Systematics

and Phylogeny

Dr. Topik Hidayat

Biologi-UPI Bandung
 What is Systematics?
Aims to recognize, describe, name,
distinguish, relate and classify earths
organisms
Borrows from other fields--very much a
multidisciplinary, or hybrid, discipline
Supplies evidence to evolutionary
biology, ecology and other fields
Fundamental to all other scientific
endeavors (and many non-scientific
human concerns)
 Why is Systematics
Fundamental?
Why do we give names to entities?
Who cares if different labs studying
mutations in Arabidopsis thaliana, or
investigating genetic disease in
chimpanzees, work with the same
organism across labs? How do we
know?
How do we access information in
libraries and museums, in computer or
cabinet files, or on the internet?
 What is Systematics?
Uses diverse Molecular
approaches: Biology
Morphology Genetics
Anatomy Physiology
Palynology Ecology
Microscopy Evolution
Biochemistry
Bioinformatics
 Why is Systematics
Important?
Detailed information at all
hierarchical levels is key to most
scientific fields, medicine and
numerous aspects of human
society
Names of taxa (e.g., species), or
even individuals, are tags for
information retrieval and
knowledge synthesis
 Why is Systematics
Important?
Modern systematic studies provide
biological context to evolutionary
and ecological studies
Modern classifications are
predictive, can guide
bioprospecting for medicines,
foods, etc.
Species-level information can
guide conservation
Classifying Organisms

Systematics is the science of the relationships of organisms

Systematics is the science of how organisms are related and the

evidence for those relationships

Systematics is divided primarily into phylogenetics and taxonomy

Speciation -- the origin of new species from previously existing

ones
- anagenesis - one species changes into another over time
- cladogenesis - one species splits to make two

Reconstruct evolutionary history

Phylogeny
Phylogenetics

Evolutionary theory states that groups of similar organisms are descended

from a common ancestor.

Phylogenetic systematics is a method of taxonomic classification based

on their evolutionary history.
It was developed by Hennig, a German
entomologist, in 1950.

Willi Hennig (1913-1976)

Phylogenetics

Phylogenetics is the science of the pattern of evolution

Evolutionary biology versus phylogenetics

- Evolutionary biology is the study of the processes that generate

diversity

- Phylogenetics is the study of the pattern of diversity produced by

those processes
Phylogenetics

Who uses phylogenetics? Some examples:

Evolutionary biologists (e.g. reconstructing tree of life)

Systematists (e.g. classification of groups)

Anthropologists (e.g. origin of human populations)

Forensics (e.g. transmission of HIV virus to a rape victim)

Parasitologists (e.g. phylogeny of parasites, co-evolution)

Epidemiologists (e.g. reconstruction of disease transmission)

Genomics/Proteomics (e.g. homology comparison of new proteins)

 Phylogenetic trees

The central problem of phylogenetics:

how do we determine the relationships between taxa?

in phylogenetic studies, the most convenient way of presenting evolutionary

relationships among a group of organisms is the phylogenetic tree
 Phylogenetic trees

Node: a branchpoint in a tree (a presumed ancestral OTU)

Branch: defines the relationship between the taxa in terms of descent and
ancestry
Topology: the branching patterns of the tree
Branch length (scaled trees only): represents the number of changes that have
occurred in the branch
Root: the common ancestor of all taxa
Clade: a group of two or more taxa or DNA sequences that includes both their
common ancestor and all their descendents
Operational Taxonomic Unit (OTU): taxonomic level of sampling selected by
the user to be used in a study, such as individuals, populations, species, genera,
or bacterial strains

Branch
S p e c ie s A
Node
S p e c ie s B
Clade
Root
S p e c ie s C

S p e c ie s D

S p e c ie s E
Phylogenetics
What are useful characters?

Use homologies, not analogies!

- Homology: common ancestry of two or more character states

- Analogy: similarity of character states not due to shared ancestry

- Homoplasy: a collection of phenomena that leads to similarities in

character states
for reasons other than inheritance from a common ancestor
(e.g. convergence, parallelism, reversal)

Homoplasy is huge problem

in morphology data sets!

But in molecular data sets, too!

Cactaceae Euphorbiaceae
(cactus spines are (euphorb spines are
modified leaves) modified shoots)
 Phylogenetics

Molecular data and homoplasy

260 * 280 * 300 * 320

0841r : CCTTCAATTTTTATT-----------------------AGAGTTTTAGGAGAAATAAGTATGTG : 272
0992r : CCTCCAATTTTTATTAGCTTGCCTACTCCTTTGGGCACAGAGTTTTAGGAGAAATAAGTATGTG : 213
3803r : CCTCCAATTTTTATTAGCTTGCCTACTCCTTTGGGCACAGAGTTTTAGGAGAAATAAGTATGTG : 305
4062r : CCTCCAATTTTTATTAGCTTGCCTACTCCTTTGGGAACAGAGTTTTAGGAGAAATAAGTATGTG : 319
3802r : CCTCCAATTTTTATTAGTTTGCCTACTCCTTTGGGCACAGAGTTTTAGGAGAAATAAGTATGTG : 282
ph2f : CCTCCAATTTTTATTAGCTTGCCTACTCCTTTGGGCACAGAGTTTTAGGAGAAATAAGTATGTG : 306
CCTcCAATTTTTATTag ttgcctactcctttggg acAGAGTTTTAGGAGAAATAAGTATGTG

gene sequences represent character data

characters are positions in the sequence (not all workers
agree; some say one gene is one character)
character states are the nucleotides in the sequence (or amino
acids in the case of proteins)
Problems:
the probability that two nucleotides are the same just by chance
mutation is 25%
what to do with insertions or deletions (which may themselves be
characters)
homoplasy in sequences may cause alignment errors
Modern phylogenetic systematics are based on
cladistic analysis

a. A phylogenetic diagram (tree) is also called a cladogram.

b. Each branch in the tree is called a clade.

c. Monophyletic pertains to a taxon that is derived from a single ancestral

species. only legitimate cladogram type!

d. Polyphyletic pertains to a taxon whose members were derived from two or

more ancestors not common to all members.

e. Paraphyletic pertains to a taxon that excludes some members that share a

common ancestor with members included in the taxon.
Constructing cladograms
Identify homologies shared characteristics derived from one ancestor.

NOTE: Analogous structures may look similar to one another, but are not
derived from a common ancestor. These are in contrast to homologous
structures.

Fig. below is an example of an analogous structure in two distantly related

plants.

When two organisms have analogous structures, this is an example of

convergent evolution Independent development of similarity between
species due to similar selection pressures.
Example of how to construct a cladogram:

1. Select your species for which you want to make a cladogram. These are
called the ingroup. They have shared primitive and derived characters.
2. Select an outgroup a species that is closely related to the species
under study, the outgroup has a shared primitive character that is common
to all species.
3. Construct a character table and tabulate the data. The more shared
characters, the more closely related are the species.
4. Construct a cladogram based on the number of shared characters. For
example:
Figure in next slide Constructing a cladogram.
The outgroup here, the lancelet has a notochord, the shared primitive
character. The ingroup is five vertebrates.
Phylogeny can be inferred also from
molecular data
DNA and RNA sequences of nucleic acids can be
compared to determine phylogeny. Example to follow.

Note that each change in a nucleic acid = one

evolutionary event! The more events, the more distantly
related are the species. Fewer events means that a
species is more closely related.
The Phylogenetic Approach in Practice

Basal Dicots
Magnoliids
Monocots

Eudicots

Judd et al. (2002)

 BARCODING LIFE
Barcoding is a standardized approach to
identifying plants and animals by minimal
sequences of DNA, called DNA barcodes.

DNA Ba rcode : A s hort DNA s e que nce , from

a uniform loca lity on the ge nome , us e d for
ide ntifying s pe cie s .
Why ba rcode a nima l a nd pla nt s pe cie s ?
By ha rne s s ing a dva nce s in e le ctronics a nd
ge ne tics , ba rcoding will
he lp ma ny pe ople quickly a nd che a ply
re cognize known s pe cie s a nd re trie ve
informa tion a bout the m
s pe e d dis cove ry of the millions of s pe cie s
ye t to be na me d
provide vita l ne w tools for a ppre cia ting a nd
ma na ging the Ea rths imme ns e a nd
cha nging biodive rs ity.
Wha t a re the be ne f its of s ta nda rdiza tion?
Why ba rcode a nima ls with mitochondria l
DNA?
Mitochondria , e ne rgy- producing orga ne lle s in pla nt
a nd a nima l ce lls , ha ve the ir own ge nome . Twe nty
ye a rs of re s e a rch ha ve e s ta blis he d the utility of
mitochondria l DNA s e que nce s in diffe re ntia ting
a mong clos e ly- re la te d a nima l s pe cie s .

P la nt: mtDNA not s uita ble ; low dive rs ity

 Four prope rtie s ma ke mitochondria l
ge nome s [Cytochrome c oxida s e I (COI)]
e s pe cia lly s uita ble for ide ntifying s pe cie s :
Greater differences among species

Copy number. There are 100-10,000 more copies of

mitochondrial than nuclear DNA per cell

Relatively few differences within species

Introns, which are non-coding regions interspersed between

coding regions of a gene, are absent from mitochondrial DNA
Ba rcoding
North
Ame rica n
birds
highlights
proba ble
cryptic s pe cie s
Ba rcode s a ff ri m the
unity of the s pe cie s
H omo sapiens.
Compa ris ons s how we
diffe r from one a nothe r
by only 1 or 2
nucle otide s out of 648,
while we diffe r from
chimpa nze e s a t 60
loca tions a nd gorilla s a t
70 loca tions .
Ca n ba rcode s
a id
unde rs ta nding
his tory of
a nima l a nd
pla nt s pe cie s ?
Cladistic versus Phenetics

Within the field of taxonomy there are two

different methods and philosophies of
building phylogenetic trees: cladistic and
phenetic
Phenetic methods construct trees (phenograms) by
considering the current states of characters without regard to
the evolutionary history that brought the species to their current
phenotypes;
phenograms are based on overall similarity

Cladistic methods construct trees (cladograms) rely on

assumptions about ancestral relationships as well as on current
data; cladograms are based on character evolution (e.g.
shared derived characters)

Cladistics is becoming the method of choice; it is considered to be more powerful

and to provide more realistic estimates, however, it is slower than phenetic
algorithms
Tha nk you for your a tte ntion