPTO Y CARACTERSTICAS

Concepto: Se pueden definir como polmeros formados por la unin, mediante enlaces
peptdicos, de unidades de menor masa molecular llamadas aminocidos.

Son molculas muy complejas. Su masa molecular es muy elevada, normalmente est
comprendida entre 6000 da y 10 6 da, son macromolculas. Algunas protenas estn
constituidas por la unin de varios polmeros proteicos que en ocasiones pueden tambin
contener otras molculas orgnicas (lpidos, glcidos, etc). En este ltimo caso reciben el
nombre genrico de prtidos.

Las protenas son las molculas orgnicas ms abundantes en las clulas, ms del 50% del
peso seco de la clula son protenas. Estn constituidas, fundamentalmente, por C, H, O y
N y casi todas tienen tambin azufre. Algunas tienen, adems, otros elementos qumicos y
en particular: P, Fe, Zn o Cu. El elemento ms caracterstico de las protenas es el
nitrgeno. Son los compuestos nitrogenados por excelencia de los seres vivos.

Las protenas son molculas especficas que marcan la individualidad de cada ser vivo.
Son adems de una gran importancia porque a travs de ellas se va a expresar la
informacin gentica, de hecho el dogma central de la gentica molecular nos dice:

DNARNAProtena

FUNCIONES GENERALES

Las protenas estn entre las sustancias que realizan las funciones ms importantes en los
seres vivos. De entre todas pueden destacarse las siguientes:

- De reserva. En general las protenas no tienen funcin de reserva, pero pueden utilizarse
con este fin en algunos casos especiales como por ejemplo en el desarrollo embrionario:
ovoalbmina del huevo, casena de la leche y gliadina del trigo.

- Estructural. Las protenas constituyen muchas estructuras de los seres vivos. Las
membranas celulares contienen protenas. En el organismo, en general, ciertas estructuras
-cartlago, hueso- estn formadas, entre otras sustancias, por protenas.

J. L. Snchez Guilln Pgina I-6-1


I) Biomolculas 6) Protenas

- Enzimtica. Todas las reacciones que se producen en los organismos son catalizadas por
molculas orgnicas. Las enzimas son las molculas que realizan esta funcin en los seres
vivos. Todas las reacciones qumicas que se producen en los seres vivos necesitan su
enzima y todas las enzimas son protenas.

- Homeosttica. Ciertas protenas mantienen el equilibrio osmtico del medio celular y


extracelular.

- Transporte, de gases, como es el caso de la hemoglobina, o de lpidos, como la


seroalbmina. Ambas protenas se encuentran en la sangre. Las permeasas, molculas que
realizan los intercambios entre la clula y el exterior, son tambin protenas.

- Movimiento. Actan como elementos esenciales en el movimiento. As, la actina y la


miosina, protenas de las clulas musculares, son las responsables de la contraccin de la
fibra muscular.

- Hormonal. Las hormonas son sustancias qumicas que regulan procesos vitales. Algunas
protenas actan como hormonas, por ejemplo: la insulina, que regula la concentracin de
la glucosa en la sangre.

- Inmunolgica. Los anticuerpos, sustancias


que intervienen en los procesos de defensa
frente a de los agentes patgenos, son
protenas.

LOS AMINOCIDOS

Son las unidades estructurales que constituyen


las protenas. Todos los aminocidos que se
encuentran en las protenas, salvo la prolina,
responden a la frmula general que se observa Fig. 1 Frmula general de un amino-cido.
en la figura.

A partir de ahora nos referiremos


exclusivamente a los aminocidos presentes en
las protenas de los seres vivos. Estos, como COOH
indica su nombre, tienen dos grupos
funcionales caractersticos: el grupo carboxilo HN C H
o grupo cido (-COOH), y el grupo amino
(-NH2 ). La cadena carbonada de los
aminocidos se numera comenzando por el
grupo cido, siendo el carbono que tiene esta Fig. 2 L-prolina; aminocido polar no
ionizable. Es el nico aminocido que no responde
funcin el carbono nmero 1, el grupo amino se a la frmula general.
encuentra siempre en el carbono 2 o carbono .

J. L. Snchez Guilln Pgina I-6-2


I) Biomolculas 6) Protenas

Por lo tanto, los aminocidos tienen en comn


los carbonos 1 (grupo carboxilo) y 2 (el del
grupo amino) diferencindose en el resto (R) de COOH
la molcula. En la frmula general de la Fig. 1 , R CH3
representa el resto de la molcula. R puede ser H2N C CH2 CH
CH3
desde un simple H- , como en el aminocido
glicocola, a una cadena carbonada ms o H
menos compleja en la que puede haber otros
Fig. 3 L-leucina; aminocido no polar.
grupos aminos o carboxilo y tambin otras
funciones (alcohol, tiol, etc.). Las protenas
delos seres vivos slo tienen unos 20
aminocidos diferentes, por lo que habr COOH
nicamente 20 restos distintos. Es de destacar
el hecho de que en todos los seres vivos slo se H2N C CH2 OH
encuentren los mismos 20 aminocidos. En
H
ciertos casos muy raros, por ejemplo en los
venenos de algunas serpientes, podemos Fig. 4 L-tirosina; aminocido polar no
encontrar otros aminocidos diferentes de ionizable.
estos 20 e incluso aminocidos que no siguen
la frmula general.
COOH
La mayora de los aminocidos pueden
sintetizarse unos a partir de otros, pero existen H 2N C CH2 CH2 COOH
otros, aminocidos esenciales, que no pueden
ser sintetizados y deben obtenerse en la dieta
H
habitual. Los aminocidos esenciales son
Fig. 5 L-Glutmico; aminocido polar
diferentes para cada especie, en la especie ionizable cido.
humana, por ejemplo, los aminocidos
esenciales son diez: Thr, Lys, Arg, His, Val,
Leu, Ileu, Met, Phe y Trp. COOH

H 2N C CH2 CH2 COOH

CLASIFICACIN DE LOS AMINOCIDOS H

Fig. 6 L-Arginina; aminocido polar


En funcin de sus caractersticas qumicas,
ionizable bsico.
los aminocidos se clasifican en:

Grupo I: Aminocidos apolares. Aminocidos cuyo resto R no es polar. Esto es, no posee
cargas elctricas en R al tener en l largas cadenas hidrocarbonadas. Estos aminocidos, si
estn en gran abundancia en una protena, la hacen insoluble en agua.

Grupo II: Aminocidos polares no ionizables. Poseen restos con cortas cadenas
hidrocarbonadas en las que hay funciones polares (alcohol, tiol o amida). Contrariamente al
grupo anterior si una protena los tiene en abundancia ser soluble en agua.

J. L. Snchez Guilln Pgina I-6-3


I) Biomolculas 6) Protenas

Grupo III: Aminocidos polares cidos. Pertenecen a


COOH
este grupo aquellos aminocidos que tienen ms de un
H2N C CH2 COOH
grupo carboxilo. En las protenas, si el pH es bsico o
H
neutro, estos grupos se encuentran cargados negativa-
mente. H2O
H3O+

Grupo IV: Aminocidos polares bsicos. Son aquellos


aminocidos que tienen otro u otros grupos aminos. En COOH
las protenas, estos grupos amino, si el pH es cido o H2 N C CH2 COO
neutro, estn cargados positivamente. H

Fig. 8 Ionizacin del grupo amino


ASIMETRA DE LOS AMINOCIDOS suplementario de un aminocido polar
ionizable cido.

Excepto en la glicocola, en el resto de los aminocidos


COOH
el carbono (el carbono que lleva la funcin amino) es
H2N C CH2 CH2 CH2 CH2 NH2
asimtrico. La molcula ser pticamente activa y H
existirn dos configuraciones: D y L. Normalmente en
H2 O
los seres vivos slo encontramos uno de los ismeros OH-
pticos. Por convenio se considera que los aminocidos
presentes en los seres vivos pertenecen todos ellos a la
COOH
serie L. No obstante, en los microorganismos (paredes H2N C CH2 CH2 CH2 CH2 NH3
bacterianas, antibiticos generados por bacterias) H
existen aminocidos no proteicos pertenecientes a la
serie D. Fig. 9 Ionizacin del grupo amino
suplementario de un aminocido polar
ionizable bsico.

OH OH
C O C O
H C NH2 H2N C H
R R
D aminocido L aminocido

Fig. 10 Asimetra de los aminocidos. Todos los aminocidos, excepto la glicocola, son asimtricos. De las dos
formas, la D y la L, en los seres vivos slo existe, normalmente, la L.

J. L. Snchez Guilln Pgina I-6-4


I) Biomolculas 6) Protenas

Aminocidos del Grupo I (apolares)


COOH COOH COOH
CH3 CH3
H2N-C-CH3 H 2N C CH2 CH H2N C CH
CH3 CH3
H H H
Alanina-Ala Leucina-Leu Valina-Val

COOH
COOH
H 2N C CH2
HN C H
H Fenilalanina-Phe
Prolina-Pro COOH

COOH H 2N C CH2 CH2 S CH3

H 2N C CH2 H Metionina-Met
COOH
H
N
H H 2N C CH CH2 CH3

Triptfano-Trp H CH3 Isoleucina-Ile

Aminocidos del Grupo II (polares no ionizables)

COOH COOH COOH


H2N C H H2N C CH2 OH H2N C CH CH3

H H H OH
Glicocola-Gly Serina-Ser Treonina-Trp

COOH COOH

H2N C CH2 SH H2N C CH2 OH

H Cistena-Cys H Tirosina-Tyr

COOH COOH
O O
H2N C CH2 C H2N C CH2 CH2-C
NH2 NH2
H H
Asparragina-Asn Glutamina-Gln

Aminocidos del Grupo III Aminocidos del Grupo IV


(polares ionizables cidos) (polares ionizables bsicos)

COOH COOH

H 2N C CH2 COOH H2N C CH2 N

H H N
Asprtico-Asp H Histidina-His

COOH COOH

H2N C CH2 CH2 COOH H2N C CH2 CH2 CH2 NH C NH2

H H NH
Glutmico-Glu Arginina-Arg

COOH

H2N C CH2 CH2 CH2 CH2 NH2

H
Lisina-Lys

J. L. Snchez Guilln Pgina I-6-5


I) Biomolculas 6) Protenas

EL ENLACE PEPTDICO

Cuando reacciona el grupo cido de un aminocido con el grupo amino de otro ambos
aminocidos quedan unidos mediante un enlace peptdico. Se trata de una reaccin de
condensacin en la que se produce una amida y una molcula de agua. La sustancia que
resulta de la unin es un dipptido.

H O H O
H N C C O H + H N C C O H
H R1 H R2
Aminocido 1 Aminocido 2

H2 O

H O H O
H N C C N C C O H
H R1 H R2
dipptido

Fig. 12 Reaccin de formacin del enlace peptdico.

CARACTERSTICAS DEL ENLACE PEPTDI CO

10) El enlace peptdico es un enlace covalente que se establece entre un tomo de carbono
y un tomo de nitrgeno. Es un enlace muy resistente, lo que hace posible el gran tamao y
estabilidad de las molculas proteicas.

Fig. 13 El enlace C-N se comporta como un doble enlace y no permite el giro.

J. L. Snchez Guilln Pgina I-6-6


I) Biomolculas 6) Protenas

20) Los estudios de Rayos X de las protenas han llevado a la conclusin de que el enlace
C-N del enlace pept dico se comporta en cierto modo como un doble enlace y no es
posible, por lo tanto, el giro libre alrededor de l.

30) Todos los tomos que estn unidos al carbono y al nitrgeno del enlace peptdico
mantienen unas distancias y ngulos caractersticos y estn todos ellos en un mismo
plano.

Fig. 14 Caractersticas del enlace peptdico.

PPTIDOS, POLIPPTIDOS y PROTENAS

Cuando se unen dos aminocidos mediante un


enlace peptdico se forma un dipptido. A cada
uno de los aminocidos que forman el dipptido
les queda libre o el grupo amino o el grupo
carboxilo. A uno de estos grupos se le podr unir
otro aminocido formndose un tripptido. Si el
proceso se repite sucesivamente se formar un
polipptido. Cuando el nmero de aminocidos
unidos es muy grande, aproximadamente a partir
de 100, tendremos una protena.
Fig. 15 Modelo de esferas de la insulina, un
pptido.

2 aa Dipptido
3 aa Tripptido
de 4 a 10 aa Oligopptido
de 10 a 100 aa Polipptido
ms de 100 aa Prote na

Toda cadena polipeptdica tendr en uno de sus extremos un aminocido con el grupo
amino libre. Este ser el aminocido amino terminal (H-). En el otro extremo quedar libre el

J. L. Snchez Guilln Pgina I-6-7


I) Biomolculas 6) Protenas

grupo carboxilo del ltimo aminocido,


aminocido carboxilo terminal (-OH). Toda
cadena proteica tendr por lo tanto una
polaridad indicada mediante una H- y un -OH.
Ejemplo:

H-Gly-Ala-Pro-Leu-Trp-Met-Ser-OH.

Muchas sustancias naturales de gran


importancia son pptidos; por ejemplo: ciertas
hormonas, como la insulina, que regula las
concentraciones de glucosa en la sangre y que
est formada por dos cadenas de 21 y 30
aminocidos unidas por puentes disulfuro; la
encefalina (5 aminocidos) que se produce en Fig. 16 Modelo de barras y esferas de la
oxitocina, una hormona peptdica.
las neuronas cerebrales y elimina la sensacin
de dolor o las hormonas del lbulo posterior de
la hipfisis: vasopresina y oxitocina (9 aa) que
producen las contracciones del tero durante el
parto; tambin son pptidos algunos antibiticos
como la gramicidina.

ESTRUCTURA O CONFORMACIN DE LAS


PROTENAS

La conformacin de una protena es la


disposicin espacial que adopta la molcula
proteica. Las cadenas peptdicas, en condicio- Fig. 17 Modelo de bolas de la ubicuitina,
una protena.
nes normales de pH y temperatura, poseen
solamente una conformacin y sta es la
responsable de las importantes funciones que
realizan.

La compleja estructura de las protenas puede


estudiarse a diferentes niveles. A saber: prima-
rio, secundario, terciario y cuaternario.

I) NIVEL O ESTRUCTURA PRIMARIA- Viene


dada por la secuencia: orden que siguen los
aminocidos de una protena. Va a ser de gran Fig. 18 La insulina, una hormona de
carcter peptdico, est formada por dos cadenas
importancia, pues la secuencia es la que polipeptdicas.
determina el resto de los niveles y como
consecuencia la funcin de la protena.

La alteracin de la estructura primaria por eliminacin, adicin o intercambio de los ami-

J. L. Snchez Guilln Pgina I-6-8


I) Biomolculas 6) Protenas

nocidos puede cambiar la configuracin


general de una protena y dar lugar a una
protena diferente. Como, adems, la funcin
de la protena depende de su estructura, un
cambio en la estructura primaria podr
determinar que la protena no pueda realizar su
funcin. Veamos, a continuacin, un ejemplo
de estructura primaria:

H-Ala-Gly-Ser-Lys-Asp-Asn-Cys-Leu-Met-Ala-
Ile-Trp-Gly-......-Pro-Asn-Glu-OH

II) NIVEL O ESTRUCTURA SECUNDARIA- Las


Fig. 19 Modelo de cintas de la ubicuitina.
caractersti cas de los enlaces peptdicos
imponen determinadas restricciones que
obligan a que las protenas adopten una
determinada estructura secundaria.

sta puede ser en hlice , hlice de colgeno o


en conformacin . Es de destacar que las tres
son configuraciones en hlice diferenciandose
en el nmero de aminocidos por vuelta (n) y en
el dimetro de la hlice. En la hlice , n=4; en
la hlice de colgeno, n=3 y en la conformacin
, n=2. A continuacin estudiaremos solo la
hlice y la conformacin por ser las Fig. 20 1) Hlices alfa; 2) conformaciones
configuraciones ms frecuentes. beta; 3) enlaces de hidrgeno; 4) puentes
disulfuro; 5) zonas irregulares.

a) Estructura en hlice . Se trata de la forma


ms simple y comn. En este tipo de estructura
la molcula adopta una disposicin helicoidal,
los restos (R) de los aminocidos se sitan hacia
el exterior de la hlice y cada 3,6 aminocidos
sta da una vuelta completa.

Este tipo de organizacin es muy estable, por-


que permite la formacin de puentes de
hidrgeno entre el grupo C=O de un
aminocido y el grupo N-H del cuarto
aminocido situado por debajo de l en la hlice.

b) Conformacin . Se origina cuando la molcu-


la proteica, o una parte de la molcula, adoptan
Fig. 21 Hlice alfa. Mediante flechas se
una disposicin en zig-zag. La estabilidad se indican algunos enlaces de hidrgeno. R) restos de
consigue mediante la disposicin en paralelo de los aminocidos.
varias cadenas con esta conformacin, cadenas

J. L. Snchez Guilln Pgina I-6-9


I) Biomolculas 6) Protenas

que pueden pertenecer a protenas


diferentes o ser partes de una misma
molcula. De esta manera pueden
establecerse puentes de hidrgeno entre
grupos C=O y -N-H. Los restos van que-
dando alternativamente hacia arriba y hacia
abajo. No obstante, si la molcula presenta
prximos entre s restos muy voluminosos o
con las mismas cargas elctricas se
desestabilizar. Fig. 22 Visin superior de una hlice alfa. Los
nmeros indican los aminocidos.

Una molcula no tiene que


estar constituida exclusi-
vamente por un tipo de
conformacin. Lo normal
es que las molculas protei-
cas presenten porciones
con hlices , otras partes
con conformaciones y
partes que no tienen una
Fig. 23 Conformacin beta o lmina plegada beta. En la figura se
observan dos fragmentos de lmina plegada beta asociados por enlaces de conformacin definida y
hidrgeno. que se llaman zonas
irregulares.

III) NIVEL O ESTRUCTURA TERCIARIA- Las protenas no se disponen linealmente en el


espacio sino que normalmente sufren plegamientos que hacen que la molcula adopte una
estructura espacial tridimensional llamada estructura terciaria. Los pliegues que originan la
estructura terciaria se deben a ciertos aminocidos, como: la prolina, la serina y la
isoleucina, que distorsionan la hlice generando
una curvatura.

La estructura terciaria se va a estabilizar por la


formacin de las siguientes interacciones:

1) Enlaces o puentes de hidrgeno.


2) Interacciones cido base.
3) Puentes disulfuro.

Estos ltimos se forman entre grupos -SH


pertenecientes a dos molculas de cistena que Fig. 24 Estructura de una protena. a) hlices
reaccionan entre s para dar cistina. alfa; b) conformaciones beta; c) zonas irregulares.

-Cis-SH + HS-Cis- ----- -Cis-S-S-Cis-

J. L. Snchez Guilln Pgina I-6-10


I) Biomolculas 6) Protenas

En la estructura terciaria los restos se van a


disponer en funcin de su afinidad con el
medio. En medio acuoso, los restos hidrfobos
se sitan hacia el interior de la molcula
mientras que los restos hidrfilos lo hacen hacia
el exterior.

Bsicamente se distingen dos tipos de


estructura terciaria: la filamentosa y la globular,
aunque muchos autores consideran que las
protenas filamentosas son protenas que
carecen de estructura terciaria.

Las protenas con conformacin filamentosa


suelen tener funcin estructural, de proteccin
Fig. 25 Estructura terciaria de una protena.
o ambas a la vez y son insolubles en agua y en
a) hlices alfa b) conformaciones beta; c) zonas
soluciones salinas. Por ejemplo, tienen esta irregulares.
conformacin: la beta-queratina, el colgeno y
la elastina.

Las protenas con conformacin globular suelen ser solubles en agua y/o en disoluciones
salinas. Son globulares las enzimas, las protenas de membrana y muchas protenas con
funcin transportadora.

Las protenas globulares suelen tener diferentes fragmentos con alfa-hlices y


conformaciones beta, pero las conformaciones beta suelen disponerse en la periferia y las
hlices alfa en el centro de la molcula. Adems, las protenas globulares se doblan de tal
manera que, en solucin acuosa, sus restos hidrfilos quedan hacia el exterior y los
hidrfobos en el interior y, por el contrario, en un ambiente lipdico, los restos hidrfilos
quedan en el interior y los hidrfobos en el exterior.

IV) ESTRUCTURA CUATERNARIA- Cuando


varias cadenas de aminocidos, iguales o
diferentes, se unen para formar un edificio
proteico de orden superior, se disponen segn
lo que llamamos estructura cuaternaria.
Tambin se considera estructura cuaternaria la
unin de una o varias protenas a otras
Glcido Glcido
molculas no proteicas para formar edificios
macromolculares complejos. Esto es frecuente
en protenas con masas moleculares superiores
a 50.000
Fig. 26 Los anticuerpos tienen estructura
Cada polipptido que interviene en la formacin cuaternaria pues estn formados por la unin,
de este complejo proteico es un protmero y mediante puentes disulfuro, de cuatro protmeros
segn el nmero de protmeros tendremos: o dominios; dos de cadena larga y dos de cadena
corta
dmeros, tetrmeros, pentmeros, etc.

J. L. Snchez Guilln Pgina I-6-11


I) Biomolculas 6) Protenas

La asociacin o unin de las molculas que


forman una estructura cuaternaria, se consigue
y mantiene mediante enlaces de hidrgeno,
fuerzas de Van der Waals, interacciones
electrostticas y algn que otro puente
disulfuro.

Un ejemplo de estructura cuaternaria es la


hemoglobina, formada por las globinas o parte
proteica (dos cadenas alfa y dos cadenas beta,
con un total de 146 aminocidos) ms la parte
no proteica o grupos hemo. O los anticuerpos,
Fig. 27 Modelo de anticuerpo.
formados tambin por cuatro cadenas, dos
cadenas cortas y dos largas.

PROPIEDADES DE LAS PROTENAS

Las propiedades de una protena, incluso su carga elctrica, dependen de los restos o
radicales de los aminocidos que quedan en su superficie y que podrn interaccionar
mediante enlaces covalentes o no covalentes con otras molculas. A continuacin veremos
las propiedades ms importantes:

Solubilidad. Las protenas solubles en agua, al ser macromolculas, no forman


verdaderas disoluciones sino dispersiones coloidales. Cada macromolcula proteica
queda rodeada de molculas de agua y no contacta con otras macromolculas
gemelas con lo que no puede producirse la precipitacin.

Especificidad. La especificidad de las protenas puede entenderse de dos maneras.


Por una parte, existe una especificidad de funcin. Esto es, cada protena tiene una
funcin concreta, diferente, normalmente, de la del resto de las molculas proticas.
Esta es la razn de que tenganos tantas protenas distintas, unas 100 000. Ahora
bien, ciertas protenas que realizan funciones similares en los seres vivos, por
ejemplo: la hemoglobina de la sangre, presentan diferencias entre las distintas
especies. Estas diferencias se han producido como consecuencia del proceso
evolutivo y cada especie o incluso cada individuo, puede tener sus propias
protenas especficas. No obstante, estas diferencias se producen en ciertas
regiones de la protena llamadas sectores variables de las que no depende
directamente se funcin. Mientras que otros sectores, de los que si depende la
funcin de la protena, tienen siempre la misma secuencia de aminocidos. La
especificidad de las protenas depender por lo tanto de los sectores variables y a
ellos se deben, por ejemplo, los problemas de rechazos en los transplantes de
rganos.

Por ejemplo: La insulina consta de 51 aminocidos en todos los mamferos, que


estn distribuidos en dos cadenas, de 21 y 30 aminocidos respectivamente, unidas
mediante dos enlaces disulfuro; de stos 51 aminocidos, la mayora son los
mismos en todas las especies, pero unos pocos (tres de la cadena corta) varan de
unas a otras.

J. L. Snchez Guilln Pgina I-6-12


I) Biomolculas 6) Protenas

Los diferentes papeles biolgicos de stas


molculas van a depender de la forma que
adopten en su conformacin espacial. Aminocidos
Especies
A8 A9 A10 B30

Cerdo Thr Ser Ile Ala

Hombre Thr Ser Ile Thr


DESNATURALIZACIN DE LAS PROTENAS Caballo Thr Gly Ile Ala

Carnero Ala Gly Val Ala

Las alteraciones de la concentracin, del grado Pollo His Asn Thr Ala

de acidez, de la temperatura (calor); pueden Vaca Ala Ser Val Ala

provocar la desnaturalizacin de las protenas.


La desnaturalizacin es una prdida total o Fig. 28 Diferencias en la estructura primaria
parcial de los niveles de estructura superiores al de la insulina de diferentes vertebrados.
primario y se debe a la desaparicin de los
enlaces dbiles tipo puente de hidrgeno, Van
der Waals, etc. y en realidad no afecta a los
enlaces peptdicos y por tanto a la estructura

Actividad enzimtica
primaria. Sin embargo al alterarse su
conformacin espacial, la protena perder su
Temperatura ptima

funcionalidad biolgica.

En las protenas globulares, solubles en agua,


la desnaturalizacin est acompaada de una
prdida de la solubilidad y la consiguiente
precipitacin de la disolucin.

Fig. 29 Variacin de la actividad de una


Puede existir una renaturalizacin casi siempre,
enzima con la temperatura. A partir de 451C la
excepto cuando el agente causante de la enzima se desnaturaliza, por alterarse su
desnaturalizacin es el calor (coagulacin de la conformacin, y al destruirse el centro activo deja
leche, huevos fritos, "permanente" del cabello, de actuar.

etc.).

t
RELACIN ENTRE LA CONFORMACIN Y LA
Variacin de la actividad enzimtica

ACTIVIDAD DE LAS PROTENAS

La funcin de las protenas depende de su


conformacin. Algunas protenas, particular-
mente las enzimas, tienen una o varias zonas
en su molcula de las que depende su funcin
llamadas: centro activo o locus. El centro activo tiempo

de la protena acta unindose a la molcula


Fig. 30 Variacin en la actividad de una
sobre la que se va a realizar la tranformacin,
enzima medida en funcin de la cantidad de
molcula que llamaremos ligando, que debe substrato (ligando) transformado a 37oC. En t se
encajar en el centro activo. ha aumentado la temperatura hasta 70oC.

El ligando y el centro activo interaccionan mediante fuerzas qumicas. Estas interacciones


se deben a que ciertos radicales de los aminocidos de la protena, que estn en el centro
activo de la molcula, tienen afinidad qumica por determinados grupos funcionales
presentes en el ligando. Algunas veces la unin protena-ligando es irreversible como
ocurre con las reacciones antgeno-anticuerpo. Otras veces es perfectamente reversible.

J. L. Snchez Guilln Pgina I-6-13


I) Biomolculas 6) Protenas

Los aminocidos cuyos restos constituyen el centro activo pueden estar muy distantes
unos de otros en la secuencia primaria de la protena, pero que debido a los pliegues y
repliegues de la estructura terciaria, quedan localizados, espacialmente, muy prximos unos
de otros y, sobre todo, formando una especie de hueco donde encajar el ligando.

El resto de los aminocidos de la protena


tienen como misin mantener la forma y la Ligando o sustrato

estructura que se precisa para que el centro


activo se encuentre en la posicin correcta.
sustrato
Para que una protena y un ligando se unan o
se reconozcan deben establecerse entre ambas coenzima

molculas varios puntos de interaccin del tipo


enzima centro activo
enlaces dbiles, especialmente fuerzas de Van
der Waals, puentes de hidrgeno, etc.

Fig. 31 Ajuste entre el ligando y el


La conformacin de una protena y por lo
centro activo de una enzima.
tanto su centro activo y su funcin pueden alte-
rarse si se producen cambios en las estructura
primaria. As, por ejemplo, en la anemia falciforme, el 61 aminocido de una de las cadenas
proteicas que forman la hemoglobina, el glutmico, ha sido sustitudo por valina. Como
consecuencia la hemoglobina pierde su funcionalidad y no puede transportar
convenientemente el oxgeno y los heritrocitos (glbulos rojos) adquieren forma de hoz.

Como ya hemos visto, la conformacin puede tambin alterarse si la protena se


desnaturaliza por la accin de agentes como el calor y los cidos y las bases fuertes. La
desnaturalizacin irreversible destruye el centro activo y la prote na no puede ya realizar su
funcin.

J. L. Snchez Guilln Pgina I-6-14


II) La clula 1) Origen de los seres vivos. Teora celular

BLOQUE II

FISIOLOGA CELULAR

1a-EL ORIGEN DE LOS SERES VIVOS

CONDICIONES INICIALES

Uno de los aspectos ms sorprendentes del origen de la vida sobre la Tierra es el de la


rapidez con la que se llev a cabo. Los estudios de datacin basados en los meteoritos
indican todos ellos una edad de 4500 millones de aos para el Sistema Solar. Si aceptamos
que el Sol, los planetas, los meteoritos y el resto de los componentes del Sistema Solar se
formaron al mismo tiempo a partir de una nube de polvo primitiva, 4500 millones de aos
ser tambin la edad de nuestro planeta. Algunas rocas sedimentarias con una edad de
3400 a 3200 millones de aos contienen microfsiles similares a bacterias. Por lo tanto, slo
1000 millones de aos despus de que se originase la Tierra ya exista sobre ella una vida
primitiva.

Debemos de tener tambin en cuenta que las condiciones que existan antes de la
aparicin de los seres vivos sobre la Tierra eran muy diferentes de las actuales. Sin entrar
en cuestiones tales como la presin o la temperatura, la composicin de la atmsfera
primitiva de la Tierra era muy distinta de la actual. Se piensa que estaba formada
fundamentalmente por una mezcla de metano (CH4), amonaco (NH3), hidrgeno (H2) y
vapor de agua (H2O). Al no haber oxgeno, la atmsfera no era oxidante como la actual sino
reductora, y la falta de ozono (O 3) haca posible que los rayos ultravioleta pudiesen
atravesar la atmsfera.

EL ORIGEN DE LA VIDA. TEORA DE OPARIN-HALDANE

La generacin espontnea: teora segn la cual los seres vivos pueden originarse a partir de la
materia inanimada, fue una idea corriente y ampliamente aceptada hasta el siglo XIX. Se
basaba en la observacin de que si se pona en un recipiente cualquier clase de materia
orgnica, al cabo de un cierto tiempo, apareceran en ella los organismos ms diversos. Se
crea que estos organismos se formaban espontneamente, sin necesidad de que otros los
hubiesen engendrado. El origen de la vida sobre la Tierra no planteaba por lo tanto ningn tipo
de dificultad, pues era claro que podra haberse originado tambin de manera espontnea. En
1860 Louis Pasteur realiz cuidadosos experimentos mediante los cuales demostr que todo
ser vivo procede de otros seres vivos semejantes a l. Estas experiencias, al destruir la
generacin espontnea, plantearon de nuevo el problema de cmo se haban originado en un
principio los seres vivos.

En 1924 el bioqumico ruso A.I. Oparin y en 1929 el ingls J.B. Haldane, emitieron,
independientemente el uno del otro, una teora segn la cual las radiaciones ultravioleta o las
descargas elctricas producidas por las tormentas, al atravesar la atmsfera, originaron los
componentes bsicos de los seres vivos. La ausencia de oxgeno y de organismos, hizo
posible que estas sustancias orgnicas, que se haban formado al azar, se fuesen acumulando
en las aguas de mares y lagos. Se form as lo que se llam "el caldo primigenio". Las

J. L. Snchez Guilln Pgina II-1-1


II) La clula 1) Origen de los seres vivos. Teora celular

molculas se fueron asociando hasta que en


algn momento adquirieron la capacidad de
autorreplicarse y de formar nuevas molculas
orgnicas que les sirviesen de fuente de
materiales y energa.

La hiptesis de Oparin y Haldane no se trataba


de una nueva edicin de las viejas teoras de la
generacin espontnea. Para ellos la vida se
origin en un momento muy concreto con unas
condiciones que ya no existen en la actualidad.
Pues la atmsfera con O 2 y los seres vivos hacen Fig. 1 Alexandr I. Oparin (1894 -1980).
imposible que esto pueda darse ahora.

PRIMERAS ETAPAS DEL ORIGEN DE LOS SERES VIVOS

1) El punto de partida, hace 3800 m.a.

La atmsfera primitiva estaba formada por: metano


(CH4), amonaco (NH3), hidrgeno (H2) y vapor de agua
(H2O), era reductora y anaerobia. No obstante en estas
sustancias estaban los principales bioelementos que
forman la materia viva: carbono (C), nitrgeno (N),
hidrgeno (H) y oxgeno (O).

2) Cmo se formaron las biomolculas?

Las radiaciones solares y las descargas elctricas


proporcionaron la energa suficiente para que los
componentes de la atmsfera reaccionasen y se
formasen las biomolculas, compuestos orgnicos
sencillos como los que ahora forman los principales
compuestos de los seres vivos.

3) Cules fueron estas biomolculas?

Se formaron as, azcares, grasas simples, aminocidos


y otras molculas sencillas que reaccionaron entre s
para dar lugar a molculas ms complejas: proteinas,
grasas complejas, polisacridos y cidos nuclicos.

4) Cmo se form el "caldo primitivo"

Segn Oparn, los compuestos orgnicos que se


formaron en la atmsfera fueron arrastrados hacia los
mares por las lluvias y all, a lo largo de millones de
aos, se concentraron formando una disolucin espesa
de agua y molculas orgnicas e inorgnicas que l
llam "caldo primitivo".

J. L. Snchez Guilln Pgina II-1-2


II) La clula 1) Origen de los seres vivos. Teora celular

5) Los precursores de las bacterias

En este "caldo primitivo" algunas molculas formaron


membranas, originndose unas estructuras esfricas
llamadas coacervados. Algunos coacervados pudieron
concentrar en su interior enzimas con las que fabricar
sus propias molculas y obtener energa. Por ltimo,
algunos pudieron adquirir su propio material gentico y
la capacidad de replicarse (reproducirse). Se formaron
as los primitivos procariotas.

EL EXPERIMENTO MILLER

En 1952 H.C. Urey volvi a expresar la tesis de


Oparin-Haldane en su libro "Los planetas". Tanto l
como S.L. Miller iniciaron en la Universidad de
Chicago una serie de experiencias para averiguar
si era posible que las fuentes de energa que haba
en un principio en la Tierra, hubiesen podido
generar compuestos orgnicos a partir de los
componentes que se encontraban en la atmsfera
del planeta. Para ello montaron un dispositivo
consistente en un baln de vidrio de 5 l conectado
a otro ms pequeo de 0,5 l. En el primero
introdujeron una mezcla formada por H2, NH3, CH4 Fig. 2 Stanley Miller (1930-).

y H2O. En el matraz mayor situaron unos


electrodos y sometieron la mezcla a una serie de
descargas elctricas. La mezcla de gases era
posteriormente introducida en el matraz pequeo
Electrodos

que contena agua hirviendo. Las sustancias que


se formaban en el matraz grande se disolvan en el Entrada de
agua del pequeo, y los gases que an no haban gases

reaccionado se volvan al matraz grande por medio Gases

de un circuito cerrado. Al cabo de unos das Miller


analiz el contenido del agua del recipiente menor
y encontr una gran variedad de compuestos
orgnicos y entre ellos descubri los 20 Condensador

aminocidos que forman las protenas (en la tabla


siguiente se relacionan los compuestos obtenidos Toma de
muestras

por Miller en su experiencia).

Esta experiencia permiti dar una base


experimental a la hiptesis de Oparin-Haldane
sobre el origen de la vida. Calor

Fig. 3 Dispositivo del experimento de


Stanley Miller.

J. L. Snchez Guilln Pgina II-1-3


II) La clula 1) Origen de los seres vivos. Teora celular

ETAPAS EN EL ORIGEN Y EVOLUCIN DE LOS SERES VIVOS

La evolucin fue un proceso que transcurri de una manera continua. No obstante, vamos a
dividirlo para su estudio en una serie de etapas:

1 La evolucin qumica. Los primeros organismos.

2 La evolucin de los organismos procariticos.

3 Origen de las clulas eucariotas

4 Orgenes de la clula vegetal y animal.

5 Origen y evolucin de los organismos pluricelulares.

6 La evolucin en los vegetales.

7 La evolucin en los animales.

PRIMERAS ETAPAS DE LA EVOLUCIN BIOLGICA

1) LA EVOLUCIN QUMICA

La evolucin qumica de los primeros organismos a partir de la materia inanimada se dio


siguiendo los siguientes pasos:

1 Sntesis y concentracin de los monmeros biolgicos: aminocidos, azcares y


bases orgnicas.

2 Polimerizacin de los monmeros y formacin de los primeros polmeros: protenas,


polisacridos y cidos nuclicos.

3 Segregacin a partir de la "sopa de Haldane" de pequeas gotitas y formacin de


"protobiontes" diferentes qumicamente del medio que les rodeaba y con una identidad
propias.

4 Desarrollo de algn tipo de maquinaria reproductora que permitiese a las "clulas


hijas" adquirir las caractersticas de las "clulas paternas".

1-1 Sntesis y concentracin de los monmeros biolgicos. 1

La experiencia de Miller nos ha permitido demostrar que es posible la formacin al azar de los
monmeros bsicos que constituyen los compuestos de los seres vivos a partir de las
sustancias existentes en la Tierra primitiva. La energa necesaria pudo muy bien provenir de
las radiaciones o de los rayos producidos por las tormentas. No obstante, las cantidades que
se obtienen son muy pequeas y adems enseguida quedaran diluidas en las grandes masas
de agua de los mares y lagos. De alguna manera debieron de existir mecanismos que
permitieron su concentracin. Se han propuesto algunos muy sencillos como la concentracin
por evaporacin o por congelacin del agua de los lagos. Otros son ms complejos; as, por
ejemplo, se ha propuesto que las sustancias pudieron concentrarse al ser absorbidas
selectivamente por ciertos minerales.

1
Los textos en cursiva son de ampliacin y deben leerse pero no estudiarse.

J. L. Snchez Guilln Pgina II-1-4


II) La clula 1) Origen de los seres vivos. Teora celular

1-2 Polimerizacin de los monmeros.

Es de destacar que las reacciones de polimerizacin se encuentran desplazadas normalmente


en el sentido de los monmeros. En los seres vivos, la formacin de polmeros es posible al
encontrarse catalizada por enzimas. Pero las enzimas son tambin polmeros. Cmo
pudieron formarse entonces los polmeros constituyentes de los seres vivos?

Se ha observado que cuando los adenilaminocidos quedan absorbidos por ciertos minerales
arcillosos, se polimerizan espontneamente formando cadenas peptdicas de 50 o ms
elementos. Tambin se ha observado en mezclas secas de aminocidos una cierta tasa de
polimerizacin espontnea a temperaturas entre los 60 oC y los 130oC. En ciertas condiciones
los polmeros as formados pueden llegar a tener hasta 200 aminocidos. Muy probablemente
se produjo uno de estos mecanismos u otro similar. Los polmeros, una vez formados,
pudieron difundirse hacia las disoluciones acuosas e irse concentrando a lo largo de millones
de aos por un mecanismo similar a los estudiados en el punto anterior.

1-3 Formacin de los coacervatos

Las clulas se caracterizan por mantener un medio interno qumicamente diferente del medio
externo. Esto se consigue por la presencia de una membrana limitante entre ambos medios.
Esta membrana impide que los componentes de la clula se diluyan y desaparezcan. Oparin
estudi durante muchos aos la tendencia a aislarse de las disoluciones acuosas de polmeros
para formar coacervatos: pequeas gotitas ricas en polmeros y separadas del medio acuoso
por una membrana.

Existen varias combinaciones de polmeros que dan lugar a la formacin de coacervatos. Por
ejemplo: las de protena-hidratos de carbono, las de protena solas y las de protena-cido
nuclico.

Las gotitas de coacervatos son no obstante inestables. Tienen tendencia a descender hacia el
fondo de la disolucin donde forman una capa no acuosa. Oparin descubri que si dotaba a
los coacervatos de molculas que les permitiesen llevar un cierto metabolismo celular, se
hacan ms estables. As, al aadir al medio la enzima fosforilasa, sta se concentraba en el
interior de las gotitas. Si posteriormente se aada glucosa-1-fosfato, sta se difunda haca el
interior y la enzima la polimerizaba formando almidn. El almidn se va aadiendo a la
membrana de la gotita con lo que aumenta de tamao. Cuando el coacervato es
excesivamente grande se divide espontneamente dando lugar a varias gotitas "hijas". La
energa necesaria proviene del enlace rico en energa de la glucosa-1-fosfato.

Si se le aaden al medio otras enzimas, los coacervatos se van transformando en estructuras


con un metabolismo y una individualidad qumica que realizan intercambios de materiales y
energa. Los coacervatos no son seres vivos pero poco les falta para serlo. Podramos pensar
que en el origen de la vida pudo pasar un proceso parecido y que poco a poco las "gotitas de
vida" que tuviesen un metabolismo ms adecuado "sobreviviran" ms tiempo y pudieron
aumentar en tamao y nmero.

1-4 Adquisicin de la maquinaria gentica.

Se trata de algo para lo que no disponemos de modelos de laboratorio. Adems, la


complejidad del material gentico y su gran diversidad no nos dan muchas pistas acerca de
como pudo suceder el proceso. Es posible que los primeros coacervatos estuviesen
constituidos por ADN u otros polinucletidos que fuesen capaces de autoduplicarse y de
traducirse a protenas. Aunque la secuencia primaria de sta fuese al azar, pudieron formar
una membrana protectora que envolviese al ADN. Se pudo establecer as una relacin mutua:
el ADN se traduca a protenas y stas protegan al ADN formando una membrana a su
alrededor. A partir de aqu ambas sustancias pudieron seguir una evolucin conjunta. Esta
hiptesis presenta la dificultad de que la traduccin de las protenas necesita en la actualidad

J. L. Snchez Guilln Pgina II-1-5


II) La clula 1) Origen de los seres vivos. Teora celular

de una compleja maquinaria qumica: varios tipos de ARN, ribosomas, enzimas, etc. Esto es,
se necesitan protenas para sintetizar el ADN y ADN para sintetizar las protenas. Esta
moderna versin de la paradoja del "huevo y de la gallina" puede resolverse contestando que
la maquinaria gentica debi de evolucionar conjuntamente a partir de mecanismos ms
simples que no existen en la actualidad, al haber sido eliminados por competencia con otros
ms perfeccionados. En resumidas cuentas, en algn momento se form una asociacin ADN,
codificador de una protena, que a su vez catalizaba la formacin de un cido nuclico y ambos
evolucionaron conjuntamente.

2 - LA EVOLUCIN DE LOS ORGANISMOS PROCARITICOS

Los distintos pasos descritos hasta ahora debieron de dar lugar a los primeros seres vivos.
Posiblemente se trat de organismos similares a las bacterias fermentadoras, como las
actuales del gnero Clostridium, aunque naturalmente su maquinaria bioqumica sera mucho
ms simple.

Estos organismos debieron de sobrevivir a base de fermentar los componentes orgnicos que
se haban formado a lo largo de millones de aos de evolucin qumica. La disminucin de la
cantidad de materia orgnica, como consecuencia de los propios procesos de fermentacin,
debi de estimular el desarrollo de los primeros organismos fotosintticos.

Parece ser que la fotosntesis basada en el SH2 como fuente de hidrgeno y electrones, como
lo hacen en la actualidad las bacterias del azufre, es anterior a la fotosntesis basada en el
H2O. Esta hiptesis se fundamenta en el hecho de que la atmsfera primitiva de la Tierra era
rica en SH2. Adems, la maquinaria bioqumica que se necesita para la fotosntesis basada en
el SH2 es menos compleja que la fotosntesis basada en la fotolisis del H2O.

No obstante, la abundancia de H2O trajo este tipo de fotosntesis. Los primeros organismos
en dar este gran paso debieron ser similares a las cianobacterias, llamadas tambin algas
verde-azuladas. Las cianobacterias actuales, como las del gnero nostoc, son organismos
procariotas que forman colonias multicelulares de aspecto filamentoso.

Durante 2000*106 aos siguientes (hasta hace 1500*10 6 aos) estos organismos
revolucionaron la composicin qumica de la atmsfera. La produccin de oxgeno transform
la atmsfera reductora en una atmsfera oxidante y se form adems una capa de ozono
(O3) que filtr considerablemente los rayos ultravioleta.

El oxgeno comenz a concentrarse en la atmsfera en un porcentaje superior al 1% hace


unos 2000*106. Esto se sabe porque los granos del mineral de uranio llamado uraninita se
oxidan rpidamente si la concentracin de oxgeno es superior al 1%. El xido de uranio as
formado se disuelve en el agua y es arrastrado hacia los mares donde se mantiene en
disolucin. Efectivamente, slo encontramos depsitos de uraninita en sedimentos que tiene
una antigedad superior a los 2000*10 6 aos y no se encuentran cuando los estratos son ms
jvenes. Un resultado similar lo proporcionan los estudios basados en la formacin de los
depsitos de xido de hierro.

3 - EL ORIGEN DE LOS EUCARIOTAS

Es difcil distinguir entre los microfsiles de hace miles de millones de aos si son procariotas
o eucariotas. Sabemos que ambos tipos de clulas se diferencian en su aspecto, tamao,
morfologa, bioqumica, etc.

J. L. Snchez Guilln Pgina II-1-6


II) La clula 1) Origen de los seres vivos. Teora celular

Los eucariotas, tal y como los conocemos ahora, no pudieron aparecer antes de hace
1500*106 aos (3500*106 aos despus del origen de la Tierra). Con los eucariotas apareci
la reproduccin sexual. No olvidemos que las principales caractersticas de los eucariotas son
la presencia de un ncleo separado del citoplasma y la estructuracin del ADN en
cromosomas. Todo esto se desarroll posiblemente para poder intercambiar ms fcilmente el
material gentico. Es cierto que los procariotas actuales pueden tambin intercambiarlo, pero
en ellos priman sobre todo los mecanismos de reproduccin asexual sobre los de reproduccin
sexual.

La reproduccin sexual fue lo que permiti la diversificacin de los seres vivos, la aparicin de
los organismos megascpicos y que estos alcanzasen la gran complejidad que tiene en la
actualidad.

Segn la Teora de la Simbiognesis (Lynn Margulis. Chicago 1938) las clulas eucariotas
seran el resultado de la simbiosis de diferentes organismos procariotas. Esto se basa en el
hecho de que muchos orgnulos y estructuras celulares (mitocondrias y plastos,) poseen su
propio ADN, e incluso sus propios ribosomas, ambos de tipo bacteriano.

J. L. Snchez Guilln Pgina II-1-7


II) La clula 1) Origen de los seres vivos. Teora celular

1b- LA TEORA CELULAR

1) ORGANIZACIN CELULAR DE LOS SERES VIVOS

TEORA CELULAR

En 1665, Robert Hooke, al observar al micros-


copio, muy rudimentario en aquella poca, un
fragmento de corcho, descubre que est com-
puesto por una serie de estructuras parecidas a
las celdas de los panales de las abejas, por lo
que las llam clulas. El posterior desarrollo de
la microscopa permiti que en 1838 Scheleiden
y en 1839 Schwan, uno para los vegetales y el
otro para los animales, planteasen la denomi-
nada TEORA CELULAR, que, resumidamente,
indica:

11- Todos los organismos son clulas o estn


constituidos por clulas.
Fig. 4 Robert Hooke.
21- Las unidades reproductoras,los gametos y
esporas, son tambin clulas.
31- Las clulas no se crean de nuevo, toda
clula proviene siempre de otra clula.
41- Existen seres unicelulares y seres pluri-
celulares.

En pocas palabras, segn la TEORA


CELULAR, la clula es la unidad estructural,
fisiolgica y reproductora de los seres vivos;
pues todo ser vivo est constituido por clu-
las:UNIDAD ANATMICA, su actividad es
consecuencia de la actividad de sus
clulas:UNIDAD FISIOLGICA y se reproduce a
travs de ellas: UNIDAD REPRODUCTORA.

La TEORA CELULAR ha sido de gran Fig. 5 Clulas de la corteza de Quercus


importancia y supuso un gran avance en el suber (alcornoque) vistas al microscopio
x300.
campo de las Biologa pues sent las bases para
el estudio estructurado y lgico de los seres
vivos.

J. L. Snchez Guilln Pgina II-1-8


II) La clula 1) Origen de los seres vivos. Teora celular

UNICELULARES Y PLURICELULARES

Como consecuencia del cuarto punto de la


teora celular, vamos a dividir los seres vivos en
dos grandes grupos:

-Unicelulares: con una sola clula.


-Pluricelulares: con muchas clulas.

No todos los seres vivos estn constituidos por


clulas. Un claro ejemplo son los virus, a estos
organismos que no son clulas se les conoce
como acelulares.

EUCARIOTAS Y PROCARIOTAS
Fig. 6 Con este primitivo microscopio Antony
Por su estructura se distinguen dos tipos de van Leeuwenhoek (1632-1723) realiz las
primeras observaciones microscpicas.
clulas: procariticas y eucariticas:

-PROCARITICAS. Muy simples y primitivas.


Apenas tienen estructuras en su interior. Se
caracterizan por no tener un ncleo propiamente
dicho; esto es, no tienen el material gentico en-
vuelto en una membrana y separado del resto 1m
del citoplasma. Adems, su ADN no est
asociado a ciertas protenas como las histonas y
est formando un nico cromosoma. Son proca- 1m

riotas, entre otras: las bacterias y las cianofceas. A B

-EUCARITICAS: Clulas caractersticas del


resto de los organismos unicelulares y pluricelu- Fig. 7 A) Clula procariota. B) Clula
lares, animales y vegetales. Su estructura es eucariota. La primera est representada a un
aumento mucho mayor que la segunda (ver
ms evolucionada y compleja que la de los escala).
procariotas. Tienen orgnulos celulares y un
ncleo verdadero separado del citoplasma por
una envoltura nuclear. Su ADN est asociado a
protenas (histonas y otras) y estructurado en
numerosos cromosomas.

ESTRUCTURA GENERAL DE LA CLULA


EUCARITICA

En toda clula eucaritica vamos a poder distin-


guir la siguiente estructura:

- Membrana plasmtica
- Citoplasma
- Ncleo
Fig. 8 Dibujo esquemtico de una clula
eucariota vista al MET (P.A.U. junio de 1999).
El aspecto de la clula es diferente segn se
observe al microscopio ptico (MO) o al electr-
nico (MET). Al MO observaremos la estructura celular y al MET la ultraestructura.

J. L. Snchez Guilln Pgina II-1-9


II) La clula 1) Origen de los seres vivos. Teora celular

DIFERENCIAS ENTRE LAS CLULAS VEGETALES Y ANIMALES

Por lo general las clulas vegetales son de mayor tamao que las animales, tienen plastos y
estn envueltas en una gruesa pared celular, tambin llamada pared celulsica o membrana
de secrecin. Sus vacuolas son de gran tamao y no tienen centriolos.

ULTRAESTRUCTURA DE LA CLULA

CLULA VEGETAL
1 Membrana plasmtica
2 Retculo endoplasmtico granular
3 Retculo endoplasmtico liso
4 Aparato de Golgi
5 Mitocondria
6 Ncleo
7 Ribosomas
8 Cloroplasto
9 Pared celulsica
10 Vacuola

Fig. 9 Dibujo esquemtico de la ultraes-


tructura de una clula eucariota vegetal.

CLULA ANIMAL
1 Membrana plasmtica
2 Retculo endoplasmtico granular
3 Retculo endoplasmtico liso
4 Aparato de Golgi
5 Mitocondria
6 Ncleo
7 Ribosomas
8 Centrosoma (Centriolos)
9 Lisosomas
10 Microtbulos (citoesqueleto)

Fig. 10 Dibujo esquemtico de la ultraes-


tructura de una clula eucariota animal.

J. L. Snchez Guilln Pgina II-1-10


II) La clula 1) Origen de los seres vivos. Teora celular

BREVE DESCRIPCIN DE LA ESTRUCTURA Y


FUNCIN DE LOS ORGNULOS CELULARES

MEMBRANA

Membrana plasmtica: Delgada lmina que recubre la clula. Est formada por lpidos, protenas y
oligosacridos. Regula los intercambios entre la clula y el exterior.

Pared celular: Gruesa capa que recubre las clulas vegetales. Est formada por celulosa y otras
sustancias. Su funcin es la de proteger la clula vegetal de las alteraciones de la presin osmtica.

CITOPLASMA

Hialoplasma: Es el citoplasma desprovisto de los orgnulos. Se trata de un medio de reaccin en el que


se realizan importantes reacciones celulares, por ejemplo: la sntesis de protenas y la glicolisis. Contiene
los microtbulos y microfilamentos que forman el esqueleto celular.

Retculo endoplasmtico: Red de membranas intracitoplasmtica que separan compartimentos en el


citoplasma. Hay dos clases: granular y liso. Sus funciones son: sntesis de oligosacridos y maduracin
y transporte de glicoprotenas y protenas de membrana.

Ribosomas: Pequeos grnulos presentes en el citoplasma, tambin adheridos al retculo


endoplasmtico granular. Intervienen en los procesos de sntesis de protenas en el hialoplasma.

Aparato de Golgi: Sistema de membranas similar, en cierto modo, al retculo pero sin ribosomas. Sirve
para sintetizar, transportar y empaquetar determinadas sustancias elaboradas por la clula y destinadas
a ser almacenadas o a la exportacin.

Lisosomas: Vesculas que contienen enzimas digestivas. Intervienen en los procesos de degradacin
de sustancias.

Vacuolas: Estructuras en forma de grandes vesculas. Almacenamiento de sustancias.

Mitocondrias: En ellas se extrae la energa qumica contenida en las sustancias orgnicas (ciclo de
Krebs y cadena respiratoria).

Centrosoma: Interviene en los procesos de divisin celular y en el movimiento celular por cilios y
flagelos.

Plastos: Orgnulos caractersticos de las clulas vegetales. En los cloroplastos se realiza la fotosntesis.

NCLEO

Contiene la informacin celular.

Nucleoplasma: En l se realizan las funciones de replicacin y transcripcin de la informacin celular.


Esto es, la sntesis de ADN y ARN.

Nucleolo: Sntesis del ARN de los ribosomas.

Envoltura nuclear: Por sus poros se realizan los intercambios de sustancias entre el ncleo y el
hialoplasma.

J. L. Snchez Guilln Pgina II-1-11


II) La clula 2) Membranas

II-2A) LAS MEMBRANAS BIOLGICAS.

LA MEMBRANA UNITARIA

Muchas estructuras de la clula estn formadas por membranas. Las membranas


biolgicas constituyen fronteras que permiten no slo separar sino tambin poner en
comunicacin diferentes compartimentos en el interior de la clula y a la propia clula
con el exterior.

La estructura de todas las membranas


biolgicas es muy parecida. Las diferencias
se establecen ms bien al nivel de la fun-
cin particular que tienen los distintos
orgnulos formados por membranas; funcin
que va a depender de la composicin que
tengan sus membranas. Este tipo de mem-
branas se denomina, debido a esto, unidad
de membrana o membrana unitaria. La
membrana plasmtica de la clula y la de los
orgnulos celulares est formada por Fig. 1 Membrana celular vista a gran
membranas unitarias. aumento al microscopio electrnico. Se
destacan dos capas oscuras y una intermedia
clara.
ORGNULOS Y OTRAS ESTRUCTURAS
FORMADOS POR MEMBRANAS UNITARIAS

- Membrana plasmtica
- Retculo endoplasmtico granular y liso
- Aparato de Golgi
- Lisosomas
- Peroxisomas
- Mitocondrias
- Plastos
- Vacuolas
- Envoltura nuclear

CARCTER ANFIPTICO DE LOS LPIDOS. Fig. 2 Sistemas de membranas celulares.

Ciertos lpidos, y en particular los fosfolpi -


dos, tienen una parte de la molcula que es Parte hidrfila

polar: hidrfila y otra (la correspondiente a Fosfolpido


Parte hidrfoba
las cadenas hidrocarbonadas de los cidos
grasos) que es no polar: hidrfoba. Las
molculas que presentan estas caractersticas
reciben el nombre de anfipticas. A partir de
Fosfolpidos
ahora representaremos la parte polar (hidr-
fila) y la no polar (hidrfoba) de los lpidos
anfipticos como se indica en la figura 3. agua

Fig. 3 Monocapa de lpidos anfipticos


(fosfolpidos, por ejemplo) en agua.

J. L. Snchez Guilln Pgina II-2-1


II) La clula 2) Membranas

FORMACIN DE BICAPAS LIPDICAS


agua
Si se dispersa por una superficie acuosa
una pequea cantidad de un lpido
anfiptico, se puede formar una capa de una
molcula de espesor: monocapa. Esto es bicapa
debido a que las partes hidrfilas se dispo- lipdica
nen hacia el interior y los grupos hidrfobos
hacia el exterior de la superficie acuosa.
Pueden tambin formarse bicapas, en particu- agua
lar entre dos compartimentos acuosos.
Entonces, las partes hidrfobas se disponen
Fig. 4 Bicapa lipdica.
enfrentadas y las partes hidrfilas se colocan
hacia la solucin acuosa. Los lpidos
anfipticos forman este tipo de estructuras
espontneamente. Las bicapas pueden formar
compartimentos cerrados denominados
liposomas. Las bicapas lipdicas poseen
caractersticas similares a las de las mem-
branas celulares: son permeables al agua
pero impermeables a los cationes y aniones
y a las grandes molculas polares. En reali-
dad, las membranas celulares son,
esencialmente, bicapas lipdi cas. Fig. 5 Estructura de una membrana
biolgica. 1) Protena integral; 2) protenas
perifricas; 3) Doble capa lipdica.
ESTRUCTURA EN MOSAICO DE LAS
MEMBRANAS BIOLGICAS

Las membranas biolgicas estn constituidas por una doble capa de fosfolpidos con
prote nas. Las protenas se pueden encontrar adosadas a la membrana pero sin
penetrar en la doble capa lipdica: protenas perifricas, o empotradas: prote nas
integrales. Las protenas forman as una especie de mosaico (estructura en mosaico).
Las partes hidrfilas de las prote nas integrales quedan hacia el interior o hacia el
exterior de la capa lipdica y las partes lipfilas (hidrfobas) se sitan en su seno.
Las prote nas integrales atraviesan completamente la membrana.

CARACTERSTICAS DE LAS MEMBRANAS BIOLGICAS

Las molculas que constituyen las membra-


nas se encuentran libres entre s pudiendo
desplazarse en el seno de ella, girar o inclu- 4
4

so rotar, aunque esto ltimo ms raramente.


La membrana mantiene su estructura por 3
uniones muy dbiles: Fuerzas de Van der 1
Waals e interacciones hidrofbicas. Esto le 2

da a la membrana su caracters tica fluidez. 3

Todos estos movimientos se realizan sin


consumo de energa. Los lpidos pueden
presentar una mayor o menor movilidad en Fig. 6 Membrana plasmtica. 1) Doble
funcin de factores internos: cantidad de capa lipdica; 2) protena integral
colesterol o de cidos grasos insaturados, o transmembranar; 3) protena perifrica; 4)
externos: temperatura, composicin de oligosacridos del glicoclix
molculas en el exterior, etc. As, una
mayor cantidad de cidos grasos insaturados

J. L. Snchez Guilln Pgina II-2-2


II) La clula 2) Membranas

o de cadena corta hace que la membrana sea ms fluida y sus componentes tengan
una mayor movilidad; una mayor temperatura hace tambin que la membrana sea ms
fluida. Por el contrario, el colesterol endurece la membrana y le da una mayor
estabilidad y por lo tanto una menor fluidez.

Otra caracterstica de las membranas biolgicas es su asimetra , debida a la


presencia de protenas distintas en ambas caras. Por lo tanto, las dos caras de la
membrana realizarn funciones diferentes. Estas diferencias son de gran importancia a
la hora de interpretar correctamente las funciones de las estructuras constituidas por
membrana.

J. L. Snchez Guilln Pgina II-2-3


II) La clula 2) Membranas

II-2B) FLUJO DE SUSTANCIAS ENTRE LA CLULA Y EL EXTERIOR

LA MEMBRANA PLASMTICA. CONCEPTO

Es una fina membrana que limita y relaciona el interior de la clula, el protoplasma,


con el exterior. Como toda membrana biolgica est constituida sobre todo por
lpidos y prote nas. En la membrana plasmtica encontramos muchas protenas
diferentes, hasta 50 clases diferentes. Tambin hay oligosacridos asociados a las
protenas y a los lpi dos.

ESTRUCTURA EN MOSAICO FLUIDO DE LA MEMBRANA PLASMTICA

La membrana plasmtica es extraordinaria-


mente delgada, teniendo un espesor medio 4

de aproximadamente 10 nm (100 ), por lo 2

que slo se ve con el microscopio 3

electrnico.
1
5
La estructura de la membrana plasmtica es 6

la misma que la de cualquier membrana


biolgica. Est formada por una doble capa
lipdica con protenas integrales y perifricas
que se encuentran dispuestas formando una Fig. 7 Esquema tridimensional de la
estructu ra en mosaico fluido. En su cara membrana plasmtica. 1) Doble capa
lipdica. 2) Oligosacricos del glicoclix; 3)
externa presenta una estructura fibrosa, que protena integral; 4) glicoprotena; 5)
no se encuentra en las membranas de los microtbulo; 6) microfilamento.
orgnulos celulares: el glicoclix, constituido
por oligosacridos. Los oligosacridos del glicoclix estn unidos tanto a los lpidos,
glicolpidos, como a las protenas, glicoprotenas. En la cara interna las protenas
estn asociadas a microtbulos, a microfilamentos y a otras protenas con funcin
esqueltica.

MECANISMOS DE FUSIN DE MEMBRANAS

La fluidez de los componentes de la mem-


brana plasmtica permite su crecimiento por
fusin con membranas provenientes de otros
orgnulos celulares, como las llamadas
vesculas de exocitosis. stas van a poder
fusionarse con la membrana. De esta manera
las sustancias que puedan contener las
vesculas pasan al exterior y al mismo
tiempo los componentes de la membrana de Fig. 8 Fusin de membranas.
la vescu la se integran en la membrana
plasmtica hacindola crecer.

J. L. Snchez Guilln Pgina II-2-4


II) La clula 2) Membranas

DIFERENCIACIONES DE LA MEMBRANA PLASMTICA

La membrana plasmtica puede tener las siguientes diferenciaciones morfolgicas:

MICROVELLOSIDADES. Las clulas que por


su funcin requieren una gran superficie,
por ejemplo, las que realizan la absorcin
de los nutrientes en el tubo digestivo,
tienen una membrana con una gran canti-
dad de repliegues que reciben el nombre
de microvellosidades.

DESMOSOMAS. Se dan en clulas que


necesitan estar fuertemente soldadas con
sus vecinas; por ejemplo: las clulas de la
epidermis de las mucosas. En ellas, el Fig. 9 1) Microvellosidades; 2)
espacio intercelular se ampla en la zona Desmosomas.
de los desmosomas y por la parte interna
de ambas membranas se dispone una sustancia densa asociada a finos filamentos
(tonofilamentos), lo que da a estas uniones una gran solidez.

UNIONES IMPERMEABLES. Se dan entre clulas que forman barreras que impiden el
paso de sustancias, incluso del agua. En ellas, el espacio intercelular desaparece y
las membranas de ambas clulas se sueldan.

FUNCIONES DE LA MEMBRANA PLASMTICA

INTERCAMBIOS. La membrana es, bsicamente, una barrera selectiva


(permeabilidad selectiva). Limita a la clula e impide el paso de sustancias, no de
todas, pero s de muchas, tanto del exterior al interior como en sentido inverso.
No obstante, y a pesar de esta funcin limitante, la clula va a necesitar intercam-
bios constantes con el medio que la rodea. Necesita sustancias nutritivas y tiene
que eliminar productos de desecho, que sern transportados a travs de la mem-
brana y por la propia membrana. La membrana es un elemento activo que
"escoge" lo que entrar o saldr de la clula.

RECEPTORA. Algunas protenas de la membrana plasmtica van a tener esta


funcin, por ejemplo: receptoras de sustancias hormonales. Muchas hormonas regu-
lan la actividad de la clula fijndose en determinados puntos de protenas
receptoras espec ficas. La protena receptora va a liberar en el interior de la clula
una molcula orgnica: el mediador hormonal. Esta sustancia va a actuar regulando
ciertos aspectos del metabolismo celular, por ejemplo, activando determinadas enzi-
mas o desencadenando la activacin de determinados genes. Al existir diferentes
prote nas receptoras en la membrana celular y al tener las clulas diferentes
receptores, la actividad de cada clula ser diferente segn sean las hormonas
presentes en el medio celular.

RECONOCIMIENTO. Se debe a las glicoprotenas de la cara externa de la


membrana. As, las clulas del sistema inmunolgico, clulas que nos defienden de
los agentes patgenos, van a reconocer las clulas que son del propio organismo
diferencindolas de las extraas a l por las glicoprotenas de la membrana. Estas
sustancias constitu yen un verdadero cdigo de identidad.

J. L. Snchez Guilln Pgina II-2-5


II) La clula 2) Membranas

DIFUSIN

Es el fenmeno por el cual las part culas


de un soluto se distribuyen uniformemente
en un disolvente de tal forma que en
cualquier punto de la disolucin se alcanza
la misma concentracin. As, si ponemos
un grano de azcar en un recipiente que
contenga 1 litro de agua destilada y
esperamos el tiempo suficiente, el azcar
se disolver y en cualquier parte de la
Fig. 10 Difusin de un soluto (glucosa) en
disolucin un volumen dado de sta
el seno de un disolvente (agua).
contendr la misma cantidad de molculas
que cualquier otro. Esto es debido a que
las molculas del soluto se comportan, en cierto modo, como las de un gas
encerrado en un recipiente desplazndose en todas las direcciones.

CLASES DE MEMBRANAS

En los medios orgnicos la difusin est


dificultada por la existencia de membranas.
Las clulas estn separadas del medio inter-
celular y de las otras clulas por la
membrana plasmtica y determinados
orgnulos celulares estn tambin separados
del hialoplasma por membranas biolgicas.

En general, las membranas pueden ser:


permeables, impermeables y semi- Fig. 11 Clases de membranas.
permeables. Las membranas permeables
permiten el paso del soluto y del disolven-
te, las impermeables impiden el paso de ambos y las semipermeables permiten pasar
el disolvente pero impiden el paso de determinados solutos. Esto ltimo puede ser
debido a diferentes causas. As, por ejemplo, muchas membranas tienen pequeos
poros que permiten el paso de las pequeas molculas y no de las que son
mayores; otras, debido a su composicin, permiten el paso de las sustancias hidrfi-
las y no de las lipfilas, o a la inversa.

LA PERMEABILIDAD SELECTIVA

Las membranas biolgicas se comportan en cierto modo como membranas


semipermeables y van a permitir el paso de pequeas molculas, tanto las no polares
como las polares. Las primeras se disuelven en la membrana y la atraviesan
fcilmente. Las segundas, si son menores de 100 u tambin pueden atravesarla. Por
el contrario, las molculas voluminosas o las fuertemente cargadas, iones, quedarn
retenidas. La membrana plasmtica es permeable al agua y a las sustancias
lipdicas. No obstante, como veremos ms adelante, determinados mecanismos van
a permitir que atraviesen la membrana algunas molculas que por su composicin o
tamao no podran hacerlo. Esto es, las membranas biolgicas tienen permeabilidad
selectiva. De este modo la clula asegura un medio interno diferente del exterior.

J. L. Snchez Guilln Pgina II-2-6


II) La clula 2) Membranas

SMOSIS

Si a ambos lados de una membrana semipermeable se ponen dos disoluciones de


concentracin diferente el agua pasa desde la ms diluida a la ms concentrada. Este
proceso se denomina smosis y la presin necesaria para contrarrestar el paso del
agua se llama presin osmtica.

La smosis se debe a que la membrana semipermeable impide el paso del soluto del
medio ms concentrado al menos concentrado, pero si puede pasar el disolvente, el
agua, en la mayora de los casos, en sentido inverso. Si se trata de un
compartimento cerrado, este aumento de la
cantidad de disolvente a un lado de la
membrana semipermeable es el responsable
de la presin osmtica.

Al medio que tiene una mayor


concentracin en partcu las que no pueden
atravesar la membrana (soluto), se le deno-
Fig. 12 smosis a travs de una
mina hipertnico, mientras que al menos
membrana semipermeable. La sustancia
concentrado en solutos se le llama representada por los crculos mayores no
hipotnico. Si dos disoluciones ejercen la puede pasar a travs de los poros de la
misma presin osmtica, por tener la misma membrana.
concentracin de partculas que no se
pueden difundir a ambos lados de la
membrana semipermeable, diremos que son
isotnicas. Es de destacar que podemos
tener dos disoluciones diferentes a ambos
lados de una membrana semipermeable y, sin
embargo, ambas ser isotnicas entre s.
As, por ejemplo, si a un lado de una
membrana semipermeable tenemos una
disolucin 0,1 molal de glucosa y al otro
lado una disolucin 0,1 molal de fructo sa,
ambas disoluciones son diferentes, pero Fig. 13 a) Turgescencia y b) plasmolisis
como tienen el mismo nmero de partcu las de una clula vegetal normal (c).
de soluto por unidad de volumen, ambas
ejercern la misma presin osmtica.

LAS CLULAS Y LA PRESIN OSMTICA

El interior de la clula es una compleja


disolucin que, normalmente, difiere del
medio extracelular. La membrana de la clula,
membrana plasmtica, se comporta como Fig. 14 a) Plasmolisis y c) turgescencia de
un glbulo rojo normal (b).
una membrana semipermeable.

Cuando una clula se encuentra en un medio hipertnico, el hialoplasma y el interior


de los orgnulos formados por membranas, por ejemplo: las vacuolas de las clulas

J. L. Snchez Guilln Pgina II-2-7


II) La clula 2) Membranas

vegetales, pierden agua, producindose la plasmolisis del contenido celular. Por el con-
trario, si la clula se introduce en una disolucin hipotnica se producir una penetra-
cin del disolvente y la clula se hinchar: turgencia o turgescencia. En las clulas
vegetales la turgencia no suele presentar un grave problema pues estn protegidas
por una gruesa pared celular. En las clulas animales la turgencia puede acarrear la
rotura de la membrana plasmtica. As, los glbulos rojos introducidos en agua
destilada primero se hinchan y despus explotan (hemolisis) liberando el contenido ce-
lular1 .

TRANSPORTE DE SUSTANCIAS A TRAVS DE LA MEMBRANA PLASMTICA

La clula necesita sustancias para su metabolismo. Como consecuencia de ste se


van a producir sustancias de desecho que la clula precisa eliminar. As pues, a
travs de la membrana plasmtica se va a dar un continuo transporte de sustancias
en ambos sentidos. Segn la direccin de este y el tipo de sustancia tendremos:

- Ingestin:Es la entrada en la clula de aquellas sustancias necesarias para su


metabolismo.

- Excrecin: Salida de los productos de desecho.

- Secrecin: Si lo que sale no son productos de desecho sino sustancias


destinadas a la exportacin.

Aunque vamos a referirnos nicamente al transporte a travs de la membrana


plasmtica, deber tenerse en cuenta que los fenmenos de transporte que estudiare-
mos a continuacin se dan tambin a travs de las membranas biolgicas de los
orgnulos formados por membranas: retculo, aparato de Golgi, lisosomas, vacuolas,
mitocondrias y plastos.
Mediante estos fenmenos la clula asegura un medio interno diferente y funciones
distintas en cada uno de los orgnulos formados por membranas.

1
Curiosidades: La presin osmtica de nuestras clulas est entre 7 y 8 atm, que se corresponde
con la que ejercera una disolucin conteniendo 9,596 g/l de NaCl. En nuestro organismo existe un
rgano especializado en regular la presin osmtica, se trata del rin. Su misin, entre otras, es la de
extraer agua y sales del plasma sanguneo para mantener estable la concentracin de solutos y por lo
tanto la presin osmtica. La presin osmtica interviene en muchos otros procesos biolgicos; por ejem-
plo en los que determinan la absorcin y transporte de la savia en los vegetales o en el movimiento en
ciertos animales.

Ciertos organismos unicelulares de las aguas dulces, por ejemplo, el paramecio, al vivir en agua dulce,
su citoplasma es hipertnico con respecto al exterior, por lo que se produce una entrada continua de
agua. No obstante disponen de ciertos orgnulos, las vacuolas pulstiles, que extraen el agua del cito-
plasma y la expulsan al exterior.

J. L. Snchez Guilln Pgina II-2-8


II) La clula 2) Membranas

A) EL TRANSPORTE DE SUSTANCIAS EN
FORMA MOLECULAR A TRAVS DE LAS
MEMBRANAS
Ext.

En el caso de sustancias disueltas, segn 1 2 3

se consuma o no energa, distinguiremos los


Int.
siguientes tipos de transporte: ATP ADP

I) Transporte pasivo. Se trata de un


transporte a favor del gradiente de Fig. 15 1 y 2) Transporte pasivo. 3)
concentracin, por lo que no requiere un Transporte activo.
aporte de energa. Puede ser:
2

a) Transporte pasivo simple o difusin de 2


2
2
molculas a favor del gradiente. Ext. 2 2 2
2
a) Difusin a travs de la bicapa 2 2 2

lipdica. Pasan as sustancias


lipdicas como las hormonas 2
2
esteroideas, los frmacos liposolubles Int. 2
2

2
y los anestsicos, como el ter.
Tambin sustancias apolares como el
oxgeno y el nitrgeno atmosfrico y Fig. 16 Transporte pasivo simple de iones
algunas molculas polares muy a travs de una protena canal. 1) glucosa;
2) in sodio.
pequeas como el agua, el CO2 , el
etanol y la glicerina.
Medio ms
b) Difusin a travs de canales glucosa concentrado

proticos. Se realiza a travs de


protenas canal. Protenas que
forman canales acuosos en la doble
capa lipdica. Pasan as ciertos
iones, como el Na+ , el K+ y el Ca+ + .

b) Transporte pasivo facilitado (difusin naveta

facilitada). Las molculas hidrfilas (glcidos, Medio menos concentrado

aminocidos...) no pueden atravesar la doble


Fig. 17 Transporte pasivo facilitado de
capa lipdica por difusin a favor del molculas de glucosa a travs de permeasas.
gradiente de concentracin. Determinadas
protenas de la membrana, llamadas Medio menos concentrado

permeasas, actan como "barcas" para que


estas sustancias puedan salvar el obstculo
que supone la doble capa lipdi ca. Este tipo
de transporte tampoco requiere un consumo
de energa, pues se realiza a favor del gra- E

diente de concentracin.

II) Transporte activo: Cuando el transporte Medio ms concentrado

se realiza en contra de un gradiente qumi co


(de concentracin) o elctrico (ver nota 1). Fig. 18 Transporte activo. La molcula
Para este tipo de transporte se precisan pasa del medio menos concentrado al ms
concentrado con gasto de energa(E).
transportadores especfi cos instalados en la

J. L. Snchez Guilln Pgina II-2-9


II) La clula 2) Membranas

membrana, siempre prote nas, que, mediante


receptor sustancia
un gasto de energa en forma de ATP, membrana

transportan sustancias a travs de sta. Con


este tipo de transporte pueden transportarse,
adems de pequeas part culas, molculas
orgnicas de mayor tamao, siempre en
clatrinas

contra del gradiente de concentracin o Vescula de endocitosis

elctrico.
Fig. 19 La endocitosis mediada por
receptor implica la presencia en la membrana
Nota 1 : Puede darse el caso de que el interior y el exterior de la
de receptores especficos de la sustancia que
clula sean isotnicos pero que exista una diferencia en el va a ser ingerida.
potencial elctrico que impida el paso de los iones. As, por
ejemplo, entre el interior y el exterior de la neurona hay una
diferencia de potencial de -70 mV, estando el interior cargado
negativamente respecto al exterior. En este caso, los iones
positivos tendrn dificultades para salir de la clula, incluso si
esta salida se realiza a favor de la presin osmtica.

B) TRANSPORTE CITOQU MICO Permite la


entrada o la salida de la clula de partculas
o grandes molculas envueltas en una mem-
brana. Se trata de un mecanismo que slo
Fig. 20 Ameba.
es utilizado por algunos tipos de clulas, por
ejemplo: amebas, macrfagos o las clulas
del epitelio intestinal.
1 4
2 3

I) ENDOCITOSIS. Las sustancias entran en la


clula envueltas en vesculas formadas a A B C

partir de la membrana plasmtica.


Fig. 21 A, B y C) Ameba fagocitando
Cuando lo que entra en la clula son part - bacterias. 1) Seudpodo. 2) Bacteria. 3)
Vacuola digestiva. 4) Ncleo.
culas slidas o pequeas gotitas lquidas el
transporte se realiza por mecanismos espe-
ciales e incluso se hace perceptible. Estos
mecanismos implican una deformacin de la
membrana y la formacin de vacuolas. Este
tipo de transporte puede ser de gran
importancia en ciertas clulas, como por
ejemplo, en los macrfagos y en las
amebas. Distinguiremos dos tipos de endo-
citosis: la fagocitosis y la pinocitosis

a) Fagocitosis: Es la ingestin de grandes


part culas slidas (bacterias, restos celu-
lares) por medio de seudpodos. Los seu-
dpodos son grandes evaginaciones de la Fig. 22 Pinocitosis.
membrana plasmtica que envuelven a la
part cula. sta pasa al citoplasma de la clula

J. L. Snchez Guilln Pgina II-2-10


II) La clula 2) Membranas

en forma de vacuola fagoctica. Este tipo de ingestin la encontramos, por ejemplo,


en las amebas o en los macrfagos.

b) Pinocitosis. Es la ingestin de sustancias disueltas en forma de pequeas gotitas


lqui das que atraviesan la membrana al invaginarse sta. Se forman as pequeas
vacuolas llamadas vacuolas pinocticas que pueden reunirse formando vacuolas de
mayor tamao.

II) EXOCITOSIS: Consiste en la secrecin o


excrecin de sustancias por medio de vacuo-
las, vesculas de exocitosis, que se fusionan
con la membrana plasmtica abrindose al
exterior y expulsando su contenido. Las
vacuolas provienen de los sistemas de
membranas o de la endocitosis. La mem-
brana de la vacuola queda incluida en la
membrana celular, lo que es normal teniendo
en cuenta que ambas membranas poseen la
misma estructura.

En todos los mecanismos de endocitosis


hay una disminucin de la membrana
plasmtica al introducirse sta en el
citoplasma. Esta disminucin es compensada
por la formacin de membranas por exocito-
Fig. 23 Exocitosis: Secrecin de moco en
sis. La membrana plasmtica est en estas
una clula mucosa de la pared intestinal.
clulas en un continuo proceso de
renovacin. En un macrfago, por ejemplo,
toda su membrana es ingerida en 30 min.

J. L. Snchez Guilln Pgina II-2-11


II) La clula 3) Hialoplasma

3) EL MEDIO INTERNO CELULAR

EL HIALOPLASMA

Si retiramos los orgnulos del citoplasma


obtendremos una disolucin constituida por
agua, sales minerales y molculas orgnicas,
protenas, fundamentalmente. Esta disolucin
es el hialoplasma. Entre las protenas, unas Fig. 1 Ameba. Los cambios sol-gel en el
hialoplasma estn relacionados con el
son enzimticas y otras estructurales. Estas movimiento ameboide.
ltimas forman el citoesqueleto.

En el hialoplasma se van a realizar gran


cantidad de procesos qumicos: la sntesis
de prote nas, la glucolisis y las primeras
fases de la degradacin de las grasas y de
algunos aminocidos. El hialoplasma es un
medio de reaccin.
Estado de sol Estado de gel

El hialoplasma, al tener grandes molculas,


va a sufrir transformaciones en el estado
Fig. 2 Estados de sol y gel.
sol-gel. Estas transformaciones darn lugar al
movimiento ameboide y a los fenmenos de
ciclosis.

EL CITOESQUELETO

Es un verdadero armazn interno celular.


Est constituido por unos finos tubos: los
microtbulos. El citoesqueleto es el respon-
sable de la forma de la clula y del
movimiento celular.
Fig. 3 1) Membrana plasmtica. 2)
Microtbulo. 3) Mitocondria. 4) Microtrabcula.
Los microtbulos son pequeos cilindros 5) Retculo endoplasmtico granular. 6)
huecos. Estn unidos a la membrana celular Ribosomas.
a los orgnulos y a la envoltura nuclear,
formando una compleja red bajo la membra-
na plasmtica y alrededor del ncleo celular.
Los microtbulos se forman a partir de unas
protenas globulares denominadas tubulinas.

En el hialoplasma vamos a encontrar


tambin otros tipos de estructuras filamento-
sas.
Fig. 4 Microfotografa en la que se
observan dos microtbulos.

J. L. Snchez Guilln Pgina II-3-1


II) La clula 3) Hialoplasma

FUNCIONES DEL CITOESQUELETO

Los microtbulos juegan un papel de gran Tubulina

importancia en el movimiento celular. La


capacidad de estas estructuras para formarse Tubulina

y destruirse (polimerizarse y despolimerizarse)


con gran rapidez es la responsable de
fenmenos tales como la variacin de la
forma celular o los movimientos celulares
tanto intra como extracitoplasmticos.
Fig. 5 Ultraestructura de un microtbulo.

A) Movimientos intracelulares de los orgnu-


los. Los microtbulos pueden constituir un
soporte sobre el que los orgnulos (mitocon-
drias, plastos, vescu las, cromosomas, etc.)
van a poder desplazarse por el interior del
citoplasma.

B) Movimientos extracelulares. Cilios y flage- Espermatozoide


Ciliado

los son prolongaciones citoplasmticas que


aseguran los movimientos de la clula o de
Fig. 6 1) Ciliado; 2) flagelado.
los fluidos alrededor de sta. Estas
estructuras reciben el nombre de orgnulos
vibrtiles de la clula. Ambos tienen la mis-
ma estructura, pero los cilios son cortos y
numerosos, mientras los flagelos son largos
y poco numerosos. Los vamos a encontrar
en organismos unicelulares y pluricelulares,
tanto animales como vegetales. As, el inte-
rior de nuestros rganos respiratorios se
encuentra recubierto por clulas con cilios
que forman el epitelio vibrtil o ciliado, y lo Fig. 7 Esquema del corte transversal de un
cilio o de un flagelo: a) Pares de
mismo ocurre en las trompas de Falopio del
microtbulos; b) membrana c) Microtbulos
aparato genital femenino. Tienen flagelos centrales.
muchos organismos unicelulares, la mayora
de los gametos masculinos de los animales
y muchos de los vegetales (algas, musgos,
helechos).

Si hacemos un corte transversal a un flage-


lo o a un cilio y lo observamos a gran
aumento al MET, veremos que presenta 9
pares de microtbulos. En el interior se en-
cuentran dos microtbulos centrales y todo
ello est rodeado por la membrana. En la
base de cada cilio o flagelo hay una Fig. 8 El centrosoma en una clula animal.
1) Aparato de Golgi; 2) ribosomas; 3) ncleo;
estructura denominada corpsculo basal. Los
4) nucleolo; 5 envoltura nuclear; 6)
corpsculos basales tienen una estructura centrosoma; 7) R.E.G; 8) mitocondria;
similar, en cierto modo, a la de los centrio- (examen de P.A.U. de sept. 1998).
los.

J. L. Snchez Guilln Pgina II-3-2


II) La clula 3) Hialoplasma

ster

Dato: Los microtbulos de cilios y flagelos


se deslizan unos sobre otros rpidamente,
batiendo a un ritmo de 500 a 1000 veces
por minuto.

centrolo
EL CENTROSOMA
Fig. 9 Esquema del centrosoma de una
Se trata de un centro organizador de micro- clula animal.
tbulos. Se encuentra tanto en las clulas
animales como en las vegetales. En las
clulas animales encontramos adems unas
estructu ras denominadas centriolos que no
se encuentran en las clulas vegetales.

Los centriolos son elementos permanentes


de la clula animal. Vistos al microscopio
electrnico de transmisin (MET) tienen
forma de barril. Son dos estructuras
cilndricas de 0.5 m situadas perpendicu- Fig. 10 Microfotografa de una pareja de
larmente una a la otra. Estn constituidos centrolos.
por 9 tripletas de cortos microtbulos que
se disponen paralelamente unos a otros
formando una hlice.

El centrosoma es muy importante en los


procesos de divisin celular. En la divisin
celular a partir del centrosoma se originar
una estructura llamada huso acromtico
responsable del desplazamiento de los cro-
mosomas a polos opuestos de la clula.
Fig. 11 Ultraestructura del corte
transversal de un centrolo.

centrosoma

Huso acromtico

Cromosomas
(cromtida)

centriolos

Fig. 12 Clula en divisin.

J. L. Snchez Guilln Pgina II-3-3


II) La clula 4) Sis. de membranas

4) SISTEMAS DE MEMBRANAS DEL CITOPLASMA

El citoplasma se encuentra compartimentado


por un complejo sistema de estructuras
formadas por membranas biolgicas relacio-
nadas entre s tanto fsicamente como por
la funcin que realizan, por lo que las
estudiaremos conjuntamente.

Estos orgnulos son:

- Retculo endoplasmtico granular (REG)


- Retculo endoplasmtico liso (REL)
Fig. 1 Esquema de una clula visto al
- Aparato de Golgi (AG) M.E.T. en el que se observan diferentes
- Lisosomas y peroxisomas estructuras constitudas por membranas.
- Vacuolas (P.A.U. de septiembre de 1997).

RETCULO ENDOPLASMTICO (RE)

Es un complejo sistema de tubos, sacos y


cisternas constituidos por membranas biolgi-
cas y que pueden ocupar una gran parte de
la clula.

Existen dos tipos de retculo endoplas-


mtico: el retculo endoplasmtico liso (REL)
y el retculo endoplasmtico rugoso o
granular (REG). En el REG se observan adhe-
ridos a las membranas unos grnulos: los Fig. 2 Elementos del retculo
ribosomas. En el REL no existen stos endoplasmtico.
grnulos y sus estructuras tienen formas
ms tubulares. Tambin se diferencian en la
funcin.

Las estructuras que forman el retculo


endoplasmtico granular se disponen general-
mente en capas concntricas paralelas al
ncleo celular (como las hojas del bulbo de
una cebolla). Es de destacar que la envoltura
nuclear es en realidad una estructura
derivada del retcu lo endoplasmtico.

El retcu lo endoplasmtico granular (REG)


est muy desarrollado en las clulas que por
su funcin deben de realizar una activa labor
Fig. 3 Microfotografa al microscopio
de snte sis, como es el caso de las clulas electrnico de elementos del retculo
del pncreas y las clulas hepticas. Si un endoplasmtico granular.
animal es sometido a un ayuno prolongado,
el REG de sus clulas pancreticas se reduce

J. L. Snchez Guilln Pgina II-4-1


II) La clula 4) Sis. de membranas

considerablemente. Por el contrario, si se le


suministra una rica dieta alimenticia, el REG
se recupera. Esta recuperacin se realiza a
partir de zonas prximas a la envoltura
nuclear.

RIBOSOMAS

Son pequeos orgnulos invisibles al mi-


croscopio ptico y poco visibles al electr- Fig. 4 Ribosomas y polirribosomas.
nico, no pudindose casi ni adivinar su
estructu ra. Invaden en gran nmero el
citoplasma y pueden estar libres o adheridos
a las membranas del retculo endoplasmtico
1
granular. Los que estn adheridos al REG
intervienen en la sntesis de las protenas
de las membranas o de aquellas destinadas
2
al exterior. Los ribosomas estn constituidos 3
bsicamente por prote nas y ARN-r (40% de
protenas y 60% de ARN ribosomal).
Fig. 5 Ultraestructura del ribosoma. 1)
Subunidad menor (40S). 2) Subunidad mayor
Estn formados por dos subunidades: la (60S). 3)Ribosoma completo (80S).
subunidad mayor y la subunidad menor. En
el citoplasma ambas estn separadas pero
pueden volver a unirse en el momento de la
sntesis de prote nas.

EL APARATO DE GOLGI (AG)

Est formado por unos conjuntos de sacos


concntricos muy apretados, mucho ms
concentrados y de menor tamao que los
del retculo endoplasmtico granular y sin Fig. 6 Dictiosoma del aparato de Golgi.
ribosomas. Cada conjunto de sacos es un
dictiosoma. El nmero de dictiosomas por
clula vara entre 5 6 a algunas decenas,
en funcin del tipo de clula y de su estado
funcional. Todos ellos se encuentran
relacionados fsica y funcionalmente.

Los dictiosomas presentan dos caras: una


convexa, la cara de formacin, y otra
cncava, la cara de maduracin. De esta
ltima se van desprendiendo pequeas
vacuolas que se independizan y que reciben Fig. 7 Esquema de un dictiosoma del
el nombre de vesculas de secrecin. aparato de Golgi. 1) Vesculas de secrecin.
2) Sculos. 3) Vesculas de transicin. 4)
Retculo endoplasmtico granular.
El AG se encuentra en permanente trans-

J. L. Snchez Guilln Pgina II-4-2


II) La clula 4) Sis. de membranas

formacin. Sus sculos se forman de manera


continua por su cara de formacin a partir
de vescu las que se desprenden del REG y
se desintegran por la cara de maduracin
para formar las vescu las de secrecin.

El aparato de Golgi se encuentra muy desa-


rrollado en las clulas que realizan funciones
de secrecin, como las clulas secretoras de
mucus del epitelio intestinal.

Los dictiosomas son el sistema de empa-


quetamiento de ciertas sustancias
qumicas, sobre todo de protenas, para su Fig. 8 Clula vegetal. 1) pared celular; 2)
almacenamiento o secrecin. dictiosoma de aparto de Golgi; 3) vacuola; 4)
envoltura nuclear; 5) nucleolo; 6) retculo
endoplasmtico granular; 7 mitocondria; 8)
cloroplasto.
LOS LISOSOMAS

Los lisosomas son pequeas vesculas constituidas por membranas provenientes de


los sistemas de membranas (AG y, ocasionalmente, REG). Se caracterizan por tener
en su interior enzimas hidrolti cas, enzimas que rompen los enlaces de los polmeros
por adicin de H2 O. Estas enzimas estn empaquetadas e inactivas en los lisosomas
y as se evita que puedan destruir las propias estructuras celulares.

Los lisosomas se originan en los dictiosomas del aparato de Golgi y, en algunos


casos, en ciertas regiones del retculo endoplasmtico granular a partir de vescu las
que se destacan de los sculos de los dictiosomas. Slo se encuentran en las clulas
animales.

LOS PEROXISOMAS

Parecidos a los lisosomas, diferencindose


de estos en que contienen enzimas que
degradan los cidos grasos y los
aminocidos. Como estos procesos generan
perxidos, contienen tambin catalasa,
enzima que descompone los perxidos y en
particular el H2 O2 en H2 O y O2 .

LAS VACUOLAS

Son estructuras celulares variables en


Fig. 9 Clula del peciolo de una hoja de
nmero y forma. En general estn consti-
remolacha. 1) Pared celular. 2) Vacuola. 3)
tuidas por una membrana y un contenido Cloroplastos. 4) Ncleo. 5) Citoplasma.
interno. Hay diferencias entre las vacuolas
de las clulas vegetales y las de las clulas
animales. Las clulas vegetales es frecuente

J. L. Snchez Guilln Pgina II-4-3


II) La clula 4) Sis. de membranas

que presenten una nica o unas pocas


vacuolas de gran tamao. Las clulas
animales, en el caso de tener vacuolas, son
de pequeo tamao.

Las vacuolas se originan por la agregacin


de las pequeas vesculas formadas a partir
de los dictiosomas de aparato de Golgi o
por invaginacin de la membrana plasmtica
(endocitosis).

Las vacuolas, en general, tienen funcin de


almacenamiento de sustancias de reserva y,
en ciertos casos, de almacenamiento de
Fig. 10 Vc) gran vacuola en una clula
sustancias txicas.
vegetal.

Existen otras estructuras que se llaman


tambin vacuolas pero cuya funcin es muy
diferente. As:

- Las vacuolas pulstiles, como las que se


observan en muchos organismos unicelulares
de las aguas dulces, por ejemplo, el parame-
cio. Este organismo, al vivir en agua dulce,
su citoplasma es hipertnico con respecto al
exterior, por lo que se produce una entrada
continua de agua. Las vacuolas pulstiles Fig. 11 Paramecios en los que se observan
vacuolas digestivas.
extraen el agua del citoplasma y la expulsan
al exterior por tansporte activo.
cil
- Las vacuolas digestivas. Se dan en las vp Mn
mn vp
clulas que capturan alimentos del medio y
los engloban en una membrana formando
una vacuola llamada vacuola digestiva. En
esta vacuola es donde se va a producir la
digestin de esas sustancias nutritivas. Una vd
vez digeridas pasan al interior de la clula y
los productos de desecho son eliminados Fig. 12 Paramecio, ciliado de las aguas
dulces. vp) Vacuola pulstil. vd) Vacuola
hacia el exterior. digestiva. cil) Cilios. Mn) Macroncleo. mn)
Microncleo.

J. L. Snchez Guilln Pgina II-4-4


II) La clula 4) Sis. de membranas

FUNCIONES DE LOS SISTEMAS DE MEMBRANAS

> Maduracin de protenas: Los sistemas de membranas estn relacionados con la


sntesis, maduracin y transporte de protenas y glicoprotenas. Intervienen, sobre
todo, en los procesos subsiguientes a la sntesis de las protenas de secrecin, las
protenas de las membranas y las enzimas de los lisosomas. Muchas de estas
protenas son glicoprotenas. La parte protica se sintetiza en el hialolplasma y de
aqu pasa al interior del REG y del A. Golgi donde unas enzimas les aaden los
oligosacridos (maduracin de las glicoprotenas). Despus se dirigirn, por medio de
las vesculas de secrecin que se desprenden del Golgi, a formar los lisosomas, a
integrarse en la membrana plasmtica o a la exportacin.

Glicosiltransferasa
( enzima)
Ribosoma
ARNm

Cisterna del REG

Glicoprotenas

Membrana del REG

Fig. 13 Maduracin y transporte de glicoprotenas en el REG.

> Funcin de los lisosomas: Hemos visto


que ciertas clulas tienen la capacidad de
ingerir sustancias por medio de fenmenos de
endocitosis. Las sustancias son englobadas
por la membrana plasmtica que, a
continuacin, se invagina formando una
vescula denominada fagosoma. El fagosoma
se fusiona con los lisosomas formando los
fagolisosomas. Las grandes molculas conte-
nidas en el fagosoma: polisacridos, prote -
nas, cidos nucleicos, etc., son sometidas a
la accin del medio cido de los lisosomas y
a las enzimas, que en este momento ya son
activas. Los polme ros son hidrolizados y
transformados en molculas menores: monosa-
cridos, aminocidos, etc., que se difunden a
travs de la membrana hacia el citoplasma. Fig. 14 1) Endocitosis; 2) lisosomas; 3)
fagolisosoma; 4) lisosoma secundario; 5)
Quedan en el lisosoma los productos no
cuerpos residuales; 6 y 7) exocitosis (excre-
degradados. Un lisosoma que ya ha actuado cin); 8 digestin de una mitocondria por un
recibe el nombre de lisosoma secundario y lisosoma (autofagia).
conserva an la capacidad de unirse a

J. L. Snchez Guilln Pgina II-4-5


II) La clula 4) Sis. de membranas

nuevos fagosomas. Las sustancias no de-


gradadas se van acumulando progresivamen-
te en el interior de los lisosomas secunda-
rios. En ciertos organismos, estos lisosomas
secundarios pueden fusionarse con la
membrana plasmtica y expulsar su
contenido al exterior (exocitosis). En los
organismos pluricelulares lo normal es que
los lisosomas secundarios se transformen en
cuerpos residuales. Esta acumulacin de
cuerpos residuales en una clula a lo largo
de su vida es un signo de degeneracin
celular.

La membrana de los lisosomas puede englo- Fig. 15 Relaciones entre el 1) REG, 2) el


bar tambin orgnulos celulares que de esta aparato de Golgi y las protenas de membrana
manera son digeridos. Por este sistema la o la secrecin de protenas u otras sustancias
clula renueva sus estructuras celulares. (3).

> Sntesis de los polisacridos de la pared celular

En el aparato de Golgi se produce la


sntesis de los polisacridos y en particular
plasmodesmos
Pared celular de la
la sntesis de la celulosa que constituye la clula contigua
sustancia fundamental de las paredes de las
clulas vegetales. Pared primaria

Pared
Las clulas vegetales disponen de una es- secundaria

tructura que las envuelve denominada pared


celular, constituida, fundamentalmente, por
celulosa. La celulosa est formada por mol-
culas de glucosa unidas entre s mediante
enlaces (1-4). Esto hace que las molculas Fig. 16 Fragmento de una clula vegetal
de celulosa adopten una conformacin lineal mostrando la pared celular y los
y que se puedan establecer puentes de hidr- plasmodesmos.
geno entre molculas dispuestas en paralelo
formando microfibrillas entre las que se sitan entrecruzadas molculas de otras
sustancias, como la lignina, que le da a la pared una gran rigidez, o ceras, que la
impermeabilizan. La pared celular no es un orgnulo celular sino un producto de
secrecin de la clula que deposita en su exterior estas sustancias concntricamente.
La pared celular aparece adems atravesada por una gran cantidad, hasta 20 000 en
ciertos casos, de finsi mos conductos denominados plasmodesmos. Los plasmodes-
mos comunican el protoplasma de las clulas contiguas que, en cierto modo, forman
una unidad.

En la pared celular distinguiremos, del interior al exterior de la clula, la pared


secundaria, la pared primaria y la laminilla media.

La pared secundaria. Ms gruesa y resistente, crece bajo la primera y se la

J. L. Snchez Guilln Pgina II-4-6


II) La clula 4) Sis. de membranas

encuentra principalmente en clulas que estn ya diferenciadas.

La pared primaria. Formada por microfibrillas de celulosa ms desordenadas


y es la nica que est presente en clulas jvenes y en clulas que se
dividen activamente.

La laminilla media. Difcil de ver al microscopio. Est formada por


sustancias pcticas y mantiene unidas a las clulas contiguas.

> Funciones del retculo endoplasmtico liso (REL)

El retculo endoplasmtico liso est relacionado con el metabolismo (sntesis,


degradacin y transporte) de los lpi dos. Las hormonas estero dicas son sintetizadas
en el REL. Se ha observado que tambin interviene en los procesos para metabolizar
ciertos medicamentos y determinadas sustancias txicas.

J. L. Snchez Guilln Pgina II-4-7


II) La clula 5) Enzimas

5) EL METABOLISMO CELULAR: GENERALIDADES. ENZIMAS

EL METABOLISMO: CONCEPTO

La nutricin de las clulas supone una serie de complejos procesos qumicos


catalizados por enzimas que tienen como finalidad la obtencin de materiales y/o
energa. Este conjunto de procesos recibe el nombre de metabolismo.

ANABOLISMO Y CATABOLISMO

El metabolismo va a poder descomponerse en dos series de reacciones:

Anabolismo. Son aquellos procesos qumicos que se producen en la clula y


que tienen como finalidad la obtencin de sustancias orgnicas complejas a
partir de sustancias ms simples con un consumo energa. Son anablicos, por
ejemplo, la fotosntesis, la sntesis de protenas o la replicacin del ADN.

Catabolismo. En estos procesos las molculas complejas son degradadas


formndose molculas ms simples. Se trata de procesos destructivos
generadores de energa; como por ejemplo: la glucolisis.

H2O Sales minerales


CO2

Fotosntesis

Compuestos
Glcidos orgnicos Prtidos

Lpidos aminocidos
Glucosa

Gluclisis Compuestos
intermediarios
Nitrgeno inorgnico

Fermentacin Respiracin

cido Lctico
CO2 H2O anabolismo
Etanol
catabolismo

Fig. 1 Principales rutas del metabolismo.

TIPOS DE METABOLISMO

Los organismos no se diferencian en la manera de procurarse compuestos inorgni-


cos del medio, todos los obtienen de una manera directa. En cambio, si se van a

J. L. Snchez Guilln Pgina II-5-1


II) La clula 5) Enzimas

diferenciar en cmo van a obtener las sustancias orgnicas. Ciertos organismos las
obtienen a partir de sustancias inorgnicas, como el CO2 , H2 O, NO3 -, PO4 -3 , etc. A
estos organismos se les llama auttrofos. Otros son incapaces de elaborar los com-
puestos orgnicos a partir de compuestos inorgnicos y deben obtenerlos del medio,
son los organismos hetertrofos.

Los organismos adems de materiales necesitan tambin energa. Cuando la fuente


de energa es la luz, el organismo recibe el nombre de fotosinttico. Cuando la
energa la obtienen a partir de sustancias qumicas, tanto orgnicas como
inorgnicas, los llamaremos quimiosintticos.

LAS ENZIMAS. CONCEPTO DE CATLISIS

energa
Las enzimas son protenas o asociaciones
Sin enzima Energa de activacin
Energa
total sin enzima

305, 14 KJ 292,6KJ

de protenas y otras molculas orgnicas o


inorgnicas que actan catalizando los con enzima

procesos qumicos que se dan en los seres Id. con enzima

vivos. Energa neta


12,54 KJ

A desarrollo de la reaccin B

Esto es, actan facilitando las


transformaciones qumicas; acelerando Fig. 2 Energa de activacin necesaria
para que A se trasforme en B, con y sin
considerablemente las reacciones y
enzima.
disminuyendo la energa de activacin que
muchas reacciones requieren.

As, por ejemplo:

I) La descomposicin del agua oxigenada (perxido de hidrgeno) en agua y oxgeno, segn la reaccin:

2H2O2 ----------> 2H2O + O2


es una reaccin que puede transcurrir espontneamente pero es extraordinariamente lenta. En condi-
ciones normales se descomponen 100 000 molculas cada 300 aos por cada mol de H2O2 (6,023*1023
molculas). Sin embargo, en presencia de una enzima que hay en nuestras clulas, la catalasa, el proceso
se desarrolla con extraordinaria rapidez (el burbujeo que se produce al echar agua oxigenada en una
herida es debido a esto).

II) La reaccin de desfosforilacin de la glucosa:

Glucosa-6-P + H2O ----------> Glucosa + Pi

es exergnica, pero se necesitan 292,6 kJ/mol para romper el enlace fosfoster. Esto significa que
para poder obtener 305,14 kJ/mol de glucosa, deberemos suministrar primero 292,6 kJ/mol
(rendimiento neto 12,54 kJ/mol de glucosa). Esta energa (292,6 kJ) recibe el nombre de energa de
activacin (EA).

J. L. Snchez Guilln Pgina II-5-2


II) La clula 5) Enzimas

Las enzimas, como catalizadores que son, no modifican la constante de equilibrio y


tampoco se transforman, recuperndose intactas al final del proceso. La rapidez de
actuacin de las enzimas y el hecho de que se recuperen intactas para poder actuar
de nuevo es la razn de que se necesiten en pequesimas cantidades.

ESPECIFICIDAD DE LAS ENZIMAS

Es de destacar que las enzimas son


especficas. Esto es, una enzima puede
actuar sobre un substrato o un grupo de
substratos relacionados (especificidad de
substrato) pero no sobre otros; por
ejemplo:la sacarasa, que hidroliza la sacaro-
sa. Otras enzimas, sin embargo, tienen
especificidad de accin al realizar una accin
determinada pero sobre mltiples substratos;
por ejemplo: las lipasas que hidrolizan los
enlaces ster en los lpidos. Debido a esta
especificidad de las enzimas existen en la Fig. 3 Estructura de una enzima.
clula miles de enzimas diferentes.

La especificidad de las enzimas ha llevado


a comparar a stas con llaves y a los
substratos con cerraduras (modelo de la
llave y la cerradura).

Centro activo

CONSTITUCIN QUMICA DE LAS ENZIMA Centro regulador


Y MODO DE ACTUACIN

Fig. 4 Representacin esquemtica de la


En el pasado las enzimas se conocan con estructura de una enzima.
el nombre de fermentos, porque los primeros
enzimas estudiados fueron los fermentos de
las levaduras y de las bacterias. En la
actualidad el trmino fermento se aplica
nicamente a las enzimas que las bacterias, sustrato
productos
hongos y levaduras vierten al exterior para
realizar determinadas trasformaciones: las
fermentaciones. coenzima

Las enzimas son, en general, prtidos. Algu-


nas son protenas en sentido estricto. Otras Centro activo
poseen una parte proteica (apoenzima) y una
Centro regulador
parte no proteica, ambas estn ms o menos
ligadas qumicamente. Fig. 5 Trasformaciones de un sustrato por
la accin de una enzima.
La conformacin espacial de la parte
proteica es la responsable de la funcin que
realiza la enzima. Para ello la sustancia o

J. L. Snchez Guilln Pgina II-5-3


II) La clula 5) Enzimas

sustancias que van a reaccionar y transformarse se unen a la enzima en una zona


que llamaremos centro activo y son las interacciones qumicas entre los restos de
los aminocidos presentes en el centro activo y el substrato o los substratos las
responsables de la transformacin; ya que estas interacciones producen
reordenamientos de los electrones que debilitan ciertos enlaces y favorecen la
formacin de otros desencadenando la transformacin qumica.

MECANISMO DE ACCIN ENZIMTICA

sustrato
coenzima

sustrato

coenzima
enzima
enzima

Centro activo

1) En primer lugar, se forma un complejo: enzima- 2) El sustrato o los sutratos y la coenzima, si es


substrato o substratos. necesaria, se unen al centro activo de la enzima.

Productos
Productos

coenzima

enzima

enzima

3) Los restos de los aminocidos que configuran el 4) Los productos de la reaccin se separan del centro
centro activo catalizan el proceso. Para ello debilitan los activo y la enzima se recupera intacta para nuevas
enlaces necesarios para que la reaccin qumica se lleve a catlisis. Las coenzimas colaboran en el proceso; bien
cabo a baja temperatura y no se necesite una elevada aportando energa (ATP), electrones (NADH/NADPH) o
energa de activacin. en otras funciones relacionadas con la catlisis
enzimtica.

La parte proteica o apoenzima es tambin, y


por las mismas razones, la que determina la
especificidad de la enzima. As, la sacarasa
Actividad enzimtica

Nivel de saturacin de la enzima


acta sobre la sacarosa por ser esta la nica
molcula que se adapta al centro activo.

Muchas enzimas precisan para su actuacin


la presencia de otras sustancias no
proteicas: los cofactores. Qumicamente son
sustancias muy variadas. En algunos casos Concentracin de sustrato

se trata de simples iones, cationes en Fig. 6 Grfica de Michaelis_Menten que


particular, como el Cu+ + o el Zn+ + . En muestra la variacin de la actividad enzimtica
con la concentracin de sustrato. Esta grfica
otros, son sustancias orgnicas mucho ms
demuestra la formacin de un complejo enzima-
complejas, en cuyo caso se llaman coenzi- sustrato.
mas. Muchas vitaminas son coenzimas o

J. L. Snchez Guilln Pgina II-5-4


II) La clula 5) Enzimas

forman parte de coenzimas. Las coenzimas


son imprescindibles para que la enzima
acte. Suelen, adems, ser las responsables
de la actividad qumica de la enzima. As,
muchas reacciones de oxidacin precisan
del NAD , que es el que capta los
+

electrones y sin su presencia la enzima no


puede actuar. Otro ejemplo lo tenemos en
las reacciones que necesitan energa en las
que acta como coenzima el ATP.

Por ltimo, indicar que las enzimas se


nombran aadiendo la terminacin asa, bien
al nombre del substrato sobre el que actan
(sacarasa), al tipo de actuacin que realizan
(hidrolasas), o ambos (ADN polimerasa).
Fig. 7 Esquema del NAD+ -NADP+ . X es
un hidrgeno en el NAD+ y un grupo fosfato
en el NADP+ .
ALGUNAS COENZIMAS IMPORTANTES

i) Coenzimas que intervienen en las


reacciones en las que hay transferencias de
Enlace rico en
energa: energa

*ATP (adenosina-5'-trifosfato): Adenina-Ribo-


sa-P-P-P
*ADP (adenosina-5'-difosfato): Adenina-Ribo-
sa-P-P.
Fig. 8 Esquema del ATP.

ii) Coenzimas que intervienen en las reacciones en las que hay transferencias de
electrones:

* NAD+ (Nicotinamn adenn dinucletido). Se trata de un dinucletido


formado por: Nicotinamida-Ribosa-P-P-Ribosa-Adenina.

* NADP+ (Nicotinamn adenn dinucletido fosfato). Similar NAD + pero con


un grupo fosfato ms esterificando el HO- del carbono 2 de la ribosa unida a
la adenina.

* FAD (Flavn adenn dinucletido). Similar al NAD pero conteniendo


riboflavina (otra de las vitaminas del complejo B2 ) en lugar de nicotinamida.

iii) Coenzimas que intervienen como transportadores de grupos acilo.

Coenzima A. Coenzima de estructura compleja y de la que forma parte el


cido pantotnico (otra de las vitaminas del complejo B2 ).

J. L. Snchez Guilln Pgina II-5-5


II) La clula 5) Enzimas

EL ATP Y EL TRANSPORTE DE ENERGA

En los procesos metablicos que se dan en


E
la clula, algunas reacciones son
endergnicas: necesitan energa para
producirse y en caso contrario no se
producen. Otras son exergnicas: producen
energa y si sta no se emplea en realizar
un trabajo fsico o una reaccin qumica se
E
perder en forma de calor.

Ciertas coenzimas, como el ATP y otras, Fig. 9 El ATP transporta energa (E)
actan transportando energa desde los desde los procesos exergnicos (A>B) a los
endergnicos (C>D).
procesos exergnicos a los endergnicos.
Pues el ATP se puede transformar en ADP y
Pi (fosfato inorgnico) al hidrolizarse el ltimo de sus enlaces ster-fosfato,
desprendindose ms de 7 kcal por mol de ATP. Por el contrario, en aquellas
reacciones en las que se produce energa esta es acumulada al sintetizarse ATP a
partir de ADP y fosfato inorgnico (Pi).

LAS COENZIMAS TRANSPORTADORAS DE


ELECTRONES e-

Muchos procesos qumicos celulares de


gran importancia: fotosntesis, respiracin
celular, etc. Son procesos de oxidacin-
reduccin. As, por ejemplo: la respiracin
celular, en la que la glucosa se oxida al e-
perder electrones, mientras que el oxge no
los capta reducindose. Ciertas coenzimas
Fig. 10 Transporte de electrones (e-) por el
actan transportando estos electrones desde NAD+ /NADH desde una sustancia que se oxida
las sustancias que se oxidan a las que se (O) a otra que se reduce (G).
reducen: son los transportadores de electro-
nes.

As, por ejemplo, el NAD + es capaz de captar dos electrones, y dos protones (H+ ),
reducindose y transformndose en NADH+H + . Mientras que el NADH +H + puede
ceder estos dos electrones all donde se necesiten para reducir a un compuesto
qumico, transformndose de nuevo en NAD + .

FACTORES QUE CONDICIONAN LA ACTIVIDAD ENZIMTICA

Las enzimas, como sustancias proteicas que son, van a ver condicionada su
actuacin por determinados factores fsicos y qumicos. Algunos de estos factores
son:

La temperatura. Como toda reaccin qumica, las reacciones catalizadas enzimtica-

J. L. Snchez Guilln Pgina II-5-6


II) La clula 5) Enzimas

mente siguen la regla de Van t'Hoff. Segn la cual, por cada 101C de aumento de
temperatura, la velocidad de la reaccin se
duplica. No obstante, las enzimas tienen una
temperatura ptima. En el hombre, y en los

Actividad enzimtica
animales homeotermos como el hombre, esta Temperatura ptima

temperatura ptima coincide con la


temperatura normal del organismo. Los
enzimas, como prote nas que son, se desna-
turalizan a elevadas temperaturas.

El pH, que al influir sobre las cargas elctri-


cas, podr alterar la estructura del centro
activo y por lo tanto tambin influir sobre la Fig. 11 Variacin de la actividad
actividad enzimtica. enzimtica en funcin de la temperatura.

Los inhibidores. Determinadas sustancias van


a poder actuar sobre las enzimas
disminuyendo o impidiendo su actuacin.
Estas sustancias son los inhibidores. Se trata Actividad enzimtica
de molculas que se unen a la enzima pH ptimo

impidiendo que sta acte sobre el substrato.


B A

Inhibicin competitiva: Cuando el


inhibidor se une al centro activo
de la enzima impidiendo que el 1 2 3 4 5 6 7 8 9 10 11 12 13 14
pH
sustrato se una a l. Se trata de
una inhibicin que depende de la Fig. 12 Variacin de la actividad
concentracin de sustrato y de enzimtica en funcin del pH de dos enzimas.
inhibidor.
Inhibicin no competitiva: Cuando
el inhibidor se une reversiblemente
a un punto diferente del centro
sustrato
activo pero con su actuacin lo
modifica lo suficiente para que,
inhibidor
aunque se puedan unir la enzima y
el sustrato, la catlisis no se
produzca o la velocidad de sta
disminuya. Este tipo de inhibicin
no depende de la concentracin de
sustrato. Enzima
Inhibicin alostrica: El inhibidor se
une tambin reversiblemente a un
punto diferente al centro activo, Fig. 13 Inhibicin competitiva. El inhibidor
pero con su actuacin lo modifica se une al centro activo, reversiblemente, y con
de tal manera que impide la unin ello impide que el sustrato se una a l.
de la enzima y el substrato.

Es frecuente que el inhibidor sea el propio producto de la reaccin enzimtica o el


producto final de una cadena de reacciones. Cuando se trata del producto final,

J. L. Snchez Guilln Pgina II-5-7


II) La clula 5) Enzimas

recibe el nombre de retrorregulacin o feed-


back.

Envenenadores: Son molculas que se unen


irreversiblemente al centro activo de la
enzima impidiendo pernanentemente que esta
acte. Muchos txicos y venenos tienen
Enzima inactiva
este modo de actuacin.

Los activadores. Son sustancias que se unen


a la enzima, que se encuentra inactiva,
cambiando su estructura espacial inhibidor

activndola.
Fig. 14 Inhibicin no competitiva. El
inhibidor se une reversiblemente a la enzima
en un punto diferente del centro activo y,
modifica este de tal manera, que aunque el
sustrato se una no se realiza la catlisis.

sustrato

Enzima

inhibidor

Fig. 15 Inhibicin alostrica. El inhibidor


se une a la enzima en un punto diferente del
centro activo y modifica este de tal manera
que el sustrato no se puede unir a l.

sustrato
envenenador

Enzima

Fig. 16 Envenenador. Los envenenadores


son sustancias que se unen al centro activo
mediante enlaces fuertes en un proceso
irreversible, con lo que impiden de manera
definitiva la catlisis.

J. L. Snchez Guilln Pgina II-5-8


II) La clula 5a) Fotosntesis

5A) METABOLISMO: OBTENCIN DE ENERGA

5A-1) OBTENCIN DE ENERGA Y SNTESIS DE COMPUESTOS ORG-


NICOS EN LA CLULA VEGETAL (FOTOSNTESIS)

LOS PLASTOS
a
Son orgnulos citoplasmticos exclusivos y
caractersti cos de las clulas vegetales.
d

Existen diversos tipos de plastos: cloroplas-


tos, cromoplastos y leucoplastos. Todos d

tienen un origen comn en unas estructu ras


celulares llamadas proplastos. Algunas e c
caractersticas de las diferentes clases
plastos son: Fig. 1 Corte transversal de una hoja: a)
epidermis del haz; b y d) parnquima
- Cloroplastos. Plastos verdes ya que cloroflico; c) epidermis del envs; e) estoma.
contiene, entre otros pigmentos foto sint-
ticos, clorofila. En ellos se realiza la foto -
snte sis.

- Cromoplastos plastos de color amarillo o


anaranjado por acumulacin de carotenoides,
como los del tomate o la zanahoria.

- Leucoplastos plastos de color blanco. Se


encuentran en las partes no verdes de la
planta. As, por ejemplo, en las clulas de la
Fig. 2 Cromoplastos en clulas vegetales
patata encontramos un tipo de leucoplastos, vistos al microscopio ptico.
los amiloplastos, llamados as por contener
almidn.
O2
Debido a su importancia para todos los
seres vivos, haremos a continuacin un
estudio particular de los cloroplastos.
CO2

Savia elaborada Savia


LOS CLOROPLASTOS bruta

Caractersticas: Son orgnulos muy variables


en cuanto a nmero, forma y tamao. As,
por ejemplo, las clulas de ciertas algas
H2O
filamentosas tienen uno o dos nicos Sales minerales

cloroplastos; otras, como la planta acutica


elodea, tienen numerosos cloroplastos. Su Fig. 3 Intercambios de sustancias entre la
forma es, normalmente, de lente biconvexa, planta y el medio durante el da.
pero pueden ser tambin estrellados o con

J. L. Snchez Guilln Pgina II-5a-1


II) La clula 5a) Fotosntesis

forma de cinta enrollada en hlice.

Ultraestructura: Es difcil observar su


estructura al microscopio ptico. Al MET
(microscopio electrnico de transmisin) se
observa una membrana externa y otra
interna separadas por un espacio
intermembrana. En el interior se ven unas
estructuras alargadas formadas por mem-
branas llamadas lminas o lamelas. Sobre
ellas se ven los grana, que son unos replie-
gues, formados tambin por membranas, que
se disponen unos encima de otros. Todo
este conjunto de membranas internas recibe Fig. 4 Clulas vegetales vistas al
el nombre de tilacoides; pudindose distinguir microscopio electrnico en las que pueden
los tilacoides de los grana y los tilacoides observarse numerosos cloroplastos.
de las lminas. Existe adems un contenido
interno: el estroma, en el que hay ADN
similar al de las clulas procariotas,
ribosomas (plastorribosomas) y
acumulaciones de almidn, protenas y
lpidos.

Funcin: En los cloroplastos se va a realizar


la fotosntesis. En los tilacoides se realiza
una de las fases de la fotosntesis: la fase
luminosa. La otra fase de la fotosntesis: la Fig. 5 Cloroplasto visto al microscopio
fase oscura, se realiza en el estroma del electrnico. me) membrana externa; mi)
membrana interna; gr) grana; la) lminas; es)
cloroplasto. estroma; pg) plastoglbulos; al) almidn.

Origen evolutivo: Es de destacar que los


plastos tienen una estructura similar a los
organismos procariticos. Segn la " Teora
endosimbitica" la clula eucaritica se
habra formado por simbiosis de diferentes
organismos procariotas, uno de ellos el
plasto, que proporcionara al conjunto
compuestos orgnicos que sintetizara
usando como fuente de energa la luz solar.

Fig. 6 Ultraestructura de un cloroplasto.


LA FOTOSNTESIS: CONCEPTO 1) Membrana externa. 2) Membrana interna.
3) Grana. 4) Lminas. 5) Estroma.
La fotosntesis puede definirse como un
proceso anablico que se produce en los cloroplastos y en el que la energa luminosa
es transformada en energa qumica que posteriormente ser empleada para la
fabricacin de sustancias orgnicas a partir de sustancias inorgnicas.

J. L. Snchez Guilln Pgina II-5a-2


II) La clula 5a) Fotosntesis

PROCESOS QUE SE DAN EN LA FOTOSNTESIS

En la fotosntesis se van a producir los siguientes procesos:

11) Captacin por las clorofilas y otros pigmentos fotosintticos de la energa


luminosa y su transformacin en energa qumica contenida en el ATP.

21) Obtencin de electrones a partir del agua. Estos electrones, convenientemente


activados por la energa luminosa, servirn para reducir NADP+ .

31) Incorporacin del carbono del CO2 a las cadenas carbonadas.

41) Reduccin por el NADPH del carbono incorporado y sntesis de compuestos


orgnicos.

51) Reduccin de otras sustancias inorgnicas (nitratos, nitritos, sulfatos, etc.) para su
incorporacin a las cadenas carbonadas.

ECUACIN GLOBAL DE LA FOTOSNTESIS

La fotosntesis en su conjunto es un proceso redox en el que el CO2 y otras


sustancias inorgnicas son reducidas e incorporadas en las cadenas carbonada.
Aunque son muchas las sustancias orgnicas que se forman en el cloroplasto, la que
se forma en mayor cantidad es la glucosa. Por esto la ecuacin global de la sntesis
de glucosa en el cloroplasto se considera como la ecuacin global de la fotosntesis.

6 CO 2 + 6 H 2O C 6 H 12 O 6 + 6 O 2

Fig. 7 Ecuacin global de la fotosntesis.

CONSECUENCIAS DE LA FOTOSNTESIS

Las consecuencias de la fotosntesis son de gran importancia para los seres vivos.
As:

1) Todos o casi todos los seres vivos dependen, directa o indirectamente, de la foto-
sntesis para la obtencin de sustancias orgnicas y energa.

2) A partir de la fotosntesis se obtiene O2 . Este oxgeno, formado por los seres


vivos, transform la primitiva atmsfera de la Tierra e hizo posible la existencia de
los organismos hetertrofos aerbicos1 .

1
Aerbicos son los organismos que necesitan en su metabolismo el oxgeno para los procesos de
oxidacin.

J. L. Snchez Guilln Pgina II-5a-3


II) La clula 5a) Fotosntesis

FASES DE LA FOTOSNTESIS

La fotosntesis es un proceso muy


complejo. Se ha demostrado que slo una
parte requiere energa luminosa, a esta parte
se le llama fase luminosa; mientras que la
sntesis de compuestos orgnicos no
necesita la luz de una manera directa, es la
fase oscura. Es de destacar que la fase
oscura, a pesar de su nombre, se realiza Fig. 8 Fase luminosa y fase oscura de la
tambin durante el da, pues precisa el ATP fotosntesis: visin de conjunto.
y el NADPH que se obtienen en la fase
luminosa.
ATP asa Phs 1 Phs 2 Cit b/f

A) FASE LUMINOSA

Se realiza en la membrana de los tilacoides.


Consiste en un transporte de electrones,
desencadenado por fotones, con sntesis de
ATP y de NADPH+H + . Fig. 9 Disposicin de los fotosistemas
(Phs) de los citocromos (Cit) y de las ATPasas
en los tilacoides de los granas.

ESTRUCTURA DE LA MEMBRANA DE LOS


TILACOIDES

La membrana de los tilacoides tiene una


estructura de doble capa o membrana unita-
ria. Integradas en esta doble capa estn
determinadas sustancias muy importantes en
el proceso de la fotosntesis y en particular
los fotosistemas I y II, ATPasas y citocro-
mos.

Cada fotosistema contiene carotenos,


clorofilas y protenas. Estas molculas
captan la energa luminosa y la ceden a las
Fig. 10 La clorofila a.
molculas vecinas presentes en cada
fotosistema hasta que llega a una molcula
de clorofila-a denominada molcula diana. Los
diferentes carotenos y clorofilas captan
fotones de unas determinadas longitudes de
onda. De esta manera, el conjunto de las
molculas del fotosistema captan gran parte
Fig. 11 El grupo fitol de las clorofilas.
de la energa luminosa incidente, slo
determinadas longitudes de onda son
reflejadas y, por lo tanto, no utilizadas. En particular, son reflejadas las radiaciones
correspondientes a las longitudes de onda del verde y el amarillo.

J. L. Snchez Guilln Pgina II-5a-4


II) La clula 5a) Fotosntesis

En el fotosistema II (Phs II) la molcula diana


es la clorofila aII que tiene su mximo de
absorcin a 680 nm (P 680). Cuando esta
clorofila capta un fotn pasa a un estado Molcula

excitado (P 680 ) y su potencial redox se diana

hace ms negativo hacindose muy reducto- Fotosistema

ra. En el fotosistema I (Phs I), la molcula


diana es la clorofila aI, cuyo mximo de Fig. 12 Captacin de la energa luminosa
absorcin se encuentra a 700 nm (P 700), por un fotosistema.
que tambin se excita (P 700 ) al captar un
fotn. La disminucin de los potenciales
Clorofila a
Clorofila b
150

redox permite que se establezca un Caroteno

transporte de electrones que pueden seguir


dos vas:
100

50

- La fotofosforilacin acclica
- La fotofosforilacin cclica 0
400 500 600 700

Longitud de onda en nm (nanometros)

LA FOTOFOSFORILACIN ACCLICA
Fig. 13 Absorcin de los diferentes
pigmentos del cloroplasto en funcin de la
La luz va a desencadenar un transporte de longitud de onda. La menor absorcin se
electrones a travs de los tilacoides con corresponde con los colores verde (492 a 577
nm) y amarillo (577 a 597 nm).
produccin de NADPH y ATP. Los electrones
ser aportados por el agua. En esta va se
pueden distinguir los siguientes procesos:

I) Reduccin del NADP+ : La clorofila-aII y 700

Rojo (622-770)
otras sustancias del fotosistema II captan
Naranja (597-622)
foto nes (luz) pasando a un estado ms
Amarillo (577-597)
energtico (excitado). Esta energa les va a 600
Verde (492-577)
permitir establecer una cadena de electrones Azul (455-492)
a travs de los tilacoides en la que Ail (430-455)
intervienen diferentes transportadores y en Violeta (390-430)
500

particular el fotosistema I que tambin es


activado por la luz. El aceptor final de estos
electrones es el NADP+ que se reduce a NA- 400

DPH+H + al captar los dos electrones y dos


protones del medio. Fig. 14 Longitudes de onda de los colores
del espectro de la luz visible.

II) Fotolisis del agua y produccin de oxgeno: Los electrones transportados a travs
de los tilacoides y captados por el NADP+ proceden de la clorofila aII (P680). Esta
molcula va recuperarlos sacndolos del agua. De esta manera podr iniciar una nueva
cadena de electrones. En este proceso la molcula de agua se descompone (lisis) en
2H + , 2e- y un tomo de oxgeno. El tomo de oxgeno, unido a un segundo tomo
para formar una molcula de O2 , es eliminado al exterior. El oxgeno producido
durante el da por las plantas se origina en este proceso.

J. L. Snchez Guilln Pgina II-5a-5


II) La clula 5a) Fotosntesis

NADPH

ATP

NADP+
3H+
Luz Luz
estroma H+ ADP

ATPasa
e
PhsII PhsI
e

H2 O 3H+

Interior del tilacoide

O2

Fig. 15 Esquema de la fotofosforilacin accliclica.

III) Obtencin de energa. Sntesis de ATP


(Teora quimiosmtica): El transporte de elec-
trones a travs de los fotosistemas produce
un bombeo de protones desde el estroma
hacia el interior del tilacoide, pues los
fotosistemas actan como transportadores
activos de protones extrayendo la energa
necesaria para ello del propio transporte de
electrones. La lisis del agua tambin genera
protones (H+ ). Todos estos protones se
acumulan en el espacio intratilacoide, pues la Fig. 16 Sntesis de ATP en los tilacoides.
membrana es impermeable a estos iones y
no pueden salir. El exceso de protones genera un aumento de acidez en el interior
del tilacoide y, por lo tanto, un gradiente electroqumico -exceso protones y de
cargas positivas. Los protones slo pueden salir a travs de unas molculas de los
tilacoides: las ATPasa. Las ATPasas actan como canal de protones y de esta
manera cataliza la sntesis de ATP. Es la salida de protones (H+ ) a travs de las
ATPasas la que acta como energa impulsora para la sntesis de ATP.

IV) Balance de la fotofosforilacin acclica: Teniendo en cuenta nicamente los pro-


ductos iniciales y finales, y podemos hacerlo porque el resto de las sustancias se
recuperan en su estado inicial, en la fotofosforilacin acclica se obtienen 1
NADPH+H + y 1 ATP. A su vez, la fotolisis del agua va a generar tambin un tomo
de oxgeno.

LA FOTOFOSFORILACIN CCLICA

En esta va la luz va a desencadenar un transporte de electrones a travs de los


tilacoides con produccin slo de ATP.

Mecanismo: El proceso parte de la excitacin de la molcula diana del fotosistema I


(clorofila-aI, P700) por la luz. Ahora bien, en este caso, los electones no irn al
NADP+ sino que seguirn un proceso cclico pasando por una serie de
transportadores para volver a la clorofila aI. En cada vuelta se sintetiza una molcula

J. L. Snchez Guilln Pgina II-5a-6


II) La clula 5a) Fotosntesis

de ATP de la misma forma que en la fotofosforilacin acclica.

ATP

Luz
ADP 3H+
estroma

e
e
PhsI
e e e
e

3H+

Interior del tilacoide

Fig. 17 Esquema de la fotofosforilacin ccliclica.

Balance de la fotofosforilacin cclica: En esta va se produce una snte sis continua


de ATP y no se requieren otros substratos que el ADP y el Pi y, naturalmente, luz
(fotones). Es de destacar que no es necesaria la fotolisis del agua pues los electrones
no son cedidos al NADP+ y que, por lo tanto, no se produce oxgeno.

REGULACIN DE AMBOS PROCESOS

En el cloroplasto se emplean ambos procesos indistintamente en todo momento. El


que se emplee uno ms que otro va a depender de las necesidades de la clula o lo
que en realidad es lo mismo, de la presencia o ausencia de los substratos y de los
productos que se generan. As, si se consume mucho NADPH+H + en la sntesis de
sustancias orgnicas, habr mucho NADP+ , y ser ste el que capte los electrones
producindose la fotofosforilacin acclica. Si en el tilacoide hay mucho ADP y Pi y
no hay NADP+ , entonces se dar la fotofosforilacin cclica. Ser el consumo por la
planta de ATP y de NADPH+H + , o, lo que es lo mismo, la existencia de los
substratos ADP y NADP+ , la que determinar uno u otro proceso.

J. L. Snchez Guilln Pgina II-5a-7


II) La clula 5a) Fotosntesis

LA FOTOFOSFORILACIN: EXPLICACIN estroma


3H+
DETALLADA Luz Luz
ADP ATP
H+
NADP+ NADPH

NOTA: Se expone aqu una explicacin ms en detalle PhsII Cit b6 PhsI Fd Rd


PQ

ATPasa
de ciertos aspectos de la fotofosforilacin con el P680 Cit f P700
PC
objetivo de que pueda contribuir a una mejor
H2O 2H+ + H+ 3H+
comprensin en aquellos alumnos que estn ms Interior del tilacoide
O2
interesados.

Fig. 18 Fotofosforilacin acclica


A) FOTOFOSFORILACIN AC CLI CA. Al captar un
fotn, la clorofila a II (P680) se excita y aumenta su
poder reductor. Esto le va a permitir reducir, por cesin
3H+
de 2e -, a la plastoquinoma (PQ). Estos dos electrones ATP
Luz ADP
3H+
son cedidos sucesivamente a otros transportadores: estroma
Citocromo b6 (Cit b6 ), citocromo f (Cit f) y
Cit b6 Fd

ATPasa
PQ PhsI
plastocianina (PC), hasta llegar a la clorofila aI (P 700)
Cit f
del fotosistema I. Se establece en consecuencia una P700

cadena de electrones. La clorofila aI (P 700) recibe la PC

3H+ 3H+
energa de otro fotn y se origina una nueva cadena
Interior del tilacoide
redox: P 700, Ferredoxina (Fd), Reductasa (Rd); en la
que el aceptor final es el NADP+ que se reduce a NA-
Fig. 19 Fotofosforilacin cclica.
DPH+H + al captar los dos electrones y dos protones
del medio.
II) LA FOTOFOSFORILACIN C CLICA: El proceso parte de la excitacin de la molcula diana (clorofila P 700) del
fotosistema I. La diferencia con el proceso estudiado anteriormente est en que, en este caso, la ferredoxina (Fd), en
lugar de ceder los 2e- a la reductasa (Rd), los cede a la plastoquinona (PQ). Se establece un proceso cclico en el
que los mismos 2e - estn pasando continuamente por los mismos transportadores: Plastoquinona (PQ), citocromo b6
(Cb6 ), citocromo f (Cf), plastocianina (PC), clorofila aI, etc. En cada vuelta se sintetiza una molcula de ATP de la
misma forma que en la fotofosforilacin acclica .

P700

Fd Fd NADP+

Rd

P680 2e-
NADPH
ADP
PQ
Cb6
Cf
2e- P700 fotones

ATP
H2O

P680 fotones

Fig. 20 Fase luminosa de la fotosntesis.

J. L. Snchez Guilln Pgina II-5a-8


II) La clula 5a) Fotosntesis

B) FASE OSCURA (CICLO DE


CALVIN2 )

En el estroma de los cloroplastos, y


como consecuencia de la fase luminosa, ATP
se van a obtener grandes cantidades de
NADPH+H+
ATP y NADPH+H + , metabolitos 3 que se
van a utilizar en la sntesis de com-
puestos orgnicos. Esta fase recibe el
nombre de Fase Oscura4 porque en ella + 6 H2 O

no se necesita directamente la luz, sino


nicamente las sustancias que se
producen en la fase luminosa. Durante Fig. 21 Ciclo de Calvin.
la fase oscura se dan, fundamentalmen-
te, dos procesos distintos:

-Sntesis de glucosa mediante la incorporacin del CO2 a las cadenas


carbonadas y su reduccin, ciclo de Calvin 5 propiamente dicho.
- Reduccin de los nitratos y de otras sustancias inorgnicas, base de la
sntesis de los aminocidos y de otros compuestos orgnicos.

DESCRIPCIN DEL CICLO DE CALVIN6

1) La ribulosa-5-P (RuP), monosacrido con cinco tomos de carbono (C5 )


fosforilada en posicin cinco, es fosforilada de nuevo por el ATP en el
carbono 1, pasando a Ribulosa-1-5-difosfato (RuBP).

2) La RuBP reacciona con el CO2 obtenindose dos molculas de cido-3-


fosfoglicrico (PGA). Este compuesto contiene una cadena carbonada de tres
tomos de carbono (C3 ). El proceso podra esquematizarse:

1 (C5 ) + CO2 -------> 2 (C3 )

3) El PGA (C3 ) es reducido por el NADPH+H + a gliceraldehdo-3-fosfato


2
En honor a su descubridor, el bioqumico norteamericano Melvin Calvin, premio Nobel de qumica en
el ao 1961 por descubrir los mecanismos de la fotosntesis.

3
Productos que se originan en el metabolismo.

4
Es de destacar, que a pesar de su nombre, la fase oscura se produce tambin por el da; pues, aunque
no precisa luz, s precisa ATP y NADPH y estos slo se originan durante el da en la fase luminosa.

5
Ciertas plantas tropicales, como la caa de azcar, pueden emplear, adems del ciclo de Calvin, otras
vas que son incluso de mayor rendimiento cuando la temperatura es elevada y la planta debe tener cerrados los
estomas. Es la llamada va del C4 o Ciclo de Hatch y Slach. En esta va, el CO2 es incorporado formando un
cido dicarboxlico de cuatro tomos de carbono.

6
Lo que viene a continuacin, se expone a los efectos de que los alumnos puedan interpretar los
esquemas y extraer las consecuencias que se derivan de ellos. No parece conveniente que el alumno deba saberlo de
memoria.

J. L. Snchez Guilln Pgina II-5a-9


II) La clula 5a) Fotosntesis

(PGAL), la reaccin necesita H H


CO2
tambin ATP. H-C-O-H
ATP ADP
H-C-O- P
C=O C=O
H-C-O-H H-C-O-H
Como consecuencia de los H-C-O-H H-C-O-H
H-C-O- P H-C-O- P
procesos 1, 2 y 3, estudiados H H
hasta ahora, vemos que, RuP RuBP

partiendo de una molcula con


cinco tomos de carbono (C5 ) y
H OH
por adicin de una molcula de NADP+ NADPH+H+
C=O
C=O
CO2 , se obtienen dos molculas H-C-O-H H-C-O-H

con tres tomos de carbono cada H-C-O- P


ADP ATP
H-C-O- P 2X
H H
una (C3 ). Esto es: PGAL PGA

C5 + C1 -----> 2 C3
Fig. 22 Primeras etapas del ciclo de Calvin.

El CO2 ha sido integrado en una molcula orgnica, una triosa, el llamado


gliceraldeh do-3-fosfato (PGAL). Si en lugar de una molcula de RuP, partimos
de seis molculas, obtendremos 12 molculas de PGAL.

Fig. 23 Ciclo de Calvin.

4) De cada 12 molculas de PGAL obtenidas, 2 se unen dando una molcula


de glucosa (C6 H12 O6 ) y el resto entra en un complejo proceso que tiene como
objetivo la recuperacin de las 6 molculas de RuP (C5 ). stas, una vez
recuperadas, entran de nuevo en el Ciclo de Calvin.

5) La glucosa as obtenida es polimerizada formndose almidn.

J. L. Snchez Guilln Pgina II-5a-10


II) La clula 5a) Fotosntesis

CICLO DE CALVIN O FASE OSCURA DE LA FOTOSNTESIS


(Estudio detallado)

Se representa aqu el desarrollo del ciclo de Calvin con sus ecuaciones qumicas, con la
finalidad de que aquellos alumnos ms interesados puedan estudiarlo con ms detalle.

CH2O- P
CO2
CO NADPH+H++
NADPH+H ATP
ATP
C=O
2
COOH COOH COOH CHO
H- C-OH H- C-OH + H- C-OH H- C-OH H- C-OH
H- C-OH CH2O- P CH2O- P CH2O- P CH2O- P
CH2O- P NADP++ ADP+Pi
ADP+Pi
NADP
PGA PGA PGA PGAL
RUBP

1) Incorporacin del CO2 a la cadena carbonada de la 2) Reduccin del carbono del CO2 incorporado: Cada
RUBP. El CO2 reacciona con la ribulosa-1-5 difosfato una de las molculas de cido-3- fosfoglicrico (PGA)
(RUBP) para dar dos molculas de cido-3- es reducida por el NADPH a aldehdo-3-fosfoglicrico
fosfoglicrico (PGA). (PGAL). El proceso es endergnico y precisa del ATP.

12NADPH+H++
12NADPH+H
CHO
CH2O- P H- C-OH
6CO2
6CO 12ATP
ATP
C=O 2 12 CHO CHO CHO HO- C-H
6 H- C-OH H- C-OH
12 H- C-OH + H- C-OH H- C-OH
H- C-OH CH2O- P
CH2O- P CH2O- P H- C-OH
CH2O- P 12NADP++ 12ADP+12Pi 2P
12NADP 12ADP+12Pi CH2OH
PGAL PGAL PGAL
RUBP GLU

3) Si los procesos 1 y 2 anteriores se repiten 6 4) Sntesis de glucosa: Dos de estas molculas de


veces obtendremos 12 molculas de aldehdo-3- aldehdo-3-fosfoglicrico (PGAL) se condensan para
fosfoglicrico (PGAL). dar una molcula de glucosa (GLU). Se obtienen,
adems, dos molculas de fosfato inorgnico (P).

CH2OH CH2OH CH2O- P


66ATP
ATP
CHO C=O C=O C=O
10 H- C-OH 6 H- C-OH 6 H- C-OH H- C-OH
6
CH2O- P H- C-OH H- C-OH H- C-OH
CH2O- P CH2O- P 66ADP
ADP CH2O- P
PGAL
RUP RUP RUBP

5) Recuperacin de la ribulosa 1-5 difosfato: Las 6) Recuperacin de la ribulosa 1-5 difosfato: Las 6
otras 10 molculas de aldehdo-3-fosfoglicrico molculas de ribulosa-5-fosfato (RUP) reaccionan con
(PGAL) reaccionan entre s para dar 6 molculas de 6 de ATP para dar 6 de ribulosa-1-5 difosfato (RUBP),
ribulosa-5-fosfato (RUP). cerrndose el ciclo.

J. L. Snchez Guilln Pgina II-5a-11


II) La clula 5a) Fotosntesis

REDUCCIN DE NITRATOS Y SULFATOS

Las plantas pueden obtener el nitrgeno que necesitan a partir de los nitratos (NO3 -),
por ejemplo. Los nitratos son absorbidos por las races y transportados por los vasos
leosos hacia el parnquima cloroflico de la hoja.

En los nitratos el nitrgeno se encuentra en una forma muy oxidada, mientras que
en los compuestos orgnicos se encuentra en forma reducida. La reduccin es
realizada por el NADPH y la energa necesaria para el proceso es aportada por el
ATP. Ambos productos, como ya sabemos, se obtienen en grandes cantidades en la
fase luminosa de la fotosnte sis. Esta es la razn por la que la reduccin del
nitrgeno y su incorporacin en las sustancias orgnicas se realiza en los cloroplas-
tos, y no porque el proceso necesite de una manera directa la luz.

Nota: Para ello, los nitratos son primero reducidos a nitritos y estos a in amonio. El in amonio es
integrado en una cadena carbonada para formar el aminocido glutmico. Es este aminocido el que
servir posteriormente para donar el nitrgeno a aquellas molculas orgnicas que lo precisen.

Por ltimo, indicar que el azufre es absorbido por las races en forma de sulfatos
(SO4 -2 ) u otras sales y, una vez reducido, es incorporado en otras sustancias
orgnicas de una manera similar a la que hemos visto con el nitrgeno.

FACTORES QUE INFLUYEN EN LA FOTOSNTESIS

El rendimiento de la fotosntesis puede ser medido fcilmente por la cantidad de


CO2 absorbido por la planta. En l influyen:

La Intensidad y longitud de onda de la luz.


Ya sabemos que los carotenos y las
clorofilas de los fotosistemas absorben
fotones de una determinada longitud de
Tasa de consumo de CO2

onda. Por lo tanto, si se ilumina una planta


con luz de longitud de onda inadecuada o
con una intensidad insuficiente, la
fotosntesis no podr realizarse y la planta
no se desarrollar.

Temperatura. La fotosntesis, como todo


proceso qumico, est influenciada por la
temperatura, ya que por cada 10 o C de Intensidad de la luz en u.a.

aumento de temperatura, la velocidad se


duplica. Ahora bien, un aumento excesivo de Fig. 24 Variacin en el rendimiento de la
fotosntesis con la intensidad de la luz.
la temperatura desnaturalizar las enzimas
que catalizan el proceso y se producir un
descenso del rendimiento fotosinttico.

Concentracin de CO2 . Si el resto de los factores se mantiene constante, un aumento


en la cantidad de CO2 existente aumentar el rendimiento de la fotosn tesis hasta
llegar a un valor mximo por encima del cual se estabilizar.

J. L. Snchez Guilln Pgina II-5a-12


II) La clula 5a) Fotosntesis

Concentracin de O2 . Un aumento en la con-


centracin de O2 inhibe la fotosntesis, ya

Tasa de consumo de CO2


Temperatura de desnaturalizacin
que el oxgeno inhibe la enzima que
incorpora el CO2 a la Ribulosa-1-5-difosfato
(RuBP).

Temperatura en C

Fig. 25 Variacin en el rendimiento de la


fotosntesis con la temperatura.

J. L. Snchez Guilln Pgina II-5a-13


II) La clula 5a) Fotosntesis

REPRESENTACIN SIMPLIFICADA DE
LOS PROCESOS QUE SE DAN EN EL CLOROPLASTO

Fase luminosa Fase oscura

LA FASE OSCURA

6 6

6 RuBP
12 NADPH PGA
12 ATP 6 ADP

6 ATP

12 NADP+
12 ADP 12 10 6

PGAL
RuP

2
+ 6 H2 O

J. L. Snchez Guilln Pgina II-5a-14


II) La clula 5a) Fotosntesis

5A-2) QUIMIOS NTESIS

LA QUIMIOSNTESIS COMO OTRA FORMA DE NUTRICIN AUTTROFA

La quimiosntesis es tambin una forma de nutricin auttrofa en la que, a diferencia


de la fotosntesis, la energa y los electrones (ATP y NADPH) necesarios para los
procesos de anabolismo van a proceder de la oxidacin de sustancias inorgnicas.

Se trata de una forma de nutricin tpicamente bacteriana. En la que las diferentes


especies se han especializado en la oxidacin de distintos substratos. Segn el
substrato oxidado tendremos:

a) Bacterias nitrosificantes. Como las del


gnero nitrosomonas que obtienen energa en
forma de ATP y coenzimas reducidas por NH4+ H2S FeCO3

medio de la oxidacin de sales amoniacales


(NH4 + ) presentes en los excrementos y en la
materia orgnica en descomposicin.
Bacterias

b) Bacterias nitrificantes. Como las del


gnero nitrobacter que oxidan los nitritos
ATP y NADPH
(NO2 -) a nitratos (NO3 _).

Entre las bacterias nitrosificantes y las Compuestos Compuestos


inorgnicos orgnicos
nitrifi cantes, el nitrgeno incorporado en los
compuestos orgnicos es transformado de
nuevo en nitrgeno contenido en compues- Fig. 26 Esquema simplificado de la
tos inorgnicos que van a parar a los suelos quimiosntesis.
o las aguas. De aqu podr ser absorbido
nuevamente por las plantas, cerrndose as
el ciclo del nitrgeno en la naturaleza.

c) Bacterias del azufre incoloras. Estas bacterias oxidan los sulfuros a azufre y el
azufre a sulfitos o a sulfatos.

d) Bacterias del hierro. Oxidan los compuestos ferrosos a frricos.

Estos dos ltimos tipos de bacterias medran, sobre todo, en los yacimientos de
azufre y hierro de origen volcnico y en particular en los llamados humeros negros.

Es de destacar, que las bacterias quimiosintticas son los nicos seres vivos no
dependientes, ni directa ni indirectamente, de la luz solar.

J. L. Snchez Guilln Pgina II-5a-15


II) La clula 5b) Respiracin celular

5B) OBTENCIN DE ENERGA A PARTIR DE COMPUESTOS ORGNICOS


EN LAS CLULAS VEGETALES Y ANIMALES (CATABOLISMO DE LA
GLUCOSA)

V AS DEL CATABOLISMO
Glucosa

Los organismos auttrofos fijan la energa solar


en forma de energa qumica contenida en los Glucolisis
compuestos orgnicos, glucosa, en particular.
Esta energa, convenientemente liberada, ser O2
utilizada posteriormente por las partes de la
Pirvico
planta que no tienen cloroplastos, como suele
ser el caso de las races y tallos no verdes, o
por toda la planta cuando falta la energa solar. Respiracin Fermentacin
Es tambin esta energa la que permite la vida de
los organismos hetertrofos. La respiracin
celular y las fermentaciones son las vas cata- CO2 y H2 O Etanol - Lctico

blicas ms corrientes para la obtencin de la


energa contenida en las sustancias orgnicas.
Fig. 1 Principales vas para el catabolismo
Ambas vas, no obstante, tienen una primera
de la glucosa.
fase comn: la glucolisis.

GLUCOLISIS1

La definiremos como el conjunto de reacciones


que degradan la glucosa (C6 ) transformndola
en dos molculas de cido pirvico (PYR) (C3 ).
Estas reacciones se realiza en el hialoplasma de
la clula. Es un proceso anaerobio, que no
necesita oxge no, y en el que por cada molcula
de glucosa (GLU) se obtienen 2 ATP y 2 NA-
DH+ H+ . Fig. 2 Ecuacin global de la glucolisis

Consta de las siguientes reacciones:

10 Fosforilacin de la glucosa (GLU) por el ATP, formndose glucosa-6-fosfato (G-6-


P).

20 La glucosa-6-fosfato (G-6-P) se isomeriza2 a fructosa-6-fosfato (F-6-P).

30 Nueva fosforilacin por el ATP de la fructosa-6-fosfato (F-6-P) que pasa a fruc-


tosa 1,6-difosfato (F-1,6-P).

40 Rotura de la molcula de F-1,6-P en dos molculas: el aldeh do-3-fosfoglicrico


(PGAL) y la dihidroxiacetona fosfato (DHA). Ambas sustancias son ismeras y se
transforman espontneamente una en otra (el equilibrio se alcanza cuando hay un
95% de DHA y un 5% PGAL).

1
Lo que viene a continuacin, se expone a los efectos de que los alumnos puedan interpretar los esquemas y extraer las
consecuencias que se derivan de ellos. No parece conveniente que el alumno deba saberlo de memoria.

2
Isomerizacin: transformacin de un compuesto qumico-orgnico en otro que sea su ismero.

J. L. Snchez Guilln Pgina II-5b-1


II) La clula 5b) Respiracin celular

Es de destacar que, hasta ahora, no slo no se ha producido energa, sino que,


incluso, se han consumido dos molculas de ATP.

50 El aldehdo-3-fosfoglicrico (PGAL) se oxida por el NAD+ ; al mismo tiempo se


produce una fosforilacin en la que interviene el fosfato inorgnico3 (H-P), formn-
dose cido 1,3-difosfoglicrico (1,3-DPGA). Cada molcula de glucosa (GLU) dar
dos molculas de 1,3-DPGA y dos de NADH+H + .

60Fosforilacin del ADP por el 1,3-DPGA, formndose ATP y cido 3-fosfoglicrico


(3-PGA). Es el primer ATP formado; dos, si tenemos en cuenta la rotura de la
cadena carbonada de la glucosa en dos cadenas de tres tomos de carbono. Hasta
este momento el balance energtico es nulo: dos ATP consumidos, dos obtenidos.

70 El cido 3-fosfoglicrico (3-PGA) se transforma en cido pirvico (PYR), sinteti -


zndose una nueva molcula de ATP (dos por cada molcula de glucosa).

CARACTERSTICAS Y SIGNIFICADO BIOLGICO DE LA GLUCOLISIS

- Se realiza tanto en procariotas como en eucariotas.


- En los eucariotas se realiza en el hialoplasma.
- Se trata de una degradacin parcial de la glucosa.
- Es un proceso anaerobio que permite la obtencin de energa a partir de los
compuestos orgnicos en ausencia de oxgeno.
- La cantidad de energa obtenida por mol de glucosa es escasa (2 ATP).
- La glucolisis fue, probablemente, uno de los primeros mecanismos para la
obtencin de energa a partir de sustancias orgnicas en la primitiva atmsfera sin
oxgeno de la Tierra.

CH2OH CH2O - P
O
O O P - O - CH2
H CH2OH
H H H
H H
H OH
OH OH H OH OH H
OH OH H HO

H OH H OH OH H

Glucosa (GLU) Glucosa 6 fosfato (G6P) Fructosa 6 fosfato (F6P)

O
P - O - CH2 CH2 O - P
CHO CH2OH
OH
H H C-OH C=O
H HO
CH2O P CH2O P

OH H
Fructosa 1, 6 difosfato (F1,6P) Aldehido 3 fosfoglicrico (PGAL) Dihidroxiacetona fosfato (DHA)

COO- P COOH COOH


H C-O-H H C-O-H C=O
CH2O P CH2O P CH3

cido 3 fosfoglicrico (3PGA) cido Pirvico (PYR)


cido 1,3 difosfoglicrico (1,3DPGA)

Fig. 3 Compuestos intermediarios de la glucolisis.

GLUCOLISIS

3
Es de los pocos casos en los que la fosforilacin se produce por el fosfato inorgnico y no por el ATP.

J. L. Snchez Guilln Pgina II-5b-2


II) La clula 5b) Respiracin celular

CH 2OH P O- CH2
ATP ADP
O O
H H H H
H H

OH H OH H
OH OH OH OH

H OH H OH

GLU G-6-P

O
CH2 -O-P CH2 O- P ADP ATP O
CH 2O- P
H CH OH
OH 2

H H OH
OH
H OH
OH H
OH H
F-1,6-P
F-6-P

CHO
NADH O
H- C - OH NAD +
C -O- P
CH - O - P H - C - OH
2
CH2 - O - P

PGAL H-P

1,3-DPGA

CH2OH
C=O

CH - O - P
2
X2 ADP

DHA

ATP

ATP ADP
O O

C-OH C - OH

C=O H - C - OH

CH2 - O - P
CH 3

PYR 3-PGA

J. L. Snchez Guilln Pgina II-5b-3


II) La clula 5b) Respiracin celular

GLUCOLISIS

CH2O-H ATP CH2O - P CH2O - P


O
O O O P - O - CH2
H H H H H CH2OH
H
H H H
H OH
OH H OH OH H OH OH H
OH OH OH OH H HO

ADP
OH H
H OH H OH H OH

Glucosa-6-P
Glucosa Glucosa-6-P Fructosa-6-P

1) Fosforilacin de la glucosa (GLU) por el ATP, for- 2) La glucosa-6-fosfato (G-6-P) se isomeriza a fruc-
mndose glucosa-6-fosfato (G-6-P). tosa-6-fosfato (F-6-P).
CH2 OH
C=O

ATP CH2O - P
O
O O P - O - CH2
P - O - CH2 P - O - CH2 CH2O -P Dihidroxiacetonafosfato
CH2OH CH2O -P

OH H OH
H H OH

H HO H HO H HO

OH H ADP
OH H OH H CHO
H C-OH
Fructosa-6-P Fructosa-1,6-P Fructosa-1,6-P
CH2O - P

Aldehido 3 fosfoglicrico

3) Nueva fosforilacin por el ATP de la fructosa-6- 4) La fructosa 1,6 difosfato se rompe para dar lugar
fosfato (F-6-P) que pasa a fructosa 1,6-difosfato (F- al aldehdo 3 fosfoglicrico y la dihidroxiacetona-
1,6-P). fosfato.
NAD+ ADP
CHO Pi COO- P COO- P COOH
H C-OH H C-OH H C-OH H C-OH
CH2O - P CH2O - P CH2O - P CH2O - P

Aldehido 3 fosfoglicrico cido 1,3-difosfoglicrico cido 1,3-difosfoglicrico cido -3-fosfoglicrico


NADH+H+ ATP

5) El aldehdo 3 fosfoglicrico se oxida por el NAD+ y 6) El cido1,3 difosfoglicrico reacciona con el ADP
se fosforila por el cido fosfrico para dar el cido1,3 para dar ATP y cido 3-fosfoglicrico.
difosfoglicrico.
ADP
COOH COOH
H C-OH C=O
CH2O - P CH3

cido -3-fosfoglicrico cido pirvico


ATP

7) El cido3 fosfoglicrico reacciona con el ADP para


dar ATP y cido pirvico.

J. L. Snchez Guilln Pgina II-5b-4


II) La clula 5b) Respiracin celular

V AS DEL CATABOLISMO DEL PIRVICO

Para evitar que la glucolisis se detenga por un


exceso de cido pirvico (PYR) y NADH+H + o
por falta de NAD + , se necesitan otras vas que
eliminen los productos obtenidos y recuperen
los substratos imprescindibles. Esto va a poder
realizarse de dos maneras:

10) Respiracin aerobia (catabolismo aerobio).


Cuando hay ox geno, el pirvico es degradado
completamente obtenindose dixido de carbo-
no (CO2 ). El NADH+H + y otras coenzimas
reductoras obtenidas son oxidadas y los
electrones transportados hacia el oxgeno (O2 ), Fig. 4 Esquema de una clula vista al
recuperndose el NAD+ y obtenindose H2 O. microscopio ptico. 1) mitocondria; 2) ncleo; 3)
Este proceso se realiza en los eucariotas en las citoplasma; 4 vacuola.
mitocondrias.
5

20) Fermentacin (Catabolismo anaerbico). 1-2-3 4

Cuando no hay oxgeno el cido pirvico se


transforma de diferentes maneras sin
degradarse por completo a CO2 y H2 O. Este
proceso tiene como objetivo la recuperacin del
NAD+ . En los eucariotas se realiza en el
hialoplasma.

Fig. 5 Mitocondria vista al microscopio


electrnico. 1-2-3) membrana externa, espacio
EL CATABOLISMO AERBICO intermembrana y membrana interna; 4) creta; 5)
(RESPIRACIN AEROBIA) matriz.

MITOCONDRIAS

Aspecto: Son orgnulos muy pequeos, difci -


les de observar al microscopio ptico, al que
aparecen como palitos o bastoncitos alargados.
Son orgnulos permanentes de la clula y se
forman a partir de otras mitocondrias preexis-
tentes.

Forma y nmero: El nmero de mitocondrias en


una clula puede llegar a ser muy elevado (hasta Fig. 6 Esquema de la ultraestructura de una
2000). Normalmente suelen tener forma elpti - clula animal: 1) nuclolo; 2) mitocondria; 3)
retculo endoplasmtico granular; 4) aparato de
ca, aunque tambin pueden ser filamentosas u Golgi; 5) ncleo/cromatina; 6) poro de la
ovoides. Sus dimensiones son muy pequeas (1 envoltura nuclear; 7) membrana plasmtica.
a 7 m de longitud por 0.5 m de dimetro). Su
forma y tamao dependen mucho de las
condiciones fisiolgicas de la clula.

J. L. Snchez Guilln Pgina II-5b-5


II) La clula 5b) Respiracin celular

Ultraestructura. Es muy similar en todas las


mitocondrias, independientemente de su forma
o tamao. Generalmente se observa la
presencia de una membrana externa y una
membrana interna, ambas similares a las dems
membranas de la clula. La membrana interna
se prolonga hacia el interior en una especie de
lminas llamadas crestas mitocondriales. Entre
ambas membranas hay un espacio llamado
espacio intermembrana (de unos 100 ).
Fig. 7 Ultraestructura de la mitocondria. 1)
Dentro de la mitocondria, entre las crestas, est Membrana externa, 2) Espacio intermembrana.
la matriz mitocondrial. Las prote nas de la 3) Membrana interna. 4) Crestas. 5) Matriz. 6)
membrana interna y las de las crestas son muy ADN.
importantes, ya que algunas son las responsa-
bles de los procesos respiratorios. El interior de
la matriz mitocondrial es una solucin de Glcidos
Lpidos O2
prote nas, lpi dos, ARN, ADN y ribosomas Otros C.O.

(mitorribosomas). Es de destacar que el ADN


mitocondrial es similar al ADN de los
Respiracin ATP
procariotas. Esto es, est formado por una
doble cadena de ADN circular asociada a
protenas diferentes de las que se encuentran CO2 y H2 O

en los eucariotas.
Fig. 8 Esquema general de la respiracin
celular.
Origen evolutivo: Las mitocondrias, igual que
los plastos, tienen una estructura similar a los
organismos procariticos. Segn la " Teora
endosimbintica" seran organismos
procariotas que han establecido una simbiosis
con las clulas eucariticas a las que proporcio-
naran energa a partir de sustancias
orgnicas.

DESCARBOXILACIN OXIDATIVA DEL CIDO


PIRVICO

En condiciones aerbicas el cido pirvico


(PYR) obtenido en la glucolisis y en otros
procesos catablicos atraviesa la membrana de
la mitocondria y en la matriz mitocondrial va a
sufrir un proceso qumico que tiene dos
vertientes:

10Descarboxilacin. El cido pirvico


Fig. 10 Descarboxilacin oxidativa del
(PYR) va a perder el grupo CO2
pirvico.
correspondiente al primer carbono, el
carbono que tiene la funcin cido.

J. L. Snchez Guilln Pgina II-5b-6


II) La clula 5b) Respiracin celular

20Oxidacin. Al perderse el primer carbono, el segundo pasa de tener un grupo


cetona a tener un grupo aldeh do. Este grupo se oxidar a grupo cido (cido
actico) por accin del NAD+ . En el proceso interviene una sustancia, la coenzima-A
(HS-CoA) que se unir al cido actico para dar acetil-coenzima A (ACA).

NADH

CO2 NAD+
CoA-SH
COOH H O O
C=O C=O C-OH C S-CoA
CH3 CH3 CH3 CH3

cido cido Acetil


pirvico acetaldehdo actico CoA

Fig. 11 La descarboxilacin oxidativa del cido pirvico (mecanismo).

Como vemos, se van a formar 2 nuevas molculas de NADH+H + por cada molcula de
glucosa (GLU) y, al mismo tiempo, se originan las primeras 2 molculas de CO2 .

EL CICLO DEL CITRATO (CTRICO) O CICLO DE KREBS

Krebs (1938), denomin ciclo del cido ctri-


co, y hoy se conoce tambin como ciclo de
Krebs, a la ruta metablica a travs de la cual el
cido actico unido a la coenzima-A va a
completar su oxidacin en la matriz
mitocondrial.

Este ciclo, no slo va a ser la ltima etapa de la


degradacin de los azucares, otros compuestos
orgnicos (los cidos grasos y determinados
aminocidos) van a ser tambin degradados a
acetil-CoA (ACA) e integrados en el ciclo de
Krebs. El ciclo de Krebs es, por lo tanto, la va
fundamental para la degradacin de la mayora
de los compuestos orgnicos y para la obten- Fig. 12 Hans Krebs (Hildesheim Alemania
cin coenzimas reductoras. Es la va ms -1900-1981).
importante para el catabolismo de las sustan-
cias orgnicas.

INCORPORACIN DE OTRAS SUSTANCIAS AL CICLO DE KREBS

Al ciclo de Krebs van a incorporarse, adems de las sustancias resultantes del catabolismo
de los glcidos, otras que provienen del catabolismo de otras las sustancias orgnicas. As,
por ejemplo, los cidos grasos se degradan en las mitocondrias transformndose en acetil-
CoA. Este proceso se realiza en la matriz mitocondrial y recibe el nombre de -oxidacin.

J. L. Snchez Guilln Pgina II-5b-7


II) La clula 5b) Respiracin celular

Polisacridos Monosacridos

Glucosa

Aminocidos Pirvico Glicerina

Lpidos
Protenas

Aminocidos cidos
Acetil-CoA grasos

Ciclo
De
Krebs

CO2
Fig. 14 Vas metablicas que desembocan en el ciclo de Krebs.

MECANISMO DEL CICLO DE KREBS4

El ciclo de Krebs, como todo proceso ccli co, no tiene ms principio o fin que el que noso-
tros queramos ponerle. Es alimentado continuamente en substratos y continuamente
genera productos. Las sustancias intermediarias se recuperan para ser de nuevo integradas
en l. Como una rueda girando sin fin, slo se detendr si faltan los substratos o si, por
exceso de productos, se inhiben las enzimas que participan en l.

Las diferentes reacciones que se producen en este proceso son:

10 Condensacin de la acetil-CoA (ACA) con el cido oxalactico (OXA ) para formar


el cido ctrico (CIT). En este proceso se recupera la CoA-SH.

20 Transformacin del cido ctrico (CIT) en su ismero, el cido isoc trico (ISO).

30 Descarboxilacin oxidativa del cido isoc trico (ISO) que se transforma en -


cetoglutrico (-KG) con la formacin de CO2 y NADH+H + .

40 Descarboxilacin oxidativa del cido -cetoglutrico (-KG) formndose CO2 ,


NADH+H + y 1 GTP (ATP). El -cetoglutrico (-KG) se transforma en cido
succnico (SUC).

4
Lo que viene a continuacin, se expone a los efectos de que los alumnos puedan interpretar los esquemas y extraer las
consecuencias que se derivan de ellos. No parece conveniente que el alumno deba saberlo de memoria.

J. L. Snchez Guilln Pgina II-5b-8


II) La clula 5b) Respiracin celular

Vemos que en estos momentos ya se ha completado la degradacin del CH3 -CO-CoA


(ACA) con la formacin de 2 molculas de CO2 , cuatro por cada molcula de glucosa.
Tenemos ya las 6 molculas de CO2 que puede originar la glucosa. Las reacciones que
vienen a continuacin van a servir para recuperar el cido oxalactico (OXA ).

50 Oxidacin del cido succnico (SUC) a cido fumrico (FUM). Esta oxidacin se
realiza por la formacin de un doble enlace. Los electrones son transferidos al FAD
que pasa a FADH2 .

60 Adicin de agua al doble enlace formndose el cido mlico (MAL).

70 Oxidacin por el NAD+ del alcohol del cido mlico, que se transforma en el
cido oxalactico (OXA ), completndose el ciclo.

Como podemos ver, la cantidad de ATP obtenida en la Glucolisis y en el Ciclo de Krebs es


ms bien escasa. Por el contrario, se van a obtener grandes cantidades de coenzimas
reducidas: NADH+H + y FADH2 que sern oxidadas en la cadena respiratoria.

O CH2 - COOH HO - CH - COOH


C-S-CoA HO C - COOH H C - COOH
CH3 CH2 - COOH CH2 - COOH

Acetil-Co-A cido ctrico cido isoctrico

O = C - COOH
CH2 - COOH CH - COOH
H C - H
CH2 - COOH CH - COOH
CH2 - COOH

cido cetoglutrico cido succnico cido fumrico

HO - CH - COOH O = CH - COOH
CH2 - COOH CH2 - COOH

cido mlico cido oxalactico

Fig. 15 Compuestos intermediarios del ciclo de Krebs.

J. L. Snchez Guilln Pgina II-5b-9


II) La clula 5b) Respiracin celular

EL CICLO DE KREBS O DEL CTRICO

J. L. Snchez Guilln Pgina II-5b-10


II) La clula 5b) Respiracin celular

DESCRIPCIN DEL CICLO DE KREBS O DEL CTRICO

ACA
O
CH3 -C-S-CoA CH2 - COOH HO- CH - COOH
CH2 - COOH HO C - COOH
O = C - COOH H C - COOH
HO C - COOH CH2 - COOH
CH2 - COOH CH2 - COOH
CH2 - COOH
OXA CoA-SH
CoA-SH CIT ISO
CIT

1) Condensacin de la acetil-CoA (ACA) con el cido 2) Transformacin del cido ctrico (CIT) en su
oxalactico (OXA) para formar el cido ctrico (CIT). ismero, el cido isoctrico (ISO).
En este proceso se recupera la CoA-SH.

NAD++
NAD NAD++
NAD GDP
GDP
HO- CH - COOH O= C - COOH O= C - COOH COOH
H C - COOH HC-H HC-H CH2
CH2 - COOH CH2 - COOH CH2 - COOH CH2 - COOH
NADH
NADH CO2 NADH CO2 GTP
CO2 NADH CO 2 GTP
ISO KG KG SUC

3) Descarboxilacin oxidativa del cido isoctrico 4) Descarboxilacin oxidativa del cido -


(ISO) que se transforma en -cetoglutrico (-KG) cetoglutrico (-KG) formndose CO2, NADH+H + y 1
con la formacin de CO2 y NADH. GTP (ATP). El -cetoglutrico (-KG) se transforma
en cido succnico (SUC).

FAD
FAD HH22OO
COOH COOH COOH
COOH
CH2 CH H-C-OH
CH
CH2 - COOH CH - COOH CH - COOH CH2 - COOH
FADH2
FADH FUM
SUC
2 MAL
FUM

5) Oxidacin del cido succnico (SUC) a cido 6) Adicin de agua al doble enlace formndose el cido
fumrico (FUM). Esta oxidacin se realiza por la mlico (MAL).
formacin de un doble enlace. Los electrones son
transferidos al FAD que pasa a FADH2.

NAD++
NAD
COOH COOH
H-C-OH C=O
CH2 - COOH CH2 - COOH
NADH
NADH
MAL OXA

7) Oxidacin por el NAD+ del alcohol del cido mlico,


que se transforma en el cido oxalactico (OXA),
completndose el ciclo.

J. L. Snchez Guilln Pgina II-5b-11


II) La clula 5b) Respiracin celular

LA FOSFORILACIN OXIDATIVA (CADENA RESPIRATORIA).CONCEPTO Y OBJETIVOS

Concepto: Consiste en un transporte de


electrones desde las coenzimas reducidas,
Acetil-CoA
NADH+H + o FADH2 , hasta el oxgeno. Este
transporte se realiza en la membrana de las
crestas mitocondriales. 3 NAD+

GTP Ciclo de
3 NADH
Objetivos: Es en este proceso donde se obtendr Krebs o del
GDP ctrico
la mayor parte de la energa contenida en la
2 CO2
glucosa y otros compuestos orgnicos, que ser
almacenada en forma de ATP. Al mismo tiempo
se recuperarn las coenzimas transportadoras de FADH2 FAD

electrones en su forma oxidada, lo que permitir


la oxidacin de nuevas molculas de glucosa y de Fig. 16 Balance del ciclo de Krebs.
otras sustancias orgnicas. Como producto de
desecho se obtendr agua.

ESTRUCTURA DE LA MEMBRANA DE LAS CRESTAS MITOCONDRIALES

Las crestas mitocondriales tienen la estructura de toda membrana biolgica. Empotradas


en la doble capa lipdica se encuentran diferentes sustancias transportadoras de electrones
formando la cadena respiratoria. Estas estn asociadas formando cuatro grandes comple-
jos:

- Complejo I (NADH deshidrogenasa)


- Complejo II (Succinato deshidrogenasa)
- Complejo III (Citocromo bc1)
- Complejo IV (Citocromo c oxidasa)

Existen, adems, otros transportadores: la coenzima Q (Co-Q) o ubiquinona (UQ), el


citocromo c (cit c) y la enzima ATP sintetasa.

II Matriz mitocondrial
ATPasa

IV
UQ

Espacio intermembrana

Fig. 17 Componentes de la membrana de las crestas mitocondriales.

J. L. Snchez Guilln Pgina II-5b-12


II) La clula 5b) Respiracin celular

LA FOSFORILACIN OXIDATIVA (CADENA RESPIRATORIA): MECANISMO

En la membrana de las crestas mitocondriales se va a realizar un transporte de electrones


desde el NADH o el FADH2 hasta el oxgeno, tal y como se indica en la figura. Este
transporte de electrones va a generar un transporte de protones por parte de los complejos
I, II y III desde la matriz hacia el espacio intermembrana. Cada complejo ser capaz de
bombear dos protones. La salida de estos protones a travs de las ATPasas servir para
sintetizar ATP, 1 ATP por cada dos protones, de forma similar a como suceda en los
cloroplastos. El NADH es capaz de reducir al Complejo I por lo que se obtendrn 3ATP por
cada molcula de NADH. El FADH2 no puede reducir al Complejo I y cede sus dos electrones
al Complejo II que los pasa a la Ubiquinona (UQ). Esta es la razn por la que el FADH2 slo
genera 2 ATP.

H 2O
3ATP
Matriz mitocondrial

6H+
NAD+
3ADP
NADH+H+ 1/2O2

II

ATPasa
IV
UQ

6H+
Espacio intermembrana

Fig. 18 Esquema general de la fosforilacin oxidativa en la cadena respiratoria. Oxidacin del NADH y
sntesis de ATP. UQ (Ubiquinona) y Cit-c (citocromo C).

Los electrones sern cedidos finalmente al oxgeno que junto con dos protones del medio
darn una molcula de H2 O

2H + + 1/2O 2 + 2e- ---- H2 O

Qu sucede con el NADH de origen


hialoplasmtico en los eucariotas? NAD+
NADH
Hialoplasma
Hemos visto que cada NADH que se origina en 2e-

las mitocondrias rinde 3 ATP. Pero, en los


eucariotas, el NADH que se origina en el 2e-

hialoplasma, en la glucolisis, slo puede originar 2 Interior mitocondrial

ATP. Esto es debido a que este NADH no puede FAD FADH2

atravesar la membrana mitocondrial y debe ceder


Fig. 19 El NADH que se origina en el
sus electrones a una sustancia intermediaria que hialoplasma cede los electrones a una sustancia
a su vez los cede al FAD que hay en el interior de que los cede a su vez al FAD que hay en el interior
la mitocondria, lo que no sucede en los de la mitocondria. Esta es la razn por la que este
NADH slo rinde 2 ATP.
procariotas.

J. L. Snchez Guilln Pgina II-5b-13


II) La clula 5b) Respiracin celular

LAS FERMENTACIONES ANAERBICAS

La oxidacin del NADH+H + y del FADH2 en la cadena respiratoria tiene como aceptor final
de los electrones al oxgeno. De esta manera, el NAD + se recupera y la glucolisis y el ciclo
de Krebs pueden mantenerse.

Si no hay oxgeno, el NADH+H + y el FADH2 se acumulan y los procesos de obtencin de


energa se interrumpen. En estas condiciones, condiciones anaerobias o de falta de
oxgeno, ciertos microorganismos y, por ejemplo, nuestras clulas musculares, recuperan
las coenzimas oxidadas por diversas vas metablicas conocidas bajo el nombre de
fermentaciones anaerbicas.

Es ms, para algunos microorganismos, los anaerobios estrictos, las fermentaciones son
su nica fuente de energa. Se les llama anaerobios estrictos porque no pueden vivir en un
medio que contenga oxgeno ya que ste les es letal. Otros, los anaerobios facultativos,
utilizan estas vas como mecanismo de emergencia durante los perodos en los que no
disponen de oxgeno.

En las fermentaciones, la glucosa no se degrada totalmente a CO2 y H2 O, sino que se


produce una degradacin incompleta de la cadena carbonada.

Segn el producto obtenido, tendremos las siguientes fermentaciones:

a) Fermentacin lctica.
b) Fermentacin alcohlica.

A) FERMENTACIN LCTICA

La realizan las bacterias del yogur y, por


ejemplo, las clulas musculares, cuando no
reciben un aporte suficiente de oxgeno, lo que
sucede cuando se lleva a cabo un ejercicio
fsico intenso.

Fig. 20 Lactobacillus.
En la fermentacin lctica, el cido pirvico es
reducido a cido lctico por medio del NADH-
+H + . De esta manera el NAD + se recupera y
pueden ser degradadas nuevas molculas de
glucosa.

Nuestras clulas musculares emplean la


fermentacin lctica cuando alcanzamos el cido pirvico
cido lctico

90% de la FCM (frecuencia cardiaca mxima).


Si este cido lctico no se elimina se puede
Fig. 21 Fermentacin lctica.
acumular produciendo fatiga muscular.

J. L. Snchez Guilln Pgina II-5b-14


II) La clula 5b) Respiracin celular

B) FERMENTACIN ALCOHLICA

En la fermentacin alcohlica el cido pirvico


es transformado en alcohol etlico o etanol.

Esta fermentacin la realizan, por ejemplo, las


levaduras del gnero Saccharomyces. Se trata
de un proceso de gran importancia industrial
que, dependiendo del tipo de levadura, dar
lugar a una gran variedad de bebidas
alcohlicas: cerveza, vino, sidra, etc. En la
fabricacin del pan se le aade a la masa una Fig. 22 Levaduras.
cierta cantidad de levadura, la fermen-
tacin del almidn de la harina har que CO2
el pan sea ms esponjoso por las
burbujas de CO2 . En este ltimo caso el
alcohol producido desaparece durante el
proceso de coccin. La fermentacin
cido pirvico etanal Alcohol etlico
alcohlica tiene el mismo objetivo que la
fermentacin lctica: la recuperacin
del NAD + en condiciones anaerbicas. Fig. 23 Mecanismo de la fermentacin alcohlica.

En la fermentacin alcohlica el ac.


pirvico se descarboxila trasformndose en acetaldeh do y este es reducido por el NADH a
alcohol etlico.

ECUACIONES GLOBALES DE LAS DIFERENTES VAS DE


DEGRADACIN DE LA GLUCOSA y RENDIMIENTO ENERGTICO EN
MOLES DE ATP POR MOL DE GLUCOSA

a) Respiracin oxidativa

C6H12O6 + 6O2 6CO2 + 6H2O (36 ATP)

b) Fermentacin lctica

C6H12O6 2 C3H6O3 (2 ATP)

c) Fermentacin alcohlica

C6H12O6 2 C2H5OH + 2CO2 (2 ATP)

J. L. Snchez Guilln Pgina II-5b-15


II) La clula 5b) Respiracin celular

ESQUEMA SIMPLIFICADO DE LA RESPIRACIN CELULAR

O2 Hialoplasma

mitocondria

Acetil-CoA Pirvico
H2O

H+
NADH
Ciclo de
Krebs Glucolisis
e- NAD

ADP+P
Glucosa
ATP

ADP+P
ATP
CO2
Reacciones endergnicas

ESQUEMA GENERAL DE LA GLUCOLISIS Y DE LAS FERMENTACIONES

Glucosa
CH2OH

Glucolisis CH3
2 Etanol

2 cido lctico

2NAD+ 2NAD+

2ATP
F. lctica F. alcohlica

2NADH+H+ 2NADH+H+

2 Etanal
2 CO2
2 cido pirvico

J. L. Snchez Guilln Pgina II-5b-16


II) La clula 5b) Respiracin celular

BALANCE DE LOS PROCESOS DE LA RESPIRACIN CELULAR EN EUCARIOTAS

Coenzimas
Sustancia Sustancia Moles de ATP
Proceso Reducidas y
inicial final (totales)
ATP

2 NADH 4 ATP *
Glucolisis Glucosa 2 cid. pirvico
2 ATP 2 ATP

Descarboxilacin 2 cid. 2 acetil-Co A


2 NADH 6 ATP
del cido pirvico pirvico 2 CO2

6 NADH
18 ATP
2 FADH2
Ciclo de Krebs 2 acetil-Co A 4 CO2 4 ATP
2 GTP
2 ATP

Glucosa 6 CO2
Balance global 36 ATP**
6 O2 6 H2O

* 6 ATP en procariotas
* * 38 ATP en procariotas

J. L. Snchez Guilln Pgina II-5b-17


III) La informacin celular 1) El ncleo celular

III

INFORMACIN CELULAR

POR QU ES NECESARIA LA INFORMACIN CELULAR?

En toda clula, tanto procariota como


eucariota, se dan complejos procesos
metablicos y fisiolgicos con la finalidad
de obtener materiales y energa. Para Regulacin de la
asegurar estos procesos la clula necesita expresin gnica
una gran variedad de protenas, enzimas,
particularmente. Se calcula que nuestras
clulas precisan a lo largo de su ciclo vital Informacin
unas 30.000 protenas diferentes. Cada una celular

de estas protenas consta, por trmino


medio, de unos 500 aminocidos que deben expresin

de estar unidos en su orden correcto. Un


slo cambio puede alterar el centro activo
Sntesis de
de la molcula y hacer que la enzima, si la protenas
protena en cuestin es una enzima, no
pueda realizar su funcin. Si multiplicamos
30.000 protenas por 500 aminocidos cada
una nos da un total de 15x10 6 . sta es la
Fig. 1 La informacin celular.
informacin necesaria, como mnimo, para
poder sintetizar todas las protenas
celulares. Si codificsemos esta informacin con un slo carcter y la escribisemos
en una hoja de papel, a 60 caracteres por lnea y 50 lneas por pgina (3000
caracteres en total por pgina), necesitaramos un total de 5000 pginas para
codificar toda esta informacin.

Adems, la clula no slo requiere protenas sino que tambin necesita regular y
controlar los procesos que se dan en ella.

Toda esta gran cantidad de informacin se encuentra en el ncleo de las clulas


eucariotas y en el genoma o cromosoma de las clulas procariotas.

Dnde est codificada esta informacin, cmo est codificada, cmo se transcribe,
cmo se traduce, cmo pasa de unas clulas a otras en el proceso de divisin
celular y de unos organismos a otros en los procesos de reproduccin y las
consecuencias de las alteraciones que se producen en ella (mutaciones) es lo que
estudiaremos a continuacin.

J. L. Snchez Guilln Pgina III-1-1


III) La informacin celular 1) El ncleo celular

1) EL NCLEO

EL NCLEO EN INTERFASE

El ncleo es una estructura caracterstica


de las clulas eucariticas. Fue descubierto
por Robert BROWN en 1831 y contiene la
informacin gentica, esto es, la A B

informacin necesaria para que se puedan


realizar las funciones celulares y, ms en Fig. 2 A) ncleo en reposo (interfase) y
concreto, la informacin para la sntesis de ncleo en divisin (mitosis).
las protenas.

FUNCIONES QUE SE DAN EN EL NCLEO


CELULAR EN INTERFASE

1) La trasmisin de la informacin gentica


de los ascendientes a los descendientes y
de una generacin celular a la siguiente se
realiza a travs del ncleo celular. Debido a
esto en el ncleo es necesario que se
realice la duplicacin o replicacin del ADN.

2) Los procesos de sntesis del ARN,


trascripcin de la informacin gentica para
la posterior sntesis de protenas en el
hialoplasma, se dan tambin en el ncleo.

Por ltimo, esta informacin se traducir


en el citoplasma celular, pues en l se Fig. 3 Clula animal vista al M.E.T.
realizar la sntesis de protenas.

EL NCLEO EN INTERFASE. CARACTERSTICAS

Aspecto. Generalmente se presenta como


una esfera de gran tamao que se destaca
del citoplasma y que est separada de l
por una envoltura nuclear, que es un
elemento del retculo endoplasmtico
granular que rodea el material nuclear. El
contenido del ncleo se revela al
microscopio ptico como ms o menos
homogneo, salvo por la presencia de
pequeas estructuras esfricas llamadas
nuclolos.

Nmero. Normalmente las clulas slo


tienen un ncleo. El paramecio, no
obstante, tiene dos ncleos: uno mayor, el
macroncleo, y otro menor, el microncleo. Fig. 4 Aspecto tpico del ncleo celular.
Las fibras musculares estriadas y los
osteoclastos presentan gran cantidad de
ncleos. Tambin pueden tener muchos

J. L. Snchez Guilln Pgina III-1-2


III) La informacin celular 1) El ncleo celular

ncleos las clulas cancerosas.


M

Forma. Si la clula es isodiamtrica -con


dimensiones similares en todas las
direcciones del espacio (por ejemplo:
esfrica o cbica)- el ncleo, normalmente, m

es esfrico. En las clulas donde dominan


dos dimensiones, clulas aplanadas, el Fig. 5 M) macroncleo y m) microncleo,
ncleo suele ser discoidal. En las clulas del paramecio.
alargadas el ncleo suele ser elptico.
Ciertos tipos celulares tienen ncleos
irregulares; as, por ejemplo, algunos
glbulos blancos tienen un ncleo lobulado
muy irregular y el stentor, organismo
unicelular ciliado, tiene un ncleo de forma
arrosariada.

Tamao. El tamao del ncleo es bastante


constante en una misma especie celular. El
ncleo es muy voluminoso en las clulas
indiferenciadas o en las muy activas. Si el Fig. 6 Ncleo en forma de u de la
ncleo sufre un aumento en su volumen es vorticela.
un indicio de que la clula est prxima a
entrar en divisin.

EL NCLEO EN INTERFASE. ESTRUCTURA

Al MET podemos distinguir en el ncleo


las siguientes estructuras:

La envoltura nuclear. Constituida por dos


membranas unitarias: una exterior y otra
interior con un espacio entre ellas llamado
espacio perinuclear. La envoltura nuclear
proviene del retculo endoplasmtico Fig. 7 Ncleo arrosariado del stentor,
granular y est conectada con l. Adosados organismo unicelular ciliado.
a la membrana exterior hay ribosomas,
como ocurre en el retculo endoplasmtico
granular. La envoltura nuclear no es
continua, pues tiene un gran nmero de
poros de 500 a 700 de dimetro con
una compleja estructura formada por 8
partculas esfricas de naturaleza protenica. ncleo
Los poros permiten el paso de grandes
molculas (ARN, protenas) e impiden
diferencias osmticas entre el ncleo y el
citoplasma. En el interior del ncleo y
adosada a la membrana interna
encontramos una estructura protenica
formada por protenas fibrilares: la lmina
nuclear, de un espesor de 150 a 500 . Su
funcin es inducir la aparicin y
desaparicin de la envoltura nuclear y Fig. 8 Clula vista al M.E.T.
resulta fundamental para la constitucin de
los cromosomas a partir de la cromatina.

J. L. Snchez Guilln Pgina III-1-3


III) La informacin celular 1) El ncleo celular

El nucleoplasma: Es el contenido nuclear


indiferenciado. Se trata de un gel de
estructura y composicin similar al
hialoplasma, pero no tiene ni microt bulos nuclolo
ni microfilamentos. Est formado por agua,
protenas, ARN e iones. En l se encuentra
inmersa la cromatina y se dan los procesos
REG
de sntesis del ARN (transcripcin) y la
replicacin del ADN.
Envoltura
La cromatina. Llamada as por teirse nuclear

fuertemente con ciertos colorantes, est


constituida por ADN (la mayor parte del
ADN celular est en la cromatina), protenas
cromatina
y algo de ARN. Entre las protenas se
encuentran las histonas, que tienen un
elevado porcentaje de aminocidos bsicos Fig. 9 Fragmento de una clula visto al
y, aparte de empaquetar el ADN, MET.
neutralizan el fuerte carcter cido de los
cidos nucleicos. Al parecer, tambin
controlan la actividad de los genes. Envoltura nuclear
REG

Adems de las histonas, podemos nuclolo


encontrar en la cromatina otras protenas,
como la miosina y la actina. Estas protenas
son las responsables en el msculo de la
contraccin muscular y en el ncleo podran
estar relacionadas con la formacin del
cromosoma metaf sico y con la separacin
de las cromtidas en la divisin celular.

La cromatina est estructurada en


elementos individuales llamados nucleoplasma
cromosomas. Hay un nmero constante de cromatina

cromosomas por ncleo celular, por


individuo y por especie. Los cromosomas Fig. 10 Esquema de la ultraestructura del
interf sicos darn lugar, cuando la clula se ncleo celular.
divida, a los metaf sicos.

El ADN nuclear representa el genoma de las clulas eucariotas

El nuclolo. Es una estructura aproximadamente esfrica, visible incluso al


microscopio ptico. Suele destacarse del resto del contenido nuclear por ser ms
brillante. Su tamao es de 1 a 3m.

Caracter sticas del nucl olo: Aparece con frecuencia asociado a zonas de cromatina
densa, los llamados organizadores nucleolares, pues se forma a partir de ellos. Las
clulas jvenes tienen por lo general uno o dos nuclolos. Algunas clulas tienen
ms de dos, segn el nmero de organizadores nucleolares que tengan. Las clulas
viejas tienen uno o ninguno. Su nmero, por lo tanto, depende de la edad y
tambin del estado funcional de la clula. Cuando la clula se va a dividir
desaparece.

J. L. Snchez Guilln Pgina III-1-4


III) La informacin celular 1) El ncleo celular

Estructura del nucl olo: No presenta


membrana de separacin con el ncleo y al
MET tiene un aspecto heterogneo,
grumoso, con zonas ms densa y otras
menos densas. Est constituido bsicamente
por ARN, protenas y ADN asociado.

Funciones del nucl olo: Su funcin principal


es la sntesis de ARNr (el ARN de los
ribosomas) y el ensamblaje de estos
mismos ribosomas. El ARN ribosomal se
sintetiza en el propio nuclolo y las
Fig. 11 Ultraestructura del nuclolo: 1)
protenas de los ribosomas provienen del
Cromatina del organizador nucleolar; 2) parte
citoplasma y pasa al interior del ncleo a granular; 3) parte fibrosa.
travs de los poros de la envoltura nuclear.

J. L. Snchez Guilln Pgina III-1-5


III) La informacin celular 2) cidos nucleicos

2) LOS CIDOS NUCLEICOS

CONCEPTO

Qumicamente, los cidos nucleicos son


polme ros constituidos por la unin mediante
enlaces qumicos de unidades menores
llamadas nucletidos. Los cidos nucleicos
son compuestos de elevado peso molecular,
esto es, son macromolculas.
Fig. 1 Pirimidina.

FUNCIONES GENERALES

Los cidos nucleicos, llamados as porque


en un principio fueron localizados en el
ncleo celular, son las molculas de la
herencia y por lo tanto van a participar en
los mecanismos mediante los cuales la
informacin gentica se almacena, replica y
transcribe. sta no va a ser su nica Fig. 2 Purina.
funcin. Determinados derivados de estas
sustancias: los nucletidos, van a tener
otras funciones biolgicas, entre las que pueden destacarse, como ejemplo, la de
servir de intermediarios en las transferencias de energa en las clulas (ATP, ADP y
otros) o en las transferencias de electrones (NAD+ , NADP+ , FAD, etc.).

LOS NUCLETIDOS: COMPONENTES

Los nucletidos estn formados por: una


base nitrogenada (BN), un azcar (A) y
cido fosfrico (P); unidos en el siguiente
orden: PABN
Adenina

LAS BASES NITROGENADAS

Son sustancias derivadas de dos compues-


tos qumi cos: la purina y la pirimidina. Las
que derivan de la purina son las bases pri-
cas. En los nucletidos vamos a encontrar,
normalmente, dos base pricas: la adenina
(A) y la guanina (G). Las que derivan de la
pirimidina se llaman pirimid nicas. Tres son Guanina
las bases pirimid nicas presentes en los
cidos nucleicos: la citosina (C), la timina Fig. 3 Bases pricas.
(T) y el uracilo (U).

J. L. Snchez Guilln Pgina III-2-1


III) La informacin celular 2) cidos nucleicos

En ciertos casos, aunque esto pasa muy raramente, pueden encontrarse en los
cidos nucleicos otras bases diferentes de estas cinco, por lo general derivados
metilados de ellas.

Fig. 4 Citosina. Fig. 5 Timina. Fig. 6 Uracilo.

EL AZCAR (GLCIDO)

El azcar que interviene en los nucletidos


puede ser o la ribosa (R) o la desoxirribosa
(dR). Ambas son aldopentosas y las
Ribosa
encontraremos en los nucletidos como -
furanosas.

Conviene destacar que la nica diferencia


entre ambas est en que en el carbono 2 de
la desoxirribosa hay un hidrgeno (-H) en
lugar del grupo alcohol (-OH).

Desoxirribosa
LOS NUCLESIDOS
Fig. 7 La ribosa y la desoxirribosa.
El azcar y la base nitrogenada se unen
entre s como se indica en las figuras
formando un nuclesido. El enlace se forma
entre el carbono anomrico del azcar y uno
de los nitrgenos de la base nitrogenada, en
concreto, el indicado en las figuras. En la
unin se forma una molcula de agua. Este
enlace recibe el nombre de enlace N-
glicosdico.

ESTRUCTURA DE LOS NUCLETIDOS

Los nucletidos son los monmeros que


constituyen los cidos nucleicos. Se forman
cuando se unen el cido fosfrico y un
nuclesido. Es una unin fosfoster entre un
OH del cido fosfrico y el OH situado en el
carbono 5 del azcar, con formacin de una Fig. 8 Nuclesido pirimidnico.
molcula de agua. Segn el azcar sea la

J. L. Snchez Guilln Pgina III-2-2


III) La informacin celular 2) cidos nucleicos

ribosa o la desoxirribosa, tendremos ribonucletidos o desoxirribonucletidos. La


timina nunca forma parte de los ribonucletidos y el uracilo no forma parte de los
desoxirribonucletidos.

NUCLETIDOS O DERIVADOS DE
NUCLETIDOS DE INTERS BIOLGICO.

Algunos nucletidos cumplen funciones por


s mismos. As, por ejemplo:

a) Nucletidos que intervienen en las


transferencias de energa : Se trata de
molculas que captan o desprenden energa
al transformarse unas en otras. As, el ATP
desprende energa cuando se hidroliza,
transformndose en ADP y fosfato inorg-
nico (Pi). Por el contrario, el ADP almacena
energa cuando reacciona con el fosfato
inorgnico y se transforma en ATP y agua.
De esta forma se transporta energa (unas 7
kilocaloras por mol de ADP/ATP) de Fig. 9 Nucletido. Las flechas indican los
aquellas reacciones en las que se desprende enlaces fosfoster (roja) y N-glicosdico (verde).

(exergnicas) a aquellas en las que se


necesita (endergnicas).

Ejemplos de nucletidos transportadores de energa:

- AMP (adenosina-5'-monofosfato) A-R-P


- ADP (adenosina-5'-difosfato) A-R-P-P
- ATP (adenosina-5'-trifosfato) A-R-P-P-P
- GDP (guanosidina-5'-difosfato) G-R-P-P
- GTP (guanosidina-5'-trifosfato) G-R-P-P-P

b) Nucletidos que intervienen en los procesos de xido-reduccin. Estas molculas


captan electrones de molculas a las que oxidan y los ceden a otras molculas a las
que a su vez reducen. As, el NAD + puede captar 2e - transformndose en su forma
reducida, el NADH, y ste puede ceder dos electrones a otras sustancias,
reducindolas y volviendo a transformarse en su forma oxidada, el NAD + . As, se
transportan electrones de aquellas reacciones en las que se desprende a aquellas en
las que se necesitan.

Ejemplos de nucletidos transportadores de electrones:

- NAD+ /NADH (Nicotinamida-adenina-dinucletido) oxidado y reducido, respecti-


vamente.
- NADP+ /NADPH (Nicotinamida-adenina-dinucletido-fosfato), oxidado y
reducido.
- FAD/FADH2 (Flavina-adenina-dinucletido), oxidado y reducido.

J. L. Snchez Guilln Pgina III-2-3


III) La informacin celular 2) cidos nucleicos

c) Nucletidos reguladores de procesos metablicos. Algunos nucletidos cumplen


funciones especiales como reguladores de procesos metablicos, por ejemplo el AMPc
(adenosina-3',5'- monofosfato) o AMP ccli co, en el que dos OH del fosfato esterifican
los OH en posiciones 3 y 5 de la ribosa formando un ciclo. Este compuesto qumico
acta en las clulas como intermediario de muchas hormonas.

LOS POLINUCLETIDOS

Dos nucletidos van a poder unirse entre


s mediante un enlace sterfosfato
(fosfoster). Este enlace se forma entre un
OH del cido fosfrico de un nucletido y el
OH (hidroxilo) del carbono nmero 3 del
5
azcar del otro nucletido con formacin de
una molcula de agua. La unin de otros
nucletidos dar lugar a un polinucletido.

Es de destacar que en toda cadena de


polinucletidos el nucletido de uno de los
extremos tendr libre el OH del azcar en
posicin 3, ste ser el extremo 3' de la
cadena. El cido fosfrico del nucletido que
se encuentre en el extremo opuesto tambin
estar libre, ste ser el extremo 5'. Esto 3
marca un sentido en la cadena de polinu-
cletidos. Toda cadena podr considerarse Fig. 10 Dinucletido.
bien en sentido 3' 5' o en sentido 5' 3' y
as habr que indicarlo.
5 P dR A

P dR G
ADN Y ARN: DIFERENCIAS A NIVEL
QUMICO P dR C

P dR T
- El ADN (cido desoxirribonucleico) sus
P dR G
nucletidos tienen desoxirribosa como azcar
y no tiene uracilo. 3
P dR A
- El ARN (cido ribonucleico) tiene ribosa y
no tiene timina.
Fig. 11 Ejemplo de cadena polinucleo-
tdica.

EL ADN (DNA)

Concepto: Qumicamente son polinucletidos


constituidos por d-AMP, d-GMP, d-CMP y d-
TMP. Los nucletidos del ADN no tienen ni
uracilo, ni ribosa, como ya se ha dicho.

Caractersticas: Los ADN celulares tienen


Fig. 12 Modelo de la estructura del ADN.
una elevada masa molecular, muchos
millones de daltons. As, por ejemplo: el
genoma humano est formado por 3x10 9

J. L. Snchez Guilln Pgina III-2-4


III) La informacin celular 2) cidos nucleicos

pares de nucletidos. Esto hace que sean


molculas de una gran longitud; por ejemplo:
1,7 m en el caso del virus de la poliomie-
litis y 2,36 m si sumamos todo el ADN de
todos los cromosomas de una clula humana.

El ADN fue aislado por primera vez en


1869, pero hasta 1950 no se empez a
conocer su estructura. Se encuentra en el
ncleo de las clulas eucariotas asociado a
prote nas (histonas y otras) formando la
cromatina, sustancia que constitu ye los
cromosomas y a partir de la cual se Fig. 13 J. Watson y F. Crick.
transcribe la informacin gentica. Tambin
hay ADN en ciertos orgnulos celulares (por
ejemplo: plastos y mitocondrias).

ESTRUCTURA DEL ADN T A

Se pueden distinguir 3 niveles estructurales:

-Estructura primaria: La secuencia de los


nucletidos.
-Estructura secundaria: La doble hlice.
-Estructura terciaria: Collar de perlas,
C G
estructura cristalina, ADN superenrollado.

En las clulas eucariotas, a partir de la


estructura 30, se dan otros niveles de
empaquetamiento de orden superior. Fig. 14 Puentes de hidrgeno (.....) entre
bases complementarias en el ADN.

ESTRUCTURA PRIMARIA DEL ADN.

Es la secuencia de nucletidos de una


cadena o hebra. Es decir, la estructura
primaria del ADN viene determinada por el
orden de los nucletidos en la hebra o
cadena de la molcula. Para indicar la
secuencia de una cadena de ADN es
suficiente con los nombres de las bases o
su inicial (A, T, C, G) en su orden correcto
y los extremos 5' y 3' de la cadena
nucleotdica.

As, por ejemplo:

5'ACGTTTAACGACAAGGACAAGTATTAA3'

La posibilidad de combinar cuatro nucle-


tidos diferentes y la gran longitud que Fig. 15 Modelo de la estructura
pueden tener las cadenas polinucleotdicas, secundaria del ADN.
hacen que pueda haber un elevado nmero
de polinucletidos posibles, lo que determina que el ADN pueda contener el mensaje
biolgico o informacin gentica y explica la diversidad del mensaje gentico de todos
los seres vivos.

J. L. Snchez Guilln Pgina III-2-5


III) La informacin celular 2) cidos nucleicos

ESTRUCTURA SECUNDARIA DEL ADN.

Datos preliminares:

A) A finales de los aos 40 Erwin


CHARGAFF y sus colaboradores estudiaron
los componentes del ADN y emitieron los
siguientes resultados:

La concentracin de bases vara de una


especie a otra. El porcentaje de A, G, C y T
es el mismo en los individuos de la misma
Fig. 16 Doble hlice del ADN.
especie y no por esto el mensaje es el
mismo.

Tejidos diferentes de la misma especie tienen la misma composicin en bases.

La composicin en bases del ADN de una misma especie no vara con la edad del
organismo ni con su estado nutricional ni con las variaciones ambientales.

Las densidades y viscosidades corresponden a la existencia de enlaces de hidrgeno


entre los grupos NH y los grupos CO.

La concentracin de Adenina es igual a la de Timina, y la de Citosina a la de


Guanina. Las dos primeras establecen dos puentes de hidrgeno entre ellas, y las
ltimas tres puentes. La cantidad de purinas es igual a la cantidad de pirimidinas.

B) Por medio del mtodo analtico de difraccin de rayos X, FRANKLIN y WILKINS


observaron una estructura fibrilar de 20 (Amstrongs) de dimetro con repeticiones
cada 3,4 y una mayor cada 34 .

C) WATSON y CRICK postularon en 1953 un modelo tridimensional para la estructura


del ADN que estaba de acuerdo con todos los datos disponibles anteriores: el modelo
de doble hlice. Este modelo, adems de explicar cmo era el ADN, sugera los
mecanismos que explicaban su funcin biolgica y la forma como se replicaba.

Segn el modelo de la doble hlice de


WATSON y CRICK:

11) El ADN estara constituido por dos


cadenas o hebras de polinucletidos enro-
lladas helicoidalmente en sentido dextrgiro
sobre un mismo eje formando una doble
hlice.
21) Ambas cadenas seran antiparalelas, una
ira en sentido 3' 5' y la otra en sentido
inverso, 5' 3'. Fig. 17 Doble hlice del ADN.
31) Los grupos fosfato estaran hacia el

J. L. Snchez Guilln Pgina III-2-6


III) La informacin celular 2) cidos nucleicos

exterior y de este modo sus cargas


negativas interaccionaran con los cationes
A T C G A T C G G G C

presentes en el nucleoplasma dando ms T A G C T A G C C C

T
estabilidad a la molcula.

A
G
primer

C
41) Las bases nitrogenadas estaran hacia el

T
A T C G A T C G G

interior de la hlice con sus planos paralelos T A G C T A G C C

entre s y las bases de cada una de las hli-

C
A
primer

ces estaran apareadas con las de la otra

G
C
A U C G A T C G G G

T
asocindose mediante puentes de hidrgeno.

A
T A G C T A G C C C

51) El apareamiento se realizara nicamente


entre la adenina y la timina, por una parte,
Fig. 18 Replicacin del ADN.
y la guanina Y la citosina, por la otra1 . Por
lo tanto, la estructura primaria de una
cadena estara determinada por la de la otra, ambas cadenas seran complementa-
rias.

La complementariedad de las cadenas sugiere el mecanismo por el cual el ADN se


copia -se replica- para ser trasferido a las clulas hijas. Ambas cadenas o hebras se
pueden separar parcialmente y servir de molde para la sntesis de una nueva cadena
complementaria (sntesis semiconservativa).

PROPIEDADES DE LA ESTRUCTURA SECUNDARIA DEL ADN: DESNATURALIZACIN

Si una disolucin de ADN se calienta


suficientemente ambas cadenas se separan,
pues se rompen los enlaces de hidrgeno
% del par C-G en la muestra

que unen las bases, y el ADN se


desnaturaliza. La temperatura de
desnaturalizacin depende de la proporcin
de bases. A mayor proporcin de C-G,
mayor temperatura de desnaturalizacin,
pues la citosina y la guanina establecen tres
puentes de hidrgeno, mientras que la
adenina y la timina slo dos y, por lo tanto,
a mayor proporcin de C-G, ms puentes de
hidrgeno unirn ambas cadenas. La Temperatura en C

desnaturalizacin se produce tambin


variando el pH o a concentraciones salinas Fig. 19 Temperatura de desnaturalizacin
del ADN en funcin del tanto por ciento de
elevadas. Si se restablecen las condiciones,
citosina-guanina.
el ADN se renaturaliza y ambas cadenas se
unen de nuevo.

ESTRUCTURA TERCIARIA DEL ADN EN LAS CLULAS EUCARIOTAS.

Las grandes molculas de ADN de las clulas eucariotas estn muy empaquetadas o-
cupando as menos espacio en el ncleo celular y adems como mecanismo para
preservar su transcripcin.

Como hemos visto, en las clulas eucariotas el ADN se encuentra en el ncleo

1
El par A-G no puede formarse por ser ambas bases demasiado grandes, y el par C-T por estar a demasiada
distancia.

J. L. Snchez Guilln Pgina III-2-7


III) La informacin celular 2) cidos nucleicos

asociado a ciertas protenas: nucleo-


protenas, formando la cromatina. En la cro- nucleosoma

matina, la doble hlice de ADN se enrolla


alrededor de unas molculas proteicas glo-
bulares, las histonas, formando los nucleoso- ADN
espaciador Histona H1

mas. Cada nucleosoma contiene 8 histonas


y la doble hlice de ADN da dos vueltas a
su alrededor (200 pares de bases). El con- Fig. 20 Fibra nucleosmica en collar de
junto, si no est ms empaquetado an, perlas.
forma una estructura arrosariada llamada
collar de perlas. Ahora bien, los nucleoso-
Histona H1
mas pueden empaquetarse formando fibras
de un grosor de 30 nm (fibra de 30 nm). ADN
Segn el modelo del solenoide las fibras se
forman al enrollarse seis nucleosomas por Ncleo de
vuelta alrededor de un eje formado por las histonas del
nucleosoma

histonas H1.

NIVELES SUPERIORES DE Fig. 21 Nucleosoma.


EMPAQUETAMIENTO

Los siguientes niveles de empaquetamiento


no estn an aclarados del todo pero,
parece ser, que cada fibra se volvera a
enrollar formando un bucle (cada bucle
tendra 50 millones de pares de bases), seis
bucles se empaquetaran asocindose a un
" esqueleto nuclear" producindose un
rosetn, 30 rosetones formaran una espiral
y 20 espirales formaran una cromtida.
Todo ello producira un gran acortamiento
de las largas cadenas de ADN. Fig. 22 Empaquetamiento de los
nucleosomas formando una fibra de 30nm,
En los espermatozoides el ADN se encuen- segn el modelo del solenoide.
tra an mucho ms empaquetado, se dice
que tiene " estructura cristalina".

Los ADN de las bacterias, virus, mitocon-


drias y plastos no presentan estructuras tan
complejas y no estn asociados a histonas,
aunque s estn asociados a otras
protenas.

TIPOS DE ADN

Segn su estructura se distinguen los


siguientes tipos de ADN: Fig. 23 Cromosomas de una clula en
divisin. Cada cromosoma tiene dos
- Monocatenarios o de una cadena; por cromtidas. En los cromosomas el ADN est
ejemplo los de algunos virus. fuertemente empaquetado y asociado a
protenas.
- Bicatenarios, con dos hebras o cadenas
(algunos virus, las bacterias y los
eucariotas).

J. L. Snchez Guilln Pgina III-2-8


III) La informacin celular 2) cidos nucleicos

A su vez, y en ambos casos, el ADN puede ser:

- Lineal, como por ejemplo el del ncleo de las clulas eucariotas y el de algunos
virus.
- Circular, como el de las mitocondrias, cloroplastos, bacterias y algunos virus.

EL ARN (RNA). DIFERENCIAS CON EL ADN

El ARN, cido ribonucleico, es un polirribonucletido que, a diferencia del ADN, no


contiene ni desoxirribosa ni timina, pero s ribosa y uracilo. El ARN no forma dobles
cadenas, salvo en ciertos virus (por ej. los reovirus). Lo que no quita que su estruc-
tura espacial pueda ser en ciertos casos muy compleja.

CLASES DE ARN

Por su estructura y su funcin se distinguen tres clases de ARN:

- El ARNm (ARN mensajero) es un polirri-


bonucletido constituido por una nica
cadena sin ninguna estructura de orden
superior. Su masa molecular suele ser
elevada. Este ARN se sinteti za en el ncleo
celular y pasa al citoplasma transportando la
informacin para la sntesis de prote nas.
La duracin de los ARNm en el citoplasma
celular es de escasos minutos siendo degra-
dados rpidamente por enzimas espec ficas.

- El ARNt (ARN de transferencia) transporta


los aminocidos para la sntesis de
protenas. Est formado por una sola
cadena, aunque en ciertas zonas se encuen-
tra replegada y asociada internamente
mediante puentes de hidrgeno entre bases
complementarias. Su peso molecular es del Fig. 24 ARNt. La lnea es la cadena de
orden de 25.000 da. Est formado por entre polinucletidos y los rectngulos las bases o
70 y 90 nucletidos y constituye el 15 % los pares de bases. 1) brazo aceptor de ami-
nocidos; 2) bucle anticodon.
del total del ARN de la clula. Se sintetiza
en el ncleo y sale hacia el citoplasma para
realizar su funcin. En el ARNt podemos distinguir un brazo aceptor de aminocidos
abierto y un bucle anticodon.

El ARNr (ARN ribosomal) es el ARN de los ribosomas, cuya funcin es poco


conocida.

Los ARN vricos. Algunos virus tienen como material gentico ARN bicatenario.

J. L. Snchez Guilln Pgina III-2-9


III) La informacin celular 2) cidos nucleicos

ESTRUCTURAS TERCIARIA Y SUPERIOR DEL ADN (SUPERENROLLAMIENTO)

Dos cromtidas 2x10


vueltas de espiral

1 vuelta de espiral
(30 rosetones)

1 rosetn (6 bucles)

1 bucle

Fibra de 30 nm

Collar de perlas
(nucleosoma)

ADN

J. L. Snchez Guilln Pgina III-2-10


III) La informacin celular 3) El gen

3) EL ADN COMO PORTADOR DE LA INFORMACIN GENTICA.

)QU ES LA GENTICA MOLECULAR?

Definiremos la Gentica como la parte de la Biologa que se ocupa del estudio de la


herencia biolgica, intentando explicar los mecanismos y circunstancias mediante los
cuales se rige la transmisin de los caracteres de generacin en generacin. La
gentica molecular estudia estos procesos desde un punto de vista qumico.

)CUL ES LA NATURALEZA DEL MATERIAL GENTICO

I) LOS EXPERIMENTOS DE GRIFFITH: La bacteria Diplococcus pneumoniae es un


pneu-mococo, una bacteria causante de enfermedades. Existen dos cepas, la S
(Smooth = lisa), virulenta, y la R (rough = rugosa), no virulenta. Las bacterias S,
vivas, producen la muerte en los ratones, pero no la producen si estn muertas. Las
segundas no son capaces de desarrollar la enfermedad. En 1928 Griffith realiz con
estas bacterias las siguientes experiencias:

Experiencia 1: Al inyec- Experiencia 2: La Experiencia 4: Al inyec-


Experiencia 3: Al inyec-
tar en ratones (2) bac- inyeccin (2) de tar a los ratones (2)
tar bacterias S viru-
terias del tipo S (viru- bacterias R no una mezcla de bacte-
lentas muertas, por
lentas) (1) se produce virulentas (1) no tena rias no virulentas R y
tratamiento con calor
la muerte de los ani- efectos sobre los S, virulentas, muertas
(2), los ratones no
males por neumona animales (3). Un por calor (1), los
desarrollaban la enfer-
(3). Un cultivo poste- cultivo de tejidos del ratones desarrollan la
medad (3). Un culti vo
rior (4) detectaba la animal despus de la enfermedad y mueren
de tejidos del animal
presencia de bacterias inyeccin no detectaba (3). En los cultivos se
no detectaba bacterias
S en el animal muerto. la presencia de bac- observan bacterias de
(4).
terias de ninguna de tipo S y R (4).
las cepas (4).

J. L. Snchez Guilln Pgina III-3-1


III) La informacin celular 3) El gen

II) LOS EXPERIMENTOS DE AVERY y


colaboradores.: En 1944. AVERY, MCLEOD
y MCCARTY, se propusieron encontrar cul
era el componente que transmita el
carcter heredable y llegaron a la conclusin
de que era el ADN de las bacterias S
muertas por el calor el que transformaba las
bacterias R en S. Demostraron as que el
ADN era la molcula que contena la
informacin necesaria para que las bacterias
S fueran virulentas y que, a pesar de estar
muertas, su ADN no estaba destruido y
poda pasar al medio y de aqu a las
bacterias de cepa R, integrndose en el Fig. 1 Oswald Avery (1877 1955).
genoma de stas y transformndolas en
virulentas.

CONCEPTO CLSICO Y MOLECULAR DE


LOS GENES

Para Mendel (1822-1884) los genes eran


considerados como factores hereditarios que
determinaban las caracters ticas externas de
los seres vivos. En su poca se ignoraba su
composicin qu mica o su localizacin. Para
poder referirse a ellos fueron denominados
mediante letras. As, en los guisantes, el Fig. 2 Imagen de un cromosoma. Al lado,
gen A determina que las semillas sean de esquema del cromosoma nmero 9 humano
color amarillo y el gen a hace que sean mostrando la posicin aproximada del gen
que determina los grupos sanguneos ABO.
verdes. Pero nadie saba qu era lo que
haca que los guisantes fueran verdes o
amarillos ni cmo lo haca. Esto es, no se
saba la naturaleza de los factores heredi-
tarios ni cul era su mecanismo de actua-
cin.

En 1901 los estudios de GARROD sobre la


alcaptonuria permitieron empezar a conocer
cmo actuaban los genes y las experiencias
de GRIFFITH (en 1928) y AVERY (en 1943),
que ya hemos estudiado, descubrieron que
los genes estaban localizados en el ADN.

III) LOS ESTUDIOS DE GARROD: La


alcaptonuria es una enfermedad hereditaria
recesiva debida a una alteracin en el meta-
bolismo celular que determina la aparicin Fig. 3 A. E. Garrod
del cido homogent sico. Este cido provoca
al oxidarse el ennegrecimiento de la orina y

J. L. Snchez Guilln Pgina III-3-2


III) La informacin celular 3) El gen

un color grisceo en los cartla gos y


ligamentos, tambin puede llegar a producir
artritis.

El cido homogentsico aparece en el


metabolismo del aminocido fenilalanina. Por
la accin de diversas enzimas la fenilalanina
se transforma en tirosina, otro aminocido,
despus, en cido polihidroxifenilpirvico y,
finalmente, en cido homogentsico.
Fig. 4 cido homogentsico.

Fenilalanina Tirosina cido polihidroxife-


nilpirvico cido Homogentsico

En las personas sanas el cido homogent -


3 ADN 5
sico es transformado por la enzima homo-
gentsi co-oxidasa en el cido 4-maleil-ace- T A C G T T A C G A A T G C T T A A A T C

toactico que, posteriormente, se transfor- HMet Gln Cys Leu Arg - Ile-OH

mar en acetil-CoA, que ser degradada en pptido

el Ciclo de Krebs a CO2 y H2 O.


Fig. 5 Colinealidad entre un fragmento de
ADN y un pptido.
GARROD lleg a la conclusin de que el
gen normal (A) produce la enzima necesaria,
mientras que el gen (a) recesivo no la EL DOGMA CENTRAL DE
produce. sta era la primera vez que se LA BIOLOGA
MOLECULAR
relacionaba un gen con una enzima y, por
tanto, con una reaccin.
ADN
De aqu surgi la hiptesis: un gen-una
enzima. Ahora bien, debido a que hay
enzimas formadas por dos o ms cadenas
ARN
polipept dicas, la hiptesis se reformul
como: un gen-un polipeptido.

Polipptido

HIPTESIS DE LA COLINEALIDAD DE CRICK

Una vez establecido el paralelismo entre Carcter


genes y enzimas y tras ser propuesto, en
1.953, el modelo de doble hlice por Watson
y Crick, este ltimo propuso la denominada Fig. 6 Dogma central de la biologa
Hiptesis de colinealidad de CRICK: molecular.

" Existe una correspondencia entre la secuencia de nucletidos del gen y la


secuencia de aminocidos de la enzima codificada".

J. L. Snchez Guilln Pgina III-3-3


III) La informacin celular 4) Sint. protenas

4) TRASCRIPCIN Y TRADUCCIN DE LA INFORMACIN GENTICA

CONCEPTO MOLECULAR DEL GEN. ESTRUCTURA DE LOS GENES EN EUCARIOTAS

Concepto molecular de gen: La mayora de los genes son fragmentos de la molcula


de ADN que determinan la sntesis de una protena, otros realizan funciones
reguladoras.

Estructura de los genes en eucariotas: La estructura de los genes en eucariotas es


compleja. La secuencia de nucletidos que constituye un gen, y los propios genes
entre s, no se disponen linealmente en los cromosomas sino espaciados por
fragmentos de ADN que no poseen informacin que pueda ser transcrita. En todo
gen, adems, distinguiremos las siguientes regiones:

- La regin promotora o promotor (P)


- La regin codificadora (C)
- La regin terminadora o terminador (T)

C Molcula de ADN
P T

Gen 1
Gen 2
P T
P T C
C

Gen 3

Regin codificadora

Promotor E1 I1 E2 I2 E3 Terminador

ATG TAG
TAC ATC

Estructura del Gen 2

Fig. 1 Estructura de un gen. P) regin promotora; C) regin codificadora; T) regin terminadora; E)


exones; I) intrones.

a)La regin promotora es una porcin del ADN situada al principio del gen y que, sin
codificar ningn aminocido, sirve para que las enzimas que realizan la
transcripcin reconozcan el principio del gen.

b)La regin codificadora es la parte del gen que contiene la informacin para la
sntesis de la protena. En la regin codificadora van a existir fragmentos de
ADN que no contienen informacin: los intrones, y fragmentos que s que
contienen informacin: los exones. Considerando la hebra 5'-> 3 ', el principio
de esta regin viene marcado por la secuencia de bases nitrogenadas ATG y
el final por una de estas tres tripletas: TAA, TAG, TGA; tripletas que se

J. L. Snchez Guilln Pgina III-4-1


III) La informacin celular 4) Sint. protenas

denominan de paro, sin sentido o secuencias stop.

c)La regin terminadora. Marca el final del gen.

TRANSCRIPCIN DE LA INFORMACIN DEL ADN


1 2
El ADN se encuentra en el ncleo celular y
la sntesis de protenas tiene lugar en el 3
ncleo

citoplasma, en el hialoplasma concretamente. 4 AAAAAAAAAAAAA

Es por esto que la informacin contenida en 5 AAAAAAAAAAAAA

la estructura primaria del ADN debe


Citoplasma
transcribirse a una molcula de ARN deno-
AAAAAAAAAAAAA

minada ARN mensajero (ARNm). Tambin se 6


7
sintetizan en el ncleo el ARNr y el ARNt ,
necesarios para la sntesis proteica. Fig. 2 Transcripcin y traduccin de un
gen en eucariotas. 1) ADN; 2) ARN
Los procesos de sntesis de ARN a partir polimerasa; 3) ARNmp ; 4) ARNm ; 5) ARNm
maduro; 6) Protena; 7) Ribosoma.
del ADN constituyen la transcripcin de la
informacin gentica.

MECANISMO DE LA TRANSCRIPCIN EN EUCARIOTAS

Destaquemos, en primer lugar, que para cada gen, slo una de las cadenas, de las
dos que posee el ADN, se transcribe. El mecanismo se realiza de la siguiente manera:

ARN mensajero ARN polimerasa

A U G C ADN
C G
G
Direccin de la trascripcin
5 A
U
C
C
G T C C A G T G C T T
A A A G A
U C A G G U C A C G A A
A U

U U

A
G
A C

Nucletidos trifosfato

Fig. 3 Trascripcin del ADN (sntesis de ARNm).

1. Iniciacin: Una ARN-polimerasa comienza la sntesis del precursor del ARN a


partir de unas seales de iniciacin "secuencias de consenso " que se encuentran en
el ADN

2. Alargamiento: La sntesis de la cadena contina en direccin 5' 3'. Despus de 30


nucletidos se le aade al ARN una cabeza (caperuza o lder) de metil-GTP en el

J. L. Snchez Guilln Pgina III-4-2


III) La informacin celular 4) Sint. protenas

extremo 5'. Esta cabeza parece tener una


funcin protectora para que las enzimas
ARNpolimerasa

exonucleasas que destruyen los ARN no lo


ataquen. Una vez que esto ha ocurrido, T A C G A A C C G T T G C A C A T C

A U G C U U G G C A A C G U G
contina la sntesis del ARN en direccin 5
3

3. Finalizacin: Una vez que la enzima (ARN m-GTP

polimerasa) llega a la regin terminadora del


Fig. 4 Alargamiento.
gen, finaliza la snte sis del ARN. Entonces,
una poliA-polimerasa aade una serie de
nucletidos con adenina, la cola poliA, y el
ARN, llamado ahora ARNm precursor, se
poliA-polimerasa
libera.

4. Maduracin: El ARNm precursor contiene m-GTP A U G C U C G U G U A G A A A A A

tanto exones como intrones. Se trata, por lo


tanto, de un ARNm no apto para que la ARNm precursor

informacin que contiene sea traducida y se


sintetice la correspondiente molcula proteica. Fig. 5 Adicin de la cola de poli A.
En el proceso de maduracin un sistema
enzimtico reconoce, corta y retira los
intrones y las ARN-ligasas unen los exones,
formndose el ARNm maduro.

Regin codificadora del gen

ADN
Promotor E1 I1 E2 I2 E3 Terminador

ATC TAG

Cabeza E1 I1 E2 I2 E3 cola
ARNm AAAAAA
precursor AUG UAG

Cabeza cola
ARNm
maduro AAAAAA
AUG UAG

Fig. 6 Mecanismo de maduracin del ARNm.

Todo esto se ha producido en el ncleo celular. El ARNm maduro, que a partir de


ahora ser simplemente el ARNm o, tambin, el transcrito, pasar al hialoplasma donde
su informacin servir para la sntesis de una protena concreta. Esto es, la informa-
cin que se encuentra en forma de una cadena de nucletidos se traducir a una
cadena de aminocidos.

J. L. Snchez Guilln Pgina III-4-3


III) La informacin celular 4) Sint. protenas

LA TRANSCRIPCIN EN PROCARIOTAS: 1

DIFERENCIAS CON EUCARIOTAS


b
3
a 2

10) En los procariotas el ARNm no tiene ni 4

caperuza ni cola. c

20) Tampoco tiene intrones y por lo tanto no 5

requiere de un mecanismo de maduracin. d

30) Al mismo tiempo que el ARNm se


transcribe se est ya traduciendo. Fig. 7 Transcripcin y traduccin en
40) Los genes son policistrnicos, esto es, procariotas. 1) ADN; 2) ARNm; 3) Sub. menor
del ribosoma; 4) sub. mayor; 5) protena. a)
un ARNm contienen informacin para varias
Extremo 5'; b) extremo 3'; c) extremo
protenas. carboxilo; d) extremo amino (P.A.U. junio del
99).

EL CDIGO GENTICO AAAAAA


AUG CAA UGC UUA CGA AUU UAG

El ARNm tiene una estructura primaria 1 2 3 4 5 6 stop

complementaria de una de las cadenas del


H Met Gln Cys Leu Arg Ile - OH
ADN. Esta disposicin de las bases nitroge-
nadas en el ARNm es la que codifica la
Fig. 8 Ejemplo de codificacin de un
secuencia de aminocidos de la protena. pptido de seis aminocidos.

CRICK demostr que los aminocidos en las protenas van a estar codificados por
secuencias de tres bases nitrogenadas consecutivas de las cadenas de ARNm, a partir
de la secuencia de iniciacin AUG, complementaria de la secuencia de iniciacin TAC
del ADN. Cada una de estas secuencias de tres bases se llaman tripletas o codo-
nes. Debe de tenerse en cuenta que, al haber en las protenas 20 aminocidos
distintos, una o dos bases no seran suficientes para codificarlos. Al tener los cidos
nucleicos cuatro bases diferentes (la adenina, la guanina, la citosina y el uracilo), que
representaremos por A, G, C y U respectivamente, existirn 64 codones o
combinaciones de tres bases y como solamente hay 20 aminocidos distintos, se
deduce, que varias tripletas codificarn un mismo aminocido.

Este cdigo, que relaciona la secuencia de bases del ARN con la secuencia de
aminocidos en las protenas, recibe el nombre de cdigo gentico.

CARACTERSTICAS DEL CDIGO GENTICO

10 El cdigo gentico es universal. Todos los seres vivos lo emplean; con ciertas
excepciones, por ejemplo, el de las mitocondrias, que tiene algunas diferencias.
20 Se trata de un cdigo degenerado pues el nmero de tripletas (64) es superior al
de aminocidos existentes en las prote nas (20).
30 Existen tres tripletas que no codifican ningn aminocido, son las tripletas " sin
sentido", de " paro" o " stop". Estas tripletas marcan el final de la regin a
traducir, esto es, el final de la molcula proteica.
40 La secuencia AUG codifica el principio de la regin que se va a traducir y al
mismo tiempo sirve para codificar al aminocido metionina. Por lo tanto, todas
las protenas comienzan por la metionina. Ahora bien, posteriormente, esta
metionina que ocupa la posicin inicial puede ser eliminada.

J. L. Snchez Guilln Pgina III-4-4


III) La informacin celular 4) Sint. protenas

EL CDIGO GENTICO

Segunda base
U C A G
P Phe UUU Ser UCU Tyr UAU Cys UGU U T
r U Phe UUC Ser UCC Tyr UAC Cys UGC C e
i Leu UUA Ser UCA Stop UAA Stop UGA A r
m Leu UUG Ser UCG Stop UAG Trp UGG G c
e Leu CUU Pro CCU His CAU Arg CGU U e
r C Leu CUC Pro CCC His CAC Arg CGC C r
a Leu CUA Pro CCA Gln CAA Arg CGA A a
Leu CUG Pro CCG Gln CAG Arg CGG G
b Ile AUU Thr ACU Asn AAU Ser AGU U b
a A Ile AUC Thr ACC Asn AAC Ser AGC C a
s Ile AUA Thr ACA Lys AAA Arg AGA A s
e Met AUG Thr ACG Lys AAG Arg AGG G e
Val GUU Ala GCU Asp GAU Gly GGU U
G Val GUC Ala GCC Asp GAC Gly GGC C
Val GUA Ala GCA Glu GAA Gly GGA A
Val GUG Ala GCG Glu GAG Gly GGG G

EL CDIGO GENTICO (orden alfabtico)

AMINOCIDO TRIPLETA O CODN


Alanina (Ala) GCU, GCC, GCA, GCG
Arginina (Arg) CGU, CGC, CGA, CGG, AGA, AGG
Asparragina (Asn) AAU, AAC
cido asprtico (Asp) GAU, GAC
Cistena (Cys) UGU, UGC
cido glutmico (Glu) GAA, GAC
Glutamina (Gln) CAA, CAG
Glicocola (Gly) GGU, GGC, GGA, GGG
Histidina (His) CAU, CAC
Isoleucina (Ile) AUU, AUC, AUA,
Leucina (Leu UUA, UUG, CUU, CUC, CUA, CUG
Lisina (Lys) AAA, AAG
Metionina (Met) AUG
Fenilalanina (Phe) UUU, UUC
Prolina (Pro) CCU, CCC, CCA, CCG
Serina (Ser) UCU, UCC, UCA, UCG, AGU, AGC
Treonina (Thr) ACU, ACC, ACA, ACG
Triptfano (Trp) UGG
Tirosina (Tyr) UAU, UAC
Valina (Val) GUU, GUC, GUA, GUG

Sin sentido (Stop) UAA, UAG, UGA

J. L. Snchez Guilln Pgina III-4-5


III) La informacin celular 4) Sint. protenas

MECANISMO DE LA TRADUCCIN DE LA
INFORMACIN GENTICA.

Consiste en la sntesis de una protena a Aminocido

partir de la informacin contenida en el


UAC
ARNm. Se trata de un proceso que se
ARNt
produce en el hialoplasma. Consta de las
siguientes fases:

M
10) Activacin de los aminocidos: La Bucle del et
anticodn
formacin del enlace peptdico es un
proceso endergnico. Para que pueda Fig. 9 ARN de transferencia unido a un
realizarse, los aminocidos (aa) deben de ser aminocido tipo. Ver la posicin que ocupa el
activados, activacin que se realiza por anticodn.
medio del GTP segn la siguiente ecuacin:

COOH

aa + GTP aa-GMP + PPi


H2N C CH2

Los aminocidos activados se unen a una


molcula de ARNt (ARN de transferencia). Anticodn

Estos polinucletidos poseen en su Codn

estructura una secuencia de tres bases, el


anticodn, complementaria de los
correspondientes codones o tripletas del Fig. 10 Iniciacin de la traduccin:
ARNm. Cada aminocido se une, por lo Acoplamiento entre la enzima, el ARNt de un
aminocido, la fenilalanina, por ejemplo, y el
tanto, a un ARNt especfico, que ser aquel
aminocido.
que lleve el anticodn correspondiente.
Subunidad menor del ribosoma

20) Iniciacin: La subunidad pequea del 5


P A
AAAAAAAAAAA 3

ribosoma se une a la regin lder del ARNm AUG CAA UGC UUA CGA UAG

UAC
y el ARNm se desplaza hasta que al llegar al
Codn

codn AUG, que codifica el principio de la Anticodn


ARNt ARNm

protena. Se les une el complejo formado


por el ARNt -metionina. La unin se produce M
et

entre el codn del ARNm y el anticodn del 1er aminocido

ARNt que transporta el aminocido. Por


Fig. 11 Traduccin: Iniciacin.
ltimo, se une la subunidad mayor a la
menor completndose el ribosoma.
Subunidad menor del ribosoma

P A
30) Elongacin. Consta de los siguientes 5 AAAAAAAAAAA 3

AUG CAA UGC UUA CGA UAG


pasos: UAC GUU

a) El complejo ARNt -aminocido 2 (ARNt -aa2 )


se sita enfrente del codn correspon- M Gl
et n
diente. La regin del ribosoma en la
que se une se le llama regin
Fig. 12 Traduccin: Elongacin 1.
aminoacil (A).

J. L. Snchez Guilln Pgina III-4-6


III) La informacin celular 4) Sint. protenas

b) Se forma el enlace peptdico y la


metionina se une al segundo ami- P A ARNm
AAAAAAAAAAA 3
nocido (aa2 ).
5
AUG CAAUGC UUA CGA UAG
UAC GUU

c) El ARNm se traslada como la cinta de una


mquina de escribir y el complejo
ARNt2 -aa2 -met queda situado en la Gl
n-
M
regin peptidil del ribosoma y la et

posicin aminoacil queda libre para la


Fig. 13 Traduccin: Elongacin 2.
entrada del complejo ARNt -aa3 . El
ARNt de la metionina se libera.
P A ARNm

De esta manera se van a ir aadiendo el 5


AUG CAA UGC UUA CGA UAG
AAAAAAAAAAA 3

resto de los aminocidos que constituyen la GUU

C
protena hasta llegar al codn de finaliza- UA

cin.
Gl
n-
M
40) Finalizacin: Cuando el ribosoma llega al et

codn de finalizacin, uno de los codones


Fig. 14 Traduccin: Elongacin 3.
sin sentido: UAA, UAG, UGA, la protena
se libera y las subunidades del ribosoma se
disocian y se separan del ARNm.
ARNm P A
5 AAAAAAAAAAA

AUG CAA UGC UUA CGA UAG


La estructura terciaria y cuaternaria de las GCU

protenas se va adquiriendo segn estas se AA


U

van sintetizando

Es de destacar, que varios ribosomas, de 4 Arg-Leu-Cys-Gln-Met

a 6, a veces incluso 100, pueden estar


Fig. 15 Traduccin: Finalizacin.
traduciendo al mismo tiempo una cadena de
ARNm. La funcin de los ribosomas no se
conoce con exactitud, pero, podra ser, la
de recibir las instrucciones genticas y
traducirlas a prote nas. Para ello es necesa-
rio que se unan al ARNm, procesen la infor-
macin, incorporen los aminocidos y los ribosoma

unan entre s mediante enlaces peptdicos.

pptido

Fig. 16 Actuacin de varios ribosomas


sobre un mismo ARNm.

J. L. Snchez Guilln Pgina III-4-7


III) La informacin celular 4) Sint. protenas

TRADUCCIN DE LA INFORMACIN GENTICA

1-Iniciacin Subunidad menor del ribosoma

P A
5 AAAAAAAAAAA 3

Unin del ARNt que transporta la AUG CAA UGC UUA CGA UAG

metionina. La unin se produce UAC Codn

entre el codn del ARNm y el antico- Anticodn


ARNt ARNm

dn del ARNt .

M
et
1er aminocido

2-Elongacin
Subunidad menor del ribosoma

P A
5 AAAAAAAAAAA 3

Unin del complejo ARNt -Gln (Gluta- AUG CAA UGC UUA CGA UAG
UAC GUU
mina) a la regin aminoacil (A) del
ribosoma.

M Gl
et n

Formacin del enlace peptdico 5


P A ARNm
AAAAAAAAAAA 3

AUG CAA UGC UUA CGA UAG


entre el grupo carboxilo de la me- GUU

tionina (Met) y el grupo amino del UA


C

segundo aminocido: la glutamina


(Gln). El ARNt de la metionina se
Gl
n-
libera. M
et

El ARNm se traslada hacia el codn


P A ARNm
AAAAAAAAAAA 3
siguiente, el 31. El complejo ARNt - 5
AUG CAA UGC UUA CGA UAG
Gln-Met queda situado en la regin GUU ACG

peptidil (P) del ribosoma y la posi-


cin aminoacil (A) queda libre,
entrando el complejo ARNt -Cys del Gl Cy
n- s
M
et
siguiente aminocido (cistena).

J. L. Snchez Guilln Pgina III-4-8


III) La informacin celular 4) Sint. protenas

(continuacin)

Formacin del enlace peptdico P A ARNm


5 AAAAAAAAAAA 3
entre el grupo carboxilo del dipptido AUG CAA UGC UUA CGA UAG
ACG
(Met-Gln) y el grupo amino de la U
GU
cistena (Cys). Liberacin del ARNt
de la glutamina.
Cy
s-
Gl
n-
M
et

Desplazamiento del ARNm a la si- P A ARNm


5 AAAAAAAAAAA 3

guiente posicin y entrada del com- AUG CAA UGC UUA CGA UAG
ACG
plejo ARNt -Leu, correspondiente al AAU

cuarto aminocido: leucina.

Cy
El proceso contina as hasta llegar s-
Gl
n-
M Leu
et
al codn de finalizacin (UAG).

3-Finalizacin
ARNm P A
5 AAAAAAAAAAA 3

AUG CAA UGC UUA CGA UAG


GCU
El ribosoma llega al codn de finali-
U
AA
zacin, uno de los codones sin
sentido. El pptido se encuentra ya
totalmente sintetizado. Arg-Leu-Cys-Gln-Met

Subunidad menor
La cadena polipeptdica se libera y
las subunidades del ribosoma se
disocian y se separan del ARNm. 5
ARNm
AAAAAAAAAAA 3

AUG CAA UGC UUA CGA UAG

Subunidad mayor del


ribosoma
Arg-Leu-Cys-Gln-Met
(pptido sintetizado)

J. L. Snchez Guilln Pgina III-4-9


III) La informacin celular 4) Sint. protenas

REGULACIN DE LA ACCIN DE LOS GENES: HIPTESIS DEL OPERN

Todas las clulas de un organismo pluricelular, excepto los gametos, poseen la misma
informacin gentica. Ahora bien, no todos los genes se encuentran activos durante el ciclo
celular. Muchos genes no actan nunca y otros actan slo en determinados momentos, pu-
diendo permanecer durante largos periodos de tiempo inactivos. Para poder comprender el
mecanismo de accin de los genes veamos a continuacin estos dos modelos de regulacin:

I) Regulacin de la actuacin del opern LAC en la bacteria Escherichia coli

La -galactosidasa es una enzima que


rompe el enlace O-glicosdico entre la Opern LAC

galactosa y la glucosa en la lactosa. Si


Regulador
no hay lactosa en el medio, E. coli ape- Operador Gen x Gen y Gen a

nas dispone de unas pocas molculas de


enzima, una o dos solamente. Sin ARNm

embargo, si aadimos lactosa al medio Si no hay lactosa los


Genes no se transcriben
donde se encuentra la bacteria, al cabo
de unos pocos minutos los niveles de -
galactosidasa suben hasta alcanzar las
5000 molculas por clula,
aproximadamente. Aparecen adems
Represor activo
otras dos enzimas: una permeasa que
facilita la absorcin de la lactosa a Fig. 17 Regulacin del opern LAC en E. coli. Si
travs de la membrana plasmtica de la no hay lactosa el represor est activo, se une al
clula y una transacetilasa, necesaria operador, y los genes estructurales no se transcriben.

tambin para el metabolismo de la


lactosa.

Jacob y Monod interpretaron estos


resultados planteando la hiptesis del Opern LAC

Regulador
opern. Segn esta hiptesis la Operador Gen x Gen y Gen a
actividad de varios genes que codifican
ARNm
enzimas relacionadas entre s, genes
Transcripcin
estructurales, sera desencadenada por
la accin de un gen operador , contiguo
a los genes estructu rales en la molcula Represor
Traduccin
de ADN. El conjunto formado por los
genes estructu rales y el gen operador
recibe el nombre de opern. Si el gen Represor
inactivo
operador se encuentra libre, los genes
Lactosa
estructu rales se transcriben. A su vez, Enzimas para
metabolizar la lactosa
el gen operador estara controlado por
un gen regulador, que puede estar Fig. 18 Regulacin del opern LAC en E. coli. Si
situado lejos del opern. Este gen va a hay lactosa, sta se une al represor, lo inactiva, y los
sintetizar un ARNm que servir para la genes estructurales se transcriben, sintetizndose las
enzimas que metabolizan la lactosa.
sntesis de una protena: el represor. Si
el represor se encuentra activo se unir
al gen operador inhibindolo, con lo que

J. L. Snchez Guilln Pgina III-4-10


III) La informacin celular 4) Sint. protenas

los genes estructurales no se transcribirn.

El opern LAC en E. coli constara de tres genes estructurales que codificaran respectiva-
mente: la -galactosidasa (gen z), la permeasa (gen y) y la transacetilasa (gen a). Si no hay
lactosa en el medio, el gen regulador se Opern reprimible

traducira en una protena, el represor,


Regulador
con dos centros activos. Por uno de Operador Gen a Gen b Gen c

ellos sera capaz de unirse al gen


ARNm
operador inhibiendo la sntesis de los
ARNm codificados por los genes
enzimas
estructurales z, y, a. Por el otro centro Represor
inactivo

activo podra unirse a la lactosa cuando


la hubiese. La lactosa cambiara la Va metablica del triptfano

estructura del represor inactivndolo e


impidiendo que ste pudiese unirse al
gen operador. De esta manera los genes triptfano

estructurales se transcribiran
producindose la sntesis de las tres
enzimas que metabolizan la lactosa en Fig. 19 Opern reprimible: El regulador sintetiza
un represor inactivo que no se puede unir al operador.
E. coli. Los genes estructurales se trascriben y se traducen,
sintetizndose las enzimas necesarias para la sntesis de
la sustacia A: triptfano, en este caso.
II) Los operones reprimibles.

Como es el caso de la regulacin de Opern reprimible

los genes responsables de los procesos


Regulador
Operador Gen a Gen b Gen c

de sntesis. Supongamos que la clula Los genes no se trascriben


ARNm
necesita producir una determinada
cantidad de una sustancia A y que no
interesa que haya un exceso de A ni Represor
inactivo
que sta falte. Supongamos tambin que
para sintetizar A se necesitan tres cuando ya hay suficiente triptfano

enzimas: a, b y c. En estos casos, la Represor


activo

protena que acta como represor del triptfano

gen operador se encuentra normalmante


en estado inactivo, permitiendo que los
Fig. 20 Opern reprimible: Cuando ya hay un
genes a, b y c se transcriban y que A exceso de triptfano, ste se une al represor y lo activa.
se sintetice. Cuando A alcanza unos El represor activo se une al operador y los genes a, b
niveles elevados, se une al represor, y c no se transcriben.
activndolo. El represor activo se une
al operador y los genes estructurales a,
b y c no se transcriben. Esto hace descender la cantidad de A, con lo que el represor vuelve
a estar inactivo, los genes estructurales vuelven a traducirse y vuelve a sintetizarse A. De
esta manera la clula mantiene unas determinadas cantidades de A.

Como se ve, se trata de un mecanismo que funciona como un termostato, manteniendo


unos niveles adecuados de una determinada sustancia, en este caso A, necesaria para la
clula.

J. L. Snchez Guilln Pgina III-4-11


III) La informacin celular 5) Replicacin del ADN

5) LA REPLICACIN DEL ADN

)CMO ES EL PROCESO DE REPLICACIN DEL ADN?

El ADN es una molcula formada por dos


hebras complementarias y antiparalelas. Una
de las primeras dudas que se plantearon fue Replicacin

la de cmo se replicaba el ADN. A este


respecto haba dos hiptesis:
ADN original ADN original ADN copia
10) El ADN se replica de manera conserva-
tiva. Esto es, cada hebra de ADN forma una Fig. 1 Replicacin conservativa.
copia y una clula hija recibe la molcula
original y la otra clula recibe la copia.
20) El ADN se replica de manera semiconser-
vativa. Cada hebra de ADN forma una hebra Replicacin

complementaria y cada clula hija recibe una


molcula de ADN que consta de una hebra
original y de su complementaria sintetizada
de nuevo. ADN original ADN copia
y original
ADN original
y copia

Esta controversia fue resuelta por Fig. 2 Replicacin semiconservativa.


MESELSON y STAHL con una serie de
elegantes experiencias.

EXPERIENCIAS DE MESELSON Y STAHL.

3
3

2 2

1
1

15 N- 15N

15 N- 15N 14 N- 14N

Se cultivan bacterias E. coli en un medio con 15


N (nitrgeno A continuacin, se cultivan las bacterias en nitrgeno 14 (14N)
pesado) durante cierto tiempo para que todo el ADN est ms ligero durante 30 minutos, lo que dura un ciclo de replica-
formado por dos hebras de 15
N (15 N-15 N) ms pesadas. Si se cin. Si la hiptesis de la sntesis conservativa fuese la co-
centrifu ga, este ADN ms pesado migra hacia el fondo del tubo rrecta, se debera obtener lo que se ve en la figura, una banda
y se obtiene el resultado que se observa en la figura. de ADN pesado (15 N-15 N) y otra con ADN ligero (14 N-14 N) pero...

3 3

2 2

1 1

14N -15N 15N -14N 14N -15N


14N- 14N 14N- 14N 15N -14N

.. lo que se obtiene en realidad es lo que se observa en la Adems, si se da otro ciclo de replicacin en 14


N, se obtiene
figura: una sola banda en posicin intermedia, pues est una banda de ADN mixto ( N- N) y otra de ADN (14 N-14 N), lo
14 15

formada por ADN mixto (15 N-14 N). Esto es, todas las clulas hijas que tambin est de acuerdo con la hiptesis de la sntesis
tienen un ADN con una hebra con 15
N y otra con 14
N. La semiconservativa.
hiptesis de la sntesis semiconservativa es la correcta.

J. L. Snchez Guilln Pgina III-5-1


III) La informacin celular 5) Replicacin del ADN

LA REPLICACIN SEMICONSERVATIVA DEL


ADN EN EUCARIOTAS

Cuando una clula se divide, o cuando se


originan los gametos, las nuevas clulas que Cromosoma: arriba, en procariotas, abajo, en eucariotas.

se forman deben contener la informacin


gentica que les permita sintetizar todas las
enzimas y el resto de las prote nas
necesarias para realizar sus funciones vitales.
sta es la principal razn por la que el ADN
debe replicarse. Fig. 3 Replicacin del ADN en procariotas
y en eucariotas. En procariotas slo hay un
ojo de replicacin, mientras que en eucariotas
La replicacin del ADN es el proceso segn hay varios.
el cual una molcula de ADN de doble hlice
da lugar a otras dos molculas de ADN con
la misma secuencia de bases.

En la clula procaritica la replicacin parte


de un nico punto y progresa en ambas
direcciones hasta completarse. En la clula
eucaritica el proceso de replicacin del Fig. 4 Microfotografa al MET de un
ADN no empieza por los extremos de la fragmento de la doble hlice de un cromosoma
de eucariota replicndose.
molcula sino que parte de varios puntos a
la vez y progresa en ambas direcciones
formando los llamados ojos de replicacin.
Primero se separan las dos hebras y, una Ojos de replicacin

vez separadas, van entrando los


nucletidostrifosfato complementarios de
cada uno de los de las hebras originales del Cromosoma
(doble hlice de ADN)
ADN. Las enzimas ADN polimerasas los replisomas

unen entre s formando una hebra de ADN


complementaria de cada una de las hebras Fig. 5 Cromosoma de eucariota
replicndose. El replisoma es un complejo
del ADN original. Se dice que la sntesis de formado por todas las enzimas que intervienen
ADN es semiconservativa porque cada una en el proceso de replicacin.
de las molculas de ADN " hijas" est forma-
da por una hebra de ADN original y otra
complementaria sintetizada de nuevo. Hebra de ADN
A
C ATP asa
T

Es de destacar que la direccin en la que Helicasa

progresa la replicacin es la misma en


ambas hebras. Ahora bien, las enzimas que
unen los nucletidos slo pueden efectuar la
unin en direccin 5' 3'. Esto nos indica
que ambas hebras, al ser antiparalelas, A Protenas
Topoisomerasa

deben de sintetizarse de diferente manera. G estabilizadoras


T ADN polimerasas

a) Sntesis continua de la hebra en direccin Fig. 6 Enzimas y otras protenas que


5' 3'. La sntesis de esta hebra no plantea forman el replisoma. Se muestra en este
ningn problema. As, una vez separadas esquema un detalle del recuadro de la figura
anterior.
ambas hebras, la ADN pol. III (una de las

J. L. Snchez Guilln Pgina III-5-2


III) La informacin celular 5) Replicacin del ADN

enzimas que unen los nucletidos) va a


elongar la cadena en direccin 5' 3' a partir
de un primer o fragmento de ARN que
despus ser eliminado. A

U
T

A
C

G
G

C
A

T
A

T
C

G
C

G
G

C
T

A
T

A
G

C
C
G
A
T
C
G
C G T T G C A C

b) Sntesis discontinua. La hebra comple-


mentaria no se va a replicar en sentido
3' 5' sino que se replica discontinuamente Fig. 7 Sntesis continua.
en direccin 5' 3'. Los diferentes fragmen-
tos sintetizados, llamados fragmentos de
Okazaki, son posteriormente unidos entre s.

El proceso es complejo y consiste en lo si-


guiente: En primer lugar se sintetiza un pe-
queo fragmento de ARN, fragmento deno-
minado primer. Partiendo de este primer se A T C G A A C C G T T G C A C C G T T G C

sintetiza un fragmento de ADN en direccin T A G C T U G G C C G T G G C A A

5' 3'. Al llegar al primer del fragmento 1er fragmento sintetizado 2 fragmento sintetizado

A A
anteriormente sintetizado, ste es degradado
y se rellena el hueco con ADN. Se dice que
Fig. 8 Sntesis discontinua.
la replicacin es discontinua porque el ADN
se va a ir sintetizando en fragmentos que,
posteriormente, son soldados uno al otro.

A T C G A T C G G G C

T A G C T A G C C C G

A T C G A T C G G
T A G C T A G C C

A U C G A T C G G G

T A G C T A G C C C

Fig. 9 Replicacin del ADN. Acontecimientos que se dan en un replisoma.

J. L. Snchez Guilln Pgina III-5-3


III) La informacin celular 6) Ciclo celular. Mitosis.

6) EL CICLO CELULAR. LA MITOSIS

se
La vida de una clula consta de dos etapas P
ro
fa

fas
e
Meta

diferentes: interfase y divisin Anafase

Telofase

La interfase es una etapa muy larga en la


cual tiene lugar el crecimiento de la clula y
Interfase Divisin

el desarrollo de las actividades metablicas


normales. La divisin es una etapa corta. El Fig. 1 El ciclo celular (P.A.U. de junio de
1995).
conjunto de ambas componen el ciclo celu-
lar.

PERIODOS DE LA INTERFASE

La interfase es de gran importancia para la


Ciclo celular
clula. No es un momento de reposo, pues
en ella tiene lugar una gran actividad
metablica. La interfase se puede subdividir
para su estudio en tres periodos: G1 , S y
G2 .
Fig. 2 Aspecto de la clula durante el ciclo
celular.
El periodo G1 sigue a la mitosis anterior y
corresponde a la fase de desarrollo de la
Interfase

clula. Los cromosomas se encuentran


Cantidad de ADN enpg

esparcidos en el interior del ncleo celular


asociados a las histonas formando las fibras
Mitosis

nucleosmicas. Los genes se transcriben de 4

acuerdo con las necesidades metablicas que


presenta la clula en cada momento. En el 0 5 15
10

citoplasma se suceden los diferentes Tiempo en u.a.

procesos metablicos y los orgnulos celula-


Fig. 3 Variacin de la cantidad de ADN
res se forman tambin en este periodo. de una clula durante un ciclo celular
completo.
El periodo S es el de sntesis de ADN. En
l, la doble hlice se abre en diversos puntos
llamados ojos de replicacin, es en ellos
donde se produce la snte sis del ADN.
Simultneamente se transcriben los genes
necesarios.

El periodo G2 es el que antecede a la mito-


sis. En este periodo los cromosomas estn
ya duplicados, es decir, estn formados por
Fig. 4 Figuras de mitosis. 1) profase, 2)
dos cromtidas con uniones a nivel del metafase, 3) anafase, 4) telofase.
centrmero.

J. L. Snchez Guilln Pgina III-6-1


III) La informacin celular 6) Ciclo celular. Mitosis.

LA DIVISIN CELULAR

La divisin celular es un proceso biolgico que en los seres unicelulares permite su


multiplicacin y en los pluricelulares el crecimiento, el desarrollo, la regeneracin de
rganos y tejidos y las funciones de reproduccin.

En una divisin celular tpica, la clula


inicial, clula madre, divide su ncleo en dos
ncleos hijos con la misma informacin
gentica que, adems, es la misma que la de
la clula madre. Al dividirse la clula, el cito-
plasma y los diferentes orgnulos celulares
quedan repartidos y durante la posterior
interfase se producirn nuevos orgnulos a
partir de los que cada clula hija ha recibido.
Por consiguiente, en una divisin celular hay
que distinguir dos aspectos distintos:

-Divisin del ncleo: cariocinesis o mitosis. Fig. 5 Clulas del meristemo de la raz de
-Divisin del citoplasma: citocinesis o citodi- ajo: 1) Profase; 2) Anafase; 3) Metafase; 4)
Interfase; 5) Telofase (citocinesis).
resis.

A partir de la fase M o de mitosis, la clula puede entrar de nuevo en la fase G1 y


dividirse otra vez o en entrar en la llamada fase G0 en Ia que sufre una serie de
trasformaciones que conducen a Ia diferenciacin celular. Por ejemplo, las clulas
epiteliales se dividen continuamente pero las clulas que dan lugar a las neuronas
entran en fase G0 se diferencian, se transforman en neuronas y ya no se dividen.
Otros tipos celulares como los hepatocitos estn en fase G0 pero si son debidamente
estimulados pueden recuperar la capacidad de divisin y pasar de G0 a G1.

DURACIN DEL CICLO CELULAR

La duracin de los periodos G1 , S, G2 y de la mitosis (M) depende del tipo de clula


que se trate. As, en clulas del epitelio humano la duracin es de 8 horas, en otros
tipos de clulas puede ser de varios das o incluso meses. Tambin depende de las
condiciones fisiolgicas y de determinados factores y, en particular, la temperatura.

Un caso tpico de duracin de un ciclo celular es el de los cultivos de clulas HeLa


en las que un ciclo celular dura 20 horas y cada fase tiene la siguiente duracin:

G1..... 8 horas
S ..... 6 horas
G2..... 5 horas
M...... 1 hora

J. L. Snchez Guilln Pgina III-6-2


III) La informacin celular 6) Ciclo celular. Mitosis.

Trasformaciones del cromosoma durante el ciclo celular.

NOR
Ojo de replicacin Trascripcin

Cromosoma

S
Centrmero G1 G2 Cromtidas

e Pro
f as fas
e
lo
Te

5
Anafase Metafase

LA MITOSIS. FASES

Aunque la mitosis es un proceso continuo se acostumbra a dividirlo, para su estudio


y reconocimiento, en cuatro fases distintas llamadas: profase, metafase, anafase y
telofase.

Es de destacar, que, aunque el estudio lo haremos en una clula animal, este


proceso se produce de una manera similar en las clulas vegetales. Las diferencias se
irn indicando a lo largo de la explicacin.

Fig. 6 Fases de la mitosis vistas al microscopio ptico. A, profase; B, metafase (visin polar); C, metafase
(visin ecuatorial); D, anafase; E, telofase.

J. L. Snchez Guilln Pgina III-6-3


III) La informacin celular 6) Ciclo celular. Mitosis.

PROFASE

Es la fase ms larga (1 a 2 horas en el


pice de raz) y en ella se suceden una
serie de fenmenos tanto en el ncleo como
en el citoplasma.

La envoltura nuclear empieza a fragmen-


tarse y los nucleolos van desapareciendo
progresivamente.

Debido al superenrollamineto de la croma- Fig. 7 Clulas en diversas fases del ciclo


tina se produce una condensacin del celular (M.O.).
material gentico y los cromosmas se van
haciendo cada vez ms visibles. Puesto que
el ADN se replic en el periodo S de la
interfase, cada cromosoma est formado por
dos cromtidas unidas por el centromero.

En las clulas animales el par de centriolos


se ha dividido en interfase y ha dado lugar
a dos pares de centriolos que constituirn
los focos de unas ordenaciones radiales de
microtubulos: los steres. Los dos steres
que al principio estn juntos se separan a Fig. 8 Interfase.

polos opuestos de la clula y los haces de


microtubulos que surgen de ellos se alargan
y forman un huso mittico o huso
acromtico bipolar. Las clulas vegetales no
tienen centriolos y el huso acromtico se
forma a partir del centrosoma. Estos husos
sin centriolo se llaman husos anastrales y
estn menos centrados en los polos.

Los tbulos del huso se forman a partir de


las molculas del citoesqueleto. ste se Fig. 9 Inicio de la profase.
desorganiza y la clula adquiere una forma
ms redondeada.

METAFASE

Es una fase corta (5 a 15 minutos en el


pice de la raz del ajo). El huso mittico ya
est perfectamente desarrollado. Los
cinetcoros de los cromosomas interaccionan
por medio de unos microtbulos con los fila-
mentos del huso y los cromosomas son Fig. 10 Metafase.
alineados en la placa ecuatorial de la clula o
placa metafsica. En esta fase los cromosomas se encuentran todos en la zona

J. L. Snchez Guilln Pgina III-6-4


III) La informacin celular 6) Ciclo celular. Mitosis.

ecuatorial, orientados perpendicularmente a los microtbulos que forman el huso


acromtico constituyendo la denominada placa ecuatorial.

Esta es la fase ms adecuada para la observacin de los cromosomas. Para ello se


rompe la clula, por ejemplo: mediante choque osmtico, si ello es posible, y los
cromosomas se tien, se aplasta para que se extiendan y a continuacin se foto gra-
fan.

ANAFASE

Es la fase ms corta (2 a 10 minutos en


el pice de raz). Los cinetcoros se
separan y cada cromtida es arrastrada
hacia un polo de la clula. El movimiento
parece ser que se produce por un
desensamblaje de los microtbulos. Al
desplazarse cada cromtida, sus brazos se
retrasan formando estructu ras en V con los
Fig. 11 Anafase.
vrtices dirigidos hacia los polos.

TELOFASE

Su duracin en el pice de raz de ajo es


de 10 a 30 minutos. Los cromosomas son
revestidos por fragmentos del retculo
endoplasmtico que terminarn soldndose
para constituir la envoltura nuclear. Poco a
poco los cromosomas van descondensn-
dose y se desfiguran adquiriendo el ncleo
un aspecto cada vez ms interfsico, los
nucleolos comienzan a reaparecer. Los
microtbulos del huso se agrupan en haces
por la aparicin en la regin media de
cilindros de una sustancia densa y pierden Fig. 12 Telofase.
sus conexiones con los polos. Finalmente
los cilindros se fusionan en un solo haz y la
clula se divide en dos.

J. L. Snchez Guilln Pgina III-6-5


III) La informacin celular 6) Ciclo celular. Mitosis.

ESQUEMA GENERAL DE LA MITOSIS

1) Interfase 2) Profase

3) Metafase 4) Anafase

5) Telofase 6) Interfase

J. L. Snchez Guilln Pgina III-6-6


III) La informacin celular 6) Ciclo celular. Mitosis.

CITOCINESIS

La divisin del citoplasma se inicia ya al


final de la anafase y contina a lo largo de
la telofase. Se produce de manera distinta
en las clulas animales y en las vegetales.
En las clulas animales tiene lugar por simple
estrangulacin de la clula a nivel del
ecuador del huso. La estrangulacin se lleva
a cabo gracias a prote nas ligadas a la
membrana que formarn un anillo contrctil.
En las clulas vegetales aparece un sistema
Fig. 13 Citocinesis en una clula animal.
de fibras formado por microtbulos en forma
de barril: el fragmoplasto. En su plano
ecuatorial se depositan pequeas vescu las
que provienen de los dictiosomas del aparato
de Golgi. Estas vesculas contienen sus-
tancias pcticas que formarn la lmina
media. Todo ello crece de dentro a fuera. La
divisin no es completa entre ambas clulas
hijas, mantenindose algunos poros de
comunicacin: los plasmodesmos, al quedar Fig. 14 Citocinesis en una clula animal.
capturados entre las vesculas elementos del
retculo. Posteriormente se depositan el
resto de las capas que forman la pared
celular. Es ms, cada clula hija depositar a
su alrededor una nueva pared celular. Las
paredes celulares de las clulas vegetales se
estiran y se rompen permitiendo a las clulas
hijas crecer.

Fig. 15 Citocinesis en una clula vegetal. a)


Por ltimo indicar que en algunos hongos a Fragmoplasto; b) disctiosoma; c) lmina media.
la cariocinesis no le sucede la citodiresis. Se
forman as masas, llamadas plasmodios, que
contienen una gran cantidad de ncleos Metafase
Profase

envueltos en una sola membrana.

Metafase

SIGNIFICADO BIOLGICO DE LA MITOSIS


Telofase

- A nivel gentico representa un sistema de


reparto equitativo e idntico de la Citocinesis

informacin gentica. Ambas clulas hijas


tendrn la misma informacin gentica, que
es la misma que posea la clula madre. Fig. 16 Figuras de mitosis.

J. L. Snchez Guilln Pgina III-6-7


III) La informacin celular 6) Ciclo celular. Mitosis.

- A nivel celular la mitosis permite la Interfase

perpetuacin de una estirpe celular y la Metafase

formacin de colonias de clulas (clones


Anafase
celulares).

- A nivel orgnico la mitosis permite el


crecimiento y desarrollo de los tejidos y de Profase

los rganos de los seres pluricelulares y la


reparacin y regeneracin de los mismos. De
esta manera, todas las clulas de un
organismo pluricelular, a excepcin de las Fig. 17 Figuras de mitosis.
clulas sexuales, dispondrn de idntica
informacin gentica.

J. L. Snchez Guilln Pgina III-6-8


III) La informacin celular 7) Cromosomas

7) LOS CROMOSOMAS MITTICOS

Durante la mitosis las cromtidas se replie-


gan sobre s mismas en tal grado que
surgen pequeos cuerpos dobles perfecta-
mente visibles al microscopio: son los
cromosomas metafsicos.

Normalmente, los cromosomas son difci les


de observar, pues se presentan en la clula
en gran nmero. Pero haciendo preparacio-
nes adecuadas pueden aislarse y Fig. 1 Clulas de raz de ajo en pro-
fotografiarse. ceso de divisin.

Su tamao es variable: segn las clulas, el


cromosoma de que se trate, del momento
funcional, etc. No obstante, oscila,
aproximadamente, entre 0,2 a 50 de lon-
gitud por 0,2 a 2 de dimetro. En la
especie humana entre 4 y 6.

Fig. 2 Cromosoma.
CARACTERSTICAS MORFOLGICAS DEL
CROMOSOMA

En cada cromosoma mittico podemos


distinguir:

Las cromtidas.- son estructuras idnticas en


morfologa e informacin ya que contienen
cada una una molcula de ADN. Las crom-
Fig. 3 Estructura de un cromosoma meta-
tidas estn unidas por el centrmero. fsico: 1) centrmero; 2 brazo; 3) cromtida;
Morfolgicamente se puede decir que el 4) telmeros; 5) satlite; 6) zona del
cromosoma es el conjunto de dos organizador nucleolar (NOR). (P.A.U. sep. 97
cromtidas y genticamente cada cromtida y jun. 98).
tiene el valor de un cromosoma. Es-
tructuralmente, cada cromtida est consti-
tuida por un esqueleto proteico, situado en
el interior, alrededor del cual se disponen
muy apelotonados el ADN y las prote nas
que forman el cromosoma.

El centrmero.- Es la regin que se fija al


huso acromtico durante la mitosis. Se
encuentra en un estrechamiento llamada
constriccin primaria, que divide a cada
cromtida del cromosoma en dos brazos. En
el centrmero se encuentran los cinetocoros:
zonas discoidales situadas a ambos lados del
centrmero que durante la divisin celular Fig. 4 Morfologa de un cromosoma. a)
tienen como funcin hacer que los micro- brazo corto; b) centrmero; c) brazo largo; d)
tbulos del huso se unan a los cromosomas. telmero; e) cinetocoro; f) bandas; g) NOR; h)
Los cinetocoros son tambin centros satlite (SAT).
organizadores de microtbulos, igual que los

J. L. Snchez Guilln Pgina III-7-1


III) La informacin celular 7) Cromosomas

centriolos o el centrosoma de las clulas vegetales.

Los telmeros.- Al extremo de cada brazo del cromosoma se le denomina telmero.


El ADN de los telmeros no se transcribe y en cada proceso de divisin celular se
acorta. Cuando los telmeros desaparecen el cromosoma sigue acortndose y la clula
pierde informacin gentica til y degenera. Los telmeros seran, por lo tanto, una
suerte de "reloj celular" que determinara el nmero de ciclos celulares que puede
tener una clula. En las clulas cancerosas, una enzima, la telomerasa, regenera los
telmeros; esta es la razn, al parecer, de que estas clulas puedan dividirse
indefinidamente.

El organizador nucleolar.- En algunos cromosomas se encuentra la regin del


organizador nucleolar (NOR). En ella se sitan los genes que se transcriben como
ARNr, con lo que se promueve la formacin del nuclolo y de los ribosomas. Esta
zona no se espiraliza tanto y por eso se ve ms clara.

EI satlite (SAT).- Es el segmento del cromosoma entre el organizador nucleolar y el


telmero correspondiente. Slo poseen satlite aquellos cromososmas que tienen NOR.

CLASIFICACIN DE LOS CROMOSOMAS POR LA POSICIN DEL CENTRMERO

Los cromosomas son orgnulos constantes


en nmero, forma y caractersticas. Pero los
cromosomas de una clula pueden ser
diferentes unos de otros. Esta diferencia
est, sobre todo, en la posicin del centr-
mero, que es variable, lo que permite clasifi-
car a los cromosomas metafsicos en meta- Metacntrico Submetacntrico acrocntrico Telocntrico

cntricos, submetacntricos, acrocntricos y


telocntricos, segn tengan el centrmero en Fig. 5 Clasificacin de los cromosomas por
la posicin del centrmero.
medio, desplazado hacia uno de los brazos,
casi en el extremo o en el extremo,
respectivamente.

EL CARIOTIPO

Se llama cariotipo al nmero, forma y


tamao de los cromosomas de una
determinada especie. Esto es, al conjunto de
los cromosomas de una clula. Los
cromosomas de una clula pueden ser ob-
servados al microscopio ptico, foto grafiados
y sobre estas fotografas pueden contarse y
medirse con toda facilidad. Los cromosomas
pueden recortarse de la foto grafa y
ordenarse por su tamao, de mayor a
menor, y por la posicin del centrmero.
Esta distribucin ordenada de los crom- Fig. 6 Placa metafsica obtenida a partir
osomas recibe el nombre de ideograma. El de una clula humana en divisin.
estudio de los cariotipos ha permitido descu-
brir los siguientes aspectos importantes:

J. L. Snchez Guilln Pgina III-7-2


III) La informacin celular 7) Cromosomas

1 1) El nmero de cromosomas es fijo para


cada especie animal o vegetal (Ley de la
constancia de los cromosomas). As, por
ejemplo, las clulas humanas tienen 46 crom-
osomas, 48 las del chimpanc, 12 las de la
mosca comn, 2 las de la lombriz intestinal
del caballo, etc. El nmero de cromosomas
oscila en los seres vivos entre 2 y varios
cientos. Es de destacar que este nmero no
est en relacin con la mayor o menor com-
plejidad evolutiva del organismo.

2 1) El nmero de cromosomas de las clulas


Fig. 7 Ideograma del cariotipo de una
somticas (no reproductoras) de la mayora mujer.
de los animales, plantas y hongos es
siempre par, excepto si se tienen anomalas
en el nmero de cromosomas, ya que cada
clula somtica dispone de dos juegos de
cromosomas y cada cromosoma de una serie
tiene su homlogo en la otra. En los
ideogramas los cromosomas se agrupan por
parejas de homlogos. Los cromosomas
homlogos provienen cada uno de un proge-
nitor. Es por esto que contienen informacin
para los mismos caracteres pero no necesa-
riamente la misma informacin, pues uno de
los progenitores ha podido aportar un gen
para un carcter y el otro progenitor otro
gen diferente.
Fig. 8 Ideograma del cariotipo de un
hombre.
3 1) El nmero de cromosomas de cada serie
recibe el nombre de nmero haploide o n y,
como ya se ha dicho, ha sido heredado de
uno de los progenitores. En la especie huma- Especie n
na n=23. El nmero total de cromosomas
La especie humana... 46
es el nmero diploide o 2n. As, en la
El chimpanc. 48
especie humana 2n= 46. Siendo n y 2n las El perro... 78
frmulas cromosmicas haploide y diploide Toro/vaca... 60
respectivamente. Gallo/gallina... 78
Rana.... 26
Mosca.. 12
4 1) En muchos grupos de seres vivos, por
Maz. 20
ejemplo en los mamferos, los cariotipos del Trigo. 46
macho y de la hembra son diferentes. As Algodn 52
la mujer tiene dos cromosomas X (XX-
homogamtica) y el hombre tiene un Fig. 9 Nmero de cromosomas de clulas
cromosoma X y otro Y (heterogamtico- XY). diploides de diferentes especies.
Estos cromosomas que determinan el sexo
se llaman, por ser distintos, heterocromo-
somas. En las aves es al contrario, el macho es homogamtico (ZZ) y la hembra
heterogamtica (ZW). El resto de los cromosomas que no determinan el sexo son los
autosomas.

El estudio del cariotipo tiene un gran inters en medicina porque algunos sndromes

J. L. Snchez Guilln Pgina III-7-3


III) La informacin celular 7) Cromosomas

son debidos a cromosomas de ms, de menos o a cromosomas incompletos. En


particular, la llamada trisoma 21 o sndrome de Down en la que el individuo
afectado presenta tres cromosomas 21 en lugar de dos y por lo tanto, su cariotipo
tiene 47 cromosomas en lugar de los 46 de la frmula diploide normal. Estas altera-
ciones en el nmero de cromosomas del cariotipo y sus causas sern estudiadas ms
adelante.

J. L. Snchez Guilln Pgina III-7-4


III) La informacin celular 8) Meiosis

8) LA MEIOSIS

LA MEIOSIS: CONCEPTO

La meiosis es un mecanismo de divisin


celular que permite la obtencin de clulas Fig. 1 La meiosis consta de dos divisiones
haploides (n) a partir de clulas diploides (2n) celulares sucesivas con una sola replicacin del
con diferentes combinaciones de genes. material gentico.

OBJETIVOS DE LA MEIOSIS

La meiosis no es un tipo de divisin celular


diferente de la mitosis o una alternativa a
sta. La meiosis tiene objetivos diferentes.
Uno de estos objetivos es la reduccin del
nmero de cromosomas. Otro de sus obje-
tivos es establecer reestructuraciones en los
cromosomas homlogos mediante
intercambios de material gentico. Por lo
tanto, la meiosis no es una simple divisin
celular. La meiosis est directamente
relacionada con la sexualidad y tiene, como Fig. 2 Evolucin de los cromosomas de una
veremos ms adelante, un profundo sentido clula durante la meiosis (P.A.U. de junio y
para la supervivencia y evolucin de las septiembre de 1995).
especies.

MECANISMO DE LA MEIOSIS

La meiosis consta de dos divisiones sucesivas de la clula con una nica replicacin
del ADN. El producto final son cuatro clulas con n cromosomas.

Fig. 3 Figuras de meiosis desordenadas (P.A.U. de junio de 1997).

J. L. Snchez Guilln Pgina III-8-1


III) La informacin celular 8) Meiosis

DIVISIN I

PROFASE I

En esta fase suceden los acontecimientos


ms caractersticos de la meiosis. La envol-
tura nuclear se conserva hasta el final de la
fase que es cuando se desintegra, al mismo
tiempo desaparece el nucleolo y se forma el
huso.

Fig. 4 Profase I: Leptoteno.


Dada su duracin y complejidad se subdi-
vide en cinco etapas: leptoteno, zigoteno,
paquiteno, diploteno y diacinesis.

Leptoteno: Los cromosomas aparecen como


largos filamentos que de trecho en trecho
presentan unos grnulos: los crommeros.
Cada cromosoma ya est constituido por
dos cromtidas, pero an no se observan
bien diferenciadas al microscopio ptico, y
se encuentran unidos en diversos puntos a
Fig. 5 Profase I: Zigoteno.
la envoltura nuclear.

Zigoteno: En esta etapa los cromosomas


homlogos se aparean punto por punto en
toda su longitud. Este apareamiento puede
comenzar bien por el centro o por los
extremos y continuar a todo lo largo. Cuan-
do los homlogos se aparean cada gen
queda yuxtapuesto con su homlogo.
Fig. 6 Intercambio de fragmentos entre
Paquiteno: Los pares de cromosomas cromtidas homlogas por sobrecruzamiento
homlogos aparecen ntimamente unidos: entre cromosomas homlogos.

bivalentes. Se puede ya observar que cada


cromosoma tiene sus dos cromtidas.
Mientras estn estrechamente unidos tienen
lugar roturas entre cromtidas prximas de
cromosomas homlogos que intercambian
material cromosmico. Este intercambio se
llama entrecruzamiento o sobrecruzamiento
(crossing-over) y supone una redistribucin
cromosmica del material gentico. Aunque quiasma

los sobrecruzamientos se producen en esta


Fig. 7 Quiasmas entre cromosomas homlo-
fase no an visibles y se apreciarn ms
gos.
tarde en forma de quiasmas.

J. L. Snchez Guilln Pgina III-8-2


III) La informacin celular 8) Meiosis

Diploteno: Los bivalentes inician su separa-


cin, aunque se mantienen unidos por los
puntos donde tuvo lugar el sobrecruzamiento,
estas uniones reciben ahora el nombre de
quiasmas y permiten ver los puntos en los
que hubo sobrecruzamientos. En cada par de
cromosomas homlogos pueden persistir uno o
varios quiasmas, todo depende de cuntos
sobrecruzamientos hayan tenido lugar a lo
largo del bivalente. Fig. 8 Profase I: Diacinesis.

Diacinesis: Las cromtidas aparecen muy con-


densadas preparndose para la metafase. La separacin entre bivalentes persiste y
permanecen los quiasmas.

Al final de la profase la envoltura nuclear ha desaparecido totalmente y ya se ha


formado el huso acromtico.

Fig. 9 Figuras de la profase de la primera divisin de la meiosis (P.A.U. de sept. de 1999).

METAFASE I

Los bivalentes se disponen sobre el ecuador


del huso, pero lo hacen de tal forma que los
dos cinetocoros que tiene cada homlogo se
orientan hacia el mismo polo, que es el
opuesto hacia el que se orientan los dos
cinetocoros del otro homlogo.

Fig. 10 Meiosis: Metafase I.


ANAFASE I

Los cromosomas slo presentan un centrmero para las dos cromtidas. Debido a
esto, se separan a polos opuesto cromosomas completos con sus dos cromtidas. No
se separan 2n cromtidas, sino n cromosomas dobles. Esta disyuncin o separacin
de los cromosomas da lugar a una reduccin cromosmica. Como consecuencia,
desaparecen los quiasmas.

J. L. Snchez Guilln Pgina III-8-3


III) La informacin celular 8) Meiosis

La distribucin al azar de los cromosomas


es una de las fuentes de variabilidad, ya que
pueden producirse como consecuencia de
este proceso una gran cantidad de gametos
(2 n, siendo n el nmero haploide).

TELOFASE I

Es una telofase normal pero que da lugar a


dos clulas hijas cuyos ncleos tienen cada
uno n cromosomas con dos cromtidas. Fig. 11 Meiosis: Anafase I.

INTERFASE

Puede ser variable en su duracin, incluso


puede faltar por completo de manera que
tras la telofase I se inicia sin interrupcin la
segunda divisin. En cualquier caso, nunca
hay sntesis de ADN; es decir, es una
interfase sin periodo S.
Fig. 12 Meiosis: Anafase I. ( P.A.U. de
junio de 1998).

B) DIVISIN II

Es una mitosis normal en la que las dos clulas anteriores separan en la anafase II
las cromtidas de sus n cromosomas. Surgen as 4 clulas con n cromtidas cada
una.

Profase II Metafase II Anafase II Telofase II

Fig. 13 Segunda divisin de la meiosis.

J. L. Snchez Guilln Pgina III-8-4


III) La informacin celular 8) Meiosis

SIGNIFICADO BIOLGICO DE LA MEIOSIS

A nivel gentico. El sobrecruzamiento da lugar a nuevas combinaciones de genes en


los cromosomas, es responsable de la recombinacin gentica. Por otra parte, cada
una de las cuatro clulas finales dispone de un conjunto de n cromtidas que no es
idntico al de las otras. Tanto el sobrecruzamiento como el reparto de las cromtidas
dependen del azar y dan lugar a que cada una de las cuatro clulas resultantes tenga
una coleccin de genes diferentes. Estas colecciones de genes se vern ms adelante
sometidas a las presiones de la seleccin natural de tal forma que solamente
sobrevivirn las mejores. A nivel gentico, la meiosis es una de las fuentes de
variabilidad de la informacin.

A nivel celular. La meiosis da lugar a la reduccin cromosmica. Las clulas diploides


se convierten en haploides.

A nivel orgnico. Las clulas haploides resultantes de la meiosis se van a convertir en


las clulas sexuales reproductoras: los gametos o en clulas asexuales reproductoras:
las esporas. La meiosis es un mecanismo directamente implicado en la formacin de
gametos y esporas. En muchos organismos los gametos llevan cromosomas sexuales
diferentes y son los responsables de la determinacin del sexo, en estos casos la
meiosis est implicada en los procesos de diferenciacin sexual.

DIFERENCIAS ENTRE LA MITOSIS Y LA MEIOSIS


(CUADRO RESUMEN)

MITOSIS MEIOSIS

A nivel gentico

Segregacin al azar de los cromosomas


Reparto exacto del material gentico. homlogos y sobrecruzamiento como fuente
de variabilidad gentica.

A nivel celular

Como consecuencia de lo anterior se Produce una reduccin del juego de


forman clulas genticamente cromosomas a la mitad exacta de los
iguales. cromosomas homlogos

A nivel orgnico

Se da este tipo de divisin en los


organismos unicelulares para su Sirve para la formacin de las clulas
reproduccin asexual y en pluricelulares reproductoras sexuales: los gametos, o
para su desarrollo, crecimiento y la las clulas reproductoras asexuales: las
reparacin y regeneracin de tejidos y esporas.
rganos.

J. L. Snchez Guilln Pgina III-8-5


III) La informacin celular 8) Meiosis

PRIMERA DIVISIN DE LA MEIOSIS

1) Interfase 2) Profase I. Leptoteno

4) Profase I. Diacinesis.
3) Profase I. Zigoteno

5) Metafase I 6) Anafase I

7) Telofase I 8) Interfase

J. L. Snchez Guilln Pgina III-8-6


III) La informacin celular 8) Meiosis

SEGUNDA DIVISIN DE LA MEIOSIS

9) Profase II 10) Metafase II

11) Anafase II 12) Telofase II

J. L. Snchez Guilln Pgina III-8-7


III) La informacin celular 9) Mutaciones

9) LAS MUTACIONES

MUTACIONES

Son cambios en la informacin hereditaria.


Pueden producirse en clulas somticas o en
clulas germinales (las ms trascendentales). La
mutacin es un cambio en el material gentico.
Por lo tanto, slo son heredables cuando
afectan a las clulas germinales; si afectan a las
clulas somticas se extinguen, por lo general
con el individuo, a menos que se trate de un
organismo con reproduccin asexual. Fig. 1 Drosophila. Mutante con alas vestigiales
(izd.) y mosca normal (dch.).
Pueden ser: naturales (espontneas) o
inducidas (provocadas artificialmente con
radiaciones, sustancias qumicas u otros
ADN original
agentes mutgenos).
A T C G A A C C G T T G C A C
T A G C T T G G C A A C G T G
Se distinguen tres tipos de mutaciones segn
la extensin del material gentico afectado:
Agente fsico
o qumico
-Gnicas o puntuales
-Cromosmicas estructurales
-Cromosmicas numricas o genmicas A T C G A A C C G T T G C A C
T A G C T T G G A A A C G T G

1) Mutaciones gnicas: Son aquellas que ADN con mutacin gnica


producen alteraciones en la secuencia de
nucletidos de un gen. Existen varios tipos:
Fig. 2 Mutacin gnica.

a) Sustituciones de pares de bases. stas pue-


den ser:

- Transiciones: Es el cambio en un
nucletido de una base prica por otra
prica o de una pirimidnica por otra
1) Transicin Nuevas cadenas
pirimidni ca.
- Transversiones: Es el cambio de una
base prica por una pirimidnica o vice-
versa.

2) Transversin
b) Perdida o insercin de nucletidos, lo que Nuevas cadenas

induce a un corrimiento en el orden de lectura.


Pueden ser: Fig. 3 Mutaciones gnicas por sustitucin:
transicin y transversin.

J. L. Snchez Guilln Pgina III-9-1


III) La informacin celular 9) Mutaciones

- Adiciones gnicas: Es la insercin de


nucletidos en la secuencia del gen.
- Deleciones gnicas: Es la prdida de
nucletidos.

Las sustituciones provocan la alteracin de un


nico triplete y, por tanto, salvo que indiquen
un triplete de parada, o un aminocido del
centro activo de una enzima, pueden no ser
perjudiciales. Sin embargo, las mutaciones que
impliquen un corrimiento en el orden de lectura,
adiciones o deleciones, salvo que se
compensen entre s, pueden alterar la
Fig. 4 Glbulos rojos de una persona con
secuencia de aminocidos de la protena
anemia falciforme.
codificada y sus consecuencias suelen ser
graves.

Consecuencias de una adicin: Corrimiento en el orden de lectura.

Consecuencias de una sustitucin ADN original

ADN ARNm Aminocido Consecuencias


T A C G T T A C G A A T G C T T A A A T A
Original -A-C-A- -U-G-U- Cys Ninguna, pues el codn
codifica el mismo
Mutado -A-C-G- -U-G-C- Cys aminocido. A U G C A A U G C U U A C G A A U U U A U

Original -A-C-A- -U-G-U- Cys Sustitucin de un -Met-Gln-Cys-Leu-Arg-Ile-Tyr-


aminocido por otro, pues
Mutado -A-C-C- -U-G-G- Trp el codn codifica un
aminocido distinto. ADN mutado
Original -A-C-A- -U-G-U- Cys Generacin de una seal
de stop. T A C G T T A A C G A A T G C T T A A A T
C
Mutado -A-C-T- -U-G-A- Stop

A U G C A A U U G C U U A C G A A U U U A G

-Met-Gln-Leu-Leu-Thr-Asn-Leu-

Fig. 6 Consecuencias de una sustitucin. Fig. 5 Consecuencias de una adicin.

2) Mutaciones cromosmicas estructurales: Son los cambios en la estructura interna de los


cromosomas. Se pueden agrupar en dos tipos:

a) Las que suponen prdida o duplicacin de segmentos:

- Delecin cromosmica: Es la prdida de un segmento de un cromosoma.


- Duplicacin cromosmica: Es la repeticin de un segmento del cromosoma.

b) Las que suponen variaciones en la distribucin de los segmentos de los cromosomas.

- Inversiones: Un segmento cromosmico de un cromosoma se encuentra situado en


posicin invertida.
- Translocaciones: Un segmento cromosmico de un cromosoma se encuentra
situado en otro cromosoma.

J. L. Snchez Guilln Pgina III-9-2


III) La informacin celular 9) Mutaciones

a a
a a
b b
b b
c c
c c

d d
d d
e e
e
e
f f
f
f
g
g d
h e
i f

Deficiencia o delecin Duplicacin

a 1 a 1
a a
b 2 b 2
b b
c 3 c 3
c c

d 4 d 4
d d
e 5 e 5
f 6 f h e h

g 7 g i f g
h 6 g f
i 7 h e
i i

Traslocacin Inversin

ORIGEN DE ALGUNAS MUTACIONES Delecin

CROMOSMICAS ESTRUCTURALES

Todos los cambios estructurales que se producen Inversin

en los cromosomas pueden explicarse por la rotura y


reunin de sus fragmentos. Fig. 7 1er caso.

Podemos considerar 3 casos posibles, el primero se


refiere a un solo cromosoma y los dos ltimos a
parejas de cromosomas. Duplicacin

a) Roturas que afectan a un cromosoma:


Delecin

1er caso.- Si la rotura se produce dentro de un brazo Fig. 8 2 caso.


del cromosoma los fragmentos pueden reunirse
dando lugar a una delecin o a una inversin ms un
fragmento sin centrmero (acntrico) que se pierde.

b) Roturas que afectan a cromosomas distintos:

21 caso.- Si la rotura afecta a dos cromosomas Traslocacin

homlogos simultneamente. Despus de la rotura la


reunin de los fragmentos puede producir una
Fig. 9 3er caso.
duplicacin ms una delecin.

J. L. Snchez Guilln Pgina III-9-3


III) La informacin celular 9) Mutaciones

3er caso.- Afecta a dos cromosomas no homlogos. Despus de la rotura se produce un intercambio
de fragmentos dando lugar a una translocacin entre cromosomas no homlogos: translocacin
recpro ca.

Efecto fenotpico de las mutaciones cromosmicas estructurales: Las deleciones y


duplicaciones producen un cambio en la cantidad de genes y por tanto tienen efectos
fenot picos, por lo general deletreos. Sin embargo las inversiones y translocaciones no
suelen tener efecto fenotpico, pues el individuo tiene los genes correctos, aunque de las
translocaciones pueden derivarse problemas de fertilidad por apareamiento defectuoso de
los cromosomas durante la gametognesis o la aparicin de descendientes con anomalas.

Ejemplo de mutacin cromosmica estructural: En la especie humana, una delecin particular en el


cromosoma 5 provoca el sndro me " cri du chat" (grito de gato) que se caracteriza por
microcefalia, retraso mental profundo y detencin del crecimiento.

Importancia evolutiva de las mutaciones cromosmicas estructurales.- La delecin apenas


tiene importancia evolutiva, mientras que la duplicacin en cambio posee una importancia
evolutiva grande. A su vez, las inversiones y translocaciones estn tambin asociadas de
una forma importante a la evolucin, por ejemplo la fusin de dos cromosomas acrocntri-
cos puede dar lugar a uno metacntrico, como ha ocurrido con el cromosoma 2 de la especie
humana, que es el resultado de la fusin de dos cromosomas de un mono antepasado antro-
pomorfo. Distintos genes de hemofilia se han adquirido por duplicaciones en el transcurso
de la evolucin.

3) Mutaciones cromosmicas numricas: Son alteraciones en el nmero de los cromosomas


propios de la especie. Pueden ser: Euploidas y Aneuploidas

a) Euploida : Cuando afecta al nmero de juegos completos de cromosomas con relacin al


nmero normal de cromosomas de la especie.

Las euploidas se pueden clasificar por el nmero de cromosomas que se tengan en:

-Monoploida o haploida : Si las clulas presentan un solo juego (n) de cromosomas.


-Poliploida : Si presentan ms de dos juegos; pudiendo ser: triploides (3n),
tetraploides (4n), etc.

Tambin se pueden clasificar por la procedencia de los cromosomas en:

-Autopoliploida . Si todos los juegos proceden de la misma especie.


-Alopoliploida . Si los juegos proceden de la hibridacin de dos especies.

Origen de las euploidas .- Si durante la meiosis se produce en algunas clulas la no


disyuncin de todos los cromosomas homlogos se originarn dos gametos con 2n
cromosomas y dos gametos sin cromosomas (0 ). La unin de estos gametos entre s o con
gametos n, puede producir zigotos haploides, triploides o tetraploides (n+0, n+2n,
2n +2n). En las plantas pueden conseguirse tetraploides, experimentalmente, por
tratamientos con colchicina.

Efectos fenotpicos de las euploidas.- En general, las anomalas en los euploides son
menores que en los aneuploides, en los que los efectos fenot picos son mayores al no
mantenerse equilibradas las dosis relativas de genes.

J. L. Snchez Guilln Pgina III-9-4


III) La informacin celular 9) Mutaciones

8 Cromosomas 12 Cromosomas 16 Cromosomas

Cariotipo Cariotipo Cariotipo

1 2 1 2 1 2

3 4 3 4 3 4

Diploide 2n Triploide 3n Tetraploide 4n

Fig. 10 Autopoliploidas en una especie con 2n=8 cromosomas.

b) Aneuploidias: Se dan cuando est afectada slo una parte del juego cromosmico y el
zigoto presenta cromosomas de ms o de menos. Las aneuploidas pueden darse tanto en
los autosomas (por ejemplo: el Sndrome de Down), como en los heterocromosomas o cro-
mosomas sexuales (por ejemplo: el sndrome de Turner o el sndro me de Klinefelter).

stas alteraciones se denominan:

- Monosomas : si falta uno de los cromosomas de la pareja de homlogos.


- Trisomas : si se tienen tres cromosomas en lugar de los dos normales.
- Tetrasomas : si se tienen 4. Etc.

Ejemplo de trisoma: el Sndrome de Down o


trisoma 21 . Existe un tipo de trisoma particular-
mente corriente en la especie humana, es la llamada
trisoma 21 o sndrome de Down (tambin
conocida como mongolismo). Las personas que pre-
sentan este sn drome se caracterizan por tener
retraso mental, cuerpo corto, dedos cortos y grue-
sos, lengua hinchada y un pliegue en el prpado
parecido al de las razas monglicas. Est demostra-
da la relacin entre el sn drome de Down y una
avanzada edad en la madre. En ciertos casos de
mongolismo el individuo presenta una placa metaf-
sica normal con 46 cromosomas, pero uno de los
Fig. 11 Ideograma del cariotipo de una clula de
cromosomas del grupo 13-15 es mayor, por lo que una persona con trisoma 21.
se cree que lo que ha sucedido es una translocacin
de uno de los cromosomas 21 en exceso a uno de

J. L. Snchez Guilln Pgina III-9-5


III) La informacin celular 9) Mutaciones

los cromosomas del grupo 13-15. Parece ser que las


trisomas se originan por una no disyuncin de los
cromosomas en la primera divisin de la meiosis (ver par 21

figura). No disyuncin del


par 21. DI

-
Importancia evolutiva de las aneuploidas .- 21 21

Tienen ms importancia evolutiva que las ante- D II

riores de cara a la obtencin de nuevas espe-


cies.
21 21
21

Formacin de un zigoto con


21 21 21
trisoma 21 por unin entre un
espermatozoide con un 21 y un
vulo con dos 21, originado por
una no disyuncin del par 21 en
la primera divisin de la meiosis.

Fig. 12 Trisoma 21 originada por una no


disyuncin del par 21 en la anafase de la 1
divisin de la meiosis del ovocito primario.

Las aneuploidas y sus consecuencias en la meiosis


Cariotipo normal Nulismico

1 2 3 4 1 2 3 4

Contenido cromosmico de los Contenido cromosmico de los


gametos o de las esporas: n gametos o de las esporas: n-1
cromosomas. cromosomas.

Monosmico Trismico

1 2 3 4 1 2 3 4

Contenido cromosmico de los Contenido cromosmico de los


gametos o de las esporas: n y gametos o de las esporas: n y
n-1 cromosomas. n+1 cromosomas.

Tetrasmico Doble trismico

1 2 3 4 1 2 3 4

Contenido cromosmico de los Contenido cromosmico de los


gametos o de las esporas: n+1 gametos o de las esporas: n,
cromosomas. n+1 y n+2 cromosomas.

J. L. Snchez Guilln Pgina III-9-6


III) La informacin celular 9) Mutaciones

LAS ANEUPLOIDAS MS IMPORTANTES EN LA ESPECIE HUMANA Y SUS EFECTOS

Aneuploidas en los autosomas


Sndrome Mutacin Caractersticas fenotpicas
Sndrome de Down Trisoma del par 21 Ojos oblicuos, retraso mental, cabeza
ancha y cara redondeada.
Sndrome de Edw ards Trisoma del par 18 Boca y nariz pequeas, deficiencia men-
tal, lesiones cardacas, membrana inter-
digital. Poca viabilidad.
Sndrome de Patau Trisoma del par 13 Labio leporino, paladar hendido, deficien-
cias cerebrales y cardiovasculares. Poca
viabilidad.

Aneuploidas en los cromosomas sexuales


Sndrome Mutacin Caractersticas fenotpicas
Sndrome de Klinefelter Uno o ms cromosomas X en Sexo masculino. Esterilidad,
exceso (XXY, XXXY,..). deficiencias mentales y algunos
caracteres sexuales secundarios
femeninos.
Sndrome de Turner Monosoma del cromosoma X. Sexo femenino con un slo cro-
mosoma X, esterilidad, baja
estatura, trax ancho.
Sndrome de doble Y Dos cromosomas Y (XYY) Varones de estatura elevada, se
relaciona con una mayor agresi-
vidad, bajo coeficiente mental.
Sndrome de triple X Tres cromosomas X Sexo femenino con rganos
genitales atrofiados, fertilidad
limitada. Bajo coeficiente mental.

J. L. Snchez Guilln Pgina III-9-7


III) La informacin celular 9) Mutaciones

AGENTES MUTGENOS

Un agente mutgeno es todo factor capaz de aumentar la frecuencia de mutacin natural.


Existen diversos factores, tanto fsicos como qumicos, capaces de actuar como agentes
mutgenos. En realidad, actuarn como agentes mutgenos todos aquellos agentes
capaces de alterar el material gentico y en particular, aquellos que alteren la secuencia del
ADN. Los principales agentes mutgenos son:

a) Agentes fsicos:

-Las radiaciones electromagnticas como los rayos X y los rayos gamma.


-Las radiaciones corpusculares como los rayos , los rayos y los flujos de protones o
neutrones que generan los reactores nucleares u otras fuentes de radiactividad natural o
artificial.
-Ciertos factores fsicos como los ultrasonidos, los choque trmicos, la centrifugacin, etc.

b) Agentes qumicos:

- Los anlogos de las bases nitrogenadas.


- El cido nitroso (HNO2 ), porque desamina ciertas bases nitrogenadas.
- Los alcaloides como la cafena, la nicotina, etc.
- El gas mostaza, el agua oxigenada (H2 O2 ), el ciclamato, etc.

MUTACIONES Y EVOLUCIN

La evolucin se debe a aquellos procesos por los que las poblaciones cambian sus
caractersticas genticas a lo largo del tiempo. Se llama " pool" gnico de una poblacin al
conjunto de genes de la misma, formado por todos los alelos de los genes que tienen los
individuos que la constituyen. Una combinacin favorable de alelos en un individuo
favorece su supervivencia y por tanto su reproduccin y su extensin en la poblacin.

La mutacin es la fuente primaria de variacin,


pero no la nica. La recombinacin gnica
incrementa la variabilidad. La mayora de los
cambios evolutivos se producen por
acumulacin gradual de mutaciones en los 1

genes y por variaciones en su nmero y


organizacin. Ahora bien, la mayor parte de las
mutaciones gnicas son deletreas (mortales) y
las que se han mantenido es porque producen
una mejora y son las esenciales para la Fig. 13 Las aves gigantes provienen todas ellas
de antepasados comunes.
evolucin.

La separacin entre los miembros de una


poblacin impide el intercambio gentico entre los mismos. Esto produce cada vez ms
diferenciacin al tener que adaptarse a ambientes distintos. Cuando con el tiempo se
acumulan diferencias que impiden la reproduccin entre los miembros de esos grupos
decimos que se trata de especies distintas.

J. L. Snchez Guilln Pgina III-9-8


III) La informacin celular 9) Mutaciones

Parece ser que los seres, a lo largo del tiempo, han ido aumentando la cantidad de genes
(duplicaciones) lo que ha supuesto que sobre estos genes duplicados pudieran generarse
mutaciones con un menor riesgo y favorecer el proceso de creacin de variabilidad. As, en
eucariotas, la cantidad de ADN es mayor que en otros grupos y mayor que la necesaria para
contener la informacin gentica.

EL CNCER: ENFERMEDAD GENTICA

CONCEPTO DE CNCER Y SU RELACIN CON EL ADN

Se desarrolla un tumor cuando se produce una multiplicacin y crecimiento irregular de las


clulas. En general, los tumores pueden ser:

-Tumores benignos: Localizados y sin crecimiento indefinido.


-Tumores malignos: Son aquellos tumores que crecen invadiendo y destruyendo a
los dems tejidos.

El cncer es una enfermedad o un conjunto de ellas que consiste en la multiplicacin de


ciertas clulas alteradas que forman tumores malignos y pueden emigrar a otros puntos a
travs del sistema linftico o circulatorio: metstasis.

Las clulas cancerosas crecen a gran velocidad, tienen protenas de membrana distintas,
presentan alteraciones en la forma e invaden a los tejidos prximos. El paso de clula normal
a cancerosa se denomina transformacin cancerosa. Puede deberse a:

- Mutaciones.
- Influencia de factores ambientales.
- Presencia de ciertos genes (protooncogenes) que pasan a oncogenes al sufrir una
mutacin.
- Presencia de ciertos genes (antioncogenes) o genes inhibidores o supresores de la
divisin celular.

1) Cncer producido por virus Se conocen virus que favorecen o facilitan la aparicin de
clulas cancergenas, debido a que producen mutaciones y algunas de estas mutaciones
pueden ser cancerge nas.

2) Cncer producido por sustancias qumicas o


por radiaciones. En humanos, la mayora de los
cnceres estn fundamentalmente relacionados
con agentes cancerge nos como:

Radiaciones UV, X y nucleares


Alquitrn
Ahumados
Pan tostado chamuscado
Amianto
Cloruro de vinilo
Cncer de
Anilinas Cncer de piel pulmn
Algunos conservantes y edulcorantes
artificiales Fig. 14 Agentes fsicos y qumicos productores
Bebidas alcohlicas (sobre todo de alta de cncer.
graduacin)

J. L. Snchez Guilln Pgina III-9-9


III) La informacin celular 9) Mutaciones

Tabaco (pulmn)

Los agentes mutgenos pueden ser cancergenos. No son de efectos inmediatos. Es


necesario que acten repetidamente y que se presenten otros factores para que se
produzca la transformacin de una clula normal en cancerosa.

J. L. Snchez Guilln Pgina III-9-10


III) La informacin celular 10) Herencia gentica

10) LA HERENCIA GENTICA

CONCEPTO DE GENTICA

Definiremos la gentica como la parte de la Biologa que se ocupa del estudio de la herencia
biolgica, intentando explicar los mecanismos y circunstancias mediante los cuales se rige
la transmisin de los caracteres de generacin en generacin.

ALELOS

Para un gen pueden existir a veces diferentes variedades que pueden dar lugar a
caractersticas distintas en el individuo. As, por ejemplo, en el guisante, el gen A
determina que los guisantes sean de color amarillo y el gen a determina que sean de color
verde.

Se llaman alelos a las distintas variedades de un gen para un carcter; A y a son genes
alelos para el carcter que determina el color en los guisantes.

RELACIONES ALLICAS: HOMOCIGOSIS Y HETEROCIGOSIS

Los individuos diploides poseen en sus clulas


dos juegos de cromosomas homlogos, uno
aportado por el gameto masculino y el otro por
el gameto femenino. Dado que los genes
A A a a A a
residen en los cromosomas, resulta evidente
que para cada carcter el individuo tendr dos
genes. Si en ambos cromosomas homlogos
reside el mismo alelo diremos que el individuo
es homocigtico para ese carcter. Por ejemplo, Homocigticos Heterocigtico

un guisante que tenga como genes para el color


AA, es homocigtico, tambin lo es el que tenga Fig. 1 Homocigosis y heterocigosis.
aa. Por el contrario, si en cada homlogo hay un
alelo distinto, el individuo ser heterocigtico
para ese carcter. Por ejemplo, los guisantes Aa
seran heterocigticos.

DOMINANCIA Y RECESIVIDAD. CODOMINANCIA

Los individuos homocigticos manifestarn el carcter externo que viene definido por sus
genes. As, los guisantes AA sern amarillos y los aa sern verdes.

J. L. Snchez Guilln Pgina III-10-1


III) La informacin celular 10) Herencia gentica

Sin embargo, cuando tratamos del fenmeno


de la heterocigosis se plantea la pregunta de )
cul ser la resultante de ambos alelos?
AA aa Aa
Generalmente, en los heterocigticos slo se
manifiesta el carcter definido por uno de los
dos alelos. Dicho alelo se dice que es el Fig. 2 Dominancia en el color de la piel de los
dominante, mientras que le otro, que slo se guisantes. El hbrido, Aa, es de color amarillo.
manifiesta en homocigosis, se dice que es el
alelo recesivo. En el caso del color de los
guisantes, A, el que determina el color amarillo,
es dominante sobre el alelo a, que determina el
color verde. El heterocigoto Aa presenta color
amarillo. Vemos que el efecto de la dominancia
enmascara uno de los genes en el
heterocigtico.

Hay algunos caso en los que ambos alelos se


hacen patentes en el heterocigtico; se dice
entonces que son codominantes. Por ejemplo,
Fig. 3 Dondiego de noche (Mirabilis jalapa).
en el hombre, el alelo IA determina el grupo
sanguneo A y el alelo IB el grupo B. Un
individuo IAIA pertenece al grupo A, IBIB al grupo
B y el heterocigtico IAIB al AB.

IA IA ....... Homocigtico ...... Grupo A


IBIB ....... Homocigtico ...... Grupo B
IA IB ....... Heterocigtico ..... Grupo AB

RR BB RB
En otros casos, como en el del color de las
flores del dondiego de noche (Mirabilis jalapa),
los heterocigticos RB (R, rojo y B, blanco) para Fig. 4 Herencia intermedia en el color de las
flores del dondiego de noche (Mirabilis jalapa).
el color de las flores, son rosas. Se dice que
ambos genes presentan herencia intermedia,
pues el heterocigtico manifiesta una mezcla de
ambos genes.

CMO SE REPRESENTAN LOS GENES?

Como hemos visto, los genes se representan


mediante letras. En el caso de ser slo dos los
alelos de un gen, uno dominante y otro Fig. 5 Drosophila. Izquierda, mutante con alas
recesivo, lo que es lo ms corriente, le vestigiales (vg) y derecha, mosca de alas normales
asignaremos una letra mayscula al gen (vg+ ).

dominante, por ejemplo (A), y la misma letra en

J. L. Snchez Guilln Pgina III-10-2


III) La informacin celular 10) Herencia gentica

minsculas al recesivo (a).

Cuando los genes que se conocen en una especie son numerosos, como es el caso de la
mosca del vinagre, Drosophila, se pueden asignar una o dos letras minsculas seguidas del
signo ms (+) para el dominante (por ejemplo vg +, alas normales) y la misma o las mismas
letras sin el signo ms (+) al recesivo (vg, alas vestigiales).

En el caso de herencia intermedia, ambos genes se representan mediante la inicial en


maysculas (R, color rojo de la flor en el dondiego y B, color blanco de la flor).

En el caso de codominancia, como es el de los grupos sanguneos A y B, se indican


mediante una letra en maysculas (I) para ambos y un superndice que los distinga (IA para
el que determina el grupo A e IB para el B).

GENOTIPO Y FENOTIPO

Los caracteres externos que exhibe un individuo constituyen su fenotipo mientras que los
genes que determinan ese fenotipo son su genotipo. En los guisantes, el color amarillo de
las semillas es el fenotipo, que est determinado por el genotipo AA o el Aa, el fenotipo
verde est determinado por el genotipo aa.

El fenotipo de un individuo no depende solamente de su genotipo, sino tambin de las


circunstancias ambientales. Se puede afirmar que el fenotipo es el resultado de la accin de
los genes expresada en un ambiente determinado.

FENOTIPO = GENOTIPO + AMBIENTE

Las flores de la hortensia pueden ser azules, si las plantas son cultivadas en tierra cida, y
de color rosa si la tierra es alcalina. El pH del suelo incide, en este caso, sobre el fenotipo.

Otro curioso ejemplo de la accin del ambiente lo tenemos en los conejos de la raza
Himalaya. Si estos conejos son criados en su ambiente natural, fro, desarrollan un
pigmento negro en la punta de la nariz y en los extremos de las orejas y de las patas. Los
mismos conejos criados en una temperatura clida pierden todo el pigmento y son
totalmente blancos. Se ha demostrado que si una regin del cuerpo de estos conejos es
enfriada artificialmente durante algunos das aparece en ella la pigmentacin. En la raza
Himalaya, el gen para el color del pelo determina la presencia de una enzima que hace
posible la aparicin del pigmento; esta enzima es, sin embargo, muy sensible a la
temperatura, siendo inactivada por las altas temperaturas, lo que conduce a la falta de
pigmentacin. Las partes ms fras del cuerpo de estos animales son siempre las
extremidades, lo que explica la curiosa distribucin del pigmento.

Es de destacar que a la hora de escribir el genotipo, en el caso del heterocigtico, siempre


se indica primero el gen dominante y despus el recesivo y nunca al revs (Aa, Nn o vg + vg y
no aA, nN o vvg + ). Cuando uno de los genes del genotipo no se conozca, lo indicaremos

J. L. Snchez Guilln Pgina III-10-3


III) La informacin celular 10) Herencia gentica

mediante una raya. Por ejemplo, si en los cobayas el pelo negro (N) domina sobre el blanco
(n), si tenemos un cobaya de pelo negro, podr ser, si no tenemos ms datos, tanto NN
como Nn. Esto es, su genotipo ser N-.

HERENCIA DE UN SOLO CARCTER

A) 1 LEY DE MENDEL. LEY DE LA


UNIFORMIDAD DE LOS HBRIDOS DE LA
PRIMERA GENERACIN FILIAL. AA X aa Progenitores

Cuando se cruzan dos variedades, individuos


A a Gametos
de raza pura, ambos para un determinado
carcter (homocigotos), todos los hbridos de
la primera generacin son iguales fenotpica y
genotpicamente. Aa F1

Mendel lleg a esta conclusin al cruzar


variedades puras (homocigticas) de guisantes
Fig. 6 1 Ley de Mendel.
amarillas y verdes, pues siempre obtena de
este cruzamiento variedades de guisante
amarillas.
Aa X Aa F1

B) 2 LEY DE MENDEL. LEY DE LA


SEGREGACIN DE LOS GENES QUE FORMAN
A a A a Gametos
LA PAREJA DE ALELOS DE LA F1.
F2
Mendel tom plantas procedentes de las
A a
semillas de la primera generacin (F1 ) del
experimento anterior, amarillas, Aa, y las A AA Aa
poliniz entre s. Del cruce obtuvo semillas
amarillas y verdes en la proporcin 3:1 (75% a Aa aa
amarillas y 25% verdes). As pues, aunque el
alelo que determina la coloracin verde de las
semillas pareca haber desaparecido en la Fig. 7 2 Ley de Mendel.

primera generacin filial, vuelve a manifestarse


en esta segunda generacin.

RETROCRUZAMIENTO

El retrocruzamiento permite determinar si un individuo que exhibe el fenotipo del gen


dominante es homocigtico (AA) o heterocigtico (Aa). El nombre de retrocruzamiento se
debe a que para saber si los descendientes de la F2 son homocigticos o heterocigticos se

J. L. Snchez Guilln Pgina III-10-4


III) La informacin celular 10) Herencia gentica

cruzan con el parental homocigtico recesivo


Amarillo Verde
(aa). F1 A? aa

As, para saber si una planta de guisantes Gametos A ? a

amarilla es AA o Aa, la cruzaremos con una


?=A ?=a
planta verde (aa). Si los descendientes son
todos amarillos, esto querr decir que la planta a
a

problema es homocigtica (AA) y si la mitad A


Amarillo
Amarillo
AA A Aa
son amarillos y la otra mitad verdes, la planta
Amarillo
ser heterocigtica (Aa). A
50% Verde
Aa a aa

HERENCIA DE DOS CARACTERES


Fig. 8 Retrocruzamiento.
SIMULTANEAMENTE

A) GENES LOCALIZADOS EN PARES DE


CROMOSOMAS HOMLOGOS DISTINTOS
A a

B b

En los guisantes, los genes A y a determinan el


color y los genes B y b determinan la textura de
la piel (B, lisa y b, rugosa). El locus (locus=
lugar, localizacin) para los genes que A A a a

determinan estos dos caracteres se encuentra B b B b

en pares de cromosomas homlogos distintos.

Fig. 9 Gametos que forma un dihbrido


Cuando los genes no alelos, genes que
(Aa,Bb) cuando los genes que determinan ambos
determinan dos caracteres distintos, se caracteres son independientes.
encuentran en pares de cromosomas
homlogos diferentes, como es el caso del
color y de la textura de los guisantes, se AaBb
AaBb X
transmiten a la F2 independientemente unos de
otros.

AB Ab aB ab AB Ab aB ab
A esta conclusin lleg Mendel en su 3 Ley
contabilizando los descendientes de los AB Ab aB ab
cruzamientos de la autopolinizacin de una
AB AA,BB AA,Bb Aa,BB Aa,Bb
planta amarillo, lisa, doble heterocigtica
(Aa,Bb), al obtener una segregacin: 9:3:3:1. Ab AA,Bb AA,bb Aa,Bb Aa,bb

aB Aa,BB Aa,Bb aa,BB aa,Bb


9, amarillos, lisos;
ab Aa,Bb Aa,bb aa,Bb aa,bb
3, amarillos, rugosos;
3, verdes, lisos;
1, verde, rugoso. Fig. 10 3 Ley de Mendel. Segregacin 9:3:3:1
que demuestra que ambos caracteres, color de la
piel y textura, son independientes.

J. L. Snchez Guilln Pgina III-10-5


III) La informacin celular 10) Herencia gentica

Esto hoy se entiende porque sabemos que los


cromosomas emigran aleatoriamente a los
polos y durante la anafase I se separan los
cromosomas homlogos de cada par. Despus, A

B
a

en la anafase II, se separan las cromtidas de


cada cromosoma y se forman cuatro clases de
gametos, cada uno de los cuales posee n
cromosomas. Puesto que su distribucin se
a
realiza totalmente al azar, una planta que sea
A

B b

(Aa,Bb) podr agrupar los genes de cuatro


formas diferentes (Fig. 9) y formar cuatro tipos
de gametos: (A,B), (A,b), (a,B) y (a,b), todos Fig. 11 Gametos que forma un dihbrido
(Aa,Bb) cuando los genes que determinan ambos
ellos en el mismo porcentaje: 25%.
caracteres se encuentran ligados con ligamiento
absoluto.
B) GENES LOCALIZADOS EN EL MISMO PAR
DE CROMOSOMAS HOMLOGOS. LIGAMIEN-
TO Y RECOMBINACIN.
A a A a A A a a

Los genes que se encuentran en el mismo B b B b B b B b

cromosoma se dice que son genes ligados.


Todos los genes que se encuentran en un
mismo cromosoma constitu yen un grupo de
ligamiento. A A a a

B b B b p) parentales

B1) LIGAMIENTO ABSOLUTO p r p r) recombinantes


r

Si los genes ligados estn muy prximos, lo Fig. 12 Gametos que forma un dihbrido
ms probable ser que durante la profase I de la (Aa,Bb) cuando los genes que determinan ambos
caracteres se encuentran ligados con ligamiento
meiosis no se produzca ningn sobrecruzamien- relativo y hay recombinacin entre ellos.
to entre ellos y pasarn juntos a los gametos
sin separarse. En este caso diremos que el
ligamiento es absoluto.

As, supongamos dos genes ligados a y b, y A a

un individuo diheterocigtico Aa,Bb en el que B b

los genes A y B estn en un cromosoma y a y b


en el homlogo. Podremos representar los
genes en los cromosomas como se indica en la
Fig. 11 . Estos genes, al estar muy prximos, lo A a

ms probable ser que no haya sobrecruza-


B b

miento entre los loci a y b, los gametos


recibirn o el cromosoma con A,B o el que porte
Fig. 13 Gametos que forma un dihbrido
a,b. Por lo tanto, se formarn slo dos clases
(Aa,Bb) cuando los genes que determinan ambos
de gametos: A,B y a,b (ver Fig. 11 ). caracteres se encuentran ligados con ligamiento
relativo y no hay recombinacin entre ellos.

J. L. Snchez Guilln Pgina III-10-6


III) La informacin celular 10) Herencia gentica

B2) LIGAMIENTO RELATIVO: ENTRECRUZAMIENTO CROMOSMICO Y


RECOMBINACIN

Si los loci ligados se encuentran lo suficientemente separados, en la profase I de la meiosis,


podr producirse un sobrecruzamiento entre ellos, lo que dar lugar a que se formen cuatro
tipos de gametos (ver Fig. 12 ), mientras que en otras no se producir, y slo se formarn dos
tipos de gametos (ver Fig. 13 ).

Obsrvese que, de los cuatro gametos surgidos de la meiosis con sobrecruzamiento, dos de
ellos tienen los genes ligados de la misma manera que en los cromosomas de los
progenitores, son los gametos parentales (p), los otros dos gametos llevan las cromtidas
producto del sobrecruzamiento y se les llama gametos recombinantes (r).

La probabilidad de que se produzca un sobrecruzamiento entre genes ligados depende de la


distancia que separa los loci en el cromosoma. Entre loci muy prximos ser difcil que se
produzca recombinacin y la probabilidad de que los gametos lleven las cromtidas
recombinantes ser baja. Por el contrario, entre dos loci muy alejados el sobrecruzamiento
ser muy probable por lo que la cantidad de gametos recombinantes se acercar al 50% del
total de los gametos producidos.

Es de destacar que en el macho de Drosophila no se producen sobrecruzamientos.

FRECUENCIA DE RECOMBINACIN. MAPAS CROMOSMICOS

La probabilidad de los gametos recombinantes


para un par de genes ligados es un valor cons-
eb
tante que depende, principalmente, de la
distancia a la que se encuentren los genes en el
20
cromosoma. Esta probabilidad recibe el nombre
de frecuencia de recombinacin. La frecuencia
44 cu
de recombinacin entre dos genes ligados es
igual a la suma de las frecuencias de los game-
tos recombinantes. La unidad de medida de la 24

frecuencia de recombinacin es el centimorgan


(). se

1 = 1% de recombinacin Fig. 14 Distancias relativas de los genes


ligados en Drosophila: eb (cuerpo bano); cu (alas
Si dos genes ligados se encuentran alejados en curvadas); se (ojos color sepia). Estas distancias se
han establecido en base a la frecuencia de
un cromosoma su frecuencia de recombinacin
recombinacin entre estos tres genes.
ser alta, prxima al 50%, y baja si se
encuentran prximos.

Veamos un ejemplo con los siguientes genes en Drosophila: el gen cu, que da lugar a alas

J. L. Snchez Guilln Pgina III-10-7


III) La informacin celular 10) Herencia gentica

anormales curvadas, el gen se, que produce ojos de color sepia, frente a los normales de
color rojo, y el gen eb que produce una coloracin bano del cuerpo. Todos ellos son genes
ligados. Las frecuencias de recombinacin son respectivamente:

se con cu ...... 24% ...... 24


se con eb ...... 44% ...... 44
cu con eb ...... 20% ...... 20

Lgicamente, esto nos indica que se y eb son los ms alejados entre s y que cu se
encuentra entre ambos (ver Fig. 14).

De acuerdo con esto podremos establecer el orden en que se encuentran estos tres genes
en el cromosoma y tambin las distancias relativas medidas en centimorgan.

Las frecuencias de recombinacin han permitido elaborar mapas cromosmicos. Estos


mapas indican la situacin y la distancia relativa a la que se encuentran los genes en el
cromosoma.

LA DETERMINACIN DEL SEXO

Es sabido que en la especie humana el sexo viene determinado por la pareja cromosmica
XY. Ahora bien, en la naturaleza, existen diferentes mecanismos para la determinacin del
sexo. As:

a) Determinacin sexual debida a un par de genes; como ocurre, por ejemplo, en las plantas
dioicas.

b) Determinacin sexual por cromosomas


Mujer Hombre
sexuales. En este caso, el sexo depende de la XX XY
presencia o ausencia de determinados
cromosomas. En el reino animal, los sistemas
ms frecuentes de determinacin sexual son: X X Y

- Sistema XX-XY . Como el del hombre y el


resto de los mamferos. En el que el sexo
femenino tiene dos cromosomas iguales XX
(homogamtico); por lo que todos los gametos
llevarn el cromosoma X. El sexo masculino XX XY
posee un conjunto XY (heterogamtico); por lo
que dar lugar a dos tipos de gametos, la mitad
con el cromosoma X y la otra mitad con el Fig. 15 Determinacin del sexo en la especie
humana.
cromosoma Y.

- Sistema ZZ-ZW. Se da en aves, reptiles, etc. En este caso el macho es el sexo


homogamtico (ZZ) y la hembra el heterogamtico (ZW).

J. L. Snchez Guilln Pgina III-10-8


III) La informacin celular 10) Herencia gentica

- Sistema XX-XO. La hembra es homogamtica XX y el macho heterogamtico (XO) posee


un slo cromosoma X y no tiene cromosoma Y. Se da en liblulas, saltamontes...

c) Sexo por haploidia: Los huevos fecundados (diploides) dan lugar a hembras y los no
fecundados (haploides) a machos. Ejemplo: las abejas.

d) Sexo debido al equilibrio gentico: Drosophila posee un sistema XX-XY pero el


cromosoma Y no determina el sexo masculino, aunque sea necesario para la fertilidad. La
determinacin sexual se encuentra en los autosomas y depende de la relacin numrica
entre el nmero de cromosomas X y el de juegos autosmicos (A).

X/A < 0,5.................Supermacho


X/A = 0,5 ................Macho
X/A entre 0,5 y 1.......Intersexo
X/A = 1.....................Hembra
X/A > 1.....................Superhembra

e) Sexo debido a factores ambientales. En ciertos casos, por ejemplo, en ciertas especies
de cocodrilos, el sexo se determina en funcin de la temperatura de incubacin de los
huevos.

f) Inversin sexual. El sexo depende de la proporcin de machos y hembras existentes en la


poblacin o de la edad. As, ciertos peces cuando son jvenes tienen un sexo y de adultos
tienen otro.

LA HERENCIA LIGADA AL SEXO EN LA ESPECIE HUMANA

Los cromosomas sexuales, adems de los genes que determinan el sexo, tienen tambin
otros genes que no tienen nada que ver con los caracteres sexuales. Estos genes son los
genes ligados al sexo.

En la especie humana, el cromosoma Y, al ser de menor tamao, posee menos informacin


que el cromosoma X. Esta es la razn de que la mayora de los caracteres ligados al sexo
que se conocen sean caracteres ligados al cromosoma X. As, en el cromosoma X se han
detectado hasta 150 loci, algunos de ellos portadores de ciertas anomalas.

- Herencia ligada al cromosoma Y

Un gen ligado al cromosoma Y se manifestar en todos los hombres que lo lleven y slo en
los hombres, independientemente de que sea dominante o recesivo. Entre los pocos casos
que se conocen de anormalidad hereditaria ligada al cromosoma Y tenemos la hipertricosis
del pabelln auricular. Se trata de un carcter cuyo gen determina la aparicin de pelo en el
pabelln de la oreja.

J. L. Snchez Guilln Pgina III-10-9


III) La informacin celular 10) Herencia gentica

- Herencia ligada al cromosoma X


Mujer Hombre
XHXh XHY
Los genes dominantes ligados al cromosoma X
son muy poco frecuentes. Se trata de un tipo
de herencia que se caracteriza por que los XH Xh XH Y
varones afectados transmiten el carcter a
todas sus hijas y a ninguno de sus hijos. Las
mujeres afectadas lo transmiten a la mitad de
XH Y
sus hijos y a la mitad de sus hijas. Un ejemplo
de este tipo de herencia es la hipofosfatemis XH XHXH XHY
(raquitismo que no cede con la administracin
de vitamina D). Xh XHXh XhY

Los genes recesivos ligados al cromosoma X Fig. 16 Herencia de la hemofilia en la especie


slo se manifiestan en la mujer, en el caso de humana. Posible descendencia entre una mujer
portadora y un hombre no hemoflico.
que estn en homocigosis, en el hombre se
manifestarn siempre.

Un ejemplo tpico es el de la hemofilia. Se


trata de una enfermedad hereditaria caracteriza-
Mujer Hombre
da por ausencia en la sangre de las personas
XHXH Xh Y
que la padecen de un factor necesario para su
coagulacin. Las personas hemoflicas, sin un
tratamiento adecuado, estn expuestas a XH Xh Y
graves hemorragias. Esta grave enfermedad es
bien conocida debido a que la reina Victoria de
Inglaterra (que era portadora del gen) lo
transmiti a uno de sus hijos (muerto de una
Xh Y
hemorragia tras una cada) y a dos de sus hijas,
responsables de que la enfermedad se XH XHXh XH Y
extendiera entre varias casas reales europeas.

El gen de la hemofilia, que representaremos Fig. 17 Herencia de la hemofilia en la especie


humana. Posible descendencia entre una mujer
como X h, es recesivo respecto al gen normal,
normal, no portadora y un hombre hemoflico.
X H. Se han conocido muy pocos casos de
mujeres hemoflicas, y esto por dos razones:

- En primer lugar, porque para que se produzca una mujer hemofli ca es necesario que el
padre sea homoflico y la madre portadora o hemoflica. El gen de la hemofilia no es muy
frecuente en la poblacin humana, lo que hace raras estas uniones.

- Por otra parte, algunos autores indican que el gen de la hemofilia podra tener efectos
letales, mortales, en homocigosis. Aunque estudios recientes parecen desmentirlo.

A pesar de todo se han citado algunos caso de mujeres hemofli cas. Una de ellas lleg

J. L. Snchez Guilln Pgina III-10-10


III) La informacin celular 10) Herencia gentica

incluso a tener descendencia y sobrevivi a la hemorragia postparto. Esto se interpreta


como una consecuencia de los distintos grados de expresividad (capacidad para
manifestarse fenotpicamente) que puede tener un gen. El cuadro siguiente nos informa
respecto a los genotipos y fenotipos posibles y en las figuras 16 y 17 tenemos dos
ejemplos de herencia del carcter.

Genotipos Fenotipos
X HX H Mujer normal
X HX h Mujer portadora
X hX h Mujer hemoflica )letal?
X HY Hombre normal
X hY Hombre hemoflico

Otro caso conocido de herencia ligada al cromosoma X es el daltonismo o ceguera para los
colores rojo y verde. Las personas que tienen esta anomala se caracterizan por no poder
distinguir ambos colores uno del otro. Su herencia se explica considerndolo tambin como
un carcter que viene determinado por un gen recesivo ligado al cromosoma X. Otra grave
enfermedad hereditaria ligada al cromosoma X y recesiva es la distrofia muscular de
Duchenne.

HERENCIA INFLUIDA POR EL SEXO

Existen caracteres, como la calvicie en la especie humana y la presencia o ausencia de


cuernos en algunas razas ovinas, que estn determinados por genes situados en la parte
homloga de los cromosomas sexuales o bien en los autosomas, y cuya manifestacin
depende del sexo. La calvicie, por ejemplo, es dominante en el hombre y recesiva en la
mujer.
Genotipos Fenotipos

Hombres Mujeres

CC Normal Normal

Cc Calvo Normal

cc Calvo Calva

OTROS TIPOS DE HERENCIA

ALELISMO MLTIPLE (ALELOMORFOS MLTIPLES)

Hasta aqu slo se ha contemplado la posibilidad de que existan dos alelos diferentes para
cada gen. Pero, puesto que un gen puede ser modificado por el proceso de mutacin,
tericamente es posible que en una poblacin de individuos existan varios alelos para un
gen. Este fenmeno se denomina alelismo mltiple y el conjunto de alelos pertenecientes el
mismo locus constituye una serie allica.

J. L. Snchez Guilln Pgina III-10-11


III) La informacin celular 10) Herencia gentica

Un caso de alelismo mltiple bien conocido es el de los genes que determinan los grupos
sanguneos en la especie humana o sistema ABO. Se trata de tres genes alelos IA , IB e i. IA e
IB son codominantes y ambos son dominantes respecto al gen i, que es recesivo. El gen IA
da lugar al grupo sanguneo A, el gen IB da lugar al B y el gen i, en homocigosis, da lugar al
grupo O. Si IA e IB estn juntos en el mismo individuo, este ser del grupo AB. Los
diferentes fenotipos y genotipos posibles para estos tres genes alelos se encuentran en el
cuadro.

CUADRO
GENOTIPOS FENOTIPOS
IAIA , IAi A
IBIB, IBi B
IAIB AB
ii O

ALELOS LETALES (FACTORES LETALES)

En ciertos casos las mutaciones que se producen dan lugar a genes que, por la razn que
sea, hacen que el individuo no sea viable. Esto es, producen su muerte bien en el periodo
prenatal o postnatal, antes de que el individuo alcance la madurez y pueda reproducirse.
Estos genes se denominan genes letales. Un alelo letal dominante nunca ser heredable
porque el individuo que lo posee nunca llegar a la madurez y no podr dejar descendencia.
Los alelos letales dominantes se originan por mutacin de un gen normal y son eliminados
en la misma generacin en la que aparecen. Por el contrario, los genes letales recesivos
quedan enmascarados bajo la condicin de heterocigosis y en un cruzamiento entre
heterocigotos la cuarta parte de los descendientes morirn.

Por ejemplo, supongamos que del gen L, normal, existe un alelo l, letal. En un cruce entre
dos individuos heterocigticos para este gen, obtendremos el siguiente cuadro gamtico:

CUADRO GAMTICO
/ L l
L normal normal
LL Ll
l normal morirn
Ll ll

POLIGENIA (HERENCIA MULTIFACTORIAL)

Cuando estudiamos el carcter color de la piel del guisante, vimos que slo caban dos
fenotipos posibles: verde y amarillo. Esto es debido a que el carcter viene determinado
nicamente por un par de genes alelos.

J. L. Snchez Guilln Pgina III-10-12


III) La informacin celular 10) Herencia gentica

No obstante, la mayora de los caracteres presentan una variacin continua del fenotipo
sin que podamos establecer grupos claramente distinguibles. Los ejemplos son numerosos:
estatura, peso, color del pelo o de los ojos, produccin de leche en el ganado vacuno, etc.

Si cuantificamos estos caracteres, si ello es


posible, veremos que sus valores siguen una
distribucin normal, tambin llamada campana
de Gauss, con unos pocos individuos en los

Nmero de individuos
valores extremos y un gran nmero en los
centrales.

Esto suele ser debido a que estos caracteres,


que llamaremos mtricos o cuantitativos, estn
controlados por un gran nmero de genes no Peso en Kg

alelos situados en el mismo o en distinto par de


Fig. 18 Campana de Gauss.
cromosomas. Los caracteres controlados por
varios genes no alelos se llaman polignicos.

Un ejemplo de carcter polignico es el de la pigmentacin de la piel en la especie humana


que se explica por la accin de alelos con efecto acumulativo. En principio se pens que el
color de la piel era controlado por dos pares de genes.

-N1 N1 ,N2 N2 (piel muy oscura)


-n1 n1 ,n 2 n2 (piel muy clara)

Otras combinaciones daran pieles intermedias. Ejemplo: N1 n1 , N2 n2 .

Un carcter polignico determina la formacin de un gran nmero de fenotipos. As, por


ejemplo, en el caso de que un carcter venga determinado por tres genes: A, B, C y sus
correspondientes alelos recesivos: a, b, c; un individuo triheterocigtico Aa,Bb,Cc podr
formar 8 tipos de gametos diferentes. Si lo cruzamos con una hembra tambin trihete-
rocigtica el nmero de genotipos posibles ser de 27.

El nmero de gametos que puede producir un heterocigoto es igual a 2 n siendo n el nmero


de loci que controlan el carcter.

Por ltimo, indicar que la accin del ambiente modifica la expresin del genotipo y suaviza
las discontinuidades entre los fenotipos. Debido a todo esto los caracteres que vienen
determinados por varios genes no alelos presentan una distribucin que sigue la forma de la
curva de Gauss.

LA HERENCIA NO NUCLEAR

No debemos olvidar que los plastos y las mitocondrias poseen material gentico. Este ADN

J. L. Snchez Guilln Pgina III-10-13


III) La informacin celular 10) Herencia gentica

no nuclear contiene informacin que tambin ser transmitida a la descendencia. Ahora


bien, tanto en los animales como en los vegetales, las mitocondrias y los plastos son
transmitidos nicamente por el gameto femenino, ya que del espermatozoide slo pasan al
zigoto el ncleo y en ciertos casos el citocentro. El ADN no nuclear dar lugar a una
herencia materna o de influencia exclusivamente materna.

Por ejemplo, en el dondiego de noche (Mirabilis jalapa), la distribucin de la clorofila vara


de una rama a otra y por lo tanto el color ms verde o ms blanco de las hojas. Algunas
ramas tienen hojas de color blanco por no tener clorofila en sus cloroplastos, otras son slo
verdes y otras variegadas (verdes y blancas). Si fecundamos flores de una rama verde, la
descendencia ser verde; independientemente de la procedencia del polen. Si fecundamos
flores de ramas de hojas blancas, la descendencia ser blanca. Si la rama es de hojas
variegadas, saldrn plantas verdes, blancas o, la mayora, variegadas.

La explicacin se encuentra en que en los sacos embrionario que se producen en las flores
de las ramas de hojas blancas no hay cloroplastos con la capacidad para fabricar clorofila.
En las flores de las ramas variegadas hay dos tipos de cloroplastos: unos que fabrican
clorofila y otros no. Segn se repartan entre las clulas hijas, unas llevarn un tipo de
cloroplastos, otras el otro tipo y la mayora una mezcla de ambos. Las flores de ramas de
hojas slo verdes poseen cloroplastos con la capacidad de fabricar la clorofila y no tienen
cloroplastos del otro tipo; por lo tanto, los descendientes que se produzcan a partir de flores
de estas ramas tendrn hojas exclusivamente verdes.

GENTICA HUMANA

MTODOS DE EXAMEN GENTICO

La transmisin de los caracteres hereditarios


en el hombre sigue las mismas leyes que las
II
que son aplicables con carcter general al resto 1 2 3 4

de los seres vivos. Algunos caracteres son


IIII
dominantes, y otros recesivos; existen
5 6 7 8 9 10
caracteres monognicos y, la mayora,
III
III
polignicos; genes letales, y alteraciones
genticas tanto gnicas como cromosmicas de 11 12 13

lo ms diversas. En el hombre, no obstante,


todas estas alteraciones tienen casi siempre Fig. 19 Ejemplo de genealoga.
una gran importancia por las graves
consecuencias que pueden tener para la
descendencia.

Como en el hombre no pueden hacerse experiencias como las que hizo Mendel se
necesitan otras tcnicas para el estudio de la gentica humana. Los principales mtodos son:
- Examen del rbol genealgico: El estudio de los ascendientes y de los descendientes de un

J. L. Snchez Guilln Pgina III-10-14


III) La informacin celular 10) Herencia gentica

individuo puede darnos una informacin muy valiosa. Se trata en particular de un mtodo
inestimable para la deteccin de las enfermedades hereditarias y para poder predecir su
aparicin en los hijos.

Veamos el siguiente caso: El


I
Epiteloma adenoides cysticun es una 1 2

enfermedad hereditaria que produce


en el rostro pequeos ndulos
II
coloreados, en el resto del cuerpo hay 1 2 3 4 5 6 7 8 9

tambin tumores de dimensin


variable. El rbol genealgico de una III
Sanos
familia en la que varios individuos
1 2 3 4 5 6
presentaban la enfermedad se Enfermos

representa a continuacin.
Fig. 20 rbol genealgico de una familia con epiteloma.

El anlisis de la informacin
proporcionada por este rbol nos va a permitir sacar las siguientes conclusiones:

1) El gen responsable de la enfermedad es dominante, pues en el caso de ser recesivo, 1 y


2 tendran que ser homocigticos y sus descendientes seran todos enfermos.

2) Si mediante T representamos el gen que determina la enfermedad y con t el gen normal,


tendremos los siguientes genotipos (G).

TABLA
Generacin I Generacin II Generacin III

G G G

1 Tt 1 tt 1 Tt o TT

2 Tt 2 Tt o TT 2 tt

3 tt 3 Tt o TT

4 Tt o TT 4 Tt o TT

5 Tt o TT 5 tt

6 tt 6 Tt o TT

7 tt

8 Tt

9 tt

En un rbol genealgico, los hombres (o los machos en las especies animales o vegetales)
se representan mediante un cuadrado, las mujeres (o las hembras si se trata de otras
especies diferentes de la especie humana) se representan mediante un crculo. Los

J. L. Snchez Guilln Pgina III-10-15


III) La informacin celular 10) Herencia gentica

cruzamientos se indican mediante una lnea horizontal y los hijos por lneas que parten del
trazo horizontal. Los integrantes de cada generacin se numeran correlativamente y las
diferentes generaciones se indican al margen mediante nmeros romanos.

Ejemplos de caracteres genticos mendelianos en la especie humana

A a
D d

E e F f

Algunos fenotipos en la especie humana. A y a) Lengua plegada y recta; D y d) lbulo de la oreja libre y
pegado; E y e) lnea frontal del pelo en pico y recto; F y f) pulgar curvado y recto.

- Gemeologa : Los gemelos procedentes de un mismo zigoto, gemelos univitelinos, tienen


en sus cromosomas la misma informacin gentica, son genticamente idnticos, y si se han
criado juntos, las diferencias que presenten sern debidas a factores ambientales. Por el
contrario, si se han criado separados, las similitudes que tengan podran ser debidas a
factores genticos. Estos estudios son importantes, sobre todo, para aquellos rasgos
psicolgicos en los que es muy difcil delimitar lo que es heredable y lo que es ambiental o
cultural.

- Exmenes citogenticos: Estn basados en el estudio del cariotipo. Estos exmenes


pueden permitir la deteccin de anomalas cromosmicas an antes de que se manifiesten.
En particular, son fcilmente detectables las aneuploidas (sndromes de Down, Turner y
Klinefelter) y las mutaciones debidas a la alteracin de la estructura de los cromosomas.
Estas ltimas se detectan por los apareamientos anormales que se producen en la meiosis.

Sobre todo es interesante el estudio cromosmico de las clulas que se encuentran en las
vellosidades de la placenta y en el lquido amnitico, tcnica esta ltima que se conoce
como amniocentesis, pues permite la deteccin precoz de las anomalas cromosmicas.

J. L. Snchez Guilln Pgina III-10-16


III) La informacin celular 10) Herencia gentica

La amniocentesis consiste en una puncin que


se realiza durante el embarazo a travs del
abdomen hasta llegar al lqui do amnitico. Se
extrae con una jeringuilla una cierta cantidad
de lquido. ste contiene clulas fetales que,
sometidas a cultivo en un medio adecuado,
entran en divisin. El tratamiento con
colchicina bloquea las divisiones celulares en
metafase. Preparaciones microscpicas de
estas clulas son fotografiadas y sus cariotipos
analizados.
Fig. 21 Amniocentesis.

J. L. Snchez Guilln Pgina III-10-17


III) La informacin celular 11) Gentica aplicada

11) GENTICA APLICADA

INGENIERA GENTICA

Se trata de una serie de tcnicas que se basan


en la introduccin de genes en el genoma de un
individuo que no los presente.
1 2

Estas tcnicas fundamentalmente son: 3

a) Transferencia de genes de una especie a


4
otra: Hay tcnicas por las que se pueden
transferir genes de una especie a otra. As,
mediante un vector apropiado, que puede ser
un plsmido o un virus, se puede introducir un
gen de una especie en otra diferente. Con estas Fig. 1 Transferencia de genes mediante el uso
tcnicas se pueden pasar genes de eucariotas a de un plsmido de una bacteria. 1) Extraccin de
eucariotas, de eucariotas a procariotas y de un plsmido de una bacteria; 2) unin del plsmido
procariotas a procariotas. Por ejemplo: se puede y el gen de otra especie que se quiere introducir; 3)
introducir en bacterias el gen que produce la introduccin del gen en clulas del organismo
insulina humana. De esta manera las bacterias receptor usando el plsmido como vector; 4)
transferencia de las clulas con el nuevo gen al
producen fcilmente y en abundancia esta
organismo receptor.
hormona.

b) Tcnica de la PCR: Tambin existen mtodos


para amplificar una determinada secuencia o
fragmento de ADN. La ms conocida es la
tcnica de la reaccin en cadena de la
polimerasa PCR. As se consigue multiplicar un
determinado fragmento de ADN millones de
veces para poder tener una cantidad suficiente
para estudiarlo. Sin esta tcnica seran
imposibles los estudios de ADN para el
reconocimiento de la paternidad o en caso de
delito, pues la cantidad de ADN presente en las
clulas es tan pequea, del orden de
picogramos, que se necesitara una gran Fig. 2 Tcnica de la PCR. Replicacin en
cantidad de material celular para tener una cadena del ADN para su obtencin en cantidades
cantidad apreciable de ADN. adecuadas para posteriores anlisis.

Todo esto ha servido para el desarrollo de la ingeniera gentica, ya que aparte de conocer
los aspectos moleculares ms ntimos de la actividad biolgica, se han encontrado
numerosas aplicaciones en distintos campos de la industria, la medicina, la farmacologa, la
agricultura, la ganadera, etc...

LA INGENIERA GENTICA Y LA TERAPIA DE ENFERMEDADES HUMANAS

Hay en los humanos numerosas enfermedades de carcter hereditario o relacionadas con


alteraciones genticas. En la mayora de los casos ni siquiera se han identificado los genes
responsables y en muy pocos casos se dispone del mecanismo para incorporar el gen
correcto a las clulas del individuo afectado. No obstante existen varias lneas de

J. L. Snchez Guilln Pgina III-11-1


III) La informacin celular 11) Gentica aplicada

investigacin que se basan en:

11) Transferir un gen humano normal a una bacteria, obteniendo de ella la sustancia
necesaria para luego inocularla en el enfermo.

21) Transferir un gen correcto a las clulas de una persona: terapia de clulas
somticas.

31) En el futuro, si el gen se hiciera llegar a un vulo, un espermatozoide o el zigoto,


todas las clulas del individuo tendran el gen normal: Terapia de clulas germinales
(no es legal).

Todas estas terapias estn sometidas a cambios muy rpidos. Veamos algunos ejemplos
en los que ya en la actualidad se emplean estas tcnicas o estn en fase de ensayo o
investigacin.

1) Sustancias humanas producidas por bacterias

En la actualidad, una de las tcnicas de ingeniera gentica ms empleada consiste en la


produccin de sustancias humanas por bacterias a las que se les ha introducido el gen
correspondiente. Entre las sustancias que ya se obtienen mediante esta tcnica estn:

- La insulina.- Es una hormona formada por dos pptidos. El pptido A (21 aminoci-
do) y el pptido B (30 aminocidos). Los genes que codifican ambos pptidos se
aslan de clulas humanas y se introducen en estirpes bacterianas diferentes. Cada
clon sintetiza uno de los polipptidos. stos se aslan, se purifican, se activan los
grupos -SH para que se unan los dos pptidos y obtenemos insulina humana.

- La hormona del crecimiento.- Es un polipptido de 191 aminocidos. Se utiliza una


tcnica similar al ejemplo anterior.

- El interfern.- Es una protena de peso molecular entre 16.000 y 20.000, con una
cadena glucosdica. En la actualidad se ha conseguido aislar el ADN responsable del
interfern en leucocitos y linfoblastos infectados. El problema es que se obtiene una
produccin baja a causa de la inestabilidad de la molcula.

- El factor VIII de la coagulacin.

2) La ingeniera gentica en humanos

Esta tcnica se basa en la introduccin de un gen correcto en las clulas humanas para
sustituir un gen deficiente. Algunos casos en los que esta tcnica est en estudio o en
proceso de ensayo son:

* La Talasemia.- Grupo de enfermedades relacionadas con la presencia de hemoglobina


distinta de la normal.

- Tratamiento: retirar clulas de la mdula sea del enfermo, introducir en ellas el gen
correcto mediante un virus, volverlas al torrente circulatorio.

- Dificultades: La seleccin de las clulas que producen hemoglobina entre todas las
clulas de la mdula, es difcil.

J. L. Snchez Guilln Pgina III-11-2


III) La informacin celular 11) Gentica aplicada

- Los genes introducidos se expresan poco.


- Las alteraciones en su manifestacin son peligrosas.

* La carencia de la enzima Adenosin Desaminasa (ADA).- Fallo en los leucocitos.


Enfermedad de los nios burbuja o inmunodeficiencia combinada grave (SCID).

- Tratamiento: semejante al de la Talasemia.

3) Enfermedades sometidas a ensayos clnicos de terapia gnica

* Cncer: melanoma, rin, ovario, neuroblastoma, garganta, pulmn, cerebro,


hgado, mama, colon, prstata, leucemia, linfoma...

* Fibrosis qustica

* Hemofilia

* Artritis reumatoide

LA INGENIERA GENTICA Y LA PRODUCCIN AGRCOLA Y ANIMAL

Llamamos organismos transgnicos a aquellos que se desarrollan a partir de una clula en la


que se han introducido genes extraos.

El objetivo de estas tcnicas es obtener caractersticas "tiles" de otros organismos. Estas


caractersticas pueden ser muy variadas.

Fue una tcnica difcil por la impermeabilidad de las membranas de las clulas eucariotas
animales y por la pared celulsica de las vegetales, aunque cada vez hay mejores tcnicas
para resolver estos problemas.

La tcnica ms empleada es la de microinyeccin (introduccin de ADN mediante


microjeringa y micromanipulador).

1) Ejemplos del empleo de estas tcnicas en la


produccin agrcola: Bacteria con el plsmido
transportador del gen Planta transgnica

Las tcnicas ms empleadas en las plantas son:

* Uso de pistolas con microbalas de metal


recubiertas de ADN.

* Uso como vector de un plsmido de una


bacteria simbionte que produce tumores.
1 2 3

Mediante estas tcnicas se han obtenido o se


est en vas de obtener: Fig. 3 Uso como vector de un plsmido de una
bacteria simbionte.
a) Variedades transgnicas del maz que:

J. L. Snchez Guilln Pgina III-11-3


III) La informacin celular 11) Gentica aplicada

* Resisten heladas.- incorporacin de un


gen de un pez resistente al fro.

* Resisten plagas.- incorporacin de un


gen del trigo. Microbala
recubierta de ADN

* Resisten herbicidas.- incorporacin de


un gen bacteriano. Fig. 4 Transferencia de genes mediante disparo
de microbalas impregnadas en ADN

b) Variedades transgnicas del trigo que:

* Son ms nutritivas.

* Resistentes a plagas y herbicidas.


Incorporacin de varios genes de
insectos y bacterias.
Planta de maz en El barrenador del
la que se ha tallo del maz
c) Variedades de tomate que maduran ms introducido un gen ingiere la planta
que produce la modificada.
lentamente por anulacin de un gen que regula protena Cry

la maduracin por haberlo introducido en


sentido contrario, se producen dos ARNm
complementarios que hibridan y no se traducen.

d) Plantas de tabaco transgnicas: Se est


trabajando en la insercin de "genes nif" que La protena causa la
posibilitaran el aprovechamiento directo del N2 lisis de los tejidos del
barrenador del maz.
atmosfrico. Se usa esta planta porque es una
planta muy maleable. Dos o tres das
despus el
barrenador del maz
muere.

2) Ejemplos del empleo de estas tcnicas en la


produccin animal: Fig. 5 Bacillus thuringiensis es una bacteria
que se encuentra en los suelos en todo el mundo.
En los animales estas tcnicas se emplean ms Esta bacteria produce una protena Cry) que mata
en peces porque la fecundacin es externa. Las en forma selectiva un grupo especfico de insectos.
La protena Cry es txico para el aparato digestivo
tcnicas ms comunes son:
de los insectos sensibles. Una vez ingeridas, las
enzimas digestivas del insecto activan la frmula
* La microinyeccin de los genes en el
txica de la protena. Las protenas Cry se ligan a
zigoto.
"receptores" especficos del revestimiento interno
de los intestinos y daan las clulas. Los insectos
* Campos elctricos que hacen dejan de comer dos horas despus de haber ingerido
permeable la membrana y permiten la el primer bocado y, si han comido suficiente
entrada de material gentico. cantidad de toxina, mueren dos o tres das despus.
Durante ms de treinta aos se han aplicado con
Mediante estas tcnicas se han obtenido o se xito en una serie de cultivos diversas frmulas
est en vas de obtener: lquidas y granuladas de Bt contra lepidpteros
(orugas).
* Carpas transgnicas que crecen de un La insercin en el maz del gen procedente de
20 a un 40% ms rpido. Se consiguen Bacillus thurigiensis, que codifica esta protena
introduciendo el gen de la hormona del txica para el insecto, que provoca la enfermedad
crecimiento de la trucha arco iris. Se conocida como taladro del maz, hace que esta
estimula aadiendo Cinc a la dieta. planta se vuelva resistente al insecto.

* Salmones transgnicos.- Resisten


mejor las temperaturas bajas. Se
consigue por incorporacin de un gen de

J. L. Snchez Guilln Pgina III-11-4


III) La informacin celular 11) Gentica aplicada

una especie de platija del rtico.

* En mamferos se han conseguido


ratones que carecan de la hormona del
crecimiento por mutacin del gen
productor de la misma por introduccin
en el zigoto de estos ratones del gen de
la hormona del crecimiento de la rata.
ADN a transferir.
Microinyeccin del ADN
en la clula receptora.

Los ratones transgnicos conseguidos


producen 800 veces ms hormona que Fig. 6 Microinyeccin de genes en el interior de
los normales. El gen de la rata no se un zigoto receptor.
introduce en el lugar propio, sino en
otro.

RIESGOS Y ASPECTOS TICOS DE LAS TCNICAS DE INGENIERA GENTICA

* BIOSANITARIOS.- La mayora de los productos se destinan al consumo humano y


an no se puede afirmar que no sean perjudiciales para la salud.

* BIOTICO.- )Hay derecho a monopolizar el uso de la informacin gentica presente


en la naturaleza?

* BIOTECNOLGICO.- )Qu pasara si el material gentico de un virus tumoral


terminara formando parte del genoma de alguna bacteria simbionte del ser humano?
)Y si los genes que permiten la resistencia a los antibiticos entraran en el genoma
de los patgenos? )O si los microorganismos inocuos adquirieran los genes para
producir toxinas potentes como la difteria, el clera, el botulismo o el ttanos?

EL PROYECTO GENOMA HUMANO

El estudio del Genoma Humano comenz en EEUU en 1990, pero hoy hay centros en
numerosos pases implicados en el proceso. El objetivo es secuenciar completamente el
ADN. Ahora bien, esto representa un enorme trabajo pues el genoma humano se compone
de 3X10 9 de pares de bases. Si representsemos cada base por un carcter (A, T, C, G),
para poder escribirlo en un libro (a 80x50 = 4000 caracteres por pgina), necesitaramos un
libro de 750 000 pginas.

LMITES A LOS RIESGOS E IMPLICACIONES TICAS DE LA INGENIERA GENTICA

Existe un Comit Internacional de Biotica de la Unesco fundado en 1993 por Federico


Mayor Zaragoza.

Los criterios establecidos son:

* Lmites por motivos ecolgicos y de sanidad.


* Lmites por motivos ticos y morales.
* Lmites por motivos sociales.
* Lmites por motivos polticos.

La organizacin HUGO defiende que slo se puedan patentar las secuencias de ADN de las
que se sepa su funcin.

J. L. Snchez Guilln Pgina III-11-5


IV) Microbiologa 1) Microbiologa

IV

1-MICROBIOLOGA y BIOTECNOLOGA

1. CONCEPTO DE MICROORGANISMO

Los microorganismos o microbios son organismos de pequeo tamao, observables nica-


mente con la ayuda del microscopio. La Microbiologa es la rama de la Biologa que se
encarga del estudio de los microorganismos.

TIPOS DE MICROORGANISMOS Y CLASIFICACIN

Los microorganismos se clasifican en:

CLASES DE MICROORGANISMOS

a) Microorganismos con Procariotas Arqueobacterias


organizacin celular Eubacterias

- Poseen membrana celular


- Tienen como cidos nucleicos tanto
ADN como ARN).

Eucariotas Protozoos
Algas microscpicas
Hongos microscpicos

b) Microorganismos sin organizacin celular Virus


Viroides
- No poseen membranas Priones
- Nunca estn presentes los dos cidos nucleicos juntos
(ADN o ARN).
- Son parsitos estrictos de los que tienen organizacin
celular, pues carecen de metabolismo.

Fig. 1 1) Procariota (bacteria); 2, 3, 4 y 5) Protozoos; 6) Alga microscpica; 7) Hongo microscpico (levadura); 8 y


9) Virus. Cada organismo est a un aumento diferente.

J. L. Snchez Guilln Pgina IV-1-1


IV) Microbiologa 1) Microbiologa

2. LAS BACTERIAS

CLASIFICACIN, MORFOLOGA,
FISIOLOGA Y ECOLOGA BACTERIANAS

1) ARQUEOBACTERIAS: Bacterias con-


sideradas "fsiles vivientes" pues viven en
hbitats que parecen corresponder con los que
existieron en la Tierra primitiva, por ejemplo, se
encuentran en ambientes termales donde se Fig. 2 Ejemplo de organismo procaritico
alcanzan temperaturas por encima del punto de (bacteria) muy aumentada.
ebullicin del agua, en fumarolas, etc. Un
ejemplo es el de Pyrococcus furiosus que tiene
su ptimo de crecimiento a 104 1C. Tambin
pueden vivir en medios halfilos (muy salados),
por ejemplo: Halobacterium, que son halfilos
estrictos.

2) EUBACTERIAS: Son las bacterias tpi cas.


Por ejemplo Escherichia coli. Se trata de mi-
croorganismos unicelulares procariotas, cuyo
Fig. 3 1) Cocos. 2) Bacilos. 3) Vibrios. 4)
tamao oscila entre 1 y 10 micras (como son Espirilos.
muy pequeas no necesitan citoesqueleto),
adaptados a vivir en cualquier ambiente,
terrestre o acutico, pues en las diferentes
estirpes bacterianas pueden observarse todas
las formas de nutricin conocidas. Las hay
auttrofas: fotosintticas y quimiosintticas, y
hetertrofas: saprfitas, simbiticas y parasita-
rias. Esta notable diversidad de funciones
convierte a las bacterias en organismos
indispensables para el mantenimiento del
equilibrio ecolgico, ya que, como se ver ms
adelante, contribuyen al mantenimiento de los Fig. 4 Bacilos (x2000).
ciclos biogeoqumicos que permiten el reciclaje
de la materia en la biosfera.

La mayor parte de las bacterias adoptan


formas caractersticas, aunque en ocasiones la
configuracin puede verse influida por las
condiciones del medio de cultivo. Son
unicelulares, pero tambin aparecen agrupadas
cuando se mantienen unidas tras la biparticin.
Entre las formas ms comunes destacan las
siguientes:
Fig. 5 Bacilos (muy aumentados) .
* Cocos, de aspecto redondeado, que aparecen
aislados o en grupos de dos: diplococos, otras veces forman cadenas arrosariadas: es-
treptococos, grupos arracimados: estafilococos, o masas cbicas: sarcinas. Esta diversidad

J. L. Snchez Guilln Pgina IV-1-2


IV) Microbiologa 1) Microbiologa

depende de que la divisin de las clulas se d a


lo largo de uno, dos o tres ejes.

Las bacterias con forma de cocos tienen una


relacin superficie/volumen mnima, son
bacterias con poca relacin con el exterior, muy
resistentes y se transmiten por el aire. Son
pequeas y exigentes con el medio de cultivo.
Suelen ser patgenas: Streptococcus, Sta-
phylococcus, etc.

* Bacilos, alargados y cilndricos, en forma de Fig. 6 Asociaciones de cocos (bacterias


esfricas).
bastn; a veces se presentan en cadenas linea-
les o ramificadas. Presentan mayor relacin
superficie/volumen que los cocos y obtienen Informacin: El estudio de las bacterias se
nutrientes con mucha mayor efectividad, por lo realiza mediante cultivos, que consisten en
que pueden vivir en lugares pobres en nutrien- esencia, en extractos nutritivos estriles, ya
sean lquidos o slidos. Los lqui dos, prepa-
tes (vas urinarias, agua ....). Por el contrario,
rados en tubos de ensayo debidamente
son menos resistentes, susceptibles a los tapados con algodn graso y esterilizados,
cambios ambientales y no pueden transmitirse suelen ser caldo de carne, suero sangu neo
por el aire, slo lo hacen por lquidos o superfi- y sangre, enriquecidos con ciertas sustan-
cies hmedas. Los ms grandes (Baccillus y cias sin las cuales no pueden reproducirse
(aminocidos, peptona, etc.). Los slidos se
Clostridium) desarrollan endosporas para resistir
obtienen a partir de los lquidos mediante
los perodos de condiciones precarias. adicin de agar-agar o gelatina en caliente,
luego se vierte sobre tubos de ensayo
* Espirilos, con forma de hlice o espiral; las inclinados o sobre cajas de Petri; posterior-
espiroquetas tienen un aspecto similar, pero mente se esterilizan, se siembran utilizando
el asa de platino y se colocan en la estufa de
con la espiral ms acusada. Las formas
cultivo a la temperatura adecuada que
espirales se mueven en medios viscosos favorezca su multiplicacin.
avanzando en tornillo. Su dimetro es muy
pequeo, lo hace que puedan atravesar las
mucosas; por ejemplo: Treponema pallidum,
causante de la sfilis. Son ms sensibles a las
condiciones ambientales que los bacilos, por
eso cuando son patgenas se transmiten por
contacto directo (va sexual) o mediante
vectores, normalmente artrpodos
hematfagos.

* Vibrios, que son muy cortos y curvados, en


Fig. 7 Cultivos de bacterias en cpsula de Petri
forma de coma. Ejemplo: Vibrio cholerae.
y en tubo de ensayo.

J. L. Snchez Guilln Pgina IV-1-3


IV) Microbiologa 1) Microbiologa

ESTRUCTURA DE UNA BACTERIA TIPO 2


1 3

4
5

La ultraestructura y la actividad fisiolgica de


las bacterias solo se puede apreciar con el
7

microscopio electrnico en conjuncin con las


tcnicas bioqumicas y citolgicas adecuadas, 8

como la ultracentrifugacin, tcnicas isotpicas 6

de marcaje, utilizacin de medios de cultivo Fig. 8 1) Cpsula; 2) pared; 3) membrana; 4)


diferenciales, etc. mesosomas; 5) ribosomas; 6) flagelo; 7) ADN,
cromosoma o genoma; 8) plsmidos.

Los componentes estructurales bsicos de las


bacterias son: Polisacridos

* Pared bacteriana: Estructura presente en


todas las bacterias. Es una envoltura rgida
exterior a la membrana. Da forma a la bacteria
y sobre todo soporta las fuertes presiones
osmticas de su interior.
Pptido glucano
Membrana plasmtica Membrana externa

Los componentes fundamentales de la pared


1) Glicolpidos. 2) Fosfolpidos y otros lpidos

son los peptidoglucanos o murenas, formados


por anillos de polisacridos complejos Fig. 9 Estructura de la pared de una bacteria
Gram negativa.
enlazados con oligopptidos. Adems contiene
otros elementos diferentes segn pertenezca al
grupo de las Gram negativas o al de las Gram Pptidoglucano
Anillo de polisacrido Oligopptido

positivas:

En las Gram negativas hay una sola capa de


pptidoglucanos sobre la que se dispone una
membrana externa constituida por una capa de
fosfol pidos y otra de glicolpi dos asociados,
estos ltimos, a polisacridos que se proyectan
Membrana plasmtica

hacia el exterior. Fig. 10 Estructura de la pared de una bacteria


Gram positiva.

En las bacterias Gram positivas la red de pepti-


doglucanos origina varias capas superpuestas,
es gruesa y homognea y no hay membrana Polisacrido
Oligopptido

externa.

* Cpsula bacteriana. En numerosas bacterias


se forma en la parte externa de la pared una
cpsula viscosa compuesta por sustancias
Fig. 11 Los pptidoglucanos de la pared
glucdi cas. Esta envoltura, que se presenta en bacteriana estn formados por anillos de un
casi todas las bacterias patgenas, las protege polisacrido complejo enlazados por un
oligopptido.
de la desecacin y de la fagocitosis por los
leucocitos del hospedador, as como del ataque

J. L. Snchez Guilln Pgina IV-1-4


IV) Microbiologa 1) Microbiologa

de los anticuerpos, lo que aumenta la INFORMACIN


virulencia de las bacterias encapsuladas. Observacin de microorganismos. Tincin de Gram:
La presencia de la cpsula no es, sin em- Fundamento

bargo, un carcter diferenciador, pues de-


INTRODUCCIN
terminadas bacterias pueden o no formarla
en funcin de los medios de cultivo. El tamao de la mayora de las clulas bacterianas es tal
que resultan difciles de ver con el microscopio ptico. La
principal dificultad es la falta de contraste entre la clula y
Informacin: Algunos antibiticos actan sobre el medio que la rodea. El modo ms simple de aumentar el
los componentes moleculares de la pared; por contraste es la utilizacin de colorantes.
ejemplo, la lisozima (presente en las lgrimas, Si se desea simplemente aumentar el contraste de las
moco nasal y en la mayora de los tejidos y clulas para la microscopa, son suficientes los procedi-
secreciones) que acta rompiendo los enlaces mientos que usan un solo colorante llamados de tincin
glucos dicos de los pptidoglucanos, lo que simple. Sin embargo, a menudo se utilizan mtodos que no
provoca la lisis por smosis de la bacteria; tienen de igual modo todas las clulas, es el proceso
otros, como la penicilina, son antibiticos denominado tincin diferencial. Uno muy usado en
bacteriostti cos porque inhiben la sntesis de microbiologa es la tincin Gram. Basndose en su
los pptidoglucanos y, por ello, interrumpen el reaccin a la tincin Gram, las bacterias pueden dividirse
crecimiento bacteriano. en dos grupos: grampositivas y gramnegativas. Esta
tincin tiene gran importancia en taxonoma bacteriana ya
que indica diferencias fundamentales de la pared celular de
las distintas bacterias.
Para explicar el mecanismo de la tincin de gram se han
propuesto varias hiptesis fundadas en la naturaleza
qumica de las paredes celulares de los microorganismos.
* Membrana. Es una envoltura que rodea
al citoplasma. Est constituida por una TINCIN DE GRAM.
membrana de tipo unitario de 75 de
espesor. Su estructura es idntica a la de Mtodo.
Extensin: En un porta bien limpio (con alcohol, papel de
las clulas eucariotas, variando slo en filtro y flameado) se coloca una gota de agua destilada a la
algunas de las molculas que la componen; que, con el asa de siembra, previamente esterilizada a la
por ejemplo, en la membrana bacteriana llama, se lleva una pequea cantidad de suspensin de
bacterias o, en su caso, de una colonia.
no hay esteroides. Una particularidad que
Con el asa se extiende la gota y las bacterias sobre el porta
presenta la membrana bacteriana es la y se fija la extensin por el calor, calentando suavemente a
existencia de unos repliegues internos que la llama del mechero hasta que se seque.

reciben el nombre de mesosomas.


Coloracin:
a) 1 minuto en cristal violeta de Hucker (colorante inicial)
Las funciones de la membrana plasmtica b) se lava con agua destilada
bacteriana son las mismas que en la clula c) 1 minuto en lugol (mordiente)
d) se decolora con alcohol de 951 (decolorante)
eucariota, es decir, limitan la bacteria y e) se lava con agua destilada
regulan el paso de sustancias nutritivas. f) 1 minuto en fucsina (colorante de contraste)
Los mesosomas incrementan la superficie g) se lava con agua corriente
h) se seca suavemente y sin frotar con papel de filtro
de la membrana plasmtica y adems
Una vez que la preparacin est totalmente seca, poner
tienen gran importancia en la fisiologa una gota muy pequea de aceite de cedro y observar al
bacteriana, puesto que en ellos hay gran microscopio con el objetivo de inmersin.

cantidad de enzimas responsables de im-


Observacin:
portantes funciones celulares, entre las Las bacterias que aparecen coloreadas de violeta son
que destacan las siguientes: Gram+ y las que aparecen coloreadas de rojo ms o
menos intenso, son Gram-.

- Transporte de los electrones, me-


diante el conjunto de transportado-

J. L. Snchez Guilln Pgina IV-1-5


IV) Microbiologa 1) Microbiologa

res de la cadena respiratoria, y fosforilacin oxidativa.


- Sntesis de diversos componentes de la membrana, la pared y la cpsula.
- Contienen los pigmentos fotosintticos y dems componentes de los fotosistemas.
- La ADN polimerasa de los mesosomas regula el proceso de duplicacin del ADN.

* Ribosomas. Son corpsculos similares a los de las clulas eucariticas, aunque de menor
tamao (su velocidad de sedimentacin es de 70 S), compuestos por una subunidad peque-
a de (30 S) y otra mayor de (50 S). Se encuentran dispersos en el protoplasma bacteriano,
aislados o asociados en cadenas de ARNm (polirribosomas), y se encargan de la snte sis de
protenas.

* Cromosoma bacteriano. El ADN de la bacteria est constituido por una sola molcula en
doble hlice (esta molcula es muy grande en comparacin con el tamao de la bacteria),
circular, superenrollada y asociada a protenas no histonas. Suele estar unida a los
mesosomas. En las clulas bacterianas puede haber tambin una o varias molculas de ADN
circular extracromosmico de menor masa molecular que el cromosoma denominadas
plsmidos. Estos plsmidos, en algunas bacterias, pueden tener genes que las protegen de
los antibiticos o tambin genes que intervienen en los procesos de reproduccin (plsmido
F).

* Inclusiones. En el protoplasma bacteriano se Flagelo

encuentra una gran variedad de granulaciones,


que cumplen, generalmente, la funcin de
depsitos de sustancias de reserva.

* Flagelos. Son apndices filiformes de mayor


longitud que la bacteria que permiten su
locomocin. Se presentan en nmero y
disposicin variable y estn formados por
fibrillas proteicas compuestas de una prote na Fig. 12 Estructura del motor flagelar de una
bacteria.
llamada flagelina.

* Fimbrias o pili. Son filamentos huecos,


delgados y rectos, situados en la superficie de
determinadas bacterias y cuya funcin no est
relacionada con la locomocin, sino con la
adherencia a los substratos y el intercambio de
fragmentos de ADN durante la conjugacin.

Fig. 13 Fimbrias o pili en una bacteria.

J. L. Snchez Guilln Pgina IV-1-6


IV) Microbiologa 1) Microbiologa

FUNCIONES DE NUTRICIN EN LAS BACTERIAS

La mayor parte de las bacterias son hetertrofas y deben tomar el alimento orgnico
sintetizado por otros organismos. La obtencin del alimento la hacen por diversos caminos:

* Las bacterias de vida libre suelen ser saprfitas, viven sobre materia orgnica muerta.

* Muchas viven en relacin estrecha con otros organismos. De ellas, la mayora son
comensales y no causan daos ni aportan beneficios a su husped; algunas son parsitas
(producen enfermedades) y otras son simbiontes (establecen relaciones con otros
organimos con beneficio mutuo).

Otras bacterias son auttrofas y utilizan compuestos inorgnicos para su nutricin:

* Las auttrofas fotosintticas, como las bacterias sulfurosas verdes y purpreas. No


utilizan agua como dador de electrones en la fotosntesis, sino otros compuestos, como el
sulfuro de hidrgeno, y por lo tanto no producen oxgeno. Al poseer pigmentos que
absorben luz casi infrarroja, pueden realizar la fotosntesis prcticamente sin luz visible.

* Las auttrofas quimiosintticas, a diferencia de las fotosintticas, utilizan la energa que


desprenden ciertos compuestos inorgnicos al oxidarse.

Independientemente del tipo de nutricin, las bacterias pueden necesitar el oxgeno


atmosfrico (bacterias aerobias) o no (bacterias anaerobias). Para algunas bacterias
anaerobias el oxgeno es un gas venenoso (anaerobias estrictas), otras lo utilizan cuando
est presente, aunque pueden vivir sin l (anaerobias facultativas).

FUNCIONES DE RELACIN EN LAS BACTERIAS

Las bacterias responden a un nmero elevado de estmulos ambientales diversos mediante


modificaciones de su actividad metablica o de su comportamiento. Ciertas clases, ante los
estmulos adversos del ambiente, provocan la formacin de esporas de resistencia, que, al
ser intracelulares, se denominan endosporas.

Las endosporas bacterianas son estructuras destinadas a proteger el ADN y el resto del
contenido protoplasmtico, cuya actividad metablica se reduce al estado de vida latente;
pueden resistir temperaturas de hasta 801C y soportan la accin de diversos agentes
fsicos y qumicos. En condiciones favorables germinan y dan lugar a una nueva bacteria
(forma vegetativa).

Pero la respuesta ms generalizada consiste en movimientos de acercamiento o distancia-


miento respecto a la fuente de los estmulos (taxias) que pueden ser de varios tipos: flage-
lar, de reptacin o flexuosos (parecido al de las serpientes, pero en espiral).

J. L. Snchez Guilln Pgina IV-1-7


IV) Microbiologa 1) Microbiologa

FUNCIONES DE REPRODUCCIN Y GENTICA BACTERIANA

* Reproduccin por biparticin: Generalmente cromosoma

las bacterias se multiplican por biparticin o


divisin binaria; tras la replicacin del ADN, que mesosoma

est dirigida por la ADN polimerasa de los Replicacin

mesosomas, la pared bacteriana crece hasta


formar un tabique transversal separador de las
dos nuevas bacterias. divisin

Ahora bien, adems de este tipo de repro-


duccin asexual, las bacterias poseen tambin Fig. 14 Ciclo de reproduccin asexual por
un conjunto de mecanismos, definidos como biparticin de un bacteria.
parasexuales, mediante los cuales se intercam-
bian fragmentos de ADN; esta transferencia de Informacin: La transformacin bacteriana
informacin gentica de una bacteria a otra fue descrita en primer lugar por Griffith
(1920) y ms tarde por Avery, McLeod y
puede realizarse por conjugacin, trans-
McCarty en 1944, y es responsable, por
formacin o transduccin: ejemplo, en el caso de Streptococcus pneu-
moniae, de la transformacin de cepas
* Conjugacin. Es un mecanismo mediante el bacterianas no virulentas (cepas R) en
virulentas (cepas S), cuando se cultivan en
cual una bacteria donadora (bacteria F+ por medios que contienen fragmentos bacteria-
tener un plsmido llamado plsmido F) nos procedentes de la cepa S destruida
transmite a travs de las fimbrias o pili el previamente por el calor.
plsmido F o tambin un fragmento de su ADN a
otra bacteria receptora (a la que llamaremos F-
por no tener el plsmido F). La bacteria F- se
cromosoma

convertir as en F+ al tener el plsmido F e plsmido F cromosoma plsmido F

incluso podr adquirir genes de la bacteria F+


que hayan pasado junto con el plsmido F. F+ F+
pili

* Transformacin. Consiste en el intercambio


gentico producido cuando una bacteria es F+
F-

capaz de captar fragmentos de ADN de otra cromosoma plsmido F

bacteria que se encuentran dispersos en el Fig. 15 Conjugacin entre una bacteria F+ y


medio donde vive. Slo algunas bacterias pue- otra F-. El factor F (crculos pequeos) pasa a
den ser transformadas. Las que pueden serlo se travs de un pili.
dice que son competentes.

* Transduccin.. En este caso la transferencia


2
de material gentico de una bacteria a otra, se
realiza a travs de un virus bacterifago que por 1

azar lleva un trozo de ADN bacteriano y se


comporta como un vector intermediario entre
las dos bacterias (ver ciclo ltico de un fago). El 3

virus, al infectar a otra bacteria, le puede 4

transmitir parte del genoma de la bacteria


anteriormente infectada. Fig. 16 Transduccin: 1) Fijacin del fago a la
bacteria; 2) Respuesta ltica; 3) Transduccin del
fragmento de ADN a otra bacteria; 4) Integracin
del ADN en el genoma.

J. L. Snchez Guilln Pgina IV-1-8


IV) Microbiologa 1) Microbiologa

Mecanismos parasexuales de reproduccin bacteriana

Informacin: Las bacterias donadoras son las que poseen, adems del cromosoma bacteriano, pequeas cadenas de
ADN de doble hlice y circulares, denominadas episomas o factores F. Estas bacterias se denominan F+ cuando el
factor F est separado del cromosoma; pero, en ocasiones, este factor puede integrarse en el cromosoma, que se abre
y se transforma en una cadena lineal, con lo que la bacteria F+ queda convertida en Hfr (alta frecuencia de recombina-
cin). Las bacterias receptoras carecen de episomas y se denominan F- .

Durante la conjugacin uno de los factores F de una bacteria F+ pasa a travs de las fimbrias a una bacteria F- , que
se cambia en F+ y adquiere la capacidad de formar estos pili sexuales, mientras que la bacteria F+, como posee varias
copias del episoma no pierde su condicin de donadora.

Las bacterias Hfr, sin embargo, pueden transferir la totalidad o parte de su ADN cromosmico a travs de las fimbrias a
una bacteria F- . Para ello, previamente, deben duplicar su ADN cromosmico, junto con el episoma que lleva
integrado, y una de las copias del cromosoma puede trasladarse a una bacteria F- (generalmente slo pasan fragmentos
cromosmicos debido a la fragilidad de las fimbrias).

El factor F suele permanecer en la bacteria Hfr, ya que se encuentra inserto en la regin terminal del cromosoma que
casi nunca circula a travs de las fimbrias, porque stas se destruyen antes de que les de tiempo a pasar. Los genes que
han logrado atravesar el pili se integran en el cromosoma de la bacteria F-, que de esta forma adquiere caracteres de la
Hfr (se producen fenmenos de sobrecruzamiento y recombinacin gnica entre el cromosoma y los fragmentos).

J. L. Snchez Guilln Pgina IV-1-9


IV) Microbiologa 1) Microbiologa

3. MICROORGANISMOS SIN ORGANIZACIN CELULAR: LOS VIRUS

LOS VIRUS: CONCEPTO

Los virus son organismos dotados de extraordinaria simplicidad, pertenecen a un nivel de


organizacin subcelular, y marcan la barrera entre lo vivo y lo inerte. No se nutren, no se
relacionan, carecen de metabolismo propio y para reproducirse utilizan la maquinaria meta-
blica de la clula a la que parasitan; su simplicidad estructural y funcional los convierte en
parsitos intracelulares obligados, tanto de bacterias (bacterifagos o fagos), como de las
clulas animales y vegetales.

Las partculas vricas, llamadas tambin viriones, estn constituidas por una molcula de
ADN o ARN, nunca los dos en un mismo virus, contenida en el interior de una cpsula
proteica y, en ocasiones, una envoltura membranosa.

Informacin: En realidad, los virus pueden considerarse como fragmentos independizados del genoma celular que han
adquirido los genes necesarios para rodearse de una envoltura protectora y poseen la capacidad de desplazarse de una
clula a otra. Mientras que los transposones son genes que se desplazan de un sitio a otro del cromosoma de una
clula , los virus representaran a otro grupo de genes similares, pero que por haber adquirido la cpsula protectora se
aventuraron a dar "saltos" mayores.

La destruccin celular es la consecuencia de la infeccin provocada por el virus, y las repercusiones para el organismo
dependen de la importancia del tejido lesionado; as, mientras el virus de la gripe causa la destruccin de clulas de la
mucosa respiratoria y " no reviste gravedad", el virus de la rabia, sin embargo, destruye neuronas y puede ser mortal si
alcanza los centros vitales del encfalo; otros, como el virus del SIDA, destruyen el sistema inmunitario, y el organismo
queda expuesto a todo tipo de infecciones oportunistas que terminan por causar la muerte.

ESTRUCTURA Y CARACTERSTICAS DE LOS VIRUS

Como ya se ha dicho, todo virus est formado por una envuelta proteica: la cpsida y por
un cido nucleico; adems, algunos virus ms complejos pueden tener una envoltura
membranosa de lpidos y protenas.

Los virus son muy pequeos y slo son visibles mediante microscopa electrnica. Su
tamao oscila desde los 10 nm, en los pequeos virus de la poliomielitis, hasta los 300 nm
en el virus de la viruela, el mosaico del tabaco -TMV- y otros. Se diferencian entre ellos,
adems de por el tamao, por las caractersticas estructurales de la cubierta (la cpsida),
por la naturaleza de su cido nucleico, el modo de penetracin en la clula hospedadora y el
mecanismo de replicacin.

3.1) Constitucin y morfologa de la cpsida

Todos los virus presentan, sin excepcin, una envoltura proteica, denominada, cpsida,
compuesta por el ensamblaje de una o varias subunidades proteicas llamadas capsmeros,
dispuestas a menudo en varias capas concntricas.

La geometra de la cpsida es uno de los criterios que permite clasificar los virus en cuatro
grupos: icosadricos, helicoidales, complejos y con envoltura.

J. L. Snchez Guilln Pgina IV-1-10


IV) Microbiologa 1) Microbiologa

* Icosadricos: son los virus de aspecto esfrico,


cuya cpsida adopta la estructura de un
icosaedro (poliedro de 20 caras triangulares, 30
aristas y 12 vrtices); por ejemplo: los adenovi-
rus, el virus de la polio y los picornavirus.

* Helicoidales o cilndricos: estn


representados por el virus del mosaico del
tabaco y el virus de la rabia; presentan un
aspecto alargado, que en realidad corresponde
Fig. 17 Virus. 1 y 2) Virus icosadricos; 3)
a un cilindro hueco, donde los capsmeros se
Virus complejo; 4) Virus helicoidal; 5) Virus con
ensamblan siguiendo un ordenamiento envoltura.
helicoidal, similar a los peldaos de una
escalera de caracol.

* Complejos, como bacterifagos (virus parsi-


tos de bacterias) que parecen adoptar las dos
estructuras anteriores. Al igual que los
icosadricos poseen una regin icosadrica
llamada cabeza donde se aloja el ADN y una
cola formada por una banda de simetra helicoi-
dal en cuyo interior se encuentra un eje tubular. Fig. 18 Virus helicoidal. Virus del mosaico del
tabaco. 1) ARN viral; 2) cpsida;
La cola est terminada en un conjunto de fibras
y espinas caudales que constituyen el sistema
de anclaje del virus a la bacteria a la que
infecta.

* Virus con envoltura membranosa: La


mayora de los virus animales, como los de la
gripe, la viruela, la hepatitis, el virus del SIDA,
etc. poseen, adems de la cpsida, una envol-
tura membranosa que no es mas que un
fragmento de la membrana plasmtica de la
clula hospedadora que el virus arrastra al aban-
donarla mediante un proceso de gemacin. La Fig. 19 Virus helicoidal. Virus del mosaico del
bicapa lipdica que forma esta envoltura posee tabaco.
un conjunto de glucoprote nas codificadas por
el virus y dispuestas hacia el exterior, a modo
de espculas, que constituyen su sistema de cabeza

anclaje en los receptores de membrana de las genoma

clulas hospedadoras y, por tanto, median en el cola fibras

mecanismo de penetracin por endocitosis o


por fusin de membranas. La envoltura
membranosa es muy importante desde el punto
de vista inmunolgico
placa
basal

Fig. 20 Virus con cpsida compleja:


Bacterifago.

J. L. Snchez Guilln Pgina IV-1-11


IV) Microbiologa 1) Microbiologa

3.2) El cido nucleico

Es el componente esencial del virus y puede ser ADN monocatenario, por ejemplo, en el
fago O-X-174, o ADN bicatenario, como el fago T4 y los adenovirus; pero tambin existen
virus con ARN bicatenario (los reovirus) y otros portadores de ARN monocatenario, como
es el caso de los virulentos retrovirus, entre los que se encuentran el de la gripe, el
sarampin, la rabia, el SIDA y determinados virus oncgenos causantes de ciertos tipos de
cncer (sarcoma de Rous, determinadas leucemias, etc.). Este ltimo grupo contiene,
adems de los otros componentes mencionados, un enzima particular llamado retrotrans-
criptasa o transcriptasa inversa, que le va a permitir transcribir su ARN en un ADN dentro
de la clula infectada.

El material gentico viral


Tipo de cido Cpsida Envoltura Ejemplo
Virus nucleico

Virus ARN Helicoidal No Mosaico del


vegetales monocatenario tabaco

Bacterifagos ADN Compleja No Bacteri-


bicatenario fago T4

Virus De todos los Icosadricos Frecuente Gripe,


animales tipos SIDA, etc.

MECANISMOS DE REPLICACIN: CICLO VITAL DE LOS VIRUS

Aunque el genoma de un virus contiene escaso nmero de genes, es suficiente para inhibir
la expresin gnica de la clula hospedadora y obligarla a transcribir y traducir su breve
mensaje. El modo de penetracin , los mecanismos y los compartimentos celulares
utilizados para la replicacin, son diferentes en los distintos tipos de virus. De todos ellos,
se pondrn como ejemplo el de los retrovirus y los bacterifagos.

a) Ciclo vital de un retrovirus: El VIH causante del SIDA.

Los retrovirus son un grupo especial de virus


animales cuyo cido nucleico es ARN, poseen
envoltura y la enzima transcriptasa inversa. a

EL VIH es un retrovirus relativamente


complejo. Est constituido por una membrana b
lipdica con glucoprotenas dispuestas hacia el
exterior a modo de espnas. En el interior
encontramos una cpsida proteica que encierra
c
el material gentico, formado por dos molculas d
de ARN monocatenario y se encuentran
ligadas, cada una de ellas, a una molcula de Fig. 21 Virus del S.I.D.A.: a) envoltura
una enzima, la transcriptasa inversa. membranosa; b) cpsida ; c) cido nucleico (ARN);
d) espculas proticas.

J. L. Snchez Guilln Pgina IV-1-12


IV) Microbiologa 1) Microbiologa

Ciclo vital del virus del SIDA

1 6a

6b
3

4
7
8

Informacin: El VIH ataca preferentemente a los linfocitos T4. Las fases de este proceso son:

10) Contacto entre las espculas de su envoltura membranosa y los receptores de la clula hospedadora. Estas permiten
la fusin de membranas, introduciendo en su interior la cpside con el material gentico.
20) Una vez en el interior, el virus se despoja de su cpsida protica y quedan libres las hebras de ARN y la enzima
retrotranscriptasa que transporta.
30) La retrotranscriptasa, tambin llamada transcriptasa inversa, primero hace una copia en ADN de la cadena de ARN,
es decir, invierte el proceso normal de transcripcin de ADN a ARN, originando una hlice hbrida ARN-ADN.
40) La hlice hbrida ARN-ADN es utilizada por la misma enzima para generar una doble hlice de ADN (previa
degradacin del ARN).
50) Las dobles cadenas de ADN vricas entran en el ncleo y se insertan en el cromosoma celular, donde puede
permanecer en estado latente en forma de provirus durante un tiempo ms o menos prolongado.
60) Finalmente se transcriben y se traducen utilizando la maquinaria metablica de la clula y origina nuevas copias de
ARN vrico, protenas de la cpsida y de la envoltura y enzimas retrotranscriptasas.
70) Estos componentes se ensamblan, y...
80) los virus abandonan la clula mediante un proceso de gemacin que les permite adquirir de nuevo su recubrimiento
membranoso.

Todos estos procesos pueden ser lentos, originando tan slo un descenso de la actividad metablica del hospedador, o
rpidos, con lo que la salida masiva de virus termina con la lisis de la clula.

J. L. Snchez Guilln Pgina IV-1-13


IV) Microbiologa 1) Microbiologa

b) Ciclo vital del fago T4.

El bacterifago T4 es un virus complejo con una cabeza icosadrica y una cola en la que
hay una placa basal y fibras de fijacin. El genoma se compone de una molcula de ADN
bicatenaria que se encuentra profusamente empaquetada dentro de la cabeza.

El fago se fija en la pared bacteriana, en las cabeza

regiones denominadas puntos de adherencia, a genoma

travs de los cuales inyecta su ADN mediante la cola fibras

contraccin de la vaina de la cola. Una vez en el


protoplasma bacteriano, el ADN puede seguir
dos caminos: multiplicarse y originar nuevos
virus (va ltica ), con lo que se produce la des-
truccin de la bacteria, o integrarse en el placa
basal
cromosoma bacteriano y adoptar la forma de
profago (va lisognica). Fig. 22 Fago T4 (bacteriofago).

i) Ciclo ltico.

1) Fijacin y entrada 2) Multiplicacin 3) Lisis y liberacin

1) Fijacin y entrada: El bacterifago fija su cola a receptores espec ficos de la pared de la bacteria, donde una enzima localizada en la cola

del virus debilita los enlaces de las molculas de la pared. A continuacin, el fago contrae la vaina helicoidal, lo que provoca la inyeccin del

contenido de la cabeza a travs del eje tubular de la cola del fago: el cido nucleico del virus penetra en la clula.

2) Multiplicacin: Una vez dentro, el ADN del virus, utilizando nucletidos y la enzima ARNpolimerasa de la bacteria, dirige la sntesis de

gran cantidad de ARNm viral. Este ARNm viral sirve de base para la snte sis de protenas del virus (capsmeros, endonucleasas, endolisi-

nas). El ADN vrico, utilizando los complejos enzimticos de la bacteria, se replica muchas veces. Tanto los cidos nucleicos replicados

como el resto de los componentes vricos que se han sintetizado se ensamblan, dando lugar a nuevos virus.

3) Lisis y liberacin. En una bacteria pueden formarse unos 100 bacterifagos, que salen al exterior debido a la accin de la endolisina,

enzima que lisa la pared bacteriana. Debido a ello, se produce la ruptura de la pared bacteriana y la muerte de la clula. Los virus quedan

libres para infectar nuevas clulas.

ii) Ciclo lisognico.

No siempre se produce la lisis inmediata de la clula. Hay fagos atemperados o atenuados


que se integran en el ADN bacteriano por entrecruzamiento de dos regiones idnticas del
fago y de la bacteria, del mismo modo a como ocurre en los plsmidos. Estos fagos
integrados se denominan profagos, y se replican pasivamente con el ADN de la bacteria.
Las bacterias capaces de establecer esa relacin con los fagos atenuados se denominan
lisognicas.

J. L. Snchez Guilln Pgina IV-1-14


IV) Microbiologa 1) Microbiologa

El ADN del profago puede permanecer en


forma latente durante varias generaciones de la
bacteria, hasta que un estmulo induzca la
1) Respuesta ltica.
separacin del profago, lo que iniciar un ciclo
ltico tpico. Mientras la clula posea el ADN
profago ser inmune frente a infecciones de
este mismo virus. Otros virus que no son
bacterifagos pueden tambin tener ciclos
2) Respuesta lisognica.

lisognicos. Fig. 23 Ciclos ltico y lisognico de un fago.

VIROIDES
Los viroides son de menor tamao que
cualquiera de los genomas vricos
Son extremadamente sencillos y forman un conocidos, pero suficiente para poder
escaln inferior a los virus. Son simplemente codificar una protena, pero no se cree que
genomas desnudos, ARN de una cadena (pero lo hagan, ya que el ARN de los viroides
en forma de horquilla, pues hay complemen- carece de seales que se necesitan para la
traduccin del ARN a una protena. Por lo
tariedad entre sus bases, simulando un ARN tanto su informacin no se traduce, solo se
doble para protegerse de los enzimas hidrolti - replica. Parece probable que sea la
cos celulares que atacan a los ARN simples) y ARNpolimerasa del hospedador, que est en
no presentan cpsida proteica. Solamente el ncleo de las plantas, la que replica el
causan enfermedades en los vegetales. Han genoma del viroide. No est claro cmo se
transmiten entre clulas ( dada la pared
producido prdidas econmicas importantes: en celular de las clulas vegetales), y mucho
cultivos de patata en USA y en cocoteros en menos entre individuos.
Filipinas.

LOS PRIONES: De estos "organismos" sabemos an menos. Se descubren en 1983 como agentes causantes de
afecciones neuronales espordicas. Ahora aumenta su inters debido al mal de las vacas locas.
Es una partcula infecciosa protenica (protena patolgica). Las pruebas obtenidas hasta el momento parecen
indicar que el prin carece de cido nuclico.
Se conocen dos enfermedades causadas por priones: La Tembladera, una alteracin neurolgica de ovejas y cabras,
conocida desde el siglo XVII y la enfermedad de Creutzfeld-Jacob, una rara demencia humana. Los priones tambin se
consideran agentes probables de otras enfermedades humanas que afectan al sistema nervioso: el Kuru, observado
slo en tribus de Nueva Guinea, asocindose al canibalismo tradicional (la enfermedad fue desapareciendo conforme
cesaban las prcticas necrfagas).
La enfermedad de Creutzfeld-Jacob en individuos menores de 35 aos se relacion con el consumo de subproductos
de vacas enfermas, que estaban alimentadas con piensos fabricados con restos de ovejas con tembladera.
La infeccin por priones no provoca una respuesta inmunitaria, debido a que el prin est dentro de nuestras propias
clulas. El agente causante es una protena propia de la membrana plasmtica de las neuronas. Se sabe que est
codificada por un gen del cromosoma 20. Esta protena sufre una alteracin que la convierte en patolgica (prin) Las
protenas defectuosas actan como agentes infecciosos que cambian las protenas normales en defectuosas. La
aparicin de la demencia es consecuencia de que se acumulan cristalizadas en las neuronas provocando su destruccin
y muerte.
Comparando las dos protenas, normal y patolgica, se comprueba que tienen la misma secuencia de aminocidos
(estructura primaria), pero tienen un plegamiento distinto.
Se han encontrado casos de transmisin hereditaria de la enfermedad, debido a una mutacin puntual que implica
modificacin en la estructura primaria de la protena, sustituyndose una prolina por una leucina.

J. L. Snchez Guilln Pgina IV-1-15


IV) Microbiologa 1) Microbiologa

CLASIFICACIN DE LOS VIRUS (slo para consultar)

Los criterios bsicos de clasificacin son el tipo de cido nucleico que contienen, el tipo de cpsida, la posesin
de envolturas membranosas y el tipo de clula a la que parasita. Segn este ltimo criterio existen virus animales,
virus vegetales y virus bacterianos o bacterifagos. Las caractersticas ms frecuentes de cada grupo ya se han
visto en la pgina .

A continuacin, y a modo de consulta veamos los ms importantes grupos de virus animales.

Clasificacin de los virus parsitos de clulas animales

N1 Familia cido nucleico Envoltura Gnero y especie Enfermedad

1 Papovaviridae ADN-bc circular Desnudos Virus del papiloma huma- Verrugas


(Papovairus) no

2 Poxviridae ADN-bc circular Envueltos Virus de la viruela Viruela


(Poxvirus)

3 Herpesviridae ADN-bc lineal Envueltos Virus de herpes simple I y Grietas en los labios y her-
(Herpesvirus) II pes genital

Virus de la varicela zoster Varicela y herpes zoster

4 Adenoviridae ADN-bc lineal Desnudos Adenovirus humano Infecciones respiratorias,


(Adenovirus) entricas y oftlmicas

5 Parvoviridae ADN-mc lineal Desnudos Virus adenoasociados Infecciones en roedores


(Parvovirus)

6 Reoviridae ARN-bc Desnudos Rotavirus Diarreas infantiles


(Reovirus)

7 Orthomixoviri- ARN-mc Envueltos Virus de la gripe Gripe


dae
(Ortomixovirus)

8 Paramixoviridae ARN-mc Envueltos Virus de la parotiditis Paperas (parotiditis)


(Paramixovirus)

Virus de sarampin Sarampin

9 Rhabdoviridae ARN-mc Envueltos Virus de la rabia Rabia


(Rabdovirus)

10 Picornaviridae ARN-mc Desnudos Enterovirus (virus de la Polio, miocarditis, pericardi-


(Picornavirus) polio, Coxsakie y Echo tis, gastroenteritis, menin-
goencefalitis.

11 Togaviridae ARN-mc Envueltos Virus de la rubola Rubola


(Togavirus)

12 Retrovirus ARN-mc Envueltos Virus de la inmunodefi- SIDA


(Retrovirus) ciencia humana (VIH-1 y
VIH-2)

Virus de la leucemia de Leucemia de las clulas T


las clulas T

J. L. Snchez Guilln Pgina IV-1-16


IV) Microbiologa 1) Microbiologa

Forma de los virus que parasitan clulas animales

Leyenda: 1) Papovavirus; 2) Poxvirus; 3) Herpesvirus; 4) Adenovirus; 5) Parvovirus; 6) Reovirus;


7) Ortomixovirus; 8) Paramixovirus; 9) Rabdovirus; 10) Picornavirus; 11) Togavirus; 12) Retrovirus.

J. L. Snchez Guilln Pgina IV-1-17


IV) Microbiologa 1) Microbiologa

Informacin: Modalidades de transcripcin de los virus animales

Los virus animales pueden clasificarse por su material gentico y por la forma de sintetizar su ARN mensajero.

Grupo I: Tienen como material gentico ADN de cadena doble (hebras + y -). La hebra (-) se transcribe en un ARNm.
Ejemplo: virus del herpes.

Grupo II: Tienen como material gentico ADN de cadena simple (+ -). La hebra de ADN sintetiza una molcula
complementaria de ADN formndose un ADN de cadena doble. De estas dos hebras, la hebra (-) se transcribe en un
ARNm. Ejemplo: Parvovirus.

Grupo III: Tienen como material gentico ARN de cadena doble (hebras + y -). De estas dos hebras, la hebra (-) sirve
de molde para la sntesis de un ARNm complementario. Ejemplo: Reovirus.

Grupo IV : Tienen como material gentico ARN de cadena simple (hebra +). Esta hebra de ARN sintetiza una molcula
complementaria de ARN: hebra (-) que sirve de molde para sintetizar un ARNm complementario. Ejemplo: Virus de la
polio de los primates.

Grupo V : Tienen como material gentico ARN de cadena simple (hebra -). Esta hebra de ARN sirve de molde para
sintetizar un ARNm complementario. Ejemplo: Gripe.

Grupo VI : Tienen como material gentico ARN de cadena simple (hebra +). Esta hebra de ARN sirve de molde para
sintetizar un ADN complementario: hebra (-) que a su vez sirve de molde para sintetizar un ADN + . Se forma as un
ADN de doble cadena (+ y -). La hebra de ADN (-) se transcribe formndose un ARNm+. Ejemplo: Retrovirus.

Modalidades de transcripcin de los virus de clulas animales

I- Herpes
II- Parvovirus
III- Reovirus ADN
IV- Polio de los ARN
primates
V- Gripe Lnea fina,
cadena que no
VI- V.I.H. se transcribe

Fig. 24

J. L. Snchez Guilln Pgina IV-1-18


IV) Microbiologa 1) Microbiologa

4. MICROORGANISMOS CON ORGANIZACIN CELULAR EUCARIOTA

PROTOZOOS
cil

vp Mn
Son organismos formados por una sola clula, mn vp

es decir, poseen la estructura tpica de una


clula eucaritica animal, aunque en ocasiones
presentan una mayor complejidad en su vg

organizacin. Tienen una membrana plasmtica


que los rodea y delimita, algunos forman un Fig. 25 Paramecio, ciliado de las aguas dulces.
vp) Vacuola pulstil. vd) Vacuola digestiva. cil)
caparazn duro, calizo o silceo, o bien una fina
Cilios. Mn) Macroncleo. mn) Microncleo.
envoltura de quitina.

ESTUDIO DE UN PROTOZOO: EL PARAMECIO. Los ciliados:


Los protozoos como el paramecio que presentan
Mirando con el microscopio una infusin o agua de una cilios para su movimiento se conocen con el nombre
charca puede observarse fcilmente el paramecio de ciliados. Otros ciliados que abundan en al agua de
(Paramecium ssp.). Tiene forma de suela de zapato y de charcas son:
su cuerpo salen muchos cilios, dispuestos en filas a lo
largo de toda su superficie, que le sirven para nadar. * Las Vorticelas, con cuerpo en forma de campana y
un largo pednculo que puede arrollarse en espiral
A un lado del cuerpo hay una abertura, la boca o como un muelle. Forman colonias.
citostoma, que da acceso a un embudo que se estrecha * Los Stentor, con forma de trompeta, que pueden
hacia el interior. Sirve para su alimentacin: con los cilios medir hasta 1 mm. Se suelen fijar a races, etc. por
provoca un remolino que arrastra las partculas su extremo puntiagudo.
alimenticias hacia el fondo del embudo, donde se forma
un vacuola digestiva que engloba las partculas ingeridas. Otros protozoos:
* La Ameba, que vive en las charcas. Forma gruesos
En su citoplasma podemos distinguir: pseudpodos para moverse y capturar su alimento:
bacterias, algas, etc. Los protozoos que forman
* Unas pequeas cavidades esfricas, ms o menos pseudpodos se denominan rizpodos. Adems de la
numerosas, llamadas vacuolas digestivas. ameba existe Entamoeba histolytica que es parsita
* En cada extremo del cuerpo se halla una vacuola del hombre donde origina la disentera amebiana
pulstil, de forma estrellada, que presenta movimientos * El Trypanosoma, protozoo de forma alargada y con
rtmicos de contraccin y cuya misin es expulsar de la un largo flagelo para su movimiento. Vive parsito en
clula los productos de deshecho de la digestin y agua. la sangre de algunos mamferos africanos de donde
* Un par de ncleos: uno grande (macroncleo) y otro puede pasar al hombre por picadura de la mosca tse-
pequeo (microncleo). ts. En el hombre origina la enfermedad del sueo.

Se reproducen asexualmente por divisin simple. Se han Los protozoos con flagelos: flagelados.
observado procesos sexuales (conjugacin) en los cuales * Plasmodium, que produce en el hombre la enfer-
dos paramecios se unen por el citostoma y a travs de l medad de la malaria o paludismo. Se introduce en la
realizan un intercambio de material nuclear, separndose sangre mediante la picadura de la hembra del
despus. Aunque en este proceso no haya variacin mosquito Anopheles , quien a su vez lo toma de otros
numrica, se considera una reproduccin sexual por el individuos enfermos. De esta forma la enfermedad se
intercambio de material nuclear, que es lo esencial de la transmite de individuos enfermos a otros sanos por
sexualidad. la picadura del mosquito. El plasmodio, una vez en la
sangre, pasa al interior de los glbulos rojos donde se
Cuando falta agua, se rodea de una membrana gruesa, divide por esporulacin y destruye las clulas
donde permanece con vida latente, pudiendo resistir sanguneas.
largas temporadas hasta que nuevamente haya agua, este
proceso se conoce como enquistamiento.

J. L. Snchez Guilln Pgina IV-1-19


IV) Microbiologa 1) Microbiologa

Fig. 26 Diferentes especies de protozoos. 1) Paramecio; 2) Stentor; 3) Ciliado sp.; 4) Vorticela; 5) Ameba.

Su forma y tamao son variables, pero casi


todos ellos son microscpicos por lo que deben
observarse al microscopio.

Algunos viven libres en aguas dulce o saladas.


Cuando se deseca el medio en que viven
forman un caparazn y se enquistan. Otros
viven parsitos en animales o vegetales
produciendo enfermedades, o bien, simbiosis
con ellos.

Se suelen reproducir por biparticin simple,


aunque algunos tienen otras modalidades e Fig. 27 Euglena.
incluso se conocen procesos de reproduccin
sexual.

ALGAS MICROSCPICAS UNICELULARES

Formadas por una sola clula. Viven en el agua


y son capaces de realizar la fotosnte sis. Entre
ellas podemos citar las Diatomeas, que viven
tanto en el mar como en el agua dulce y poseen
un caparazn de slice (frstula) constituido por
dos piezas que encajan como una caja y su
tapadera. Algunas algas unicelulares, como
Euglena viridis, tienen flagelos con los que se
Fig. 28 Diatomeas.
desplazan en el agua. Las algas unicelulares
forman parte importante del llamado plancton.

J. L. Snchez Guilln Pgina IV-1-20


IV) Microbiologa 1) Microbiologa

HONGOS MICROSCPICOS

Bajo esta denominacin se incluye un amplio


esporangios
grupo de organismos de gran heterogeneidad.
Entre las caractersticas comunes a todos los
hongos pueden destacarse: hifas

a) Estar formados por una o ms clulas


eucariotas.
b) Encontrarse desprovistos de clorofila Fig. 29 Hifas y esporangios del Mucor, hongo
u otro pigmento fotosinttico. que coloniza el pan hmedo.
c) La pared celular no es de celulosa sino
de quitina.

Los hongos son organismos hetertrofos que


necesitan para su nutricin sustancias
orgnicas ya elaboradas; la mayora son
saprfitos - se desarrollan sobre materia
orgnica en descomposicin - y otros son
parsitos que producen enfermedades en el
hombre y otros animales y vegetales.
Fig. 30 Clula de levadura.
Dentro de los hongos podemos encontrarlos
unicelulares (levaduras) y pluricelulares
(mohos), estos tienen una estructura deno-
minada " talo" y que suele estar constituida por
una serie de filamentos denominados " hifas",
que pueden ser ramificadas y tabicadas,
formando, en su conjunto, una estructura
denominada " micelio".

Su reproduccin puede ser sexual o asexual


(gemacin, esporulacin, fragmentacin) y su
Fig. 31 Clula de levadura dividindose por
clasificacin es compleja y se puede realizar
gemacin.
atendiendo a diferentes caracteres

APLICACIONES Y PAPEL EN EL ECOSISTEMA conidiforos

El papel que los hongos ejercen en la


naturaleza resulta de gran importancia, sobre
todo si tenemos en cuenta su actividad
descomponedora en los ecosistemas (reciclaje
de materia orgnica). Tambin tienen una parte
fundamental en la actividad humana. As, es hifas

conocido su papel en la alimentacin, la


agricultura, silvicultura, industria qumica, Fig. 32 Hifas y conidiforos de Penicillium.
enfermedades, etc. Este hongo aparece sobre pan hmedo y naranjas
enmohecidas.
Los hongos son capaces de descomponer

J. L. Snchez Guilln Pgina IV-1-21


IV) Microbiologa 1) Microbiologa

algunos materiales fabricados y usados por el hombre a partir de materiales de origen


orgnicos (vegetal y animal); reciclan por tanto estos materiales como si se tratara de la
materia orgnica que forma parte del ecosistema (biodeterioro).

Por otra parte, desde hace cientos de aos el hombre ha utilizado diferentes especies de
hongos para la transformacin de alimentos, un claro ejemplo son las levaduras utilizadas
en la elaboracin de la cerveza y del vino (Saccharomyces), de los quesos (algunas especies
de Penicillium), del pan, etc.

Los hongos son muy importantes en la industria qumica como productores de numerosas
sustancias como vitaminas, cortisonas, cidos orgnicos y sobre todo antibiticos (en este
sentido cabe recordar que la penicilina fue descubierta por Fleming a partir de una especie
de Penicillium).

R H H
Los hongos tambin pueden ser agentes
S
patgenos directos sobre el ser humano, son 1 N CH3
causantes de numerosas micosis superficiales H 2 3
en la piel, uas, pelo, etc. y micosis profundas
N CH3
con mayor riesgo para la salud. Tambin puede
haber alergias micgenas provocando molestias O

respiratorias (por las esporas). COOH

Fig. 33 Penicilina. 1) Grupo amino libre; 2)


Anillo -lactmico; 3) Anillo de tiazolina; R)
Radical que determina las propiedades
farmacolgicas.

J. L. Snchez Guilln Pgina IV-1-22


IV) Microbiologa 1) Microbiologa

5. INTERVENCIN DE LOS MICROORGANISMOS EN LAS TRANSFORMACIONES O


CICLOS BIOGEOQUMICOS.

Las bacterias y los hongos son los microorganismos que, junto a los productores, permiten
la existencia del ciclo de la materia en la biosfera. Su funcin es descomponer la materia
orgnica procedente de restos vegetales, cadveres y excrementos, convirtindola en
materia inorgnica que vuelve a ser utilizada por los productores.

La actividad de los descomponedores en la biosfera permite que la materia se recicle y no


se disperse en las sucesivas transferencias, como ocurre con la energa.

Muchos de los elementos qumicos que componen los materiales terrestres estn
sometidos a unos circuitos cclicos que consisten, bsicamente, en que pasan de formar
parte de materia inorgnica inerte a formar parte de materia constitutiva de seres vivos y de
stos, posteriormente, de nuevo a materia inorgnica inerte, cerrndose el ciclo. Estos ciclos
de la materia son los ciclos biogeoqumicos.

Como ejemplos de ciclos biogeoqumicos, y el papel que desempean los microorganismos


en ellos, estudiaremos el ciclo del carbono y el ciclo del nitrgeno:

A) EL CICLO DEL CARBONO

Mediante el proceso de fotosntesis, las plantas toman el carbono en forma de CO2 de la


atmsfera o del agua, asimilndolo durante la fase oscura de dicho proceso para formar
molculas orgnicas. Parte del carbono vuelve al medio inerte en la misma forma de CO2
como resultado de la respiracin tanto de las propias plantas como de los organismos
consumidores y descomponedores. Los desechos, restos o cadveres que contienen
carbono vuelven tambin al medio inorgnico por accin de los descomponedores (bacterias
y hongos).

Combustin CO2

Vegetales
Descomponedores
P Fotosntesis Respiracin
e (Bacterias
C
t a Hongos)
r r Compuestos
b
l orgnicos
e n
o

Consumidores

Compuestos
orgnicos

Fig. 34 El ciclo del carbono.

J. L. Snchez Guilln Pgina IV-1-23


IV) Microbiologa 1) Microbiologa

Una parte muy importante del carbono, puede tardar millones de aos en incorporarse al
medio inerte. Es el caso del carbono que llega a formar parte del petrleo y del carbn
mineral. Este carbono puede volver al ciclo por combustin de estos combustibles fsiles.

B) EL CICLO DEL NITRGENO

La fuente principal de nitrgeno es la atmsfera, de la que este gas constituye un 78%; sin
embargo, este nitrgeno atmosfrico slo puede ser fijado por un grupo de bacterias
fijadoras del nitrgeno que transforman este gas en compuestos nitrogenados utilizados
directamente por las plantas. Entre el grupo de bacterias fijadoras del nitrgeno est el
gnero Rhizobium que se encuentra en simbiosis con las races de las plantas leguminosas
(guisantes, judas, trboles, alfalfa, etc.), estas bacterias se introducen en los tejidos del
vegetal, donde proliferan y desarrollan una especie de ndulos fijadores del nitrgeno.

El resto de las plantas depende del nitrgeno que se encuentra en el suelo, de donde lo
toman en forma de nitratos.

Cuando un organismo muere, el nitrgeno de los restos orgnicos, como son las protenas
y los cidos nucleicos, por accin de bacterias y hongos presentes en el suelo, se convierte
en amoniaco o in amonio (amonificacin).

Otros grupos de bacterias del suelo oxidan los iones amonio a nitritos y finalmente las
bacterias nitrificantes oxidan los nitritos a nitratos. Los nitratos son ya fcilmente
absorbidos por las races de las plantas y utilizados para formar molculas nitrgenadas
(protenas y cidos nucleicos). Mediante las cadenas trficas posteriores, el nitrgeno
asimilado en estas molculas del vegetal pasa a los animales.

Existe un grupo de bacterias desnitrificantes que en condiciones anaerobias y de


inundacin, convierten los nitratos del suelo en nitrgeno molecular, que escapa a la
atmsfera. Por eso los agricultores drenan las tierras para reducir la desnitrificacin y
aaden fertilizantes para incrementar los niveles de nitrgeno del suelo.

Bacterias y
hongos

Animales

Bacterias Sustancias
Suelos nitrogenadas
fijadoras
de orgnicas:
Nitrgeno Nitratos
nitrgeno -Protenas
atmosfrico Nitritos
de los
suelos Sales - cidos
amoniacales nuclicos

Vegetales
Algas

Fig. 35 El ciclo del nitrgeno.

J. L. Snchez Guilln Pgina IV-1-24


IV) Microbiologa 1) Microbiologa

6. LOS MICROORGANISMOS COMO AGENTES DE ENFERMEDADES INFECCIOSAS

La mayora de los microorganismos son inocuos para los dems seres vivos. Muchos de
ellos incluso se han adaptado a las condiciones especiales que tienen los tejidos de los
animales viviendo en ellos, en su piel, en sus conductos digestivos o respiratorios; son la
denominada flora normal. Sin embargo, los microbios ms conocidos son aquellos que
producen enfermedades infecciosas en las plantas, en los animales y en la especie humana.
Estos son los microorganismos patgenos.

El grado de patogenidad se denomina virulencia y se mide, generalmente, por el nmero de


microorganismos necesarios para desarrollar la enfermedad. Hay microorganismos que
normalmente no son patgenos pero pueden serlo cuando disminuyen los mecanismos
defensivos de un animal: son los microorganismos oportunistas.

Robert Koch (1843- 1910) fue el primero en comprobar que una bacteria era la causante de una enfermedad
infecciosa, el carbunco en ovinos. Estableci cuatro postulados que constituyen la base de las investigaciones
mdicas para establecer el tratamiento de las infecciones:

1)El organismo especfico ha de encontrarse siempre asociado a la enfermedad.


2)El organismo tiene que ser aislado y obtenido en cultivo puro en el laboratorio.
3)Este cultivo puro inoculado en un animal susceptible de ser infectado produce la enfermedad.
4)Se debe recuperar el organismo del animal infectado experimentalmente en cultivo puro.

Otros aportes de la labor investigadora de Koch fueron el descubrimiento de los cultivos en medios slidos y el
descubrimiento de los agentes causantes de la tuberculosis (llamado desde entonces bacilo de Koch) y del clera.

V AS DE INFECCIN

El primer paso en una infeccin es la colonizacin por parte de los microorganismos de


tegumentos y mucosas corporales, donde deben competir con otros microorganismos
comensales. Los que superan esta primera fase con ms xito son los que producen las
enfermedades ms contagiosas.

La entrada de microorganismos en el cuerpo del hospedador puede tener lugar a travs de


distintas vas:

- Heridas o abrasiones en los tegumentos.


- Roturas microscpicas en las mucosas.
- Picaduras de artrpodos (arcnidos e insectos, principalmente).
- Adherencia especfica del microorganismo a las clulas del hospedador y paso a travs de
clulas epiteliales.
- En determinadas circunstancias, algunos microorganismos forman colonias muy
numerosas en los tegumentos, las cuales son responsables de una lesin epitelial,
producindose inflamacin y rotura, a travs de la cual penetran.

Una vez dentro, los microbios tienen que reproducirse, ya sea en una lesin superficial, ya
sea en un tejido especfico al que son conducidos por va linftica o sangunea. En esta
primera fase tienen que superar los mecanismos defensivos del hospedador, lo que incluye

J. L. Snchez Guilln Pgina IV-1-25


IV) Microbiologa 1) Microbiologa

la inflamacin, la detencin en los ganglios linfticos y su eliminacin de la sangre por


accin de los fagocitos. Si consiguen superarlos, se desarrolla la enfermedad. El tiempo
que transcurre desde que penetran hasta la manifestacin de los sntomas de enfermedad
se denomina perodo de incubacin.

Las infecciones pueden ser superficiales, si el microorganismo se multiplica en las clulas


epiteliales de la zona de entrada, o sistmicas si alcanzan los vasos sanguneos y se
multiplican en varios rganos a la vez.

Factores de patogenicidad. Toxinas

Segn la infeccin va progresando, se empiezan a manifestar los sntomas de la


enfermedad. Esto nos indica que el hospedador ya ha sufrido una lesin por diversas
causas:

* La proliferacin de los microorganismos

El crecimiento del nmero de clulas microbianas puede conllevar dos clases de peligro: de
un lado, se puede crear una competencia entre el microbio y las clulas del hospedador por
un determinado nutriente; de otro lado, se puede producir el bloqueo de vasos sanguneos
o un dao directo sobre las clulas del hospedador

* Produccin de toxinas

Las toxinas son sustancias venenosas de bajo peso molecular, que pueden ser excretadas
al medio (exotoxinas), como la del botulismo o el ttanos, o retenidas dentro de la clula
(endotoxinas). Estas toxinas pueden provocar daos locales, cuando son muy especficas,
o difundirse y causar lesin sistmica.

* La produccin de enzimas extracelulares como la lecitinasa que hidroliza los lpidos de


membrana de las clulas husped; las hemolisinas que lisan los glbulos rojos, liberando al
plasma su hemoglobina, etc.

J. L. Snchez Guilln Pgina IV-1-26


IV) Microbiologa 1) Microbiologa

7. BIOTECNOLOGA

La biotecnologa es el conjunto de procesos industriales que se sirve de microorganismos


o de clulas procedentes de animales o vegetales para obtener determinados productos
comerciales o para realizar importantes transformaciones qumicas.

La biotecnologa se ocupa, entre otros, de procesos tan diferentes como la clonacin, la


terapia gnica, la inseminacin in vitro, la obtencin de bebidas alcohlicas, etc.

Aunque el trmino es moderno, rene tcnicas y mtodos conocidos desde la antigedad.


Por ejemplo, la fabricacin del pan, que ya realizaban los antiguos egipcios, la mejora de las
razas de animales y la obtencin de plantas con mayor produccin de frutos.

El trmino biotecnologa se comenz a usar a finales de los aos setenta, tras la aparicin
de la ingeniera gentica, que se basa en la manipulacin del material gentico de las clulas.

En la actualidad, con la expansin de la biotecnologa y los mtodos de manipulacin


gentica, los microorganismos han sido modificados para fabricar productos tiles que los
microorganismos no producen de manera natural.

BIOTECNOLOGAS APLICADAS A LA MEJORA DEL MEDIO AMBIENTE

Diversas tcnicas biotecnolgicas permiten resolver, de diferentes y novedosas maneras, el


problema de la contaminacin ambiental.

Se pueden utilizar diversos microorganismos para afrontar problemas de tratamiento y


control de la contaminacin qumica de distintos ecosistemas. La ingeniera gentica
permite combinar las caractersticas de estos microorganismos para aumentar su eficacia o
generar microbios recombinantes con nuevas caractersticas.

Aunque muchos microorganismos diferentes juegan un papel esencial en los equilibrios


ambientales, la mayora de las aplicaciones biotecnolgicas actuales se realizan con ciertos
tipos de bacterias.

Algunas de las aplicaciones de la biotecnologa a la mejora del medio ambiente son las
siguientes:

- Eliminacin de metales pesados.


- Eliminacin de mareas negras.
- Obtencin de energa no contaminante.
- Tratamiento de residuos urbanos e industriales.
- Tratamiento de diferentes tipos de contaminacin asociados a la industria del
petrleo.
- Tratamiento de la contaminacin producida por herbicidas, pesticidas e insectici-
das.
- Depuracin de aguas residuales.

J. L. Snchez Guilln Pgina IV-1-27


IV) Microbiologa 1) Microbiologa

Control de mareas negras

Se llama marea negra al vertido masivo de petrleo debido a un accidente durante el transporte del petrleo en
grandes barcos.

Es posible utilizar bacterias que digieren los hidrocarburos que forman el petrleo y los transforman en sustancias
qumicas nada o menos contaminantes. Aunque generalmente cada tipo de bacteria utiliza una clase de
hidrocarburo, se intenta combinar las caractersticas de varias bacterias para conseguir una bacteria recombinante
capaz de transformar muchos hidrocarburos diferentes.

Eliminacin de metales pesados

Los iones metlicos de los elementos pesados (por ejemplo, mercurio, cinc, nquel, cobre, plomo) movilizados por la
accin humana a distintos ecosistemas constituyen el tipo de contaminacin ms grave del planeta. Los efectos
contaminantes de los metales pesados superan en cuanta la suma de todos los dems tipos de contaminacin
qumica.

Gracias a la ingeniera gentica se han desarrollado bacterias que pueden vivir en presencia de metales pesados y
eliminarlos mediante diversas reacciones qumicas.

BIOTECNOLOGAS APLICADAS A LA MEJORA DE LA SALUD

La biotecnologa tiene en la salud humana, entre otros, los siguientes campos de


aplicacin:
- Prevencin de enfermedades hereditarias.
- Terapia gnica.
- Produccin de vacunas.
- Obtencin de anticuerpos monoclonales e interferones.
- Produccin de hormonas (por ejemplo insulina y hormona del crecimiento).
- Produccin de antibiticos y otros productos farmacuticos.

Antibiticos

La palabra antibitico designa a aquellas sustancias que, producidas por determinados microorganismos, pueden
acabar con la vida de otros.

En 1929, Alexander Fleming descubri estas sustancias. Estaba trabajando con Staphylococcus aureus y su cultivo
se contamin con un hongo del gnero Penicillium, de forma que las colonias rodeadas por ste moran. Fleming
supuso que el hongo produca alguna sustancia antibacteriana, por lo que hizo un filtrado, descubriendo as, la
penicilina. Fue incapaz de purificarla, dado que era qumicamente inestable, lo que se hizo aos ms tarde, gracias al
desarrollo de un proceso industrial adecuado.

Desde 1945 se han aislado cientos de antibiticos producidos por hongos del gnero Penicillium y bacterias de los
gneros Bacillus y Streptomyces.

El gran problema de la actualidad es que han comenzado a desarrollarse a un ritmo alarmante cepas de patgenos
resistentes a antibiticos e, incluso, cepas multirresistentes a varios antibiticos simultneamente, por lo que hay
que encontrar otros nuevos, o modificar los existentes para que recobren su eficacia, lo que constituye el gran reto
de la biotecnologa.

J. L. Snchez Guilln Pgina IV-1-28


IV) Microbiologa 1) Microbiologa

Hormonas

Las personas que sufren diabetes mellitus deben inyectarse insulina varias veces al da. Hasta 1983 la insulina que
utilizaban las personas diabticas era insulina de cerdo purificada (diferente de la humana). Desde esa fecha se utiliza
insulina obtenida por ingeniera gentica: se ha introducido el gen de la insulina humana en la bacteria Escherichia
coli, que la produce en cantidades masivas y con las mismas caractersticas. La insulina es la primera protena
fabricada por ingeniera gentica y comercializada.
Tambin por ingeniera gentica se obtiene la hormona del crecimiento.
Otras hormonas como la testosterona y progesterona, hormonas sexuales masculina y femenina, utilizada sta
ltima en la fabricacin de frmacos anticonceptivos se obtienen de la fermentacin de ciertas levaduras.

Fabricacin del yogur


BIOTECNOLOGAS DE LOS ALIMENTOS Se utiliza leche, que fermenta mediante determi-
nadas cepas de las bacterias Lactobacillus y
El hombre desde la antigedad ha obtenido Streptococcus que transforman la lactosa en
productos alimenticios con la intervencin de cido lctico. El cido lctico es el causante de la
los microorganismos, a pesar de desconocer su precipitacin de las protenas de la leche. Ambos
existencia. Hoy da gracias al conocimiento de microorganismos necesitan una temperatura de
sus caractersticas y metabolismo, son explota- 45C para desarrollarse al mximo, por eso la
dos industrialmente en la fabricacin de leche se envasa en caliente para que despus siga
el proceso de fermentacin en la estufa a dicha
numerosos alimentos y bebidas. Por ejemplo:
temperatura. El pH del yogur (despus del
enfriamiento a 4 C) es alrededor de 4, este medio
cido impide el crecimiento de otras bacterias.
Pan. Actualmente la produccin de yogures se ha
Yogur. especializado en gran cantidad de sabores e
Queso. incluso en el enriquecimiento de nuevas bacterias.
Mantequilla.
Vinagre.
Vino.
Cerveza.
Encurti dos.
Fabricacin de cerveza
Produccin de protenas para piensos de
Es un proceso que se conoce desde antiguo, ya
animales domsticos. que, al parecer, los babilonios fueron los primeros
Sntesis de vitaminas que se aaden a los en elaborar la cerveza.
alimentos o en compuestos farmacuticos. Se basa en la fermentacin alcohlica que
(Por ejemplo la vitamina B12 es producida realizan las levaduras del gnero Saccharomyces.
industrialmente a partir de bacterias y la La cerveza se obtiene por fermentacin de la
riboflavina es producida por diversos cebada realizada por las levaduras S. cerevisae o
microorganismos como bacterias y hongos). S. carlsbergensis. Los granos de cebada se ponen
Sntesis de aminocidos que se utilizan a remojo, de forma que germinan y generan
amilasas suficientes que hidrolizan el almidn.
como aditivos alimentarios. (Ejemplos de
Despus se secan, lo que constituye la malta, la
aminocidos producidos por fermentacin
cual se puede almacenar hasta su uso. Con la
microbiana son el cido glutmico, la lisina, malta se obtiene el mosto de cerveza, al cual se
la glicina, la metionina y la alanina). adiciona el lpulo, encargado de dar a la cerveza
el sabor amargo y de conservarla del crecimiento
bacteriano. Es entonces cuando se aade el
inculo, que fermenta durante cinco a diez das a
temperatura y pH adecuados.

J. L. Snchez Guilln Pgina IV-1-29


V) Inmunologa 1) Inmunologa

INMUNOLOGA

(1)
CONCEPTO DE INMUNIDAD

Conjunto de mecanismos que un individuo posee para enfrentarse a la invasin de


cualquier cuerpo extrao y para hacer frente a la aparicin de tumores.

Esta cualidad se adquiere antes del nacimiento y se madura y afianza en los primeros aos
de vida. En los vertebrados implica que los organismos diferencian lo propio de lo ajeno, es
decir reconocen todos sus tipos celulares.

El Sistema Inmune es el responsable de conferir inmunidad. Este sistema, presente en


invertebrados, alcanza su mxima complejidad en los primates y seres humanos. La ciencia
encargada de estudiar estos procesos se denomina Inmunologa .

EL SISTEMA INMUNE

Es un sistema biolgico complejo. Se adenoides

encuentra distribuido por todos los rganos y amgdalas


ganglios linfticos
fluidos vasculares e intersticiales, excepto el
cerebro, concentrndose en rganos
especializados como la mdula sea, el bazo, el
timo y los ndulos linfticos. timo
bazo
Presenta componentes celulares: linfocitos,
macrfagos y granulocitos y molculas solubles: placas de Peyer

anticuerpos, linfocinas y complemento. (intestino delgado)

apndice
Es el responsable de conferir la inmunidad al
actuar de forma coordinada todos sus mdula sea
componentes.

Las clulas y molculas que participan en la


defensa inmune llegan a la mayor parte de los
tejidos por el torrente sanguneo que pueden
abandonar a travs de las paredes de los
capilares y al que pueden regresar por el Fig. 1 Situacin de los rganos del sistema
sistema linftico. inmune en la especie humana.

(1) Lectura: http://www.ugr.es/~eianez/inmuno/cap_01.htm

J. L. Snchez Guilln Pgina V-1-1


V) Inmunologa 1) Inmunologa

FUNCIONES DE LOS RGANOS LINFOIDES

rganos
rganos
linfoides
linfoides

Secundarios
Secundarios
Primarios
Primarios
Enellos
En elloslas
las
Origen,
Origen, clulasinmunes
clulas inmunes
desarrolloyy
desarrollo madurasson
maduras son
maduracinde
maduracin de
activadaspor
activadas porlos
los
lasclulas
las clulasdel
del
antgenos
antgenos
sistemainmune
sistema inmune

Mdulasea
sea Timo
Timo Adenoides,
Adenoides, Ganglios
Ganglios
Mdula
amgdalasyy
amgdalas linfticos
linfticos
Origende
Origen delas
las Maduracinde
Maduracin de placasde
placas de yybazo
bazo
clulasdel
clulas del loslinfocitos
los linfocitosTT Peyer
sistema
Peyer Activacinde
Activacin delos
los
sistema Activacinde delos
los linfocitosTTyyBB
inmunolgico Activacin linfocitos
inmunolgico linfocitospor
porlos
los
Maduracinde
Maduracin de linfocitos
loslinfocitos
linfocitosBB antgenos
antgenos
los

17

Fig. 2 Funcin de los diferentes rganos linfoides del sistema inmunitario.

DEFENSAS DEL ORGANISMO FRENTE A LA INFECCIN

Mecanismos de
defensa

Mecanismos Mecanismos
Innatos adquiridos

Mecanismos Mecanismos
Innatos externos Innatos internos

Barreras fsicas Clulas fagocitarias:


Celulares: linfocitos
Barreras qumicas - Neutrfilo (pus)
Moleculares: anticuerpos
Flora autctona - Macrfago
Clulas asesinas
Interfern
Complemento

Fig. 3 Defensas del organismo.

J. L. Snchez Guilln Pgina V-1-2


V) Inmunologa 1) Inmunologa

DEFENSAS INESPECFICAS O MECANISMOS INNATOS.

Estn presentes en el organismo de forma natural y se definen como el conjunto de


mecanismos que tienden a evitar la invasin de los microorganismos. Son de dos tipos:
unos impiden la entrada del agente invasor y otros lo combate una vez que ha penetrado.

MECANISMOS INNATOS EXTERNOS:

* Barreras fsicas.

La piel en los animales, que gracias a la capa de queratina, que sufre continuas descamacio-
nes, evita que penetren o proliferen colonias de microorganismos. As, slo los espirilos
con su efecto de barrena pueden atravesar las mucosas.

* Barreras qumicas.

- Los orificios naturales estn tapizados por mucosas que segregan mucus con la finalidad
de englobar partculas extraas para su expulsin. El moco posee adems sustancias que
engaan a ciertos virus, hacindoles creer que ya han penetrado dentro de la clula, el virus
suelta su cido nucleico que se pierde en el exterior.

- Tambin, la presencia de fluidos en ciertas zonas, por ejemplo: las lgrimas, en los ojos o la
saliva en la boca, que lavan y arrastran los microorganismos impidiendo que se instalen o
que penetren. Adems, estos fluidos contienen sustancias antimicrobianas; por ejemplo: la
saliva contiene lisozima, el semen, espermina, etc. Como curiosidad se puede decir que las
infecciones oculares son ms frecuentes en los hombres que en las mujeres.

- Las secreciones de sustancias que modifican el pH dificultan la supervivencia de los


grmenes. Un ejemplo es el HCl del estmago que no tiene una funcin digestiva sino
antimicrobiana o la secrecin de cidos grasos en la piel o de cido lctico.

* Flora autctona.

Los microorganismos presentes de una manera natural en ciertas partes de nuestro


organismo, por ejemplo, las bacterias que forman la flora intestinal, impiden que otros se
instalen, segregando sustancias o estableciendo competencia por los nutrientes.

MECANISMOS INNATOS INTERNOS

En caso de que el agente extrao logre salvar


los anteriores obstculos intervienen
respuestas tanto celulares como acelulares.

Clulas asesinas naturales (Natural Killer -


NK). Son clulas linfoides que se parecen a
los linfocitos y que provocan la muerte de los
microorganismos, clulas infectadas, clulas
tumorales o clulas ajenas. No se sabe cmo Clula Natural killer Clula atacada

las reconocen. Las destruyen unindose a


ellas y fabricando " perforina" una protena Fig. 4 Actuacin de las clulas NK.
que, como su propio nombre indica, crea
agujeros en la membrana de las clulas atacadas matndolas. Son pues clulas
citolticas.

J. L. Snchez Guilln Pgina V-1-3


V) Inmunologa 1) Inmunologa

Interfern. Son molculas de naturaleza proteica segregadas por las clulas infectadas por
virus, que captadas por las clulas adyacentes, las estimulan a sintetizar enzimas
antivirales evitando la proliferacin viral, inhibiendo la replicacin del genoma vrico,
inhibiendo la sntesis de protenas o activando a las clulas NK para destruir a las clulas
infectadas.

El Complemento. Formado por complejos macromoleculares de protenas que se


sintetizan en el hgado y circulan por la sangre donde constituyen un 15% de la fraccin
de inmunoglobulina del suero. Consta de un conjunto de molculas plasmticas
implicadas en una danza bioqumica coordinada, cuya funcin es potenciar la respuesta
inflamatoria, facilitar la fagocitosis y dirigir la lisis de clulas, incluyendo la apoptosis (el
suicidio celular). Cuando se activa alguno de sus componentes por diversas sustancias
como polisacridos o anticuerpos, se originan una serie de reacciones en cadena. El
complemento es uno de los componentes fundamentales de la respuesta inmunitaria en
la defensa ante un agente hostil.

La respuesta inflamatoria es parte de la inmunidad innata y se presenta cuando los


tejidos son lesionados por bacterias, traumas, toxinas, calor o cualquier otra causa. Las
sustancias qumicas, incluyendo la histamina, bradiquinina, serotonina y otras, son
liberadas por el tejido daado y hacen que los vasos sanguneos derramen lquido en los
tejidos, lo que deriva en una inflamacin localizada. Esto ayuda a delimitar y aislar la
sustancia extraa del contacto con otros tejidos corporales.

Clulas responsables de
la inmunidad innata

Macrfago Clulas natural Neutrfilo


asesinas (natural
killer)

-Fagocitosis. Fagocitosis y
Citotxicas.
-Activacin de los eliminacin de
linfocitos T microorganismos.

Fig. 5 Clulas responsables de la inmunidad innata interna.

DEFENSAS ESPECFICAS O MECANISMOS ADQUIRIDOS.

A lo largo del proceso evolutivo muchos microorganismos se han hecho parsitos


celulares, incluso de las clulas que nos defienden de ellos, los macrfagos. En estas
circunstancias, la respuesta innata no es eficaz. Es por esto que se han desarrollado
defensas especficas contra ellos. Estas defensas las lleva a cabo el Sistema Inmunitario y
al contrario que los mecanismos inespecficos, que siempre estn presentes, nicamente

J. L. Snchez Guilln Pgina V-1-4


V) Inmunologa 1) Inmunologa

se desarrollan como respuesta a la invasin por un agente extrao concreto. Estas


respuestas son celulares: linfocitos y humorales: anticuerpos.

La caracterstica de este sistema es que nos defiende especficamente de parsitos,


rganos trasplantados, clulas cancerosas, microorganismos y sustancias txicas
fabricadas por ellos.

Los individuos nacen con un sistema inmunolgico capaz de responder ante lo propio y lo
ajeno. Durante las primeras fases del desarrollo este sistema "aprende" a reconocer lo
propio y esta capacidad se denomina tolerancia inmunolgica, cuando esta tolerancia se
pierde aparecen las enfermedades autoinmunes. En ocasiones pueden producirse
reacciones de hipersensibilidad: alergias, que son respuestas del sistema inmunitario a
sustancias que en principio son inocuas (por ejemplo: el polen).

Las clulas y las sustancias que se comportan como extraas para el organismo y contra las
cuales ste desarrolla una respuesta inmune especfica se llaman antgenos. Casi cualquier
macromolcula (protena o polisacrido, ms concretamente) con masa molecular de 5000
da o ms puede desencadenar la respuesta inmunitaria, siempre que sea extraa al
receptor.

Los ndulos linfticos sirven como filtro de la circulacin a los microbios, partculas
extraas, restos tisulares y clulas muertas. Contienen linfocitos y macrfagos y es en su
interior donde ocurren las interacciones responsables de la respuesta inmune.

LAS CLULAS DEL SISTEMA INMUNITARIO ADQUIRIDO

1) Los linfocitos Son clulas sanguneas que se desarrollan a partir de las clulas madres
hematopoyticas, presentes en la mdula roja de ciertos huesos, clulas pluripotenciales que
dan lugar a todos los tipos de clulas sanguneas: glbulos rojos (heritrocitos), glbulos
blancos (leucocitos) y plaquetas.

Los lifocitos, uno de los tipos de leucocitos, son


los responsables de la especificidad inmunitaria.
Existen dos clases fundamentalmente:

* Los linfocitos T: Responsables de la inmunidad


celular. Se originan a partir de clulas de la mdula
sea que emigran al timo. Una vez maduran en el
timo lo abandonan y se instalan en los tejidos
linfoides. La maduracin en el timo se da poco
antes del nacimiento y algunos meses despus.
Si se elimina el timo antes de esta
transformacin la respuesta inmunitaria celular
no se desarrolla.
Fig. 6 Linfocito T (microscopio de barrido).
Cada linfocito T puede reaccionar a un antgeno
especfico o un grupo de antgenos sensibilizndose lo que desencadena la respuesta
inmunitaria celular. El linfocito T especfico aumenta de volumen, se divide activamente y
produce un clon del que se diferencian diversas subpoblaciones de linfocitos:
Los lifocitos Tc (citotxicos) que destruyen las clulas infectadas y las clulas
tumorales.

J. L. Snchez Guilln Pgina V-1-5


V) Inmunologa 1) Inmunologa

Los linfocitos Th-2 (linfocitos Receptores T (TCR)

ayudadores tipo 2) que


desencadenan la produccin de
anticuerpos por los linfocitos B.
Los linfocitos Th-1 (linfocitos
Linfocito Th-1 o Th-2 activado
ayudadores tipo 1) que Linfocito Th

desencadenan una de las vas de la


respuesta celular.
Los linfocitos T supresores (Ts):
Linfocito Th
Inhiben la respuesta inmune cuando Macrfago u otra
clula presentadora
del antgeno
esta ya no es necesaria.
Los linfocitos T de hipersensibilidad Fig. 7 La interaccin entre un macrfago y un
retardada: Juegan un importante linfocitos Th (ayudador), lo trasforma en lifocito
papel en las reacciones de Th-1 o linfocito Th-2.
hipersensibilidad (alergias).
Los linfocitos T amplificadores: Aumentan desmesuradamente la actividad de los
linfocitos T (auxiliares y supresores) y de los linfocitos B.
Los linfocitos T de memoria: Son responsables de la memoria inmunolgica.
Responden rpidamente a nuevas invasiones del antgeno

Los linfocitos B. Son las clulas responsables de la inmunidad humoral, Se originan


tambin en la mdula sea y al parecer maduran tambin en ella. Se llaman as pues en las
aves maduran en la bolsa de Fabricio. Despus de madurar, emigran al tejido linfoide
donde se instalan. Se piensa que cada individuo tiene del orden de 100 000 000 de
linfocitos B diferentes capaces cada uno de producir un anticuerpo distinto. A lo largo del
proceso de respuesta inmunitaria, por la actuacin de los linfocitos Th-2 darn lugar a:

Las clulas plasmticas: responsables de la produccin de anticuerpos


responsables de la inmunidad humoral.
Las clulas plasmticas de memoria: Capaces de desencadenar una rpida
produccin de anticuerpos ante una nueva entrada del antgeno.

2) Los macrfagos: Los macrfagos son clulas


que se desplazan con movimiento ameboide MHC-II Antgeno

entre las clulas de los tejidos fagocitando a los


microorganismos, degradndolos y exponiendo Virus

molculas del microorganismo o fragmentos de


estas en su superficie unidas a unas molculas
glicoproteicas presentes en la membrana de Macrfago
fagocitando un virus Macrfago presentador
todas las clulas denominadas molculas del del antgeno.

Complejo Mayor de Histocompatibilidad (MHC).


Es as como los linfocitos T pueden reconocer
Fig. 8 Macrfago fagocitando un virus y
que un agente extrao ha penetrado en el
presentando los antgenos unidos al MHC-II
organismo. Las clulas presentadoras de ant - (complejo mayor de histocompatibilidad-II).
geno pueden ser macrfagos u otras clulas del
organismo.

As pues, puede decirse que el sistema inmunitario slo reconoce lo "ajeno" si


es presentado por lo "propio".

J. L. Snchez Guilln Pgina V-1-6


V) Inmunologa 1) Inmunologa

LOS ANTICUERPOS. ESTRUCTURA DE LOS Cadena pesada (H)

ANTICUERPOS. Cadena ligera (L)

Zona bisagra

Los anticuerpos (Ac) o inmunoglobulinas son


prote nas globulares que participan en la
defensa contra bacterias y parsitos mayores.
Circulan por la sangre y penetran en los fluidos
corporales donde se unen espec ficamente al
antgeno que provoc su formacin Glcido Glcido

Son prtidos, glucoprotenas (gamma glo-


Parte variable
bulinas). Son molculas formadas por una o va- Parte constante

rias unidades estructurales bsicas, segn el Enlaces disulfuro

tipo de anticuerpo. Cada unidad esta formada


Fig. 9 Unidad estructural bsica de un
por cuatro cadenas polipptidicas iguales dos a
anticuerpo.
dos. Dos cadenas pesadas (H) y dos ligeras (L)
y una cadena glucdica unida a cada una las
cadenas pesadas. Las uniones entre las
subunidades proteicas se establecen por puen-
tes disulfuro.

Tanto en las cadenas ligeras como en las


cadenas pesadas hay dos porciones, la porcin
variable (en gris en la figura) diferente en cada
anticuerpo y la porcin constante (en blanco).

La porcin variable es la encargada de reco-


nocer al antgeno y de unirse a l. Al haber
tantos tipos de antge nos, debe de haber
tambin muchos tipos de anticuerpos que se
distinguirn por su regin variable. Es por esto
que esta regin debe de tener una gran Fig. 10 Modelo molecular de la unidad
posibilidad de variacin. estructural bsica de un anticuerpo.

La regin constante tiene funcin estructural


y tiene menos variacin, aunque hay nueve tipos de regiones constantes distintas. De la
regin constante va a depender, en cierto modo, la localizacin del anticuerpo. As,
segn la regin constante que tengan unos van a localizarse en la saliva, otros pueden
pasar la placenta, etc. La regin constante es tambin la parte que desencadena la
respuesta celular. As, los anticuerpos se unen a los microorganismos por su parte
variable, esto hace cambiar la regin constante y este cambio es detectado por los
macrfagos que fagocitarn aquello que lleve anticuerpos pegados, por lo que los
anticuerpos libres en la sangre no desencadenarn la respuesta celular.

Los anticuerpos tienen adems una zona bisagra. Esta zona es de gran importancia pues
debido a ella se pueden adaptar mejor y unirse mejor al antgeno. Ahora bien, al tener en
ambos extremos regiones variables va a poder unirse a dos antgenos diferentes.

Tipos de anticuerpos

Hay cinco tipos: Ig M, Ig G, Ig A, Ig D e Ig E . Se diferencian en estructura, momento de


la infeccin en el que aparecen, actividad y lugar donde se encuentran (sangre, leche,
saliva, etc.)

J. L. Snchez Guilln Pgina V-1-7


V) Inmunologa 1) Inmunologa

Los de tipo M (Ig M) son los primeros que se


producen frente a una infeccin. No tienen
regiones bisagra, por lo que no se adaptan bien al
antgeno. Ahora bien, al ser tan grandes y tener
tantos puntos de unin, si no se unen por una
parte, se unir por otra y por eso son eficaces.
Aparecen tambin en la superficie de los linfocitos
Pieza J
B como "antenas" para recibir los anticuerpos.

Los de tipo G (Ig G) se generan despus. Al tener


regiones bisagra protegen ms eficazmente que los
de tipo M. Pueden atravesar la placenta y proteger
al feto de las infecciones pues los fetos no tienen Fig. 11 Anticuerpo Ig M, anticuerpos de baja
sistema inmunitario especfico, si lo tienen innato. afinidad. Son los primeros que aparecen despus de
La presencia de anticuerpos G indica que la infec- la infeccin.
cin es un proceso antiguo. Componente
secretor

Tipo A (Ig A): Aparecen despus de los M. Son de


alta afinidad. No se encuentran en gran cantidad
en el suero pero s en las secreciones, saliva y
moco, pues atraviesan las mucosas. Pueden
tambin pasar a la leche y proteger a los lactantes.
Cadena J
La pieza secretora y la especial configuracin que
pueden adoptar los protege y evita que sean degra-
dados en ciertas zonas, como en el intestino, Fig. 12 Anticuerpo Ig A de alta afinidad,
donde existen proteasas que podran destruirlos. aparecen en las secreciones como la saliva o el
moco.
Tipo D (Ig D): Sustituyen a los M. Tienen la misma
funcin que estos pero tienen ms afinidad y se unen ms fuertemente. Aparecen tambin como
antenas en la superficie de los linfocitos B cuando estos contactan con el antgeno.

Tipo E (Ig E): Son de alta afinidad. Tienen tambin la capacidad de salir a las secreciones. Tienen
mala fama, pues median en los procesos alrgicos y de anafilaxis (alergia a huevos, mariscos,
polen...). Su funcin es la de eliminar parsitos, sobre todo gusanos. Promueven la accin de los
mastocitos y de los eosinfilos que producen protenas que vacan a los gusanos. Es de destacar
que las infestaciones por protozoos y gusanos son ms corrientes que las infecciones bacterianas.

J. L. Snchez Guilln Pgina V-1-8


V) Inmunologa 1) Inmunologa

LA RESPUESTA INMUNITARIA ADQUIRIDA

Los organismos que desarrollan inmunidad adquirida van a reaccionar desencadenando


dos tipos de respuesta:

La respuesta inmunitaria humoral: El objetivo de esta respuesta es la produccin de


anticuerpos por las clulas plasmticas. Estos se fijarn a los organismos y molculas
extraas con capacidad antignica provocando una serie de reacciones que conducirn a
la destruccin de los agentes extraos, que sern fagocitados por los macrfagos
fundamentalmente. Esta respuesta se dirige sobre todo a los agentes extraos, virus, por
ejemplo, que salen de las clulas infectadas para infectar nuevas clulas.

La respuesta inmunitaria celular: La respuesta humoral es poco eficaz si se trata de


destruir a los agentes extraos que estn en el interior de las clulas del propio organismo.
La respuesta celular va dirigida a destruir estas clulas infectadas y a evitar que los
agentes extraos puedan seguir reproduciendose en ellas.

Ambas respuestas actan coordinadamente contra los agentes patgenos circulantes,


los que se encuentran en el interior de las clulas y las toxinas producidas por ellos.

La respuesta
inmunitaria

Humoral Celular

Objetivo:
produccin de Dirigida a destruir
anticuerpos por a clulas
las clulas infectadas para
plasmticas. evitar que puedan
seguir generando
nuevos agentes
infecciosos.
Dirigida a agentes Tambin
extraos, virus, destruyen clulas
por ejemplo, que tumorales.
salen de las
clulas infectadas
para infectar otras
clulas.

Fig. 13 La respuesta inmunitaria adquirida.

J. L. Snchez Guilln Pgina V-1-9


V) Inmunologa 1) Inmunologa

LA RESPUESTA INMUNITARIA I (La respuesta humoral)

1) Comienza cuando un macrfago o una clula MHC-II Antgeno

emparentada fagocita al microorganismo y lo degrada,


presentando partculas del microorganismo o antgenos Virus

(Ag) en la superficie de su membrana unidos al MHC-II


(complejo mayor de histocompatibilidad) del macrfago.

Macrfago
fagocitando un virus Macrfago presentador
del antgeno.

TCR
3) Si un linfocito Th (ayudador) que lleve un receptor (TCR) MHC-II-Antgeno

adecuado, que se adapte al complejo MCH-II-Ag, entra en


contacto con el macrfago presentador del antgeno, se
activa, se multiplica y se diferencia en dos poblaciones de
linfocitos: la Th-1 y la Th-2. La Th-2 ser la que
desencadene la respuesta humoral y la Th-1 desencadenar
la respuesta celular.
Linfocito
Linfocito Th-2Thactivado
(ayudador)

Virus
3) Si un linfocito B que lleve en su membrana un anticuerpo MHC-II-Ag
BCR
especfico (BCR o receptor de la clula B) adecuado
establece contacto con el antgeno, lo internaliza mediante
endocitosis, lo degrada y presenta fragmentos antignicos
en su membrana unidos al MHC-II (MHC-II-Ag).

Linfocito
Linfocito B especfico
especfico
activado

4) Cuando el linfocito Th-2 activado y el linfocito B que TCR


Interleucinas
MHC-II-Ag
lleva el complejo MHC-II-Ag adecuado, por haber estado en
contacto con el antgeno, entran en contacto, se
desencadena la produccin de interleucinas por parte del
linfocito Th-2. Esto transformar al linfocito B en una clula
plasmtica.

Linfocito Th-2 activado Linfocito


Linfocito B por Ag
B activado

5) La clula plasmtica produce grandes cantidades de Anticuerpos Virus

anticuerpos. Los anticuerpos se fijan al agente extrao (un Macrfago


Macrfago
fagocitando los virus
virus, en este caso) de manera especfica y lo marcan para
que pueda ser localizado, identificado y fagocitado por los
macrfagos y otras clulas fagocitarias.

Clula plasmtica

Despus de haber destruido al agente patgeno, la mayor parte de los linfocitos Th-2 y las clulas plasmticas
desaparecen quedando slo algunas pocas llamadas clulas B de memoria y linfocitos Th de memoria que pueden
permanecer durante largo tiempo, incluso aos, para responder de inmediato a futuras entradas del agente invasor
(memoria inmunolgica).

J. L. Snchez Guilln Pgina V-1-10


V) Inmunologa 1) Inmunologa

LA RESPUESTA INMUNITARIA II (La respuesta celular)

TCR
1) Si un linfocito Th (ayudador) que lleve un receptor MHC-II-Antgeno

(TCR) adecuado, que se adapte al complejo MCH-II-Ag


del macrfago presentador del antgeno, entra en
contacto con este, se activa, se multiplica y se
diferencia en dos poblaciones de linfocitos Th: la Th-1
y la Th-2. Los Th-1 desencadenarn la respuesta
celular.

Macrfago presentador del Linfocito


Linfocito Th-1Thactivado
(ayudador)
antgeno.

2) Estos linfocitos liberan sustancias que activan a los


macrfagos para que destruyan a las clulas
infectadas.

Linfocito Th-1 Activacin


Macrfagodel
macrfago

3) Los macrfagos activados (clulas enfadadas) tienen Clula infectada

una gran capacidad fagocitaria. Fagocitan a las clulas


infectadas y son refractarios al parsito intracelular no
infectndose por el microorganismo.

Macrfago Virus
activado

4) Una segunda va celular parte de los lifocitos T Receptores TCR

citotxicos. Estos reconocen con sus receptores (TCR)


los componentes antignicos que les presentan las
celulas infectadas.

Linfocito Tc (citotxico) Clula infectada o tumoral

5) Los linfocitos Tc (citotxicos) actan entonces


produciendo sustancias que destruyen las clulas
infectadas por el virus y tambin clulas tumorales,

Linfocito Tc citotxico Clula infectada o tumoral

Despus de haber destruido las clulas infectadas, las clulas citotxicas desaparecen, pero algunas clulas citotxicas de
memoria permanecen durante ms o menos tiempo para responder de inmediato a futuras entradas del microorganismo
invasor (memoria inmunolgica).

J. L. Snchez Guilln Pgina V-1-11


V) Inmunologa 1) Inmunologa

La respuesta
humoral

Antgeno Macrfago
(fagocita a los patgenos)

activacin

Linfocito B
activacin Linfocito Th-2
fagocita al antgeno

Interleucinas

Linfocito Th-2 de
Anticuerpos memoria
Clula plasmtica

Se unen a los
Clula plasmtica de patgenos. Los
memoria macrfagos los
fagocitan

Fig. 14 La respuesta inmunitaria humoral.

La respuesta
celular

Macrfago Clula infectada


(fagocitan a los patgenos)
Activacin
Activacin

Linfocito Th-1 Linfocito Tc citotxico

Clula infectada

Clula enfadada

Destruccin de
clulas infectadas o
tumorales

Clula enfadada de Fagocitosis de Clula citotxica de


memoria clulas infectadas memoria

Fig. 15 La respuesta inmunitaria celular.

J. L. Snchez Guilln Pgina V-1-12


V) Inmunologa 1) Inmunologa

LA ESPECIFICIDAD ANTIGNICA Y SELECCIN CLONAL

El Sistema Inmunitario puede distinguir


antgenos muy similares entre s, por ejemplo
dos protenas que nicamente se diferencien
en un aminocido.

Por lo tanto el Sistema Inmunitario puede


responder a millones de antgenos extraos
diferentes de una manera altamente espe-
cfica mediante la produccin de anticuerpos
que reaccionan slo con el antge no que ha
inducido su formacin.

)Cmo puede ser que teniendo slo unas


decenas de miles de genes en nuestras clulas
podamos generar hasta 100.000 .000 anticuer-
pos diferentes?

Esto es debido a que durante el desarrollo,


cuando se generan los lifocitos B, se producen
combinaciones y recombinaciones entre los
genes que producen los protmeros que for-
man los anticuerpos. De esta manera se gene-
ran hasta 100.000.000 de lifocitos B diferen-
tes, cada uno de estos linfocito B tiene en su Fig. 16 Especificidad antignica y seleccin
superficie celular unos receptores que se adap- clonal.
tan espec ficamente a un antge no distinto.

Posteriormente, si un antgeno se une a uno de estos receptores, el linfocito se activa y


se reproduce produciendo un clon de clulas que tendrn todas ellas la misma especifici-
dad antignica (Teora de la seleccin clonal). Es decir, la llegada de un antge no extrao
estimula selectivamente a aquellas clulas que presentan unos receptores complementa-
rios y especfi cos del antgeno y por consiguiente listas para dar una respuesta al mismo.

LA REACCIN ANT GENO ANTICUERPO

Las zonas del antgeno que se unen especfi camente con el anticuerpo o con el receptor
de un linfocito, se denominan determinantes antignicos. Cada antgeno puede presentar
varios determinantes antignicos diferentes que estimulan la produccin de anticuerpos y
la repuesta de los linfocitos. Estas estructuras qumi cas, los determinantes antignicos,
son los responsables de la especificidad de la respuesta inmunitaria.

Al entrar en contacto antgeno y anticuerpo se unen mediante enlaces no covalentes (F.


Van der Waals, Uniones hidrofbicas, E. hidrgeno) y se desencadenan una serie de
procesos capaces de neutralizarlo y eliminarlo. La unin entre ellos es reversible, depende
de sus concentraciones y tambin de la afinidad, cuanto mayor sea sta, ms proporcin
de molculas estarn unidas. Las reacciones ms importantes entre antgeno y anticuerpo
son las siguientes:

J. L. Snchez Guilln Pgina V-1-13


V) Inmunologa 1) Inmunologa

Precipitacin: Al unirse ant genos y anticuer- Antgeno

pos solubles forman agregados insolubles que


precipitan, lo que inacti va a los antge nos.

Anticuerpo

Precipitado

Aglutinacin: El anticuerpo se une a ant genos


situados en la superficie de una clula. Como Microorganismo Anticuerpo

los anticuerpos tienen dos puntos de unin, los


microorganismos forman agregados y ya no
Aglutinado
pueden infectar otras las clulas.

Neutralizacin: Anti cuerpos situados en la Antgenos


Antgenos
membrana plasmtica bloquean la accin de los
ant genos contra la clula. As, los antge nos
no se pueden unir a las clulas y matarlas.
Anticuerpos

Clula protegida Clula no protegida (muere)

Opsonizacin: Consiste en la fagocitosis de los


aglutinados de patgenos, de las clulas
infectadas o de las clulas tumorales por los
macrfagos, que son atrados por la presencia
de anticuerpos especficos que se han unido a
sus ant genos.

Clula fagocitaria Aglutinado


de virus

La unin antgeno-anticuerpo no es suficiente para la eliminacin del agente extrao contra el que luchamos. Se precisa la
colaboracin de otros elementos (complemento, clulas fagocitarias y clulas NK). El conglomerado antgeno-anticuerpo
puede as ser fagocitado por las clulas del Sistema Retculo Endotelial (S.R.E.) o por las Natural Killer. Las molculas del
Complemento, al unirse al complejo formado por antgenos y anticuerpos, pueden estimular la fagocitosis por parte de los
macrfagos.

J. L. Snchez Guilln Pgina V-1-14


V) Inmunologa 1) Inmunologa

LA RESPUESTA PRIMARIA Y SECUNDARIA

Respuesta humoral primaria: Se produce la


primera vez que se entra en contacto con el
antgeno (a los 7 das de la primera
infeccin). Las clulas plasmticas producen
anticuerpos IgM dosis moderadas hasta que
cesa la infeccin.

Respuesta humoral secundaria: Si se repite


el ataque, al cabo de das, incluso aos, se
desencadena la respuesta secundaria, ms
rpidamente. Las clulas de memoria
producen en poco tiempo (al cabo de unos 3
das) de 100 a 1000 veces ms
anticuerpos del tipo IgG (en ciertas
situaciones de los tipos IgA e IgE). Tambin Fig. 17 Respuestas primaria y secundaria
dura ms tiempo, y su declive sea ms
lento.

INMUNOESTIMULACIN: VACUNAS Y SUEROS

Aunque el Sistema Inmunitario est capacitado para combatir y eliminar clulas o


molculas ajenas, las enfermedades infecciosas siguen siendo una de las principales
causas de mortalidad, sobre todo en pases subdesarrollados. En los ms industrializados
se est produciendo un aumento de enfermedades que se crean controladas como la
tuberculosis, o la aparicin de otras como el SIDA. Es pues una preocupacin actual la
prevencin de las enfermedades.

Denominamos profilaxis al conjunto de medidas tomadas para prevenir la enfermedad.

Los mecanismos para conseguir inmunidad los podemos resumir en:

a) La inmunidad adquirida activa.

- Natural: Cuando el propio sujeto desarrolla la respuesta frente a antgenos concretos al


estar en contacto con el agente.

- Artificial: Como la que se adquiere con la vacunacin.

b) Inmunidad adquirida pasiva.

Se consigue cuando hay transferencia de anticuerpos fabricados activamente por otro


individuo. Puede ser:

- Espontnea: Cuando el paso de anticuerpos es de la madre al feto a travs de la placenta

J. L. Snchez Guilln Pgina V-1-15


V) Inmunologa 1) Inmunologa

o por absorcin de la leche materna en los primeros das de lactancia.

- Artificial: La inmunidad adquirida pasiva se denomina artificial cuando los anticuerpos se


administran en preparados biolgicos, como en el caso de los sueros.

Fig. 18 Tipos de inmunidad

Tipos de inmunidad
Inmunoestimulacin
Inmunidad
Inmunidad adquirida pasiva
adquirida activa

Natural: Como la que


Natural: El propio sujeto la adquiere el feto a travs de
desarrolla al pasar la la placenta o el lactante con
enfermedad. la leche materna.

Artificial: Se adquiere por Artificial: Administracin de


medio de la vacunacin. anticuerpos externos
(sueros).

Las vacunas son Los sueros son


preparados antignicos preparados de anticuerpos
constituidos por organismos destinados a desencadenar
no virulentos destinados a la respuesta inmune de
desencadenar la respuesta una manera rpida,
humoral. aunque no duradera.
57

Fig. 19 Inmunoestimulacin.

VACUNAS

Son preparados antignicos constituidos por microorganismos no virulentos, muertos o


por molculas de estos desprovistas de toxicidad. Se obtienen a partir de microorganismos
u otros agentes infecciosos e inducen en el individuo una inmunidad adquirida activa
frente a esos agentes inoculados, con un mnimo de riesgos y de reacciones locales y
generales. Su objetivo es desencadenar la produccin de clulas inmunitarias de memoria.

J. L. Snchez Guilln Pgina V-1-16


V) Inmunologa 1) Inmunologa

Las vacunas deben tener dos propiedades:

- Eficacia, pues tienen que desencadenar la respuesta inmune correcta.

- Inocuidad, la vacuna debe estar desprovista de poder patgeno, logrando este objetivo
sin interferir en la respuesta inmune.

SUEROS

Mediante los sueros se consigue una inmunidad inmediata ya que los preparados
biolgicos que inoculamos contienen los anticuerpos especficos que la urgencia precisa.
Es una intervencin rpida menos duradera e intensa que la provocada por la vacunacin.

El paciente no participa en la elaboracin de molculas, es por tanto una inmunidad


adquirida pasiva.

Existen dos tipos de sueros:

- Sueros homlogos: Son sueros obtenidos de humanos que poseen anticuerpos para un
determinado antgeno.

- Sueros heterlogos: Proceden de otras especies pero contienen anticuerpos para


patgenos humanos. De esta manera se obtiene, por ejemplo, las antitoxinas, que son
sueros frente al veneno de las serpientes, escorpiones, araas, etc.

SEROVACUNACIN

Conjunto de medidas preventivas que combinan la vacunacin con los tratamientos con
sueros adecuados.

Este procedimiento combina la administracin del suero preciso con la vacunacin. El


suero contiene anticuerpos que actan en los primeros momentos de urgencia y,
posteriormente, se desencadena la inmunidad activa producida por la vacuna. Se emplea,
por ejemplo, en el tratamiento del ttanos, del botulismo y de la rabia.

INMUNOPATOLOGA

Descripcin del concepto de enfermedad autoinmune y algunos tipos de ellas.

Las clulas del sistema inmunitario linfocitos, macrfagos y otras han de aprender a
tolerar cada clula y cada protena del organismo sin dejar de atacar por ello a los
invasores externos.

No obstante, se puede dar el caso de que algunos linfocitos inmaduros respondan ante
elementos del propio cuerpo. Ahora bien, normalmente, si una clula inmunitaria reacciona
ante un producto del propio organismo mientras se est formando en el timo o en la
mdula sea, suele ser destruida o, al menos, inactivada por el propio organismo. Sin

J. L. Snchez Guilln Pgina V-1-17


V) Inmunologa 1) Inmunologa

embargo, a pesar de este mecanismo de seguridad, algunos linfocitos pueden escapar a la


inactivacin o destruccin y desencadenar una respuesta inmunitaria contra molculas o
clulas del propio organismo generndose una enfermedad autoinmunitaria.

Las enfermedades de autoinmunidad pueden afectar a cualquier rgano, si bien algunos


se ven afectados con ms frecuencia que otros; por ejemplo: la sustancia blanca del
cerebro y de la mdula espinal, en la esclerosis mltiple, los revestimientos de las
articulaciones, en la artritis reumatoide, las clulas secretoras de insulina, en la diabetes
mellitus juvenil. Ciertas enfermedades autoinmunes destruyen las conexiones entre
nervios y msculo (miastenia gravis) y otras producen un exceso de hormona tiroidea en
la glndula tiroides (enfermedad de Graves). Las hay que producen ampollas en la piel
(pnfigo vulgar) o que destruyen los riones y otros rganos (lupus eritematoso sistmico).

Fenmenos de hipersensibilidad: alergias.

La respuesta alrgica es una intensa reaccin de ciertos componentes del sistema


inmunitario contra una sustancia extraa que por lo general es inofensiva.

Nota: )Por qu la seleccin natural ha permitido que la alergia se haya extendido tanto? Se sabe que ciertos
rasgos de la alergia solo vuelven a darse cuando el sistema inmunitario intenta erradicar parsitos. As, el
cuerpo sintetiza cantidades elevadas de anticuerpos de tipo IgE tanto ante la presencia de alrgenos como
ante la de parsitos. Frente a otro tipo de invasores recurre a otro tipo de anticuerpos.

Una hiptesis podra ser que el cuerpo desarroll en su origen la respuesta alrgica para hacer frente a los
parsitos. Las personas capacitadas por su dotacin gentica para organizar un ataque inmunitario eficaz
contra esos organismos sobreviviran mejor que quienes carecieran de ese mecanismo defensivo, habran
tenido mayor descendencia y sus hijos habran transmitido a su vez a los suyos esos genes. As se
extendera entre la poblacin humana el sistema de defensa contra los parsitos. Esta capacidad de
defensa ha permanecido til all donde abundan los parsitos. Sin embargo, el sistema inmunitario de
quienes ya no se encuentran con esos organismos reacciona ahora libremente -aunque de forma
contraproducente- ante otras sustancias como el polen. En respaldo de esta tesis se ha observado que la
alergia es menos comn en las naciones en vas de desarrollo que en las industrializadas pero la
investigacin realizada en animales de experimentacin para someter a prueba la hiptesis no ha resuelto
nada.

Se sabe que alrgenos diferentes provocan sntomas dispares, en parte porque atacan al
sistema inmunitario en diferentes puntos del organismo.

En el tracto respiratorio superior la respuesta inmunitaria errnea produce estornudos y


congestin nasal: rinitis alrgica. En el tracto respiratorio inferior puede causar constric-
cin y obstruccin de los bronquios, participando, por lo tanto, en el desarrollo de
sntomas asmticos. En el tracto gastrointestinal la actividad inmunitaria provoca a veces
nauseas, espasmos abdominales, diarrea y vmitos. Por ltimo, si un alrgeno introducido
por cualquier va llega a la circulacin sangunea puede inducir anafilaxis.

Aunque las manifestaciones externas de la respuesta alrgica varan, sta siempre se


pone en marcha mediante un proceso silencioso de sensibilizacin. Este proceso empieza
cuando los macrfagos (2) degradan el alrgeno (1) y muestran los fragmentos resultantes
a los linfocitos T (3). Estos segregan interleucinas (4) que hacen que los linfocitos B
maduren y se transformen en clulas plasmticas que secretan inmunoglobulinas (5).
Estos anticuerpos se unen a sus receptores en los mastocitos (6) -glbulos blancos no
circulantes que se encuentran en el tejido conjuntivo- y en los basfilos circulantes en

J. L. Snchez Guilln Pgina V-1-18


V) Inmunologa 1) Inmunologa

sangre (7).

3 Linfocito T
1 alrgeno

Linfocito B

2 macrfago 5 anticuerpos

4 Molculas
sealizadoras
Vaso
sanguneo

*
*
* * *
7 Basfilos 6 Mastocitos
*
Histamina

Fig. 20 La respuesta alrgica.

En posteriores contactos entre el alrgeno y el organismo las molculas de alrgeno se


unen a anticuerpos IgE de los mastocitos con lo que se desencadenan una serie de
reacciones que llevan a la secrecin por parte de los mastocitos de histamina y otras
sustancias que sern los responsables de muchos sntomas alrgicos.

El cncer y la respuesta inmunitaria.

Las clulas cancergenas se parecen a las clulas normales del cuerpo en muchos
aspectos. An as, actan como clulas extraas, reproducindose rpidamente e
invadiendo los tejidos. Adems, las clulas cancergenas tienen antgenos en su
superficie celular que difieren de los antgenos de las clulas normales y pueden ser
identificadas como extraas por lo que, quizs, el organismo pueda organizar una
respuesta inmunitaria.

Cada vez hay ms pruebas que indican que el cncer no slo puede inducir una respuesta
inmunitaria sino que es un hecho que sta se podra producir de modo que las clulas
cancergenas fuesen suprimidas mucho antes de que se detecte el cncer. Los cnceres
que se desarrollan representaran fallos ocasionales del sistema inmunitario. Por lo tanto,
si se refuerza la respuesta inmunitaria, se podr avanzar en el proceso de lucha contra el
cncer.

J. L. Snchez Guilln Pgina V-1-19


V) Inmunologa 1) Inmunologa

El S.I.D.A y sus efectos en el sistema inmune.

Estructura del V.I.H.

El virus del S.l.D.A. 1 es un retrovirus, cono-


cido como virus de la inmunodeficiencia huma-
a
na (VIH). Est constituido por dos molculas de
RNA acompaadas de dos o ms molculas del
enzima retrotranscriptasa (o transcriptasa
b
inversa). Rodeando a la zona central hay dos
envolturas proteni cas distintas que, a su vez,
estn rodeadas por una bicapa lipdi ca con
glucoprotenas insertas. Las porciones c
d
proteni cas de las molculas superficiales
contienen regiones constantes idnticas de una Fig. 21 Virus del S.I.D.A.: a) envoltura
cepa del virus a otra y regiones variables. membranosa; b) cpsida ; c) cido nucleico (ARN);
d) espculas proteicas.

Ciclo del V.I.H.

Cuando el VIH entra en el organismo, las glucoprotenas externas se unen a las molculas
CD4 de los linfocitos T cooperadores (tambin puede infectar macrfagos), sin embargo,
para entrar en el interior del linfocito necesita fusionarse con la membrana celular (1). En
1996, un equipo de trabajo del Instituto Nacional de Alergias y Enfermedades Infecciosas
de EEUU, encabezado por Edward Berger, identific en la cara exterior de la membrana de
los linfocitos T una protena, a la que denominaron fusina, que permite la entrada del VIH
en la clula2 .

Juntamente con la fusina, estos dos ltimos aos se han descubierto otras molculas, de
funcin similar, que se denominan correceptores3 .

Una vez dentro de la clula, el RNA se libera de la cpsula que lo contiene (2), y la
transcriptasa inversa cataliza la transcripcin inversa sintetizando un ADN complementa-
1
Fue identificado por primera vez en 1981 al observar la aparicin en hombres jvenes de un tumor maligno
(Sarcoma de Kaposi) que afecta a los revestimientos endoteliales de los vasos sanguneos y que hasta entonces
slo se haba observado en hombres de edad avanzada.

En la misma poca y tambin en hombres jvenes se detecta un incremento de neumonas e infecciones fatales
del tracto intestinal causadas por protistas ubicuos pero habitualmente inocuos. Anteriormente estas
enfermedades se haban observado en pacientes cancerosos y en receptores de transplantes cuyos sistemas
inmunes haban sido suprimidos. Estos hechos sugeran que la causa era una supresin masiva del sistema
inmune.

Las primeras imgenes del virus al microscopio electrnico se identificaron, en febrero de 1983, en el Instituto
Pasteur de Pars por el profesor Luc Montaigner.

2
La hipottica funcin normal de esta protena se desconoce, se sabe que est formada por 352
aminocidos y que pertenece al grupo de las protenas receptoras G, conocidas como facilitadoras de la entrada
en la clula de los virus y otros agentes patgenos. Se sospecha que los macrfagos tienen una protena similar.

3
Recientemente se ha visto que. entre los mecanismos que explican la resistencia de algunas personas
probablemente inmunes a la infeccin, existe tambin una causa gentica. Alrededor de un 1% de la poblacin
europea es deficiente para alguno de aquellos correceptores y, por tanto, resistente a la infeccin por VIH.

J. L. Snchez Guilln Pgina V-1-20


V) Inmunologa 1) Inmunologa

rio del ARN viral (3 y 4). Este ADN se incorpora a un cromosoma de la clula hospedadora
(5), en esta etapa el virus es extremadamente sensible a los inhibidores de dicha enzima.
A continuacin comienza a replicarse (6) originando nuevas partculas virales que salen
del linfocito T (8) e invaden a otros linfocitos u a otras clulas. Frecuentemente el linfocito
T resulta destruido.

1 6a

6b
3

4
7
8

Fig. 22 Infeccin de una clula por el virus del SIDA (ciclo del VIH).

Se sabe que la replicacin del VIH se produce desde las fases muy precoces de la
infeccin y en tasas muy elevadas, por medio de continuados ciclos de infeccin. Si el
seropositivo no enferma hasta transcurrido un tiempo es porque el organismo dispone de
herramientas eficaces para hacerle frente.

En un solo da pueden originarse en una persona infectada del orden de 1000 millones de
nuevas partculas vricas, producindose cada 48 a 72 horas la renovacin de buena
parte de los virus circulantes y de los linfocitos infectados. Esta situacin se amplifica
enormemente la variabilidad gentica del virus, la cual se produce como consecuencia de
los errores de copia que tienen lugar durante la transferencia de informacin desde el ARN
viral hasta el ADN. Muchas de las variantes genticas originadas por mutacin resultan no
ser viables, pero algunas s lo son y llegan a formar un cmulo de variantes que
explicara por qu finalmente el sistema inmunitario acaba por fracasar, ante la imposibili-
dad de mantener una lucha contra un enemigo tan inestable.

Algunas de las formas mutantes del virus implican cambios en la estructura de los
pptidos que actan como determinantes antignicos. Aunque muchos de estos cambios
no parecen afectar a la actividad del sistema inmunitario, distintos investigadores han
sugerido que algunos pueden hacer que determinado pptido se vuelva invisible a las
defensas del organismo (mutantes elusivos). Este encadenamiento de determinantes

J. L. Snchez Guilln Pgina V-1-21


V) Inmunologa 1) Inmunologa

antignicos variables y mutantes escurridizos explicara la pervivencia de la infeccin y la


dificultad de erradicarla (adems de complicar la bsqueda de vacunas).

Transmisin del V.I.H.

Los estudios epidemiolgicos realizados en Europa, Amrica, frica y Australia han


documentado de forma reiterada que solamente hay tres formas de transmisin del V.I.H.

- Por relacin sexual (homosexual, bisexual, heterosexual) con personas infectadas


- Por contacto con la sangre, hemoderivados, semen y los rganos transplantados
de personas infectadas
- Por transmisin de madre infectada a hijo. La mayor parte de las veces antes del
nacimiento y quizs durante el parto (transmisin perinatal)

Prcticas de riesgo.

- Compartir la misma jeringuilla o agujas sin desinfectar.


- Las relaciones sexuales con penetracin anal, sin utilizar preservativos.
- Las relaciones sexuales con personas enfermas o portadoras, sin utilizar
preservativos.
- Otros tipos de relaciones en las que se puedan producir heridas entre las
personas con riesgo de contagio.

Rechazo de transplantes.

Desde hace algn tiempo se recurre a la tcnica de transplantes para solucionar


situaciones que ponen en peligro la salud de un individuo.

En los transplantes se produce la eliminacin del tejido o del rgano daado y la


implantacin de otro que rena las condiciones adecuadas para la supervivencia del
receptor.

En los autoinjertos el transplante procede del mismo organismo y el tejido simplemente


es movido de una posicin a otra. Esta situacin siempre tiene xito si las tcnicas
quirrgicas y aspticas son las adecuadas.

Tambin tienen xito los transplante en los que el donante y el receptor son gemelos
genticamente iguales.

Otra posibilidad es entre individuos de la misma especie pero genticamente diferen-


tes.

Tambin se realizan en algunas ocasiones transplantes entre individuos de diferente


especie, xenoinjerto, como entre el hombre y el cerdo.

En los dos ltimos casos el tejido transplantado generar, por parte del receptor, una
respuesta inmune destructiva que se denomina rechazo. Tiene su origen en la existencia
de protenas de superficie en las membranas (molculas del CMH), si stas son recono-
cidas como extraas se desencadena la respuesta inmune especfica.

J. L. Snchez Guilln Pgina V-1-22


V) Inmunologa 1) Inmunologa

Con el fin de evitar estos problemas, los inmunlogos de transplantes realizan pruebas
previas de histocompatibilidad.

La experiencia demuestra que algunos lugares anatmicos son privilegiados y, en


porcentajes elevados, no generan rechazo. Es el caso del transplante de crnea. Por lo
general, en todas las dems intervenciones debe tratarse al paciente con inmunosupre-
sores inespecficos con el consiguiente riesgo de enfermedades infecciosas en el
postoperatorio, o tambin se puede aplicar un tratamiento de inmunosupresin especfi ca.

En la actualidad se est experimentando para obtener por ingeniera gentica y clonacin


cerdos cuyos tejidos no produzcan rechazo en la especie humana y poder tener de esta
manera una gran cantidad de rganos para transplantes.

ANTICUERPOS MONOCLONALES

Si una sustancia extraa (un antgeno) se inyecta en el cuerpo de un ratn o un humano,


alguna de las clulas B de su sistema inmune se transformarn en clulas plasmticas y
empezarn a producir anticuerpos que se unirn a ese antgeno. Cada clula B produce un
solo tipo de anticuerpo, pero diferentes linfocitos B producirn anticuerpos
estructuralmente diferentes que se unen a distintas partes del antgeno. Esta mezcla
fisiolgica natural de anticuerpos es conocida como 'anticuerpos policlonales'.

Un anticuerpo monoclonal es un anticuerpo homogneo producido por una clula hbrida


producto de la fusin de un clon de linfocitos B descendiente de una sola y nica clula
madre y una clula plasmtica tumoral.

Los anticuerpos monoclonales (Mab, del ingls monoclonal antibody), son anticuerpos
idnticos porque son producidos por un solo tipo de clula del sistema inmune, es decir,
todos los clones proceden de una sola clula madre. Es posible producir anticuerpos
monoclonales que se unan especficamente con cualquier molcula con carcter antignico.
Este fenmeno es de gran utilidad en bioqumica, biologa molecular y medicina.
Para producir anticuerpos monoclonales, primero se extraen clulas B del bazo de un animal
que ha sido expuesto al antgeno. Estas clulas B son fusionadas con clulas tumorales que
pueden crecer indefinidamente en cultivo celular. Estas clulas fusionadas hbridas pueden
multiplicarse rpida e indefinidamente, puesto que son clulas tumorales despus de todo y
pueden producir gran cantidad de anticuerpos. Los hibridomas son diluidos y cultivados
para obtener un nmero diferente de determinadas colonias, las cuales producen slo un
tipo de anticuerpo.

Los anticuerpos monoclonales se utilizan en muchos campos como:

La investigacin biomdica, como la identificacin y clonacin de genes, la identificacin


y aislamiento de protenas, la activacin de enzimas.

Diagnstico: En medicina, gracias a la gran especificidad y capacidad prcticamente


ilimitada de los anticuerpos monoclonales para reconocer cualquier estructura qumica,

J. L. Snchez Guilln Pgina V-1-23


V) Inmunologa 1) Inmunologa

permite la deteccin de hormonas, vitaminas, citocinas; la monitorizacin de drogas,


deteccin de enfermedades infecciosas en microbiologa; la deteccin de alergenos en
alergia, hematologa, marcadores tumorales e infartos de miocardio, aplicaciones forenses,
inmunoescintografa. En las tnicas diagnsticas se emplean diversas herramientas de
biologa molecular como ELISA, EIA, citometra, inmunohistoqumica, inmufluorescencia.
Los anticuerpos monoclonales son unas de las sustancias ms utilizadas en los laboratorios
de diagnstico.

Biosensores: Los anticuerpos monoclonales acoplados a transductores electrnicos


pueden detectar tanto molculas orgnicas como inorgnicas como la contaminacin de
metales pesados en alimentos y agua, deteccin de gases txicos, etc. Un biosensor es un
instrumento analtico formado por un material biolgico inmovilizado como una enzima,
anticuerpo, clula entera, orgnulo o combinaciones de los mismos, en ntimo contacto con
un sistema transductor adecuado que convierta la seal bioqumica en una seal elctrica
cuantificable.

Tratamiento: Las aplicaciones teraputicas constituyen el campo ms importante de los


anticuerpos monoclonales, ya que son capaces de erradicar ciertas infecciones y destruir
clulas, incluidas las tumorales, mediante distintos mecanismos. Por esta razn, son
excelentes sustancias para el tratamiento de enfermedades infecciosas, enfermedades
autoinmunes, el cncer o en trasplantes para evitar el rechazo. Existen varios anticuerpos
monoclonales aprobados para su uso en determinadas enfermedades.

J. L. Snchez Guilln Pgina V-1-24