You are on page 1of 19

Interbits SuperPro Web

1. (Fgv 2015) As estruturas ilustram os ossos das mos ou patas anteriores de seis espcies
de mamferos, no pertencentes obrigatoriamente ao mesmo ecossistema.

A transformao evolutiva de tais estruturas, ao longo das geraes, ocorre em funo


__________ e indicam uma evidncia evolutiva denominada __________.

Assinale a alternativa que preenche, correta e respectiva- mente, as lacunas do pargrafo


anterior.
a) da variabilidade gentica [...] paralelismo evolutivo
b) da maior ou menor utilizao das mesmas [...] analogia
c) do ambiente a ser ocupado [...] coevoluo
d) da seleo natural [...] homologia
e) de eventuais mutaes genticas [...] convergncia adaptativa

2. (Ufsm 2015) Aproximadamente 30 milhes de hectares do planeta so afetados por sais, e


de 0,25 a 0,5 milho de hectares de rea produtiva perdido a cada ano em funo da
salinizao do solo.

Fonte: FAO, 2002 apud Willadino & Camara,2010. (adaptado)

A informao apresentada tem preocupado agricultores, ambientalistas e pesquisadores. Em


busca de novos cultivares de plantas adaptadas a solos com maior salinidade, pesquisadores
do mundo inteiro esto intensificando estudos sobre espcies de plantas halfitas, que so
naturalmente adaptadas altas concentraes de sais no solo. Considerando- se os
mecanismos gerais de evoluo por seleo natural, apresentados por Darwin e Wallace,
possvel inferir:
a) Futuramente, todas as espcies cultivadas estaro adaptadas ao excesso de sais no solo,
pois, ao longo do seu crescimento, cada indivduo realizar adequaes metablicas
profundas que garantiro sua sobrevivncia.
b) Para que as plantas se adaptem a solos com alta salinidade, basta submet-las lentamente
doses crescentes de soluo salina, estimulando a ocorrncia de mutaes que as
tornaro resistentes.
c) Podero ocorrer mutaes ao acaso em certos indivduos, algumas delas conferindo
resistncia alta salinidade e permitindo maior sucesso reprodutivo dos indivduos
portadores dessa mutao nos solos com alta salinidade, em comparao com aqueles
indivduos no portadores da mutao.
d) Podero ocorrer mutaes especficas, causadas pelo excesso de sais, que sero
direcionadas pela planta para resistncia alta salinidade.
e) intil procurar novas plantas adaptadas alta salinidade do solo alm das j conhecidas,
pois as espcies so imutveis.

Pgina 1 de 19
Interbits SuperPro Web

3. (Uepa 2014) Mesmo com o avano da tecnologia em comunicao, o ser humano continua
se debruando sobre os registros fsseis para desvendar o mistrio da criao do mundo e da
notvel biodiversidade, com milhes de espcies de seres vivendo nos mais variados
ambientes que compem a biosfera. A teoria da evoluo biolgica busca explicar o
mecanismo que propiciou essa imensa variedade de seres vivos. Os principais argumentos
cientficos que explicam esse mecanismo so:

I. rgos vestigiais indicam a presena de um ancestral comum entre as espcies nas quais
ocorrem.
II. A anlise dos fsseis indica que a extino de espcies faz parte do processo evolutivo.
III. Os fsseis permitem o estudo comparativo entre organismos ou estruturas de diferentes
eras geolgicas que demonstram mudanas ao longo do tempo.
IV. Desde Darwin, vrios aspectos de sua teoria j foram revistos, o que demonstra sua falta de
fundamentao.
V. Os rgos homlogos indicam relaes de parentesco entre espcies, por terem a mesma
origem embrionria.

A alternativa que contm todas as afirmativas corretas :


a) I, II, III e V.
b) I, III, IV e V.
c) II, III, IV e V.
d) II, III e IV.
e) I, II, III, IV e V.

4. (Ufrn 2013) A restrio venda de antibiticos no Brasil foi uma medida tomada em funo
do aparecimento de bactrias super-resistentes. Atualmente, com os avanos na rea da
gentica e da biologia molecular, uma das explicaes aceitas para o surgimento dessas
bactrias a ocorrncia de mutaes, a partir das quais haveria uma mudana aleatria em
um determinado gene, e, dessa forma, as bactrias passariam a apresentar resistncia ao
antibitico.
No passado, sem o conhecimento da gentica e da biologia molecular, Lamarck e Darwin
elaboraram explicaes para o surgimento de novas variedades de seres vivos.

Nesse contexto, como pode ser explicado o surgimento de bactrias super-resistentes


a) com base na teoria da evoluo de Lamarck?
b) com base na teoria da evoluo de Darwin?

5. (Upf 2014) Celulose, esteroides, RNA e albumina so exemplos dos seguintes tipos de
molculas orgnicas, respectivamente:
a) protena, carboidratos, lipdio, cido nucleico.
b) carboidrato, lipdios, cido nucleico, protena.
c) carboidrato, protenas, cido nucleico, lipdio.
d) lipdio, carboidratos, protena, cido nucleico.
e) protena, carboidratos, cido nucleico, lipdio.

6. (Uepb 2014) Sobre os compostos orgnicos dos seres vivos so apresentadas as


proposies abaixo, leia atentamente cada uma delas e, em seguida, relacione o composto
proposio apresentada.

I. Carboidratos
II. Lipdios
III. Protenas

A. So os principais componentes das biomembranas. Apresentam uma regio polar e outra


apoIar, estando esta caracterstica intimamente ligada estrutura em bicamada das
membranas celulares.
B. Elevao da temperatura e alteraes no pH do meio podem provocar alterao da estrutura
espacial destes compostos, fenmeno este denominado desnaturao.

Pgina 2 de 19
Interbits SuperPro Web

C. So molculas apolares, utilizadas pelos seres vivos como reserva energtica, alguns
tambm os utilizam como impermeabilizantes, em outros aparecem como elementos
estruturais e precursores de hormnios esteroides.
D. Representam a principal fonte de energia para os seres vivos, alm de desempenharem
relevante papel na estrutura corporal destes.
E. Dentre as suas funes destacamos a de atuarem como biocatalisadores, sendo esta
funo desempenhada por um grupo especial.

A relao est estabelecida de forma correta em:


a) I-A, II-B, II-C, Ill-D, II-E.
b) I-A, III-B, II-C, lI-D, III-E.
c) III-A, II-B, I-C, II-D, II-E.
d) II-A, I-B, III-C, I-D, I-E.
e) II-A, III-B, II-C, I-D, III-E.

7. (Ufrgs 2014) Os quatro tipos de macromolculas biolgicas esto presentes,


aproximadamente, nas mesmas propores, em todos os organismos vivos.

Sobre essas macromolculas, assinale a alternativa correta.


a) As vitaminas so triglicerdeos sintetizados no fgado e podem funcionar como coenzimas.
b) Os polissacardeos, como a frutose e o glicognio, so respectivamente compostos
armazenadores de energia em plantas e animais.
c) As protenas tm, entre as suas funes, o suporte estrutural, a catlise e a defesa dos
organismos.
d) Os cidos nucleicos so polmeros de nucleotdeos, caracterizados pela presena de
hexoses.
e) Os carboidratos, assim como os cidos nucleicos, podem funcionar como material
hereditrio.

8. (Ufpr 2014) Os vertebrados possuem grupos de clulas bastante variados, com adaptaes
necessrias ao seu funcionamento. Essas adaptaes refletem-se, muitas vezes, na prpria
estrutura celular, de modo que as clulas podem tornar-se especializadas em determinadas
funes, como contrao, transmisso de impulsos nervosos, gerao de calor, sntese de
protenas e lipdios, secreo etc. Considere os resultados obtidos do estudo de duas clulas
diferentes, apresentados na tabela.

Estrutura de duas clulas extradas de tecidos diferentes, observadas ao microscpio.

Clula A Clula B
Filamentos de actina +++ +
Microtbulos + ++
Retculo endoplasmtico liso +++ ++
Retculo endoplasmtico rugoso + +++
Mitocndrias +++ +++
Aparato de Golgi + +++
Ncleo +++ +
+ poucos ou escassos; ++ intermedirios; +++ muitos ou abundantes.

Considerando os resultados, que funo poderia ser desempenhada pelas clulas A e B,


respectivamente?
a) Contrao e secreo.
b) Sntese de lipdios e contrao.
c) Gerao de calor e sntese de lipdios.
d) Sntese de protenas e gerao de calor.
e) Transmisso de impulso nervoso e sntese de protenas.

Pgina 3 de 19
Interbits SuperPro Web

9. (Ufpr 2015) Um pesquisador injetou uma pequena quantidade de timidina radioativa


(3 H timidina) em clulas com o propsito de determinar a localizao dos cidos nucleicos
sintetizados a partir desse nucleotdeo, utilizando uma tcnica muito empregada em biologia
celular, a autorradiografia combinada com microscopia eletrnica.

Assinale a alternativa que apresenta os dois compartimentos celulares nos quais o pesquisador
encontrar cidos nucleicos radioativos.
a) Ncleo e mitocndrias.
b) Citosol e mitocndrias.
c) Ncleo e retculo endoplasmtico.
d) Citosol e retculo endoplasmtico.
e) Peroxissomos e retculo endoplasmtico.

10. (Ufsj 2012) Em um experimento laboratorial, fez-se a anlise da composio de


nucleotdeos do cido nucleico que constitui o material gentico de quatro organismos
hipotticos. Os resultados da anlise esto descritos na tabela abaixo.

% de nucleotdeos
Organismo adenina guanina timina citosina uracila
A 23,3 26,7 23,5 26,5 0
B 17,3 40,5 28,2 14,4 0
C 27,5 14,3 0 35,5 22,7
D 18,5 31,5 18,3 31,7 0

Com base nesses resultados, CORRETO afirmar que


a) os organismos A, B e D possuem DNA e RNA.
b) o DNA dos organismos A e D possui duas cadeias polinucleotdicas complementares (dupla
hlice).
c) o DNA do organismo C possui uma cadeia polinucleotdica simples.
d) os cidos nucleicos dos organismos B e C so de cadeias polinucleotdicas simples.

11. (Ufrgs 2012) O quadro abaixo representa o cdigo gentico universal.

U C A G
UUU UCU UAU UGU
Fen Tir Cis U
UUC UCC UAC UGC C
U Ser
UUA UCA UAA UGA Fim A
Leu Fim
UUG UCG UAG UGG Trp
G

CUU CCU CAU CGU


His U
CUC CCC CAC CGC C
C Leu Pr o Arg
CUA CCA CAA CGA A
GIn
CUG CCG CAG CGG G

AUU ACU AAU AGU


Ans Ser U
AUC Ile ACC AAC AGC C
A Tre
AUA ACA AAA AGA A
Lis Arg
AUG Met/Incio ACG AAG AGG
G

GUU GCU GAU GGU


Asp U
GUC GCC GAC GGC C
G Val Ala Gli
GUA GCA GAA GGA A
Glu
GUG GCG GAG GGG G

A molcula de RNA mensageiro com a sequncia CGAAUGACAAAAGGAUAACGU produz o


segmento de protena

Pgina 4 de 19
Interbits SuperPro Web

a) Met Tre Lis Gli Arg.


b) Tre Arg Met.
c) Arg Met Tre Lis Gli.
d) Met Tre Lis Gli.
e) Leu Arg Met Tre Lis Gli.

12. (Uel 2011) Em uma populao, foi identificado um indivduo que possui resistncia
gentica a um vrus que provoca uma importante doena. Em um estudo comparativo,
verificou-se que esse indivduo produz uma protena que confere tal resistncia, com a
seguinte sequncia de aminocidos: serina-tirosina-cistena-valina-arginina.

A partir da tabela de cdigo gentico, a seguir:

AGU - serina AGC - serina


UAC - tirosina UAU - tirosina
UGC - cistena UGU - cistena
GUA - valina GUU - valina
AGG - arginina CGA - arginina

E considerando que o RNA mensageiro deste gene contm: 46,7% de uracila; 33,3% de
guanina; 20% de adenina e 0% de citosina, assinale a alternativa que apresenta a sequncia
correta de bases da fita-molde deste gene.
a) TCA - ATA - ACA - CAA - TCC
b) TCA - ATA - ACG - CAT - TCC
c) TCA - ATG - ACA - CAT - TGG
d) AGU - UAU - UGU - GUU - AGG
e) AGC - UAC - UGC -CAA- CGA

13. (Ufpr 2015) As enzimas encontradas nos rgos de diferentes espcies de animais
apresentam atividade prxima do timo nos valores de temperatura e pH encontrados nesses
rgos. Baseado nesse preceito, um pesquisador realizou um estudo traando o perfil cintico
de quatro enzimas (I a IV) presentes em aves e peixes da Antrtida, encontrando os resultados
apresentados nos grficos a seguir.

As enzimas provenientes do intestino de peixe e do estmago de ave da Antrtida so,


respectivamente,
a) I e II.
b) I e IV.
c) III e II.

Pgina 5 de 19
Interbits SuperPro Web

d) III e IV.
e) IV e I.

14. (Ufsj 2013) Analise o grfico abaixo.

Analise as afirmativas abaixo em relao ao grfico apresentado:

I. O grfico tpico de imunoterapias, como a utilizao de soros antiofdicos, que fornecem


rapidamente uma dose maior de anticorpos, aumentando a concentrao de anticorpos no
plasma.
II. A resposta secundria observada no grfico com maior concentrao de anticorpos no
plasma deve-se aos linfcitos T da memria que vo produzir mais anticorpos em menos
tempo.
III. O grfico caracterstico de um processo de imunizao ativa.
IV. A resposta secundria observada no grfico com maior concentrao de anticorpos no
plasma deve-se aos linfcitos B da memria que vo produzir mais anticorpos em menos
tempo.

Com base nessa anlise, esto CORRETAS apenas as afirmativas


a) I e II.
b) III e IV.
c) II e III.
d) I e IV.

15. (Fuvest 2013) O fitoplncton consiste em um conjunto de organismos microscpicos


encontrados em certos ambientes aquticos. O desenvolvimento desses organismos requer luz
e CO2, para o processo de fotossntese, e requer tambm nutrientes contendo os elementos
nitrognio e fsforo.
Considere a tabela que mostra dados de pH e de concentraes de nitrato e de oxignio
dissolvidos na gua, para amostras coletadas durante o dia, em dois diferentes pontos (A e B)
e em duas pocas do ano (maio e novembro), na represa Billings, em So Paulo.

Pgina 6 de 19
Interbits SuperPro Web

Concentrao Concentrao de
pH
de nitrato (mg/L) oxignio (mg/L)
Ponto A
9,8 0,14 6,5
(novembro)
Ponto B
9,1 0,15 5,8
(novembro)
Ponto A
7,3 7,71 5,6
(maio)
Ponto B
7,4 3,95 5,7
(maio)

Com base nas informaes da tabela e em seus prprios conhecimentos sobre o processo de
fotossntese, um pesquisador registrou trs concluses:

I. Nessas amostras, existe uma forte correlao entre as concentraes de nitrato e de


oxignio dissolvidos na gua.
II. As amostras de gua coletadas em novembro devem ter menos CO2 dissolvido do que
aquelas coletadas em maio.
III. Se as coletas tivessem sido feitas noite, o pH das quatro amostras de gua seria mais
baixo do que o observado.

correto o que o pesquisador concluiu em


a) I, apenas.
b) III, apenas.
c) I e II, apenas.
d) II e III, apenas.
e) I, II e III.

16. (Uerj 2015) Em um experimento, os tubos I, II, III e IV, cujas aberturas esto totalmente
vedadas, so iluminados por luzes de mesma potncia, durante o mesmo intervalo de tempo,
mas com cores diferentes. Alm da mesma soluo aquosa, cada tubo possui os seguintes
contedos:

A soluo aquosa presente nos quatro tubos tem, inicialmente, cor vermelha. Observe, na
escala abaixo, a relao entre a cor da soluo e a concentrao de dixido de carbono no
tubo.

Os tubos I e III so iluminados por luz amarela, e os tubos II e IV por luz azul. Admita que a
espcie de alga utilizada no experimento apresente um nico pigmento fotossintetizante. O
grfico a seguir relaciona a taxa de fotossntese desse pigmento em funo dos comprimentos
de onda da luz.

Pgina 7 de 19
Interbits SuperPro Web

Aps o experimento, o tubo no qual a cor da soluo se modificou mais rapidamente de


vermelha para roxa o representado pelo seguinte nmero:
a) I
b) II
c) III
d) IV

17. (Ufpr 2012) Dois tipos de transporte que podem acontecer nas membranas plasmticas
so o transporte passivo e o transporte ativo. O primeiro pode acontecer por simples difuso do
elemento a ser transportado atravs da bicamada lipdica da membrana. J o transporte ativo
sempre depende de protenas que atravessam a membrana, s quais o elemento a ser
transportado se liga, desligando-se posteriormente do outro lado da membrana. Ambos os tipos
de transporte esto esquematizados na figura abaixo. Com base nessas informaes e nos
conhecimentos de biologia celular, assinale a alternativa que apresenta corretamente os
grficos de cada tipo de transporte.

a)

Pgina 8 de 19
Interbits SuperPro Web

b)

c)

d)

e)

18. (Uerj 2012) Em um experimento em que se mediu a concentrao de glicose no sangue,


no filtrado glomerular e na urina de um mesmo paciente, os seguintes resultados foram
encontrados:

Concentrao de glicose
Lquido biolgico
(mg/dL)
sangue 140
filtrado glomerular 120
urina 0,12

Esses resultados mostram que as clulas epiteliais dos tbulos renais do paciente estavam
reabsorvendo a glicose pelo mecanismo denominado:
a) difuso passiva
b) transporte ativo
c) difuso facilitada
d) transporte osmtico

19. (Upf 2014) Considere a figura abaixo, a qual representa, de forma esquemtica, um
importante processo da fisiologia celular. As trs etapas desse processo esto destacadas nos
retngulos de cor laranja. Com base na anlise da figura, assinale a nica afirmativa
verdadeira.

Pgina 9 de 19
Interbits SuperPro Web

a) As etapas 1, 2 e 3 representam as etapas da respirao celular denominadas,


respectivamente, Gliclise, Ciclo de Calvin e Cadeia transportadora de eltrons (ou cadeia
respiratria).
b) As etapas 1, 2 e 3 representam as etapas da fotossntese denominadas, respectivamente,
Gliclise, Ciclo de Calvin e Cadeia transportadora de eltrons.
c) Durante o processo, a energia contida em molculas orgnicas liberada pouco a pouco e
parte dessa energia armazenada na forma de ATP.
d) As etapas 1 e 2 ocorrem, respectivamente, no citoplasma das clulas e no estroma.
e) A etapa 3 ocorre nas membranas dos tilacoides.

20. (Pucrj 2014) O processo de respirao celular ocorre em trs etapas: Gliclise, Ciclo de
Krebs e Cadeia Respiratria. Marque a alternativa correta com relao a essas etapas.
a) O ciclo de Krebs e a gliclise ocorrem na matriz mitocondrial.
b) No ciclo de Krebs, uma molcula de glicose quebrada em duas molculas de cido
pirvico.
c) Nas cristas mitocondriais, h transferncia dos hidrognios transportados pelo NAD e pelo
FAD atravs da cadeia respiratria, levando formao de gua.
d) A utilizao de O2 se d nas cristas mitocondriais, durante o ciclo de Krebs.
e) A via glicoltica ocorre somente nos processos anaerbios, enquanto o ciclo de Krebs ocorre
nos processos aerbios.

21. (Uftm 2012) O grfico ilustra o espectro de absoro da luz pelas clorofilas a e b, em
diferentes comprimentos de onda. Elas so duas das principais clorofilas presentes nos
eucariontes fotossintetizantes.

Suponha que trs plantas (I, II e III) da mesma espcie ficaram expostas diariamente aos
comprimentos de onda 460 nm, 550 nm e 660 nm por um ms, respectivamente. possvel
supor que
a) todas sucumbiram depois desse perodo, devido falta de reservas orgnicas.
b) apenas a planta II conseguiu sintetizar matria orgnica suficiente para crescer.

Pgina 10 de 19
Interbits SuperPro Web

c) as plantas I e III conseguiram sintetizar matria orgnica suficiente para crescerem.


d) todas permaneceram no seu ponto de compensao ftico durante esse perodo.
e) a planta II respirou e as outras realizaram somente a fotossntese para crescer.

22. (Fuvest 2013) A lei 7678 de 1988 define que vinho a bebida obtida pela fermentao
alcolica do mosto simples de uva s, fresca e madura. Na produo de vinho, so utilizadas
leveduras anaerbicas facultativas. Os pequenos produtores adicionam essas leveduras ao
mosto (uvas esmagadas, suco e cascas) com os tanques abertos, para que elas se
reproduzam mais rapidamente. Posteriormente, os tanques so hermeticamente fechados.
Nessas condies, pode-se afirmar, corretamente, que
a) o vinho se forma somente aps o fechamento dos tanques, pois, na fase anterior, os
produtos da ao das leveduras so a gua e o gs carbnico.
b) o vinho comea a ser formado j com os tanques abertos, pois o produto da ao das
leveduras, nessa fase, utilizado depois como substrato para a fermentao.
c) a fermentao ocorre principalmente durante a reproduo das leveduras, pois esses
organismos necessitam de grande aporte de energia para sua multiplicao.
d) a fermentao s possvel se, antes, houver um processo de respirao aerbica que
fornea energia para as etapas posteriores, que so anaerbicas.
e) o vinho se forma somente quando os tanques voltam a ser abertos, aps a fermentao se
completar, para que as leveduras realizem respirao aerbica.

23. (Fatec 1996) Observe o grfico a seguir, que representa o Ponto de Compensao Ftico
(PCF) de duas plantas A e B, de espcies diferentes, que se encontram no mesmo ambiente.

correto afirmar que


a) o PCF o mesmo para as plantas A e B.
b) a taxa respiratria varia para as plantas A e B.
c) a planta A, para poder crescer, precisa receber luz em intensidade abaixo do seu PCF.
d) a planta B provavelmente uma planta de sol (helifila) e para poder crescer precisa
receber luz em intensidade igual do seu PCF.
e) as plantas A e B para poderem crescer precisam receber luz em intensidade superior aos
seus PCF.

24. (Fgv 2013) Observe a figura que ilustra uma clula em determinada etapa de um processo
de diviso celular.

Pgina 11 de 19
Interbits SuperPro Web

Sendo 2n o nmero diploide de cromossomos, correto afirmar que tal clula encontra-se em
anfase da mitose de uma clula-me
a) 2n = 8, ou anfase I da meiose de uma clula-me 2n = 8.
b) 2n = 16, ou anfase II da meiose de uma clula-me 2n = 8.
c) 2n = 4, ou anfase I da meiose de uma clula-me 2n = 8.
d) 2n = 8, ou anfase II da meiose de uma clula-me 2n = 16.
e) 2n = 4, ou anfase II da meiose de uma clula-me 2n = 8.

25. (Unesp 2009) Um pesquisador analisou clulas em diviso das gnadas e do trato
digestrio de um macho de uma nova espcie de mosca. A partir de suas observaes, fez as
seguintes anotaes:

Nas clulas do tecido I, em uma das fases da diviso celular, veem-se 8 cromossomos, cada
um deles com uma nica cromtide, 4 deles migrando para um dos polos da clula e os outros
4 migrando para o polo oposto.
Nas clulas do tecido II, em uma das fases da diviso celular, veem-se 4 cromossomos, cada
um deles com duas cromtides, 2 deles migrando para um dos polos da clula e os outros 2
migrando para o polo oposto.

Pode-se afirmar que as clulas do tecido I e as clulas do tecido II so, respectivamente,


a) da gnada e do trato digestrio. Essa nova espcie de mosca tem 2n = 2.
b) da gnada e do trato digestrio. Essa nova espcie de mosca tem 2n = 4.
c) do trato digestrio e da gnada. Essa nova espcie de mosca tem 2n = 8.
d) do trato digestrio e da gnada. Essa nova espcie de mosca tem 2n = 2.
e) do trato digestrio e da gnada. Essa nova espcie de mosca tem 2n = 4.

26. (Uel 2015) Leia o texto a seguir.

Quando se fala em diviso celular, no valem as regras matemticas: para uma clula dividir
significa duplicar. A clula se divide ao meio, mas antes duplica o programa gentico localizado
em seus cromossomos. Isso permite que cada uma das clulas-filhas reconstitua tudo o que foi
dividido no processo.
AMABIS, J. M.; MARTHO, G. R. Biologia. v.1. So Paulo: Moderna, 1994. p.203.

Considerando uma clula haploide com 8 cromossomos (n 8), assinale a alternativa que
apresenta, corretamente, a constituio cromossmica dessa clula em diviso na fase de
metfase da mitose.
a) 8 cromossomos distintos, cada um com 1 cromtide.
b) 8 cromossomos distintos, cada um com 2 cromtides.
c) 8 cromossomos pareados 2 a 2, cada um com 1 cromtide.
d) 8 cromossomos pareados 2 a 2, cada um com 2 cromtides.
e) 8 cromossomos pareados 4 a 4, cada um com 2 cromtides.

27. (Unesp 2014) A figura mostra o encontro de duas clulas, um espermatozoide e um


ovcito humano, momentos antes da fecundao.

Pgina 12 de 19
Interbits SuperPro Web

Considerando as divises celulares que deram origem a essas clulas, correto afirmar que o
sexo da criana que ser gerada foi definido na
a) metfase I da gametognese feminina.
b) diacinese da gametognese masculina.
c) anfase II da gametognese feminina.
d) anfase I da gametognese masculina.
e) telfase II da gametognese masculina.

28. (Fuvest 2015) Na gametognese humana,


a) espermatcitos e ovcitos secundrios, formados no final da primeira diviso meitica, tm
quantidade de DNA igual de espermatognias e ovognias, respectivamente.
b) espermtides haploides, formadas ao final da segunda diviso meitica, sofrem diviso
mittica no processo de amadurecimento para originar espermatozoides.
c) espermatognias e ovognias dividem-se por mitose e originam, respectivamente,
espermatcitos e ovcitos primrios, que entram em diviso meitica, a partir da puberdade.
d) ovognias dividem-se por mitose e originam ovcitos primrios, que entram em meiose, logo
aps o nascimento.
e) espermatcitos e ovcitos primrios originam o mesmo nmero de gametas, no final da
segunda diviso meitica.

29. (Unesp 2011) Em geral, os cromossomos sexuais nos mamferos so iguais nas fmeas e
diferentes nos machos. Nestes, o cromossomo do tipo Y possui genes, tamanho e morfologia
diferentes daqueles do cromossomo do tipo X. Nas aves, ocorre o contrrio. A fmea apresenta
cromossomos sexuais diferentes; nesse caso, chamados de tipo Z, o maior, e de tipo W, o
menor.
As figuras A e B representam, respectivamente, os cromossomos de um homem e de um
macho de arara-azul. Em A so representados, no destaque, os cromossomos sexuais de uma
mulher (XX) e, em B, no destaque, os cromossomos sexuais de uma arara-azul fmea (ZW).

Considerando tais informaes, correto afirmar que


a) tanto em aves quanto em mamferos, o conjunto de espermatozoides carregar sempre um
cromossomo sexual de um mesmo tipo.
b) tanto em aves quanto em mamferos, o conjunto de vulos carregar sempre um
cromossomo sexual de um mesmo tipo.
c) na gametognese de fmeas de aves, aps a metfase I, as duas clulas resultantes da
diviso anterior apresentaro cromossomos sexuais de mesmo tipo.
d) na gametognese de machos de mamferos, aps a metfase II, as duas clulas resultantes
da diviso anterior apresentaro cromossomos sexuais de mesmo tipo.

Pgina 13 de 19
Interbits SuperPro Web

e) tanto na prole de aves quanto na de mamferos, o zigoto que herdar o menor cromossomo
sexual ser do sexo masculino.

Pgina 14 de 19
Interbits SuperPro Web

Gabarito:

Resposta da questo 1:
[D]

O processo de seleo natural preserva as variaes favorveis em determinado ambiente.


Estruturas homlogas possuem a mesma origem embrionria, independentemente de sua
funo, e indicam ancestralidade comum.

Resposta da questo 2:
[C]

Mutaes casuais e espontneas podem produzir vegetais capazes de sobreviver e se


reproduzir em solos com alta salinidade. As plantas incapazes de se adaptar nesses ambientes
so eliminadas pelo processo de seleo natural.

Resposta da questo 3:
[A]

[IV] Falsa. A teoria darwinista da evoluo biolgica j foi revista em diversos aspectos, o que
tem demonstrado sua fundamentao.

Resposta da questo 4:
a) Segundo a teoria lamarckista, as bactrias podem se tornar resistentes para sobreviver
na presena dos antibiticos e transmitem essa aptido adquirida aos seus descendentes.
b) Segundo a teoria darwinista, os antibiticos selecionam as variedades bacterianas
naturalmente resistentes, eliminando as variedades sensveis.

Resposta da questo 5:
[B]

A celulose um polissacardeo formado pela condensao de molculas de glicose


(monossacardeo). Os esteroides so lipdios derivados do colesterol. O RNA um cido
nucleico formado pela unio de nucleotdeos contendo as bases nitrogenadas adenina,
guanina, citosina e uracila. A albumina uma protena formada pela unio peptdica de
unidades estruturais denominadas aminocidos.

Resposta da questo 6:
[E]

A correlao entre os compostos orgnicos e suas funes esto relacionadas na alternativa


[E].

Resposta da questo 7:
[C]

As protenas apresentam uma grande diversidade de funes biolgicas atuando, por exemplo,
na defesa dos organismos, na composio de muitas estruturas corporais e na catlise de
diferentes reaes metablicas. As vitaminas so substncias orgnicas no sintetizadas pelos
organismos, necessrias em pequenas quantidades. A frutose um monossacardeo do tipo
hexose. Os cidos nucleicos caracterizam-se pela presena de pentoses e, ao contrrio dos
carboidratos, atuam como material hereditrio.

Resposta da questo 8:
[A]

As clulas A e B podem estar diferenciadas para realizar as seguintes funes,


respectivamente: contrao e secreo. A clula A pode ser um micito estriado esqueltico,

Pgina 15 de 19
Interbits SuperPro Web

por apresentar abundncia em filamentos de actina, REL desenvolvido, abundncia em


mitocndrias e ser multinucleada. A clula B pode ser uma clula secretora de uma glndula
excrina, ou endcrina, por ser rica em RER, aparato de Golgi (sistema golgiense e
mitocndrias).

Resposta da questo 9:
[A]

A timidina radioativa (3 H timidina) ser incorporada ao DNA nuclear e mitocontrial.

Resposta da questo 10:


[B]

O DNA dos organismos A e D possui duas cadeias polinucleotdicas complementares porque


nos dois casos a relao A+G/T+C igual a 1.

Resposta da questo 11:


[D]

O RNA mensageiro ser traduzido a partir do cdon de iniciao AUG e terminar no cdon
terminal UAA. Dessa forma, o peptdeo formado apresentar a seguinte sequncia de
aminocidos: metionina treonina lisina glicina.

Resposta da questo 12:


[A]

O RNA mensageiro que foi traduzido apresenta a seguinte sequncia de nucleotdeos: AGU
UAU UGU GUU AGG. Logo, a cadeia ativa da fita molde do DNA que transcreveu esse
RNAm ter a sequncia: TCA ATA ACA CAA TCC.

Resposta da questo 13:


[C]

Os peixes so animais ectotrmicos e, portanto, suas enzimas atuam em temperaturas


prximas temperatura ambiental. A enzima que atua no intestino do peixe que vive na
Antrtida a [III]. Ela exerce o seu efeito em temperaturas baixas (5C) e pH timo igual a 8
(alcalino).
As aves so animais endotrmicos com temperatura corprea alta e estvel. A enzima que
atua no seu estmago a [II]. Ela hidrolisa protenas em pH 2 (cido) em temperatura tima
em torno de 35C.

Resposta da questo 14:


[B]

[I] Falso. O grfico refere-se ao processo de vacinao com a inoculao de antgenos que
induzem o organismo a produzir anticorpos e clulas de memria.
[II] Falso. As clulas de memria se diferenciam a partir dos linfcitos B. Esses linfcitos so
tambm responsveis pela produo de anticorpos.

Resposta da questo 15:


[D]

[Resposta do ponto de vista da disciplina de Biologia]

I. Falso. Os dados da tabela no mostram uma forte correlao entre as concentraes de


nitrato e de oxignio dissolvido na gua.

[Resposta do ponto de vista da disciplina de Qumica]

Pgina 16 de 19
Interbits SuperPro Web

Anlise das afirmaes:

I. Incorreta. Nessas amostras, no se verifica correlao entre a concentrao de nitrato e a de


oxignio, o pH diminui e as concentraes oscilam:

Concentrao Concentrao de
pH
de nitrato (mg/L) oxignio (mg/L)
Ponto A
9,8 0,14 6,5
(novembro)
Ponto B
9,1 0,15 5,8
(novembro)
Ponto A
7,3 7,71 5,6
(maio)
Ponto B
7,4 3,95 5,7
(maio)

II. Correta. As amostras de gua coletadas em novembro devem ter menos CO2 dissolvido do
que aquelas coletadas em maio, pois o pH em maio menor, ou seja, a concentrao de
+
ons H devido a presena do gs carbnico maior.

Concentrao
pH
de nitrato (mg/L)
Ponto B
9,1 0,15
(novembro)
Ponto A
7,3 7,71
(maio)

III. Correta. Se as coletas tivessem sido feitas noite, o pH das quatro amostras de gua seria
mais baixo do que o observado, pois a concentrao de gs carbnico maior neste perodo.

Resposta da questo 16:


[B]

[Resposta do ponto de vista da disciplina de Qumica]


A partir do grfico verifica-se maior taxa de fotossntese no comprimento de onda azul, neste
caso ocorre maior consumo de gs carbnico (CO2 ) e diminuio de sua concentrao (cor da
soluo tendendo roxa).

Concluso: o tubo no qual a cor da soluo se modificou mais rapidamente de vermelha para

Pgina 17 de 19
Interbits SuperPro Web

roxa aquele no qual encontramos apenas algas, ou seja, o tubo nmero II.

[Resposta do ponto de vista da disciplina de Biologia]


Ao absorver o comprimento de luz equivalente ao azul, o pigmento fotossintetizante da alga
apresenta a maior eficincia na fixao do CO2 como matria orgnica. No tubo II, a cor da
soluo deve ficar roxa devido ao consumo de CO2 durante a fotossntese realizada pela alga.
No tubo IV, os caramujos respiram e liberam CO2 para a soluo.

Resposta da questo 17:


[A]

O transporte passivo segue o gradiente de concentrao. O transporte ativo regulado por


protenas transportadoras. Quando os transportadores esto saturados, a passagem de
substncias transmembrana torna-se constante.

Resposta da questo 18:


[B]

A reabsoro de glicose nos tbulos renais ocorre por transporte ativo, uma vez que a
concentrao sangunea desse monossacardeo excede a concentrao no filtrado glomerular.
Dessa forma, a glicose transportada de um meio hipotnico (filtrado) para um meio
hipertnico (sangue) com consequente consumo energtico.

Resposta da questo 19:


[C]

O processo de respirao celular aerbica libera energia pouco a pouco e parte dela
armazenada na forma de ATP (adenosina trifosfato).

Resposta da questo 20:


[C]

O ciclo de Krebs ocorre na matriz mitocondrial e a gliclise no citoplasma. Na gliclise, uma


molcula de glicose quebrada em duas molculas de cido pirvico. A utilizao de O2 se d
nas cristas mitocondriais, durante fosforilao oxidativa na cadeia respiratria. A via glicoltica
ocorre nos processos aerbios e anaerbios, enquanto o ciclo de Krebs ocorre nos processos
aerbios.

Resposta da questo 21:


[C]

O grfico mostra que as clorofilas a (verde-azulada) e b (verde-amarelada) absorvem melhor


os comprimentos de onda prximos a 660 e 460 nm, respectivamente. A planta submetida ao
comprimento de onda igual a 550 nm no consegue realizar fotossntese eficientemente,
porque absorve pouca energia.

Resposta da questo 22:


[A]

As leveduras utilizadas na produo vincola so fungos unicelulares anaerbicos facultativos.


Misturados ao mosto das uvas em tanques abertos, eles realizam a respirao aerbica,
liberando CO2 e H2O. Em tanques fechados, em ambiente anxico, as leveduras realizam a
fermentao alcolica, produzindo o lcool etlico e CO 2.

Resposta da questo 23:


[E]

Resposta da questo 24:

Pgina 18 de 19
Interbits SuperPro Web

[E]

A figura representa a anfase da mitose de uma clula diploide 2n=4, ou a anfase II da


meiose de uma clula-me 2n=8.

Resposta da questo 25:


[E]

A espcie de mosca analisada pelo pesquisador possui 2N = 4 cromossomos. As clulas


somticas, em diviso mittica, revelam quatro cromossomos filhos em separao. As clulas
germinativas, em diviso meitica, evidenciam a separao dos cromossomos homlogos
durante a fase reducional (meiose I).

Resposta da questo 26:


[B]

Durante a metfase da mitose sero observados 8 cromossomos distintos, cada um com 2


cromtides-irms unidas pelo centrmero.

Resposta da questo 27:


[D]

A determinao do sexo em mamferos segue o padro xy, sendo o macho heterogamtico,


isto , o tipo de cromossomo sexual (x ou y) presente no espermatozoide determinar se o
descendente ser uma fmea (xx) ou um macho (xy). Dessa forma, o sexo da criana foi
estabelecido durante a anfase I da gametognese masculina.

Resposta da questo 28:


[A]

Considerando-se os 46 cromossomos humanos como uma quantidade X de DNA, observados


nos ncleos das espermatognias e ovognias; nos espermatcitos e ovcitos segundrios
tambm haver X de DNA, porque essas clulas, resultantes da primeira diviso meitica,
possuem em seus ncleos 23 cromossomos duplicados.

Resposta da questo 29:


[D

Observe o esquema adiante:

Pgina 19 de 19