Original Research ajog.

org

OBSTETRICS
Diagnostic accuracy of fetal rhesus D genotyping using
cell-free fetal DNA during the first trimester of pregnancy
Alexandre Vivanti, MD; Alexandra Benachi, MD, PhD; Franois-Xavier Huchet, MD; Yves Ville, MD, PhD;
Henri Cohen, MD; Jean-Marc Costa, PharmD

BACKGROUND: Rhesus D genotyping with cell-free fetal DNA
currently is used throughout the world. Although this technique has spread
rapidly, its optimal use is still a matter of debate. This screening test has
been introduced mainly for the treatment of RhD-negative pregnant
women during the third trimester of pregnancy, thereby avoiding sys-
tematic anti-D prophylaxis, yet such a strategy has proved cost-ineffective.
Publications reporting on fetal RHD genotyping with cell-free DNA in
maternal plasma, specifically during the first trimester of pregnancy, are
scarce in the scientific literature.
OBJECTIVE: This study sought to assess the performance of nonin-
vasive fetal Rhesus D genotyping in the first trimester of pregnancy with a
single-exon real-time polymerase chain reaction assay.
STUDY DESIGN: This was a retrospective observational multicenter
study. Cell-free fetal DNA was extracted from maternal blood of both
nonimmunized and immunized women at 10e14 weeks of gestation.
RHD sequence was determined by quantitative polymerase chain
reaction, with amplification of exon 10. Results were compared with
RhD phenotype data that were obtained by cord blood sampling of
neonates.
RESULTS: In total, 416 serum samples from RhD-negative pregnant
women were collected during the first trimester of pregnancy. The tests
overall sensitivity and specificity were 100% (95% confidence interval,
96.9e100.0) and 95.2% (95% confidence interval, 90.5e97.6),
respectively. The negative and positive predictive values were 99.8%
(95% confidence interval, 94.9e100.0) and 97.1% (95% confidence
interval, 94.2e98.6), respectively. Fetal RHD status was inconclusive in 9
cases (2.2%).
CONCLUSION: Noninvasive fetal RHD determination by single-exon
quantitative polymerase chain reaction during the first trimester of preg-
nancy exhibits high accuracy.
Key words: cell-free fetal DNA, maternal serum, RHD genotyping

S ince 1997 when Lo et al1 reported

detecting cell-free fetal DNA in the
plasma of pregnant women, numerous
applications have been developed,
which has led to an entirely new era
for noninvasive prenatal diagnosis. As a
major application, noninvasive rhesus D
(RhD) genotyping has revolutionized
the determination of fetal RHD status
for RhD-negative women. Before RHD
genotyping by polymerase chain reaction
(PCR), fetal RHD status was ascertained
after an invasive procedure (ie, chorionic
villus sampling or amniocentesis). At the
present time, the assay is based on the
detection of RHD gene sequences in the
plasma of RhD-negative women.2 This
assay was proposed initially for small
cohorts of RhD-immunized women to
exclude any risk of RhD incompatibility
or, conversely, adapt patient care for
Cite this article as: Vivanti A, Benachi A, Huchet F-X,
et al. Diagnostic accuracy of fetal rhesus D genotyping
using cell-free fetal DNA during the first trimester of
pregnancy. Am J Obstet Gynecol 2016;215:606.e1-5.
0002-9378/$36.00
2016 Elsevier Inc. All rights reserved.
http://dx.doi.org/10.1016/j.ajog.2016.06.054
pregnancies at risk of hemolytic
disease and fetal anemia. Thereafter,
RHD genotyping has been assessed in
large populations of nonimmunized
women, with promising results.3-6
In 2002, the rst noninvasive fetal
RHD genotyping test was introduced by
our team in routine practice in France.
Solely based on the detection of RHD
gene exon 10 by real-time PCR, this
assay, which initially was assessed in a
cohort of 102 rst-trimester pregnant
women, exhibited perfect accuracy
(100% sensitivity and specicity).7 Next,
the assay was evaluated in a cohort of 283
women for whom reliable fetal RHD
genotype determination could again be
achieved with 100% accuracy.3
Here we have reported the results that
pertain to our extended experience in
the noninvasive prenatal determination
of fetal RHD status that is proposed
routinely in the rst pregnancy
trimester.
Material and Methods
Study population
In total, 416 RhD-negative pregnant
women were enrolled retrospectively in
5 obstetrics departments in the Paris
area (American Hospital of Paris, Insti-
tut Mutualiste Montsouris, Centre
Hospitalo-Universitaire Necker-Enfants
Malades, Centre Hospitalo-Universitaire
Antoine Bclre, and Institut Hospitalier
Franco-Britannique) between January
2007 and December 2012. All blood
samples were obtained at 10e14 weeks
of gestation as part of a routine consul-
tation or specic prenatal diagnosis
consultation in relation to previous RhD
immunization. Medical indications for
noninvasive fetal RHD determination in
RhD-negative women were (1) system-
atic screening of nonimmunized RhD-
negative women, to guide anti-D
administration after an invasive proce-
dure (chorionic villus sampling or
amniocentesis) if needed or (2) events at
risk for RhD immunization (abdominal
trauma, miscarriage, or metrorrhagia).
Samples
Blood samples (7 mL) were collected
into Vacutainer SST tubes (Becton
Dickinson, Meylan, France). Immedi-
ately after clotting, serum was obtained
by centrifugation at 3000g for 10 minutes
at 4
C, aliquoted, and stored at e80
C. If
not treated immediately, the blood

606.e1 American Journal of Obstetrics & Gynecology NOVEMBER 2016

ajog.org
sample was kept at room temperature
for a maximum of 72 hours before being
processed. Anti-D immunoglobulins
were not administered to patients whose
fetus was found to be RhD-negative.
Real-time PCR for RHD gene
Detection of sequences derived from the
human RHD gene was performed, as
described elsewhere8; the mouse GALT
gene was used as a positive control of
DNA extraction. Briey, as a tracer for
DNA extraction and amplication steps,
a low amount (250 pg) of mouse DNA
(Sigma, Grenoble, France) was added to
each patients sample (1 mL of serum)
immediately before DNA extraction.
Total DNA was then extracted with the
use of the PCR Template Preparation Kit
(Roche Diagnostics, Meylan, France),
and the adsorbed DNA was eluted with
50 mL of elution buffer, 10 mL of which
was used per PCR reaction. Amplica-
tion was carried out in a Light-Cycler
V2.0 instrument (Roche Diagnostics).
PCR reactions were performed with the
use of the FastDNAMaster Hybridiza-
tion Probes Kit (Roche Diagnostics) in a
nal volume of 20 mL, with 0.5 mmol/L
of each primer (Table), 0.25 mmol/L
of each probe (Sigma), 1.25 units of
uracil-DNA glycosylase (Biolabs, Saint-
Quentin en Yvelines, France), and 4.75
mmol/L of magnesium chloride. After
an initial 1-minute incubation at 50
C, a
rst denaturation step of 8 minutes at
95
C was followed by amplication
performed for 50 cycles of denaturation
(95
C, 10 seconds, ramping rate 20
C/
sec), annealing (56
C, 10 seconds,
ramping rate 20
C/sec), and extension
(72
C, 20 seconds, ramping rate 2
C/
sec). Each sample was treated twice for
DNA extraction, and the RHD assay was
performed in duplicate on each DNA
extract. During each run, sera that were
obtained from women carrying an RhD-
positive or RhD-negative fetus were used
as positive and negative controls. RHD
reaction was considered to be positive
when a uorescent signal was detected
for the RHD gene and to be negative
when a signal was detected for the
mouse GALT gene only. The results
were considered inconclusive when the
crossing point value (uorescent signal)
OBSTETRICS
that was observed for the RHD reaction
appeared much earlier than for the
positive control. In that specic case, it
means that the amount of RHD se-
quences that are detected in maternal
serum is too large to be of fetal origin.
Based on these ndings, it can be
concluded that RHD gene sequences are
present in the maternal genome, which
suggests the presence of a mother variant
of RHD gene. Denitive RhD-negative
genotype was considered established
when all RHD PCR reactions were
negative, and RHD-positive genotype
was considered established when at least
3 of 4 PCR reactions were positive.
The results were compared with
those obtained by RhD serology of the
neonate cord blood sample.
Data and statistical analyses
For each woman who was included in the
study, the following data were collected:
gestational age at noninvasive RHD
determination, indication for RHD
determination, results of real-time PCR
for RHD gene, neonatal RhD determi-
nation (cord blood sampling) as gold
standard, antenatal and postnatal
screenings for irregular antibodies,
antenatal or postnatal anti-D adminis-
tration, and geographic origin of both
parents.
Data were analyzed with JMP 10 Sta-
tistical Discovery software (SAS Insti-
tute, Cary, NC). All estimates were
presented with 95% condence intervals
(CI).
Details of ethics approval
This observational retrospective study
was approved by the institutional review
board of the French college of obstetri-
cians and gynecologists (CEROG OBS
2013-02-04 R1). All data were deidenti-
ed to ensure patient privacy and
condentiality. According to the French
regulation regarding prenatal diagnosis,
written informed consent was obtained
from all patients.
Results
Among the 416 RhD-negative women
who were tested for fetal RHD status, the
mean gestational age at blood sampling
was 13.1  1.0 weeks. Overall 25
NOVEMBER 2016 American Journal of Obstetrics & Gynecology
Original Research
procedures (6.0%) were performed at
10e11 weeks of gestation. Most women
(90.6%) were tested as part of systematic
screening; 22 women (5.3%) were tested
before an invasive procedure, and 17
women (4.1%) were tested because of
existing RhD immunization. Among
women who were tested for fetal RHD
status, 48 women (11.5%) were of Afri-
can or Caribbean origin. Neonatal RhD
status was negative in 162 cases (38.9%)
and positive in 254 cases (61.1%).
In this study cohort, fetal RHD status
was inconclusive in 9 cases (2.2%;
Figure), with 6 of them being of African
or Caribbean origin. Concerning these
inconclusive results, 2 newborn infants
were determined to be RhD-positive, and
7 infants were determined to be RhD-
negative (based on cord blood sera).
Fetal RHD status was conclusive for
407 maternal sera (97.8%): 259 nonin-
vasive assays (63.6%) were positive, and
148 assays (36.4%) were negative. When
conclusive, all sera from women carrying
an RhD-positive fetus (n252) provided
positive results for RHD gene detection
vs 7 sera from women carrying an RhD-
negative fetus. None of the RhD-positive
fetuses provided negative results for
RHD gene detection. The tests overall
sensitivity and specicity were 100%
(95% CI, 96.9e100.0) and 95.2% (95%
CI, 90.5e97.6), respectively. In our
cohort, the negative and positive pre-
dictive values were 99.8% (95% CI,
94.9e100.0) and 97.1% (95% CI,
94.2e98.6), respectively.
According to antenatal and postnatal
screenings for irregular antibodies,
none of the nonimmunized women had
been sensitized during their pregnancies.
Among the 17 immunized women, all
RHD statuses were determined correctly,
with 7 fetuses who tested RhD-negative.
Of the 7 women with false-positive RHD
antenatal noninvasive genotyping tests,
4 had been administered anti-D immu-
noglobulins during pregnancy.
Comment
Our study results revealed that fetal RHD
status can be determined with very high
accuracy with the use of a single-exon
assay, even during the rst pregnancy
trimester and in a mixed population.
606.e2
Original Research OBSTETRICS
Such an early detection of RHD ge-
notype with the use of cell-free fetal
DNA could have resulted in a high rate of
false-negative results, with dramatic
consequences on RhD-sensitized preg-
nant women who are expecting
RhD-positive children. In our study,
however, pregnant women who were
expecting RhD-positive children were
both consistently and correctly diag-
nosed (100% sensitivity). This high level
of accuracy supports the use of nonin-
vasive RHD status determination in
routine clinical practice after 10 weeks
of gestation.
Noninvasive RHD determination is
performed routinely in most developed
countries, and numerous research teams
have assessed its overall accuracy over
the past 10 years, with 2 meta-analyses
performed. First, Geifman-Holtzman
et al9 retrieved 37 publications that
included a total of 3261 samples that
were taken at 8e42 weeks of gestation.
Overall diagnostic accuracy was 91.4%
(94.8% after exclusion of samples with
lacking DNA and/or RHD status of the
newborn infant not veried). RHD sta-
tus determination during the rst preg-
nancy trimester concerned only 218
samples (6.7%), which resulted in a
90.8% diagnostic accuracy. More
recently, Zhu et al10 conducted a larger
meta-analysis that included 41 studies
and 11,129 samples. After the exclusion
of 352 samples, overall accuracy proved
to be 98.5%, with 99% sensitivity and
98% specicity. First-trimester RHD
status determinations (when clearly
identied) showed a 99% diagnostic
accuracy (882 samples).
The rst large study specically
focusing on the rst pregnancy trimester
while using a single-exon (exon 10)
quantitative PCR assay was published in
2002.7 This study involved 102 women
before 14 weeks of gestation, and resul-
ted in both 100% sensitivity and speci-
city. These results were consistent with
another rst-trimester study11 that
involved 111 RhD-negative women. The
latter work focused on the detection of
exons 5 and 7 at 9e13 weeks of gestation.
The assays specicity and sensitivity
were 93% and 100%, respectively, with
97% diagnostic accuracy. The largest
606.e3 American Journal of Obstetrics & Gynecology NOVEMBER 2016
ajog.org
TABLE
Details of primers and probes used in the polymerase chain reaction assay
Variable Target Sequence (50 -30 ) Modification
Primer name
RHE10A Human RHD gene GCCTGCATTTGTACGTGAGA None
RHE10B Human RHD gene CAAAGAGTGGCAGAGAAAGGA None
IS11 Mouse GALT gene GCGCTTCCCGAGGTACACTAT None
IS12 Mouse GALT gene ATGTCACATCTGCCCGAACTCC None
Probe name
RHE10C Human RHD gene GCAGGCACTGGAGTCAGAGAAAA 50 LCRed640 30 Ph
RHE10D Human RHD gene TGACAGCAAAGTCTCCAATGTTCG 30 FITC
IS9 Mouse GALT gene TGGTGATCCTGCCGTTTCCTTGTCTT 50 LCRed705 30 Ph
IS10 Mouse GALT gene GCCCTGATGTGGTCACAGTCAAGCA 30 FITC
Vivanti et al. Fetal RHD genotyping in the rst pregnancy trimester. Am J Obstet Gynecol 2016.
specic rst trimester cohort (591 sam- results signicantly increased (16/856 vs
ples) that we could nd was published in 1/956 for the 11e13 weeks of gestation
2011 by Akolekar et al,12 with an overall period). More recently, Picchiassi et al16
accuracy of 98.8%. Yet, there was a high reported an Italian experience that used
number of inconclusive results (n84; a similar 2-exon strategy (exons 5 and 7)
14.3% of the whole cohort), which could concerning 193 rst-trimester pregnant
have been accounted for by the high women, with a 93.3% overall accuracy
proportion of African women (19.3%). (92.8% sensitivity and 94.1%
The RhD-negative phenotype is consid- specicity).
ered to result from homozygosity for a Our data are consistent with that of
complete RHD deletion in most white previously published studies that used
women.13 Nevertheless, the RHD*Pseu- single-exon amplication. Wikman et al6
dogene could be responsible for more reported a high performance level, yet
than one-half of RhD-negative pheno- only after 8 weeks of gestation, when
types in African women.14 This RHD analyzing exon 4 in a triplicate mode.
variant contains a 37-base pair that is RHD genotyping by a multi-exon
inserted in exon 4, which likely in- approach was suggested to be more
troduces a stop codon at position 210, appropriate because it could detect some
while also comprising another stop RHD-positive allele (RHD gene variants)
codon in exon 6. The RHD*Pseudogene that were associated with RhD-negative
presence is a leading cause of inconclu- phenotype, thereby reducing the rate of
sive results in the African ethnic group. false positives. Identication of such
In our cohort, 48 women (11.5%) were RHD gene variants relies on analysis of
of African or Caribbean origin, with 6 of discrepancies between the different tar-
them showing inconclusive RHD geno- geted exons. However, such discrep-
typing. A prospective multicenter study ancies could also be due to analytical
that involved a large cohort was pub- variations, especially when the amount
lished recently; the results stratied by of fetal DNA proves low, as during the
gestational age.15 Of the 4913 women rst trimester. As a result, a high rate of
who were recruited into the cohort, 956 no-call report was described,12,15 and
were included at 11e13 weeks of gesta- most studies that have been published to
tion. The tests sensitivity (PCR of exons date failed, in fact, to demonstrate the
5 and 7) achieved 99.8%, with 75 superiority of multiple exon analysis. In
inconclusive results (7.8%). When the clinical practice, these nonreportable
test was performed at <11 weeks of results would probably lead to anti-D
gestation, the rate of false-negative administration.
ajog.org
FIGURE
Flow chart
Results of noninvasive fetal RHD genotyping in maternal serum during the first trimester of pregnancy
using cell-free fetal DNA.
RhD, rhesus D.
Vivanti et al. Fetal RHD genotyping in the rst pregnancy trimester. Am J Obstet Gynecol 2016.
In addition, replicate testing of a single
target has been shown to increase the
sensitivity of fetal DNA detection in
maternal plasma.17 Such approach could
not be applied reasonably to a multi-exon
strategy, because this would increase the
assays cost dramatically. Although the
single exon genotyping approach could
result in a higher number of false-
positives thereby resulting in a slightly
lower specicity, it could prove to be a
more suitable and cost-effective means to
offer practical systematic screening with
acceptable performance.18
At the present time, noninvasive fetal
RHD determination would be suf-
ciently accurate to be routinely per-
formed as from 10-11 weeks of gestation.
Making rst-trimester fetal testing
coincide with routine antenatal visits
may help reduce anti-D immunoglob-
ulin administration during pregnancy,
while promptly providing adapted care
to nonsensitized women, with mini-
mized costs for both women and health
services.
Nevertheless, RHD genotyping has to
be balanced against systematic anti-D
administration in a cost-effectiveness
OBSTETRICS
analysis. A rst analysis concluded that
fetal RHD genotyping in early pregnancy
did not prove to be an effective
cost-reduction strategy, regardless of
whether antenatal prophylaxis was
given.8,19,20 Recent Canadian data,
however, supports the feasibility of a
targeted antenatal anti-RhD prophylaxis
program that appears sufciently cost-
effective to warrant large-scale diffu-
sion.21 A similar conclusion was reached
in a Swedish model in which systematic
prophylaxis was shown to result in lower
costs and immunization risk when
compared with no routine antenatal
anti-D prophylaxis.22
In conclusion, RHD genotyping in
early pregnancy appears optimal because
this strategy option could be included in
a systematic screening program, thus
avoiding extra visits or further in-
vestigations in the event of fetal RhD-
negative status, all the more so because
continued anti-D administration to all
RhD-negative pregnant women appears
ethically unacceptable.23 For this reason,
the suggestion has been made by the
National Health Service24 of the United
Kingdom that RHD genotyping be
NOVEMBER 2016 American Journal of Obstetrics & Gynecology
Original Research
extended to all pregnant women across
the country. Yet, this would require a
simple and robust assay that is both cost-
effective and highly sensitive, given that
undetected immunization would bear
dramatic consequences. Moreover, the
ideal assay should yield a low rate of
nonreportable results to avoid system-
atic anti-D administration. RHD geno-
typing based on single-exon analysis may
prove to be a good balance between
safety and practicality if performed in
triplicate6 or quadruplicate (the herein
study), because this process was shown
to result in improved sensitivity in cell-
free fetal DNA analysis.17 Although the
lack of positive control for fetal DNA
presence appears undoubtedly prob-
lematic, optimal controls (without add-
ing supplementary steps, extra costs, and
considerable workload) still have to be
identied.25 n
Acknowledgments
The authors thank Martine Olivi, Sandrine Mou-
koury, Ramdane Mallek, and all members of the
molecular biology unit at Laboratoire Cerba for
technical assistance and Genevive Cremer for
language editing.
References
1. Lo YM, Corbetta N, Chamberlain PF, et al.
Presence of fetal DNA in maternal plasma and
serum. Lancet 1997;350:485-7.
2. Lo YM, Hjelm NM, Fidler C, et al. Prenatal
diagnosis of fetal RhD status by molecular
analysis of maternal plasma. N Engl J Med
1998;339:1734-8.
3. Gautier E, Benachi A, Giovangrandi Y, et al.
Fetal RhD genotyping by maternal serum anal-
ysis: a two-year experience. Am J Obstet
Gynecol 2005;192:666-9.
4. Rouillac-Le Sciellour C, Srazin V,
Brossard Y, et al. Noninvasive fetal RHD geno-
typing from maternal plasma: use of a new
developed free DNA fetal kit RhD. Transfus Clin
Biol 2007;14:572-7.
5. Bombard AT, Akolekar R, Farkas DH, et al.
Fetal RHD genotype detection from circulating
cell-free fetal DNA in maternal plasma in non-
sensitized RhD negative women. Prenat Diagn
2011;31:802-8.
6. Wikman AT, Tiblad E, Karlsson A, Olsson ML,
Westgren M, Reilly M. Noninvasive single-exon
fetal RHD determination in a routine screening
program in early pregnancy. Obstet Gynecol
2012;120:227-34.
7. Costa J-M, Giovangrandi Y, Ernault P, et al.
Fetal RHD genotyping in maternal serum during
the rst trimester of pregnancy. Br J Haematol
2002;119:255-60.
606.e4
Original Research OBSTETRICS
8. Benachi A, Delahaye S, Leticee N,
Jouannic J-M, Ville Y, Costa J-M. Impact of non-
invasive fetal RhD genotyping on management
costs of rhesus-D negative patients: results of a
French pilot study. Eur J Obstet Gynecol Reprod
Biol 2012;162:28-32.
9. Geifman-Holtzman O, Grotegut CA,
Gaughan JP. Diagnostic accuracy of noninva-
sive fetal Rh genotyping from maternal blood: a
meta-analysis. Am J Obstet Gynecol 2006;195:
1163-73.
10. Zhu Y-J, Zheng Y-R, Li L, et al. Diagnostic
accuracy of non-invasive fetal RhD genotyping
using cell-free fetal DNA: a meta-analysis.
J Matern Fetal Neonatal Med 2014;27:1839-44.
11. Cardo L, Garca BP, Alvarez FV. Non-inva-
sive fetal RHD genotyping in the rst trimester of
pregnancy. Clin Chem Lab Med 2010;48:
1121-6.
12. Akolekar R, Finning K, Kuppusamy R,
Daniels G, Nicolaides KH. Fetal RHD genotyping
in maternal plasma at 11-13 weeks of gestation.
Fetal Diagn Ther 2011;29:301-6.
13. Wagner FF, Flegel WA. RHD gene deletion
occurred in the Rhesus box. Blood 2000;95:
3662-8.
14. Singleton BK, Green CA, Avent ND, et al.
The presence of an RHD pseudogene contain-
ing a 37 base pair duplication and a nonsense
mutation in Africans with the Rh D-negative
blood group phenotype. Blood 2000;95:12-8.
15. Chitty LS, Finning K, Wade A, et al. Diagnostic
accuracy of routine antenatal determination of
fetal RHD status across gestation: population
based cohort study. BMJ 2014;349:g5243.
606.e5 American Journal of Obstetrics & Gynecology NOVEMBER 2016
16. Picchiassi E, Di Renzo GC, Tarquini F, et al.
Non-invasive prenatal RHD genotyping using
cell-free fetal DNA from maternal plasma: an
Italian experience. Transfus Med Hemother
2015;42:22-8.
17. Hromadnikova I, Houbova B, Hridelova D,
et al. Replicate real-time PCR testing of DNA in
maternal plasma increases the sensitivity of non-
invasive fetal sex determination. Prenat Diagn
2003;23:235-8.
18. Tiblad E, Taune Wikman A, et al. Targeted
routine antenatal anti-D prophylaxis in the pre-
vention of RhD immunisation: outcome of a new
antenatal screening and prevention program.
PLoS One 2013;8:e70984.
19. Szczepura A, Osipenko L, Freeman K.
A new fetal RHD genotyping test: costs and
benets of mass testing to target antenatal anti-
D prophylaxis in England and Wales. BMC
Pregnancy Childbirth 2011;11:5.
20. Hawk AF, Chang EY, Shields SM,
Simpson KN. Costs and clinical outcomes of
noninvasive fetal RhD typing for targeted pro-
phylaxis. Obstet Gynecol 2013;122:579-85.
21. Teitelbaum L, Metcalfe A, Clarke G,
Parboosingh JS, Wilson RD, Johnson JM. Costs
and benets of non-invasive fetal RhD determi-
nation. Ultrasound Obstet Gynecol 2015;45:
84-8.
22. Neovius M, Tiblad E, Westgren M,
Kublickas M, Neovius K, Wikman A. Cost-effec-
tiveness of rst trimester non-invasive fetal RHD
screening for targeted antenatal anti-D prophy-
laxis in RhD-negative pregnant women: a model-
based analysis (2015). BJOG 2016;123:1337-46.
ajog.org
23. Kent J, Farrell AM, Soothill P. Routine
administration of anti-D: the ethical case for of-
fering pregnant women fetal RHD genotyping
and a review of policy and practice. BMC
Pregnancy Childbirth 2014;14:87.
24. Soothill PW, Finning K, Latham T, Wreford-
Bush T, Ford J, Daniels G. Use of cffDNA to
avoid administration of anti-D to pregnant
women when the fetus is RhD-negative:
implementation in the NHS. BJOG 2015;122:
1682-6.
25. Scheffer PG, de Haas M, van der Schoot CE.
The controversy about controls for fetal blood
group genotyping by cell-free fetal DNA in
maternal plasma. Curr Opin Hematol 2011;18:
467-73.
Author and article information
From the Service de Gynecologie-Obstetrique et Mede-
cine de la Reproduction, Hopital Antoine Beclere,
Universite Paris Sud, Clamart, France (Drs Vivanti and
Benachi); the Laboratoire de Biologie Medicale
(Dr Huchet) et the Departement Mere-Enfant, Institut
Montsouris (Dr Cohen), Paris, France; the Service de
Gynecologie-Obstetrique, Hopital Necker-Enfants Mal-
ades, Paris, France (Dr Ville); the Departement de Biologie
Specialisee et de Genetique, Laboratoire CERBA, Saint-
Ouen lAumone, France (Dr Costa).
Received March 31, 2016; revised June 8, 2016;
accepted June 28, 2016.
J.-M.C. is an employee and shareholder of CERBA.
The other authors report no conflict of interest.
Corresponding author: Jean-Marc Costa, PharmD.
jmcosta@lab-cerba.com