WORKSHOP RESTRICTION ENZYMES

FUNDAMENTALS OF MOLECULAR BIOLOGY

CHEMISTRY DEPARTMENT. UNIVERSIDAD NACIONAL DE COLOMBIA

Cristhian Paredes Cardona

Nicols Preciado Muoz

1. You are given the following LINEAR strand of DNA that is 5000 base pairs long. The sites on the DNA where various
restriction enzymes will recognize and cut are indicated below:
0---------------------500 (EcoRI)----------------------1000 (SalI)-------1200 (EcoRI)--------------2000 (EcoRI)------------5000

a. How many DNA fragments would result from an EcoRI digest? What would their sizes be?
From an EcoRI digest will result 4 fragments, with a size of 500, 700, 800 and 3000 Base Pairs.

b. How many DNA fragments would result from a SalI digest? What would their sizes be?
A Sall Digest will only make 2 fragments of 1000 and 4000 base pairs.

c. Draw a theoretical agarose electrophoresis gel showing these digestions (individually and with both enzymes together)

Kb STD EcoRI SaII EcoRI + SaII

5 --------

4 --------

3 -------- --------

1 --------

0.8 -------- --------

0.7 --------

0.5 -------- --------

--------

0.2 --------

2. Southern Blot

a. You are asked to design a probe to hybridize to the following segment of DNA: 5 ATGCTACGACC 3 What should the
sequence for the probe be?
The sequence for the probe should be 3 TACGATGCTGG 5

b. As a lab technician, part of your job is to make sure the probes you are using are appropriate for the DNA you are
trying to detect. You are working with the following sample of DNA (only one strand is shown):
5ATCCGCTAATGGCCGATCTAATGCTACGACCTCTACGTTTACAATATAGGCCTAGCTAGCTTCGATCGCTC3

i. Suppose you were to cut the DNA shown above with the enzyme HaeIII. The recognition sequence for this enzyme
is 5 GGCC 3. The enzyme cuts between the G and C bases.

5ATCCGCTAATGG / CCGATCTAATGCTACGACCTCTACGTTTACAATATAGG / CCTAGCTAGCTTCGATCGCTC3

ii.
iii.You denature the DNA from the gel and transfer it onto a nylon membrane. You incubate the membrane with the
probe you made in part (a). Draw an arrow to the DNA fragment(s) on the gel that the probe will bind to.

5ATCCGCTAATGG / CCGATCTAATGCTACGACCTCTACGTTTACAATATAGG / CCTAGCTAGCTTCGATCGCTC3

 iv. The same nylon membrane can be used with another probe. The membrane is subjected to high temperatures to
detach the existing probe from the membrane. The probe is washed off then the membrane is incubated and hybridized with a
new probe. Suppose you incubate the membrane with the following probe: 3 GATCGAAGCTAG 5 Which DNA fragment(s)
will this new probe bind to? Circle the fragment(s) on the gel that this new probe will bind to.

The probe will recognize this fragment: 5 CTAGCTTCGATC 3, so no fragments are recognized in the DNA sample.

3. RFLP can also be used to determine paternity and show how individuals are related to one another.
A man comes to your lab because he believes that his wife has been unfaithful and is carrying another
mans child. After obtaining DNA from the wife and he fetus she is carrying, you do RFLP analysis for a
polymorphism on chromosome 2 (called D2S44). The autoradiograph is shown. Could this man really
be the father of the fetus?

Yes, we can not say anything about the fidelity of his wife (and it does not concern us much) but the
man could really be the father of the fetus. In the autoradiograph is evident the coincidence in a blinded to a
probe fragment of both the Child and the Alleged Father, evidencing that the same sequence of DNA is present
in a part of the D2S44 chromosome of the progenitor and the fetus.

4. As the newest member of an elite CSI squad, you are assigned a burglary case in which there are 3
possible suspects (lines 2, 3 and 4). When the burglar fled the scene of the crime, he/she cut
him/herself on a broken window and left behind some blood. After obtaining a court order to get the
DNA of all three suspects, you do RFLP analysis on
the suspect's DNA and the blood found at the crime
scene. You use 2 different probes on the same nylon membrane (2
separate hybridizations). The combined autoradiograph (of all 2
hybridizations) is seen below.

a. Based on the autoradiograph, which suspects can be ruled out as

NOT being the burglar?
Suspect No. 1 and 2 can be ruled out, because in the autograph, no
coincidences in bands are found between Lane 7 (Crime Scene Blood) and the
lanes of the suspects, that means that the studied sequences appear in different
parts of the DNA and in conclusion in not the same subject.

b. Which suspect is most likely the burglar?

Suspect No. 3 may be the one that committed the robbery, his/her DNA shows
two coincidences in the bands of its lane with the lane from the DNA of the
crime scene blood, that indicates that at least two reconogzibles fragments of
DNA are equal in both the Suspect No. 3 and the thief.

c. Why is it necessary to use more than one probe when doing DNA
profiling like this?
Because just one probe could be poorly selective in the way that there is a big
probability for two different DNA chains to show the same band.

d. Using this autoradiograph alone, can we be 100% certain that one

of the suspects (A, B, or C) is the burglar who left his/her blood at the
crime scene? Why or why not?
No, we cannot. Even if the bands are equivalents in the autoradiograph there is always an uncertainty because the analysis does not
do an exhaustive comparison of the sequence of nucleotides of the DNA samples.

5. A linear fragment of DNA (7.5 kb) is cleaved with the individual restriction enzymes HindIII and SmaI and then with a
combination of the two enzymes. The fragments obtained are: HindIII : Sma1: HindIII and SmaI:
a. Draw the restriction map. 2.5 kb, 5 kb; 2.0 kb, 5.5 kbs; 2.5 kb, 3.0 kb, 2.0 kb.
HindIII:
0---------------------------------2500 (HindIII) ------------------------------------------------------------------7500
Sma1:
0-----------------------------------------------------------------------5500 (Sma1)----------------------------7500
HindIII and Sma1:
0---------------------------------2500 (HindIII) --------------------------------------5500 (Sma1)----------------------------7500

b. The mixture of fragments produced by the combined enzymes is cleaved with the enzyme EcoRI, resulting in the loss of
the 3--kb fragment (band stained with ethidium bromide on an agarose gel) and the appearance of a band stained with
ethidium bromide representing a 1.5--kb fragment. Mark the EcoRI cleavage site on the restriction map.
0---------------------------------2500 (HindIII) ------------------4000(EcoRI)-------------------5500 (Sma1)----------------------------7500

6. Use the figure below:

You decide to clone your favorite gene (yfg) into a 6000bp target plasmid that contains a special inducible promoter.
Therefore, in order to achieve high expression of yfg, you must clone yfg in the same orientation as the promoter in the target
vector (arrowheads must point in the same direction). You have already mapped the plasmid for three sticky--end restriction
enzymes as shown above (assume a negligible distance between the sites in the target vector multiple cloning site within
lacZ). You also note that yfg has a HinDIII site that cuts yfg into a 200bp fragment and an 800bp fragment in your TetR vector
when double digested with HinDIII and EcoRI.
a. What enzyme(s) do you use to cut the target vector for cloning yfg into it? Briefly justify your choice.
We would use BamHI to cut the target vector. In practical terms, all three restriction enzymes will in theory put the gen in the same
place, but perhaps the EcoRI could cut the gen after its is placed as we can see in the experiment with the TetR vector and the HinIII
will cut the gen of interest. The BamHI is the best option.
b. Using your strategy, will yfg insert into the target vector in the same orientation as the promoter always, sometimes, or
never? Briefly justify your answer.
The orientation of the gen is aleatory, so the desired one will be obtained just sometimes. We arent doing anything to route the gen
and both orientation, the desired and the other one are equally probable.

c. Which single restriction enzyme can be used to conclusively confirm that yfg is cloned in the correct orientation in the
target vector? Briefly justify by explaining what results you expect to see if yfg is in the correct and in the incorrect
orientation.
The HinDIII can be used, this enzyme will cut the yfg and the plasmid in a part nearly after the end of the gen, so if the gen is good
oriented, two DNA segments of 6200 bp and 800 bd would appear in an agarosa gel electrophoresis, but if the gens orientation is
incorrect, the fragments that appear will have a size of 6800 and 200 bp.

7. Restriction Mapping Problems

For each of the problems below develop a map of the plasmid or show how the gel for a particular plasmid would appear:

Kb STD EcoRI BamHI EcoRI + BamHI

20 ------- --------

18

16

14
12 --------

10

8 -------- --------

6 --------

4 --------

2 -------- --------

Kb STD HindIII HpaI HindIII + HpaI

26 -------- --------

24

22

20

18

16

14

13 --------

10

7 --------

6 -------- --------
--------

4 -------- --------

3 -------- --------

0
Kb STD EcoRI + PstI EcoRI + BamHI EcoRI + BamHI + PstI

2.6 --------

2.4

2.2 --------

2.0 -------- --------

1.8

1.6

1.4

1.2

1.0

0.8

0.6

0.4 --------- --------

0.2 --------- --------

Kb STD EcoRI BamHI EcoRI + BamHI

20 -------- --------

18

16

14
11 --------

10

8 --------

6 -------- --------

3 -------- --------
--------

Kb EcoRI PstI Sall EcoRI + SaII EcoRI + PstI PstI + Sall STD

4.36 -------- -------- -------- --------

4.2

3.98 --------

3.61 ---------

3.23 --------

3.0

2.7

2.4

2.1

1.8

1.5

1.13 --------

0.75 --------

0.6

0.38 --------

Kb HindIII BamHI EcoRI HindIII + BamHI HindIII + EcoRI BamHI + EcoRI STD

4.0 --------

3.82 --------
3.0 --------

2.8

2.4 -------- --------

2.0 --------

1.6 -------- --------

1.4 -------

1.2 --------

1.0 -------- --------

0.95 --------

0.75 --------

0.4

0.27 --------

0.25 --------

0.18 -------- -------- --------

Kb SaII HhaIII SaII + HhaIII STD

4.35 --------

2.30 --------

2.10 --------

1.8 --------

1.55 --------

1.2 -------

1.1 -------

0.75 --------

0.70 -------- --------

0.35 -------

0.25 -------- --------