APPLIED AND ENVIRONMENTAL MICROBIOLOGY, Apr. 2011, p. 23252331 Vol. 77, No.

7
0099-2240/11/$12.00 doi:10.1128/AEM.02149-10
Copyright 2011, American Society for Microbiology. All Rights Reserved.

Antibacterial Activity and Mechanism of Action of Zinc Oxide

Nanoparticles against Campylobacter jejuni
Yanping Xie,1 Yiping He,2* Peter L. Irwin,2 Tony Jin,3 and Xianming Shi1*
Joint Sino-U.S. Food Safety Research Center & Bor Luh Food Safety Center, School of Agriculture & Biology,
Shanghai Jiao Tong University, 800 Dongchuan Road, Shanghai, China 200240,1 and Joint U.S.-Sino
Food Safety Research Center & Molecular Characterization of Foodborne Pathogens Research Unit2
and Residue Chemistry and Predictive Microbiology Research Unit,3 U.S. Department of Agriculture,
Agricultural Research Service, Eastern Regional Research Center (USDA-ARS-ERRC),
600 East Mermaid Lane, Wyndmoor, Pennsylvania 19038
Received 10 September 2010/Accepted 28 January 2011

Downloaded from http://aem.asm.org/ on October 27, 2016 by guest

The antibacterial effect of zinc oxide (ZnO) nanoparticles on Campylobacter jejuni was investigated for
inhibition and inactivation of cell growth. The results showed that C. jejuni was extremely sensitive to
treatment with ZnO nanoparticles. The MIC of ZnO nanoparticles for C. jejuni was determined to be 0.05
to 0.025 mg/ml, which is 8- to 16-fold lower than that for Salmonella enterica serovar Enteritidis and
Escherichia coli O157:H7 (0.4 mg/ml). The action of ZnO nanoparticles against C. jejuni was determined
to be bactericidal, not bacteriostatic. Scanning electron microscopy examination revealed that the ma-
jority of the cells transformed from spiral shapes into coccoid forms after exposure to 0.5 mg/ml of ZnO
nanoparticles for 16 h, which is consistent with the morphological changes of C. jejuni under other stress
conditions. These coccoid cells were found by ethidium monoazide-quantitative PCR (EMA-qPCR) to have
a certain level of membrane leakage. To address the molecular basis of ZnO nanoparticle action, a large
set of genes involved in cell stress response, motility, pathogenesis, and toxin production were selected for
a gene expression study. Reverse transcription-quantitative PCR (RT-qPCR) showed that in response to
treatment with ZnO nanoparticles, the expression levels of two oxidative stress genes (katA and ahpC) and
a general stress response gene (dnaK) were increased 52-, 7-, and 17-fold, respectively. These results
suggest that the antibacterial mechanism of ZnO nanoparticles is most likely due to disruption of the cell
membrane and oxidative stress in Campylobacter.

Directly adding antimicrobial agents to food or into pack-
aging materials during food processing is considered an effec-
tive means of controlling microbial contaminants in food and
extending the shelf life of fresh produce and meat. In recent
years, inorganic antimicrobial agents, such as metal oxides,
have received increasing attention in food applications because
they are not only stable under high temperatures and pressures
that may occur in harsh food-processing conditions, but they
are also generally regarded as safe for human beings and an-
imals relative to organic substances (6, 24).
Zinc oxide (ZnO) is listed as generally recognized as safe
(GRAS) by the U.S. Food and Drug Administration
(21CFR182.8991). As a food additive, it is the most commonly
used zinc source in the fortification of cereal-based foods.
Because of its antimicrobial properties, ZnO has been incor-
porated into the linings of food cans in packages for meat, fish,
corn, and peas to preserve colors and to prevent spoilage.
Nano-sized particles of ZnO have more pronounced antimi-
crobial activities than large particles, since the small size (less
than 100 nm) and high surface-to-volume ratio of nanopar-
* Corresponding author. Mailing address for Yiping He: USDA-
ARS-ERRC, 600 East Mermaid Lane, Wyndmoor, PA 19038.
Phone: (215) 233-6422. Fax: (215) 836-3742. E-mail: yiping.he@ars
.usda.gov. Mailing address for Xianming Shi: Mail box 49, School of
Agriculture & Biology, Shanghai Jiao Tong University, 800
Dongchuan Road, Shanghai, China 200240. Phone and fax: 86-21-
3420-6616. E-mail: xmshi@sjtu.edu.cn.
Published ahead of print on 4 February 2011.
ticles allow for better interaction with bacteria. Recent studies
have shown that these nanoparticles have selective toxicity to
bacteria but exhibit minimal effects on human cells (21). ZnO
nanoparticles have been shown to have a wide range of anti-
bacterial activities against both Gram-positive and Gram-neg-
ative bacteria, including major foodborne pathogens like Esch-
erichia coli O157:H7, Salmonella, Listeria monocytogenes, and
Staphylococcus aureus (13, 14), but currently there is no infor-
mation available on their antibacterial effect against species of
Campylobacter. Campylobacter jejuni is a leading cause of mi-
crobial foodborne illness worldwide. In fact, it has recently
been shown that approximately 80% of poultry products are
contaminated with this pathogen (11). Consumption of Cam-
pylobacter-contaminated food and water usually causes a mild
to severe gastrointestinal infection in humans that can some-
times develop into a life-threatening disease called Guillain-
Barre syndrome (28). Therefore, it is important to focus on the
use of ZnO particles as a potential food safety intervention
technology to effectively control Campylobacter and other mi-
crobial contaminants in food.
To make better use of ZnO nanoparticles in food products
and to assist in the development of powerful, but nontoxic,
antimicrobial derivatives, it is necessary to understand the
mechanism of action of ZnO nanoparticles against bacteria,
but to date, the process underlying their antibacterial effect is
not clear. However, a few studies have suggested that the
primary cause of the antibacterial function might be from the
disruption of cell membrane activity (4). Another possibility

2325
2326 XIE ET AL.
could be the induction of intercellular reactive oxygen species,
including hydrogen peroxide (H2O2), a strong oxidizing agent
harmful to bacterial cells (13, 22). It has also been reported
that ZnO can be activated by UV and visible light to generate
highly reactive oxygen species such as OH, H2O2, and O22.
The negatively charged hydroxyl radicals and superoxides can-
not penetrate into the cell membrane and are likely to remain
on the cell surface, whereas H2O2 can penetrate into bacterial
cells (18). To better understand the nature of the inhibitory
and lethal effects of ZnO nanoparticles on bacteria, we used C.
jejuni as a model organism to investigate this mechanism. C.
jejuni is a Gram-negative, spiral-shaped, highly motile, ther-
mophilic and microaerophilic bacterium that grows optimally
in a neutral pH and microaerobic environment at 42C. Unlike
other major foodborne pathogens, such as E. coli O157:H7,
Salmonella, and L. monocytogenes, C. jejuni has a low tolerance
for oxygen but does require some for growth (i.e., it is
microaerophilic). Due to the lack of some important oxida-
tive stress response genes (soxRS and oxyR) and a global
stationary-phase stress response gene (rpoS), C. jejuni is
extremely sensitive to oxidative stress as well as to other
environmental stresses. Exposure of this organism to differ-
ent stresses results in a remarkable morphological shift from
spiral-shaped cells to coccoid forms, which is associated with
the loss of culturability (10, 25). Due to these distinguishing
characteristics and sensitive stress responses, C. jejuni is
highly suitable for studying the modes of action of ZnO
nanoparticles against bacterial cells, especially in the assess-
ment of cell membrane integrity and the reactive oxygen
species-induced stress response.
The purpose of this research was to evaluate the antibacte-
rial effects and to investigate the mechanism of action of ZnO
nanoparticles against C. jejuni by examining cell morphology,
membrane permeability, and gene expression through the uti-
lization of scanning electron microscopy as well as advanced
molecular methods. The results were compared to those for
other foodborne pathogens, including E. coli O157:H7 and
Salmonella.
MATERIALS AND METHODS
ZnO nanoparticles. ZnO nanoparticles (purity over 99.7%) with an average
size of 30 nm and a Brunauer-Emmett-Teller (BET)-specific surface area of
35 m2/g were purchased from Inframat Advanced Materials LLC (Manchester,
CT). A stock suspension was prepared by resuspending the nanoparticles in
double-distilled water (ddH2O) to yield a final concentration of 100 mg/ml;
the suspension was kept at 4C. Immediately after the suspension was sub-
jected to vigorous vortex mixing, aliquots of the suspension were added into
Mueller-Hinton medium (MH; Becton Dickinson Co., Sparks, MD) for the
following experiments.
Bacterial culture conditions and antibacterial test. C. jejuni strains 81-176,
ATCC 35918, and ATCC 49943 were grown at 42C in MH broth in a microaero-
bic workstation (Don Whitley Scientific Ltd., Shipley, United Kingdom) in which
5% O2, 10% CO2, 85% N2, and 82% relative humidity were maintained. A mixed
culture of the three C. jejuni strains was prepared by combining equal volumes
(1/3) of each pure culture growing at the late log phase. Salmonella enterica
serovar Enteritidis ATCC 13076 and E. coli O157:H7 ATCC 43889 were aero-
bically grown at 37C in Luria-Bertani medium (Becton Dickinson). Bacterial
growth inhibition was tested by inoculating ca.104 CFUs of C. jejuni cells onto
each MH agar plate or into 20 ml of MH broth containing various concentrations
(0, 0.025, 0.03, 0.04, 0.05, and 0.10 mg/ml) of ZnO nanoparticles. After the
inocula were incubated for 16 h, inhibition of cell growth was determined by
counting the numbers of CFUs on the plates or by the turbidities of the cell
cultures. The inoculas that showed no cell growth were further verified for cell
culturability by spreading 100-l aliquots of the cultures onto drug-free MH agar
APPL. ENVIRON. MICROBIOL.
plates to determine the bactericidal (bacteria-killing) or bacteriostatic (bacteria-
inhibiting) effect of ZnO nanoparticles. The MICs of ZnO nanoparticles for C.
jejuni, E. coli O157:H7, and Salmonella were determined using a broth microdi-
lution method reported previously (19). Briefly, serial 2-fold dilutions of nano-
particles ranging from 0.00625 to 1.6 mg/ml were prepared in a 96-well microtiter
plate using MH or LB broth. Freshly grown bacterial cells were inoculated into
each well to give a final concentration of 104 CFU/ml. After the inocula were
incubated microaerobically for 24 h at 42C for C. jejuni or aerobically for 16 h
at 37C for E. coli O157:H7 and Salmonella, cell growth in each well was
monitored and compared with that of the positive-control well to which no ZnO
nanoparticles were added. The MIC was recorded as the lowest concentration of
ZnO nanoparticles that completely inhibited cell growth.
Examination of cell morphology by scanning electron microscope (SEM).
Mid-log-phase C. jejuni cultures were treated with 0.5 mg/ml of ZnO nanopar-
ticles for 12 h under microaerobic conditions. Aliquots of 200 l of treated and
untreated cell suspensions were deposited on glass coverslips. After being air
dried for 1 h, the coverslips were fixed with a primary fixative solution containing
2.5% glutaraldehyde and 0.1 M imidazole buffer solution (pH 7.2) for 2 h.
Downloaded from http://aem.asm.org/ on October 27, 2016 by guest
Subsequently, the fixative solution was exchanged for 0.1 M imidazole buffer,
followed by dehydration with a series of ethanol solutions (50%, 80%, and
100%), with three ethanol changes at each concentration. Finally, the cover-
slips were dried by liquid CO2-ethanol exchange in a DCP-1 Critical Point
dryer (Denton Vacuum, Inc., Cherry Hill, NJ). The coverslips were mounted
on SEM stubs with carbon adhesive tabs and then sputter coated with a thin
layer of gold using a Scancoat Six sputter coater (BOC Edwards, Wilmington,
MA). Digital images of the treated and untreated C. jejuni cells were acquired
using a Quanta 200 FEG scanning electron microscope (FEI, Inc., Hillsboro,
OR) at an accelerating voltage of 10 kV and instrumental magnifications
of 25,000.
EMA treatment, DNA isolation, and EMA-qPCR assay. Ethidium monoazide
(EMA) treatment of C. jejuni cells and a follow-up quantitative PCR (qPCR)
were carried out as described before (10). Briefly, 1 ml of freshly grown cells was
treated with 20 mg/ml of EMA in the dark for 5 min and subsequently exposed
to a 600-W halogen light for 1 min. Cells were then immediately washed with
phosphate-buffered saline and subjected to DNA extraction using a DNeasy
tissue kit (Qiagen, Valencia, CA) according to the manufacturers instructions.
The hipO gene was selected as a target for detection in qPCR because the DNA
sequence is unique to C. jejuni. The primers and TaqMan probe of hipO used in
this experiment were reported in previous work (9).
RNA preparation and RT-qPCR analysis of gene expression. To prepare total
cellular RNA, 80 ml of the C. jejuni 81-176 culture in the late log phase of growth
was treated or not treated with ZnO nanoparticles at 0.1 mg/ml for 30 min. The
ZnO concentration used herein was determined from the cell-killing results
shown in Fig. 1A. After the treatment, cells were harvested by centrifugation at
4,000 g for 10 min at 4C. RNA isolation was carried out using TRI Reagent
according to the manufacturers instructions (Molecular Research Center, Inc.,
Cincinnati, OH). DNase I treatment and reverse transcription (RT) of the RNA
samples were done as described before (8). Quantification of cDNA was per-
formed on a 7500 real-time PCR system (Applied Biosystems, Foster City, CA).
For PCR, all the listed primers were designed using Primer3 software (http:
//frodo.wi.mit.edu/primer3). Each 20-l PCR mixture contained 0.25
EvaGreen dye (Biotium, Hayward, CA), 0.25 M each primer, 2 l of cDNA
template, 5 units of Platinum Taq DNA polymerase, and buffer (Invitrogen, Inc.,
Carlsbad, CA). The amplification program was 50C for 2 min and 95C for
10 min, followed by 40 cycles at 95C for 15 s and 60C for 1 min. The gyrA
gene was used as a reference for data normalization. tsf and 16S rRNA
housekeeping genes were also included as controls to ensure data reliability.
All the samples, including no-RT and no-template controls, were analyzed in
triplicate. Data analysis was performed using the 2CT method, where
CT CT(treated sample) CT(untreated sample), CT CT(target
gene) CT(gyrA), and CT is the threshold cycle value for the amplified gene
(15).
RESULTS
Growth inhibition of C. jejuni by ZnO nanoparticles.
Growth inhibition of C. jejuni 81-176 was examined both on
agar plates and in broth containing a range of concentrations
(0, 0.025, 0.03, 0.04, 0.05, and 0.10 mg/ml) of ZnO nanopar-
ticles. On the plates spread with 104 CFU/plate and in the
broth inoculated with the equivalent number of cells, bacterial
VOL. 77, 2011
FIG. 1. Antibacterial activities of ZnO nanoparticles against C. je-
juni, S. enterica serovar Enteritidis, and E. coli O157:H7. Freshly grown
bacterial cultures (108 to 109 CFU/ml) were treated with a range of
concentrations of ZnO nanoparticles. Culturable cell numbers were
determined at the time intervals after treatment shown on the figure.
The values for CFU/ml are the means of 12 replicates. Error bars
indicate standard deviations of the means.
growth was completely inhibited at 0.03 mg/ml of ZnO nano-
particles. However, at a concentration of 0.025 mg/ml, ZnO
nanoparticles had a modest effect on cell growth, resulting in
the recovery of fewer viable cells than from the untreated
control suspension. To determine if the growth inhibition was
caused by an inhibitory or lethal effect of ZnO nanoparticles,
100-l aliquots of the treated-cell suspension were spread onto
drug-free MH plates. The results showed that the cells treated
with 0.03 mg/ml of the nanoparticles for 16 h were no longer
culturable, suggesting a lethal effect of ZnO nanoparticles
against C. jejuni. In addition, the MIC of ZnO nanoparticles
for all three C. jejuni strains was determined to be between 0.05
and 0.025 mg/ml, which was 8- to 16-fold lower than that (0.4
mg/ml) for E. coli O157:H7 and S. enterica serovar Enteritidis,
clearly indicating a higher level of susceptibility of C. jejuni to
ZnO nanoparticles.
Lethal effect of ZnO nanoparticles on C. jejuni. The lethal
effect of ZnO nanoparticles on C. jejuni was further investi-
gated using ca. 108 CFU/ml of freshly grown pure and mixed
ANTIMICROBIAL MECHANISM OF ZnO NANOPARTICLES 2327
FIG. 2. Scanning electron microscopic images of C. jejuni. (A) C.
jejuni cells in the mid-log phase of growth were treated with 0.5
mg/ml of ZnO nanoparticles for 12 h under microaerobic condi-
Downloaded from http://aem.asm.org/ on October 27, 2016 by guest
tions. (B) Untreated cells from the same growth conditions were
used as a control.
cultures of C. jejuni strains 81-176, ATCC 35918, and ATCC
49943. Cell culturability of all three C. jejuni strains was
affected by ZnO nanoparticles at all concentrations tested
(Fig. 1A to D). Most significantly, 0.5, 0.3, and 0.1 mg/ml of
ZnO nanoparticles resulted in complete killing (100%) of
108 CFU/ml of C. jejuni cells in 3 h or less. The pure and
mixed cultures of three C. jejuni strains showed a similar
susceptibility to ZnO nanoparticles. In contrast to the strong
and rapid bactericidal action against C. jejuni, 20- to 100-
fold-higher concentrations (10 mg/ml) of ZnO nanoparticles
caused only a 1- or 2-log reduction in viable E. coli O157:H7
and S. enterica serovar Enteritidis cells after an 8-h exposure
(Fig. 1E and F). These results demonstrated that ZnO nano-
particles are effective at killing C. jejuni even at low con-
centrations.
Morphological analysis of C. jejuni. Effects of ZnO nano-
particles on C. jejuni cell morphology were examined by scan-
ning electron microscopy. After a 12-h treatment with 0.5
mg/ml of ZnO nanoparticles in MH broth under microaerobic
conditions, spiral-shaped C. jejuni cells underwent a dramatic
change from spiral to coccoid morphological forms. The SEM
image in Fig. 2A illustrates the dominance of coccoid forms in
the treated cells and shows the formation of irregular cell
surfaces and cell wall blebs in great detail. These coccoid cells
remained intact and possessed sheathed polar flagella. The
image of the untreated cells clearly displays spiral shapes (Fig.
2B). Moreover, this ZnO nanoparticle-induced formation of
coccoid cells was confirmed by confocal microscopic visualiza-
tion (data not shown). Not surprisingly, a similar transforma-
tion in morphology was observed when C. jejuni was exposed to
different environmental stresses, including oxidative stress (10,
25). To determine the bactericidal versus bacteriostatic effect
of ZnO nanoparticles, cultures previously exposed to ZnO
nanoparticles and exhibiting a coccoid cell morphology were
spread plated. No growth of the coccoid cells was observed on
drug-free MH plates, confirming that they were no longer
culturable. Together these results suggest that ZnO nanopar-
ticles cause not only cell morphology changes but also a lethal
effect against C. jejuni.
EMA-PCR assessment of cell membrane integrity. EMA
selectively enters into membrane-compromised cells and binds
2328 XIE ET AL.
FIG. 3. EMA-qPCR of C. jejuni membrane integrity. Mid-log-
phase cells exposed to different concentrations of ZnO nanoparticles
were briefly treated with (black bars) and without (white bars) EMA.
Inhibition of DNA amplification was quantified by real-time PCR of
the hipO gene. Reduced DNA amplification in cells exposed to 0.3 and
0.5 mg/ml of ZnO nanoparticles indicates a certain degree of mem-
brane leakage in the treated cells.
to cellular DNA, which subsequently inhibits PCR amplifica-
tion of the DNA. The reduction in PCR amplification has been
used as an indicator of cell membrane leakage (17). To assess
the membrane integrity of the coccoid cells, EMA-qPCR was
performed on the C. jejuni cultures treated with 0, 0.1, 0.3, and
0.5 mg/ml of ZnO nanoparticles for 12 h. The results in Fig. 3
show that the cells treated with 0.3 and 0.5 mg/ml of ZnO
nanoparticles had a 10-fold (1-log) reduction in DNA am-
plification, indicating increased penetration of EMA into the
treated cells. This result demonstrates that the treatment of C.
jejuni with ZnO nanoparticles increases cell membrane perme-
ability (i.e., damages membrane integrity).
Gene expression profile of C. jejuni in response to ZnO
nanoparticle treatment. To understand the molecular basis of
ZnO nanoparticle action against bacterial cells, a set of C.
jejuni genes involved in general and oxidative stress responses,
motility, pathogenesis, and toxin production were selected for
a gene expression study (Table 1). After late-log-phase cells
were exposed to 0.1 mg/ml of ZnO nanoparticles for 30 min,
the transcripts of these genes were quantified by RT-qPCR.
Most significantly, two oxidative stress genes, katA (encoding
catalase) and ahpC (encoding alkyl hydroperoxide reductase),
and one general stress gene, dnaK (encoding a chaperone),
were found to be upregulated 52-, 7-, and 17-fold, respectively,
in response to the treatment. The transcription levels of other
stress response genes as well as the analyzed virulence genes
were not significantly up- or downregulated (3-fold) (Fig. 4).
As expected, the expression levels of three housekeeping genes
(gyrA, which encodes gyrase subunit A; tsf, which encodes
elongation factor TS; and 16S rRNA) were not changed re-
gardless of the treatment (Fig. 4). Similar gene expression
results were obtained from cells treated with 0.05 mg/ml of
ZnO nanoparticles for the same length of time (data not
shown). All these results suggest that the antibacterial mech-
anism of ZnO nanoparticles is likely due to oxidative stress in
C. jejuni cells.
DISCUSSION
ZnO nanoparticles have a broad spectrum of antibacterial
activities. At concentrations higher than 0.24 mg/ml, they in-
hibit the growth of E. coli O157:H7, L. monocytogenes, and S.
APPL. ENVIRON. MICROBIOL.
enterica serovar Enteritidis (12, 14). An inhibitory effect of
ZnO nanoparticles on Bacillus subtilis, Staphylococcus aureus,
Staphylococcus epidermidis, Streptococcus pyogenes, and Entero-
coccus faecalis has been reported as well (13). In this study, the
antibacterial properties of ZnO nanoparticles were first inves-
tigated in C. jejuni, the most common foodborne pathogen.
Our results showed that C. jejuni is extremely sensitive to ZnO
nanoparticles, with a MIC 8- to 16-fold lower than those for E.
coli O157:H7 and Salmonella. Antibacterial tests both on agar
plates and in broth showed that 0.03 mg/ml of ZnO nanopar-
ticles was sufficient to inactivate C. jejuni, whereas the concen-
tration of nanoparticles needed for 100% inhibition of E. coli
O157:H7 growth was between 0.24 and 0.98 mg/ml (4, 14),
approximately 8 to 32 times higher than the lethal dosage for
C. jejuni. It has previously been reported that the antibacterial
Downloaded from http://aem.asm.org/ on October 27, 2016 by guest
activity of ZnO nanoparticles increases with reduction in par-
ticle size (16). The number of bacterial cells and the growth
media used could also contribute to variation in results. For
data consistency, we used 30-nm (average-sized) ZnO nano-
particles to test similar numbers of bacterial cells.
Previously, it was unclear whether ZnO nanoparticles func-
tion as a bactericidal or bacteriostatic agent, except for a few
reports on the inhibition of bacterial growth (13, 14). In this
study, we demonstrated that the action of ZnO nanoparticles
on C. jejuni was bactericidal, not bacteriostatic, by showing no
recovery of the treated cells on drug-free MH plates as well as
by the rapid killing of 108 CFU/ml of freshly grown cells of
three different C. jejuni strains. The effectiveness of ZnO nano-
particles in inactivating C. jejuni was also compared with their
effectiveness against other major foodborne pathogens. For E.
coli O157:H7 and Salmonella, 20- to 100-fold-higher concen-
trations of ZnO nanoparticles were needed to reduce 1 to 2
logs of viable cells (Fig. 1). Therefore, the bactericidal action
of ZnO nanoparticles against C. jejuni was extremely effective.
Although the antibacterial mechanism of ZnO nanoparticles
is still unknown, the possibilities of membrane damage caused
by direct or electrostatic interaction between ZnO and cell
surfaces, cellular internalization of ZnO nanoparticles, and the
production of active oxygen species such as H2O2 in cells due
to metal oxides have been proposed in earlier studies (6, 24).
The generation of H2O2 in ZnO slurries was determined by
oxygen electrode analysis and spectrophotofluorometry (23,
27). In examining cell morphology, membrane integrity, and
gene expression in C. jejuni, we found that all of these aspects
were affected by ZnO nanoparticles. A dramatic change in C.
jejuni cell morphology was revealed by SEM by showing the
dominance of coccoid forms in the treated cells while the
untreated cells remained spiral. This considerable alteration in
cell morphology was not only observed in C. jejuni cells treated
with ZnO nanoparticles but has also been found in Campylo-
bacter cells and in cells of the closely related genus Helicobacter
when cells were exposed to different stresses (1, 5, 10). It might
be specific to spiral bacteria, as no significant changes in cell
shape were found in E. coli O157:H7 after exposure to ZnO,
but the nanoparticles adhered to the cell surface (29). In ad-
dition to changing the structure of C. jejuni cells, ZnO nano-
particles resulted in the formation of irregular cell surfaces and
membrane blebbing and an increase in membrane permeabil-
ity. This induced membrane leakage was also consistently ob-
served in E. coli O157:H7 by transmission electron microscopy
VOL. 77, 2011 ANTIMICROBIAL MECHANISM OF ZnO NANOPARTICLES 2329

TABLE 1. Genes and primers selected for RT-qPCR

Gene function/protein encodeda Gene Primer Sequence (533)

Oxidative stress response genes

Peroxide-sensing regulator perR Forward TTCAATCTCTTTAGCGACGG
Reverse CACATTTGGCGCAAACAACA
Flavodoxin I fldA Forward TCCACCAAGACTAAGCCCTG
Reverse CAGAAGGAGCGGCTAATACAA
Iron-binding protein dps Forward CCACTAATGTTAATATGCGTTCC
Reverse TGTGCTTGATAATCTTGCGACAA
Superoxide dismutase (Fe) sodB Forward TGGCGGTTCATGTCAAAGTA
Reverse ACCAAAACCATCCTGAACCA
Alkyl hydroperoxide reductase ahpC Forward AGTTGCCCTTCGTGGTTCGT
Reverse ATCGCCCTTATTCCATCCTG
Catalase katA Forward ACCGTTCATGCTAAGGGAAG
Reverse CCTACCAAGTCCCAGTTTCC
Nonheme iron-containing ferritin cft Forward TTCTTCTTCGTGTTGTTCGC

Downloaded from http://aem.asm.org/ on October 27, 2016 by guest

Reverse GCTGGAGCCTTCTTGTTTGC
Ferredoxin fdxA Forward CCCCACTTCTCATATCAGCG
Reverse ATGCGTTGAATGCGTAGGAC
Rubrerythrin rbr Forward TGCAGCAGTTACTAGGTTTT
Reverse AGACATTTTAGAGAAGCGGC
Ferric uptake regulator fur Forward CCATTTCTTTTGGTTCAGCAG
Reverse TGCAATCAAGGCTTGCTGTC
Carbon storage regulator csrA Forward TCAAAGTCGTTCAAACAGGG
Reverse TCATTCTGAACAACAGAATGC

General stress response genes

Probable thiol peroxidase tpx Forward GCCAGTTACAATGGTGCTGA
Reverse TTTGCCACAAAATCACTTGC
Cochaperonin groES Forward AAACAACAGCCTCAGGCATAA
Reverse TTCTGTTCCACCGTATTTAGCA
Chaperonin groEL Forward GCAGGCGATGGAACAACTAC
Reverse TCCATACCGCGTTTTACCTC
Chaperone dnaK Forward CGGTATGCCACAAATCGAAG
Reverse GCTAAGTCCGCTTGAACCTG
Cochaperone dnaJ Forward TTTAAAAGGCGGTGGATTTG
Reverse TTTTCTACGACGCGATGATG
Bacterioferritin comigratory protein homolog BCP Forward ACCCCAGGTTGTACTACAGAAG
Reverse AGCAATCTTACCTGTTTCATCG
RelA/Spot family protein spoT Forward GCCCCAATAGCCCATAGAC
Reverse ACCCCAAGCAAATCAAGAAC
Rod shape-determining protein mreB Forward GAGCCTTCTGTTGTGGCAGTT
Reverse AGCGGATCATTTTTTCAGTCAT
RND efflux system; membrane fusion protein cmeA Forward TATTACGCCGCTAACTTGAG
Reverse CAGCAAAGAAGAAGCACCAA
RND efflux system; inner membrane transporter cmeB Forward TAATCCAGGTATGGGAGGTA
Reverse GGAAAGATAGAAATGTAAGCG
RND efflux system; outer membrane lipoprotein cmeC Forward GGACGTTGAAGCAAGATGGT
Reverse AGTTGGCGCTGTAGGTGAAT
Major outer membrane protein porA Forward TTGATAGCGAACTTGATGAT
Reverse ATACGAAGTCAGCACCAACG
Inner membrane protein yagU Forward CTATTTCCATACCCCACAGC
Reverse CCTTTAATTGCAGAAGTTCC
ATP-dependent Clp protease ATP-binding subunit clpA Forward GTAGGAGCTGGAAGCACAGG
Reverse ACGGCGACTTAGGGGTTTAT

Virulence factors and toxins

Cytolethal distending toxin cluster cdtA Forward TCCACATTTGTGCGTGATTG
Reverse GATTTGGCGATGCTAGAGTTT
cdtB Forward AAAGCATCATTTCCATTGCG
Reverse ACCAAGAACAGCCACTCCAA
cdtC Forward CCAAAAGGAAGTTCATCAGC
Reverse AGCCTTTGCAACTCCTACTG
Invasion antigen B ciaB Forward CTCATCATTTGGAACGACTTG
Reverse AATTATACTCATGCGGTGGC
Flagellin A flaA Forward CCAATGTCGGCTCTGATTTG
Reverse GCGCAGGAAGTGGATTTTC
Flagellin B flaB Forward CCGTTTCCATCACCATCTTC
Reverse ACACGCTTTGAAACAGGAGG
Continued on following page
2330 XIE ET AL. APPL. ENVIRON. MICROBIOL.

TABLE 1Continued
Gene function/protein encodeda Gene Primer Sequence (533)

Outer membrane fibronectin-binding protein cadF Forward TGCTTGTGGAGCTGGACGAG

Reverse TAAAAGCGGTGGATTTGGAC
N-acetylneuraminic acid synthetase neuB Forward TGTTGAAGTGGGACTAAGCG
Reverse TCTAACTTGCCATCGCCTAA
Vacuolating cytotoxins vacB Forward AAGGACGAGGTAGCATAGGT
Reverse CAAACGGCGATAGTGTTGAT

Housekeeping genes
Gyrase subunit A gyrA Forward TGCTAAAGTGCGTGAAATCG
Reverse GCATTGGTGCGTTTTCCTAT
Elongation factor TS tsf Forward GAACTCCGCGAAAGTACAGG
Reverse TTGCCACAAAATCTGTTTCG
16S rRNA 16S rRNA gene Forward GCTCGTGTCGTGAGATGTTG
Reverse TCACCGTAGCATGGCTGAT

Downloaded from http://aem.asm.org/ on October 27, 2016 by guest

a
RND, resistance nodulation cell division family.

and Raman spectroscopy when cells were treated with ZnO
nanoparticles (14).
When extracellular environments change, bacteria adopt
mechanisms that quickly regulate the synthesis of defensive
proteins in response to stress. In Campylobacter, a number of
genes/proteins that play critical roles in protecting cells from
different stresses, especially oxidative stress, have been identi-
fied (26). Most importantly, to eliminate reactive oxygen spe-
cies and to assist the organism in defense against oxidative
stress, superoxide dismutase (SodB) breaks down O2 to H2O2
and O2, catalase (KatA) inactivates H2O2 and interrupts the
formation of toxic intermediates, and alkyl hydroperoxide re-
ductase (AhpC) destroys toxic hydroperoxide intermediates
and repairs damage to molecules caused by oxidation (3, 20).
In addition to these oxidative stress response proteins, general
stress response proteins (DnaK, DnaJ, GroES, and GroEL),
which act as molecular chaperones and play a critical role in
preventing protein aggregation and refolding, are also impor-
tant for cell survival (2). Analysis of ZnO nanoparticle-modu-
lated stress gene expression showed that the transcription lev-
els of two oxidative stress genes (ahpC and katA) and one
general stress response gene (dnaK) were significantly in-
creased, up to 7- to 52-fold, while another 4 stress response
genes (sodB, dps, groEL, and groES) were expressed at approx-
imately 2- to 3-times-higher levels. Expression of all other
stress response genes was either unchanged or downregulated.
Because KatA is a single catalase enzyme whose expression
level increases in C. jejuni upon exposure to H2O2 (7), the
52-fold induction of KatA expression suggests a high probabil-
ity that more intercellular H2O2 is produced in response to the
ZnO nanoparticles. From these experiments and the role of
the oxidative stress regulatory system in Campylobacter, we can
conclude that the antibacterial mechanism of ZnO nanopar-
ticles is very likely through increased levels of oxidative stress
in bacterial cells. Furthermore, the expression of a number of
virulence factors related to cell motility, toxin production, and
adhesion to host cells was also examined in response to ZnO
nanoparticles. All of the analyzed virulence genes were found
to be downregulated, suggesting decreased pathogenicity of
the bacterium after treatment.
In summary, ZnO nanoparticles exhibited remarkable anti-
bacterial activity and demonstrated a lethal effect against C.
jejuni, even at low concentrations. ZnO nanoparticles induced
significant morphological changes, measurable membrane
leakage, and substantial increases (up to 52-fold) in oxidative
stress gene expression in C. jejuni. Based on these phenomena
and cell responses, a plausible mechanism of ZnO inactivation
of bacteria involves the direct interaction between ZnO nano-
particles and cell surfaces, which affects the permeability of
membranes where nanoparticles enter and induce oxidative

FIG. 4. Relative gene expression levels of ZnO nanoparticle-treated and untreated C. jejuni. C. jejuni cells in the late log phase of growth were
treated with 0 or 0.1 mg/ml of ZnO nanoparticles for 30 min. Transcripts of the selected genes were quantified by RT-qPCR, and data were
analyzed using the comparative critical threshold (CT) method. The relative expression ratio for each gene is presented as a log2 value in the
histogram. A ratio greater than zero (0) indicates upregulation of gene expression and a ratio below zero (0) indicates downregulation. Error
bars indicate standard deviations for three replicates.
VOL. 77, 2011 ANTIMICROBIAL MECHANISM OF ZnO NANOPARTICLES
stress in bacterial cells, subsequently resulting in the inhibition
of cell growth and eventually in cell death.
ACKNOWLEDGMENTS
This research was jointly supported by the Agriculture Research
Service, U.S. Department of Agriculture, the Ministry of Science and
Technology of China (2009BADB9B01 and 2009BAK43B31), and the
Science and Technology Commission of Shanghai Municipality
(09DZ0503300).
We thank Guoping Bao of the Microscopy Imaging Facility of the
USDA, ARS, ERRC, for technical assistance in acquiring the SEM
images and George Paoli of the Molecular Characterization of Food-
Borne Pathogens Research Unit of the USDA, ARS, ERRC, for
providing the C. jejuni ATCC strains.
REFERENCES
1. Adams, B. L., T. C. Bates, and J. D. Oliver. 2003. Survival of Helicobacter
pylori in a natural freshwater environment. Appl. Environ. Microbiol. 69:
74627466.
2. Arsene, F., T. Tomoyasu, and B. Bukau. 2000. The heat shock response of
Escherichia coli. Int. J. Food Microbiol. 55:39.
3. Baillon, M. L., A. H. van Vliet, J. M. Ketley, C. Constantinidou, and C. W.
Penn. 1999. An iron-regulated alkyl hydroperoxide reductase (AhpC) con-
fers aerotolerance and oxidative stress resistance to the microaerophilic
pathogen Campylobacter jejuni. J. Bacteriol. 181:47984804.
4. Brayner, R., et al. 2006. Toxicological impact studies based on Escherichia
coli bacteria in ultrafine ZnO nanoparticles colloidal medium. Nano Lett.
6:866870.
5. Catrenich, C. E., and K. M. Makin. 1991. Characterization of the morpho-
logic conversion of Helicobacter pylori from bacillary to coccoid forms. Scand.
J. Gastroenterol. Suppl. 181:5864.
6. Fu, G., P. S. Vary, and C. T. Lin. 2005. Anatase TiO2 nanocomposites for
antimicrobial coatings. J. Phys. Chem. B 109:88898898.
7. Grant, K., and S. Park. 1995. Molecular characterization of katA from
Campylobacter jejuni and generation of a catalase-deficient mutant of Cam-
pylobacter coli by interspecific allelic exchange. Microbiology 141:13691376.
8. He, Y., J. G. Frye, T. P. Strobaugh, and C. Y. Chen. 2008. Analysis of
AI-2/LuxS-dependent transcription in Campylobacter jejuni strain 81-176.
Foodborne Pathog. Dis. 5:399415.
9. He, Y., et al. 2010. Simultaneous detection and differentiation of Campylo-
bacter jejuni, C. coli, and C. lari in chickens using a multiplex real-time PCR
assay. Food Anal. Methods 137:168174.
10. He, Y. P., and C. Y. Chen. 2010. Quantitative analysis of viable, stressed and
dead cells of Campylobacter jejuni strain 81-176. Food Microbiol. 27:439446.
11. Jacobs-Reitsma, W. F., U. Lyhs, and J. Wagenaar. 2008. Campylobacter in
the food supply, p. 627644. In I. Nachamkin, C. M. Szymanski, and M. J.
Blaser (ed.), Campylobacter, 3rd ed. ASM Press, Washington, DC.
2331
12. Jin, T., D. Sun, J. Y. Su, H. Zhang, and H. J. Sue. 2009. Antimicrobial
efficacy of zinc oxide quantum dots against Listeria monocytogenes, Salmo-
nella Enteritidis, and Escherichia coli O157:H7. J. Food Sci. 74:M46M52.
13. Jones, N., B. Ray, K. T. Ranjit, and A. C. Manna. 2008. Antibacterial activity
of ZnO nanoparticle suspensions on a broad spectrum of microorganisms.
FEMS Microbiol. Lett. 279:7176.
14. Liu, Y., et al. 2009. Antibacterial activities of zinc oxide nanoparticles against
Escherichia coli O157:H7. J. Appl. Microbiol. 107:11931201.
15. Livak, K. J., and T. D. Schmittgen. 2001. Analysis of relative gene expression
data using real-time quantitative PCR and the 2CT method. Methods
25:402408.
16. Nair, S., et al. 2009. Role of size scale of ZnO nanoparticles and micropar-
ticles on toxicity toward bacteria and osteoblast cancer cells. J. Mater. Sci.
Mater. Med. 20(Suppl. 1):S235S241.
17. Nogva, H. K., S. M. Dromtorp, H. Nissen, and K. Rudi. 2003. Ethidium
monoazide for DNA-based differentiation of viable and dead bacteria by
5-nuclease PCR. Biotechniques 34:804813.
18. Padmavathy, N., and R. Vijayaraghavan. 2008. Enhanced bioactivity of ZnO
nanoparticlesan antimicrobial study. Sci. Technol. Adv. Mater. 9:17.
Downloaded from http://aem.asm.org/ on October 27, 2016 by guest
19. Petersdorf, R. G., and J. C. Sherris. 1965. Methods and significance of in
vitro testing of bacterial sensitivity to drugs. Am. J. Med. 39:766779.
20. Purdy, D., S. Cawthraw, J. H. Dickinson, D. G. Newell, and S. F. Park. 1999.
Generation of a superoxide dismutase (SOD)-deficient mutant of Campylo-
bacter coli: evidence for the significance of SOD in Campylobacter survival
and colonization. Appl. Environ. Microbiol. 65:25402546.
21. Reddy, K. M., et al. 2007. Selective toxicity of zinc oxide nanoparticles to
prokaryotic and eukaryotic systems. Appl. Phys. Lett. 90:21390212139023.
22. Sawai, J. 2003. Quantitative evaluation of antibacterial activities of metallic
oxide powders (ZnO, MgO and CaO) by conductimetric assay. J. Microbiol.
Methods 54:177182.
23. Sawai, J., et al. 1996. Detection of active oxygen generated from ceramic
powders having antibacterial activity. J. Chem. Eng. Jpn. 29:627633.
24. Stoimenov, P. K., R. L. Klinger, G. L. Marchin, and K. J. Klabunde. 2002.
Metal oxide nanoparticles as bactericidal agents. Langmuir 18:66796686.
25. Tangwatcharin, P., S. Chanthachum, P. Khopaibool, and M. W. Griffiths.
2006. Morphological and physiological responses of Campylobacter jejuni to
stress. J. Food. Prot. 69:27472753.
26. van Vliet, A. H., J. M. Ketley, S. F. Park, and C. W. Penn. 2002. The role of
iron in Campylobacter gene regulation, metabolism and oxidative stress de-
fense. FEMS Microbiol. Rev. 26:173186.
27. Yamamoto, O., M. Komatsu, J. Sawai, and Z. E. Nakagawa. 2004. Effect of
lattice constant of zinc oxide on antibacterial characteristics. J. Mater Sci.
Mater. Med. 15:847851.
28. Yuki, N., and M. Koga. 2006. Bacterial infections in Guillain-Barre and
Fisher syndromes. Curr. Opin. Neurol. 19:451457.
29. Zhang, L. L., Y. H. Jiang, Y. L. Ding, M. Povey, and D. York. 2007. Inves-
tigation into the antibacterial behavior of suspensions of ZnO nanoparticles
(ZnO nanofluids). J. Nanopart. Res. 9:479489.