Scientia Horticulturae 161 (2013) 249258

Contents lists available at ScienceDirect

Scientia Horticulturae
journal homepage: www.elsevier.com/locate/scihorti

Changes in leaf morphology, antioxidant activity and photosynthesis

capacity in two different drought-tolerant cultivars of
chrysanthemum during and after water stress
Jing Sun 1 , Jing Gu 1 , Jun Zeng, Shuang Han, Aiping Song, Fadi Chen, Weimin Fang,
Jiafu Jiang, Sumei Chen
College of Horticulture, Nanjing Agricultural University, Nanjing 210095, China

a r t i c l e i n f o a b s t r a c t

Article history: Two chrysanthemum cultivars, drought tolerant Nannong Xuefeng and drought sensitive Nannong
Received 9 January 2013 Jingyan were subjected to 7-day drought stress by withholding irrigation, followed by re-watering for 3
Received in revised form 22 June 2013 days. We analyzed the biomass, morphological characteristics, physiological changes, and transcription
Accepted 12 July 2013
proles of genes involved in reactive oxygen species (ROS) scavenging. The biomass of Nannong Xuefeng
increased 67.5% by 7-day drought, while little increase was observed in drought sensitive Nannong
Keywords:
Jingyan. It showed that Nannong Xuefeng had denser trichomes, lower stomata density and greater
Drought stress
quantities of wax on leaf surfaces, i.e., 2.3- and 3-fold of wax in Nannong Jingyan, respectively. Leaves of
Chrysanthemum
Antioxidant enzyme
Nannong Jingyan had a higher concentration of superoxide anion radicals, malondialdehyde, and proline,
Photosynthesis however, these indicators in Nannong Xuefeng were stable throughout the duration of drought stress
Leaf surface morphology and rehydration. Other important factors leading to drought tolerance in chrysanthemums are associated
with reduced ROS damage; these factors include higher activities of antioxidant enzymes, such as SOD
(EC 1.15.1.1), POD (EC 1.11.1.7), and CAT (EC 1.11.1.6), and induced expression of genes encoding these
enzymes and APX (EC1.11.1.11). Although stomatal conductance, net photosynthetic rate, transpiration
rate, chlorophyll concentration, and chlorophyll uorescence of the two cultivars both decreased with the
reduced soil water content, the decreases occurred earlier and were more apparent in Nannong Jingyan
that in Nannong Jingyan. In addition, Nannong Xuefeng had a higher photosynthetic capacity during the
stress. Our ndings provide new insights into the mechanisms of drought tolerance in chrysanthemum
plants.
2013 Elsevier B.V. All rights reserved.

1. Introduction
During their life cycle, plants may experience frequent periods
of water decit, and drought is one of the major abiotic stresses
affecting plants (Farooq et al., 2009). The capacity of withstanding
a water limitation period and the capacity for rapid recovery after
rewatering may be adaptive to plants (Galms et al., 2007). Some
Abbreviations: APX, ascorbate peroxidase; CAT, catalase; Ci , intercellular CO2
concentration; F m , maximum uorescence in light-adapted state; Fs , steady-state
uorescence in light-adapted state; Fv /Fm , maximum quantum efciency of PSII
photochemistry; Gs , stomatal conductance; H2 O2 , hydrogen peroxide; MDA, malon-
dialdehyde; O2 , superoxide anion radical; Pn , net photosynthetic rate; POD,
peroxidase; PSII, actual photosynthetic efciency of PSII photochemistry; ROS,
reactive oxygen species; RWC, relative water content; SOD, superoxide dismutase;
SWC, soil volumetric water content; Tr , transpiration rate.
Corresponding author. Tel.: +86 2584399670; fax: +86 2584395266.
E-mail address: chensm@njau.edu.cn (S. Chen).
1
These authors contributed equally to this work.
differences found between species with respect to growth and sur-
vival can be attributed to different abilities for water acquisition,
transport and conservation, as well as differences in metabolism
(de Carvalho et al., 2011).
Plants exploit morphological characteristics of drought adapta-
tion that ensure maximum water absorption during dry conditions.
For example, the cuticle serves creating an effective barrier against
water loss (Mackov et al., 2013). When stomata are closed during
drought stress, however, plant survival depends on the amount of
water lost through the cuticle. The interplay between stomatal and
cuticular water loss regulation is thus essential for plants coping
with water shortages (Mackov et al., 2013). Transpiration through
the cuticle is dependent on physical and chemical properties of the
leaf surface, especially wax content.
When higher plants are exposed to exogenous environmen-
tal stresses, ROS are frequently generated (Munne-Bosch and
Penuelas, 2003), leading oxidative modications to proteins, lipids,
and DNA, and impair normal cell functions (Sairam et al., 2005).
To remove ROS, plants have evolved a well-developed antioxidant

0304-4238/$ see front matter 2013 Elsevier B.V. All rights reserved.
http://dx.doi.org/10.1016/j.scienta.2013.07.015
250 J. Sun et al. / Scientia Horticulturae 161 (2013) 249258
defense system. Previous studies have shown that drought tol-
erant cultivars generally have enhanced constitutive antioxidant
enzyme activity under drought stress in comparison with sensi-
tive cultivars. This has been demonstrated under water-limiting
stress in numerous plant species, such as Pinus densata (Gao et al.,
2009), mulberry (Guha et al., 2010) and woody karst species (Liu
et al., 2011). Little research, however, has been carried out on gene
expression levels associated with antioxidant defense systems.
Osmotic adjustment, accomplished via compatible solute accu-
mulation, is a major process in postponement of dehydration stress
during water-scarce conditions (Morgan, 1990). Proline is one of
the most important cytosolutes, and its concentration has been sug-
gested as a general indicator for drought tolerance (Ahmed et al.,
2009; Liu et al., 2011).
The limitation of plant growth imposed by low water availabil-
ity is mainly due to reduction of plant carbon balance, which is
largely dependent on photosynthesis (Flexas and Medrano, 2002).
Photosynthesis is one of the most sensitive processes in response to
drought stress. During drought stress, the rst response of almost
all plants is stomatal closure to prevent transpirational water loss
(Alscher and Cumming, 1990). Stomatal closure limits CO2 absorp-
tion and leads to a parallel decline in photosynthesis. When drought
stress is more severe, non-stomatal limitations on photosynthe-
sis are observed, including protein degradation, declining Rubisco
activity, and reduced photosystem II quantum efciency (Reddy
et al., 2004). During initial stages of drought stress, rapid stomatal
closure is conducive both to water conservation and maintenance
of higher photosynthetic and metabolic activity (Hu et al., 2010).
Chrysanthemum (Chrysanthemum morifolium), an important
ornamental plant native to China, is widely cultivated for orna-
mental purposes around the world (Li, 1993). Chrysanthemum
production is highly labor-intensive in terms of water manage-
ment; because of water scarcity, the breeding of drought tolerant
chrysanthemums is thus highly desirable. To the best of our
knowledge, however, little information on mechanisms of drought
tolerance in cut chrysanthemums is available. In this study, in order
to illustrate the inter-linked mechanisms underlying chrysan-
themum drought tolerance, we evaluated leaf epidermal surface
morphology, antioxidant activity, and photosynthetic characteris-
tics in two cultivars. We also examined the expression of genes
encoding antioxidant defense systems in chrysanthemums. The
present research inferred that a comprehensive adaption was
employed for chrysanthemum to cope with drought stress.
2. Materials and methods
2.1. Plant materials
Cut chrysanthemum cultivars Nannong Xuefeng (drought tol-
erant) and Nannong Jingyan (drought sensitive) were obtained
from the Chrysanthemum Germplasm Resource Preservation Cen-
ter, Nanjing Agricultural University, China. Plants were grown in
pots (15 cm in diameter 12 cm in depth) containing a mixture
of loamy garden soil, perlite, and vermiculite (3:2:1, v/v/v) and
maintained in a greenhouse with a mean temperature of 26/19 C
(day/night), relative humidity of 7585%, photon ux density of
600700 mol m2 s1 . Morphologically uniform seedlings at the
810-leaf stage were selected for drought stress experiments. Well-
watered plants were used as controls. Control plants were watered
every other day to eld capacity. Plants undergoing drought stress
treatment were subjected to 7-day drought stress by withholding
irrigation, then plants were rewatered to eld capacity and fol-
lowed by a recovery for 3 days. The experiment was carried out
using a completely randomized split-plot design with three repli-
cates. Each replicate consisted of ve plants, giving a total of 15
plants per treatment. Samples were harvested 0, 3, 5, and 7 days
after drought stress, and also post-drought after 3-day re-watering.
Fully expanded leaves at the third or fourth positions from the apex
of the shoot were sampled.
2.2. Soil water status and leaf water status
Soil water status and leaf water status were determined by mea-
suring soil volumetric water content (SWC) and leaf relative water
content (RWC), respectively, in the morning (9 a.m.10 a.m.). SWC
of soil in a 010 cm from the soil surface of each pot was mon-
itored by time domain reectometry (Soil Moisture Equipment
Corp., Santa Bar-bara, CA). RWC was determined according to Guha
et al. (2010). RWC (%) = [(fw dw)/(sw dw)] 100, where fw is
fresh weight of sampled leaves, sw is the mass after rehydration by
soaking sampled leaves in distilled water for 24 h, and dw is oven
dry weight (105 C) of leaves. Each data point represented the mean
of three independent samples.
2.3. Measurement of root/shoot ratio
In order to determine biomass accumulation, roots and shoots
of two cultivars were sampled on 7 days after drought stress. Dry
mass of shoots and roots was determined after being dried at 105 C
until constant weight. Root/shoot ratio was calculated as total root
biomass divided by shoot biomass. Changes in root/shoot ratio
was expressed in [(R:S(drought) R:S(control) )/R:S(control) ] 100%. The
changes in root/shoot ratio of each cultivar were a mean value
obtained from 5 individual plants.
2.4. Morphological characteristics of chrysanthemum lower leaf
epidermis
The surface structure of the lower leaf epidermis was observed
by scanning electron microscopy. Specimens were prepared
according to He et al. (2011). To calculate trichome density and
stomata density, each sample was observed under 10 different
microscope visual elds. Wax extraction and estimation followed
the protocol of Russin et al. (1997). For the extraction, 1-g leaf
samples were immersed in 50 ml of chloroform for 60 s at room
temperature. The wax content of each cultivar was a mean value
obtained from 20 independent samples.
2.5. Measurement of enzymatic antioxidants and protein content
A 0.5-g leaf sample was ground to a ne powder in liquid
nitrogen and extracted by homogenization in 5 ml 50 mM potas-
sium phosphate buffer (pH 7.0) containing 1 mM EDTA and 1%
(w/v) polyvinyl pyrrolidone 30. The homogenate was centrifuged
(12,000 g, 15 min, 4 C) and the supernatant used for subsequent
enzyme assays. SOD, CAT, and APX activities were determined as
described in Yin et al. (2009). In particular, SOD activity was assayed
by the photochemical NBT method. 100 l supernatant was added
to 2.9 ml reaction mixture containing 50 mM potassium phosphate
buffer (pH 7.8), 13 mM l-methionine, 75 M NBT, 2 M riboavin
and 1 mM EDTA. Then the reaction was illuminated for 10 min in
white uorescent light (100 mol2 s1 ), and the absorbance was
recorded at 560 nm. One unit of SOD activity was dened as the
quantity sufcient to inhibit the reduction of NBT by 50% per min
per mg protein. CAT activity was determined by tracking the con-
sumption of H2 O2 at 240 nm. Each reaction was initiated by adding
100 l supernatant into 2.9 ml reaction mixture containing 50 mM
potassium phosphate buffer (pH 7.0) and 15 mM H2 O2 . One unit of
CAT activity was dened to be equivalent to the amount of enzyme
required to degrade 0.1 mol of H2 O2 per min per mg protein. APX
activity was assayed by monitoring the decline in absorbance in the
 J. Sun et al. / Scientia Horticulturae 161 (2013) 249258
presence of ascorbic acid at 290 nm. Each reaction was initiated by
adding 100 l supernatant into 2.9 ml reaction mixture containing
50 mM potassium phosphate buffer (pH 7.0), 0.5 mM ascorbate and
15 mM H2 O2 . One unit of APX activity was dened to be equivalent
to the amount of enzyme required to degrade 0.01 mol of H2 O2
per min per mg protein. Following He et al. (2011), POD activity
was estimated from the absorbance change at 470 nm caused by
the oxidation of guaiacol. One unit of POD activity was dened to be
equivalent to the amount of enzyme required to degrade 0.01 mol
of substrate per min per mg protein. Protein concentration was
measured based on the method of Bradford (1976), using bovine
serum albumin as a standard.
2.6. Superoxide anion radical,oxidative damage to lipids and
proline concentration
Superoxide anion radical (O2 ) content in leaves was deter-
mined according to Zhao and Zou (2002). A 0.5 g (fresh mass) leaf
sample was homogenized in 2 ml of 50 mM phosphate buffer (pH
7.8) at 4 C. The homogenate was ltered through four layers of
cheesecloth and centrifuged at 5000 g for 10 min. A volume of
0.9 ml of 65 mM phosphate buffer and 0.1 ml of 10 mM hydroxyl-
amine chloride reagent was added to 1 ml of the supernatant and
incubated in a water bath at 25 C for 20 min. A fresh mixture,
made by combining 0.5 ml of the incubated solution with 0.5 ml
of 17 mM p-aminobenzene sulfonic acid and 0.5 ml of 7 mM -
naphthylamine, was incubated at 25 C for 20 min. After incubation,
the liquid became colored, and an equal volume of ether was added.
The mixture was stirred and then centrifuged at 1500 g for 15 min,
and the absorbance of the pink layer was measured at 530 nm.
O2 content was calculated according to a NO2 standard curve and
expressed as nmol mg1 protein min1 .
Lipid peroxidation was measured in terms of malondialdehyde
(MDA) concentration. MDA concentration was determined using
the thiobarbituric acid method according to Yin et al. (2009). The
level of lipid peroxidation was expressed as nmol g1 fresh weight.
Proline concentration was determined by the ninhydrin method
according to Guha et al. (2010) with minor modications. A 0.5 g
leaf sample was homogenized in 10 ml 3% (w/v) aqueous sulfos-
alicylic acid, and the homogenate was centrifuged at 12,000 g
for 10 min. The supernatant was boiled in 3 ml acid ninhydrin
for 30 min, cooling to room temperature. The absorbance of the
supernatant was recorded at 520 nm. Proline concentration was
expressed as g g1 fresh weight.
2.7. Photosynthesis related parameters and chlorophyll
concentration
Net photosynthetic rate (Pn ), stomatal conductance (Gs ), tran-
spiration rate (Tr ), and intercellular CO2 concentration (Ci ) of
fully expanded leaves were determined at 9 a.m. and 11 a.m.
using a LI-COR 6400 portable photosynthesis system (LI-COR,
Lincoln, NE, USA). The CO2 concentration in the chamber was
380 10 mol mol1 , and a photosynthetic photon ux density of
800 mol m2 s1 at the leaf surface was provided by an LED red-
blue light source (LI-COR 6400-02). For each treatment, Pn , and Gs
values were obtained for 10 leaves at each time point.
Maximum quantum efciency of PSII photochemistry (Fv /Fm )
and actual photosynthetic efciency (PSII) were determined
using the LI-COR 6400 portable photosynthesis system (LI-COR,
Lincoln, NE, USA) in the morning (8:0011:30 a.m.). Measurements
were made on the fully expanded leaves with the uorometer after
plants were adapted in darkness for 30 min. Determination of Fv /Fm
was based on the method of Liu et al. (2011). Steady-state uores-
cence (Fs ) and maximum uorescence (Fm  ) of light-adapted leaves
were measured when uorescence reached a steady-state level.
251
Table 1
Primers and sequences used in this study.
Primer Sequence (5 3 )
POD-F TTGACACGAAGGTTAGCCAGAC
POD-R CCATCACCAGCCAACGACA
Cu-Zn SOD-F ATTCCCCACTTCAAATCCCA
Cu-Zn SOD-R AGTCCCTTTAAGCACAGCAACA
Mn-SOD-F TGTGAATCACTCAATTTTCTTGGAA
Mn-SOD-R GCACCTTCGGCACTCATTTT
CAT-F ACTCATCCTTGACTGTTGGCACT
CAT-R GCACGGAGAAAATCAGCACA
APX-F CGCTTTGTGCTAACACGACAC
APX-R CAGATATTGCATTGCTGGATGAT
CmGAPDH-F GCTGTATCCCCATTCGTT
CmGAPDH-R AGAAGGCAAGCTCAAGGG
PSII was calculated as (Fm F )/F  (Yang et al., 2011). For each
s m
treatment, Fv /Fm and PSII were obtained for 5 leaves at each time
point.
Chlorophyll was extracted in 95% ethanol for 48 h and the
absorbance of the supernatant was recorded at 470, 649 and
665 nm. Total chlorophyll (a + b) concentration was determined fol-
lowing Yang et al. (2011) and expressed in mg g1 fresh weight.
2.8. qRT-PCR analysis of genes encoding antioxidant enzymes
Total RNA was isolated from leaves using RNAiso reagent
(Takara, Japan) following the manufacturers instructions. Gene
expression proles were obtained by real-time quantitative PCR
(qRT-PCR) performed on an iQ5 PCR device (Bio-Rad, USA). PCR
volumes and conditions were as reported in Lv et al. (2011). The
chrysanthemum CmGAPDH (DK941612) gene was used as a con-
trol. Three biological replicates were included. Primer sequences
used for qRT-PCRs of POD, Cu-Zn SOD, Mn-SOD, CAT, and APX genes
are listed in Table 1. The identities of amplicons and specicity of
reactions were veried by agarose gel electrophoresis and melting
curve analyses. The data were analyzed using Bio-Rad iQ5 optical
system software v.1.0. The level of gene expression was given by
2Ct . All assays were performed at least three times. The Ct
(threshold cycle) values were calculated by subtracting the Ct value
of GAPDH from the arithmetic mean Ct value of the target gene.
The Ct values were calculated by subtracting the Ct values
of control plant from the Ct value of treatment plant (Livak and
Schmittgen, 2001).
2.9. Statistical analysis
The data were expressed as means standard errors. SPSS v13.0J
and Microsoft Excel 2003 were used for statistical analysis. To
determine differences among cultivars and treatments for each
variable at each sampling time point, a one-way analysis of variance
(ANOVA) followed by Duncans multiple range test (with P = 0.05)
was employed.
3. Results
3.1. Soil water status, leaf water status and biomass changes
At the beginning of drought treatments, soil volumetric water
content (SWC) of soil-grown Nannong Xuefeng (designated as NX)
and Nannong Jingyan (designated as NJ) was 44.2% and 45.1%,
respectively, while, it had declined to 6% and 5.7% at 7 days after
drought stress (Fig. 1A). After re-watering, SWC of the two culti-
vars returned to control levels. There was no signicant difference
between SWC in the two cultivars under control, drought, or re-
watered conditions.
252 J. Sun et al. / Scientia Horticulturae 161 (2013) 249258
Fig. 1. Soil water content (A) and leaf relative water content (B) in Nannong Xuefeng (NX) and Nannong Jingyan (NJ) subjected to drought stress and re-watering. CK:
well-watered; D: drought stress treatments of 0, 3, 5, and 7 days, and 3 days after re-watering (10 days). **Signicant difference (P 0.01) based on Duncans multiple range
test, in comparisons between the two cultivars at a given day of treatment. Values are means SD (n = 3).
Under control conditions, leaf relative water content (RWC) of
both cultivars was about 84% (Fig. 1B). Drought stress induced a pro-
gressive decrease in RWC of both cultivars during the 7-d drought
treatment period (Fig. 1B). At 7 days after drought stress, RWC was
reduced to 68.8% and 45.5%, respectively, in NX and NJ. RWC of NX
was restored to the control level after 3 days of re-watering, but
this was not the case for NJ. The RWC of NJ was signicantly lower
than that of NX after 5 days of drought stress and 3 days of water
recovery.
Root/shoot ratio of Nannong Xuefeng increased by 67.5% which
was signicantly higher than that of Nannong Jingyan (by 0.5%)
by 7-d after drought, indicating that Nannong Xuefeng can still
accumulated biomass under the 7-day progressive drought.
3.2. Variation in lower leaf epidermal morphology between the
two chrysanthemum cultivars
A signicant difference was observed between the leaf surface
structures of the two cultivars. Trichome density in NX was greater
than in NJ (Table 2 and Fig. 2A and B). Furthermore, the leaf surface
of NX was covered with a thick layer of wax crystals, while in NJ the
surface was only sparsely covered (Fig. 2CF). NX had signicantly
greater quantity of wax but lower stomatal density than NJ (18.9
vs 6.4 mg g1 FW; 95.58 vs 76.01 per mm2 , respectively) (Table 2).
3.3. Antioxidant enzyme activity and qRT-PCR analysis of
antioxidant genes
SOD activity was greater in NX than in Nannnong Jingyan after
3 days of drought stress (Fig. 3A). On day 7, SOD activity was 1.7
and 1.4 times, respectively, higher than control levels in NX and NJ.
Moreover, NX had a signicantly higher SOD activity than NJ after
3 days of re-watering (Fig. 3A).
There was a decline in POD activity on day 3, an increase on day
7, and a decline after re-watering in both cultivars (Fig. 3B). The
greatest increase occurred on day 7 in NX (2.5 times higher than
the background level and 1.7 times the NJ level). After 3 days of re-
watering, the POD activity in NJ was no different from background
level, while in NX it was 1.5 times of the background level (Fig. 3B).
Table 2
Variation in lower leaf surface morphology in chrysanthemum cultivars Nannong Xuefeng and Nannong Jingyan.
Cultivar Epidermal trichome density (mm2 )
Nannong Xuefeng 132.0 8.1 A
Nannong Jingyan 57.3 4.8B
Note: Values (given as mean S.E.) labeled with a different letter differed signicantly (P 0.01).
A rapid increase in APX activity was observed in NJ from day 3
to day 7, being 2.8 times higher on day 7. In NX, there was a decline
in APX activity on day 5, but APX activity then increased rapidly
and peaked on day 7 (3.0 times higher than the background level)
(Fig. 3C). Moreover, APX activity was higher in NX than in NJ after
3 days of re-watering (Fig. 3C).
Under drought treatment, CAT activity in NX signicantly
increased and peaked on day 7, reaching 2.4 times the control level
(Fig. 3D). Drought stress also elevated CAT levels in NJ, which were
signicantly higher than in 5-d drought-stressed NX. Moreover,
CAT activity in NJ was restored to control levels by re-watering,
whereas CAT levels in NX remained signicantly higher than those
of controls (Fig. 3D).
Drought stress signicantly increased Cu-Zn SOD and Mn-SOD
expression levels in both cultivars (Fig. 4A and B). On day 5, Cu-Zn
SOD expression was 2.7 times higher than the control in NJ, and
9.1 times greater in NX. Likewise, during the same period Mn-SOD
expression peaked at 2.0 and 7.6 times background levels in NJ and
NX, respectively (Fig. 4A and B). After 3 days of re-watering, expres-
sion levels of Cu-Zn SOD and Mn-SOD in NX were still at higher levels
compared with controls (Fig. 4A and B).
POD expression levels in NX reached a maximum on day 5, 3.0
times the background level, whereas those in NJ were 2.5 times
the background level. POD expression levels in both cultivars were
decreased on day 7 after drought and day 3 after re-watering, with
POD transcript abundance being higher in NX than in NJ (Fig. 4C).
CAT expression was clearly induced by drought in both culti-
vars (Fig. 4D). The rate of increase of CAT expression was more
pronounced in NX than in NJ. On day 5, CAT expression in both
cultivars reached a peak, to 1.8 times the control level in NJ and 2.6
times the control level in NX (Fig. 4D). Moreover, CAT expression
levels were higher in NX than in NJ at 3 days after re-watering.
Changes in APX expression in response to drought were similar
to those in CAT (Fig. 4E). APX expression levels in NJ peaked at 2
times higher than the control level by day 3. In NX, APX expression
levels peaked at 11.2 times higher by day 5. After re-watering, APX
expression levels of NJ were restored to control levels, whereas in
NX this value was 1.7 times background levels.
Variations in gene expression were similar to variation in
antioxidant enzyme activity, although the increase in antioxidant
Waxiness content (mg g1 ) Stoma density (mm2 )
18.9 1.5
A
76.01 6.03A
6.4 0.9B 95.58 9.46B
 J. Sun et al. / Scientia Horticulturae 161 (2013) 249258 253

Fig. 2. SEM micrographs of leaf epidermis in Nannong Xuefeng and Nannong Jingyan. (A, C and E) Leaf of Nannong Xuefeng; (B, D and F) leaf of Nannong Jingyan; (A and
B) lower epidermis of leaf, showing trichome distribution; (CF) waxiness of leaf surface.

activity lagged behind the related gene expression. Peak expression
in SOD, POD, CAT and APX in NX and SOD and CAT in NJ occurred dur-
ing 5 days drought stress, while the highest POD and APX expression
levels in NJ emerged on day 3 of drought stress.
3.4. Superoxide anion radical and oxidative damage to lipids
In both cultivars, O2 concentration remained low under con-
trol conditions, and O2 production was sensitive to drought stress
(Fig. 5A). In drought-stressed NJ plants, O2 concentration was sig-
nicantly higher than in control plants throughout the drought
stress period, and it increased to levels 2.81 times higher on day 7
compared with controls, about two-fold that of NX on day 7; after
re-watering, it declined and remained at a higher level than that of
controls (Fig. 5A). NX accumulated less O2 than in NJ. In drought-
stressed NX plants, O2 concentration reached a maximum on day
7 (2.0 times background level), and it decreased to control levels
after recovery from drought (day 10).

Fig. 3. SOD, POD, APX, and CAT activity in Nannong Xuefeng (NX) and Nannong Jingyan (NJ) subjected to drought stress and re-watering. CK: well-watered; D: drought
stress treatments of 0, 3, 5, and 7 days, and 3 days after re-watering (10 days). * and ** signicant differences (respectively, P 0.05 and P 0.01) based on Duncans multiple
range test, in comparisons between the two cultivars at a given day of treatment. Values are means SD (n = 3).
254 J. Sun et al. / Scientia Horticulturae 161 (2013) 249258

Fig. 4. Gene expression of (A) Cu-Zn SOD, (B) Mn-SOD, (C) POD, (D) CAT, and (E) APX in Nannong Xuefeng (NX) and Nannong Jingyan (NJ) subjected to drought stress and
re-watering. CK: well-watered; D: drought stress treatments of 0, 3, 5, and 7 days, and 3 days after re-watering (10 days).

MDA concentration in NX remained at low levels during the
whole drought period (Fig. 5B). In contrast, MDA concentration in
NJ increased to 1.4 and 2.6 times background levels on days 3 and 7,
respectively. After re-watering, this value was signicantly higher
than in the control.
3.5. Proline concentration
During drought stress, proline concentration uctuated in NJ
and rose gradually in NX (Fig. 6). On day 7 of drought stress, pro-
line concentration in NX and NJ had increased to 1.9 and 3.1 times
background levels, respectively. After 3 days of re-watering, proline
concentrations of stressed plants in both cultivars were restored to
control levels.
3.6. Photosynthetic parameters
Signicant reductions in Pn and Gs in both cultivars were
induced by drought (Fig. 7). The extent of the decrease in Pn was
less in NX (Fig. 7A). On day 7, Pn in NJ was a negative value, while Pn
was 17.6% of the control level in NX. After recovery, Pn was restored
to 69.5% and 37.4% of control levels in NX and NJ, respectively.
Reduction in Gs was more apparent in Nannong Jingyan than in
NX (Fig. 7B). On day 7, Gs in NJ had declined to almost zero, while
the corresponding value was 7.9% of control levels in NX.
3.7. Chlorophyll uorescence and concentration
There was a progressive drop in chlorophyll concentration in
both cultivars over the entire course of the drought treatment,
although the two cultivars differed signicantly from one another
with respect to the induced level of this parameter (Fig. 8). On day 7,
the leaf chlorophyll concentration of NX and NJ decreased to 49.7%
and 25.4% of the background levels, respectively. After re-watering,
chlorophyll concentration was restored to 92.8% of background lev-
els in NX and to 68.4% in NJ (Fig. 8).
Leaf Fv /Fm and PSII in control plants of both cultivars were con-
stant throughout the experiment (Fig. 9A). On day 5, Fv /Fm began to

Fig. 5. Superoxide anion (O2 ) and MDA content in Nannong Xuefeng (NX) and Nannong Jingyan (NJ) subjected to drought stress and re-watering. CK: well-watered; D:
drought stress treatments of 0, 3, 5, and 7 days, and 3 days after re-watering (10 days). * and ** signicant differences (respectively, P 0.05 and P 0.01) based on Duncans
multiple range test, in comparisons between the two cultivars at a given day of treatment. Values are means SD (n = 3).
 J. Sun et al. / Scientia Horticulturae 161 (2013) 249258 255

Fig. 6. Protein content in Nannong Xuefeng (NX) and Nannong Jingyan (NJ) sub-
jected to drought stress and re-watering. CK: well-watered; D: drought stress
treatments of 0, 3, 5, and 7 days, and 3 days after re-watering (10 days). **Signicant
difference (P 0.01) based on Duncans multiple range test, in comparisons between
the two cultivars at a given day of treatment. Values are means SD (n = 3).
Fig. 8. Chlorophyll (a + b) concentration in Nannong Xuefeng (NX) and Nannong
Jingyan (NJ) subjected to drought stress and re-watering. CK: well-watered; D:
drought stress treatments of 0, 3, 5, and 7 days, and 3 days after re-watering (10
days). * and ** signicant differences (respectively, P 0.05 and P 0.01) based on
Duncans multiple range test, in comparisons between the two cultivars at a given
day of treatment. Values are means SD (n = 3).

decline in both cultivars. On day 7, Fv /Fm in NX and NJ had decreased

to 66% and 45.7%, respectively, of background levels (Fig. 9A). After
recovery, Fv /Fm was 92% of the control level in NX and 52% of the
control level in NJ. PSII was negatively affected by drought stress
in both cultivars (Fig. 9B). On day 7, PSII was 48.5% and 25.2% of
the background levels in NX and NJ, respectively. On day 3 after
recovery, PSII was restored to 56.9% and 80.1% of the background
levels in NX and NJ, respectively (Fig. 9B).
4. Discussion
We monitored the soil volumetric water content (SWC) of soil-
grown NX and NJ, and found that there was no signicant difference
between SWC in the two cultivars under control, drought, or re-
watered conditions. The consistency of the experimental setup was
therefore ensured. After 7-day drought stress, the growth was ham-
pered in drought sensitive NJ but not in drought tolerant NX in
terms of changes in root/shoot ratio, it inferred a 7-day drought
could be an appropriate stress dose for testifying drought tolerance
of chrysanthemum.
Lower leaf epidermal surfaces differed signicantly between
the two cultivars, as did their levels of drought tolerance. It has
been proposed that leaf trichomes function as a physical barrier to
drought and heat stress (Sandquist and Ehleringer, 2003). In our
study, the drought-tolerant cultivar (NX) had consistently higher
trichome density. Trichome density may thus be a useful selec-
tion criterion for improving chrysanthemum drought tolerance. It
has also been suggested that cuticular waxes are mainly responsi-
ble for cuticular barrier properties during drought stress (Riederer
and Schreiber, 2001). We found that NX also had larger amounts
of cuticular wax and less stomatal density than NJ (Table 2). All
these features of leaves contribute to reducing water loss capabil-
ities of NX. Our research found that NX had a higher RWC than NJ
under drought stress (Fig. 1B), which is in agreement with their
morphological symptoms. The water situation is one of the most
important plant physiological parameters, and RWC is indicative
of a relationship between physiological traits and level of drought
tolerance (Farooq et al., 2009).
As is well known, drought stress causes a marked increase in
oxidative damage to plants (Bartoli et al., 2004; Sairam et al., 2005).
We observed O2 concentration increased signicantly and pro-
gressively during the duration of drought stress in both cultivars.
The relative magnitude of this increase was lower in NX than in NJ
during 7 days of drought stress (Fig. 5A). High ROS levels are known
to increase lipid peroxidation, allowing MDA concentration to be
used as an indicator of oxidative stress peroxidation of membrane
lipids (Wu et al., 2003). The MDA content of NJ was higher than NX
during the entire drought stress and re-watering period (Fig. 5B),
showed a similar trend to their O2 concentration.

Fig. 7. Levels of (A) Pn and (B) Gs in Nannong Xuefeng (NX) and Nannong Jingyan (NJ) subjected to drought stress and re-watering. CK: well-watered; D: drought stress
treatments of 0, 3, 5, and 7 days, and 3 days after re-watering (10 days). * and ** signicant differences (respectively, P 0.05 and P 0.01) based on Duncans multiple range
test, in comparisons between the two cultivars at a given day of treatment. Values are means SD (n = 3).
256 J. Sun et al. / Scientia Horticulturae 161 (2013) 249258
Fig. 9. Fv /Fm and PSII in Nannong Xuefeng (NX) and Nannong Jingyan (NJ) subjected to drought stress and re-watering. CK: well-watered; D: drought stress treatments
of 0, 3, 5, and 7 days, and 3 days after re-watering (10 days). * and ** signicant differences (respectively, P 0.05and P 0.01) based on Duncans multiple range test, in
comparisons between the two cultivars at a given day of treatment. Values are means SD (n = 3).
Plants have evolved a well-developed antioxidant defense sys-
tem to keep ROS under control (Gill and Tuteja, 2010). In the present
study, progressive drought stress generally caused an increase in
activity of SOD, POD, CAT, and APX enzymes that coordinate ROS
concentration (Fig. 3). The role of this enzymatic antioxidant sys-
tem has been investigated in several other species (Sairam et al.,
2005). In the diploid hybrid Pinus densata, drought stress induced
an increase in SOD, POD, and CAT activity for 14 days, with a sub-
sequent decline after 28 days of drought; APX activity increased
over the entire drought duration (Gao et al., 2009). Mller et al.
(2007) have suggested that high levels of antioxidant enzyme activ-
ity can increase plant resistance to drought stress. ROS scavenging
enzymes and plant antioxidants, including SOD and APX, are acti-
vated in rice in response to drought stress treatments (Moumeni
et al., 2011). In our research, we found that SOD and CAT activi-
ties were higher in NX than in Nannong Jingyang after 5 days of
drought stress. In both cultivars, SOD and APX activity levels were
highest on day 7 of treatment (Fig. 3). In contrast to NX, POD and CAT
activity levels in NJ were highest at 5 days of drought. This suggests
that these ROS scavengers provide cells with efcient machinery
for detoxifying O2 and H2 O2 .
ROS, particularly O2 and H2 O2 , can either be cytotoxic or take
part in a cellular signaling process that induces many genes and
proteins involved in drought stress defenses (Gao et al., 2009). Var-
ious genes are induced in response to drought at the transcriptional
level (Kavar et al., 2008). A previous study showed that expression
levels of genes in the SOD family are higher in drought tolerant rice
(Moumeni et al., 2011). In our study, we also investigated the effects
of drought stress on the expression of genes encoding antioxidant
enzymes at the mRNA level, and detected a signicant increase
in expression during drought stress in both cultivars (Fig. 4). In
addition, expression levels and accumulation rates of antioxidant
enzyme encoding genes were signicantly higher in NX than in
NJ. After 3 days of re-watering, NX still maintained higher antiox-
idant activities and gene expression levels (Fig. 4). Variations in
gene expression were similar to variations in antioxidant enzyme
activity, although antioxidant activity lagged behind related gene
expression. We hypothesize that the delayed changes in enzyme
activity are the result of the gene translation and modication pro-
cess.
Proline accumulation, considered a general indicator for
drought tolerance (Ahmed et al., 2009; Liu et al., 2011), permits
osmotic adjustment, which results in water retention and avoid-
ance of cell dehydration (Blum et al., 2005). There are some studies,
however, that have shown that the accumulation of proline under
adverse conditions is the result of injury, implying that it should not
be used as an indicator of tolerance screening (Liu et al., 2000). In
our research, proline concentration was signicantly higher than
control levels in both cultivars during the drought stress period.
Proline concentration appeared to increase sharply, however, in NJ
after 3 days of drought treatment (Fig. 6). This indicates that pro-
line does not bolster drought tolerance in chrysanthemums, but
rather is increased in response to damage, and is thus not a use-
ful selector for chrysanthemum drought tolerance. Similar results
have been observed in warm-season turfgrass (Liu et al., 2003) and
bluegrass (Qian et al., 2001). Liu et al. (2003) reported that more
drought-intolerant turfgrass cultivars accumulate the most pro-
line, indicating that proline accumulation is a damage response
to drought treatment. In contrast, in other speciesdespite some
controversythe more proline accumulated by a cultivar, the more
drought tolerant it is (Ahmed et al., 2009; Gao et al., 2009).
This process thus seems to be cultivar- and species-dependent,
with different species having different mechanisms under water
decit.
In both cultivars in our study, drought stress decreased Gs and
Pn , with Gs more sensitive to early drought than Pn (Fig. 7). Var-
ious experiments have shown that stomatal responses are often
more closely linked to soil moisture content than to leaf water
status (Farooq et al., 2009). This conclusion is supported by our
results; on day 3 of drought stress when SWC was 23.324.5%, Gs
of both cultivars decreased (Fig. 7B) while RWC remained con-
stant (Fig. 1B), indicating that Gs is a more sensitive parameter
at the primary stage of drought. On day 3 of drought stress, the
decline in Pn was accompanied by dramatic decreases in Gs ; Fv /Fm
remained unaffected in both cultivars. Stomatal closure limits
CO2 assimilation, which may promote an imbalance between PSII
photochemical activity and photosynthetic electron requirements,
leading to overexcitation and subsequent damage to PSII reaction
centers from photoinhibition (Hu et al., 2010). Based on chloro-
phyll uorescence measurements, we observed that Fv /Fm did not
decline until day 5 of drought stress, and NX had signicantly higher
PSII than NJ (Fig. 9). These results indicate that during primary
stages of drought, Pn was mainly affected by stomatal closure. From
day 5 to day 7 in NX, G and Fv /Fm continued to decrease, suggesting
that when drought stress is prolonged, non-stomatal limitations
are the major factors inuencing Pn . Flexas et al. (2004) reported
that non-stomatal limitations on Pn occurred when Gs was reduced
below 0.05 mol CO2 m1 s1 . We found that Gs remained above
0.05 mol CO2 m1 s1 through day 5, but was reduced to below this
level by day 7 (Fig. 7B), further conrming that non-stomatal factors
affected Pn during prolonged drought stress in NX. In NJ, in contrast,
Gs and PSII decreased during drought stress (Figs. 7B and 9B), sug-
gesting that both stomatal and non-stomatal limitations played a
role throughout almost the entire drought duration. Non-stomatal
 J. Sun et al. / Scientia Horticulturae 161 (2013) 249258
limitations are the main factors destroying the PSII system and
affecting maximum quantum efciency and actual photosynthetic
efciency (PSII) (Bu et al., 2010). Decrease of Fv /Fm and PSII
causes irreversible PSII damage and decreases reaction center pho-
tochemical activity. Not only is photosynthesis inhibited during the
drought stress process, but also the ability to recover after stress
removal is affected. After re-watering, higher levels of Pn , Gs , Fv /Fm ,
and PSII were observed in NX than in NJ (Figs. 7 and 9). The incom-
plete recovery of photosynthesis could be attributable to lasting
stomatal limitations that were induced by prolonged drought dam-
age in both cultivars.
Throughout the entire treatment, NX had a higher photo-
synthetic capacity, which may be correlated with chlorophyll
concentration. Under control conditions, the chlorophyll concen-
tration in NX was almost twice that of NJ. Previous investigations
found that chlorophyll concentration decreased in apple (Sircelj
et al., 2007) and wheat (Wang et al., 2011) under drought stress,
and similar changes were observed in our study. When both
chrysanthemum cultivars were subjected to identical drought
stress, however, chlorophyll concentration was highest in NX
and could be restored to near control levels by re-watering
(Fig. 8).
In summary, we found that the more drought-tolerant chrysan-
themum had a highly-integrated system, with a well-developed
leaf epidermis, up-regulation in antioxidative defense mechanisms,
and better gas exchange capabilities that allowed high photosyn-
thetic activity under drought stress. To the best of our knowledge,
this is the rst report on leaf epidermal surface morphology of cut
chrysanthemum seedlings and physiological responses to drought
stress.
Acknowledgements
This study is supported by the Program for New Century Excel-
lent Talents in University of Chinese Ministry of Education (Grant
No. NCET-10-0492), The Fundamental Research Funds for the
Central Universities (KYZ201112), the Natural Science Fund of
Jiangsu Province (BK2011641) and Sci-Tech Support Plan of Jiangsu
Province (BE2011325 and 2012350).
References
Ahmed, C.B., Rouina, B.B., Sensoy, S., Boukhris, M., Abdallah, F.B., 2009. Changes in
gas exchange proline accumulation and antioxidative enzyme activities in three
olive cultivars under contrasting water availability regimes. Environmental and
Experimental Botany 67, 345352.
Alscher, R.G., Cumming, J.R., 1990. Stress Responses in Plants: Adaptation and Accli-
mation Mechanisms. Wiley-Liss, New York.
Bartoli, C.G., Gmez, F., Martnez, D.E., Guiamet, J.J., 2004. Mitochondria are the main
target for oxidative damage in leaves of wheat (Triticum aestivum L.). Journal of
Experimental Botany 55, 16631669.
Blum, A., Walker, G., Dunshea, F., Doyle, P., Bariana, H., Brown, G., Bansal, U., Miah,
H., Standen, G., Lu, M., 2005. Drought resistance, water-use efciency, and yield
potentialare they compatible, dissonant, or mutually exclusive? Australian
Journal of Agricultural Research 56, 11591168.
Bradford, M.M., 1976. A rapid and sensitive method for the quantitation of micro-
gram quantities of protein utilizing the principle of proteindye binding.
Analytical Biochemistry 72, 248254.
Bu, L.D., Zhang, R.H., Chang, Y., Xue, J.Q., Han, M.M., 2010. Response of photosynthetic
characteristics to water stress of maize leaf in seedling. Acta Ecologica Sinica 30,
11841191.
de Carvalho, R.C., Cunha, A., da Silva, J.M., 2011. Photosynthesis by six Portuguese
maize cultivars during drought stress and recovery. Acta Physioliae Plantarum
33, 359374.
Farooq, M., Wahid, A., Kobayashi, N., Fujita, D., Basra, S.M.A., 2009. Plant drought
stress: effects mechanisms and management. Agronomy for Sustainable Devel-
opment 29, 185212.
Flexas, J., Bota, J., Clfre, J., Mariano Escalona, J., Galms, J., Gulas, J., Le, E.L.K., Florinda
Martnez-Canellas, S., Teresa Moreno, M., Ribas-Carb, M., 2004. Understanding
down-regulation of photosynthesis under water stress: future prospects and
searching for physiological tools for irrigation management. Annals of Applied
Biology 144, 273283.
257
Flexas, J., Medrano, H., 2002. Energy dissipation in C3 plants under drought. Func-
tional Plant Biology 29, 12091215.
Galms, J., Flexas, J., Sav, R., Medrano, H., 2007. Water relations and stoma-
tal characteristics of Mediterranean plants with different growth forms and
leaf habits: responses to water stress and recovery. Plant and Soil 290,
139155.
Gao, D., Gao, Q., Xu, H.Y., Ma, F., Zhao, C.M., Liu, J.Q., 2009. Physiological responses to
gradual drought stress in the diploid hybrid Pinus densata and its two parental
species. Trees-Structure and Function 23, 717728.
Gill, S.S., Tuteja, N., 2010. Reactive oxygen species and antioxidant machinery in
abiotic stress tolerance in crop plants. Plant Physiology and Biochemistry 48,
909930.
Guha, A., Sengupta, D., Kumar Rasineni, G., Ramachandra Reddy, A., 2010. An inte-
grated diagnostic approach to understand drought tolerance in mulberry (Morus
indica L.). Flora 205, 144151.
He, J., Chen, F., Chen, S., Lv, G., Deng, Y., Fang, W., Liu, Z., Guan, Z., He, C.,
2011. Chrysanthemum leaf epidermal surface morphology and antioxidant and
defense enzyme activity in response to aphid infestation. Journal of Plant Phys-
iology 168, 687693.
Hu, L., Wang, Z., Huang, B., 2010. Diffusion limitations and metabolic factors asso-
ciated with inhibition and recovery of photosynthesis from drought stress in a
C3 perennial grass species. Physiologia Plantarum 139, 93106.
Kavar, T., Maras, M., Kidric, M., Sustar-Vozlic, J., Meglic, V., 2008. Identication of
genes involved in the response of leaves of Phaseolus vulgaris to drought stress.
Molecular Breeding 21, 159172.
Li, H., 1993. Chrysanthemums in China. Jiangsu Scientic and Technical Press, Nan-
jing.
Liu, C., Liu, Y., Guo, K., Fan, D., Li, G., Zheng, Y., 2011. Effect of drought on pigments,
osmotic adjustment and antioxidant enzymes in six woody plant species in karst
habitats of southwestern China. Environmental and Experimental Botany 71,
174183.
Liu, E., Zong, H., Guo, Z., Li, Y., 2000. Effects of drought, salt and chilling stresses on
proline accumulation in shoot of rice seedlings. Journal of Tropical and Subtrop-
ical Botany 8, 235238.
Liu, S., Chen, S., Chen, S., Liang, X., Guo, Z., 2003. Responses of proline content
and activity of antioxidant enzymes in warm-season turfgrasses to soil drought
stress. Acta Horticulturae Sinica 30, 303306.
Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data
using real-time quantitative PCR and the 2CT method. Methods 25,
402408.
Lv, G., Tang, D., Chen, F., Sun, Y., Fang, W., Guan, Z., Liu, Z., Chen, S., 2011. The anatomy
and physiology of spray cut chrysanthemum pedicels and expression of a caffeic
acid 3-O-methyltransferase homologue. Postharvest Biology and Technology 60,
244250.
Mller, I.M., Jensen, P.E., Hansson, A., 2007. Oxidative modications to cellular com-
ponents in plants. Annual Review of Plant Biology 58, 459481.
Mackov, J., Vaskov, M., Macek, P., Hronkov, M., Schreiber, L., Santrucek, J., 2013.
Plant response to drought stress simulated by ABA application: changes in chem-
ical composition of cuticular waxes. Environmental and Experimental Botany 86,
7075.
Morgan, P., 1990. Effects of abiotic stresses on plant hormone systems. Plant Biology
12, 113146.
Moumeni, A., Satoh, K., Kondoh, H., Asano, T., Hosaka, A., Venuprasad, R., Serraj, R.,
Kumar, A., Leung, H., Kikuchi, S., 2011. Comparative analysis of root transcrip-
tome proles of two pairs of drought-tolerant and susceptible rice near-isogenic
lines under different drought stress. BMC Plant Biology 11, 174.
Munne-Bosch, S., Penuelas, J., 2003. Photo-and antioxidative protection, and a role
for salicylic acid during drought and recovery in eld-grown Phillyrea angusti-
folia plants. Planta 217, 758766.
Qian, Y., Wilhelm, S., Marcum, K., 2001. Comparative responses of two Kentucky
bluegrass cultivars to salinity stress. Crop Science 41, 18951900.
Reddy, A.R., Chaitanya, K.V., Vivekanandan, M., 2004. Drought-induced responses of
photosynthesis and antioxidant metabolism in higher plants. Journal of Plant
Physiology 161, 11891202.
Riederer, M., Schreiber, L., 2001. Protecting against water loss: analysis of the barrier
properties of plant cuticles. Journal of Experimental Botany 52, 20232032.
Russin, J., Guo, B., Tubajika, K., Brown, R., Cleveland, T., Widstrom, N., 1997. Compar-
ison of kernel wax from corn genotypes resistant or susceptible to Aspergillus
avus. Phytopathology 87, 529533.
Sairam, R., Srivastava, G., Agarwal, S., Meena, R., 2005. Differences in antioxidant
activity in response to salinity stress in tolerant and susceptible wheat geno-
types. Biologia Plantarum 49, 8591.
Sandquist, D.R., Ehleringer, J.R., 2003. Population-and family-level variation of brit-
tlebush (Encelia farinosa Asteraceae) pubescence: its relation to drought and
implications for selection in variable environments. American Journal of Botany
90, 14811486.
Sircelj, H., Tausz, M., Grill, D., Batic, F., 2007. Detecting different levels of drought
stress in apple trees (Malus domestica Borkh) with selected biochemical and
physiological parameters. Scientia Horticulturae 113, 362369.
Wang, Y., Suo, B., Zhao, T., Qu, X., Yuan, L., Zhao, X., Zhao, H., 2011. Effect of nitric oxide
treatment on antioxidant responses and psbA gene expression in two wheat
cultivars during grain lling stage under drought stress and rewatering. Acta
Physiologiae Plantarum 33, 19231932.
Wu, F., Zhang, G., Dominy, P., 2003. Four barley genotypes respond differently to cad-
mium: lipid peroxidation and activities of antioxidant capacity. Environmental
and Experimental Botany 50, 6778.
258 J. Sun et al. / Scientia Horticulturae 161 (2013) 249258

Yang, W., Sun, Y., Chen, S., Jiang, J., Chen, F., Fang, W., Liu, Z., 2011. The effect of
exogenously applied nitric oxide on photosynthesis and antioxidant activity in
heat stressed chrysanthemum. Biologia Plantarum 55, 737740.
Yin, D., Chen, S., Chen, F., Guan, Z., Fang, W., 2009. Morphological and
physiological responses of two chrysanthemum cultivars differing in their
tolerance to waterlogging. Environmental and Experimental Botany 67,
8793.
Zhao, H.J., Zou, Q., 2002. Protective effects of exogenous antioxidants and pheno-
lic compounds on photosynthesis of wheat leaves under high irradiance and
oxidative stress. Photosynthetica 40, 523527.