Molecular Biology
Long-term objective: make single amino
acid substitutions that converts a green
fluorescent protein to a protein that
fluoresces blue, or yellow.
We will do this in two stages:
I: purify plasmid DNA of WT (wild-type)
strain and confirm the presence GFP
gene.
II: execute site-directed mutagenesis
and transform bacteria with plasmid
bearing the mutated gene.
Steps for the current stage
day 1: purify plasmid DNA, cut with
restriction enzymes.
day 2: restriction analysis to test for
presence of gene to be mutated.
Book Sections
Although we will follow the protocols
provided in various industry-standard
kits, the book chapters still provide good
background and explanations.
! isolation of DNA: Book Chapter 19
(posted).
! Quiagen handout (posted).
! DNA and genetic elements: Book pages
301-332. (posted)
! Review PCR: Book Chapter 24
(posted).
! Restriction endonuclease digestion:
Book chapter 21 (posted).
2
 pET28 derivative bearing the
Plasmids, why? superfolder GFP gene.
! We want to manipulate one gene and not the rest of the
bacteriums genes.
We want to express a gene that is not a natural component of
the bacterial genome.

! Plasmids are extrachromosomal, circular DNA elements.

GFP gene inserted here
! They contain an origin of replication, which is required for
the plasmids to be replicated. This origin is specific for the
particular host organism.
high copy number (make lots of copies per cell)
low copy number (use to prevent toxicity)

! Plasmids usually carry a genetic element that provides a

selective advantage on those cells that contain the plasmid.
We engineer in an antibiotic resistance gene (in this case
resistance to kanamycin (Kan)).

! Commercial plasmids are engineered to contain a Multiple

Cloning Site (MCS), which combines a number of unique
restriction sequences. This makes it easy to insert foreign
DNA into the plasmid.

! Expression plasmids are engineered to contain a promoter

element that directs the cell to transcribe/translate sequences
that follow it. The promoter is chosen to be one whose activity
can be regulated, ie transcription can be induced to occur
upon addition of a inducer (small molecule). For example,
lactose could be used to induce expression of genes under
control of the lac operator. Isopropylthio--galactoside (IPTG)
is a non-metabolized analog of lactose that induces
transcription.
Day 1: Isolation and cleavage of
plasmid DNA
Protocols: the only
constant is change.
! We will not be following the protocols
from the book. However, the book is a
good source of background information.
! As is standard for molecular biology
experiments, all protocols will be
obtained from the companies we buy
the material from. In this area
technology is changing very rapidly so
textbooks have difficulty keeping up.
Feel free to visit the companies web
sites for additional information.
1-Plasmid Extraction
! This is executed via a kit, from Quiagen
(QuickLyse, pages 14 & 15, posted on line).
! Due to the use of a kit the chemistry is
hidden, but read the manual to determine
how the steps and materials in the procedure
work to yield pure plasmid DNA at the end.
! Explain what the steps accomplish in your
prelab write-up.
! We determine the yield of our purifications by
knowing the volume obtained and measuring
the DNA concentration. To do so, we use
DNAs extinction coefficient at 260 nm:
260=0.02 (g/ml)-1 cm-1.

! Likewise, protocols can be developed

from our Molecular Cloning Manuals.
Maniatis is a staple in the field, there
are now even journals and video
journals devoted to these techniques
and the tricks embedded in them.
6
 Plasmid Extraction
Analysis of the fractions at each stage of the
plasmid purification procedure. Left figure shows
an analytical gel of the different fractions,
together with examples of problems that can
arise at each step.
Analysis of Plasmid DNA
Plasmid DNA is much smaller than chromosomal DNA,
but can nonetheless suffer mechanical damage in the
course of purification.
Breaks can occur anywhere, and a high incidence of
breaks raises the possibility that your gene of
interested is fragmented or the plasmid can no longer
be replicated.

L: Cleared lysate containing supercoiled and

open circular plasmid DNA and degraded
RNA (sample 1).
F: Flow-through fraction containing only
degraded RNA is depleted of plasmid DNA
which is bound to the QIAGEN Resin (sample
2). Nick
nicked W1: First wash fraction, in which the
remaining traces of RNA are removed without
affecting the binding of the DNA (sample 3). SC Linear
SC W2: Second wash fraction, which ensures that
the resin is completely cleared of RNA and
other contaminants, leaving only pure plasmid
DNA on the column (sample 3). E: The eluate sheared
containing pure plasmid DNA with no other
contaminating nucleic acids (sample 4).
M: Lambda DNA digested with HindIII.*
Lanes 15 illustrate some atypical results that
may be observed in some preparations,
depending on plasmid type and host strain.
1: low-quality plasmid DNA: supercoiled migrates faster and nicked circular
migrates more slowly.
2: high-quality plasmid DNA: dominated by supercoiled.
3: linear DNA in which both strands have been cut in one place (by restriction
endonuclease digestion).
4: linear DNA generated by strand breakage as a result of sonication for 2
seconds (Thompson et al (2008) Biotechniques 45(3) 327-329).
7
 2-Endonuclease Digestion Choice of enzymes
! To test that the DNA we purified indeed
corresponds to the correct plasmid we will use
MCS (multiple cloning site)
agarose electrophoresis to assess the size of GFP gene inserted here
the plasmid.
! We will also cut the plasmid with enzymes for
which we know what fragments sizes ought to
be produced if the DNA is indeed our plasmid.
! NdeI and XhoI can both function in the same
buffer so they can be used together.
! We will also set up controls to confirm that both
our enzymes are active.
! A working enzyme should convert circular
plasmid to linear. The two enzymes together
also convert circular plasmid to linear DNA, but
they should also release smaller fragments.
! Question: Sketch the outcomes of each
digestion and explain why NdeI and XhoI are
informative choices for the analysis of our
plasmid (map on next page).
Choose enzymes that each cut the plasmid just once.
These are listed on the second page of the plasmid fact-
sheet.

9 We choose NdeI and XhoI 10

 Choice of enzymes Choice of enzymes
They need to be compatible with the same solution MCS (multiple cloning site)
conditions for highest fidelity cutting.

NdeI (from Neisseria denitrificans) cuts in cutsmart buffer at

XhoI (from Xanthomonas holcicola) cuts in cutsmart buffer at

Cut empty vector with

NdeI and Xho.
Digest with XhoI and NdeI

11 12
 Choice of enzymes
MCS (multiple cloning site) GFP gene
inserted
here
Digest with XhoI and NdeI
Cut with a third
enzyme
+ AGTCAAGTTTGAAGGTGATACCCTTGTTAATCGTATCGAGTTAAAGGGTATTGATTTTAAAGAAGATGGAAACATTCTTGG
COMPLICATION: for our enzyme XhoI also cuts once inside
the gene. It is the third enzyme as well as the second in the
cartoons above. Thus we never see the outcome predicted
above, just the one below.
13
Our gene sequence
includes an XhoI site
Sequencing)result)of)GFP(Feb)2014)
NNNNNNNNNNNNNNNNANNNNNNNNNNNNNNNTATTTTGTTTAACTTAAANAAGGATATATACATATGAGCAAAGG
AGAAGNNNNNANNNNGGAGTTGTCCCAATTCTTGTTGAATTAGATGGNNNTGTTAATGGGCACAAATTTTCTGTCCGTG
GAGAGGGTGAAGGTGATGCTACAAACGGAAAACTCACCCTTAAATTTATTTGCACTACTGGAAAACTACCTGTTCCGTGG
CCAACACTTGTCACTACTCTGACCTATGGTGTTCAATGCTTTTCCCGTTATCCGGATCACATGAAACGGCATGACTTTTTCA
AGAGTGCCATGCCCGAAGGTTATGTACAGGAACGCACTATATCTTTCAAAGATGACGGGACCTACAAGACGCGTGCTGA
ACACAAACTCGAGTACAACTTTAACTCACACAATGTATACATCACGGCAGACAAACAAAAGAATGGAATCAAAGCTAACT
TCNAAATTCGCCACAACGTTGAAGATGGTTCCGTTCAACTAGTAGATCATTATCAACAAAATACTTCCAATTGGCGATGGC
CCTGTCCTTTTTACCAGACAACCATTACCTGTCGACACAATCTGTCCTTTCGTAAGATCCCNNCGAANAGCGTGACCNCNT
GGTCCTTCTTTGAGTTTNNAACTTGCTGNTGGGANTACACATGGCATGGATGAGCTCTATNNANGNATCCCACCACCACC
ACCNCCTCTAANCTCGAGTACCACNNCTNCCACNN
ATG:)start)codon
CATATG:)cuAng)site)by)Ndel
CTCGAG):)CuAng)site)by)XhoI)
14
 What you will do
Day 1-Plasmid Extraction
! Cells from 1.5 ml overnight LB/Kn
culture will have been harvested in one
1.5 ml eppendorf tube.
! Follow instructions for use of QuickLyse
spin miniprep kit with a microcentrifuge
pgs 14-15 except for changes on next
page. (Read elsewhere as well to
understand the role of each step and
the important precautions.)
! Dilute a small amount of your DNA as
would be needed to obtain an
absorbance of 0.2 for a 1 ml sample,
assuming that the 50 l solution you
obtained from the QuickLyse contained
8 g of DNA (hint: the extinction
coefficient at 260 nm for double-
stranded DNA is 260 = 0.020 (g/ml)-1
cm-1
! Your pre-lab needs to show your math
calculating how much of your DNA
solution you will dilute with how much
water.
! Measure A260 and determine the actual
concentration of your DNA, and thus
your yield.
Plasmid Extraction-2
! Changes from QuickLyse protocol:
- use two washes with QLW buffer
for clean DNA, incubating 5 min.
each,
- 5 min. incubation with QLE buffer
Vortex for DNA elution. Vortex
3 min
! Question: Why do we use a single
inc. colony to start a culture, instead of
several colonies ? What are the
costs and benefits of this practice ?
! Question: We can theoretically
obtain 8 g of DNA from a QIAquick
prep. Imagining that a single
dry molecule of plasmid dimer
transformed the cell that gave rise to
the colony we drew upon, what factor
of amplification does the sequence of
transformation, single colony, 1.5 ml
culture represent ? (Assume that the
plasmid has 5,000 base pairs to
calculate the molecular weight of the
plasmid.)
! Question: Why do we use the unit of
g/ml for concentration instead of
moles/l ?
15 16
Things to do before starting
! Ensure that the Complete Lysis Solution has been prepared according to
the instructions on page 12.
! Chill the Complete Lysis Solution on ice until it is <4C.
! Ensure that Diluted Buffer QLW has been prepared according to
instructions on page 13.

Procedure Transfer your purified DNA to a fresh labeled tube.

1. Using a 2 ml QuickLyse Lysis Tube (provided), pellet bacterial cells Begin the endonuclease digestions below and while they are
from 1.5 ml of culture (OD600 2.04.0) by centrifugation at
>13,000 rpm (approximately 17,000 x g) in a conventional, table-top under way use some of the remaining DNA to measure the
microcentrifuge for 1 min at room temperature (1525C). A260 and thus the [DNA].
A culture volume of 1.5 ml should be used for cells with an OD600 >2 as
excessive biomass will cause inefficient lysis leading to poor yield and DNA
quality.
2. Remove medium by decanting or pipetting.
Inverting the tubes on a paper towel may improve removal of the medium. Day 1-Endonuclease Digestion
3. Add 400 l ice cold Complete Lysis Solution to the pelleted bacterial
cells.
Complete Lysis Solution must be ice cold (<4C) to ensure maximum DNA We will make up two controls and one experiment.
yield.
4. Mix thoroughly by vortexing at the highest setting for 30 s. LABEL your tubes CLEARLY with the reaction ID and your
name !
This step is critical to obtaining maximum DNA yield.
If the pellet is not completely resuspended, continue vortexing until no cell
clumps are visible.
Prepare digests of the plasmid DNA in 0.5 ml eppendorf tubes
(eppis):
5. Incubate at room temperature (1525C) for 3 min. Plasmid-NX = 10 L plasmid DNA + 11.5 L sterile water
Lysate should appear nonviscous and slightly cloudy, with no precipitate. 2.5 L 10x digestion buffer + 1 L NdeI + 1 L XhoI.
6. Transfer the lysate to a QuickLyse spin column by decanting or
Plasmid-X = 10 L plasmid DNA + 12.5 L sterile water
pipetting.
2.5 L 10x digestion buffer + 1 L NdeI.
7. Centrifuge for 3060 s at 13,000 rpm (approximately 17,000 x g) in
a table-top microcentrifuge. Plasmid-N = 10 L plasmid DNA + 12.5 L sterile water
It is not necessary to decant the flow-through. 2.5 L 10x digestion buffer + 1 L XhoI.
6. Wash the QuickLyse spin column by adding 400 l diluted Buffer
14 QLW and centrifuge for 3060 s at 13,000 rpmMiniprep
QuickLyse (approximately
**
Handbook 10/2006 Each reagent can be deposited as a droplet on the inside wall
17,000 x g). Discard the flow-through. of a sterile eppi, so you can see what has been added, and
7. Place the QuickLyse spin column back into the waste tube and return they stay separate temporarily.
it to the centrifuge.
8. Centrifuge for 1 min at 13,000 rpm (approximately 17,000 x g) to
Centrifuge briefly, to mix all reagents together in the bottom of
the tube.
dry the QuickLyse spin column.
9. Transfer the QuickLyse spin column into a clean collection tube. To
elute DNA, pipet 50 l Buffer QLE directly onto the center of the
Reaction time begins when eppis are placed in 37 C water
bath.
**
QuickLyse spin column. Centrifuge for 3060 s at 13,000 rpm
(approximately 17,000 x g). Incubate for 1 hr. (T.A. will stop the reaction by heating tubes to
60 C, which will also enforce sterility, for storage).
To avoid inconsistent elution volumes, ensure that Buffer QLE is pipetted
onto the center of the column, taking care to avoid the walls of the column.
Eluted DNA can be used immediately in downstream reactions or stored at 17 18
20C. pages 14 & 15 of QuickLyse handbook
Day 2: Agarose gel
electrophoresis of plasmid Electrophoresis samples

Prepare gel as described under day 2 of ! Your five samples to be analyzed by electrophoresis
are:
Experiment #24 pp. 385-396, but.... ! 100 bp ladder, this sample will be made up by the T.A.
! Plasmid-XN : 25 l of digest + 5 l 6x Sample buffer
Make a 0.7% agarose gel (use the comb with wider teeth).
! Follow steps 5-7 on day 2 but use our master mix
! Plasmid-X : 25 l of digest + 5 l 6x Sample buffer
(below) ! Plasmid-N : 25 l of digest + 5 l 6x Sample buffer
! Use TAE buffer, not TBE ! Uncut plasmid: 10 l plasmid DNA + 2 l 6x Sample
! Add 3 uL Ethidium Bromide* to the gel solution buffer
! Do not worry about evaporation
! Make these up and heat them to 60 C for 3-5 minutes
immediately before loading into the gel sample wells.
Follow step 8 but you will have only 5 samples (see
next page)
Run your gel (step 9). Turn off power before
removing gel.
Skip steps 10-11 (we incorporated EtBr* in the gel)
photograph your gel.
Skip steps 12- 16, 18 and 19.

TAE = Tris-acetate (40 mM, pH 8.5) EDTA (1 mM).

* Ethidium Bromide, EtBr is VERY toxic. The MSDS is

posted. Stock solution is 10 mg/ml.
20