Downloaded from http://rsob.royalsocietypublishing.

org/ on May 27, 2017

Over-expression of Plk4 induces

centrosome amplification, loss of primary
rsob.royalsocietypublishing.org
cilia and associated tissue hyperplasia
in the mouse
Paula A. Coelho1, Leah Bury1, Marta N. Shahbazi2, Kifayathullah Liakath-Ali1,3,
Research Peri H. Tate4, Sam Wormald4, Christopher J. Hindley5, Meritxell Huch5,
Cite this article: Coelho PA et al. 2015 Joy Archer6, William C. Skarnes4, Magdalena Zernicka-Goetz2
Over-expression of Plk4 induces centrosome and David M. Glover1
amplification, loss of primary cilia and
1
Department of Genetics, University of Cambridge, Downing Street, Cambridge CB2 3EH, UK
associated tissue hyperplasia in the mouse. 2
Department of Physiology, Development and Neuroscience, Physiological Laboratory, University of Cambridge,
Open Biol. 5: 150209. Downing Street, Cambridge CB2 3EG, UK
3
http://dx.doi.org/10.1098/rsob.150209 Centre for Stem Cells and Regenerative Medicine, Kings College London, Floor 28, Tower Wing, Guys Hospital,
Great Maze Pond, London SE1 9RT, UK
4
Wellcome Trust Genome Campus, the Wellcome Trust Sanger Institute, Cambridge, Hinxton CB10 1SA, UK
5
Henry Wellcome Building of Cancer and Developmental Biology, the Wellcome Trust/Cancer Research UK
Gurdon Institute, Tennis Court Road, Cambridge CB2 1QN, UK
Received: 22 October 2015 6
Department of Veterinary Medicine, University of Cambridge, Madingley Road, Cambridge CB3 0ES, UK
Accepted: 2 December 2015
To address the long-known relationship between supernumerary centro-
somes and cancer, we have generated a transgenic mouse that permits
inducible expression of the master regulator of centriole duplication, Polo-
Subject Area: like-kinase-4 (Plk4). Over-expression of Plk4 from this transgene advances
the onset of tumour formation that occurs in the absence of the tumour sup-
developmental biology/cellular biology
pressor p53. Plk4 over-expression also leads to hyperproliferation of cells in
the pancreas and skin that is enhanced in a p53 null background. Pancreatic
Keywords: islets become enlarged following Plk4 over-expression as a result of equal
primary cilia, Polo-like-kinase-4, skin, tumour expansion of a- and b-cells, which exhibit centrosome amplification. Mice
development, centrosome amplification, overexpressing Plk4 develop grey hair due to a loss of differentiated melano-
pancreas cytes and bald patches of skin associated with a thickening of the epidermis.
This reflects an increase in proliferating cells expressing keratin 5 in the basal
epidermal layer and the expansion of these cells into suprabasal layers. Such
cells also express keratin 6, a marker for hyperplasia. This is paralleled by a
Author for correspondence: decreased expression of later differentiation markers, involucrin, filaggrin
David M. Glover and loricrin. Proliferating cells showed an increase in centrosome number
e-mail: dmg25@hermes.cam.ac.uk and a loss of primary cilia, events that were mirrored in primary cultures
of keratinocytes established from these animals. We discuss how repeated
duplication of centrioles appears to prevent the formation of basal bodies
leading to loss of primary cilia, disruption of signalling and thereby aberrant
differentiation of cells within the epidermis. The absence of p53 permits cells
with increased centrosomes to continue dividing, thus setting up a neoplastic
state of error prone mitoses, a prerequisite for cancer development.

1. Introduction
The centrosome was first described almost simultaneously by Edouard van
Beneden working in Liege and Theodor Boveri in Munich in 1887 (reviewed
in [1]) as a structure at the poles of the mitotic spindle that persisted through
the life cycle of the cell. Towards the end of the nineteenth century tumour
cells were already observed to have multiple spindle poles, and now we
know supernumerary centrosomes to be present in a wide range of solid and

& 2015 The Authors. Published by the Royal Society under the terms of the Creative Commons Attribution
License http://creativecommons.org/licenses/by/4.0/, which permits unrestricted use, provided the original
author and source are credited.
 Downloaded from http://rsob.royalsocietypublishing.org/ on May 27, 2017
haematological tumours, including pancreatic, ovarian, colon
and prostate cancer, multiple myeloma, non-Hodgkins and
Hodgkins lymphoma, and acute and chronic myeloid leu-
kaemia [2 7]. Abnormalities have been detected at both
early [810] and advanced stages of disease where they
generally indicate poor prognosis [11]. Amplified centrosomes
also correlate with metastasis of head and neck, prostate and
breast tumours [1214]. However, despite these long-known
associations, the contribution of centrosomal amplification to
oncogenesis remains unclear.
Centrosome number is normally tightly controlled within
the cell division cycle. At the core of centrosomes lie the nine-
fold symmetrical centrioles. Cells enter mitosis with two
pairs of orthogonally arranged centrioles that separate to
form the two centrosomes at the poles of the spindle. The
centrioles disengage upon the completion of mitosis
and enable both individual centrioles to initiate the dupli-
cation process. Centriole duplication is controlled by
Polo-like-kinase-4 (Plk4) that phosphorylates the centriole
protein Stil/Ana2 allowing it to recruit Sas6, the core com-
ponent of the centriole cartwheel [15 18]. Elevating Plk4
expression through its ectopic expression or by eliminating
the SCF ubiquitin-protein ligase required for Plk4 destruction
results in the formation of multiple centrosomes [19 23].
The loss of centrioles has different consequences in differ-
ent organisms and tissues. Drosophila can tolerate centriole
loss in some, but not all, tissues, allowing defective cell div-
isions to continue [23 27]. However, centrioles also serve
as basal bodies, the foundations of cilia and flagellae
[28,29], and so are essential to fashion the flys sensory
organs for correct physical coordination [24,30]. In mamma-
lian cells, the physical removal of centrosomes prevents cell
cycle progression but eventually centrioles reform by a
de novo pathway and the cell cycle resumes [31 33]. In the
mouse, there is a greater reliance on centrioles to generate pri-
mary cilia essential for many types of cell signalling.
However, unlike mutants that lack cilia, mutant embryos
deficient for the centriole component Sas4 and thereby lack-
ing centrioles exhibit extensive apoptosis associated with
elevated p53 expression [34]. Apoptosis was rescued in
embryos double mutant for Sas4 and p53, thus identifying
a p53-dependent apoptotic pathway triggered by loss of cen-
trioles. This has been further supported by experiments to
eliminate Plk4 activity from cultured cells using either an
auxin-inducible degradation system or pharmacological inhi-
bition of the enzyme using a small molecule, centrinone
[33,35]. In both these cases, loss of Plk4 activity results in
loss of centrioles and a p53-dependent arrest of cell cycle
progression, the mechanism of which is not understood.
The consequences of Plk4 over-expression also vary in
different organisms and in different cell types. Over-expression
or stabilization of Plk4 in either cultured Drosophila cells or
mammalian cells leads to multiple centrosomes [19,2123,36]
and in fertilized Drosophila eggs drives the formation of thou-
sands of centrioles at the expense of the normal progression of
nuclear division cycles [20]. Strikingly this also happens in
unfertilized eggs in which centrioles have been naturally elimi-
nated during oogenesis and in which there is no incoming
sperm to provide a basal body. Thus, in this circumstance, cen-
triole formation is entirely driven by Plk4. Moreover, elevated
expression of Plk4, and indeed perturbation of centrosome
function through several routes, can promote tumourigenesis
in flies [37,38].
Correct centrosome behaviour is also required for the devel- 2
opment of cerebral cortex of the mammalian brain. Deficiency
rsob.royalsocietypublishing.org
of any of several centrosome components including Plk4 results
in microcephaly [3941]. To study the effects of elevating Plk4
expression in the mouse brain, Marthiens et al. [42] generated
transgenic animals in which Plk4 expression could be activated
in the central nervous system in response to a tissue-specific
Cre-mediated recombination event. This led to a microce-
phaly-like condition that was ascribed to the poor clustering
of amplified centrosomes leading to abnormal mitoses and con-
sequent apoptosis. Cell death could be overcome by removing
p53 function, leading to the accumulation of aneuploidy cells
Open Biol. 5: 150209
that would differentiate rather than proliferate.
We wished to examine the consequences of elevated Plk4
expression, and thereby centrosome amplification, in other
tissues in the mouse. To have temporal control on the over-
expression of Plk4, we have developed a mouse line in
which Plk4 is under the control of a doxycycline-inducible
promoter. Induction of Plk4 expression in this mouse leads
to an early onset of tumour formation in p53 null mice,
behavioural defects suggesting abnormalities of brain devel-
opment in agreement with a previous study [39], and
hyperproliferation of cells in the pancreas and in the skin.
Here we focus upon characterizing defects in the skin of these
animals and show that elevated Plk4 leads to amplification of
centrosomes and loss of primary cilia. Together this leads to
both hyperproliferation and uncontrolled differentiation of
the basal epidermis. We discuss how these phenotypes can
arise and how we might account for the enhancement of these
phenotypes when the p53 gene is deleted.
2. Results
2.1. Elevated Plk4 expression dramatically advances the
onset of tumour formation in p53-deficient mice
Centrosome amplification has been identified as a marker of
poor prognosis of aggressive, drug-resistant tumours in breast,
pancreatic and colorectal cancer patients [43,44], but the relation-
ship of centriole amplification to oncogenesis is uncertain. To
address this in a model system, we generated a transgenic
mouse that allows the inducible over-expression of wild-type
mPlk4, the master regulator of centriole duplication. The
vector comprised the reverse-tetracycline-controlled transactiva-
tor (rtTA) linked to a tetracycline-responsive element (TRE)
regulating expression of wild-type mPlk4 and was targeted to
the ROSA26 locus. This enabled the inducible and reversible
over-expression of Plk4 at any time of development in the result-
ing transgenic animals or in cultured cells derived from them
(figure 1a). We designate the homozygous transgenic mouse
harbouring the inducible extra copy of wild-type Plk4 as
Plk4OE/ Plk4OE.
As p53 was reported to overcome both the cell cycle arrest
associated with loss of centrioles resulting from deletion of
Sas4 or degradation or inhibition of Plk4 [3335] and
the cell death resulting from elevated Plk4 expression in the
mouse brain [42], we were prompted also to determine the
consequences of centrosome amplification induced by Plk4
over-expression in a p53 knockout (KO) background (from
now on p53KO). These mice show accelerated tumour for-
mation, behavioural defects and cell hyperproliferation
associated with elevated Plk4 expression in several tissues
 Downloaded from http://rsob.royalsocietypublishing.org/ on May 27, 2017

(a) (b) survival curve (c) malignant lymphomas sarcomas 3

Plk4 transgene 100
100

rsob.royalsocietypublishing.org
Rosa26 Rosa26
locus 5 SA rtTA TRE mPLK4 puro locus 3
Plk4OE /Plk4OE 80

% of tumour free

% of tumours
Plk4OE/Plk4OE (+DOX)
DOX 60
50 Plk4OE/Plk4OE;
p53KO/p53KO 40
Rosa26
locus 5 SA rtTA TRE mPLK4 puro
Rosa26
locus 3 Plk4OE/Plk4OE;
p53KO/p53KO (+DOX) 20
**p < 0.01
+DOX
0 0
0 5 10 15 20 25 30 35 Plk4OE /Plk4OE; Plk4OE /Plk4OE;
time (weeks) p53KO/p53KO p53KO/p53KO (+DOX)

(d ) thymus (e) lymphoma (f) kidney (g) heart

Open Biol. 5: 150209

Plk4OE/Plk4OE: p53KO/p53KO

Li
Ap
Vn *
Li

Li
50 mm 80 mm 120 mm 400 mm

(l) 1 pair of 2 pairs of

(h) +DOX (i) +DOX ( j) +DOX 50 centrioles centrioles
Plk4OE/Plk4OE; p53KO/p53KO

>2 pairs of
centrioles
G 40
M
G MM

% of cells
30
G

20

10
250 mm MM 100 mm 50 mm

DNA g-tubulin DNA Ac-tubulin DNA g-tubulin

(k)
(m) mitotic progression (n) abnormal mitotic cells
Plk4OE /Plk4OE; p53KO/p53KO

35
monopolar
70 prometaphase
30
60 tripolar
prometaphase 25
bipolar 10 mm 10 mm monopolar tripolar 10 mm prometaphase
% of cells

% of cells

50
metaphase 20 anaphase
DNA Ac-tubulin DNA g-tubulin DNA g-tubulin 40 missegregration
anaphase
15
30
20 10

10 5
10 mm 10 mm 10 mm 0 0
chromosome lagging aneuploidy

Figure 1. Tumour formation following tetracycline-inducible conditional Plk4 expression. (a) Doxycycline associates with the rtTA that binds the TRE, leading to transcriptional
activation of Plk4. (b) Tumour incidence in Plk4 transgenic mice in wild-type background (Plk4OE/Plk4OE) or p53 null background (Plk4OE/Plk4OE; p53KO/p53KO) with or without
treatment with doxycycline (DOX) to promote Plk4 over-expression. The differences observed between Plk4OE/Plk4OE; p53KO/p53KO (n 24) and Plk4OE/Plk4OE; p53KO/p53KO
DOX (n 14) survival curves are significant (**p , 0.01; Students t-test). (c) Proportions of sarcomas and lymphomas. Note that animals that developed sarcomas also
showed lymphomas. (d) Architecture of thymus and lymph nodes is obliterated and replaced by sheets of large, round cells with vesicular nuclei (Vn, black arrows). Apoptotic
cells were also present (Ap, black asterisk). (e) Multicentric high-grade large cell lymphoma. (f) Kidney has normal architecture but contains multifocal cortical interstitial and
sub-capsular infiltrates of large lymphocytes (Li). (g) Large sheets of lymphocytes (Li) attached to pericardial surface of heart wall. (hj) These tumours are sarcomas isolated
from Plk4OE/Plk4OE; p53KO/p53KO mice. Typically, large masses of cells extended into muscle fibre bundles (M) and into attached adipose surrounding nerves and blood vessels.
(i,j) Higher magnifications of sarcomas showing pleomorphic and anaplastic cells. Examples of giant (G) or multinucleated (MM) cells are indicated. These tumours were found
close to the front limbs with high percentage of mitotic cells (an average of 510/40 field). (k) Paraffin section of samples from sarcomas where stained to reveal g-tubulin or
acetylated-tubulin (green). DNA is shown in red. Three different samples were analysed and showed a high mitotic index (8.55 + 2.53%, n 1400 cells/sample) in agree-
ment with histological analysis made after H&E staining. (l ) Proportion of cells that show one pair or two pairs of centrioles per cell or show centriole/centrosome amplification
(more than 2 pairs of centrioles). (m) Mitotic progression in sarcomas from cryostat sections. (n) Proportions of mitotic abnormalities in sarcomas. Quantification in
(ln) performed in three different sarcomas; 5001000 cells analysed per sarcoma.

including the pancreas and skin. Here we describe some key parallel studies on the viability of the Plk4OE/Plk4OE line
features of mice that are expressing elevated levels of Plk4 with or without the addition of doxycycline (DOX) to pro-
and focus upon how this affects development of the skin mote Plk4 over-expression. Plk4OE/Plk4OE and Plk4OE/
and pancreas. Plk4OE (DOX) mice remained healthy during the period
We first wished to address the effects of Plk4 over- of study. Litter sizes were reduced in Plk4OE/Plk4OE
expression upon tumour formation and so carried out (DOX), but tumour formation was not observed during
 Downloaded from http://rsob.royalsocietypublishing.org/ on May 27, 2017
the first 35 weeks (figure 1b). We found that approxima-
tely one half of Plk4OE/Plk4OE; p53KO/p53KO mice on a
doxycycline-free diet developed tumours by the age of 20
weeks and all had tumours by 35 weeks. This time course
of tumour appearance parallels previous reports for p53
homozygous null mice [45]. Interestingly, when Plk4
over-expression was induced in the Plk4OE/Plk4OE; p53KO/
p53KO mice by the addition of DOX from eight weeks
onwards, tumour formation was accelerated; half of the
mice developed tumours by 15 weeks and all died within
26 weeks (red line; figure 1b).
The tumours arising in Plk4OE/Plk4OE; p53KO/p53KO mice
were highly similar whether or not doxycycline was adminis-
tered and comprised mainly lymphomas and sarcomas
(figure 1c). The lymphomas invaded a variety of tissues
including the thymus, kidney and heart (figure 1dg). How-
ever, a wide variety of sarcomas arose more frequently and
earlier after Plk4 over-expression. All animals that succumbed
to sarcomas also had lymphomas. The sarcomas were typically
localized close to the front limbs and developed very rapidly
within one week. These tumours had highly pleomorphic
and anaplastic cells that displayed a high incidence of mitosis
(an average of 510 mitotic figures per 40 field) suggesting
they are highly malignant (figure 1hj) and centrosome amplifi-
cation was detected in 34.79 + 5.48% of cells from sarcomas
(figure 1l ). The mitotic figures in these Plk4 over-expressing
tumour cells were typically bipolar with multiple centrosomes
at the poles (71%). Centrosome clustering was lost in 12.7 +
10.7% of prometaphase cells that were multipolar (figure 1kn).
Although we failed to detect any multipolar anaphases, we
found chromatid lagging in 23.4 + 10.6% of anaphase figures
(figure 1n). It will be of future interest to identify and characterize
the mesenchymal cells in which these tumours arise.
We conclude that Plk4 over-expression significantly
advances the onset of tumour formation in p53 null mice and
that this is associated with an increased frequency of mitoses
that generate aneuploid cells characteristic of many tumours.
2.2. Elevated Plk4 expression induces hyperproliferation
of cells in the pancreas
The above findings raised the question of whether we could
identify any tissues exhibiting common cellular changes
that could be associated with events anticipating tumour
development particularly in the absence of p53 function.
Systematic histological examination of the tissues of
Plk4OE/Plk4OE mice revealed that although pancreases had
normal lobular architecture with intact acinar cell clusters,
there was enlargement of the islets of Langerhans when
over-expression of Plk4 was induced (figure 2ac,e). The
diameter of the islets was increased by approximately 30%
and the density of cells within the islets more than doubled
under these conditions (figure 2ef ). To determine whether
this reflected differential proliferation of the major two endo-
crine cell types, we stained pancreas sections with antibodies
against glucagon and insulin to detect a- and b-cells, respect-
ively. This revealed a proportionate increase in the number
of both glucagon- and insulin-positive cells following induc-
tion of Plk4 over-expression (82.8 + 6.7% b-cells versus
79.8 + 6.0% in Plk4OE/Plk4OE islets without and with DOX,
respectively; figure 2df ). Because loss of p53 is known
to exacerbate the effects of both decreased and increased
centrosome number [33,35,42], we also examined the effects 4
of Plk4 over-expression on the pancreas in p53 null mice.
rsob.royalsocietypublishing.org
Plk4 over-expression now resulted in a more than doubling
in the diameters of the islets although the cell density was
not as high as when p53 was present (figure 2e,f ). Again,
there was an increase in both a- and b-cells in similar pro-
portions (89.8 + 3.2% b-cells versus 85.5 + 3.1% in Plk4OE/
Plk4OE; p53KO/p53KO without and with DOX). The size of
the islets directly correlated with the levels of Plk4 transcripts
(figure 2g) and immunostaining of the islets revealed elev-
ated Plk4 protein following treatment of the mice with
doxycycline (figure 2g,h,j) and an increase in centrosome
Open Biol. 5: 150209
number (figure 2h,i). Plk4 was present in punctate bodies
corresponding to centrosomes, and these increased in the
number from one such body in non-doxycycline-treated,
p53 / cells to four or more in p53 null cells over-
expressing Plk4 (figure 2j ). Thus, elevated expression levels
of Plk4 and higher centrosome numbers correlate with
hyperproliferation of a- and b-cells in the pancreas that is
exacerbated in the absence of p53.
2.3. Elevated Plk4 over-expression affects melanocyte
differentiation
A striking feature of the Plk4OE/Plk4OE mice was skin lesions
that include alopecia at the time of weaning followed by
regrowth of hair around one month after birth. Animals
that did not lose hair had grey coats (figure 3a,b). Most of
the grey hair did not persist and there was a regain of
some black fur within the first month. This phenotype led
us to examine the effects of Plk4 over-expression upon
melanocytes and the melanin pigment produced by
them. Melanocytes are located in the interfollicular epidermis
and within hair follicles, and differentiate from neural-
crest-derived melanocyte stem cells (MSCs). These MSCs
are intermingled with hair follicle stem cells in the bulge
and the hair germ. Differentiated melanocytes produce and
transfer melanin to the adjacent keratinocytes during the
anagen (growth) phase of the cyclical process of hair regener-
ation (reviewed in [46]). Using Fontana-Masson staining, we
found a reduction of melanin granules in the bulge of
2-day-old Plk4OE/Plk4OE mice and their apparent absence
from follicles, both in a wild-type or p53KO/p53KO back-
ground (figure 3d). We also stained skin sections to
examine melanin distribution at 20 days. This revealed a
reduction in melanin in Plk4OE/Plk4OE mice irrespective of
whether animals were treated with doxycycline and that
was accentuated if the animals were also null for p53
(figure 3e). As an alternative way to assess melanin pro-
duction, we determined the relative levels of transcripts for
tyrosinase, the enzyme catalysing the first step in melanin
synthesis and which is expressed in melanocytes [47]. Tyrosi-
nase mRNA was reduced both in untreated Plk4OE/Plk4OE
mice that show some elevation of basal Plk4 mRNA levels
and following doxycycline treatment to induce Plk4
expression. Tyrosinase transcripts were further reduced in a
p53 null background (figure 3c). Taken together these obser-
vations point to reduced melanin biosynthesis in response to
elevated Plk4, an effect enhanced in the absence of p53 so
accounting for the grey hair of the animals.
We then wanted to determine whether the grey hair was a
consequence of reduced melanin production or a reduced
 Downloaded from http://rsob.royalsocietypublishing.org/ on May 27, 2017

+DOX 5
+/+ Plk4OE/Plk4OE Plk4OE /Plk4OE; p53KO/p53KO
I
(a) (b)

rsob.royalsocietypublishing.org
(c)

AC
AC l

AC
l
l

AC
50 mm AC 50 mm 150 mm

Open Biol. 5: 150209

Plk4OE/Plk4OE Plk4OE /Plk4OE; p53KO/p53KO

(d ) + DOX + DOX
glucagoninsulinDNA

50 mm 50 mm 50 mm 50 mm

(i) Plk4OE/Plk4OE Plk4OE /Plk4OE; p53KO/p53KO

(e) (f)
300 ** +DOX +DOX
DNA E-cadherin

250 160 **
diameter of islets of

no. islet cells 100 mm2

Langerhans (mm)

200
120
Cep 192

** **
150 *
80 10 mm 10 mm 10 mm 10 mm
100
40
50
Cep192

0 0
(g) 14
***
relative Plk4 mRNA levels

12
10 Plk4OE /Plk4OE
in pancreas

8 Plk4OE /Plk4OE +DOX

6 ** Plk4OE /Plk4OE; p53KO/p53KO
4 Plk4OE/Plk4OE; p53KO/p53KO ( j) Plk4OE/Plk4OE Plk4OE /Plk4OE; p53KO/p53KO
2 +DOX
+DOX +DOX
0
(h)
DNA Plk 4

100

80
*
60
% of cells

*** *** ***

40 10 mm 10 mm 10 mm 10 mm

20

0
1 pair of 2 pairs of >2 pairs of
20 dots dots dots

Figure 2. Plk4 over-expression leads to hyperplasia of the pancreatic islets. (ac) Haematoxylineosin-stained sections of mouse pancreas. (a) Control (/) pancreas
shows normal acinar cells (AC), islets of Langerhans (I) and lobular architecture. (b) Pancreas of Plk4OE/Plk4OE (DOX) male has normal lobular architecture, intact acinar
cell clusters within lobes and islets of variable size. Lymphocytes are seen surrounding islets and between clusters of acinar cells (black arrows). (c) Pancreas from a
Plk4OE/Plk4OE; p53KO/p53KO male showing normal lobular architecture and very large islets. (d) Immunofluorescence of pancreas cryosections showing b-cells detected by
anti-insulin (red) and a-cells detected by anti-glucagon (green) in islets. DNA is blue. (e) Diameter of islets (mean + s.d., n 12) in mice of indicated genotypes
without or with (DOX) doxycycline treatment. (f) Density of insulin or glucagon-positive cells (mean + s.d., n 12) in islets of indicated genotypes without and
with doxycline (DOX) treatment. (g) Q-RT-PCR analysis of relative levels of Plk4 transcripts in pancreatic extracts of indicated genotypes without or with (DOX)
doxycycline treatment. Average from three biological samples (three replicates for each). (h) Proportion of cells showing 1 (one pair of dots), 2 (two pairs of dots)
centrosomes or centrosome amplification (more than two pairs of dots) in pancreatic islets. Centrosomes quantified by counting punctate Cep192 or g-tubulin staining.
(i) Pancreas cryosections stained to reveal E-cadherin (green), centrosome component Cep192 (red in merge; white in monochrome) and DNA (blue). Cell borders
identified by E-cadherin outlined in monochrome image. Note: increase in the number of centrosomes/cell following treatment with doxycycline (DOX). ( j) Pancreas
cryosections stained to reveal Plk4 (green) and DNA (blue). Note: increase in the number per cell and size of anti-Plk4-stained dots following treatment with doxycycline
(DOX). Significance was determined by Students t-test. *p , 0.05, **p , 0.01, ***p , 0.005.
 Downloaded from http://rsob.royalsocietypublishing.org/ on May 27, 2017

(a) (b) (c) ** ** ***

6
3.0

relative mRNA levels in skin

2.5

rsob.royalsocietypublishing.org
2.0

1.5
tyrosinase
1.0
** *** *** Plk4
0.5

+/+

Plk4OE/PlkOE

Plk4OE/PlkOE
+DOX

Plk4OE/PlkOE;
p53KO/p53KO

Plk4OE/PlkOE;
p53KO/p53KO
+DOX
PlkOE/PlkOE Plk4OE/Plk4OE; p53KO/p53KO
(d) +/+
+DOX +DOX

Open Biol. 5: 150209

2 days

50 m 50 m 50 m 50 m 50 m

Plk4OE/Plk4OE Plk4OE/Plk4OE; p53KO/p53KO

(e) +/+ +DOX +DOX
20 days

50 m 50 m 50 m 50 m 50 m

+/+ Plk4OE/Plk4OE
(f) DNAMITF (g) DNAMITF DNAMITF +DOX
KITDCT MITFKIT KIT DCT KITDCT MITFKIT KIT DCT KITDCT MITFKIT KIT DCT

Bu Bu Bu

10 m 10 m 10 m

Plk4OE/Plk4OE; p53KO/p53KO
(h) DNAMITF DNAMITF +DOX (i)
KITDCT MITFKIT KIT DCT KITDCT MITFKIT KIT DCT
8 +/+
bulb
MIFT+c-KIT+DCT+ cells/

6 Plk4OE/PlkOE
*
** Plk4OE/PlkOE
4 +DOX
Plk4OE/PlkOE;
Bu 2 p53KO/p53KO
Bu
Plk4OE/PlkOE;
0
10 m 10 m p53KO/p53KO
+DOX

Figure 3. Plk4 over-expression leads to loss of hair and its pigmentation. (a) Plk4OE/Plk4OE; p53KO/p53KO mouse exhibiting typical hair loss phenotype. (b) Plk4OE/Plk4OE;
p53KO/p53KO mice showing varying degrees of greying hair. (c) Q-RT-PCR analysis of Plk4 and tyrosinase transcripts in extracts of total back skin from mice of indicated
genotypes and treatment indicating mean + s.e. for three independent biological samples and three replicates/sample (DOX indicates doxycycline treatment).
(d) Fontana-Masson staining of cryosections of P2 back skin from mice of indicated genotypes. DOX indicates treatment with doxycycline. (e) Fontana-Masson staining
of P20 back skin cryosections from mice of indicated genotypes and treated with doxycycline where indicated (DOX). (f) Anagen hair follicle in wild-type back skin
immunostained to reveal melanocyte markers KIT (red in merge; white, monochrome), MITF (green) and DCT (blue in merge; white in monochrome). DNA is represented
in white. Differentiated melanocytes identified by triple KITMITFDCT staining. (g) P2 back skin from Plk4OE/Plk4OE mice without or with Plk4 over-expression
(DOX) showing anagen hair follicle immunostained to reveal melanocyte markers KIT (red in merge; white in monochrome), MITF (green) and DCT (blue in
merge; white in monochrome). DNA is white in merge. Note reduction in differentiated melanocytes identified by triple KITMITFDCT-positive immunostaining.
(h) P2 back skin from Plk4OE/Plk4OE; p53KO/p53KO mice without or with Plk4 over-expression (DOX) showing hair follicles immunostained for melanocyte markers
KIT (red in merge; white in monochrome), MITF (green) and DCT (blue in merge; white in monochrome). DNA is white in merge. Differentiated melanocytes
(KITMITFDCT) are reduced in Plk4OE/Plk4OE; p53KO/p53KO (DOX) mice. (i) Mean numbers + s.d. of differentiated melanocytes (KITMITFDCT) per bulb in
indicated genotypes and treatments. Significance determined by Students t-test. *p , 0.05, **p , 0.01 and ***p , 0.005.
 Downloaded from http://rsob.royalsocietypublishing.org/ on May 27, 2017
number of melanocytes undergoing activation/differentiation.
To this end, we carried out immunofluorescence upon cryosec-
tions of the back skin of animals 2 days after birth (P2) to
detect the MSC population undergoing differentiation
(figure 3fi). The tyrosine kinase receptor, c-KIT and dopa-
chrome tautomerase (DCT) are hallmarks to identify the MSC
population (reviewed in [46]). MSCs co-expressing Kit and
microphthalmia-associated transcription factor (MITF), the
master regulator of melanocyte differentiation (reviewed in
[46]), identify the differentiated melanocyte subpopulation. We
found a reduced number of KITMITFDCT cells in the
bulge when Plk4 was over-expressed, particularly in a p53KO/
p53KO background (figure 3i). This population is responsible
for pigmentation of growing hair. However, the number of
MSCs (expressing DCT and KIT) in the bulge that will renew
the melanocyte population in subsequent hair cycles did not
vary significantly between the different genotypes and treat-
ments (an average of 4.355 KITDCT cells per bulge). This
strongly suggests that Plk4 over-expression compromises
melanocyte differentiation and subsequent melanin synthesis.
2.4. Plk4 over-expression affects cell proliferation
in epidermis
The above experiments also revealed a thickening of the epi-
dermis and some apparently invaginated hair follicles when
Plk4 levels were elevated in Plk4OE/Plk4OE; p53KO/p53KO
mice. Thus, we decided to explore the epidermal phenotype
in greater detail. The epidermis is a stratified structure con-
taining self-renewing stem cells within the basal layer that
express keratins 5 and 14 (K5, K14) and that through
delamination and/or asymmetrical cell division give rise to
non-proliferative, spinous and granular layers (expressing
keratins 1 and 10 (K1, K10) and Involucrin) and outer
layers of terminally differentiated stratum corneum cells
(reviewed in [48]). The increased cell density within the
epidermal basal layer of Plk4 over-expressing samples
(figure 3e) prompted us to ask whether cell proliferation
was affected as a result of increased levels of Plk4.
To address whether there was an increased number of
cycling cells within the basal epidermis, we analysed skin
from 2-day-old pups (P2) and 20 day-old pups (P20) using
Ki67 as a marker for proliferating cells (figure 4a c). In
wild-type skin (/), Ki67-positive cells are solely found
in the basal layer, as these are the only cycling cells in unper-
turbed circumstances (figure 4a). We found Ki67-positive
cells in the basal layer did not increase significantly following
doxycycline treatment of Plk4OE/Plk4OE mice (n 300/
sample; 59.5 + 19.4% in Plk4OE/Plk4OE; p53KO/p53KO
versus 63.9 + 9.4% in control (/)). However, in the skin
of Plk4OE/Plk4OE; p53KO/p53KO mice, doxycycline treatment
also led to the appearance of Ki67-positive cells in the supra-
basal layers (n 425 cells/sample, 7.40 + 3.90%) within 2
days after birth (asterisk in figure 4a). We also examined
the distribution of keratin 6 (K6), which is normally restricted
to the hair follicles but is also found in the interfollicular epi-
dermis in conditions of hyperplasia the epidermis [49,50].
Strikingly, we found that K6 was widely expressed in basal
and suprabasal cells after induction of Plk4 expression in
either a wild-type or p53 null background (arrowheads in
figure 4a). Whereas in normal skin there is a clear separation
between basal (K5-positive cells) and suprabasal (K10-
positive cells) layers, induction of Plk4 expression in either 7
a wild-type or p53 null background led to an expansion of
K5-positive cells. This was particularly evident in Plk4OE/
rsob.royalsocietypublishing.org
Plk4OE; p53KO/p53KO doxycycline-treated mice at 20 days
(figure 4d), where both Ki67- and K5-positive cells were
significantly expanded to suprabasal layers and K6 staining
extended to most of the epidermis and hair follicles. There
was also an increase in the number of cells expressing the
early differentiation marker, K10.
The above findings were mirrored by the quantitation of
mRNA levels for these markers. Over-expression of Plk4 in
a p53 null background led to a notable increase in the
Open Biol. 5: 150209
expression of the basal marker K14 and a reduction in
mRNA levels for involucrin, filaggrin and loricrin, markers
of late stages of differentiation figure 4b). We also found a
reduction of the transcript levels of DNp63, a p53 family
member that controls expansion of epidermal cells and pro-
motes differentiation [51] (figure 4c). This, together with a
similar reduction in expression of the Cdk inhibitor p21
(mp21; figure 4c), is compatible with delayed terminal dif-
ferentiation [52 54]. In agreement, with these results,
percentage of Ki67-positive cells is significantly increased in
Plk4OE/Plk4OE; p53KO/p53KO doxycycline-treated mice at
20 days, suggesting increased proliferation sustains the
higher number of suprabasal cells in these samples compared
to control (figure 4e,f ).
Taken together our findings indicate that elevated
expression of Plk4 results in hyperproliferation of the epidermis.
Specifically, we observed an expansion of basal progenitor cells
in suprabasal layers and a decreased expression of genes associ-
ated with terminal differentiation. These observations accord
with the thickening of the epidermis and disrupted hair follicle
morphology as a consequence of Plk4 over-expression.
2.5. Plk4 over-expression induces centriole over-
duplication and primary cilia disappearance
in epidermis
We next considered whether the alterations we had observed
in the regulation of cell proliferation and differentiation in the
epidermis could reflect changes mediated by elevated Plk4
upon the centrosomes and/or primary cilia, both of which
rely upon centrioles for their correct formation and function.
To this end, we stained skin sections to reveal acetylated
a-tubulin, a marker of the primary cilia, and Plk4 itself,
which associates with centrioles, either in basal bodies or cen-
trosomes. In the skin of wild-type mice, the great majority of
cells of the basal epidermis showed bodies of Plk4 staining
associated with the base of single primary cilia (figure 5a).
Over-expression of Plk4 during development led to increased
numbers of centrosomes in the basal epidermis and a loss of
primary cilia (figure 5a,c). Loss of primary cilia and mis-posi-
tioning of centrosomes was particularly dramatic when Plk4
over-expression occurred in a p53 null background (12.2 +
4.5% of cells with primary cilia in Plk4OE/Plk4OE; p53KO/
p53KO (DOX) versus 35.3 + 4.9% in Plk4OE/Plk4OE;
p53KO/p53KO; figure 5a,c). We were still able to observe
some residual primary cilia in hair follicles even though
these cells had extra centrioles (figure 5b). However, consist-
ently, only a single primary cilium was formed (figure 5b),
and these cilia were longer than those in wild-type cells
(figure 5d). Thus, the effects of elevated Plk4 may differ in
 Downloaded from http://rsob.royalsocietypublishing.org/ on May 27, 2017

(a) +DOX +DOX 8

2 days
Wt Plk4OE/Plk4OE Plk4OE/Plk4OE Plk4OE/Plk4OE; p53KO/p53KO Plk4OE/Plk4OE; p53KO/p53KO

rsob.royalsocietypublishing.org
Epi Epi

g-tubulin
Epi B Epi B
Sp
DNA

Ki67
B B Epi *
Der Der
B
Der Der
Der
HF 30 m 30 m 30 m 30 m 30 m
E-cadherin K6 K5

B
SB B
Der B
B B Der
Der Der
Der

30 m HF 30 m HF 30 m 30 m 30 m
HF HF

Open Biol. 5: 150209

HF

B
E-cadherin K6

Der
B B
Der Der

HF HF HF HF
g-tubulin

Sp
DNA

Sp
K10

Sp Sp Sp
30 m B 30 m 30 m 30 m B 30 m
B B B

(b) 3.5 (c)

1.4
* * Plk4OE/Plk4OE Plk4OE/Plk4OE
3.0 Plk4OE/Plk4OE (+DOX) Plk4OE/Plk4OE (+DOX)
1.2
* Plk4OE/Plk4OE; p53KO/p53KO Plk4OE/Plk4OE; p53KO/p53KO
relative mRNA levels

2.5 Plk4OE/Plk4OE; p53KO/p53KO(+DOX) Plk4OE/Plk4OE; p53KO/p53KO(+DOX)

1.0
relative mRNA levels
2.0 *
0.8

1.5
* 0.6
* *
1.0
* 0.4
*
0.5 **
0.2

0 0
Plk4 K5 K14 K1 K10 Fla Inv Loc mp21 DNP63
basal early late differentiation genes
(d) 20 days
DNA g-tubulin Ki67 E-cadherin K6 K5 E-cadherin K6

control control control control

(e) 2.5 *
Sp Plk4OE/Plk4OE
2.0
basal/suprabasal

B p53KO/p53KO
B
Der 1.5
Der
Plk4OE/Plk4OE; p53KO/p53KO

Plk4OE/Plk4OE
1.0 p53KO/p53KO
+DOX
0.5
HF
HF 30 m 30 m HF HF 30 m HF 30 m
0

+DOX +DOX +DOX +DOX

( f ) 70 Plk4OE/Plk4OE
p53KO/p53KO
% of cells ki67+

Sp
50
B Plk4OE/Plk4OE
B B
Der p53KO/p53KO
Sp Der Der 30
+DOX

B 10 *

30 m HF 30 m 0
30 m 30 m HF HF HF HF HF basal supra
basal

Figure 4. Plk4 over-expression leads to hyperproliferation and abnormal differentiation of cells in suprabasal layers. (a) Immunofluorescence of cryosections of P2
back skin from mice of indicated genotypes treated with doxycycline as indicated (DOX). Note: Ki67 reveals proliferating cells in basal and suprabasal (white
asterisk) epidermal layers of Plk4OE/Plk4OE; p53KO/p53KO (DOX) mice; K6, restricted to hair follicles in controls, is present in epidermis following Plk4 induction
(arrowheads). Basal layer marker K5 present throughout epidermis following Plk4 induction; distribution of early differentiation marker, K10 not affected and does
not reveal differences between the experimental samples and the control at this stage. B, basal; Der, dermis; Epi, epidermis; Sp, suprabasal; dotted lines, dermo-
epidermal border. (b) Quantitative RT-PCR assays for levels of indicated transcripts in total back skin from 2 day pups of indicated genotypes and treatment (n 3
and three replicates for each sample). Note: elevated Plk4 transcripts consistently correlate with low expression of late differentiation genes filaggrin (Fla), involucrin
(Inv) and loricrin (Loc). (c) Quantitative RT-PCR assays as in (b) for P21 (mp21) and DNP63. (d) Immunofluorescence analysis of back skin from 20 day pups of
indicated genotypes and treatment. Note: Ki67-positive cells in basal and suprabasal cells (arrowheads) and K6 in multiple layers co-localizing with K5 (white arrow)
in Plk4OE/Plk4OE; p53KO/p53KO (DOX) mice; expanded staining of K5 and K10. (e) Ratio of basal to suprabasal cells indicated as mean + s.d. ( f ) Proportion of
cycling cells in epidermis. Mean + s.d. % of cells showing Ki67-positive immunostaining. Significance determined by Students t-test. *p , 0.05.
 Downloaded from http://rsob.royalsocietypublishing.org/ on May 27, 2017

(a) 9
+DOX

rsob.royalsocietypublishing.org
wild-type (C57BL/6) Plk4OE/Plk4OE Plk4OE/Plk4OE; p53KO/p53KO

DNA Plk4 Act-tubulin

B

EPi
B B
HF
dermis
20 m 20 m 20 m

Open Biol. 5: 150209

dermis
DNA Plk4 Act-tubulin

B
10 m 10 m 10 m
Plk4 Act-tubulin

10 m 10 m 10 m

(b) DNA Plk4 Ac-tubulin Plk4 Ac-tubulin (c) +/+

100 Plk4OE/Plk4OE
Plk4OE/Plk4OE (+DOX)
Plk4OE/Plk4OE; p53KO/p53KO
% cells of epidermis

80 Plk4OE/Plk4OE; p53KO/p53KO (+DOX)

wild-type

***
60 ***
***

40
***
20
+DOX +DOX
0
Plk4OE/Plk4OE

1 pair 2 pairs >2 pairs

of centrioles of centrioles of centrioles
(d)
+/+
Plk4OE/Plk4OE (+DOX)
Plk4OE/Plk4OE; p53KO/p53KO (+DOX)

***
2.0 **
Plk4OE/Plk4OE; p53KO/p53KO

length of cilium (m)

+DOX +DOX
1.5

1.0

0.5

Figure 5. Over-expression of Plk4 leads to multiple centrosomes and loss of primary cilia. (a) Immunostaining of back skin of P2 pups of indicated genotypes and
treatment to reveal Plk4 (red), acetylated tubulin (green) and DNA (blue). Arrows indicate individual primary cilia (anti-acetylated tubulin) that are apically oriented
in basal and suprabasal cells in wild-type control. Note: induction of Plk4 leads to extra centrioles and loss of primary cilia. (b) Immunostaining of hair follicles in
mice of indicated genotypes and treatment. Note: primary cilia (arrowheads) are still observed in hair follicles after Plk4 induction although they appear longer than
in control. (c) Quantification of centriole pairs in basal and superbasal layers. Mean + s.d., n 30 50 cells/condition. (d ) Quantification of primary cilium length
in samples illustrated in (b). Mean + s.d., n 30 50 cells per condition. Significance determined by Students t-test. **p , 0.01, ***p , 0.005.
 Downloaded from http://rsob.royalsocietypublishing.org/ on May 27, 2017

+DOX 10
(a) (b)
+/+ Plk4OE/Plk4OE Plk4OE/Plk4OE Plk4OE/Plk4OE; p53KO/p53KO
Wt (+/+)

rsob.royalsocietypublishing.org
2 3
Plk4OE/Plk4OE
centrin2/3 g-tubulin

Plk4OE/Plk4OE +DOX
DNA Plk4

1 1 45 Plk4OE/Plk4OE; p53KO/p53KO +DOX

2 3
**
40
** **
35
2
1 2
10 mm 10 mm 1 10 mm 10 mm

% of keratinocytes
30

25
g -tubulin centrin 2/3 Plk4

g -tubulin centrin 2/3 Plk4

g -tubulin centrin 2/3 Plk4

g -tubulin centrin 2/3 Plk4

20
1 2 1 2 3 1 2 1 2 3
15

Open Biol. 5: 150209

1 2 1 2 3 1 2 1 2 3 10

1 3 mm 2 3 mm 1 3 mm 2 3 mm 3 3 mm 1 3 mm 2 3 mm 1 3 mm 3 mm 2 3 mm 3 0
>4 centrioles

(d)
Wt (+/+)
+ DOX Plk4OE/Plk4OE
45
(c) +/+ Plk4OE/Plk4OE Plk4OE/Plk4OE Plk4OE/Plk4OE; p53KO/p53KO Plk4OE/Plk4OE +DOX
40
35 Plk4OE/Plk4OE; p53KO/p53KO +DOX

% of keratinocytes
30
act-tubulin
DNA Plk4

25
20
** **
15
10

5 mm 5 mm 5 mm 5 mm 5
0
1 cilium >1 cilium

1
(e) Wt (+/+)
4.0
Plk4

Plk4OE/Plk4OE
3.5 **
*

length of cilium (mm)

3.0
2
2.5
2.0
1.5
1.0
Plk4

0.5
1 2
3 mm 3 mm 3 mm 3 mm 0
Plk4OE/Plk4OE +DOX)
Plk4OE/Plk4OE; p53KO/p53KO +DOX

Figure 6. Over-expression of Plk4 leads to multiple centrosomes and loss of primary cilia in primary keratinocytes. (a) Primary culture of keratinocytes isolated from
Wt, Plk4OE/Plk4OE and Plk4OE/Plk4OE; p53KO/p53KO dorsal skin under low calcium conditions. Plk4 over-expression promoted by addition of doxycycline (DOX). Immu-
nostaining reveals Plk4 (red), centrin 2/3 (green) and g-tubulin (blue). DNA stained with DAPI (white). Individual regions magnified in insets showing example of
centriole over-duplication after Plk4 over-expression. (b) Quantitation of centrioles in three independent experiments. Mean values + s.d.; more than 200 cells
quantified for each condition. (c) In vitro, addition of Ca2 induces primary cilia formation in control, Plk4OE/Plk4OE and Plk4OE/Plk4OE; p53KO/p53KO. In control
and Plk4OE/Plk4OE, 38.70 + 3.80% and 31.70 + 2.38% of keratinocytes, respectively, formed a primary cilium after higher Ca2 conditions. If Plk4 is over-
expressed, the percentage of keratinocytes showing primary cilia is reduced to 1/3 in Plk4OE/Plk4OE compared to controls (11.00 + 4.38%). Similar results
were obtained in Plk4OE/Plk4OE; p53KO/p53KO over-expressing Plk4 (9.66 + 4.87%). (d ) Quantitation of percentage of keratinocytes exhibiting one or more primary
cilia under indicated conditions. (e) Quantitation of primary cilium length under indicated conditions. Significance evaluated by Students t-test and compared to
wild-type (*p , 0.05 and **p , 0.01).

different cell types. In the majority of cells of the basal epider- following addition of doxycycline to primary Plk4OE/Plk4OE-
mis, Plk4 over-expression results in elevated numbers of derived keratinocytes cultured in low concentrations of
centrosomes that form at the expense of primary cilia. This calcium reproducibly resulted in centriole over-duplication.
correlates with the increased proliferation of these cells. A pri- (figure 6a,b). By 48 h after addition of calcium, adherens junc-
mary cilium is still able to form alongside additional tions formed and tight junctions and desmosomes were
centrosomes in some hair follicle cells after Plk4 over- assembled. Such cells expressed markers of early and late differ-
expression but these primary cilia are abnormal in structure. entiation and grew on top of each other to form a pseudo-three-
We then prepared primary cultures of keratinocytes from dimensional epidermis. Under these conditions, a single
our mouse lines as these can be cultured under conditions primary cilium formed at the surface of approximately 40% of
that permit either cell proliferation or, following the addi- cells in either wild-type control cells or in Plk4OE/Plk4OE cells
tion of calcium, the formation of cellcell contacts and without Plk4 induction. Addition of doxycycline to the
cellular differentiation. Induction of Plk4 over-expression medium promoted the formation of supernumerary centrioles
 Downloaded from http://rsob.royalsocietypublishing.org/ on May 27, 2017
and the formation of fewer primary cilia (figure 6b,c). When
a primary cilium was formed, there was only one per cell
even though multiple centrioles could be present. Moreover,
these primary cilia were significantly longer than in wild-type
cells or Plk4OE/Plk4OE cells that had not been induced to
over-express Plk4 (figure 6d).
Thus, over-expression of Plk4 results in supernumerary
centrosomes both in cells of the basal epidermis and in cultures
of primary keratinocytes. In both cases, cells appear to fail to
leave the proliferative state and they fail to form primary
cilia. This suggests that over-expression of Plk4 leads to an
alteration in the balance between proliferation and differen-
tiation of the progenitor epidermal cells. Cilia formation
could be compromised either directly by the increased
number of centrosomes or as a consequence of a failure of
cells to cease cycling sufficiently to enable ciliogenesis. It is
known that the primary cilia receive and transmit extracellular
signals during development [55 57] and that several ciliary
mutants display defects in the commitment of progenitors to
differentiate. It is also known that lack of primary cilia in
cells of the basal epidermis would compromise the signalling
events required to promote their correct differentiation [58,59],
so accounting for the defects that we see in cell differentiation
in the skin of Plk4 over-expressing mice.
3. Discussion
The great majority of tumour cells are both aneuploid and
have multiple centrosomes [7,8,60], leading to the suggestion
that these properties may be causally related. However, the
extent to which chromosome instability resulting from mul-
tiple centrosomes contributes to tumour formation is not
clear because centrosome clustering at mitosis usually
ensures the fidelity of chromosome transmission on bipolar
spindles [61]. The transgenic mouse we have generated
allows us to induce centriole duplication in response to
elevated Plk4 and so begin to address the relationship
between multiple centrosomes and tumour formation. Our
findings that elevating Plk4 perturbs the balance between
proliferation and differentiation in different tissues in a
manner exacerbated by loss of the p53 tumour suppressor
gives the potential to identify links between supernumerary
centrosomes and early steps in tumourigenesis.
Mice deficient for p53 are susceptible to tumour formation
[62] and, moreover, the embryonic fibroblasts established
from such mice show supernumerary centrosomes [63]. One
interpretation of these findings has been that p53 might mediate
cell cycle arrest in response to increased centrosome numbers as
part of a tetraploidy checkpoint to monitor completion of cyto-
kinesis [64] or by monitoring DNA damage or spindle defects in
these cells [6567]. Others have proposed a direct role for p53 in
directly regulating centrosome duplication [6870]. While it
remains difficult to distinguish cause from effect, growing evi-
dence points towards a p53-mediated response to changes in
centrosome integrity that receives support from our present
study and earlier findings. p53 deletion overcomes either the
block to cell progression or apoptosis resulting from depletion
of several different centrosome proteins in cultured cells [71]
or centriole loss in Sas4 knockout mouse embryos [34]. More-
over, recent studies have identified a p53 response that is
triggered by the inhibition or the destruction of Plk4 that pre-
vents centriole duplication [33,35]. DNA damage, stress,
chromosome mis-segregation, prolonged time in mitosis 11
[33,35], nor the Hippo-signalling pathway, recently shown to
rsob.royalsocietypublishing.org
respond to cytokinesis failure [72], were responsible for trigger-
ing this p53-dependent arrest in a senescent-like G1 state in
response to centrosome loss. We now show that defects in the
pancreas and skin resulting from Plk4 over-expression are
enhanced by the loss of p53. We do not know the nature of
this p53-dependent response to either gain or loss of centro-
somes but it seems possible that it uses a common pathway as
both situations can perturb spindle organization and dynamics
and cell cycle progression.
The tumour formation that we observe, however, appears
Open Biol. 5: 150209
dependent upon the loss of p53 function; it is exacerbated by
Plk4 over-expression but is not seen following Plk4 over-
expression alone. It will be important in future studies to
identify the origins of these tumour cells, particularly the sar-
comas that appear with increased frequency when Plk4 levels
are elevated. That we see tissue hyperplasia rather than neo-
plasia in the pancreas and skin might reflect the time course
of the development of different tumour types in the absence
of p53. Usually, p53 null mice first develop lymphomas and
most do not survive for long enough for sarcomas to arise.
Nevertheless, sarcoma formation predominates in mice in
which lymphocytes have been genetically eliminated and it
is conceivable that the development of carcinomas, as
would occur in the skin, would be masked by these earlier
events of lymphoma and then sarcoma formation [73].
The hyperplasia we observe in the pancreas in response to
elevated Plk4 and enhanced in the absence of p53 appears to
affect the differentiated endocrine cells equally. Thus, the
enlarged islets of Langerhans maintain similar proportions of
a- and b-cells suggesting that both populations have prolifer-
ated and differentiated. In the skin, on the other hand,
elevated Plk4 permits proliferating cells to expand into the
suprabasal layers of the epidermis where they show inap-
propriate expression of differentiation markers. This too is
enhanced in a p53 background. The shift in the balance of
cell proliferation and differentiation could reflect persistence
of the centriole as a structure associated with the centrosome
and so keeping the cell prepared for cell division. It could
also result from a loss of barrier function due to the disruption
in the stratified epidermal architecture as occurs, for example,
in the inflammatory response (reviewed in [74]). The stratifica-
tion of the skin occurs when polarized cells of the basal
epidermis undergo divisions perpendicular to the basal cell
layer to produce the differentiating upper layers [75]. Multiple
centrosomes might affect the orientation of mitotic spindles
thus perturbing the mechanism that delivers cells from the
basal to the suprabasal layers in an orderly manner.
Alternatively, the abnormal differentiation in Plk4 over-
expressing, p53 null cells could reflect loss of primary cilia
that we observe to reciprocate additional centrosome for-
mation both in cells of the basal epidermis and in cultures
of primary keratinocytes established from this skin. The differ-
entiation of cells entering the spinous layer is a Notch
signalling-dependent process [76] and a failure of ciliogenesis
has been reported to compromise Notch signalling and result
in defective epidermal differentiation [58]. Thus, in the absence
of sufficient primary cilia, the signalling pathways required for
correct differentiation would be defective. Reduced signalling
activity was also previously reported in cultured cells expres-
sing elevated levels of Plk4 [77]. However, in the examples
studied by these authors, cells with extra centrosomes often
 Downloaded from http://rsob.royalsocietypublishing.org/ on May 27, 2017

Table 1. Primers for mPlk4 and genotyping. 12

rsob.royalsocietypublishing.org
mPlk4RosaFor 50 GGGGACAAGTTTGTACAAAAAAGCAGGCTTCATGGCGGCGTGCATCGGGGAGAGGATCGAGGACTTTAAG30
mPlk4RosaRev 50 GGGGACCACTTTGTACAAGAAAGCTGGGTTTAGGAGTTGGATTAGAAAACATCAGAAGGATGGAAGAAAG30
Plk4Insert_Forward 50 CCGCGCCTGTCCTTTCTCCC30
Plk4Insert_Reverse 50 GTCCGGCCAGGACGACGAGG30
Wt_Rosa_locus 50 GGCAAGCACCACCACTGGCTGGC30
Wt_Rosa_locus 50 GAAGTGTAACTGTGGACAGAGGAGCC30
IMR8306_p53Mut_FW 50 CTATCAGGACATAGCGTTGG30
IMR7778_p53_Rev 50 ATACTCAGAGCCGGCCT30

Open Biol. 5: 150209

IMR7777_p53_FW 50 ACAGCGTGGTGGTACCTTAT30

formed more than one primary cilium. These cilia were associ-
ated with reduced concentrations of signalling molecules and
this appeared to be responsible for the reduction in signalling
activity. This contrasts to our findings in keratinocytes where
supernumerary centrosomes appear to form at the expense
of the formation of cilia. The occasional cell that we do find
with two primary cilia of increased length seems at odds
with these earlier findings. The net outcome of disrupted sig-
nalling is the same although in one case it appears to be the
consequence of the inefficient operation of the signalling
machinery and in the other through the loss of the mechanical
apparatus, the cilia themselves.
In addition to the work we now report, another study has
described a p53-dependent response to mitotic abnormalities
resulting from Plk4 over-expression in the developing mouse
brain [42]. These authors described how this led neural stem
cells to undertake multipolar mitoses leading to aneuploid
cells that were directed to p53-dependent apoptosis. They
reported that loss of p53 allowed aneuploid cells to accumulate
and differentiate thereby reducing the proportion of proliferat-
ing cells and reducing brain size. These consequences seem to
differ from the ones we now report in the pancreas and
skin where p53 enhances the effects of Plk4 over-expression
by allowing cells to proliferate. This suggests that the
responses to the supernumerary centrosomes resulting from
over-expression of Plk4 might differ in different tissues.
Our study highlights the importance of the p53 pathway
in monitoring defects elicited by the elevated expression of
Plk4. The increase in centrosome numbers and decrease in
primary cilia strongly suggest that the effects we observe
reflect the principal function of Plk4 to drive centrosome
duplication, although we cannot at this stage exclude an
involvement of Plk4 in regulating other aspects of cellular
physiology (e.g. [78,79]). Further studies are now required
to dissect out the precise manner by which the p53 pathway
is triggered together with the mechanisms whereby elevated
Plk4 affects cell cycle progression and cellular architecture,
how these might affect the differentiation programme of the
cell and how this could contribute to tumour development.
elements attR1/attR2. mPlk4 cDNA flanked by attL1/attL2
sites was introduced into the vector by Gateway cloning
(Life Technology), yielding a Rosa26 targeting vector
harbouring tetracycline-inducible cDNA for Plk4. Primers
used for subcloning the mousePlk4cDNA were mPlk4Rosa-
For and mPlk4RosaRev (table 1). The targeting vector was
introduced into JM8 mESCs by electroporation, and success-
ful integrations were selected for with 1 mg ml21 puromycin.
Correct targeting was confirmed by long-range PCR across
the 50 homology arm of clonal puromycin-resistant cell lines.
4.2. Histological analysis of skin and pancreas
Samples were fixed in 4% paraformaldehyde in PBS at 48C
overnight and then dehydrated and embedded in paraffin
wax. Eight micrometre sections were stained with haema-
toxylin and eosin for histological analysis. Samples from
dorsal skin or pancreas were washed in PBS, embedded in
OCT compound and kept at 2808C prior to cryosectioning
for immunofluorescence.
4.3. Fontana-Masson staining
Fontana-Masson staining of backskin cryosections was per-
formed following the protocol provided in the Fontana-Masson
kit (Abcam, ab150669).
4.4. Culture of kerotinocytes
Mouse keratinocytes were isolated from the backskin of 2-
day-old pups from each genetic background using dispase
and trypsin. After filtration in 40 mm cell strainers, cells
were cultured in low calcium medium (50 mM Ca2) on
plates coated with coating matrix (Gibco) as previously
described [81]. Once confluency was reached, coverslips
were either fixed in 2208C methanol to visualize centrosomes
or cultures were shifted to 2 mM Ca2 media for 48 h to
analyse cytoskeleton and primary cilium formation.

4. Material and methods
4.1. Generation of mESCs inducibly expressing Plk4
from the Rosa26 locus
The rtTA gene and response element (ClonTech) were cloned
into a Rosa26 targeting vector [80] upstream of Gateway
4.5. Antibodies
Primary antibodies were obtained from the following sources:
rabbit anti-Cep192 [82] (1 : 1000), rabbit anti-keratin 5 ab52635
(Abcam, 1 : 1000), chicken anti-keratin 5 #905901 (BioLegend,
1 : 1000), rabbit anti-keratin 10 ab76318 (Abcam, 1 : 1000),
rabbit anti-keratin 6 #905701 (BioLegend, 1 : 1000), rabbit
anti-cKit ab5506 (Abcam), rabbit anti-Ki67 ab15580
(Abcam, 1 : 500), mouse anti-g-tubulin monoclonal GTU-88
 Downloaded from http://rsob.royalsocietypublishing.org/ on May 27, 2017

(Sigma, 1 : 200), rabbit anti-g-tubulin T3559 (Sigma, 1 : 500), rat Table 2. Primers for RT-QPCR. 13
anti-PLK4 [78] (1 : 1000), mouse anti-centrin2/3 S3332 (Santa

rsob.royalsocietypublishing.org
Cruz Biotechnology, 1 : 500), guinea-pig anti-insulin ab7842 Plk4 forward 50 AGGAGAAACTAATGAGCACCACA30
(Abcam, 1 : 50), mouse monoclonal anti-glucagon ab10988
Plk4 reverse 50 TGGCTCTCGTGTCAGTCCAA30
(Abcam, 1 : 200), mouse monoclonal anti-acetylated-tubulin
clone 6-11B-1 (Sigma, 1 : 200), mouse anti-MITF ab80651 GAPDH forward 50 AAGGTCATCCCAGAGCTGAA30
(Abcam, 1 : 200), rabbit anti-DCT ab74073 (Abcam, 1 : 200), GAPDH reverse 50 CTGCTTCACCACCTTCTTGA30
mouse anti-E-cadherin clone ECDD-2 (Invitrogen, 1 : 200), rat K1 forward 50 GAACACTAAGCTGGCCCTGGACAT30
anti-mouse-cKIT clone 2B8 (Biolegend). Secondary antibodies
K1 reverse 50 CCTCGGGAGTAACTGGTGGAAACA30
used (1 : 2000 for immunofluorescence) were conjugated with
Alexa 488, Alexa 568 or Alexa 647 (Invitrogen) and had minimal K5 forward 50 CAGTGTGCCAACCTCCAGAACG30
cross-reactivity to other species. K5 reverse 50 AGCCCGCTACCCAAACCAAGAC30

Open Biol. 5: 150209

K10 forward 50 GGAGGGTAAAATCAAGGAGTGGTA30
4.6. Fixation protocol for tissues and cells K10 reverse 50 TCAATCTGCAGCAGCACGTT30
For identification of centrosomal proteins by immuno- K14 forward 50 GACGCCGCCCCTGGTGTG30
fluorescence, preparations were fixed (12 min in ice-cold K14 reverse 50 GGTGGCGATCTCCTGCTC30
methanol), quickly rinsed in 1PBS and then permeabilized lagrin forward 50 GGAGGCATGGTGGAACTGA30
in 1PBS; 0.1% Triton-X100 for three times, for 5 min each.
lagrin reverse 50 TGTTTATCTTTTCCCTCACTTCTACATC30
Preparations were blocked with 1PBS; 0.1% Tween 20;
10% FBS for 1 h, followed by primary antibody incubation involucrin forward 50 GTCCGGTTCTCCAATTCGTGTTT30
in the same solution for at least 2 h at room temperature. involucrin reverse 50 GCAATTGGAAGAGAAGCAGCATCAG30
Washes were performed in 1PBS; 0.1% Tween 20 for loricrin forward 50 TCACTCATCTTCCCTGGTGCTT30
30 minutes before the addition of secondary antibody in
loricrin reverse 50 GTCTTTCCACAACCCACAGGA30
1PBS; 0.1% Tween 20 with 10% FBS. Preparations were
washed as previously, mounted in Vectashield with DAPI DNp63 forward 50 CTGGAAAACAATGCCCAGAC30
and sealed. DNp63 reverse 50 GAGGAGCCGTTCTGAATCTG30
mp21_forward 50 GTGGGTCTGACTCCAGCCC30
4.7. Microscopy mp21_reverse 50 CCTTCTCGTGAGACGCTTAC30
Images were collected on a Zeiss LSM 510 Meta Laser Scan- tyrosinase forward 50 GCGAAGGCACCGCCCTCTTT30
ning Confocal Microscope using 63X/1.4 or 100X/1.4 oil tyrosinase reverse 50 TCCCACCAGTGCTGCCCCAA30
objectives, and the LSM 510 v. 4.2 software. Images were
deconvolved using HUYGENS PROFESSIONAL software; proces-
sing and analysis was performed with IMAGEJ v. 1.50b and for at least three biological samples and fold changes calcu-
Adobe PHOTOSHOP CS5. lated using the 22DDCT method.

4.8. RT-qPCR conditions

RNA was isolated from the different tissues with RNAqueous
Kit (Ambion) and RT-QPCR was performed using Power
SYBRw Green RNA-to-CTTM 1-Step Kit (Life Technologies)
on a Stepone Plus 96 RT system (Life Technologies) with
GAPDH as reference gene. Primers pairs (forward and
reverse) used for each gene are indicated in table 2. Specificity
was confirmed by subsequent melting curve analysis or gel
electrophoresis. Levels of PCR product were expressed as a
function of GAPDH. Reactions were performed in triplicate
Competing interests. We declare we have no competing interests.
Funding. P.A.C. is supported by a Program Grant from Cancer
Research UK to D.M.G. L.B. is the recipient of a Cancer Research
UK research studentship from Cambridge Cancer Centre. M.S. is
supported by an EMBO Fellowship. M.H. is a Wellcome Trust Sir
Henry Dale Fellow, jointly funded by the Wellcome Trust and the
Royal Society and receiving core support grant from the Wellcome
Trust and Cancer Research UK to the Wellcome TrustCancer
Research UK Gurdon Institute. W.C.S. is supported by core funding
to the Wellcome Trust Sanger Institute; M.Z.G. holds a Wellcome
Trust Senior Fellowship.

References
1. Scheer U. 2014 Historical roots of centrosome
research: discovery of Boveris microscope slides in
Wurzburg. Phil. Trans. R. Soc. B 369, 20130469.
(doi:10.1098/rstb.2013.0469)
2. Kramer A, Neben K, Ho AD. 2005 Centrosome
aberrations in hematological malignancies. Cell Biol.
Int. 29, 375383. (doi:10.1016/j.cellbi.2005.03.004)
3. Lingle WL, Lutz WH, Ingle JN, Maihle NJ, Salisbury
JL. 1998 Centrosome hypertrophy in human breast
tumors: Implications for genomic stability and cell
polarity. Proc. Natl Acad. Sci. USA 95, 29502955.
(doi:10.1073/pnas.95.6.2950)
4. Pihan GA, Purohit A, Wallace J, Knecht H, Woda B,
Quesenberry P, Doxsey SJ. 1998 Centrosome defects
and genetic instability in malignant tumors. Cancer
Res. 58, 39743985.
5. Hsu L-C, Kapali M, DeLoia JA, Gallion HH. 2005
Centrosome abnormalities in ovarian cancer.
Int. J. Cancer 113, 746751. (doi:10.1002/ijc.
20633)
6. Sato N, Mizumoto K, Nakamura M, Nakamura K,
Kusumoto M, Niiyama H, Ogawa T, Tanaka M. 1999
Centrosome abnormalities in pancreatic ductal
carcinoma. Clin. Cancer Res. 5, 963 970.
7. Giehl M, Fabarius A, Frank O, Hochhaus A, Hafner
M, Hehlmann R, Seifarth W. 2005 Centrosome
aberrations in chronic myeloid leukemia correlate
with stage of disease and chromosomal instability.
Leukemia 19, 1192 1197. (doi:10.1038/sj.leu.
2403779)
 Downloaded from http://rsob.royalsocietypublishing.org/ on May 27, 2017
8. Lingle WL, Barrett SL, Negron VC, DAssoro AB,
Boeneman K, Liu W, Whitehead CM, Reynolds C,
Salisbury JL. 2002 Centrosome amplification drives
chromosomal instability in breast tumor
development. Proc. Natl Acad. Sci. USA 99,
19781983. (doi:10.1073/pnas.032479999)
9. Pihan GA, Wallace J, Zhou Y, Doxsey SJ. 2003
Centrosome abnormalities and chromosome
instability occur together in pre-invasive carcinomas.
Cancer Res. 63, 1398 1404.
10. Segat D et al. 2010 Pericentriolar material analyses
in normal esophageal mucosa, Barretts metaplasia
and adenocarcinoma. Histol. Histopathol. 25,
551560.
11. Yamamoto Y, Matsuyama H, Furuya T, Oga A,
Yoshihiro S, Okuda M, Kawauchi S, Sasaki K, Naito
K. 2004 Centrosome hyperamplification predicts
progression and tumor recurrence in bladder cancer.
Clin. Cancer Res. 10, 6449 6455. (doi:10.1158/
1078-0432.CCR-04-0773)
12. DAssoro AB, Lingle WL, Salisbury JL. 2002
Centrosome amplification and the development of
cancer. Oncogene 21, 6146 6153. (doi:10.1038/sj.
onc.1205772)
13. Pihan GA, Purohit A, Wallace J, Malhotra R, Liotta L,
Doxsey SJ. 2001 Centrosome defects can account for
cellular and genetic changes that characterize
prostate cancer progression. Cancer Res. 61,
2212 2219.
14. Reiter R et al. 2009 Centrosome abnormalities in
head and neck squamous cell carcinoma (HNSCC).
Acta Otolaryngol. 129, 205 213. (doi:10.1080/
00016480802165767)
15. Ohta M, Ashikawa T, Nozaki Y, Kozuka-Hata H, Goto
H, Inagaki M, Oyama M, Kitagawa D. 2014 Direct
interaction of Plk4 with STIL ensures formation of a
single procentriole per parental centriole. Nat.
Commun. 5, 5267. (doi:10.1038/ncomms6267)
16. Dzhindzhev NS, Tzolovsky G, Lipinszki Z, Schneider
S, Lattao R, Fu J, Debski J, Dadlez M, Glover DM.
2014 Plk4 phosphorylates Ana2 to trigger Sas6
recruitment and procentriole formation. Curr. Biol.
24, 2526 2532. (doi:10.1016/j.cub.2014.08.061)
17. Kratz A-S, Barenz F, Richter KT, Hoffmann I. 2015
Plk4-dependent phosphorylation of STIL is required
for centriole duplication. Biol. Open 4, 370377.
(doi:10.1242/bio.201411023)
18. Moyer TC, Clutario KM, Lambrus BG, Daggubati V,
Holland AJ. 2015 Binding of STIL to Plk4 activates
kinase activity to promote centriole assembly. J. Cell
Biol. 209, 863878. (doi:10.1083/jcb.201502088)
19. Cunha-Ferreira I, Rodrigues-Martins A, Bento I,
Riparbelli M, Zhang W, Laue E, Callaini G, Glover
DM, Bettencourt-Dias M. 2009 The SCF/Slimb
ubiquitin ligase limits centrosome amplification
through degradation of SAK/PLK4. Curr. Biol. 19,
43 49. (doi:10.1016/j.cub.2008.11.037)
20. Rodrigues-Martins A, Riparbelli M, Callaini G, Glover
DM, Bettencourt-Dias M. 2007 Revisiting the role of
the mother centriole in centriole biogenesis. Science
316, 1046 1050. (doi:10.1126/science.1142950)
21. Rogers GC, Rusan NM, Roberts DM, Peifer M, Rogers
SL. 2009 The SCF Slimb ubiquitin ligase regulates
Plk4/Sak levels to block centriole reduplication.
J. Cell Biol. 184, 225 239. (doi:10.1083/jcb.
200808049)
22. Habedanck R, Stierhof Y-D, Wilkinson CJ, Nigg EA.
2005 The Polo kinase Plk4 functions in centriole
duplication. Nat. Cell Biol. 7, 1140 1146. (doi:10.
1038/ncb1320)
23. Bettencourt-Dias M et al. 2005 SAK/PLK4 is required for
centriole duplication and flagella development. Curr.
Biol. 15, 21992207. (doi:10.1016/j.cub.2005.11.042)
24. Basto R, Lau J, Vinogradova T, Gardiol A, Woods CG,
Khodjakov AL, Raff JW. 2006 Flies without
centrioles. Cell 125, 1375 1386. (doi:10.1016/j.cell.
2006.05.025)
25. Rodrigues-Martins A, Bettencourt-Dias M, Riparbelli
M, Ferreira C, Ferreira I, Callaini G, Glover DM. 2007
DSAS-6 organizes a tube-like centriole precursor,
and its absence suggests modularity in centriole
assembly. Curr. Biol. 17, 1465 1472. (doi:10.1016/
j.cub.2007.07.034)
26. Varmark H, Llamazares S, Rebollo E, Lange B, Reina
J, Schwarz H, Gonzalez C. 2007 Asterless is a
centriolar protein required for centrosome function
and embryo development in Drosophila. Curr. Biol.
17, 17351745. (doi:10.1016/j.cub.2007.09.031)
27. Conduit PT, Wainman A, Raff JW. 2015 Centrosome
function and assembly in animal cells. Nat. Rev.
Mol. Cell Biol. 16, 611624. (doi:10.1038/nrm4062)
28. Fuller MT. 1993 The development of Drosophila
melanogaster. I. Cold Spring Harbor, NY: Cold Spring
Harbor Laboratory Press.
29. Chevalier RL. 1969 The fine structure of
campaniform sensilla on the halteres of Drosophila
melanogaster. J. Morphol. 128, 443 463. (doi:10.
1002/jmor.1051280405)
30. Baker JD, Adhikarakunnathu S, Kernan MJ. 2004
Mechanosensory-defective, male-sterile unc mutants
identify a novel basal body protein required for
ciliogenesis in Drosophila. Development 131, 3411
3422. (doi:10.1242/dev.01229)
31. Khodjakov AL, Rieder CL. 2001 Centrosomes
enhance the fidelity of cytokinesis in vertebrates
and are required for cell cycle progression. J. Cell
Biol. 153, 237 242. (doi:10.1083/jcb.153.1.237)
32. Mahoney NM, Goshima G, Douglass AD, Vale RD.
2006 Making microtubules and mitotic spindles in
cells without functional centrosomes. Curr. Biol. 16,
564 569. (doi:10.1016/j.cub.2006.01.053)
33. Wong YL et al. 2015 Cell biology. Reversible
centriole depletion with an inhibitor of Polo-like
kinase 4. Science 348, 1155 1160. (doi:10.1126/
science.aaa5111)
34. Bazzi H, Anderson KV. 2014 Acentriolar mitosis
activates a p53-dependent apoptosis pathway in
the mouse embryo. Proc. Natl Acad. Sci. USA 111,
E1491 E1500. (doi:10.1073/pnas.1400568111)
35. Lambrus BG, Uetake Y, Clutario KM, Daggubati V,
Snyder M, Sluder G, Holland AJ. 2015 p53 protects
against genome instability following centriole
duplication failure. J. Cell Biol. 210, 63 77. (doi:10.
1083/jcb.201502089)
36. Holland AJ, Fachinetti D, Zhu Q, Bauer M, Verma
IM, Nigg EA, Cleveland DW. 2012 The autoregulated
instability of Polo-like kinase 4 limits centrosome 14
duplication to once per cell cycle. Genes Dev. 26,
rsob.royalsocietypublishing.org
2684 2689. (doi:10.1101/gad.207027.112)
37. Castellanos E, Dominguez P, Gonzalez C. 2008
Centrosome dysfunction in Drosophila neural stem
cells causes tumors that are not due to genome
instability. Curr. Biol. 18, 12091214. (doi:10.1016/
j.cub.2008.07.029)
38. Basto R, Brunk K, Vinadogrova T, Peel N, Franz A,
Khodjakov AL, Raff JW. 2008 Centrosome
amplification can initiate tumorigenesis in flies. Cell
133, 1032 1042. (doi:10.1016/j.cell.2008.05.039)
Open Biol. 5: 150209
39. Martin C-A et al. 2014 Mutations in PLK4,
encoding a master regulator of centriole
biogenesis, cause microcephaly, growth failure and
retinopathy. Nat. Genet. 46, 1283 1292. (doi:10.
1038/ng.3122)
40. Godinho SA, Pellman D. 2014 Causes and
consequences of centrosome abnormalities in
cancer. Phil. Trans. R. Soc. B 369, 20130467.
(doi:10.1098/rstb.2013.0467)
41. Mahmood S, Ahmad W, Hassan MJ. 2011
Autosomal recessive primary microcephaly (MCPH):
clinical manifestations, genetic heterogeneity and
mutation continuum. Orphanet. J. Rare Dis. 6, 39.
(doi:10.1186/1750-1172-6-39)
42. Marthiens V, Rujano MA, Pennetier C, Tessier S,
Paul-Gilloteaux P, Basto R. 2013 Centrosome
amplification causes microcephaly. Nat. Cell Biol. 15,
731740. (doi:10.1038/ncb2746)
43. Glinsky GV. 2006 Genomic models of metastatic
cancer: functional analysis of death-from-cancer
signature genes reveals aneuploid, anoikis-resistant,
metastasis-enabling phenotype with altered cell
cycle control and activated Polycomb group (PcG)
protein chromatin silencing pathway. Cell Cycle 5,
1208 1216. (doi:10.4161/cc.5.11.2796)
44. Finetti P et al. 2008 Sixteen-kinase gene expression
identifies luminal breast cancers with poor
prognosis. Cancer Res. 68, 767 776. (doi:10.1158/
0008-5472.CAN-07-5516)
45. Harvey M, McArthur MJ, Montgomery CA, Butel JS,
Bradley A, Donehower LA. 1993 Spontaneous and
carcinogen-induced tumorigenesis in p53-deficient
mice. Nat. Genet. 5, 225 229. (doi:10.1038/
ng1193-225)
46. Mort RL, Jackson IJ, Patton EE. 2015 The
melanocyte lineage in development and disease.
Development 142, 620 632. (doi:10.1242/dev.
106567)
47. Wasmeier C, Hume AN, Bolasco G, Seabra MC.
2008 Melanosomes at a glance. J. Cell. Sci. 121,
3995 3999. (doi:10.1242/jcs.040667)
48. Hsu Y-C, Li L, Fuchs E. 2014 Emerging interactions
between skin stem cells and their niches. Nat. Med.
20, 847 856. (doi:10.1038/nm.3643)
49. Weiss RA, Eichner R, Sun TT. 1984 Monoclonal
antibody analysis of keratin expression in epidermal
diseases: a 48- and 56-kdalton keratin as molecular
markers for hyperproliferative keratinocytes. J. Cell
Biol. 98, 1397 1406. (doi:10.1083/jcb.98.4.1397)
50. Stoler A, Kopan R, Duvic M, Euchs E. 1988 Use of
monospecific antisera and cRNA probes to localize
 Downloaded from http://rsob.royalsocietypublishing.org/ on May 27, 2017
the major changes in keratin expression during
normal and abnormal epidermal differentiation.
J. Cell Biol. 107, 427 446. (doi:10.1083/jcb.
107.2.427)
51. Danilova N, Sakamoto KM, Lin S. 2008 p53 family in
development. Mech. Dev. 125, 919931. (doi:10.
1016/j.mod.2008.09.003)
52. Deng C, Zhang P, Wade Harper J, Elledge SJ, Leder
P. 1995 Mice Lacking p21CIP1/WAF1 undergo
normal development, but are defective in G1
checkpoint control. Cell 82, 675684. (doi:10.1016/
0092-8674(95)90039-X)
53. Brugarolas J, Chandrasekaran C, Gordon JI, Beach D,
Jacks T, Hannon GJ. 1995 Radiation-induced cell
cycle arrest compromised by p21 deficiency. Nature
377, 552557. (doi:10.1038/377552a0)
54. Martn-Caballero J, Flores JM, Garca-Palencia P, 65.
Serrano M. 2001 Tumor susceptibility of
p21(Waf1/Cip1)-deficient mice. Cancer Res. 61,
6234 6238.
55. Bershteyn M, Atwood SX, Woo W-M, Li M, Oro AE.
2010 MIM and cortactin antagonism regulates
ciliogenesis and hedgehog signaling. Dev. Cell 19,
270283. (doi:10.1016/j.devcel.2010.07.009)
56. Goetz SC, Anderson KV. 2010 The primary cilium: a
signalling centre during vertebrate development.
Nat. Rev. Genet. 11, 331344. (doi:10.1038/
nrg2774)
57. Santos N, Reiter JF. 2010 Tilting at nodal windmills:
planar cell polarity positions cilia to tell left from
right. Dev. Cell 19, 56. (doi:10.1016/j.devcel.2010.
07.001)
58. Ezratty EJ, Stokes N, Chai S, Shah AS, Williams SE,
Fuchs E. 2011 A role for the primary cilium in Notch
signaling and epidermal differentiation during skin
development. Cell 145, 1129 1141. (doi:10.1016/j.
cell.2011.05.030)
59. Croyle MJ et al. 2011 Role of epidermal primary
cilia in the homeostasis of skin and hair follicles.
Development 138, 1675 1685. (doi:10.1242/dev.
060210)
60. Nam H-J, Chae S, Jang S-H, Cho H, Lee J-H. 2010
The PI3 K-Akt mediates oncogenic Met-induced
centrosome amplification and chromosome
instability. Carcinogenesis 31, 15311540. (doi:10.
1093/carcin/bgq133)
61. Quintyne NJ, Reing JE, Hoffelder DR, Gollin SM,
Saunders WS. 2005 Spindle multipolarity is
prevented by centrosomal clustering. Science 307,
127 129. (doi:10.1126/science.1104905)
62. Donehower LA, Harvey M, Slagle BL, McArthur MJ,
Montgomery CA, Butel JS, Bradley A. 1992 Mice
deficient for p53 are developmentally normal but
susceptible to spontaneous tumours. Nature 356,
215 221. (doi:10.1038/356215a0)
63. Fukasawa K, Choi T, Kuriyama R, Rulong S, Vande
Woude GF. 1996 Abnormal centrosome
amplification in the absence of p53. Science 271,
1744 1747. (doi:10.1126/science.271.5256.1744)
64. Andreassen PR, Lohez OD, Lacroix FB, Margolis RL.
2001 Tetraploid state induces p53-dependent arrest
of nontransformed mammalian cells in G1. Mol.
Biol. Cell 12, 13151328. (doi:10.1091/mbc.12.5.
1315)
Uetake Y, Sluder G. 2004 Cell cycle progression after
cleavage failure: mammalian somatic cells do not
possess a tetraploidy checkpoint. J. Cell Biol. 165,
609 615. (doi:10.1083/jcb.200403014)
66. Wong C, Stearns T. 2005 Mammalian cells lack
checkpoints for tetraploidy, aberrant centrosome
number, and cytokinesis failure. BMC Cell Biol. 6, 6.
(doi:10.1186/1471-2121-6-6)
67. Aylon Y, Michael D, Shmueli A, Yabuta N, Nojima H,
Oren M. 2006 A positive feedback loop between the
p53 and Lats2 tumor suppressors prevents
tetraploidization. Genes Dev. 20, 26872700.
(doi:10.1101/gad.1447006)
68. Tarapore P, Horn HF, Tokuyama Y, Fukasawa K. 2001
Direct regulation of the centrosome duplication
cycle by the p53-p21Waf1/Cip1 pathway. Oncogene
20, 31733184. (doi:10.1038/sj.onc.1204424)
69. Tarapore P, Tokuyama Y, Horn HF, Fukasawa K. 2001
Difference in the centrosome duplication regulatory
activity among p53 hot spot mutants: potential
role of Ser 315 phosphorylation-dependent
centrosome binding of p53. Oncogene 20,
6851 6863. (doi:10.1038/sj.onc.1204848)
70. Shinmura K, Bennett RA, Tarapore P, Fukasawa K.
2007 Direct evidence for the role of centrosomally
localized p53 in the regulation of centrosome
duplication. Oncogene 26, 2939 2944. (doi:10.
1038/sj.onc.1210085)
71. Mikule K, Delaval B, Kaldis P, Jurcyzk A, Hergert P,
Doxsey S. 2007 Loss of centrosome integrity induces
p38-p53-p21-dependent G1-S arrest. Nat. Cell Biol.
9, 160 170. (doi:10.1038/ncb1529)
72. Ganem NJ, Cornils H, Chiu S-Y, ORourke KP, Arnaud 15
J, Yimlamai D, Thery M, Camargo FD, Pellman D.
rsob.royalsocietypublishing.org
2014 Cytokinesis failure triggers hippo tumor
suppressor pathway activation. Cell 158, 833 848.
(doi:10.1016/j.cell.2014.06.029)
73. Landuzzi L et al. 2014 Genetic prevention of
lymphoma in p53 knockout mice allows the early
development of p53-related sarcomas. Oncotarget 5,
11 924 11 938. (doi:10.18632/oncotarget.2650)
74. Simpson CL, Patel DM, Green KJ. 2011
Deconstructing the skin: cytoarchitectural
determinants of epidermal morphogenesis. Nat.
Open Biol. 5: 150209
Rev. Mol. Cell Biol. 12, 565 580. (doi:10.1038/
nrm3175)
75. Williams SE, Ratliff LA, Postiglione MP, Knoblich JA,
Fuchs E. 2014 Par3-mInsc and Gai3 cooperate to
promote oriented epidermal cell divisions through
LGN. Nat. Cell Biol. 16, 758769. (doi:10.1038/
ncb3001)
76. Estrach S, Cordes R, Hozumi K, Gossler A, Watt FM.
2008 Role of the Notch ligand Delta1 in embryonic
and adult mouse epidermis. J. Invest. Dermatol.
128, 825832. (doi:10.1038/sj.jid.5701113)
77. Mahjoub MR, Stearns T. 2012 Supernumerary
centrosomes nucleate extra cilia and compromise
primary cilium signaling. Curr. Biol. 22,
1628 1634. (doi:10.1016/j.cub.2012.06.057)
78. Coelho PA, Bury L, Sharif B, Riparbelli MG, Fu J,
Callaini G, Glover DM, Zernicka-Goetz M. 2013
Spindle formation in the mouse embryo requires
Plk4 in the absence of centrioles. Dev. Cell 27,
586597. (doi:10.1016/j.devcel.2013.09.029)
79. Martindill DMJ, Risebro CA, Smart N, Franco-Viseras
MDM, Rosario CO, Swallow CJ, Dennis JW, Riley PR.
2007 Nucleolar release of Hand1 acts as a molecular
switch to determine cell fate. Nat. Cell Biol. 9,
1131 1141. (doi:10.1038/ncb1633)
80. Vooijs M, Jonkers J, Berns A. 2001 A highly efficient
ligand-regulated Cre recombinase mouse line shows
that LoxP recombination is position dependent.
EMBO Rep. 2, 292297. (doi:10.1093/embo-
reports/kve064)
81. Nowak JA, Fuchs E. 2009 Isolation and culture of
epithelial stem cells. Methods Mol. Biol. 482,
215232. (doi:10.1007/978-1-59745-060-7_14)
82. Zhu F et al. 2008 The mammalian SPD-2 ortholog
Cep192 regulates centrosome biogenesis. Curr. Biol.
18, 136 141. (doi:10.1016/j.cub.2007.12.055)