Appl Biochem Biotechnol (2014) 172:34883501

DOI 10.1007/s12010-014-0784-7

Thermostable Hemicellulases of a Bacterium, Geobacillus

sp. DC3, Isolated from the Former Homestake Gold Mine
in Lead, South Dakota

Terran E. Bergdale & Stephen R. Hughes & Sookie S. Bang

Received: 11 December 2013 / Accepted: 5 February 2014 /

Published online: 19 February 2014
# Springer Science+Business Media New York 2014

Abstract A thermophilic strain, Geobacillus sp. DC3, capable of producing hemicellulolytic

enzymes was isolated from the 1.5-km depth of the former Homestake gold mine in
Lead, South Dakota. The DC3 strain expressed a high level of extracellular endoxylanase
at 39.5 U/mg protein with additional hemicellulases including -xylosidase (0.209 U/mg)
and arabinofuranosidase (0.230 U/mg), after the bacterium was grown in xylan for 24 h.
Partially purified DC3 endoxylanase exhibited a molecular mass of approximately 43 kDa
according to zymography with an optimal pH of 7 and optimal temperature of 70 C.
The kinetic constants, Km and Vmax, were 13.8 mg/mL and 77.5 mol xylose/minmg xylan,
respectively. The endoxylanase was highly stable and maintained 70 % of its original activity
after 16 h incubation at 70 C. The thermostable properties and presence of three different
hemicellulases of Geobacillus sp. DC3 strain support its potential application for industrial
hydrolysis of renewable biomass such as lignocelluloses.

Keywords Geobacillus . Extremophile . Xylanase . Betaxylosidase . Arabinofuranosidase

Introduction

Environmental microorganisms have been frequently sought for their ability to produce novel
enzymes and potential in enhancing industrial processes. The recent demands for renewable
biofuels have led to bioprospecting for microorganisms capable of producing such enzymes
from extreme environments including compost piles, hot springs, and deep mines [13].
Recognizing environmental concerns of the general public on petroleum-based fuels,
bioprocessing using lignocellulosic feedstock has become an attractive renewable energy

T. E. Bergdale : S. S. Bang (*)

Department of Chemical and Biological Engineering, South Dakota School of Mines and Technology,
501 East Saint Joseph Street, Rapid City, SD 57701, USA
e-mail: sookie.bang@sdsmt.edu

S. R. Hughes
Renewable Product Technology Research Unit, National Center for Agricultural Utilization Research
(NCAUR), Agricultural Research Service (ARS), United States Department of Agriculture (USDA),
1815 North University Street, Peoria, IL 61604, USA
Appl Biochem Biotechnol (2014) 172:34883501 3489

alternative. Due to the fact that these processes often accompany extreme pH or temperature, it
is plausible to apply thermostable cellulases and hemicellulases in biomass conversion to
fermentable sugars.
The Homestake gold mine, located in the Black Hills of Lead, SD (44 35 2074 N, 103
75 082 W), provides an ideal site for bioprospecting of such extremophilic microorganisms.
Until its closure in 2001, this mine was active for 125 years and mined down to 2.5 km
below the surface. While the mine was developed into the Sanford Underground Re-
search Facility (SURF), formerly referred to as the Deep Underground Science and
Engineering Laboratory (DUSEL), it was accessible for scientific research. Our previous
work examined water and weathered soil-like material from the 610-m depth of SURF,
including phylogenetic and geochemical analyses [4]. The results indicated the presence
of a diverse microbial community within the mine samples containing high concentra-
tions of heavy metals, sulfur, nitrogen, and salt. Additional research on SURF samples at
the 1.5-km depth confirmed the presence of bacteria capable of utilizing cellulosic
biomass [3, 5, 6]. Our current study examines the capability of bacteria from SURF to
utilize hemicellulosic biomass.
Xylan, one of the main forms of hemicellulose, is a heteropolymer comprised of -1,4-
linked xylopyranose sugars with variable substituent groups depending on the source [7].
Xylan is the second most abundant polysaccharide found in nature after cellulose and
comprises approximately one third of all renewable organic carbon on earth [8]. Xylan
polymers are readily degraded by two hydrolytic enzymes, endo-1,4--xylanase (EC
3.2.1.8) and xylan 1,4--xylosidase (EC 3.2.1.37). The former randomly cleaves the
xylan backbone, while the latter removes xylose monomers from the non-reducing end
of xylo-oligosaccharides and xylobiose. Removal of the various substituent groups is
performed by multiple enzymes such as - L-arabinofuranosidase (EC 3.2.1.55),
arabinan endo-1,5--L-arabinanase (EC 3.2.1.99), -D-glucuronidase (EC 3.2.1.139),
mannan endo-1,4--mannosidase (EC 3.2.1.78), -mannosidase (EC 3.2.1.25), feruloyl
esterase (EC 3.1.1.73), and acetylxylan esterase (EC 3.1.1.72) [911]. The cooperation
of these enzymes is required for complete hydrolysis of the different types of xylan,
as well as a close interaction between the enzymes and substrates [12, 13]. Xylanases
are industrially important due to a wide range of their application beyond biofuel
production, including food, beer and wine, animal feed, textiles and laundry, pulp and paper,
and agricultural industries [14].
Extensive studies have been performed on extracellular xylanases from diverse groups of
mesophilic and thermophilic microorganisms including fungal species from the genera
Trichoderma [15], Thermomyces [16], Aspergillus [17], and Talaromyces [18] and several
bacterial species within the genera Streptomyces [19], Bacillus [2022], and Geobacillus [1, 3,
2325]. Single organisms have been found to produce multiple xylanases [20, 2628], which
can lead to synergistic effects on hydrolysis. Conversion of xylan to fermentable sugars can
also be enhanced through use of thermostable enzymes. Endoxylanases from various thermo-
philic Bacillus strains have been purified and characterized including Bacillus sp. JB99 [22],
Geobacillus stearothermophilus T-6 [24, 29], and G. thermoleovorans [30]. Hemicellulases of
Geobacillus strains were also heterologously expressed in Escherichia coli [20, 31].
In this study, a wood slime sample from the Homestake mine at the 1.5-km level was used
as the source for lignocellulolytic microorganisms. We report the characteristics of a thermo-
philic strain isolated from SURF, Geobacillus sp. DC3, with respect to its ability to produce
hemicellulolytic enzymes including endoxylanase, -xylosidases, and -arabinofuranosidase.
Kinetic constants and additional biochemical characteristics of the DC3 endoxylanase were
also examined using the partially purified enzyme.
3490 Appl Biochem Biotechnol (2014) 172:34883501

Materials and Methods

Chemicals and Materials

All chemicals including beechwood xylan, carboxymethyl cellulose (CMC), Avicel, micro-
crystalline cellulose, p-nitrophenyl-- D -xylopyranoside (pNPX), p-nitrophenyl-- L-
arabinofuranoside (pNPA), p-nitrophenyl--D-cellobioside (pNPC), and p-nitrophenyl--D-
glucopyranoside (pNPG) used in this study were purchased from Sigma-Aldrich (St. Louis,
MO) unless noted otherwise.

Strain Isolation and Growth Conditions

A slimy wood sample was obtained from SURF at the 1.5-km depth on July 1, 2009, where the
surrounding ambient temperature was approximately 25 C, and the local water pH was 8.42.
The sample was taken using sterile gloves and spatulas, placed in a sterile Whirl-Pak bag
(Nasco, Fort Atkinson, WI), and kept on ice while transported to the laboratory. The wood
slime was immediately enriched for 7 days at 60 C in a modified Nitschs minimal medium
containing a low amount of NH4Cl (0.2 g/L) and additional CaCl22H2O (0.05 g/L) [32],
which was supplemented with pine timber (10 g/L) (KL Energy, Rapid City, SD) as the sole
energy and carbon sources. Pure isolates were obtained from colonies grown on modified
Nitschs medium containing substrate (10 g/L CMC or xylan) and Bacto agar (15 g/L). For the
screening of cellulolytic activity, Grams iodine plate tests were used [33]. Briefly, after
overnight growth, the plates were flooded with Grams iodine solution (2 g KI and 1 g I2 in
300 mL distilled water) for 15 min at room temperature. As halos around colonies appeared,
the stain solution was poured off. The strains exhibiting apparent hydrolytic activities were
further characterized through phylogenetic analyses and enzyme assays.
The isolates were maintained and cultured on a modified Sharma basal medium containing
(per liter) the following: 2 g yeast extract, 1 g peptone, 2 g (NH4)2SO4, 0.3 g MgSO47H2O,
2.5 g K2HPO4, 1 g NaCl, 0.05 g CaCl22H2O, and 1 g xylan with 15 g Bacto agar for solid
medium [23].

Strain Identification and Phylogenetic Analysis

For phylogenetic analysis of the SURF isolates, genomic DNA was extracted after lysing the
cells with sodium dodecyl sulfate (SDS) [34] and DNA concentrations were determined by the
NanoDrop ND-1000 spectrophotometer (Thermo Scientific, Pittsburg, PA). The 16S rRNA
gene sequences were amplified from the extracted DNA. Polymerase chain reactions (PCRs)
were performed on an iCycler thermal cycler (Bio-Rad, Hercules, CA) and consisted of
approximately 200 ng of sample DNA, 25 L of 2 Master Mix (Promega, Madison, WI),
0.25-M of forward primer (27F [5AGAGTTTGATCCTGGCTCAG3]) [35] and reverse
primer (1492R [5GGTTACCTTGTTACGACTT3] [36], and nuclease-free water for a total
volume of 50 L. Thermal cycling parameters were as described previously [4]. The appro-
priate band was excised after gel electrophoresis and cleaned using the Promega Wizard SV
gel and PCR cleanup kit (Promega, Madison, WI). The PCR products were sequenced by
Molecular Cloning Laboratories (MCLAB, South San Francisco, CA). Electropherograms of
the 16S rDNA sequences were viewed and edited with Sequencher software (Gene Codes,
Ann Arbor, MI).
The sequences were aligned using the ClustalW software [37] to generate Jukes-Cantor-
corrected distance matrices [38]. The SeqMatch tool of the Ribosomal Database Project (RDP)
Appl Biochem Biotechnol (2014) 172:34883501 3491

II was used to obtain closely related phylogenetic sequences for references in the phylogenetic
trees [39]. The trees were constructed in MEGA version 4 [40], using the neighbor-joining
method [41] and 10,000 bootstrap replicates to test phylogeny [42].

Enzyme and Protein Assays

Endoxylanase activity was measured by incubating a reaction mixture with a total volume of
1 mL containing 0.1 mL of enzyme solution in 50-mM sodium phosphate buffer, pH 7, and
xylan (10 g/L) for 5 min at 60 C. Endoglucanase activity was measured under the same
conditions as those of endoxylanase, except using CMC (10 g/L) as the substrate and
incubating the reaction for 30 min at 60 C. Both reactions were terminated by adding
1.5 mL of 3,5,-dinitrosalicylic acid (DNS) reagent [43] and incubated at 100 C for 5 min,
followed by cooling on ice. The amount of reducing sugars was measured at 540 nm using
xylose or glucose (08 mM) as the standard for endoxylanase or endoglucanase activity,
respectively. One unit of endoxylanase or endoglucanase was defined as the amount of enzyme
required to release 1 mol of reducing sugar per minute. Effects of pH on endoxylanase
activity were examined using four different 50-mM buffers: citrate (pH 36), sodium phos-
phate (pH 68), Tris-HCl (pH 89), and sodium bicarbonate (pH 1011).
Activities of -xylosidase, arabinofuranosidase, exoglucanase, and -glucosidase were
measured by incubating a reaction mixture with a total volume of 0.5 mL containing
0.1-mL enzyme, 1-mM pNPX, pNPA, pNPC, and pNPG, respectively, in 50-mM sodium
phosphate buffer, pH 7. After incubation at 60 C for 10 min, the reaction was terminated by
adding 1-mL of 1-M Na2CO3. The amount of p-nitrophenol (pNP) released was measured at
405 nm, using a pNP standard (0125 M) [44, 45]. One unit of each enzyme was defined as
the amount of enzyme required to release 1 mol of pNP per minute.
The amount of total protein present in the samples was determined by following the
procedure of Bradford [46] with a Bio-Rad protein assay solution (Bio-Rad, Hercules, CA).
Bovine serum albumin was used as the standard (016 g/mL).

Polyacrylamide Gel Electrophoresis and Zymography

Native [47] and SDS [48] polyacrylamide gel electrophoreses (PAGE) were conducted
using 10 % gels to analyze the samples for the presence of proteins and their hydrolytic
activities. In both PAGE, the protein patterns were visualized with Coomassie brilliant
blue R-250, while enzyme activities of the proteins were detected via zymography by
preparing the gels embedded with substrates (2 mg/mL), including xylan, CMC, and
locust bean gum for the detection of endoxylanase, endoglucanase, and mannase activities,
respectively. The Bio-Rad Precision Plus Protein standard (Hercules, CA) was used as
molecular markers.
For zymography of native PAGE, the gels were washed twice after electrophoresis in 10-
mM sodium phosphate buffer, pH 7, at room temperature with shaking. Endoxylanase,
endoglucanase, and mannase activity gels were washed twice with 10-mM sodium phosphate
buffer, pH 7, for 15 min each at room temperature, and incubated in fresh buffer for 14 h at
60 C. To observe enzyme activities, the gels were stained through submerging in Congo red
(3 mg/mL) while shaking for 15 min, destained with 1-M NaCl until achromatic bands
appeared, and then treated with 0.5 % glacial acetic acid to increase contrast. Activities of
-xylosidase, arabinofuranosidase, exoglucanase, and -glucosidase were examined by incu-
bating washed gels at 60 C in 2.5-mM of pNPX, pNPA, pNPC, and pNPG, respectively, in
10-mM sodium phosphate buffer, pH 7, for 15 min.
3492 Appl Biochem Biotechnol (2014) 172:34883501

For zymography of SDS-PAGE, the denatured enzymes in the gel were refolded after
electrophoresis for 30 min in -cyclodextrin (2 mg/mL) [49], while shaking at room temper-
ature. The gels were then washed with 10-mM sodium phosphate buffer, pH 7, twice for
15 min each with shaking at room temperature, which were further incubated in fresh buffer
for 14 h at 60 C, followed by Congo red staining.

Purification of Xylanases

Geobacillus sp. DC3 was grown in a modified Sharma liquid medium containing xylan (1 g/L)
for 24 h at 60 C and 150 rpm. Cell-free culture supernatant (2 L) was collected by
centrifugation at 7,500 rpm to remove cells followed by filtration to remove media debris or
precipitants (0.45 m nylon filter). The supernatant was concentrated by ultrafiltration with a
Pellicon Biomax XL 5-kDa cutoff filter (Millipore, Billerica, MA) and fractionated with
(NH4)2SO4 crystals. The 3070 % NH4SO4 fraction was dissolved in a minimal amount of
20-mM piperazine-HCl buffer, pH 10, and dialyzed in 3 L of the same buffer. The dialysate
was clarified through a 0.2-m nylon filter, and the clear filtrate was added to an anion
exchange (AE) Q-sepharose fast flow (GE Life Sciences, Uppsala, Sweden) column
(10 cm1.1 cm) pre-equilibrated with 20-mM piperazine-HCl buffer, pH 10 at room
temperature. Elution was performed at a flow rate of 0.5 mL/min with a linear gradient to
0.5-M NaCl and a final elution with 1-M NaCl. Fractions of 5-mL were collected to
determine enzyme activity. Those exhibiting xylanolytic activity were pooled into 5
groups based on zymography, each of which was concentrated by (NH4)2SO4 precipitation
up to 90 %. The concentrated pools were suspended in 50-mM sodium phosphate buffer,
pH 7, dialyzed against the same buffer, and characterized through the enzyme assays and
zymography.

Results and Discussion

Identification of Lignocellulolytic Isolates

Seven thermophilic lignocellulolytic SURF strains were isolated from enrichment cultures
using lignocellulosic substrates. Sequence analyses by RDP II classifier and BLAST of 16S
rDNA identified that all of the strains belonged to the genus Geobacillus. Furthermore, four of
the isolates had 100 % similarity in their 16S rDNA sequences and grouped into a single strain,
DC1 (Fig. 1). The 16S rDNA sequences from a total of four individual isolates were submitted
to GenBank and assigned under accession numbers, KC822365, KC822366, KC822367, and
KC822368.
The DC1 isolates (KC822365) were closely related to G. caldoxylosilyticus (AY608951).
Isolate DC5 (KC822367) was most closely related to G. thermodenitrificans (Z26928) that has
genes corresponding to unique metabolism adapted to petroleum products [50]. Isolate DC6
(KC822368) was most closely related to G. thermoglucosidasius (X60641) that exhibited a high
level of oligo--1,6-glucosidase activity [51]. In addition, a strain of G. thermoglucosidasius
was reported to ferment C5 and C6 sugars and to tolerate 10 % (v/v) ethanol [52]. Isolate DC3
(KC822366) was 99 % similar to three G. thermoleovorans strains: G. thermoleovorans GE-7
(AY450926) isolated from a deep South African gold mine [53], Geobacillus sp. R7
(EU010242), a thermophilic, cellulolytic strain, previously isolated from SURF (formerly
DUSEL) [3], and G. thermoleovorans ATCC 43513 (M77488) expressing cellulolytic [1]
and xylanolytic activities [23]. As depicted in the phylogenetic tree (Fig. 1), all SURF
Appl Biochem Biotechnol (2014) 172:34883501 3493

Fig. 1 Phylogenetic tree showing the relationship of 16S rDNA sequences from SURF isolates with reference
sequences selected from GenBank. The isolate sequences are in bold and the representative GenBank accession
numbers in parentheses. Bootstrap values (10,000 data re-samplings) above 75 % are shown. The scale bar
represents 0.01 substitutions per nucleotide position. Tree is rooted with Bacillus subtilis DSM10 as an outgroup

Geobacillus isolates clustered closely together due to high levels of similarity in 16S
rDNA sequences (96 %).

Enzyme Activities from the SURF Isolate DC3

Geobacillus sp. DC3 grew on both CMC (Fig. 2a) and xylan (Fig. 2b), exhibiting significantly
higher hydrolytic activities, as measured by Congo red staining, than other SURF isolates. The
DC3 strain grew faster on xylan than on CMC (unpublished observation), which is consistent
with the previous study indicating that Geobacillus strains grew best on the substrate xylan

Fig. 2 Plate screening of SURF Geobacillus isolates for hydrolytic enzymes, where strains were grown for 24 h
on Sharma medium containing different substrates (2 g/L) including a CMC and b xylan. Plates were stained
using Grams iodine solution where the enzyme activities are visible as clear halos against a dark background
3494 Appl Biochem Biotechnol (2014) 172:34883501

[23]. Therefore, xylan was used as the substrate for further characterization of the strain.
Cellulolytic and xylanolytic activities of the DC3 strain were examined in the presence of
xylan, where there were little or no detectible levels of endoglucanase, -glucosidase, and
exoglucanase activities. However, significant levels of endoxylanase, -xylosidase, and
arabinofuranosidase activities were measured. Cell growth was further examined in the
presence of xylan as well as its ability to produce these three different hemicellulase enzymes
(Fig. 3). Maximum endoxylanase and -xylosidase activities were observed after 1 day of
growth, while arabinofuranosidase activity was highest on day 4. Endoxylanase activity
steadily declined after the first day, whereas -xylosidase and arabinofuranosidase activities
maintained their levels for the remainder of the test period.

Zymogram Analysis

Cell-free supernatant of the DC3 culture grown in xylan for 24 h was concentrated using
ultrafiltration and (NH4)2SO4 fractionation (3070 %). The concentrated dialyzed sample was
analyzed with native and SDS-PAGE gels.

Native PAGE

The DC3 proteins were subjected to native PAGE (Fig. 4a), where protein patterns were
examined after Coomassie blue staining (lane 1) and hemicellulase activities detected after
zymography (lanes 24). Zymograms of native PAGE of DC3 proteins show the presence of
multiple hemicellulases (arrows), including one endoxylanase (lane 2), two -xylosidases
(lane 3), and one arabinofuranosidase (lane 4). Due to the smear observed in the zymogram of

Fig. 3 Cell growth and enzyme activities of Geobacillus sp. DC3 grown on Sharma medium containing xylan
(1 g/L) for 4 days. Cell-free supernatant was measured for the total protein concentration and endoxylanase
(Endo-XYL), -xylosidase (-XYL), and arabinofuranosidase (Araf-ASE) activities. Error bars represent
standard deviation of triplicate measurements
Appl Biochem Biotechnol (2014) 172:34883501 3495

Fig. 4 PAGE and zymogram analyses of DC3 concentrated cell-free supernatant. a Native PAGE (50 g protein
per well): Coomassie blue stain (lane 1), zymograms of Endo-XYL (lane 2), -XYL (lane 3), and Araf-ASE
(lane 4). b SDS-PAGE (10 g protein per well): Coomassie blue stain of molecular markers (lane 1) and DC3
proteins (lane 2), and zymogram of DC3 Endo-XYL (lane 3). Arrows indicate enzyme activities

native PAGE (lane 2), it is not clear whether the endoxylanase produced by DC3 is a single
isozyme or a multimeric protein that also has -xylosidase or arabinofuranosidase catalytic
sites. This smearing effect may be due to either activity or binding of the enzyme with the
gel-embedded substrate during electrophoresis [54, 55]. However, xylan showed little effect
on the mobility of the -xylosidases or arabinofuranosidase when embedded within the
native PAGE gels (lanes 3 and 4). No other enzymatic activities of glycosyl hydrolases
including endoglucanase, exoglucanase, -glucosidase, or mannase were detected by zymography
of native PAGE.

SDS-PAGE

Zymogram of SDS-PAGE (Fig. 4b) of DC3 proteins shows a primary band of endoxylanase
activity at the molecular mass of approximately 43 kDa (lane 3). Endoxylanases from other
Geobacillus species have been reported to have similar molecular masses within the 4548-
kDa range [23, 30]. Interestingly, zymography of SDS-PAGE exhibited neither -xylosidase
nor arabinofuranosidase activity under different sample preparation conditions such as elimi-
nation of mercaptoethanol and boiling. This may be due to the commonly observed multimeric
structures of -xylosidase and arabinofuranosidase, which cannot be properly refolded after
separation through SDS-PAGE [56]. Alternatively, the endoxylanase protein produced by DC3
may contain multiple catalytic sites in a single protein as described by Zhu et al. [57], in
which case the -xylosidase and arabinofuranosidase catalytic regions were irreversibly
denatured under SDS conditions. In addition, no activity of endoglucanase, -glucosidase,
or mannase was detected through zymography of SDS-PAGE from the DC3 proteins.

Purification of Endoxylanase

Figure 5 depicts a chromatogram of the AE column loaded with concentrated cell-free

supernatant after ultrafiltration and (NH4)2SO4 fractionation. Endoxylanase activity of each
3496 Appl Biochem Biotechnol (2014) 172:34883501

Fig. 5 Anion exchange chromatography of DC3 concentrated cell-free supernatant. Blocks indicate pooled fractions

5-mL fraction was analyzed using zymography to avoid interference of NaCl on the DNS
assay or activity of the enzymes [58]. The fractions showing endoxylanase activities were
pooled into five groups as numbered blocks (Fig. 5). Endoxylanase activity was detected in a
broad range of the elution profile, in which pool 1 contained the highest level of endoxylanase
specific activity with little -xylosidase or arabinofuranosidase activity (Table 1). In addition,
SDS-PAGE of pool 1 (Fig. 6) showed the presence of less proteins and higher endoxylanase
activity than the concentrated cell-free supernatant, indicating that DC3 endoxylanase was
partially purified via AE chromatography. This partially purified endoxylanase (pool 1)
was used for further studies on the biochemical characteristics of endoxylanase. Pools 25
contained endoxylanase activities of less than 10 U/mg protein for each pool (Table 1).
The levels of -xylosidase and arabinofuranosidase increased as the concentration of
NaCl in the elution increased, majority of which were eluted from the column at a high
concentration of NaCl.

Table 1 Hemicellulase activities during partial purification of endoxylanase from Geobacillus sp. DC3

Endo-XYL (U/mg) -XYL (U/mg) Araf-ASE (U/mg)

Cell-free supernatant 33.8 0.127 0.907

(NH4)2SO4 fraction (3070 %) 12.3 0.046 0.447
Anion exchange
Pool 1 129.8 0.001 0
Pool 2 7.8 0.002 0.004
Pool 3 1.3 0.002 0.003
Pool 4 2.4 0.044 0.034
Pool 5 8.6 0.309 0.054

Endo-XYL endoxylanase (beechwood xylan), -XYL betaxylosidase (pNPX), Araf-ASE arabinofuranosidase

(pNPA)
Appl Biochem Biotechnol (2014) 172:34883501 3497

Fig. 6 SDS-PAGE and zymogram analyses of DC3 partially purified endoxylanase from AE column pool 1.
SDS-PAGE (10 g protein per well): Coomassie blue stain of molecular markers (lane 1) and DC3 proteins
(lane 2), and zymogram of DC3 Endo-XYL (lane 3). An arrow indicates enzyme activity

Overall, the DC3 strain had comparable endoxylanase activity to other thermophilic
Bacillus and Geobacillus strains as observed in Table 2. Michaelis-Menten kinetic constants
of the partially purified DC3 endoxylanase exhibited a maximum velocity (Vmax) of
77.5 mol/minmg and Km of 13.8 mg/mL. Although the Km value of DC3 endoxylanase
was higher than that of G. thermoleovorans as shown in Table 2, it was comparable to previous
studies that showed a wide range for xylanases in bacilli from 0.3217 mg/mL [56, 59].
Geobacillus DC3 endoxylanase had a molecular mass close to that of G. thermoleovorans and
G. stearothermophilus T-6. Thermostable endoxylanases have been reported from
thermoalkaliphiles as well as thermoacidophiles [60]. The optimal pH of DC3 endoxylanase
was 7 at 70 C (Fig. 7). However, it maintained over 60 % of its maximum activity in a broad
pH range of 48 and more than 50 % of its activity at temperatures ranging from 50 C to
90 C. Furthermore, DC3 endoxylanase exhibited high thermostability at elevated tempera-
tures where the enzyme maintained 87.6, 70.1, and 53.1 % of its original level when incubated

Table 2 Properties of thermostable endoxylanases from Geobacillus and Bacillus sp.

Strain Endo-XYL Optimum Km Vmax Molecular Reference

(U/mg) (mg/ml) mass (kDa)
pH Temp
(C)

Geobacillus 10.2 8.5 80 2.6 31.2 mol/minmg 48 [30]

thermoleovorans
Geobacillus sp. DC3 39.5 7 70 13.8 77.5 mol/minmg 43 This study
Bacillus 7.2 6.5 55 1.63 288 U/mg 43 [24]
stearothermophilus T-6
Bacillus sp. JB 99 61.9 8 70 4.8 218.6 M/minmg 20 [22]
Bacillus polymyxa 4.5 6.5 50 17.7 112 U/mg 61 [61]
CECT 153
3498 Appl Biochem Biotechnol (2014) 172:34883501

Fig. 7 Effects of pH (a) and temperature (b) on DC3 endoxylanase (pool 1). Relative activities are expressed as
percent of maximum. Error bars represent standard deviation of triplicate measurements

for 16 h at 60, 70, and 80 C, respectively (Fig. 8). These results support the potential for
application of endoxylanase produced by Geobacillus sp. DC3 in industrial processes that are
often carried out at elevated temperatures and varied pH ranges.
To date, limited studies have investigated the thermophilic lignocellulolytic capabilities of
Geobacillus strains. Geobacillus sp. R7 isolated from SURF at the 1.5-km depth showed
endoglucanase activity with an acidic optimum pH range of 46 [3]. Khasin et al. [24] found
endoxylanase of G. stearothermophilus (formerly Bacillus) to optimally bleach pulp at pH 9
and 65 C. Sharma et al. [23] characterized a G. thermoleovorans strain that produced
cellulase-free endoxylanase and -xylosidase, where the optimum activity of its endoxylanase
was found at pH 8.5 and 80 C. It has been reported that G. stearothermophilus 21 produces
both endoxylanase and -xylosidase [20], while several Geobacillus strains produce
arabinofuranosidase and endoxylanase [25]. However, no investigation has reported the
presence of all three of these hemicellulases in one Geobacillus strain. In particular, the SURF
Geobacillus DC3 strain exhibiting a broad range of hemicellulase activities at elevated

Fig. 8 Thermostability of DC3 endoxylanase (pool 1). Relative activities are expressed as percent of maximum.
Error bars represent standard deviation of triplicate measurements
Appl Biochem Biotechnol (2014) 172:34883501 3499

temperatures has potential as a biocatalyst to enhance biomass conversion efficiency in

biofuels production from plant biomass. Further studies involving cloning and enzyme
purification are needed to determine whether multiple domains of these proteins exist or if
they are individual isozymes.

Acknowledgments The authors wish to thank Dr. Cynthia Anderson and Dr. Dave Bergmann at Black Hills
State University for providing valuable help in obtaining and interpreting sequencing data. Additional thanks go
toward Dr. Todd Menkhaus for lending equipment for this project. Part of this work was supported by the South
Dakota NASA EPSCoR Research Infrastructure Development (RID) Grant No. NNX07AL04A and South
Dakota Board of Regents (SDBOR/BHSU 2011-19005) as a subaward from Black Hills State University
(BHSU/SDSMT BA1100002). Additional support was received from the South Dakota 2010 Center of
Bioprocessing Research and Development.

References

1. Tai, S. K., Lin, H. P., Kuo, J., & Liu, J. K. (2004). Isolation and characterization of a cellulolytic Geobacillus
thermoleovorans T4 strain from sugar refinery wastewater. Extremophiles, 8, 345349.
2. Wang, C. M., Shyu, C. L., Ho, S. P., & Chiou, S. H. (2007). Species diversity and substrate utilization
patterns of thermophilic bacterial communities in hot aerobic poultry and cattle manure composts. Microbial
Ecology, 54, 19.
3. Rastogi, G., Muppidi, G. L., Gurram, R. N., Adhikari, A., Bischoff, K. M., Hughes, S. R., et al. (2009).
Isolation and characterization of cellulose-degrading bacteria from the deep subsurface of the Homestake
gold mine, Lead, South Dakota, USA. Journal of Industrial Microbiology and Biotechnology, 36, 585598.
4. Waddell, E. J., Elliott, T. J., Vahrenkamp, J. M., Roggenthen, W. M., Sani, R. K., Anderson, C. M., et al.
(2010). Phylogenetic evidence of noteworthy microflora from the subsurface of the former Homestake gold
mine, Lead, South Dakota. Environmental Technology, 31, 979991.
5. Rastogi, G., Bhalla, A., Adhikari, A., Bischoff, K. M., Hughes, S. R., Christopher, L. P., et al. (2010).
Characterization of thermostable cellulases produced by Bacillus and Geobacillus strains. Bioresource
Technology, 101, 87988806.
6. Zambare, V. P., Bhalla, A., Muthukumarappan, K., Sani, R. K., & Christopher, L. P. (2011). Bioprocessing of
agricultural residues to ethanol utilizing a cellulolytic extremophile. Extremophiles, 15, 611618.
7. Biely, P. (1985). Microbial xylanolytic systems. Trends in Biotechnology, 3, 286290.
8. Prade, R. A. (1996). Xylanases: from biology to biotechnology. Biotechnology and Genetic Engineering, 13,
101131.
9. Coughlan, M. P. and Hazlewood, G. P. (1993). Hemicellulose and hemicellulases. ed. Portland Press,
London ; Chapel Hill, NC.
10. Collins, T., Gerday, C., & Feller, G. (2005). Xylanases, xylanase families and extremophilic xylanases.
FEMS Microbiology Reviews, 29, 323.
11. Subramaniyan, S., & Prema, P. (2002). Biotechnology of microbial xylanases: enzymology, molecular
biology, and application. Critical Reviews in Biotechnology, 22, 3364.
12. Bayer, E. A., Setter, E., & Lamed, R. (1985). Organization and distribution of the cellulosome in Clostridium
thermocellum. Journal of Bacteriology, 163, 552559.
13. Ratanakhanokchai, K., Kyu, K. L., & Tanticharoen, M. (1999). Purification and properties of a xylan-
binding endoxylanase from alkaliphilic Bacillus sp. strain K-1. Applied and Environmental Microbiology, 65,
694697.
14. Howard, R. L., Abotsi, E., Jansen van Rensburg, E. L., & Howard, S. (2003). Lignocellulose biotechnology:
issues of bioconversion and enzyme production. African Journal of Biotechnology, 2, 602619.
15. Mach, R. L., & Zeilinger, S. (2003). Regulation of gene expression in industrial fungi: Trichoderma. Applied
Microbiology and Biotechnology, 60, 515522.
16. Bakalova, N. G., Petrova, S. D., Atev, A. P., Bhat, M. K., & Kolev, D. N. (2002). Biochemical and catalytic
properties of endo-1,4--xylanases from Thermomyces lanuginosus (wild and mutant strains). Biotechnology
Letters, 24, 11671172.
17. Krengel, U., & Dijkstra, B. W. (1996). Three-dimensional structure of Endo-1,4-beta-xylanase I
from Aspergillus niger: molecular basis for its low pH optimum. Journal of Molecular Biology,
263, 7078.
3500 Appl Biochem Biotechnol (2014) 172:34883501

18. Maalej, I., Belhaj, I., Masmoudi, N. F., & Belghith, H. (2009). Highly thermostable xylanase of the
thermophilic fungus Talaromyces thermophilus: purification and characterization. Applied Biochemistry
and Biotechnology, 158, 200212.
19. Jiang, Z. Q., Deng, W., Li, L. T., Ding, C. H., Kusakabe, I., & Tan, S. S. (2004). A novel, ultra-large
xylanolytic complex (xylanosome) secreted by Streptomyces olivaceoviridis. Biotechnology Letters, 26,
431436.
20. Baba, T., Shinke, R., & Nanmori, T. (1994). Identification and characterization of clustered genes for
thermostable xylan-degrading enzymes, beta-xylosidase and xylanase, of Bacillus stearothermophilus 21.
Applied and Environmental Microbiology, 60, 22522258.
21. Mamo, G., Hatti-Kaul, R., & Mattiasson, B. (2006). A thermostable alkaline active endo--1,4-xylanase
from Bacillus halodurans S7: purification and characterization. Enzyme and Microbial Technology, 39,
14921498.
22. Shrinivas, D., Savitha, G., Raviranjan, K., & Naik, G. R. (2010). A highly thermostable alkaline cellulase-
free xylanase from thermoalkalophilic Bacillus sp. JB 99 suitable for paper and pulp industry: purification
and characterization. Applied Biochemistry and Biotechnology, 162, 20492057.
23. Sharma, A., Adhikari, S., & Satyanarayana, T. (2007). Alkali-thermostable and cellulase-free xylanase
production by an extreme thermophile Geobacillus thermoleovorans. World Journal of Microbiology and
Biotechnology, 31, 5156.
24. Khasin, A., Alchanati, I., & Shoham, Y. (1993). Purification and characterization of a thermostable xylanase
from Bacillus stearothermophilus T-6. Applied and Environmental Microbiology, 59, 17251730.
25. Canakci, S., Inan, K., Kacagan, M., & Belduz, A. O. (2007). Evaluation of arabinofuranosidase and xylanase
activities of Geobacillus spp. isolated from some hot springs in Turkey. Journal of Microbiology and
Biotechnology, 17, 12621270.
26. Biely, P., Vrsanska, M., Tenkanen, M., & Kluepfel, D. (1997). Endo--xylanases families: differences in
catalytic properties. Journal of Biotechnology, 57, 151.
27. Saraswat, V., & Bisaria, V. S. (2000). Purification, characterization and substrate specificities of xylanase
isoenzymes from Melanocarpus albomyces IIS 68. Bioscience Biotechnology and Biochemistry, 64,
11731180.
28. van Dyk, J. S., Sakka, M., Sakka, K., & Pletschke, B. I. (2009). The cellulolytic and hemi-cellulolytic system
of Bacillus licheniformis SVD1 and the evidence for production of a large multi-enzyme complex. Enzyme
and Microbial Technology, 45, 372378.
29. Teplitsky, A., Mechaly, A., Stojanoff, V., Sainz, G., Golan, G., Feinberg, H., et al. (2004). Structure
determination of the extracellular xylanase from Geobacillus stearothermophilus by selenomethionyl
MAD phasing. Acta Crystallographica Section D: Biological Crystallography, 60, 836848.
30. Verma, D., & Satyanarayana, T. (2012). Cloning, expression and applicability of thermo-alkali-stable
xylanase of Geobacillus thermoleovorans in generating xylooligosaccharides from agro-residues.
Bioresource Technology, 107, 333338.
31. Wu, S., Liu, B., & Zhang, X. (2006). Characterization of a recombinant thermostable xylanase from deep-sea
thermophilic Geobacillus sp. MT-1 in East Pacific. Applied Microbiology and Biotechnology, 72, 12101216.
32. Viamajala, S., Peyton, B. M., Richards, L. A., & Petersen, J. N. (2007). Solubilization, solution equilibria,
and biodegradation of PAHs under thermophilic conditions. Chemosphere, 66, 10941106.
33. Kasana, R. C., Salwan, R., Dhar, H., Dutt, S., & Gulati, A. (2008). A rapid and easy method for the detection
of microbial cellulases on agar plates using grams iodine. Current Microbiology, 57, 503507.
34. Zhou, J., Bruns, M. A., & Tiedje, J. M. (1996). DNA recovery from soils of diverse composition. Applied
and Environmental Microbiology, 62, 316322.
35. Lane, D. J. (1991). in Nucleic acid techniques in bacterial systematic, (Stackebrandt, E. and Goodfellow, M.,
eds.), John Wiley and Sons, New York, pp. 115-175.
36. Turner, S., Pryer, K. M., Miao, V. P. W., & Palmer, J. D. (1999). Investigating deep phylogenetic
relationships among cyanobacteria and plastids by small subunit rRNA sequence analysis1. Journal of
Eukaryotic Microbiology, 46, 327338.
37. Thompson, J. D., Higgins, D. G., & Gibson, T. J. (1994). CLUSTAL W: improving the sensitivity of
progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and
weight matrix choice. Nucleic Acids Research, 22, 46734680.
38. Jukes, T. H. and Cantor, C. R. (1969). in Mammalian protein metabolism, (Munro, H. N., ed.), Academic
Press, New York, pp. 21-132.
39. Cole, J. R., Chai, B., Farris, R. J., Wang, Q., Kulam-Syed-Mohideen, A. S., McGarrell, D. M., et al. (2007).
The ribosomal database project (RDP-II): introducing myRDP space and quality controlled public data.
Nucleic Acids Research, 35, D169D172.
40. Tamura, K., Dudley, J., Nei, M., & Kumar, S. (2007). MEGA4: Molecular Evolutionary Genetics Analysis
(MEGA) software version 4.0. Molecular and Biological Evolution, 24, 15961599.
Appl Biochem Biotechnol (2014) 172:34883501 3501

41. Saitou, N., & Nei, M. (1987). The neighbor-joining method: a new method for reconstructing phylogenetic
trees. Molecular and Biological Evolution, 4, 406425.
42. Felsenstein, J. (1985). Confidence limits on phylogenies: an approach using the bootstrap. Evolution, 39,
783791.
43. Ghose, T. K. (1987). Measurement of cellulase activities. Pure and Applied Chemistry, 59, 257268.
44. Riou, C., Salmon, J. M., Vallier, M. J., Gunata, Z., & Barre, P. (1998). Purification, characterization, and
substrate specificity of a novel highly glucose-tolerant beta-glucosidase from Aspergillus oryzae. Applied and
Environmental Microbiology, 64, 36073614.
45. Kim, Y. A., & Yoon, K. H. (2010). Characterization of a Paenibacillus woosongensis beta-Xylosidase/
alpha-Arabinofuranosidase produced by recombinant Escherichia coli. Journal of Microbiology and
Biotechnology, 20, 17111716.
46. Bradford, M. M. (1976). A rapid and sensitive method for the quantitation of microgram quantities of protein
utilizing the principle of protein-dye binding. Analytical Biochemistry, 72, 248254.
47. Ornstein, L., & Davis, B. P. (1964). Disc electrophoresis. I. Background and theory. Annals of the New York
Academy of Sciences, 121, 321349.
48. Laemmli, U. K. (1970). Cleavage of structural proteins during the assembly of the head of bacteriophage T4.
Nature, 227, 680685.
49. Yamamoto, E., Yamaguchi, S., & Nagamune, T. (2008). Effect of beta-cyclodextrin on the renaturation of
enzymes after sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Analytical Biochemistry, 381,
273275.
50. Nazina, T. N., Tourova, T. P., Poltaraus, A. B., Novikova, E. V., Grigoryan, A. A., Ivanova, A. E., et al. (2001).
Taxonomic study of aerobic thermophilic bacilli: descriptions of Geobacillus subterraneus gen. nov., sp. nov.
and Geobacillus uzenensis sp. nov. from petroleum reservoirs and transfer of Bacillus stearothermophilus,
Bacillus thermocatenulatus, Bacillus thermoleovorans, Bacillus kaustophilus, Bacillus thermodenitrificans to
Geobacillus as the new combinations G. stearothermophilus, G. thermocatenulatus, G. thermoleovorans, G.
kaustophilus, G. thermoglucosidasius and G. thermodenitrificans. International Journal of Systematic and
Evolutionary Microbiology, 51, 433446.
51. Suzuki, Y., Kishigami, T., Inuoue, K., Mizoguchi, Y., Eto, N., Takagi, M., et al. (1983). Bacillus
thermoglucosidasius sp. nov., a new species of obligately thermophilic bacilli. Systematic and Applied
Microbiology, 4, 487495.
52. Tang, Y. J., Sapra, R., Joyner, D., Hazen, T. C., Myers, S., Reichmuth, D., et al. (2009). Analysis of
metabolic pathways and fluxes in a newly discovered thermophilic and ethanol-tolerant Geobacillus strain.
Biotechnology and Bioengineering, 102, 13771386.
53. Deflaun, M. F., Fredrickson, J. K., Dong, H., Pfiffner, S. M., Onstott, T. C., Balkwill, D. L., et al. (2007).
Isolation and characterization of a Geobacillus thermoleovorans strain from an ultra-deep South African gold
mine. Systematic and Applied Microbiology, 30, 152164.
54. Afzal, A., Bokhari, S., Ahmad, W., Rashid, M., Rajoka, M., & Siddiqui, K. (2000). Two simple and rapid
methods for the detection of polymer-degrading enzymes on high-resolution, alkaline, cold, in situ-native
(HiRACIN)-PAGE and high-resolution, in situ-inhibited native (HiRISIN)-PAGE. Biotechnology Letters, 22,
957960.
55. Karlsson, E. N., Bartonek-Roxa, E., & Holst, O. (1998). Evidence for substrate binding of a recombinant
thermostable xylanase originating from Rhodothermus marinus. FEMS Microbiology Letters, 168, 17.
56. Sunna, A., & Antranikian, G. (1997). Xylanolytic enzymes from fungi and bacteria. Critical Reviews in
Biotechnology, 17, 3967.
57. Zhu, H., Paradis, F. W., Krell, P. J., Phillips, J. P., & Forsberg, C. W. (1994). Enzymatic specificities and
modes of action of the two catalytic domains of the XynC xylanase from Fibrobacter succinogenes S85.
Journal of Bacteriology, 176, 38853894.
58. Sa-Pereira, P., Paveia, H., Costa-Ferreira, M., & Aires-Barros, M. (2003). A new look at xylanases: an
overview of purification strategies. Molecular Biotechnology, 24, 257281.
59. Beg, Q. K., Kapoor, M., Mahajan, L., & Hoondal, G. S. (2001). Microbial xylanases and their industrial
applications: a review. Applied Microbiology and Biotechnology, 56, 326338.
60. Bhalla, A., Bansal, N., Kumar, S., Bischoff, K. M., & Sani, R. K. (2013). Improved lignocellulose conversion
to biofuels with thermophilic bacteria and thermostable enzymes. Bioresource Technology, 128, 751759.
61. Morales, P., Sendra, J. M., & Perez-Gonzalez, J. A. (1995). Purification and characterization of an
arabinofuranosidase from Bacillus polymyxa expressed in Bacillus subtilis. Applied Microbiology and
Biotechnology, 44, 112117.