EXPERIMENTAL PARASITOLOGY 89, 18 (1998)
ARTICLE NO. PR974274
Plasmodium falciparum: Detection of Polymorphisms in the Dihydrofolate
Reductase and Dihydropteroate Synthetase Genes by PCR and
Restriction Digestion
Manoj T. Duraisingh, Jill Curtis, and David C. Warhurst
Department of Infectious and Tropical Diseases, London School of Hygiene and Tropical Medicine, Keppel
Street, London, WC1E 7HT United Kingdom
Duraisingh, M. T., Curtis, J., and Warhurst, D. C. 1998. Plasmodium
falciparum: Detection of polymorphisms in the Dihydrofolate reduc-
tase and dihydropteroate synthetase genes by PCR and restriction
digestion. Experimental Parasitology 89, 18. With the spread of resis-
tance to chloroquine, the combination of sulphadoxine and pyrimeth-
amine is growing in importance for the treatment of infection with the
malaria parasite Plasmodium falciparum. Mutations in the dhfr gene
of P. falciparum have been associated with resistance to pyrimethamine.
Recently, several polymorphisms have been identified in the P. falci-
parum dhps gene which may correlate with sulphadoxine-resistance.
Simple and rapid tests have been developed to detect these polymor-
phisms, using PCR followed by restriction digestion. These tests can
accurately identify all the polymorphisms described to date at codons
16, 51, 59, 108, and 164 in the dhfr gene and those at codons 436,
437, 540, 581, and 613 in the dhps gene. A nested system has been
developed which allows the accurate detection of these polymorphisms
in samples of fingerprick blood collected on glass fiber membranes and
filter papers, some with very low parasitaemias. q 1998 Academic Press
Index Descriptors and Abbreviations: Plasmodium falciparum; dhfr,
dihydrofolate reductase; dhps, dihydropteroate synthetase; polymor-
phism; PCR, polymerase chain reaction; restriction digestion.
INTRODUCTION
Inhibitors of the folic acid biosynthesis pathway enzymes
dihydrofolate reductase (dhps) and dihydropteroate synthe-
tase (dhps) are particularly useful as antimalarials when used
in synergy (Winstanley et al. 1995). The combination of
pyrimethamine and sulfadoxine (PYR/SDX), known com-
mercially as Fansidar, has been used successfully in the
0014-4894/98 $25.00
Copyright q 1998 by Academic Press
All rights of reproduction in any form reserved.
treatment of clinical malaria. It is becoming increasingly
important as an alternative to chloroquine, to which resis-
tance is spreading. Resistance to PYR (PYR-R) has been
recognised for a long time (Clyde and Shute 1954), but the
combination of PYR/SDX has been effective against PYR-
R strains of Plasmodium falciparum. However, since the
eighties, resistance to PYR/SDX has been reported in south-
east Asia, Latin America, and Africa (Hurwitz et al. 1981;
Alecrim et al. 1982; Kilimali and Mkufya 1985).
The dhfr gene product is long established as an important
target of PYR in malaria parasites and bacteria (Gutteridge
and Trigg 1971). Mutations in the dhfr gene have been
associated with resistance to PYR, in studies with both labo-
ratory and field isolates (Peterson et al. 1988; Cowman et
al. 1988; Basco et al. 1995; Curtis et al. 1996). Transforma-
tion of P. falciparum with plasmids containing dhfr genes
with several of these mutations has demonstrated definitively
their importance in conferring resistance to PYR (Wu et
al. 1996). Recently, sequence analysis has indicated that
resistance to SDX may be associated with nonsilent muta-
tions in the dhps gene (Brooks et al. 1994; Triglia and
Cowman 1994). These correlate with mutations that confer
resistance to sulphonamides in other organisms. Recently,
strong evidence for a role of specific dhps mutations has
been obtained from a genetic cross (Wang et al. 1997). It
is of importance to be able to type these polymorphisms and
assess their contribution to drug failure in the field. If such
associations are shown to be of significance they may then
be used as predictors of resistance to PYR and SDX in
different geographical areas, and to other potential drug
1
2 DURAISINGH, CURTIS, AND WARHURST

combinations such as chlorproguanil/dapsone and

trimethoprim/sulfamethoxazole (Winstanley et al. 1995).
Mutation-specific PCR tests have been described to distin-
guish most of the known alleles of dhfr and dhps (Zolg et
al. 1990, Gyang et al. 1992, Wang et al. 1995). We describe
the development of a nested system based on what we believe
is a robust technique, that of amplification by PCR of the
region of the gene of interest followed by restriction diges-
tion. Tests have been previously described for codon-16 and
codon-108 polymorphisms of dhfr using the presence of
already existing restriction sites for discrimination (de Pec-
oulas et al. 1995; Zindrou et al. 1996). We have designed
the primers used for PCR to create restriction sites so that
polymorphisms not described by natural restriction sites can
also be detected to distinguish between all of the polymor-
phisms in the dhfr and dhps genes identified to date. The
techniques are sensitive enough to detect polymorphisms FIG. 1. A schematic representation of the nested system for the
from blood samples collected on glass fibre membranes detection of polymorphisms in the dhfr and dhps genes of Plasmodium
(GFMs) or filter paper, from asymptomatic individuals, some falciparum. Primers and restriction enzymes used for the detection of
variant codons are indicated. Artificially introduced sites are asterisked.
with very low parasitaemias. We are using the system for
the detection of polymorphisms in the field to establish their
clinical relevance to failure of treatment with PYR/SDX and
other antifolate combinations. The principles used in the previously been determined along with the sequence polymorphisms
design of these tests, such as the engineering of primers to associated with PYR and SDX resistance (Peterson et al. 1988; Cow-
create suitable restriction sites in the absence of natural ones, man et al. 1988; Brooks et al. 1994; Triglia and Cowman 1994; Wang
may be used to design tests for many defined polymor- et al. 1997). K1, T9/96, and FCR-3 DNA was prepared in our laboratory.
phisms. V1/S and W2 DNA were a kind gift of Dr. J. Hyde (UMIST, UK).
Field samples were collected from Muheza, Tanga region of N.E.
Tanzania. TN-1 is one of the samples collected in Muheza in 1995
from a child 3 weeks after treatment with PYR/SDX.
Schematic system. Figure 1 schematically represents the tests
MATERIALS AND METHODS which consist of PCR amplification of the regions flanking the muta-
tions using the primers indicated followed by digestion with enzymes
specific for each variant. The protocol includes Nest I followed by
Parasite material. In this study we have used the P. falciparum Nest II reactions. Table II lists the primers used in the tests, showing
strains and clones K1, V1/S, W2, T9/96, FCR3, and TN-1 as our the mutations engineered into them. All primers were supplied by
representative controls for the development of the tests for between Pharmacia Biotech.
them they possess all polymorphisms described to date (Table I). PCR. Reaction volumes of 50 ml were used which contained 2 ml
Sensitivities of these lines to pyrimethamine and sulphadoxine have of the sample DNA/0.25 mM of each primer/200 mM dNTPs/1.5 mM

TABLE I
Summary of the Amino Acid Polymorphisms of dhfr and dhps of the Control P. falciparum Strains Used in This Study

dhfr dhps
16 51 59 108 164 436 437 540 581 613
K1 ala asn arg asn ile ser gly lys gly ala
V1/S ala ile arg asn leu phe gly lys ala thr
W2 ala ile arg asn ile phe gly lys ala ser
FCR3 val asn cys thr ile ser ala lys ala ala
T9/96 ala asn cys ser ile ala gly lys ala ala
TN-1 ala ile arg asn ile ser gly glu ala ala
DETECTION OF dhfr AND dhps POLYMORPHISMS IN MALARIA
TABLE II
Sequences of the Primers Used for the Detection of Polymorphisms in the dhfr and dhps Genes
NESTII
dhfr
M3 58TTTATGATGGAACAAGTCTGCGACGTT38
F/ 58AAATTCTTGATAAACAACGGAACCTttTA38
F 58GAAATGTAATTCCCTAGATATGgAATATT38
M4 58TTAATTTCCCAAGTAAAACTATTAGAgCTTC38
dhps
K 58TGCTAGTGTTATAGATATAGGatGAGcATC38
K/ 58CTATAACGAGGTATTgCATTTAATgCAAGAA38
J 58TGCTAGTGTTATAGATATAGGTGGAGAAagC38
L 58ATAGGATACTATTTGATATTGGAccAGGATTcG38
L/ 58TATTACAACATTTTGATCATTCgcGCAAccGG38
NEST I
dhfr
M1 58TTTATGATGGAACAAGTCTGC38
M5 58AGTATATACATCGCTAACAGA38
dhps
R2 58AACCTAAACGTGCTGTTCAA38
R/ 58AATTGTGTGATTTGTCCACAA38
Note. Mismatches that were engineered into the primers are denoted in lower case. Gen Bank Accession Nos.: dhfr, J04643; dhps, Z30659.
MgCl2/1 U of Taq polymerase (BioLine)/50 mM KCl or NH4OH buffer
(BioLine)/5% DMSO.
Reaction conditions for tests F-M4, M3-F/, L-L/, K-K/, and J-K/
were as follows: initial denaturation at 948C for 3 min; then 948C for
1 min, annealing at 458C for 1 min and extension at 728C for 1 min,
repeated for 40 cycles, with a final extension step at 728C for 10 min.
A Hybaid Thermal Cycler (Hybaid, Teddington, Mdx, UK) was used
in all reactions.
For the nested PCR reactions volumes of 50 ml were used which
contained 2 ml of sample DNA or a small piece of washed glassfiber
membrane containing a blood sample with 0.25 mM of each primer/
200 mM dNTPs/1.5 mM MgCl2/1 U BioTaq polymerase (Bioline)/50
mM KCl or NH4OH buffer. Reaction conditions were as above but the
first five annealing steps were carried out for 2 min.
Restriction digestions. These were carried out overnight at the
optimum temperature indicated by the suppliers (New England Biolabs
(UK) Ltd.). The PCR product was used without purification. When
incubation was at 508C or higher, samples were overlaid with a few
drops of mineral oil. Electrophoresis of the restriction digest was carried
out on 1.53% agarose gels (2:1 Ultrapure agarose (Gibco):
NusieveGTG (FlowGen, UK)) and the gels were stained with ethidium
bromide. Markers (100 bp) (Pharmacia Biotech) were used to size
the bands.
RESULTS
Principles and primer design. The regions of the dhfr
or dhps genes flanking the polymorphisms of interest were
3
Nucleotide number
2324
491519
144172
439469
269298
676706
269299
703735
832863
2318
625645
223242
913933
amplified by PCR (Nest II reactions), followed by digestion
with a specific restriction enzyme to detect each variant
(Fig. 1). Published sequences of dhfr and dhps (Peterson et
al. 1988; Cowman et al. 1988; Brooks et al. 1994; Triglia
and Cowman 1994) were used to determine whether poly-
morphisms in the genes were already described by conve-
nient restriction sites. If restriction sites were not present
an alternative approach was employedthat of designing
primers with mismatches in their 38 end to create restriction
sites following amplification by PCR. In this way almost
all point polymorphisms of interest may be described by a
restriction site. This relies on the observation by Kwok et
al. (1993) and Huang et al. (1992) that certain mismatches
in the 38 end of a primer can be tolerated during amplification
by PCR without a great loss in sensitivity. We have also
attempted to flank as many polymorphisms with a single
primer pair as possible to increase the throughput of the
method.
One of the main advantages of a PCR-RFLP based detec-
tion system is the separation of PCR and the restriction
digestion discrimination step, which means that optimization
of the PCR step is not as crucial as with mutation-specific
PCR (MS-PCR). On the other hand, one of the main weak-
nesses of such a system is the possibility of incomplete
digestion. The primers were designed to demonstrate com-
plete digestion in the tests, as far as possible, by several
4 DURAISINGH, CURTIS, AND WARHURST
DETECTION OF dhfr AND dhps POLYMORPHISMS IN MALARIA
strategies: (i) the presence of another restriction site in the
PCR product for a particular restriction enzyme, which is
always cut following restriction digestion, and therefore
serves as an internal positive control for restriction diges-
tion, and/or (ii) digestion with restriction enzymes which
cut alternative allelic forms, and(iii) where control restriction
sites were absent from the amplified fragments restriction
sites for some enzymes were designed into the primers. In
practice one restriction enzyme may be used to screen for
the presence of a particular variant and a second enzyme
may be used to confirm it.
PCR/RFLP tests for the dhfr gene. Figure 2 depicts agar-
ose gels of the restriction digests to detect the polymorphisms
at each codon. In every case the patterns corresponding to
the different variants are indicated as well as the undigested
PCR product and the band sizes are as predicted from the
sequence. Amplification with the primers M3 and F/ gives
a 522-bp PCR product. The three alternative forms of codon
108, ser, asn, or thr, may be discriminated by digestion with
AluI, BsrI, and BstNI (an isoschizomer of Scrf I), respectively
(de Pecoulas et al. 1995). The polymorphisms in codon 16
and codon 51 may be discriminated by digestion with NlaIII
(de Pecoulas et al. 1995) and Tsp509I, respectively. The
PCR product M3-F/ contains additional NlaIII and Tsp509I
sites which serve as internal controls for restriction digestion
in these tests. Primer F/ was engineered to create a DraI
restriction site which allows the discrimination of the vari-
ants of the codon-164. The PCR product also contains inter-
nal DraI sites as controls for restriction digestion.
Amplification with the primers F and M4 yields a 326-
bp PCR product. F was engineered to create a restriction
site which allows the detection of the polymorphic forms
of codon-59 following restriction digestion with XmnI. The
PCR product also contains another XmnI site which serves
as an internal control. The variants of codon-108 can be
distinguished by digestion with AluI, BsrI, and BstNI, as
with the M3-F/ PCR product. M4 was engineered to create
an additional AluI site as an internal control. We digest the
F-M4 PCR product with AluI and the M3-F/ product with
BsrI. These tests should detect the same polymorphisms.
PCR/RFLP tests for the dhps gene. Figure 3 shows the
tests for the polymorphisms in the dhps gene. Amplification
with the primers K and K/ gives a PCR product of 438 bp.
The ser and ala variants of codon 436 are discriminated by
parallel digestion with MnlI and MspA1I. The PCR product
FIG. 2. (opposite) Agarose gels of the restriction digests of the PCR products ((a) M3-F/; (b) F-M4) of the tests for the polymorphisms of
the dhfr gene. U, undigested fragment. Sizes in bp.
5
contains an internal restriction site for MnlI. If there is a
mixture of ser and ala variants present, it is not possible to
establish whether phe-436 is present, therefore an additional
primer J was designed which describes the phe-codon specif-
ically. Parallel digestion of J-K/ with HindIII and HhaI con-
firms the presence of the phe- and ala-codons, respectively
(data not shown). K has been engineered to create a MwoI
restriction site describing ala-437 and K/ has an additional
MwoI site to serve as a control for digestion. AvaII digests
the other codon-437 (gly) variant. Polymorphism has been
described at codon-540 (Wang et al. 1997). We have identi-
fied the novel polymorphism glu-540 in a Tanzanian isolate,
TN-1, by sequencing. This isolate also had the ser-436 and
gly-437 variants in the dhps gene, and asn-108, ile-51, and
arg-59 in dhfr (Table II). Digestion with the enzyme FokI
can distinguish between the alternate lys- and glu-540 co-
dons, and K was designed to create an additional FokI site
as an internal control.
Primers L and L/ produce a PCR product of 161 bp
following amplification. Codons 581 and 613 are not de-
scribed by restriction sites. Primer L was engineered to
create restriction sites for both the ala- and gly-581 codons
recognized by the enzymes BstUI and BslI, respectively.
Primer L/ was designed with an additional restriction site
for BstUI to serve as an internal control for digestion. Three
polymorphic forms have been observed at codon-613 which
are not described by restriction sites. Primer L/ was engi-
neered to create a restriction site describing the ala-codon
recognised by MwoI digestion. The ser- and thr-613 variants
are both detected by digestion with BsaWI. For further dis-
crimination AgeI detects the thr-allele specifically.
Sensitivity and the nested protocol. Sensitivities of the
PCR amplification were determined by amplification of dilu-
tions of pure K1 DNA. The diagnostic tests amplified pure
parasite DNA down to 5 (with K-K/) - 500 (with L-L/) pg.
This corresponds to 15015,000 copies of target template
DNA. These differences in sensitivity probably reflect the
lowering of affinities due to the introduction of mismatches.
Field samples are often of low parasitaemia (less than
0.5%). In many studies samples from asymptomatics with
low parasitaemias are used, while mixed infections may
contain minor clones of interest. Collection and transport of
fingerprick, earprick, heelprick blood on glass-fiber mem-
branes and filter-papers are an easy way to obtain large
numbers of samples. With field samples from Tanzania on
6 DURAISINGH, CURTIS, AND WARHURST

FIG. 3. Agarose gels of the restriction digests of the PCR products ((a) K-K/; (b) L-L/) of the tests for the polymorphisms of the dhps gene.
U, undigested fragment. Sizes in bp.
DETECTION OF dhfr AND dhps POLYMORPHISMS IN MALARIA
GFM prepared by the method of Warhurst et al. (1991), it
was found that parasitaemias less than 0.5% could not be
reliably amplified in the Nest II reactions directly. These
samples contained background human DNA, as well as other
potential contaminants which reduce sensitivity.
The nested protocol was developed to increase the sensi-
tivity of the PCR reactions (Fig. 1). The blood spots on
GFMs collected from Tanzania, were used to optimize these
reactions. Two pairs of primers, M1 and M5 and R2 and
R/, were designed to flank the primers described above (Fig.
1, Nest I reactions). With this system, parasitaemias as low
as 40/ml (' 0.001%) were consistently amplified using all
primer combinations from GFMs. Sensitivities with diluted
pure DNA were as high as 40 fg (1 copy of target DNA)
with all primer combinations.
DISCUSSION
Certain allelic forms of dhfr and dhps may confer resis-
tance to folate antagonists and sulphonamide drugs (Peterson
et al. 1988; Cowman et al. 1988; Brooks et al. 1994; Triglia
and Cowman 1994; Zindrou et al. 1996; Wang et al. 1997).
In this paper we describe tests based on PCR followed by
restriction digestion which can distinguish variants of the
dhfr and dhps genes. Although the tests we have described
can discriminate between all polymorphisms that have been
described to date, they will overlook novel ones. Sequencing
of the genes of several isolates from new geographical areas
may ensure that this does not happen. The methodology we
have used to develop our system can then be used to create
similar tests for novel polymorphisms.
Mutation-specific PCR systems for the detection of some
of the polymorphisms in the dhfr and dhps genes have been
described (Zolg et al. 1990, Gyang et al. 1992; Wang et al.
1995). These methods are very sensitive and rapid once
optimal thermocycler conditions are established. With the
method we use, the PCR step simply prepares DNA in
sufficient quantities for subsequent restriction digestion.
Therefore PCR, which is influenced by a number of variable
reaction conditions, is separated from restriction digestion
the discriminating step. As with Kwok et al. (1993) we have
found that PCR primers can tolerate several mismatches in
their 38 end, while a reasonable sensitivity is maintained.
This sensitivity is greatly increased when the nested ap-
proach is used.
In practice we have found that restriction digestion
presents the limiting step in this kind of analysis. Therefore
7
we have included different controls to ensure against
misinterpretations due to incomplete digestion. Additional
restriction sites as internal controls and digestion with
restriction enzymes specific for alternative codons in paral-
lel provide powerful controls. Samples with mixed allelic
forms can readily be detected. Few PCR reactions are
needed as several polymorphic sites can be flanked by a
single pair of primers.
These tests were designed to type samples collected from
the field with very low parasitaemias, using simple methods
of collection and transport such as the use of bloodspots on
GFMs or filter paper as the carrier (Warhurst et al. 1991).
In our laboratory, using these methods we have detected
polymorphisms in samples collected in Tanzania, Uganda,
The Gambia, Kenya, Guinea Bissau, and Venezuela. In con-
clusion, these methods provide a simple, rapid, and inexpen-
sive means to determine the prevalences and geographical
distributions of the polymorphisms of the dhfr and dhps
genes of P. falciparum described to date. Moreover the strate-
gies involved in designing the tests may be used to describe
many genetic polymorphisms of P. falciparum.
ACKNOWLEDGMENTS
Financial support for M.T.D. was from E.C. Grant TS3-CT93.0224
and a Wellcome Trust Prize Studentship and for J.C. from the U.K.
Medical Research Council. We acknowledge Dan Salaman for help
with the gel photographs.
REFERENCES
Alecrim, W. D., Dourado, H., Alecrim, M. G., Passos, L. F., Wanssa,
E., and Albuquerque, B. 1982. In vivo resistance of Plasmodium
falciparum to the combination of sulfadoxine and pyrimethamine,
at RIII level, in Amazonas, Brazil. Revista de Instituto Medicale
Tropicale de Sao Paulo 24, 5253.
Basco, L. K., Eldin de Pecoulas, P. H., Wilson, C. M., and Le Bras,
J. 1995. Point mutations in the dihydrofolate reductase gene as the
molecular basis for pyrimethamine and cycloguanil resistance in
Plasmodium falciparum. Molecular and Biochemical Parasitology
69, 135138.
Brooks, D. R., Wang. P., Read, M., Watkins, W. M., Sims, P. F. G.,
and Hyde, J. E. 1994. Sequence variation in the hydroxymethyldihy-
dropterin pyrophosphokinase: dihydropteroate synthetase gene in
lines of the human malaria parasite Plasmodium falciparum, with
different resistance to sulfadoxine. European Journal of Biochemis-
try 224, 397405.
8 DURAISINGH, CURTIS, AND WARHURST
Clyde, D. F., and Shute, G. T. 1954. Resistance of East African varieties
of Plasmodium falciparum to pyrimethamine. Transactions of the
Royal Society of Tropical Medicine and Hygiene 48, 495500.
Cowman, A. F., Morry, M. J., Biggs, B. A., Cross, G. A., and Foote,
S. J. 1988. Amino acid changes linked to pyrimethamine resistance
in the dihydrofolate reductase thymidylate synthase gene of Plasmo-
dium falciparum. Proceedings of the National Academy of Sciences
USA 85, 91099113.
Curtis, J., Duraisingh, M. T., Trigg, J. K., Mbwana, H., Warhurst,
D. C., and Curtis, C. F. 1996. Direct evidence that asparagine at
position 108 of the Plasmodium falciparum dihydrofolate reductase
is involved in resistance to antifolate drugs in Tanzania. Transactions
of the Royal Society of Tropical Medicine and Hygiene 90, 678680.
De Pecoulas, E. P., Basco, L. K., Abdallah, B., DJE, M. K., Le Bras,
J., and Mazabraud 1995. Plasmodium falciparum: Detection of anti-
folate resistance by mutation-specific restriction enzyme digestion.
Experimental Parasitology 80, 483487.
Gutteridge, W. E., and Trigg, P. I. 1971. Action of pyrimethamine and
related drugs against Plasmodium knowlesi in vitro. Parasitology
62, 431444.
Gyang, F. N., Peterson, D. S., and Wellems, T. E. 1992. Plasmodium
falciparum: rapid detection of dihydrofolate reductase mutations that
confer resistance to cycloguanil and pyrimethamine. Experimental
Parasitology 74, 470472.
Huang, M. M., Arnheim, N., and Goodman, M. F. 1992. Extension of
base mispairs by Taq DNA polymerase: Implications for single
nucleotide discrimination in PCR. Nucleic Acids Research 20, 4567
4573.
Hurwitz, E. S., Johnson, D., and Campbell, C. C. 1981. Resistance
of Plasmodium falciparum malaria to sulfadoxine-pyrimethamine
(Fansidar) in a refugee camp in Thailand. Lancet 16, 1, 10681070. Zindrou, S., Dao, L. D., Xuyen, P. T., Dung, H. P., Sy, N. D., Skold,
Kilimali, V. A. E. B., and Mkfuya, A. R. (1985) In vivo assessment
of the sensitivity of Plasmodium falciparum to sulphadoxine/pyri-
methamine combinations (Fansidar) in six localities in Tanzania
where chloroquine-resistant P. falciparum has been detected. Trans-
actions of the Royal Society of Tropical Medicine and Hygiene
79, 482483.
Kwok, S., Kellogg, D. E., McKinney, N., Spasic, D., Goda, L., Leven-
son, C., and Sninsky, J. J. 1990. Effects of primer-template mis-
matches on the polymerase chain reaction: human immunodeficiency
virus type I model studies. Nucleic Acids Research 18, 9991005.
Peterson, D. S., Walliker, D., and Wellems, T. E. 1988. Evidence that
a point mutation in dihydrofolate reductase-thymidylate synthase
confers resistance to pyrimethamine in falciparum malaria. Proceed-
ing of the National Academy of Sciences USA 85, 91149118.
Triglia, T., and Cowman, A. F. 1994. Primary structure and expression
of the dihydropteroate synthetase gene of Plasmodium falciparum.
Proceeding of the National Academy of Sciences USA 91, 7149
7153.
Wang, P., Brooks, D. R., Sims, P. F. G., and Hyde, J. E. 1995. A
mutation-specific PCR system to detect sequence variation in the
dihydropteroate synthetase gene of Plasmodium falciparum. Molecu-
lar and Biochemical Parasitology 71, 115125.
Wang, P., Read, M., Sims, P. F. G., and Hyde, J. E. 1997. Sulfadoxine
resistance in the human malaria parasite Plasmodium falciparum
is determined by mutations in dihydropteroate synthetase and an
additional factor associated with folate utilisation. Molecular Micro-
biology 23, 5, 979986.
Warhurst, D. C., Awad El Kariem, F. M., and Miles, M. A. 1991.
Simplified preparation of malarial blood samples for polymerase
chain reaction. Lancet 2, 337, 303304.
Winstanley, P. A., Mberu, E. K., Szwandt, I. S. F., Breckenridge,
A. M., and Watkins, W. M. 1995. In vitro activities of novel antifolate
drug combinations against Plasmodium falciparum and human gran-
ulocyte CFUs. Antimicrobial Agents and Chemotherapy 39, 4, 948
952.
Wu, Y., Kirkman., L. A., and Wellems, T. E. 1996. Transformation of
Plasmodium falciparum malaria parasites by homologous integration
of plasmids that confer resistance to pyrimethamine. Proceedings
of the National Academy of Sciences USA 93, 11301134.
O., and Swedberg, G. 1996. Rapid detection of pyrimethamine sus-
ceptibility of Plasmodium falciparum by restriction endonuclease
digestion of the dihydrofolate reductase gene. American Journal of
Tropical Medicine and Hygiene 54, 2, 185188
Zolg, J. W., Chen, G. X., and Plitt, J. R. 1991. Detection of pyrimeth-
amine resistance in Plasmodium falciparum by mutation-specific
polymerase chain reaction. Molecular and Biochemical Parasitology
39, 2, 25765
Received 27 May 1997; accepted with revision 8 December 1997