Environmental Innovation and Societal Transitions 24 (2017) 8393

Contents lists available at ScienceDirect

Environmental Innovation and

Societal Transitions
journal homepage: www.elsevier.com/locate/eist

A transition to green buildings in Norway

Hilde Nykamp
Centre for Technology Innovation and Culture, University of Oslo, Pb. 1108 Blindern, 0317 Oslo, Norway

a r t i c l e i n f o a b s t r a c t

Article history: Energy use in buildings is a signicant contributor to climate change. The purpose of this
Received 29 January 2016 paper is to explore industrial changes towards sustainability in the Norwegian construction
Received in revised form 5 October 2016 industry, adding to debates about transitions to sustainability and transition pathways in a
Accepted 12 October 2016
traditional, low-tech sector. Empirically the paper reports a case of cumulative changes
Available online 17 October 2016
in the Norwegian construction industry over from 1998 to 2013. The case explores a
complex innovation and diffusion process where technologies, visions, actors and policy
Keywords:
co-evolve over time to transform an existing socio-technical regime. Findings indicate that
Green building
the transition moved forward through interplay between innovations in niches, a growing
Transition pathway
CoPS constituency around green building and a string of regulative and market changes.
Transformation 2016 Elsevier B.V. All rights reserved.
Project based industry

1. Introduction

In the past decade concerns about the environmental impact of the built environment have been raised. Green building
has shifted from being a peripheral niche activity to having mainstream appeal. As a result building green is now considered
strategically important to rms in the construction sector a situation in stark contrast to prevailing industry attitudes ten
fteen years ago. This promising change is the topic of this paper. There is a growing body of literature on transitions to
sustainability in construction (Berry et al., 2013; Oneill and Gibbs, 2014; Rohracher, 2001; Smith et al., 2005). The literature
on transitions is used to frame an investigation of innovation in green building in Norway. The aim is to explore the progress
of industrial change and to answer the question: What are the main driving forces and characteristics of the transition
towards green buildings in Norway?
The motives, development paths and possible consequences of this apparent shift have not been studied systematically.
This is the main contribution of the paper. Understanding how the change towards sustainability has occurred can help
create better policies for steering or scaling up change processes in a desirable direction. A series of regulatory changes,
innovative demonstration projects and a shift in attitudes towards green buildings in combination were found to be the
drivers of the transition.
The paper is structured as follows. Section 2 provides a theoretical perspective on transitions to sustainability and inno-
vation in construction. Section 3 presents methods and data sources of the case study. Section 4 analyses the case by
constructing a timeline of industrial change phases. Section 5 provides additional analysis and concludes the paper.

E-mail address: hilde.nykamp@tik.uio.no

http://dx.doi.org/10.1016/j.eist.2016.10.006
2210-4224/ 2016 Elsevier B.V. All rights reserved.
84 H. Nykamp / Environmental Innovation and Societal Transitions 24 (2017) 8393

2. Theoretical framework

2.1. Transitions to sustainability

A transition can be conceptualized as the process of moving from one stable socio-technical regime to another. Transition
studies have successfully described historical industry transformations, and increasingly describe industrial transitions to
sustainability (Geels, 2005, 2006; Smith et al., 2010; Verbong and Geels, 2007). Studies of technological innovation systems
have focused on the emergence of new industries the formative phase and the difculties new technologies meet when
introduced (Bergek and Jacobsson, 2003; Bergek et al., 2008a; Hekkert et al., 2007; Suurs et al., 2010). The multi-level
perspective (MLP) was adopted in this paper because focusing on the stabilizing forces in a regime ts with the aim to
explore a wider industry transformation and not a specic technology. In the MLP framework, transitions are explained by
dynamics between three analytical levels: niches, regimes and landscapes. The niche level denotes a place where alternative
technologies are developed, such as R&D laboratories or subsidized demonstration projects. A socio-technical regime is
understood as a relatively stable structure consisting of established practices and institutional arrangements. The landscape
is thought of as exogenous factors that can inuence the regime-niche interaction, such as global political events and global
markets (Geels, 2011).

2.2. Innovation in niches

Niches are described as bubbles or protected spaces in which innovations can develop, a place where new technologies
can grow, relatively free from market pressure and institutionalizing forces of the construction regime (Kemp et al., 1998;
Smith and Raven, 2012). As construction is project based, niches are also referred to as niche projects or innovation projects
in the following.
Green buildings may vary in technological complexity, but generally they consist of well-known components combined
to a new whole. This kind of innovation is in line with Schumpeters (1934) denition of innovation as new combinations
of new or existing knowledge, resources, or equipment. Buildings are understood as complex product systems (Dubois
and Gadde, 2002; Hobday et al., 2000), and changes in the links between product parts can be understood as architectural
innovations (Henderson and Clark, 1990); newness lies in successfully recombining known components to form a new
whole. Environmental innovation in construction is often conceptual in nature and connected to sustainable design and
design management practices (Berry et al., 2013; Herazo and Lizarralde, 2015; Koch and Buhl, 2013; Reed, 2009). Capacity
to innovate in building projects, therefore depends not only on protection from time and market pressures, but also on
freedom from prevailing organizational practices in the construction industry.

2.3. Regime

A regime is understood as a dynamically stable structure consisting of established practices and institutional arrange-
ments that legitimize regulation and nancing mechanisms that in turn help preserve the regime. Regimes are results of
path dependency and lock-in mechanisms to technologies, practices and institutions, and are consequently hard to change
(Turnheim and Geels, 2013; Unruh, 2000). Regime actors have vested interests in regime preservation and can resist and ght
back pressures to change (Geels, 2014; Orstavik, 2014). Regime is used here interchangeably with mainstream or established
industry.
Market and policy structures are regime elements, and regulatory changes and market conditions are considered regime
changes. In a study of transitions in the energy sector in Germany, Jacobsson and Lauber (2006) argued that industrial change
was primarily driven by changes in the regulatory framework. Change ultimately comes down to a battle over institutions
(p.260). Institutions refer to changes in policy and the formation of a market, more specically policy supporting market
formation or correcting market failures as well as the minimum requirements in the building codes. Policy impacting on the
energy performance of buildings is essential for sustainable transition in construction (Greenwood, 2012; Oneill and Gibbs,
2014; Smith et al., 2005). However a transition cannot be dictated by policy alone. As Berry et al. (2013) show, regulatory
changes are closely linked to innovative experiments because they legitimize the new technology and provide policy makers
with the condence to revise regulation.
Social acceptance of technology, established practices and common frames of mind are important regime elements.
Rohracher pointed out in 2001 that the main challenge with a transformation in construction is that it is social in nature, it
is not primarily a technological problem, or even related to new technologies. Many sustainable building techniques exists,
the major challenge is to persuade a risk-averse industry actors to try out green concepts.

2.4. Process of regime change

The MLP perspective has been criticized for not being sufciently explicit about how niches and regimes interact (Smith,
2007). In historical examples, niches emerge on the outer margins of the established regime; subsequent niche-regime-
landscape interaction patterns direct the process along different pathways. Four transition pathways are identied in the
literature transformation, reconguration, substitution and de-alignment/re-alignment (Geels and Kemp, 2007; Geels et al.,
 H. Nykamp / Environmental Innovation and Societal Transitions 24 (2017) 8393 85

2016; Geels and Schot, 2007). Transformation and reconguration describe evolutionary pathways of change, whereas
substitution and re-alignment/de-alignment describe conictual processes where new entrants substitute, or signicantly
destabilize the incumbent regime. As the analysis will show, the transition pathway of green buildings in Norway shifted
from a reconguration pathway to a transformation pathway.
A reconguration pathway involves interaction between niches and regime actors through strategic alliances between
incumbents and entrants (Geels et al., 2016). One example of a niche/regime interaction, or strategic alliance, is described
by Smith (2007) in what he labels intermediary projects. Or what Berry et al. (2013) called transformative niche events. Inter-
mediary projects are learning arenas, where regime and niche actors explore niche technologies face to face. Such alliances
can act as stepping stones between niche and mainstream (p. 446). Intermediary projects are relatively easy to establish in
construction because work is organized in projects People move between projects, and projects form, dismantle and reform
with new and semi-new groupings of actors (DeFillippi and Arthur, 2002). Intermediary projects demonstrate possibili-
ties, and can impact transition through learning, supply chain development and by giving policy makers the condence to
advance policy goals (Berry et al., 2013).
A transformation pathway can be described as an endogenous regime change; it is focused on interactions between the
strategic choices and adaptive capability of regime actors, in response to institutional or landscape pressure. The transfor-
mation process is characterized by gradual regime reorientation (Geels et al., 2016; Geels and Schot, 2007). Transformation
processes in mature industries have been described as creative knowledge accumulation, which refers to the incumbents
ability to absorb and utilize new technologies (Bergek et al., 2013; Berggren et al., 2015). A similar notion is developed by
Bulkeley et al. (2014), which they label regime experiments, in which regime actors experiment with niche technologies.
Jacobsson and Lauber (2006) described how industries grow and change in different phases. They identied mechanisms
that take place in a formative phase, in order for a new technology to move into a rapid growth phase. The formative phase
includes a multitude of competing designs and lack of a dominant design (Utterback and Abernathy, 1975). The formation
of a dominant design, as well as formulating visions and agreeing on what green building means is a precondition for the
formative phase to proceed to a growth phase. Green building is a multifaceted phenomenon and a relative concept. Different
actors have different assumptions about what it means to build green and the activity incorporates a multitude of practices
(Oneill and Gibbs, 2014). Therefore the emergence of a dominant design is key in order to put pressure on an existing regime.
Kemp et al. (1998) emphasized the importance of building a constituency behind the new technology. The build up of
a constituency involves entrepreneurial actors, or system builders, it involves the establishment of networks or advocacy
coalitions and the entry of actors into the constituency (Markard et al., 2016). Entry of actors happens through intermediary
projects, and through industry networks. The niche technology gains strength as new rms and other organizations join the
constituency. Building a constituency is tightly connected to increasing the legitimacy and obtaining social acceptance of
the new technology (Bergek et al., 2008b).
The concepts described above are used to structure the analysis. First, the extent to which there is a dominant design
along with a coherent vision of sustainability is considered. This forms the basis of the division into specic phases. Second,
the build up of a constituency includes attitudes to green building as well as recruitment of industry actors, either through
participation in innovation projects or industry networks. Third, regime change is described through tracking market, policy
and regulative changes as well as changes in attitude towards green building.

3. Research methods and data analysis

The research is based on a case-study strategy (Yin, 2011). Case studies are considered appropriate when the phenomenon
is context-dependent (Eisenhardt, 1989). The case is longitudinal, in the sense that the intention is to provide a detailed
empirical narrative of a change process. A single case design was deemed appropriate because the object of study was
industry change over time (Dubois and Gadde, 2014).
Different data sources were combined to create a coherent narrative. The timeline constructed was primarily based on
interviewee accounts. 30 interviews were conducted with industry professionals and institutional actors. Industry pro-
fessionals include architects, consultants on energy and building physics, property developers, and builders. Institutional
actors include policy makers, bureaucrats, professional and trade organizations and researchers. The interviews were semi-
structured and lasted between 40 and 90 min. Interviews were recorded, transcribed, and coded in several stages using
Nvivo software.
The Norwegian Association of Architects (NAL) maintains a database of notable building projects. The database contains
a short description of the environmental targets and the responsible builders/developers. The types of actors involved in
the different projects were classied according to the theoretical notions of niche project, intermediary alliance project or
commercial mainstream project. The strategy for analysis was thus theoretically motivated. The Norwegian news archive
Retriever was searched for keywords to monitor news coverage and public interest in green building over time. Key terms
that describe green building over time; have been traced: from eco-building; to low-energy; to passive-house building; to
plus energy building. These ndings have been used to reinforce the timeline and periodization. Fig. 1 was constructed using
the nine largest regional/national newspapers and a prominent weekly technical journal as sources. Content from the media
archive has also been used to corroborate statements in interviews about key events such as introduction of EU legislation;
building codes; and also landscape factors such as energy prices and political shifts. The case data includes written material
such as government white papers and commissioned reports that have been useful to follow policy changes.
86 H. Nykamp / Environmental Innovation and Societal Transitions 24 (2017) 8393

180
160
140

ARTICLES PER YEAR

120
100
80
60
40
20
0

ECO-BUILDING LOW-ENERGY PASSIVE-HOUSE PLUS-ENERGY

Fig. 1. Media attention to green building concepts.

The strength of the approach lies in the number of industry actors interviewed and the variety of data sources. The
stakeholders interviewed represent different parts of the industrial system, and cover activities over time, making it possible
to discern shifts in attitudes. A considerable weakness is the lack of measurable data. Another limitation with the construction
of a longitudinal narrative based on interview data is that it relies on the recollection of interviewees. The dependence on
retrospective analysis is somewhat mediated by triangulation with other data sources, such as the project database and the
media coverage.

4. Phases of development of green building

It is difcult to pinpoint an exact point in time when sustainability entered the agenda in construction. The analysis in
this paper spans 19982013, acknowledging that there were sporadic experiments in the 1970s, 1980s and early 1990s. The
periodization is pragmatic, but it reects changes in the public debate and key events.
The chart shows how different terms and concepts appear in the media during the period. The term eco-building
appeared 1998 with a little peak around 2001 and disappeared by 2003. Low-energy building enters the public debate
around 2003 but is surpassed by passive-houses in 2007. Passive-house is by far the most widely accepted concept, starting
around 2008 and culminating in 2012. The massive spike in interest in passive houses coincides with the announcement of
the policy strategy intending to demand energy performance on a passive-house level in 2015. By 2014 media interest in
zero-energy and plus-energy building is slowly starting to replace passive-house building.

4.1. Eco-building period 19982003

The rst period was labeled the eco-building period. Between 1998 and 2003 the beginnings of an environmental agenda
appeared in the construction industry. The NAL database lists 33 projects in this period. The smallest was a wood red sauna
built exclusively from materials found on the property, while the largest project was a 1600 unit student-housing complex.
The projects were heterogeneous in their approach to sustainability. The notion of urban ecology was prominent, and
many project descriptions contain the phrase built according to ecological principles. Closeness to nature, urban gardens
and green roofs were also highlighted. The use of natural materials was emphasized; avoiding chemical and particulate
emissions from building materials was a central concern in many projects. Water conservation techniques, including grey
water recycling were tried out. Other measures mentioned in the project descriptions include facilitating for occupant
recycling, compost systems and waste management. Utilizing natural daylight and solar irradiation as well as reducing
the need for energy were considered important. The conceptual approach to green building was eclectic and reected
the different actors, although two categories of intermediary projects stand out. About half of the projects are public:
schools, kindergartens, and nursing homes. Projects built by public clients or mainstream developers involved incremental
improvements, particularly regarding choice of materials that t in easily with the mainstream industry. The remaining
projects were radical projects, initiated by enthusiasts on the outer margins of the established industry.
There was a distinctive aesthetic linked to the eco-building movement. Particularly bale/straw-insulated buildings had
thick walls and small windows. The eco-buildings were also at the time linked strongly to the idea of self-building and
reuse of materials and waste, as well as autonomous (off grid) buildings. The notion of an eco-lifestyle, living off grid and
self-sufciently, appealed to a particular, small group of people, and it never gained much mainstream attention. These
 H. Nykamp / Environmental Innovation and Societal Transitions 24 (2017) 8393 87

environmental buildings and the ideas that went with them had closer ties to the environmental movement than to the
construction industry.
A research group started to study energy efciency in housing around this time at Norwegian University of Science and
Technology. One researcher described the time period: The winter in 2000 was very cold, that was when the increased focus
started, I think. An International Energy Agency funded research project about low energy buildings was initiated. Up until then
we had never talked about low-energy housing in Norway. There had been some experiments, but it never spread. A professor
in architecture described the situation as follows: It used to be something very few were interested in. I tried to convince the
students that energy was important, good for the environment and the world. I tried to convince developers they would save
money on energy, but nothing worked, very few were interested. The period was characterized by experimentation by fringe
actors like self-builders and activists, as an industry consultant described: The world wasnt all that interested. You know there
were all these environmentalists, talking about mud-houses and the like. That was counterproductive. The close links to radical
environmentalists was described as counterproductive because it alienated the mainstream industry actors.
During this period green building entered the policy agenda. In 1997 a policy initiative called the Eco-build program was
established aiming to increase awareness of eco-efciency in the sector. Funding was split between industry and government,
and the program ran from 1998 to 2002. The prime concerns were solutions for energy efciency, material efciency,
waste, hazardous chemicals, and air quality. The program resulted in manuals for procurement of materials, manuals for
technical installations, and waste and demolition management manuals. Even though the notion of eco-efciency never quite
succeeded, a group of people who worked with the Eco-Build program went on to establish the industry organization for
property developers called the Green Building Alliance in 2003/2004. The Norwegian State housing bank granted inexpensive
loans to housing projects with environmental qualities. In 2001 the Ministry of Oil and Energy established a subsidiary
organization called Enova. Enovas mission was to contribute to clean energy production and to energy efciency in industry,
buildings and households. In their two rst years the main activity was to subsidize energy efciency in households.
The years 19982003 were recognized by niche experimentation, the beginnings of institutional changes and a consistent
lack of interest from the mainstream regime actors. There was considerable variety in the niches, but no unied vision about
what green building was or meant. There was a lack of market and a lack of interest from commercial actors, in line
with the early formative phase of a new technology. Niche projects appeared on the fringes of the mainstream industry,
and in opposition to the dominant regime. Meanwhile on the landscape level climate change was entering the agenda. A
Government White Paper from 2000 on climate policy identied area planning as important for energy saving. The third IPCC
report came out in 2001, and it emphasized buildings as an important and cost efcient sector in which to reduce emissions.
The EU directive (2002/91/EC) on the energy performance of buildings was adopted in 2002, which had a clear inuence
on national policy. Electricity prices in Norway had been low for a long time, practically cancelling arguments about saving
money on energy efciency. 2002/2003 saw a sharp rise in electricity prices sparking some interest in alternative sources
of space heating, however electricity prices stabilized again and it was short lived. Despite a growing awareness of green
building in certain circles, neither companies nor customers were very interested in it, and thus the regime remained largely
unaffected.

4.2. Low-energy house period 20042008

The period between 2004 and 2008 was labeled the low energy period because the majority of projects that were
documented were identied as low energy. Low energy buildings were based on the same principles as the German passive
houses, limiting heat loss by insulation and compact design as well as utilizing solar irradiation. The key aim was to conserve
energy and therefore limit greenhouse gas emissions. Energy use became the fundamental denition of green building. The
earlier focus on natural materials, closeness to nature, gray water recycling, compost, urban gardens etc. was gradually
replaced by a focus on energy and passive design principles. There was some debate about how to achieve energy savings,
and to what extent renewable energy sources should be included in building designs. Several projects from this period
featured various heat pump technologies, as well as solar water heaters. Two high prole public buildings experimented with
integrated photovoltaic elements. A prototype from 2005, which demonstrated the possibility of not having an active heating
system in an arctic climate, was much publicized and gained interest. The rst large-scale apartment blocks constructed as
low-energy buildings/passive buildings attracted much attention in 2008. Commercial developers slowly started to consider
it a strategic advantage to gain experience with green building. A majority of the projects from this time were intermediary
bridging projects. They predominantly involved partners from the mainstream building industry, and they often formed
alliances with universities or other expert actors.
The low energy and passive houses that were built at the time were still somewhat tied to fringe actors, activists and a
few dedicated architects. Low-energy buildings were considered the domain of engineers rather than architects. A professor
in architecture described: Part of the story is that it (energy efciency) was very technical and the architects didnt really get it.
The buildings were quite ugly or at least very distinct. And I am sure it held progress back a lot because it was not what people
wanted, neither for ofces nor to live in. Energy efciency was also described in interviews as a niche for architects who were
not very aesthetically gifted, not something normal architects would do. Mainstream attitudes to green building were still
rather negative, although attitudes seemed to change somewhat towards the end of the period. By now, green buildings no
longer looked so different due to supply chain developments in windows enabling larger glass areas. A prevalent concern
for the industry at the time was that there was no identied market for green building, and very little willingness to pay
88 H. Nykamp / Environmental Innovation and Societal Transitions 24 (2017) 8393

a premium for sustainability. The saying was that the only way to sell low energy houses was by promoting qualities like
thermal comfort and healthy indoor climate. One developer said: It has to be a nice place to live, and make economic sense to
buy it. And if you save some money on electricity, then thats a bonus for now. If we were to sell 80 apartments to environmental
activists they would still be empty. Ambitious industry actors were at that point calling for stricter regulation in order to
correct the market failure, because they wanted to build greener, but saw the lack of regulation as creating an unfair playing
eld. Other mainstream actors were still reluctant, and wanted a slower introduction of energy performance regulation.
In 2005 a red-green1 alliance won the Parliamentary elections. While energy performance regulation was underway, the
new government took it a step further and declared all new buildings should be low-energy. One policy interviewee recalled:
I remember there was one sentence in the new government platform probably put there by the socialist party and then forgotten
about about low energy buildings becoming standard. Nobody thought much about it, but the environmental movement picked
up on it and suddenly the 2007 building codes demanded low-energy. We were all a bit surprised when they were introduced.
By 2007 the building codes had not been updated in 10 years, and previously they had said little about buildings energy
performance. While it had taken ten years to revise the previous building codes, these were to be revised at regular intervals
from then on. The updated building codes were met with resistance when they were introduced. It seems the industry came
to terms with energy efciency demands relatively quickly. In the words of one industry informant: The industry has changed,
and one could wonder if it is due to pressure from the new building codes. Every time the building codes are revised there is some
controversy the industry has been stalling and they have fought and fought to avoid it. Until a few years ago when it seemed
they suddenly gave up more or less, and accepted that it is the future and they would have to accept it.
Some of the innovative projects from this period went on to become very visible demonstration projects in the sense
that they were communicated widely to the industry and held up as examples by policy makers in the years to come.
Several demonstration projects were realized in this period through a program called Norwegian Wood, which ran from
2005 until 2008. Norwegian Wood was set up as collaboration between industry actors, municipalities, policy actors such as
the Norwegian Housing Bank, Innovation Norway, Enova, actors from the lumber industry and the Norwegian Association of
Architects (NAL). Seven demonstration projects were built and the goal was to demonstrate modern environmentally sound
solid wood architecture. Another industry network, the previously mentioned Green Building Alliance, started working
on establishing an environmental certication system in Norway around the same time. The organization developed into a
formal network, arranging seminars and courses for their members, as well as acting as a consultative body for policymakers.
The network introduced property developers to ideas of green building.
In the research domain, the establishment of the Zero Emission Building Center (ZEB) in 2008 saw powerful actors enter
the constituency. ZEB was established as a collaborative effort involving research, industry and public agency partners.
The objective was to stimulate innovation among partners and to provide research useful to industry. The research groups
involved in ZEB came from the applied research institute SINTEF as well as the Norwegian University of Science and Tech-
nology. They had been doing research on energy and buildings for a number of years, highlighting the importance of earlier
efforts. The founder explained: It is not something that suddenly materialized from nothing, weve been planning and building it
for years. We have been doing research in this eld since the 1970s. We have had IEA projects for the past 12 years. We have the
publications and the merits, which made it obvious we were going to get the funding if there was going to be a center on build-
ings. The research center established alliances with large industry actors and has been credited with providing consultancy
services, calculations, denitions and methods to innovative industry actors.
During this time a dominant design emerged and green building took on a specic meaning. Previous interest in
urban ecology, gray water recycling and avoiding chemical emissions from materials was replaced by a narrower focus on
measureable energy saving and passive house principles. Demonstration projects were increasingly competing in the regular
market helped by nancial policy instruments, such as subsidies and favorable loans from the Norwegian State Housing Bank.
Enova established a support scheme to cover up to 50% of costs associated with building to low energy or passive house
levels. Both the emergence of a dominant design and the existence of instruments to help the technology in the marketplace
bore witness of a growing niche inuence. Concrete niche-regime interaction happened through intermediary projects,
which were proliferating at the time. The intermediary projects acted as learning arenas for the involved organizations. The
experimental projects were important for policy makers who felt more condent implementing the new building codes. The
EU directive on the energy performance of buildings, which was adopted in Norway in 2005 inuenced the new building
codes. The winter 2006/2007 was very cold, coinciding with a sharp rise in electricity price. In the national media it was called
a power crisis. Although electricity prices stabilized at a low level again, it acted as a reminder that inexpensive electricity
might not last. In 2007 the IPCC and Al Gore were awarded the Nobel Peace Prize, and climate change entered the agenda
full-scale in Norway.

4.3. Passive-house period 20092013

Passive houses dominated the debate in this period. A national passive house standard was meant to be released in June
2009. It was delayed several times because of internal debate and disagreement in the committee. The national Passive House

1
The redgreen coalition was a center-left coalition of parties in Norway, constituting the Labour Party (Ap), the Socialist Left Party (SV), and the agrarian
Centre Party (Sp).
 H. Nykamp / Environmental Innovation and Societal Transitions 24 (2017) 8393 89

Standard (NS 3700) was nally released in 2012. The standard included two categorizations of low-energy buildings, based
on the same principles, but with less stringent parameters. 39 passive house projects were initiated and built during this
period. The largest projects in terms of costs were also the most ambitious in terms of environmental prole. Municipalities
were responsible for some of the projects in this period; schools and kindergartens were built according to passive house
standard. One of the largest house building associations (OBOS) initiated a project with 17 passive detached houses in
2010. The headquarters for the environmental organization Bellona were built in 2010, and for a while, the building was
considered state of the art. It was also the rst manifestation of an ongoing debate over the need for more versus less
technology integrated in the buildings. While passive houses are about reducing demand for space heating to a minimum,
the Bellona building was based on the passive principles, but prioritized energy production arguing that at some point it is
more cost effective to produce energy than to conserve. Towards the end of the period several approaches to green building
coexisted. New concepts emerged zero emission buildings and plus energy buildings were frequently talked about in
industry media, although the rst plus energy building was not realized until 2014. A pragmatic goal of building to a passive
house level became widely accepted, and it could be reached through certication such as BREEAM, energy labeling, or the
passive house standard.
The shift in focus from energy saving to energy production had what interviewees called a psychological impact on the
industry. The idea of producing energy was seen as a lot more appealing than not using or conserving energy and reached
a much broader audience. One architect explained: It is a response to the rather sad passive house debate, it is about making
sure that people who build these kinds of buildings feel positive about it, more than doing less of something negative. There is a
psychological difference between a surplus of something positive and electricity is positive, people see that and reaching zero,
of something you should not have in the rst place. It might be more accurate in academic terms, but it is really hard to sell. Plus
energy on the other hand is easy.
As environment and energy concerns slowly became legitimized in the industry, it was no longer the work of energy
consultants but top management. The following quote from a property developer explains the shift: I was at a conference in
2009 where it struck me that the speakers used to be environmental consultants and enthusiasts; the speakers now are business
leaders and top management. Now thats a big change, environment is no longer on the passion-agenda it is on the business-agenda.
The efforts of the Green Building Alliance (GBA) also contributed to the shift in attitudes. At the time they were working
to establish a certication scheme paid off in October 2011, when BREEAM-Nor was launched. BREAAM-Nor was a voluntary
environmental certication scheme where projects score points along several dimensions. A property developer expressed:
BREEAM-Nor was a game changer, not primarily because of the energy focus, but in the sense that it made sustainability a
legitimate goal. BREEAM-Nor was positively received in the industry partly due to its exibility. It was exible in terms of
incorporating other certication and management systems, for example the mandatory government building classication
scheme. Many informants also suggested that it became popular because it introduced an element of competition to the
industry by constituting a very visible and marketable sign of quality to potential building owners and tenants. A GBA
representative summarized: If you ask developers why they jumped on the Breeam bandwagon, almost before they knew what it
was, theyll tell you its because it is fun to compete and to compete about something as tangible as BREEAM excellent. A third
success factor was that it was grounded in the industry through the Norwegian Green Building Council (NGBC). Industry
actors thus had a feeling of ownership and control because they had a say throughout the process.
In 20092 a commission to The Ministry of Petroleum and Energy pointed to the construction sector as key to energy
efciency, and recommended that building codes should include net energy frame values that would eventually cut energy
use in half. In 20103 an independent commission reporting to The Ministry of Local Government and Regional Development
recommended that all new buildings should conform to a passive house standard by 2015. Both ministries recommended to
Parliament in 20124 that building codes should be updated in 2015 to passive house level and to zero emission by 2020.
From that point on the policy strategy was very clearly communicated, that the energy requirements would reect that goal.
Meanwhile much policy focus was on incentivizing the industry to experiment with building beyond the minimum
standards pending the new codes. One such incentivizing program called Futurebuilt was established in 2010, and by 2013
9 demonstration projects were built. Futurebuilt was said to be the legacy of the Norwegian Wood program. It was designed
to encourage sustainable architecture in collaboration between several municipalities and policy organizations and industry
organizations like the Green Building Alliance and the National Association of Architects. Several interviewees accredited
Futurebuilt as a driving force for pushing boundaries and creating examples and demonstration projects. Both agencies
providing nancial incentives continue to do. At this point many interviewees explain they were getting concerned with the
growing gap between the innovative projects and the building codes, which created high expectations for the 2015 update.
The period was characterized by internal regime changes. At the landscape level, the recast of EU directive on the energy
performance of buildings (2010/31/EU) clearly affected the decision to reach for nearly zero energy buildings across Europe
by 2020. In 2012, the launch of the passive-house standard coincided with much talk of upgrading the building codes to
demand a passive house level by 2015. The ongoing efforts in the ZEB center conrmed the importance of green building
in the research community and enlisted some of the most powerful actors in the industry to the cause. Finally the launch of

2
Lavenergiutvalget Low-energy Commission https://www.regjeringen.no/globalassets/upload/oed/rapporter/oed energieffektivisering lavopp.pdf.
3
Arnstadutvalget https://www.regjeringen.no/globalassets/upload/KRD/Vedlegg/BOBY/rapporter/energieffektivisering av bygg rapport 2010.pdf.
4
Government white paper on climate policy 20112012 https://www.regjeringen.no/en/dokumenter/report-no.-21-2011-2012/id679374/.
90 H. Nykamp / Environmental Innovation and Societal Transitions 24 (2017) 8393

Table 1
Summary of analysis.

Time Build-up of constituency Regime change Landscape factors

Eco-building period 19982003
No dominant design
Few mainstream actors
Academic attention
Mostly fringe actors in
opposition to regime
Weak regulation
Information-based policy
instruments (guidelines
developed by eco-build
program)
Financial policy instruments
emerging (State housing
bank nancing low energy
projects, Enova established
in 2001)
Lack of market
EU directive on the energy
performance of buildings
(2002/91/EC)
Third IPCC report growing
acceptance of climate
change
Spike in electricity prices
2002/2003

Low-energy period 20042008
Emerging dominant design
Buildings start to look
normal
Networks such as NGBC and
GBA growing
Demonstration projects
interact with academia
ZEB Research center with
industry partners
New building codes
introduced (TEK07)
Financial policy instruments
(subsidies for extra cost
associated with exceeding
minimum requirements)
Demonstration projects
through Norwegian Wood
program
Direct subsidies for
alternative technologies
such as heat pumps
Emerging market
Government change 2005
Stern report in 2005
EU directive implemented in
Norway after 2005
Spike in electricity prices
2006/2007
Fourth IPCC assessment
report
Al Gore and IPCC win Nobel
peace prize

Passive-house period 20092013
Dominant design
Commercial projects
increasing strategic
importance of green building
Building code updates (TEK Recast of the EU directive on
10) the energy performance of
Expectations for passive buildings (2010/31/EU)
house level in 2015 update Fifth IPCC report 2013
Continued economic
incentives for innovation
projects through Enova
Continued focus on
demonstration projects
through Futurebuilt program
BREEAM-Nor launched

the BREEAM-Nor certication scheme was important for anchoring green building in industry. In addition to institutional
changes, there was a serious shift in attitudes towards green building, clearly helped along by a now strong constituency
formed around it. Green building was no longer a niche, but a growing part of the regime. Most developers, consultancies and
contractors consider green building to be important strategically. This period also witnessed interaction between previously
diverging efforts, such as passive house standard buildings, obtaining BREEAM certication, and becoming a demonstration
project at the same time. The launch of BREEAM-Nor and the ZEB center were two relatively independent processes. They
came into contact with each other through personal relationships because individuals had been involved with both of
them, through companies who participated in the new certication scheme and the research center. BREEAM also utilized
calculations coming out of ZEB research.
Table 1 provides a summary of the analysis (Table 1). As for the period beyond 2013, focus has shifted beyond passive-
houses towards plus-energy and zero-energy concepts. Buildings have become part of the energy policy, and consequently
debates focus more on if and how energy produced in buildings can be delivered to the net. The building code, in effect from
January 2016 requires all buildings to conform to a passive house level.

5. Discussion and conclusions

The article analyses changes in the Norwegian construction industry, covering the period from 1998 to 2003, in order
to identify driving forces and characteristics of an apparent transition towards green building. Such a transition can occur
when there is simultaneous pressure on a dominant regime from a niche technology and from the exogenous factors at the
landscape level (Geels, 2002, 2004). In the green construction case, multilevel interaction processes constitute a transition
pathway for the regime inuenced alternately by pressure from niches and landscape developments.
As expected in the early formative period, green building technologies emerged in niches on the outer margins of the
regime and in opposition to the mainstream. Niche activity was observed primarily in the form of innovative green building
projects, but also in the form of R&D activity as well as industry and policy network formation. The early niche projects varied
in their approach to green building; there was no unied understanding of what green building meant, or how sustainability
 H. Nykamp / Environmental Innovation and Societal Transitions 24 (2017) 8393 91

should be understood. Disagreement about the relative virtue of different approaches to green building and competition
between niche technologies subsided with the emergence of a dominant design (Abernathy and Utterback, 1978; Jacobsson
and Lauber, 2006). By 2007/2008 low-energy building based on passive house principles of compactness and minimizing need
for space heating had become the de facto dominant design. The increasing agreement among the different niche projects
helped the mainstream industry view green building as a valid option rather than as isolated experiments. Establishing a
dominant design that was suitably aligned with regime practices helped the diffusion of green building concepts, speeding up
the pace of the transition process. The build-up of a constituency around the new technology a process by which mainstream
actors endorsed green building practices contributed to legitimization and social acceptance and eased collaboration with
regime actors.
Regime change is the essence of this transition. Changes in the regime were observed through policy and regulatory
changes, market development and a signicant shift in attitudes towards green buildings. The formulation of clear policy
goals combined with a stepwise tightening of regulation provided predictability for the regime to work towards reducing
the gap between the niche innovation projects and the industry as a whole. When energy performance regulation became
stricter, demonstration projects from previous years were used actively to legitimize the new building codes. The existence
of successful demonstration projects gave policy makers the condence to demand a higher energy standard. The most
elusive indication of regime change was the shift in attitudes towards green buildings. Increasingly positive perception of
green building practices may be seen as both cause and effect, contributing to positive feedbacks and cumulative changes in
the industry. The buildup of a strong constituency and successful demonstration projects strengthened the shift in attitudes,
and the positive perceptions of green buildings recruited new actors to the constituency.
Landscape factors such as increasing concern for the environment and obligations to international climate agreement
commitments inuenced policy in the regime. The 2002 EU directive on buildings energy performance (EPBD)5 put pressure
on the government to facilitate green building. The adoption of the directive coincided with a government change in 2005,
and by 2007 the new building codes were introduced. In The 2007 Nobel peace price to the IPCC and Al Gore increased
awareness of climate change issues in Norway, again energizing the growing niches. In 2010 the EU recast of the EPBD6
emerged, which prompted the policy strategy to reach a passive-house level by 2015, and nearly zero by 2020.
In the early stages the transition followed a reconguration pathway (Geels and Schot, 2007). Reconguration in this case
meant testing green building concepts in cooperation with niche actors. Interaction and alliances were formed between
niche and regime actors in intermediary projects where regime actors could experiment with green building (Smith, 2007),
that is innovative building projects involving collaborations between regime and niche actors. Because of the project-based
nature of construction, regime actors were able to simultaneously participate in regular non-innovative projects and in niche
projects.
A shift to a transformation pathway, characterized by strategic exploration of niche technologies by incumbent actors
(Geels and Schot, 2007), transpired around 2012 as attitudes towards the value and worthwhileness of sustainability grad-
ually changed. Major regime actors strategically explored opportunities previously developed in niches. The rationale for
green building was no longer social consciousness or environmentalism, but rather business strategy. The analysis indicates
that the shift in attitudes preceded strategic appropriation of niche technologies to mainstream projects. The intermediary
projects acted as learning arenas for regime actors, who went on to incorporate practices from these activities in their next
projects, thus contributing to endogenous regime change. Alliances between academic institutions and industry proved to
be an effective driver of transformational change because it attracted powerful mainstream actors to green building projects.
Green building thus became incorporated in the regime, and the current pathway is one of endogenous regime change.
In the ongoing transition in the Norwegian construction industry, green building is a moving target. The case study has
identied signicant changes in attitudes towards green building and analysed how green building practices entered into the
mainstream market. This was largely due to interplay between increasingly demanding building codes, and incentives for
innovation and green building experiments. The minimum requirements in the building codes, effective from January 2016
demands building to a passive-house level, which means that the legal minimum requirements are now approximately where
the most innovative demonstration projects were 15 years ago; the innovative demonstration projects have themselves
moved beyond energy efciency towards energy production. This is interpreted as a strong indication that a transition is
underway. It can hardly be interpreted as a complete transition, as the industry continues to evolve and as the frontier
of green building moves beyond energy efciency towards energy production. Two major barriers still warrant attention
the observed changes do not apply to the existing building stock, apart from major refurbishments that are subject to
building codes. Secondly, the majority of innovative projects are high-end ofce buildings, which could mean that the
housing segment of the industry is lagging behind in innovative projects.
The multilevel perspective on transitions has proven a useful concept to study the greening of industries to sustainability;
however it often juxtaposes incumbents and new entrants (Bergek et al., 2013; Berggren et al., 2015; Geels and Kemp,
2007; Geels and Schot, 2007). This paper contributes to nuancing the discussion of different types of transition pathways
in an established industry, where incumbent actors simultaneously contribute to regime preservation and participate in
niche projects. Later investigations may want to explore other project-based industries to conrm if similar patterns may

5
(2002/91/EC) http://eur-lex.europa.eu/legal-content/EN/ALL/?uri=CELEX:32002L0091.
6
(2010/31/EU) http://www.eceee.org/policy-areas/buildings/EPBD Recast
92 H. Nykamp / Environmental Innovation and Societal Transitions 24 (2017) 8393

be detected there. Further research could also explore how different combinations and sequences of policy instruments
interact and reinforce each other.
Although policy has had an impact on the green building transition, such a transition concerns a multitude of actors
and cannot be completely steered by instruments and regulation alone. Still, the observed changes in the industry can be
strongly tied to long-term and coordinated policy efforts. Policy in the eld has been based on a long-term strategy with
stepwise introduction of a variety of policy instruments as a main approach. Increasingly strict regulation and simultaneous
support for niche projects turned out to be a powerful combination in order to prompt regime change. Interaction between
research and industry resulted in innovative demonstration projects, which again contributed to the legitimization of stricter
regulation. The formulation of clear policy goals along with a stepwise regulatory tightening provided predictability for the
industry to work towards diminishing the gap between the innovation projects and the minimum requirements specied
by regulation. A stepwise approach and policies that form a link between innovative projects and industry standards may
be relevant approaches also in other industries.
The project-based nature of construction nevertheless means that incumbent rms in the mainstream industry can
simultaneously contribute to regime preservation and participate in niche projects. Projects allowed powerful regime actors
to experiment with green technologies without committing the whole organization to the technology. Participation in
intermediary projects and alliances in order to experiment with green building technologies was identied as a central
driver of change. Policy instruments designed to encourage regime actors to experiment with niche technologies could be
a way to move forward with a transition in other countries and industry sectors.

References

Abernathy, W.J., Utterback, J.M., 1978. Patterns of industrial innovation. Technol. Rev. 64, 254228.
Bergek, A., Jacobsson, S., 2003. The Emergence of a Growth Industry: a Comparative Analysis of the German, Dutch and Swedish Wind Turbine Industries
Change, Transformation and Development. Physica-Verlag HD, pp. 197227.
Bergek, A., Jacobsson, S., Carlsson, B., Lindmark, S., Rickne, A., 2008a. Analyzing the functional dynamics of technological innovation systems: a scheme of
analysis. Res. Policy 37, 407429.
Bergek, A., Jacobsson, S., Sandn, B.A., 2008b. Legitimation and development of positive externalities: two key processes in the formation phase of
technological innovation systems. Technol. Anal. Stratgic Manag. 20, 575592.
Bergek, A., Berggren, C., Magnusson, T., Hobday, M., 2013. Technological discontinuities and the challenge for incumbent rms: destruction, disruption or
creative accumulation? Res. Policy 42, 12101224.
Berggren, C., Magnusson, T., Sushandoyo, D., 2015. Transition pathways revisited: established rms as multi-level actors in the heavy vehicle industry.
Res. Policy 44, 10171028.
Berry, S., Davidson, K., Saman, W., 2013. The impact of niche green developments in transforming the building sector: the case study of Lochiel Park.
Energy Policy 62, 646655.
Bulkeley, H., Broto, V.C., Maassen, A., 2014. Low-carbon transitions and the reconguration of urban infrastructure. Urban Stud. 51, 14711486.
DeFillippi, R.J., Arthur, M.B., 2002. Paradox in project-based enterprise: the case of lm making. Manag. Innovation Change 189 (15).
Dubois, A., Gadde, L.-E., 2002. The construction industry as a loosely coupled system: implications for productivity and innovation. Construct. Manag.
Econ. 20, 621631.
Dubois, A., Gadde, L.-E., 2014. Systematic combininga decade later. J. Bus. Res. 67, 12771284.
Eisenhardt, K.M., 1989. Building theories from case study research. Acad. Manag. Rev. 14, 532550.
Geels, F.W., Kemp, R., 2007. Dynamics in socio-technical systems: typology of change processes and contrasting case studies. Technol. Soc. 29, 441455.
Geels, F.W., Schot, J., 2007. Typology of sociotechnical transition pathways. Res. Policy 36, 399417.
Geels, F.W., Kern, F., Fuchs, G., Hinderer, N., Kungl, G., Mylan, J., Neukirch, M., Wassermann, S., 2016. The enactment of socio-technical transition
pathways: a reformulated typology and a comparative multi-level analysis of the German and UK low-carbon electricity transitions (19902014). Res.
Policy 45, 896913.
Geels, F.W., 2002. Technological transitions as evolutionary reconguration processes: a multi-level perspective and a case-study. Res. Policy 31,
12571274.
Geels, F.W., 2004. From sectoral systems of innovation to socio-technical systems: insights about dynamics and change from sociology and institutional
theory. Res. Policy 33, 897920.
Geels, F., 2005. Co-evolution of technology and society: the transition in water supply and personal hygiene in the Netherlands 18501930a case study
in multi-level perspective. Technol. Soc. 27, 363397.
Geels, F.W., 2006. Co-evolutionary and multi-level dynamics in transitions: the transformation of aviation systems and the shift from propeller to turbojet
(19301970). Technovation 26, 9991016.
Geels, F.W., 2011. The multi-level perspective on sustainability transitions: responses to seven criticisms. Environ. Innovation Soc. Trans. 1, 2440.
Geels, F.W., 2014. Reconceptualising the co-evolution of rms-in-industries and their environments: developing an inter-disciplinary Triple
Embeddedness Framework. Res. Policy 43, 261277.
Greenwood, D., 2012. The challenge of policy coordination for sustainable sociotechnical transitions: the case of the zero-carbon homes agenda in
england. Environ. Plann. C: Govern. Policy 30, 162179.
Hekkert, M.P., Suurs, R.A.A., Negro, S.O., Kuhlmann, S., Smits, R.E.H.M., 2007. Functions of innovation systems: a new approach for analysing technological
change. Technol. Forecasting Soc. Change 74, 413432.
Henderson, R.M., Clark, K.B., 1990. Architectural innovation: the reconguration of existing product technologies and the failure of established rms.
Adm. Sci. Q. 35, 930.
Herazo, B., Lizarralde, G., 2015. The inuence of green building certications in collaboration and innovation processes. Construct. Manag. Econ. 33,
279298.
Hobday, M., Rush, H., Tidd, J., 2000. Innovation in complex products and system. Res. Policy 29, 793804.
Jacobsson, S., Lauber, V., 2006. The politics and policy of energy system transformationexplaining the German diffusion of renewable energy technology.
Energy Policy 34, 256276.
Kemp, R., Schot, J., Hoogma, R., 1998. Regime shifts to sustainability through processes of niche formation: the approach of strategic niche management.
Technol. Anal. Strategic Manag. 10, 175198.
Koch, C., Buhl, H., 2013. Integrated design process a concept for green energy engineering. Engineering 5, 292.
Markard, J., Suter, M., Ingold, K., 2016. Socio-technical transitions and policy change advocacy coalitions in Swiss energy policy. Environ. Innovation Soc.
Trans. 18, 215237.
Oneill, K.J., Gibbs, D.C., 2014. Towards a sustainable economy? Socio-technical transitions in the green building sector. Local Environ. 19, 572590.
 H. Nykamp / Environmental Innovation and Societal Transitions 24 (2017) 8393 93

Orstavik, F., 2014. Innovation as re-institutionalization: a case study of technological change in housebuilding in Norway. Construct. Manag. Econ. 32,
857873.
Reed, B., 2009. The Integrative Design Guide to Green Building: Redening the Practice of Sustainability. Wiley Hoboken, N.J.
Rohracher, H., 2001. Managing the technological transition to sustainable construction of buildings: a socio-technical perspective. Technol. Anal. Strategic
Manag. 13, 137150.
Schumpeter, J.A., 1934. The Theory of Economic Development: An Inquiry Into Prots, Capital, Credit, Interest, and the Business Cycle. University Press,
Oxford.
Smith, A., Raven, R., 2012. What is protective space? Reconsidering niches in transitions to sustainability. Res. Policy 41, 10251036.
Smith, A., Stirling, A., Berkhout, F., 2005. The governance of sustainable socio-technical transitions. Res. Policy 34, 14911510.
Smith, A., Vo, J.-P., Grin, J., 2010. Innovation studies and sustainability transitions: the allure of the multi-level perspective and its challenges. Res. Policy
39, 435448.
Smith, A., 2007. Translating sustainabilities between green niches and socio-technical regimes. Technol. Anal. Strategic Manag. 19, 427450.
Suurs, R.A.A., Hekkert, M.P., Kieboom, S., Smits, R.E.H.M., 2010. Understanding the formative stage of technological innovation system development: the
case of natural gas as an automotive fuel. Energy Policy 38, 419431.
Turnheim, B., Geels, F.W., 2013. The destabilisation of existing regimes: confronting a multi-dimensional framework with a case study of the British coal
industry (19131967). Res. Policy 42, 17491767.
Unruh, G.C., 2000. Understanding carbon lock-in. Energy Policy 28, 817830.
Utterback, J.M., Abernathy, W.J., 1975. A dynamic model of process and product innovation. Omega 3, 639656.
Verbong, G., Geels, F., 2007. The ongoing energy transition: lessons from a socio-technical, multi-level analysis of the Dutch electricity system
(19602004). Energy Policy 35, 10251037.
Yin, R.K., 2011. Applications of case study research. Sage.
 Building and Environment 123 (2017) 243e260

Contents lists available at ScienceDirect

Building and Environment

journal homepage: www.elsevier.com/locate/buildenv

A critical comparison of green building rating systems

Dat Tien Doan a, *, Ali Ghaffarianhoseini a, Nicola Naismith a, Tongrui Zhang a,
Amirhosein Ghaffarianhoseini b, c, John Tookey a
a
Department of Built Environment Engineering, Auckland University of Technology, 55 Wellesley St E, Auckland, New Zealand
b
Faculty of Engineering and Architectural Science, Ryerson University, Toronto, Canada
c
Faculty of Arts and Social Sciences, University of Malaya (UM), Kuala Lumpur, Malaysia

a r t i c l e i n f o a b s t r a c t

Article history: Various green rating systems are established globally to evaluate the sustainability of construction projects.
Received 13 April 2017 Their categories and criteria have been under constant updates to follow the sustainable trend of building
Received in revised form development. This paper aims to develop a systematic review of the development of green rating systems. The
5 July 2017
specic objectives are: 1) discover how interest and research in green rating systems have developed; 2)
Accepted 5 July 2017
Available online 8 July 2017
identify the similarity, difference, strength and weakness of green rating systems; 3) examine whether they
fully assess the projects in all aspects of sustainability. Specically, LEED (Leadership in Energy and Envi-
ronmental Design), BREEAM (Building Research Establishment Assessment Method), CASBEE (Comprehensive
Keywords:
Green rating systems
Assessment System for Building Environmental Efciency) and Green Star NZ were analysed in this paper. The
Sustainability results indicate that BREEAM, LEED, and CASBEE have been utilized since late the 2000s while Green Star NZ is
BREEAM still in its earlier stages. 70% of the research papers focusing on BREEAM, LEED, CASBEE are developed
LEED geographically in the USA, Canada, the UK, China, and Australia. Although these four rating systems were
CASBEE initiated in different contexts with different standards, Indoor Environment Quality, Energy, and Material are
Green Star NZ core common categories for all. Environmental concerns are the main focus in New Construction manuals
while Society is emphasized in Neighbourhood Development manuals. Currently, BREEAM has been the only
tool which could assess all four sustainable factors. Further in-depth research is anticipated to focus more on
economic and institutional factors to improve the capability of green rating systems for sustainability
assessment purposes.
2017 Elsevier Ltd. All rights reserved.

Contents

1. Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 244
2. Green vs sustainable buildings . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 244
3. Green rating systems . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 245
3.1. BREEAM . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 245
3.2. LEED . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 245
3.3. CASBEE . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 246
3.4. Green Star NZ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 246
3.5. Overview of BREEAM, LEED, CASBEE, and Green Star NZ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 246
4. Research methodology . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 249
5. Results and analyses . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 250
5.1. Selection of relevant papers . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 250
5.2. Attraction of BREEAM, LEED, CASBEE, and Green Star NZ topics . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 251
5.3. Contributing regions . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 251
5.4. Comparison of BREEAM, LEED, CASBEE, and Green Star NZ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 251
5.4.1. New construction manuals . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 251

* Corresponding author.
E-mail address: dat.doan@aut.ac.nz (D.T. Doan).

http://dx.doi.org/10.1016/j.buildenv.2017.07.007
0360-1323/ 2017 Elsevier Ltd. All rights reserved.
244 D.T. Doan et al. / Building and Environment 123 (2017) 243e260

5.4.2. Neighbourhood Development/Communities/Urban Development manuals . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 256

6. Discussion . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 256
7. Conclusion . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 258
Acknowledgement . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 258
References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 258

1. Introduction have been continuously updating their criteria. LEED had a major
update in 2013 with LEED v4, and it just updated its rating tools in
The construction industry plays an important role in satisfying mid-2016 [42]. While the major update to BREEAM happened in
the needs of society, enhancing the quality of life [1e3], and mid-2014 with BREEAM UK New Construction [43]. Mid-2015 and
contributing to the economic growth of a country [3e6]. However, mid-2016 saw the latest version of Green Star Australia and Green
it has been heavily criticised for being a major contributor to carbon Star New Zealand respectively [44,45]. Besides, international
emissions, environmental degradation, and global warming [7e11] standards about sustainable buildings have also created. For
due to its utilization of a large proportion of natural resources and example, ISO/TC 59/SC 17 was created in 2002 to implement as-
energy consumption [11e14]. The building sector consumes a third pects of sustainability in the building sector [46].
of global resources [15,16], one sixth of global freshwater with- Although green building rating certications have been the
drawals [17], 25% of wood harvested [16], and 40% of all raw ma- focus of various researchers during the past 20 years, there is still
terials [16]. Approximately 10% of all global energy supply takes no systematic review of the detailed criteria and the updated
place during the manufacturing of building materials [10,15]. Also, process of each rating system. A number of papers focused on the
the building sector generates a large amount of construction and trend and credits in an individual rating tool, however, a compre-
demolition waste, accounting for 40% of total solid waste in hensive comparison of tools has not been established. For example,
developed countries [18e20]. Moreover, the construction industry Todd [47] focused on the global trends in LEED-NC and LEED-EBOM
is responsible for major energy consumption, accounting for besides investigating the achievement of individual LEED credits.
40e50% of all energy usage and anthropogenic greenhouse gas Murakami [48] introduced the concept and framework of the
emissions globally [21e25]. CASBEE-City. Cheng and Ma [49] adopted data mining techniques
Recognizing the importance of sustainable building practices, to examine the relationship between LEED credits and climate
going green and environment sustainability has been intro- factors. While other researchers made comparisons among green
duced for many years [10,26]. However, construction is still a major rating schemes, studies to examine the update and the global trend
energy consumer based on ofcial statistics [10]. This could be due of those schemes together or research about their capability in
to the passive attitude of construction practitioners towards promoting the sustainability are lacking. Lee and Burnett [50], for
adopting sustainable solutions [7]. Facing the rising energy costs instance, analysed the energy use assessment of HK-BEAM,
and growing environmental concerns, the demand for sustainable BREEAM, and LEED. Schwartz and Raslan [37] examined the
building facilities with minimal environmental impact has been impact of building energy simulation tools on BREEAM and LEED
pushed recently [27e29]. ratings. Ng [52] tried to nd out the properties and standards of
Authorities and organizations initiated the rating systems for various building environmental assessment ratings on evaluating
green buildings to minimize/optimize consumption of natural re- carbon emissions. Besides research papers, projects focusing on
sources and control pollution. Buildings certied by those rating sustainable indicators for buildings had also been carried out. For
systems are considered as consuming less energy, providing a example, Super Buildings project funded by European Commission
better living environment and contributing to the overall reputa- was conducted during 2010e2012 by leading European organiza-
tion of the property [30]. It is estimated that there are approxi- tions and companies [53]. However, this project focused more on
mately 600 green rating systems globally [31]. BREEAM (Building the European context where BREEAM is accounting for 80% of the
Research Establishment Assessment Method) is known as the rst market [43,54e56], which may not provide an inclusive view. This
rating tool to assess building performance based on certain target paper, therefore, aims to develop a systematic review of the
values for different criteria [32e34]. In addition, numerous development of green rating systems focusing on the well-known
schemes such as the United States' LEED (Leadership in Energy and global schemes with LEED in the Americas, BREEAM in the
Environmental Design), Canada's LEED Canada, France's HQE (High Europe, CASBEE in the Asia, and Green Star in the Australasia. The
Environmental Quality), Germany's DGNB (Deutsche Gesellschaft specic objectives are:
fr Nachhaltiges Bauen e.V.), Australia's Green Star, New Zealand's
Green Star, Japan's CASBEE (Comprehensive Assessment System for 1 Discover how interest and research in green rating systems have
Building Environmental Efciency), Hong Kong's BEAM (Building developed
Environmental Assessment Method), Singapore BCA (Building and 2 Identify the similarity, difference, strength, and weakness of
Construction Authority) Green Mark Scheme are currently being green rating systems
utilized to evaluate building performances. BREEAM certied 3. Examine whether they fully assess the projects in all aspects of
buildings could consume 6e30% lower energy costs than non- sustainability.
certied buildings [35,36] while LEED certied properties
consume 18e39% lower energy usage than non-certied properties
[35,37e39]. However, the focus on green credentials evidenced
such as LEED misses the larger picture, sustainable aspect [40]. 2. Green vs sustainable buildings
According to Berardi [41], and Runde and Thoyre [40], the impact of
sustainability will extend far beyond green buildings in the near Green and Sustainable building have been used interchangeably
future. Concerning this, all leading green building rating systems [10,40,41,57], but these two terms are far from synonymous
[40,41,57]. Cole [58] described Green as building design strategies
 D.T. Doan et al. / Building and Environment 123 (2017) 243e260
that are less environmentally and ecologically damaging than typical
practice [59,60] in 1999. While Kua and Lee [61], and Yoshida and
Sugiura [62] dened Green building as one that meets certain
criteria for environmental performance [61]. In 2008, it was indi-
cated that Green is a term encompassing strategies, techniques, and
construction products that are less resource-intensive or pollution-
producing than regular construction [63]. Howe [64] detailed it as
using land and energy efciently, conserving water and other re-
sources, improving indoor and outdoor air quality, and increasing
the use of recycled and renewable materials. The concept of Green
building has been continually revised and its denition is
commonly accepted as providing people with healthy, applicable,
efcient space and natural harmonious architecture with the
maximum savings on resources (energy, land, water, materials), pro-
tection for the environment and reduced pollution throughout its
whole lifecycle [65e67].
The denition of Sustainability has also suffered from ambiguity
and uncertainty [41,68,69]. New denitions incorporating over 100
concepts have been given [41]. One of the earliest of its denitions
was given by Brundtland Commission in 1987, which stated that
sustainable development is a development which meets the needs of
the present without compromising the ability of future generations to
meet their own needs [41,70,71]. Although Sustainability has been
dened concerning diverse aspects, environmental, social, and
economic impacts are its three main pillars [72e77]. Recently, the
fourth pillar, institutional dimension, has gained increasing recog-
nition [75,78e80]. Institution was introduced as the fourth pillar in
1995 by the Commission on Sustainable Development [81]. It is
dened as the results of interpersonal processes, such as communi-
cation and co-operation, resulting in information and systems of rules
governing the interaction of members of a society [82]. Its indicators,
used to evaluate the institutional sustainability, were suggested by
the United Nations focusing on several aspects such as a partici-
pator political system, non-discriminatory education, social secu-
rity systems, gender equity etc. [81,83].
It is clear that the concepts for both Green and Sustainability are
simple and can be considered vague in the beginning. However,
they can be claried in detail step by step. There are factors created
to evaluate how Green buildings are more environmental and
ecological than the traditional ones such as energy, land, water, and
materials. While four main pillars are identied to determine the
Sustainability of a project. It is noticed that although the denition
of Green has still been developing, the environment is always its
core. Whereas, Sustainability could be considered as a non-stop
development concept depending on the sustainable building
practices. This is because Sustainability is multi-interpretations and
an interdisciplinary concept [81,84], and the difference in current
sustainable construction practices is occurring due to the various
concepts of sustainable construction among countries [85]. Wangel
[86] stated that Sustainability should be a normative concept
established for a particular purpose than dening inductively. Shari
and Soebarto [60] believed that Sustainability could embrace all
facets of human activity, and Yanarella [57] considered it as a
concept tied to the whole systems.
Up to date, Green (GRE) buildings embrace environmental im-
provements while Sustainable buildings focus on four main pillars,
including environmental (ENV), social (SOC), economic (ECO), and
institutional issues (INS) [78], see Fig. 1. With the continuous up-
date on the denition, it is anticipated that more and more pillars
will be established to assess the Sustainability of building practices.
Council [87], Cities and Governments [88] suggested Culture could
be the next dimension of Sustainability while Redclift [89] deter-
mined Epistemology is one of Sustainability's dimension.
245
Fig. 1. Sustainable framework.
3. Green rating systems
During this study, BREEAM, LEED, CASBEE, and Green Star NZ,
were analysed in detail. The rationale to select these rating systems
is based on considering BREEAM, LEED, and CASBEE as globally
well-known leading ones alongside Green Star NZ, which in com-
parison is a relatively new system that has recently released its
latest version and New Zealand has subsequently seen a signicant
increase in the number of registered green buildings.
3.1. BREEAM
BREEAM is seen as the rst green building rating assessment in
the world, launched and operated by BRE (Building Research
Establishment) in the UK [32e34]. It was introduced to the market
in 1990 and was rst revised to assess ofces in 1993 [33,90]. It is
widely accepted that almost all later major green rating systems
such as LEED, Green Star, and CASBEE are under the inuence of
BREEAM (Fig. 2).
BREEAM is widely used owing to its exibility. It not only as-
sesses local codes and conditions but also allows application in
international buildings [91]. In addition, BREEAM enables evalua-
tion of a building's lifecycle in view to design, built, operation and
refurbishment; BRE provides New Construction, In-use, Refur-
bishment and Fit-Out, Communities, and Infrastructure manuals
for planners, local authorities, developers, and investors. As a result,
BREEAM has so far issued over 560,000 certications [43]. This
number is anticipated to follow its increasing pattern (from
250,000 buildings in 2014 [92] to 425,000 buildings in 2015 [93],
and 540,000 buildings in 2016 [56]). A similar incremental pattern
applied to the number of countries adapting BREEAM since 1990
(50 countries in 2014 [92], 70 countries in 2016 [56], and over 75
countries in 2017 [43,94]). BREEAM certications accounts for 80%
of the European market share for sustainable building certications
[43,54,55,95]. Although all of the sustainability pillars could be
assessed by BREEAM, the environmental factor is still predominant
with eight main categories including Management, Energy, Trans-
port, Water, Materials, Waste, Land Use & Ecology, and Pollution.
3.2. LEED
LEED is a voluntary standard developed by USGBC (US Green
Building Council) [97,98]. It was rst launched in 1998 with a pilot
version (LEED 1.0) [99,100]. Although it was released after BREEAM,
it is considered as the most widely adopted rating scheme based on
the number of countries, with over 79,000 projects [42,101,102]
across 135 countries in 2012 [103,104], reaching nearly 150 coun-
tries and territories in 2014 [92], and over 160 countries and
246 D.T. Doan et al. / Building and Environment 123 (2017) 243e260
Fig. 2. The relationship among green ratings (adapted from Mao [96]).
territories at present [42]. The square footage of LEED-certied
projects has risen dramatically during 2008e2016 (approximately
100%), from around 0.15 billion to over 15 billion square feet
[42,96]. Similar to BREEAM, LEED predominantly evaluates envi-
ronmental factors including Sustainable Sites, Water Efciency, En-
ergy and Atmosphere, Material and Resources, and Indoor
Environment Quality categories. All of the building's lifecycle could
be evaluated based on the criteria from Building Design and Con-
struction, Interior Design and Construction, Building Operations
and Maintenance, Neighbourhood Development manuals.
3.3. CASBEE
CASBEE was developed by the collaboration of academia, in-
dustry, and the local governments in 2001 in Japan [105,106].
Owing to its limitation to Japanese context, the number of certied
buildings is still modest (330 buildings since 2004) [105]. However,
it is the rating which evaluates the broadest context (Fig. 3) and
started releasing a pilot version for worldwide use in 2015. CASBEE
could assess the buildings starting from the design to the renova-
tion with criteria from CASBEE Buildings, CASBEE for Commercial
Interiors, and CASBEE for Temporary Construction manuals. While
CASBEE for Urban Development and CASBEE for Cities manuals are
used as frameworks to evaluate a group of buildings.
3.4. Green Star NZ
The Green Star NZ rating scheme was rst launched in 2007 by
Fig. 3. Overview of green rating tools.
NZGBC (New Zealand Green Building Council), based on the
Australian Green Star [45]. Compared to the rating schemes above,
Green Star NZ is the youngest. It is the only one that does not
provide a manual to assess the building during its performance
phase (Fig. 3). Since it has been in the market for a decade only, the
number of certied buildings is still limited. However, it has seen a
positive trend (10 times increase since 2009) to reach 125 certi-
cations [107].
3.5. Overview of BREEAM, LEED, CASBEE, and Green Star NZ
BREEAM, LEED, and Green Star NZ were established by non-
prot third parties, while the government plays a dominant role
in CASBEE besides the industry and academia. Due to the collabo-
rations among various parties, CASBEE could receive the feedbacks
and consider them for future updates more frequently, precisely,
and thoroughly. This could be a reason why CASBEE is considered as
a leader in the assessment of comprehensive area development
projects. This includes a group of buildings or a city with the release
of CASBEE Urban Development CASBEE City (see Fig. 3), even though
CASBEE was established after the leading global rating systems
BREEAM and LEED a decade and half of a decade, respectively.
Green Star NZ is the latest established rating systems compared to
BREEAM, LEED, and CASBEE. Consequently, though it could eval-
uate the majority of the whole life cycle of a project, operation stage
assessment is still not covered (see Fig. 3).
The main features of BREEAM, LEED, CASBEE, and Green Star NZ
are shown in Table 1. It is clear from the Table that all of these four
 D.T. Doan et al. / Building and Environment 123 (2017) 243e260 247

Table 1
Main features of BREEAM, LEED, and Green Star NZ.

BREEAM LEED CASBEE Green Star NZ

Country UK US Japan NZ
Organizations BRE USGBC JSBC NZGBC
Flexibility 77 countries 160 countries 1 country 1 country
First version 1990 1998 2002 2007
Latest version 2016 2013 2015 2016
Main categories Management Integrative process Indoor Environment Management
Health & Wellbeing Indoor Environment Quality of Service Indoor Environment Quality
Energy Quality On-site Environment Energy Energy
Transport Energy & Atmosphere Resources & Materials Transport
Water Location & Transportation Off-site Environment Water
Material Water Efciency Material
Waste Material & Resources Land Use & Ecology
Land Use & Ecology Sustainable Sites Emissions
Pollution Regional Priority Innovation
Innovation Innovation
Rating approach Pre-weighted Additive credits BEE ranking chart Pre-weighted categories except for
categories Innovation
Rating level Pass
30 Certied
40 Poor: BEE <0.5 Best practice
45
Good
45 Silver
50 Fairy Poor: BEE 0.5e1.0 Excellent
60
Very good
55 Gold
60 Good: BEE 1e1.5 Leadership
75
Excellent
70 Platinum
80 Very good: BEE 1.5e3; or BEE
3 and
Outstanding
85 Q < 50
Excellent: BEE
3 and Q  50
Number of certied 561,600 79,100 541 125
buildings

rating schemes just released their latest versions recently. Although
the latest version of LEED was released four years ago, it has the
new update in 2017 [108]. This proves that all of the rating systems
are making efforts to revise and update their criteria more
frequently to follow immediately with the rapid development of
sustainable construction.
The exibility or the application of CASBEE and Green Star NZ is
still limited; it is suggested that they are only capable of domestic
projects leading to the modest certied projects, with 541 for
CASBEE and 125 for Green Star NZ. This is because CASBEE and
Green Star NZ were just established around a decade ago and they
are still at the earlier stages compared to BREEAM and LEED. A pilot
version for worldwide use was released in 2015 to make CASBEE
more exible to gain the widespread adoption and the number of
registered projects.
BREAM and LEED have a signicant number of green certied
buildings globally. Despite the different regional characteristics,
climate, culture, etc., countries other than the UK and the US could
adopt BREAM or LEED. This is because standards used to assess
green criteria could be the international standards or local equiv-
alent standards. For example, LEED states that International Society
of Arboriculture using ISA standard method or local equivalents
could be used to assess Sensitive Land Protection in LEED. While
BREEAM also allows national or local equivalents to ISO 7730:2005
used to evaluate Thermal Comfort sub-category.
BREAM and LEED differ signicantly in their exibility and the
number of certied buildings. 561,600 buildings in total were
certied by BREEAM, which is seven times higher than those for
LEED. Regarding geographic adoption, up to 160 countries and
territories have adopted LEED for green project assessment in
comparison with 77 countries for BREEAM. This could be explained
in three main reasons. Firstly, BREEAM targets the European market
where the majority of countries are well-aware of Sustainability.
Secondly, LEED is considered as a more transparent rating approach
for calculating the nal results, while BREEAM adopts the pre-
weighted categories method which is more complex and stricter.
Finally, BREEAM is stricter in its criteria for achieving credits. It sets
absolute parameters while relative percentage improvement or
reduction targets are employed by LEED. For example, in the sub-
category of Energy, Reduction of energy use and carbon emissions,
BREEAM provides guidance in the form of a table for Energy Per-
formance Ratio for International New Constructions benchmark scale,
in which absolute values are targeted like 0.06 for achieving one
credit and 0.9 for achieving 15 credits. While in the sub-category
accounting for the highest credits of Energy and Atmosphere of
LEED, Optimize energy performance, a table is created to compare
the difference in the percentage of the assessed building energy
simulation with the past energy simulation analyses or published
data for similar buildings. If the simulation shows that the energy
performance improves 6% for new construction, one point will be
achieved for a school project, and 16 points will be attained for 42%
of the improvement. As a result, BREEAM has many certied pro-
jects, but LEED gains global adoption.
Considering the number of main categories of the four rating
schemes, it is clear that BREEAM has the highest number of cate-
gories (10), which is slightly higher than those of LEED and Green
Star NZ with nine categories for each. It is worth noticing that
BREEAM, LEED, and Green Star NZ share the same patterns in the
characteristics of categories. This is due to the strong inuence of
BREEAM on LEED and Green Star NZ, as demonstrated in Fig. 2.
Although CASBEE is affected by BREEAM, it was established by the
cooperation of various parties, including the government, industry,
and academia, thereby leading to the difference in the assessed
categories constituting only six main categories. These rating
schemes have the common categories such as Energy and Material,
even though they are created based on their local contexts. This
proves that these same categories are the global concerns and
should be considered thoroughly.
In view of the rating approach, LEED adds all credit points to
sum up the nal grade while BREEAM and Green Star NZ pre-
weight the categories before adding them up. Fig. 4 shows the
weightings of Green Star NZ and BREEAM.
The weightings for Green Star NZ depend on projects types
(Ofce, Education or Industry). For example, in an Education proj-
ect, Material constitutes a higher percentage than the one in an
Ofce or an Industry project. Likewise, Indoor Environment Quality is
248 D.T. Doan et al. / Building and Environment 123 (2017) 243e260
Fig. 4. Green Star NZ's and BREEAM's weightings.
a more signicant point of focus in Industry projects compared to
the others.
BREEAM further categorizes projects into Shell and core only,
Shell only, and Fully tted out. Although BREEAM's and Green Star
NZ's weightings are created based on two different local contexts
and standards, they have the same common in the weightings of
characteristics. It is clear that Energy is the most important category
in both ratings, accounting for the highest proportion of the
weighting scale. In other words, Energy is seen as the priority cri-
terion compared to the others. This is understandable due to the
excessive energy consumption of the construction industry. Ac-
cording to EIA (Energy Information Administration), buildings
constituted almost a third of the global energy consumption
[109,110]. Based on the IPCC (Intergovernmental Panel on Climate
Change) AR5 (Fifth Assessment Report), buildings consumed 32% of
global energy and emission of 19% of energy-related greenhouse
gases [111]. Also, buildings were responsible for 40% of the EU
energy consumption [112].
Besides the importance of the Energy criterion, the weighting
scales for Material and Indoor Environment Quality/Health & Well-
being also reect their major priorities in the building evaluation
compared to other criteria. The building construction industry is
responsible for a substantial proportion of the global raw material
consumption exploiting 25% of wood harvest; 40% of stone, sand,
and gravel, and 16% of water [113e115], thereby leading to the high
weighting scale in Material. Whereas Indoor Environment Quality/
Health & Wellbeing focuses on the wellbeing and health issues of
building occupants [116,117]. This is considered as a key role in
dening Green as: providing people with healthy, applicable, efcient
space and natural harmonious architecture [65e67]. Therefore, the
weighting for Indoor Environment Quality/Health & Wellbeing is
highlighted.
In any manual version of BREEAM or Green Star NZ, Energy,
Material, and Indoor Environment Quality/Health & Wellbeing are
prioritized. However, in the later versions, the weighting percent-
ages of Energy, and Indoor Environment Quality/Health & Wellbeing
tend to reduce. In contrast, those of Material show an opposite
tendency. For example, 20% is the gure of Indoor Environment
Quality of Ofce version 1, which reduces to 16% in the next three
versions, as opposed to Material with a growth by 4% in Ofce
version 09, version 3, and version 3.1. This could be explained that
previous building practices might show a positive trend toward
Energy and Indoor Environment Quality/Health & Wellbeing, while
Material had not caught much attention yet. These weightings have
a strong inuence on the nal results of BREEAM and Green Star.
BREEAM and Green Star follow a similar approach to determine the
nal results based on pre-weighted categories. Points will be
given for each sub-category which are then summed up for total
points of each category. As individual categories have their own
weighting scale (e.g. Fig. 4), the total point of each category will be
multiplied by the weighting scale which is equivalent to the cate-
gory before adding up for the nal results. In spite of this, LEED uses
a simpler method called additive credits, where all credits are just
added up to calculate the nal results regardless of the weightings.
In contrast to the rest, the assessment results for CASBEE are
calculated in a complex way. It is worth noticing that CASBEE has a
different approach to calculating the nal results. Instead of sepa-
rating credits into different green categories such as energy,
transportation, etc., CASBEE evaluates two spaces, internal and
external, divided by the virtual boundary, see Fig. 5 [105]. In other
words, CASBEE evaluates two factors, Q (Built Environment Quality)
and L (Built Environment Load). Q is used to assess improvement
in everyday amenity for the building users, within the virtual
enclosed space boundary [105] while L is used to assess negative
aspects of environmental impact that go beyond the virtual
enclosed space boundary to the outside (the public property)
[105]. Credits for Q and L are calculated before putting on a BEE
(Built Environment Efciency) chart which is divided according to
the line gradient (Fig. 6) for the nal results or calculating by the
equation BEE Q/L. An example is displayed in Fig. 5 in which
Q 80 and L 34. The point (80, 34) is in A gradient translated as a
very good building in Fig. 5.
A timeline of developments for the discussed four rating sys-
tems is displayed in Fig. 7. It is noticeable that, since 2005, they all
have been furnished with new tools, most especially BREEAM with
almost a new update every year. In contrast to BREEAM and CAS-
BEE, LEED and Green Star NZ have updated their tools
synchronously.
Although these four schemes are voluntary tools, they are being
used as a mandatory requirement in some regions or for particular
 D.T. Doan et al. / Building and Environment 123 (2017) 243e260 249

Fig. 5. Built environment quality and built environment load [105].

Fig. 6. BEE ranking chart.

purposes. BREEAM assessment is a mandatory requirement to
achieve funding from Department of Health and Education in the
UK [118]. San Francisco is the rst state in the U.S. which required
high-rise residential projects to be certied LEED silver by 2010
[119]. CASBEE assessment results have been used as a mandatory
for building permits by some local Japanese governments [120],
whereas Auckland Council has included requirements for Green
Star NZ in the Proposed Unitary Plan [45].
4. Research methodology
This research utilized a two-step approach to review green
certications comprehensively, see Fig. 8.
a. Initially, a systematic desktop search was carried out via major
scientic databases namely, Scopus and Web of Science (WOS), to
identify the relevant journals for this study. WOS and Scopus are
seen as the most widespread databases covering publications in
various elds [121]. WOS has a strong coverage with papers pub-
lished since 1990 and English is the main language in its most
journals while a superior number of journals is covered by Scopus
[122]. To narrow the selected journals which published many
relevant papers, search keywords, including LEED, BREEAM,
CASBEE00 , Green Star NZ, Green Building, and Sustainable
Building were used under the article title/abstract/keywords
eld for Scopus and Title for WOS. Journals publishing the largest
number of papers in these elds were identied as Energy and
Buildings (E&B), Building and Environment (B&E), Automation in
Construction (A&C), Building Research and Information (BR&I),
International Journal of Sustainable Building Technology and Urban
Development (SBT&UD), Journal of Cleaner Production (CP), Envi-
ronmental Impact Assessment Review (EIAR), and Renewable and
Sustainable Energy Reviews (R&SER). They are also high-ranking
250 D.T. Doan et al. / Building and Environment 123 (2017) 243e260
Fig. 7. BREEAM, LEED, CASBEE, and Green Star timeline.
journals in the construction eld which are ranked by Scimago
Journal & Country Rank (http://www.scimagojr.com/), see Table 2.
Therefore, they are the mainstreams chosen for reviewing.
Due to the popular use of the chosen search keywords, irrele-
vant papers are possibly available in the results. Thus, abstracts
were read to lter out the irrelevant papers. Unless the papers
mainly focused on the green rating systems, they will be excluded.
The aim of this rst step is to a) observe the development of green
rating systems, b) nd out how they are popular in the research, c)
discover which rating is more globally recognized, d) locate the
countries concerning about green building.
b. In a latter step, manuals of BREEAM, LEED, CASBEE, and Green
Star NZ were examined to determine their developments, similar-
ities, and differences along with their strengths and weaknesses to
determine their support to sustainability. New Construction man-
uals and Neighbourhood Development manuals were investigated in
this paper. New Construction manuals represent for a new individ-
ual building assessment guidance. It aims to mitigate the life cycle
impacts of new buildings on the environment in a robust and cost-
effective manner [117]. While Neighbourhood Development man-
uals represent for a large-scale development plans guidance. It
provides a framework to planners, local authorities, developers, and
investors through the master planning process, before embarking on
procurement, detailed building level design and construction [123].
All of the examined manuals are indicated in Table 3.
5. Results and analyses
5.1. Selection of relevant papers
A total of 408 papers were identied in the above-mentioned
eight journals; however, 206 papers were delimitated as none of
BREEAM, LEED, CASBEE, or Green Star NZ were the main focus. It
was discovered that the rst set of LEED and BREEAM related pa-
pers were published in 1998, see Fig. 9. This eld attracted the
attention of researchers by the end of the 2000s. The number of
published papers increased dramatically from 8 papers in 2010 to
36 papers in 2016.
BR&I contributed the highest number of papers, accounting for
35% of total papers in eight selected journals (Fig. 10). This gure is
almost double the total number of papers that E&B released during
1998e2016. A signicant increase in a number of published papers
was seen in E&B, B&E, and R&SER from 2013 to 2016 (an average of
16 paper each year for these three journals). While BREEAM, LEED,
CASBEE, and Green Star NZ have just received attention recently
from A&C, CP, SBT&UD, and EIAR. Except BR&I, E&B, and B&E, the
rest of the journals published fewer papers, but they all shared a
similar pattern, a growth in the number of papers recently.
 D.T. Doan et al. / Building and Environment 123 (2017) 243e260 251

Fig. 8. Methodology steps.

Table 2 5.3. Contributing regions

Ranking of selected journals.

Areas Journals Rank Identifying the contributions of regions/countries on research

topics in different elds have been the interest of many researchers
Building and Construction B&E 3
E&B 5 [124e126]. Since rst authors are seen as the main research con-
A&C 13 tributors in scientic papers, this study examined the research
BR&I 15 origin of the rst authors of the identied papers. 202 papers
SBT&UD 115
originated from 30 countries; however, only those countries
Renewable Energy, Sustainability and the Environment CP 21
R&SER 5 contributing two or more papers are shown in Fig. 12. It is noted
Management, Monitoring, Policy and Law EIAR 24 that almost a quarter of papers come from the USA (49 papers). Five
leading countries in publications (the USA, Canada, the UK, China,
and Australia) have contributed to approximately 70% of the total
Table 3 papers. It is worth noting that these countries are also the origins of
Selected manuals of BREEAM, LEED, CASBEE, and Green Star NZ. widely utilized green rating schemes namely, LEED (USA and
Canada), BREEAM (The UK), and Green Star (Australia). Further-
Manuals BREEAM LEED CASBEE Green Star NZ
more, developing countries such as Turkey, India, Brazil, and
New Construction 2006 2.0 2014 v1
Malaysia, are also aiming for green buildings.
2008 2.1 2009
2011 2.2 v3
The abovementioned statistics prove that green rating systems
2013 v3 v3.1 are globally well-known and have attracted the attention of many
2014 v4 countries including developed and developing ones. Although
2016 BREEAM and LEED have been established for a long time, they
Neighbourhood Development 2012 v4 2014
caught the attention of researchers by the end of the 2000s,
especially 2008 in which the number of LEED papers was doubled
to reach ten papers per year, while BREEAM's and LEED's gures
5.2. Attraction of BREEAM, LEED, CASBEE, and Green Star NZ topics were also increased.

Despite the use of BREEAM, LEED, CASBEE, and Green Star
NZ as search keywords, no publications under Green Star NZ
were found. This is a conrmation that Green Star NZ is still in its
earlier stages compared to the rest leading to the academia's
neglect. Fig. 11 shows the statistics for the papers related to LEED,
BREEAM, and CASBEE. LEED has attracted the most increasing
attention with 63% of the total papers (36% more than BREEAM-
related publications). In contrast to BREEAM and LEED, with a
dramatic increase in the number of papers, the gures for CASBEE
have only risen slightly at the beginning of the 2010s.
5.4. Comparison of BREEAM, LEED, CASBEE, and Green Star NZ
5.4.1. New construction manuals
This research compared New Construction manuals of the dis-
cussed green building rating systems (Fig. 13). Although different
terminologies were used to describe BREEAM's, LEED's, CASBEE's,
and Green Star's assessment criteria, they generally share common
purposes, focusing on environmental concerns, especially in
BREEAM, LEED, and Green Star NZ. Indoor Environment Quality,
Energy, and Material criteria are all assessed under these four
252 D.T. Doan et al. / Building and Environment 123 (2017) 243e260

Fig. 9. BREEAM, LEED, CASBEE, and Green Star NZ related papers published from 1998 to 2016.

Fig. 10. BREEAM, LEED, CASBEE, and Green Star NZ related papers published in each selected journal.

systems which proves that they are global concerns. Also, the total
points for each category of Indoor Environment Quality, Energy, and
Material are higher than those of the rest ones. In other words,
these categories are the main focus, and they are promoted by in-
ternational organizations.
Establishing by non-prot organizations and strongly depend-
ing on BREEAM, LEED and Green Star NZ have similar categories
and total points with BREEAM as opposed to CASBEE. About the
total points, BREEAM, LEED, and Green Star NZ have around 150
points on the average. It is worth noticing that the later of the
version released, the more total points could be achieved. LEED has
the most notable increase in points, from 69 points in version 2 to
145 points in version 4. BREEAM and Green Star NZ followed the
same approach in their latest version with their total points
increased by over 15 points accumulating to 159 and 153 respec-
tively. This means that the evaluation of the rating systems is
gradually comprehensive. Taking BREEAM for example, the total
points of Material in International New Construction 2013 are 11
which then increased by one in International New Construction
2016. In the sub-category namely Responsible sourcing of construc-
tion product, International New Construction 2016 assesses not only
three credits which are same with 2013 manual but also one more
 D.T. Doan et al. / Building and Environment 123 (2017) 243e260 253

Fig. 11. The proportions of BREEAM, LEED, CASBEE, and Green Star NZ in the research papers.

Fig. 12. Research origin of BREEAM, LEED, CASBEE, and Green Star related paper published.

credit for sustainable procurement plan.
While points are gained for the assessment process of BREEAM,
LEED, and Green Star NZ, levels are determined for CASBEE evalu-
ation. Point achievement could be seen as a exible assessment
method which does not have any particular maximum points.
These points are earned based on the important of the criteria. In
Energy of Green Star NZ version 3.1, for instance, total points
achievement could be 10 for the rst sub-category, but it is only one
for the second sub-category. It means that the important of the rst
sub-categories is much higher than that of the second sub-category.
This is opposite with CASBEE in which levels are given in a
particular range. Five levels are granted from Level 1 to Level 5.
Level 1 is earned when the minimum conditions requirement is
satised, and Level 3 represents the achievement of the ordinary
technical and social practices at the time of assessment. Despite the
different important of sub-categories, ve is the maximum level
that each sub-category of CASBEE could be attained. Put differently,
the level or the important of each sub-category is equal in CASBEE
system in case weighting coefcients are not taken into account,
which is totally opposite with BREEAM, LEED, and CASBEE.
In view to the mandatory credits, ensuring a project achieves a
certain minimum score in each category, BREEAM, LEED, and Green
254 D.T. Doan et al. / Building and Environment 123 (2017) 243e260
Fig. 13. A comparison of New Construction manuals.
Star NZ increased their credits to prevent greenwash action.
Greenwash action is dened as the use of public relations or mar-
keting in order to promote a misleading perception that a company's
policies or products are environmentally friendly [127]. In other
words, mandatory credits are created to prevent plans achieving
green certications by applying for the least necessary credits.
Despite a big difference regarding the total number of mandatory
credits in BREEAM and Green Star NZ, they both have the same
tendency (a slight increase towards the mandatory credits in their
updated versions). BREEAM and LEED share a similar gure in the
number of mandatory credits in the latest version while the gure
for Green Star NZ is still modest. It is clear from the schemes that
Indoor Environment Quality and Energy are key categories, ac-
counting for a considerable number of points and including
mandatory credits in any versions.
Although BREEAM, LEED, and Green Star NZ include a combi-
nation of mandatory and non-mandatory credits, they have a
different approach for the result calculation. Points could be ach-
ieved if a project satises the requirement for mandatory credits in
BREEAM and Green Star NZ as opposed to LEED when no point is
allocated for those credits but it is compulsory to comply with the
credits.
This research also investigated the development of sub-
categories in these green rating systems (Fig. 14). It is noted that
there is a slight rise towards the total number of sub-categories of
BREEAM, LEED, and Green Star NZ in the later versions, especially
with the release of two new categories in LEED version 4, namely
Integrative Process and Location and Transportation. The categories
of these rating systems are analysed in more detail in which more
sub-categories are created to assess projects in every angle of the
category with the development and the release of new versions of
manuals. Energy is again emphasized with the rise in sub-
categories among BREEAM, LEED, and Green Star NZ. Besides,
BREEAM, LEED, and Green Star NZ also have a common increase in
the number of Transport sub-categories.
It is worth noting that despite the strong dependence on
BREEAM, LEED and Green Star NZ have a different way towards the
total points and sub-categories breakdown. BREEAM, LEED, and
Green Star NZ have a similar total of points, but the total sub-
categories of BREEAM are much lower than those of LEED and
Green Star NZ, see Fig. 14. In other words, more points can be
achieved in each sub-category of BREEAM than those of LEED and
Green Star NZ. Furthermore, the total sub-categories of BREEAM
except for Innovation are fairly equal in each category as opposed to
those of LEED and Green Star NZ. Management is promoted in New
Zealand context while the US focuses on Sustainable Sites. However,
Indoor Environment Quality, Energy, and Material are emphasized in
both LEED and Green Star NZ.
In CASBEE, due to the unavailability of manual in English, only
CASBEE for Building (New Construction) 2014 is considered. Having
the same trend with LEED and Green Star NZ, Indoor Environment
Quality and Resources and Material have the highest number of sub-
categories. Besides, Quality of Service is taken into account in Japan
context. It is worth noticing that CASBEE is the only rating system
 D.T. Doan et al. / Building and Environment 123 (2017) 243e260 255

Fig. 14. A comparison of new construction manuals regarding sub-categories.

having Earthquake Resistance sub-category to cope with the high
frequency of earthquake in Japan.
Despite the inuence of BREEAM, these rating systems pay
attention to different categories depending on their contexts.
However, Indoor Environment Quality and Material are the key
common categories among all with the highest number of sub-
categories.
All of the sub-categories were then analysed to categorize them
in sustainable pillars including Environment, Society, Economy, and
Institution, see Table 4. As aforementioned, the number of sub-
categories of LEED and Green Star NZ is much higher than those
of BREEAM. The gures for LEED and Green Star NZ are exactly the
same, with 68 sub-categories, while BREEAM and CASBEE share a
common in the total sub-categories, 53 and 51 respectively.
It is clear from Table 4 that some sub-categories fall into Pro-
cedural in which none of Environmental, Social, Economic, or Insti-
tutional factors is assessed. For example, some points can be
achieved if a project proves that accredited professional people
participate in the project for Green Star, or the integrated design
process is recognized and encouraged for BREEAM and LEED. While
CASBEE rewards levels for sufcient maintenance plans. Approxi-
mately 15% of total sub-categories of Green Star NZ are divided into
Procedural compared to BREEAM, LEED, and CASBEE with a rela-
tively low percentage. In other words, sub-categories of BREEAM,
LEED, and CASBEE are more sufciency regarding the green or
sustainable assessment in which more percentage of total sub-
categories is used to assess sustainable pillars.
Environment is the key factor on which all of the rating systems

Table 4
A comparison regarding sustainable aspects by sub-categories.

Sub-categories BREEAM (53) LEED (68) CASBEE (51) Green Star NZ(68) Average

Procedural Management z 4 Integrative Process 2 Quality of Service z 3 Management z 10 7.8%

Total z 7.5% Total z 2.9% Total z 5.9% Total z 14.7%
Environment Health &Wellbeing z 7 Location & Transportation z 3 Indoor Environment z 13 Management z 1 80.2%
Energy z 9 Sustainable Sites z 13 Energy z 7 Indoor Environment Quality z 13
Transport z 3 Water Efciency z 7 Resources & Material z 10 Energy z 11
Water z 4 Energy & Atmosphere z 11 Off-site Environment z 7 Transport z 4
Material z 4 Material & Resources z 10 Quality of Service z 6 Water z 2
Waste z 6 Indoor Environment Quality z 12 Total 84.3% Material z 9
Land Use & Ecology z 4 Total 82.4% Land Use & Ecology z 5
Pollution z 5 Emissions z 6
Total 79.3% Total 75.0%
Society Health & Wellbeing z 2 Location & Transportation z 5 Quality of Service z 1 Indoor Environment Quality z 1 9.2%
Transport z 3 Material & Resources z 2 On-site Environment z 4 Transport z 1
Total z 9.4% Regional Priority z 1 Total z 9.8% Material z 1
Total z 11.8% Emissions z 1
Total z 5.9%
Economy Management z 1 Total 0.0% Total 0.0% Total 0.0% 0.5%
Total z 1.9%
Extra Innovation 1 Innovation 2 Total 0.0% Innovation 3 2.3%
Total 1.9% Total 2.9% Total 4.4%
256 D.T. Doan et al. / Building and Environment 123 (2017) 243e260
focus. More than 75% of total sub-categories are adopted in any
rating systems, around 80% on average, to evaluate Environmental
factor. Energy, Material, and Indoor Environment Quality/Health &
Wellbeing; which are dominant in weighting coefcients, the
number of points, and the number of sub-categories; are all avail-
able under Environment. This conrms that Environment is the main
focus in the New Construction manuals.
Although Society has caught attention recently, the number of
sub-categories for Social assessment is still modest, with around
ve sub-categories on the average, accounting for approximately
9% of total sub-categories, for these four rating systems. BREEAM is
the only rating scheme considering economic aspects (2% one
sub-category). Except for CASBEE, the rest three ratings have extra
sub-categories for Innovation in which more points could be ach-
ieved. These sub-categories have not been classied in any sus-
tainable pillars. Innovation points could be gained once a project
achieves exceptional or innovative performances in which these
performances are not included or go beyond the requirement of the
credit criteria. Therefore, depending on the project stakeholders,
these sub-categories could be categorized as Environmental, Social,
Economic, or Institutional factors. Innovation could improve the
exibility and capability of rating systems.
It is noticeable that all the rating systems except for Green Star
NZ have similar gures for Procedural, Environment, and Society
despite the different local contexts which rating systems are
implemented. Besides, all these four schemes have failed to assess
the Institutional pillar while Economy is only mildly evaluated in
BREEAM. It could be validated that New Construction tools could be
only adopted to examine how green buildings are and they could
not be used for sustainable assessment.
5.4.2. Neighbourhood Development/Communities/Urban
Development manuals
Difference with New Construction tool assessing individual
buildings, Neighbourhood Development/Communities/Urban Devel-
opment tools have been released to evaluate how sustainable a
comprehensive area development project will be. Although CASBEE
was established much later than BREEAM and LEED, it is the rst
organization releasing this type of tool in 2006 compared to the
ones of BREEAM and LEED in 2009 (see Fig. 3). Till now, Green Star
NZ is still the only system which does not have a tool to evaluate a
group of buildings.
A breakdown of sub-categories regarding the sustainable pillars
was examined, see Table 5. LEED has the widest scope regarding the
Neighbourhood Development with 56 sub-categories, which is 15
Table 5
A comparison regarding sustainable aspects by sub-categories in neighbourhood development manuals.
Sub-categories BREEAM (41)
Environment Resources & Energy z 5
Land Use & Ecology z 3
Total 19.5%
Society Social & Economic Wellbeing z 14
Resources & Energy z 2
Land Use & Ecology z 3
Transport and Movement z 6
Total 61.0%
Economy Social and Economic Wellbeing z 3
Total 7.3%
Institution Governance z 4
Total 9.8%
Extra Innovation 1
Total 2.4%
and 27 higher than those of BREEAM and CASBEE respectively.
Compared to New Construction, none of the sub-categories falls into
Procedure which is unnecessary for sustainable assessment. As
shown in the names of the tools, Neighbourhood Development/
Communities/Urban Development, Society is the most promoted
pillar here. Over 60% of total sub-categories have been used to
assess social factors in BREEAM and LEED, which doubles the gure
for CASBEE.
Although Environment is not the main focus in these tools, a
considerable proportion of sub-categories has been still used to
assess the Environmental factors. LEED and CASBEE share the same
gure with almost a third of total sub-categories, which around 10%
higher than that of BREEAM. Urban Development marks the
impressive growth of CASBEE in Economic assessment. The Econ-
omy of a project could be assessed by over a third of sub-categories
of CASBEE, while the gures for both BREEAM and LEED are still
very modest. It is noticeable that CASBEE is almost equal not only in
the level or the important of each sub-category but also equal in the
proportions of total-sub-categories for Environmental, Social, and
Economic assessment. CASBEE could be seen as a balanced tool in
Urban Development assessment. BREEAM is one more time a leader
of sustainable assessment when it is the only tool could measure
four pillars of sustainability, with few aspects of the Institutional
pillar.
In comparison with New Construction, these tools have evolved
considerably to assess Social and Economic factors, 52.63% and
15.13% of total sub-categories respectively; however, it is still far
ahead for these tools to be seen as sustainable assessment ones. In
four pillars, only Environment and Society are paid much attention,
contributing around 80% of total sub-categories, while little
emphasis is placed for Economy and Institution. Limited knowledge
or the vague of the sustainable concept leads to the uncertainty of
the parameters in sustainable assessment could be a reason for this
unbalanced focus. Compared to the rest sustainable pillars, Envi-
ronment has been dened and analysed for a long time, thereby all
of the rating tools could assess the Environmental factors properly.
Society, the second appeared pillar, is known and analysed soon
after the Environment. This could be explained why Society is then
promoted in Neighbourhood Development/Communities/Urban
Development tools while Economy and Institution have still on the
way of the development.
6. Discussion
The comprehensive review of relevant papers provides strong
LEED (56) CASBEE (29) Average
Neighbourhood Pattern & Design z 1 Resource z 4 26.97%
Green Infrastructure & Buildings z 16 Nature z 4
Total 30.4% Artifact z 1
Total 31.0%
Smart Location & Linkage z 14 Impartiality/Fairness z 2 52.63%
Neighbourhood Pattern & Design z 15 Safety/Security z 4
Green Infrastructure & Buildings z 5 Amenity z 4
Regional Priority z 1 Total 34.5%
Total 62.4%
Neighbourhood Pattern & Design z 2 Trafc/Urban Structure z 4 15.13%
Total 3.6% Growth Potential z 3
Energy System z 3
Total 34.5%
Total 0.0% Total 0.0% 3.27%
Innovation 2 Total 0.0% 2%
Total 3.6%
 D.T. Doan et al. / Building and Environment 123 (2017) 243e260 257

evidence of the essence and the recognition of green rating systems
to the construction industry recently. BREEAM, LEED, CASBEE, and
Green Star NZ have been researched in 202 papers in eight journals
during 1998e2016, and a dramatic increase in the number of pa-
pers since the mid-2000s is noted. It is consistent with Eichholtz
[128]s statement in which the popular of green building has greatly
increased since 2000. The review conrms that BREEAM and LEED
are dominant regarding the breadth and a total number of papers
published compared to CASBEE and Green Star NZ during the
research period. This could indicate that BREEAM and LEED are
most widespread globally and more commonly used in comparison
to the other rating tools [129]. Also, the attraction of green rating
systems depends on their marketing as well as their transparency,
which was proved by the case of BREEM and LEED [130]. BREEAM
focuses on the European market in which the Green/Sustainability
denition seems to be more well-aware of than the other markets,
leading to the high number of certied projects. While LEED is
more transparency and easier to be certied than BREEAM which
promotes the popular of LEED globally based on the adoption of
countries.
To follow the sustainable trend of building development, New
Construction is continuously updated. More points, sub-categories,
and categories are added in the later versions to assess a project
more comprehensively, especially LEED with a double increase
toward the total points and an available of two more categories in
the version 4. In New Construction, all assessment ratings concen-
trated mainly on Environment while Society receives less attention.
Besides, only BREEAM has one sub-category considering Economic
aspects. Therefore, New Construction could be considered as a green
rating system rather than a sustainable rating system.
Due to the need to address issues in local contexts of individual
countries or regions, different rating systems have a different
emphasis. The categories of LEED and Green Star NZ are funda-
mentally similar with BREEAM while CASBEE could be seen as an
independent scheme in which their categories and sub-categories
are set up based on Japan's distinctive identity even though LEED,
CASBEE, and Green Star NZ are all inuenced by BREEAM. However,
Indoor Environment Quality/Health & Wellbeing, Energy, and Material
are the core categories in New Construction manuals in any ratings,
accounting for major points, mandatory credits, weightings, and
sub-categories. In other words, Indoor Environment Quality/Health &
Wellbeing, Energy, and Material are widely concerned and
international promoted. These are followed by Transport, Land Use
and Ecology.
Results in Neighbourhood Development/Communities/Urban
Development indicate that although these tools have developed
signicantly, their sub-categories have failed to address all aspects
of Economy and Institutional sustainability. While Environment and
Social are placed great importance, only few sub-categories are
established to measure the Economy of a project and solely BREEAM
takes Institutional dimension into account. Despite dramatic
evolving, Neighbourhood Development/Communities/Urban Devel-
opment could only assess two over four dimensions of sustain-
ability. This could be explained that Environmental and Social
dimensions were critically analysed leading to the details of their
factors in which these could be measured and evaluated. While it is
still struggling with precisely dening Economic and Institutional
pillars to have their factors fully assessed.
Greenwashing could be an issue when gaining enough points for
certication without addressing pertinent issues related to the
sustainability is the main focus of building owners [131,132]. To
prevent greenwashing action, mandatory credits have been intro-
duced. Except for CASBEE which does not use mandatory credits,
BREEAM, LEED, and Green Star NZ have seen an increase in the total
of those credits. However, LEED is the only rating system which
does not have reward points for mandatory credits. LEED should be
considered as a reference for the other rating schemes to follow in
mandatory credits. This is because it emphasizes the role of these
credits are not negotiable and have to be satised even though
achieving these credits could not positively affect the nal result.
After reviewing these four rating systems, their strengths and
weaknesses are summarized in Table 6. It is clear that each rating
system has its own strengths and weaknesses. LEED is popular with
the global adoption while CASBEE is well-known with its balanced
tools. It could be seen that BREEAM is currently leading in sus-
tainable assessment when it could assess more aspects in both New
Construction and Communities. Otherwise, Green Star NZ should
make more considerable efforts to have its tools more compre-
hensive in the sustainable assessment. The process of attaining
green certications or implementing environmental activities are
considered as time-consuming and high spending [133e138].
Therefore, entirely transparent processes with detailed guidance in
manuals along with case studies conrming that green certied
buildings are much less costly in the long term than non-certied

Table 6
Strengths and Weaknesses of rating systems (adapted from manuals in Table 3).

BREEAM LEED CASBEE Green Star NZ

Establishment Only non-prot third party Only non-prot third party Corporations of government, industry, and Only non-prot third
academia. party
Market Penetration Popular use in the European Global adoption Only in Japan (published a pilot version for Only in NZ
market international use)
Building's lifecycle assessment Design, Built, Operation and Design, Built, Operation and Design, Built, Operation and Refurbishment Design, Built, and
Refurbishment Refurbishment Refurbishment
Large-scale projects manual Communities manual Neighbourhood Development Urban Development manual, and City None
manual manual
Attraction Global researchers and Global researchers and Limit None
organizations organizations
Results calculation Moderation Transparency Complex Moderation
Mandatory credits Use Use None Limit
New Construction Environment Sufcient assessment Sufcient assessment Sufcient assessment Sufcient assessment
manual Society Limited assessment Limited assessment Limited assessment Limited assessment
Economy Limited assessment None None None
Institution None None None None
Communities/ Environment Sufcient assessment Sufcient assessment Sufcient assessment None
Neighbourhood Society Sufcient assessment Sufcient assessment Sufcient assessment None
Development/ Economy Limited assessment Limited assessment Sufcient assessment None
Urban Development Institution Limited assessment None None None
258 D.T. Doan et al. / Building and Environment 123 (2017) 243e260
ones should be provided.
7. Conclusion
All of the building rating systems have evolved over the years
and have been updated to become more demanding in line with
technological advances. This paper aims to develop a systematic
review of the development of green rating systems focusing on four
well-known rating systems, namely BREEAM, LEED, CASBEE, and
Green Star NZ to 1) discover how interest and research in green
rating systems have developed; 2) identify the similarity, differ-
ence, strength and weakness of green rating systems; 3) examine
whether they fully assess the projects in all aspects of sustainability.
The results indicate that green rating systems have become the
focus point of various researchers recently. Since 1998, 408 papers
mentioned BREEAM, LEED, or CASBEE in E&B, B&E, A&C, BR&I,
SBT&UD, CP, EIAR, R&SER while 202 of these papers focused on
these ratings with a more in-depth approach. During the research
period of 1998e2016, the number of green rating related papers
rises sharply from only 2 to 36 on an annual basis. BREEAM is the
rst released green rating system in the world which certied
approximately 560,000 buildings, but LEED is seen as the most
exible tool used in 160 countries and territories. In addition, there
are a signicantly higher number of papers discussing LEED
compared to BREEAM concerning the eight main journal sources
for this research since 1998. While the CASBEE and Green Star NZ
related research papers are still limited. Green or sustainable
building assessment is a global concern in both developed and
developing countries. USA, Canada, the UK, China, and Australia
have contributed up to approximately 70% of the total papers while
Turkey, India, Brazil, and Malaysia are prominently considering
green rating systems in their research schemes.
The similarity, difference, strength, and weakness of green rat-
ing systems were also identied based on the research manuals.
The total categories, sub-categories, points, and mandatory credits
tend to increase and more comprehensive in order to completely
assess the sustainability of a project. LEED is the particular scheme
in which the total points and mandatory credits were double in the
version 4 since the version 2 besides the addition of two more
categories. BREEAM is considered as the strongest rating system in
which Environment and Society are carefully assessed along with
the consideration in Economy and Institution. The weakest system
could be Green Star NZ when it could only focus on one pillar of the
sustainability, Environment. While Society is critically evaluated by
LEED; and CASBEE is a well-balanced tool in Environment, Society,
and Economy assessment. However, no rating scheme could assess a
project in all aspects of sustainability.
This paper could be valuable for both green practitioners and
researchers to have an overall understanding of BREEAM, LEED,
CASBEE and Green Star NZ. Categories, points, and mandatory
credits were discussed in details to pinpoint the current status/
tendency of the green building rating systems. In addition,
strengths and weaknesses of each rating system were also ana-
lysed. Besides, the difference between New Construction and
Neighbourhood Development/Communities/Urban Development were
also examined to identify which sustainable pillars could be
assessed by these tools.
It is recommended to include Economic and Institutional factors
as supplementary assessment criteria and manuals for green
building rating systems for a more comprehensive and through
review of the project. Further research is needed to validate the
impacts of adding Economic and Institutional factors to current
green building certication systems.
To provide a better background knowledge of green rating
systems, Interior Design, Building Operation and other manuals
should be examined, but this research was only considered two
main manuals, New Construction and Neighbourhood Development
manuals. In addition, only recently CASBEE's manuals were ana-
lysed because the previous ones are not in English. Furthermore,
the examination in the four selected rating schemes may not reect
the overall trend of hundreds of schemes worldwide. These could
be the limitations of this research.
Acknowledgement
This paper is a signicant upgrade to the paper Green Building
Assessment Schemes: A critical comparison among BREEAM, LEED,
and Green Star NZ presented at the International Conference on
Sustainable Building Asia in South Korea on 11e14 December 2016.
This research has been supported with Vice Chancellor Doctoral
Scholarship by Auckland University of Technology, New Zealand.
References
[1] C. Tam, V.W. Tam, W. Tsui, Green construction assessment for environmental
management in the construction industry of Hong Kong, Int. J. Proj. Manag.
22 (2004) 563e571.
[2] I. Abdul Rahman, A.H. Memon, A. Karim, A. Tarmizi, Signicant factors
causing cost overruns in large construction projects in Malaysia, J. Appl. Sci.
13 (2013) 286e293.
[3] M. Kucukvar, O. Tatari, Towards a triple bottom-line sustainability assess-
ment of the US construction industry, Int. J. Life Cycle Assess. 18 (2013)
958e972.
[4] M. Chowdhury, A. Upadhyay, A. Briggs, M. Belal, An Empirical Analysis of
Green Supply Chain Management Practices in Bangladesh Construction In-
dustry, 2016.
[5] Z. Alwan, P. Jones, P. Holgate, Strategic sustainable development in the UK
construction industry, through the framework for strategic sustainable
development, using Building Information Modelling, J. Clean. Prod. 140 (Part
1) (2017) 349e358.
[6] V. Osei, The construction industry and its linkages to the Ghanaian economy-
polices to improve the sector's performance, Int. J. Dev. Econ. Sustain. 1
(2013) 56e72.
[7] J.K.-W. Wong, K.-L. Kuan, Implementing BEAM Plus for BIM-based sus-
tainability analysis, Automation Constr. 44 (2014) 163e175.
[8] A. Stadel, J. Eboli, A. Ryberg, J. Mitchell, S. Spatari, Intelligent sustainable
design: integration of carbon accounting and Building Information Modeling,
J. Prof. issues Eng. Educ. Pract. 137 (2011) 51e54.
[9] J.K. Wong, H. Li, H. Wang, T. Huang, E. Luo, V. Li, Toward low-carbon con-
struction processes: the visualisation of predicted emission via virtual pro-
totyping technology, Automation Constr. 33 (2013) 72e78.
[10] J.K.W. Wong, J. Zhou, Enhancing environmental sustainability over building
life cycles through green BIM: a review, Automation Constr. 57 (2015)
156e165.
[11] N. Wang, The role of the construction industry in China's sustainable urban
development, Habitat Int. 44 (2014) 442e450.
[12] R.S. Srinivasan, W. Ingwersen, C. Trucco, R. Ries, D. Campbell, Comparison of
energy-based indicators used in life cycle assessment tools for buildings,
Build. Environ. 79 (2014) 138e151.
[13] A. Invidiata, E. Ghisi, Life-cycle energy and cost analyses of window shading
used to improve the thermal performance of houses, J. Clean. Prod. 133
(2016) 1371e1383.
[14] S. Bansal, S. Singh, A sustainable approach towards the construction and
demolition waste, Int. J. Innovative Res. Sci. Eng. Technol. 3 (2014)
1262e1269.
[15] P. Rode, R. Burdett, J.C. Soares Gonalves, Buildings: Investing in Energy and
Resource Efciency, 2011.
[16] M. Yeheyis, K. Hewage, M.S. Alam, C. Eskicioglu, R. Sadiq, An overview of
construction and demolition waste management in Canada: a lifecycle
analysis approach to sustainability, Clean Technol. Environ. Policy 15 (2013)
81e91.
[17] M.K. Dixit, C.H. Culp, J.L. Fern
andez-Sols, System boundary for embodied
energy in buildings: a conceptual model for denition, Renew. Sustain. En-
ergy Rev. 21 (2013) 153e164.
[18] N. Udawatta, J. Zuo, K. Chiveralls, G. Zillante, Attitudinal and behavioural
approaches to improving waste management on construction projects in
Australia: benets and limitations, Int. J. Constr. Manag. 15 (2015) 137e147.
[19] B.M. Taylor, Sustainability and performance measurement: corporate real
estate perspectives, Perform. Improv. 52 (2013) 36e45.
[20] M. Ylmaz, A. Baks, Sustainability in construction sector, Procedia-Social
Behav. Sci. 195 (2015) 2253e2262.
[21] D. Miller, J.-H. Doh, K. Panuwatwanich, N. van Oers, The contribution of
structural design to green building rating systems: an industry perspective
and comparison of life cycle energy considerations, Sustain. Cities Soc. 16
 D.T. Doan et al. / Building and Environment 123 (2017) 243e260
(2015) 39e48.
[22] C. Baek, S.-H. Park, M. Suzuki, S.-H. Lee, Life cycle carbon dioxide assessment
tool for buildings in the schematic design phase, Energy Build. 61 (2013)
275e287.
[23] M.K. Dixit, J.L. Fern
andez-Sols, S. Lavy, C.H. Culp, Need for an embodied
energy measurement protocol for buildings: a review paper, Renew. Sustain.
Energy Rev. 16 (2012) 3730e3743.
[24] A. Stephan, R.H. Crawford, K. De Myttenaere, Towards a more holistic
approach to reducing the energy demand of dwellings, Procedia Eng. 21
(2011) 1033e1041.
[25] T. Blankendaal, P. Schuur, H. Voordijk, Reducing the environmental impact of
concrete and asphalt: a scenario approach, J. Clean. Prod. 66 (2014) 27e36.
[26] J.A. Lorenzen, Going Green: the process of lifestyle change 1, in: Sociological
Forum, Wiley Online Library, 2012, pp. 94e116.
[27] S. Azhar, W.A. Carlton, D. Olsen, I. Ahmad, Building Information Modeling for
sustainable design and LEED rating analysis, Automation Constr. 20 (2011)
217e224.
[28] T. Biswas, Wang Tsung-Hsien, R. Krishnamurti, Integrating Sustainable
Building Rating Systems with Building Information Models, 2008.
[29] F. Jalaei, A. Jrade, Integrating Building Information Modeling (BIM) and LEED
system at the conceptual design stage of sustainable buildings, Sustain. Cities
Soc. 18 (2015) 95e107.
[30] S.-M. Yu, Y. Tu, Are Green Buildings Worth More Because They Cost More,
2011. NUS Institute of Real Estate Studies working paper (IRES2011eR2023).
[31] S. Vierra, Green Building Standards and Certication Systems, Steven Winter
Associates, Inc, Washington DC, 2011.
[32] S.H. Alyami, Y. Rezgui, Sustainable building assessment tool development
approach, Sustain. Cities Soc. 5 (2012) 52e62.
[33] W. Lee, A comprehensive review of metrics of building environmental
assessment schemes, Energy Build. 62 (2013) 403e413.
[34] L.M. Mitchell, Green Star and NABERS: learning from the Australian expe-
rience with green building rating tools, Energy Efc. (2010) 93.
[35] J. Vimpari, S. Junnila, Value inuencing mechanism of green certicates in
the discounted cash ow valuation, Int. J. Strategic Prop. Manag. 18 (2014)
238e252.
[36] D.E. Shiers, Green developments: environmentally responsible buildings in
the UK commercial property sector, Prop. Manag. 18 (2000) 352e365.
[37] C. Turner, M. Frankel, Energy performance of LEED for new construction
buildings, New Build. Inst. 4 (2008) 1e42.
[38] G.R. Newsham, S. Mancini, B.J. Birt, Do LEED-certied buildings save energy?
Yes, but, Energy Build. 41 (2009) 897e905.
[39] J.H. Scoeld, Efcacy of LEED-certication in reducing energy consumption
and greenhouse gas emission for large New York City ofce buildings, Energy
Build. 67 (2013) 517e524.
[40] T. Runde, S. Thoyre, Integrating sustainability and green building into the
appraisal process, J. Sustain. Real Estate 2 (2010) 221e248.
[41] U. Berardi, Clarifying the new interpretations of the concept of sustainable
building, Sustain. Cities Soc. 8 (2013) 72e78.
[42] LEED, LEED Homepage, 2017. Retrieved 10 February 2017, http://www.
usgbc.org/leed.
[43] BREEAM, BREEAM Homepage, 2017. Retrieved 10 February 2017, http://
www.breeam.com/.
[44] Australia GS, Green Star Australia Homepage, 2017. Retrieved 10 February
2017, http://new.gbca.org.au/green-star/.
[45] NZ GS, Green Star NZ Homepage, 2017. Retrieved 10 February 2017, https://
www.nzgbc.org.nz/Category?ActionView&Category_id217.
[46] ISO, ISO/TC 59/SC 17, 2002. Retrieved 01 May 2017, https://www.iso.org/
committee/322621.html.
[47] J.A. Todd, C. Pyke, R. Tufts, Implications of trends in LEED usage: rating
system design and market transformation, Build. Res. Inf. 41 (2013)
384e400.
[48] S. Murakami, S. Kawakubo, Y. Asami, T. Ikaga, N. Yamaguchi, S. Kaburagi,
Development of a comprehensive city assessment tool: CASBEE-City, Build.
Res. Inf. 39 (2011) 195e210.
[49] J.C. Cheng, L.J. Ma, A data-driven study of important climate factors on the
achievement of LEED-EB credits, Build. Environ. 90 (2015) 232e244.
[50] W. Lee, J. Burnett, Benchmarking energy use assessment of HK-BEAM,
BREEAM and LEED, Build. Environ. 43 (2008) 1882e1891.
[52] S.T. Ng, Y. Chen, J.M. Wong, Variability of building environmental assessment
tools on evaluating carbon emissions, Environ. impact Assess. Rev. 38 (2013)
131e141.
[53] T. Hakkinen, Sustainability and Performance Assessment and Benchmarking
of Buildings-Final Report, VTT, Espoo, 2012.
[54] D. Collins, A. Junghans, T. Haugen, Green leasing in theory and practice: a
study focusing on the drivers and barriers for owners and tenants of com-
mercial ofces, Creating built Environ. new Oppor. 1 (2016) 419.
[55] C. Ciampa, U. Hartenberger, Going for Green, Professional Group Sustain-
ability RICS Deutschland, German, 2012.
[56] E. Soulti, D. Leonard, The Value of BREEAM: a Review of Latest Thinking in
the Commercial Building Sector, Building Research Establishment Ltd, Wat-
ford, United Kingdom, 2016.
[57] E.J. Yanarella, R.S. Levine, R.W. Lancaster, Research and solutions:" Green" vs.
Sustainability: from semantics to enlightenment, Sustain. J. Rec. 2 (2009)
296e302.
[58] R.J. Cole, Shared markets: coexisting building environmental assessment
259
methods, Build. Res. Inf. 34 (2006) 357e371.
[59] R.J. Cole, Environmental performance of buildings: setting goals, offering
guidance, and assessing progress, Reshaping Built Environ. Ecol. Ethics, Econ.
(1999) 276.
[60] Z. Shari, V. Soebarto, Green vs. Sustainability performance assessment: a case
study of an ofce building in Putrajaya, Malaysia, in: 28th PLEA Conference:
Opportunities, Limits and Needs - towards an Environmentally Responsibile
Architecture, 2012. Lima, Peru.
[61] H. Kua, S. Lee, Demonstration intelligent buildingda methodology for the
promotion of total sustainability in the built environment, Build. Environ. 37
(2002) 231e240.
[62] J. Yoshida, A. Sugiura, Which greenness Is Valued? Evidence from Green
Condominiums in Tokyo, 2010.
[63] A.J. Hoffman, R. Henn, Overcoming the social and psychological barriers to
green building, Organ. Environ. 21 (2008) 390e419.
[64] J.C. Howe, Overview of green buildings, Natl. Wetl. Newsl. 33 (2010) 3e14.
[65] Y. Li, W. Yu, B. Li, R. Yao, A multidimensional model for green building
assessment: a case study of a highest-rated project in Chongqing, Energy
Build. 125 (2016) 231e243.
[66] A. Haapio, P. Viitaniemi, A critical review of building environmental
assessment tools, Environ. Impact Assess. Rev. 28 (2008) 469e482.
[67] C.J. Kibert, Sustainable Construction: Green Building Design and Delivery,
John Wiley & Sons, 2016.
[68] R. Buter, A. Van Raan, Identication and analysis of the highly cited knowl-
edge base of sustainability science, Sustain. Sci. 8 (2013) 253e267.
[69] A. Komeily, R.S. Srinivasan, A need for balanced approach to neighborhood
sustainability assessments: a critical review and analysis, Sustain. Cities Soc.
18 (2015) 32e43.
[70] WCED, Our Common Future, Oxford University Press, New York, 1987.
[71] D. Lorenz, T. Ltzkendorf, Sustainability in property valuation: theory and
practice, J. Prop. Invest. Financ. 26 (2008) 482e521.
[72] F. Berkes, C. Folke, J. Colding, Linking Social and Ecological Systems: Man-
agement Practices and Social Mechanisms for Building Resilience, Cambridge
University Press, 2000.
[73] M.J. Epstein, A.R. Buhovac, Making Sustainability Work: Best Practices in
Managing and Measuring Corporate Social, Environmental, and Economic
Impacts, Berrett-Koehler Publishers, 2014.
[74] J. Pope, D. Annandale, A. Morrison-Saunders, Conceptualising sustainability
assessment, Environ. impact Assess. Rev. 24 (2004) 595e616.
[75] B. Littig, E. Grieler, Social sustainability: a catchword between political
pragmatism and social theory, Int. J. Sustain. Dev. 8 (2005) 65e79.
[76] L. Lebel, N.H. Tri, A. Saengnoree, S. Pasong, U. Buatama, L.K. Thoa, Industrial
transformation and shrimp aquaculture in Thailand and Vietnam: pathways
to ecological, social, and economic sustainability? AMBIO A J. Hum. Environ.
31 (2002) 311e323.
[77] C.T. Boyko, R. Cooper, C.L. Davey, A.B. Wootton, Addressing sustainability
early in the urban design process, Manag. Environ. Qual. An Int. J. 17 (2006)
689e706.
[78] A. Shari, A. Murayama, Neighborhood sustainability assessment in action:
cross-evaluation of three assessment systems and their cases from the US,
the UK, and Japan, Build. Environ. 72 (2014) 243e258.
[79] D.V. Hunt, D.R. Lombardi, C.D. Rogers, I. Jefferson, Application of sustain-
ability indicators in decision-making processes for urban regeneration pro-
jects, in: Proceedings of the Institution of Civil Engineers - Engineering
Sustainability, vol. 161, 2008, pp. 77e91.
[80] A. Valentin, J.H. Spangenberg, A guide to community sustainability in-
dicators, Environ. Impact Assess. Rev. 20 (2000) 381e392.
[81] R.F.M. Ameen, M. Mourshed, H. Li, A critical review of environmental
assessment tools for sustainable urban design, Environ. Impact Assess. Rev.
55 (2015) 110e125.
[82] J.H. Spangenberg, Institutional sustainability indicators: an analysis of the
institutions in Agenda 21 and a draft set of indicators for monitoring their
effectivity, Sustain. Dev. 10 (2002) 103e115.
[83] J.H. Spangenberg, Environmental space and the prism of sustainability:
frameworks for indicators measuring sustainable development, Ecol. Indic. 2
(2002) 295e309.
[84] A. Bond, A. Morrison-Saunders, J. Pope, Sustainability assessment: the state
of the art, Impact Assess. Proj. Apprais. 30 (2012) 53e62.
[85] L. Bourdeau, P. Huovila, R. Lanting, A. Gilham, Sustainable Development and
the Future of Construction: a Comparison of Visions from Various Countries,
1998.
[86] J. Wangel, M. Wallhagen, T. Malmqvist, G. Finnveden, Certication systems
for sustainable neighbourhoods: what do they really certify? Environ. impact
Assess. Rev. 56 (2016) 200e213.
[87] A.D.U.P. Council, The Pearl Rating System for Estidama Building Rating Sys-
tem: Design & Construction (Version 1.0), 2010. Abu Dhabi, UAE.
[88] U. Cities, L. Governments, Culture: Fourth Pillar of Sustainable Development.
United Cities and Local Governments (UCLG) Policy Statement, 2010.
[89] M. Redclift, The multiple dimensions of sustainable development, Geography
(1991) 36e42.
[90] X. Chen, H. Yang, L. Lu, A comprehensive review on passive design ap-
proaches in green building rating tools, Renew. Sustain. Energy Rev. 50
(2015) 1425e1436.
[91] G. Marjaba, S. Chidiac, Sustainability and resiliency metrics for buildingse-
Critical review, Build. Environ. 101 (2016) 116e125.
260 D.T. Doan et al. / Building and Environment 123 (2017) 243e260
[92] C.A. Poveda, R. Young, Potential benets of developing and implementing
environmental and sustainability rating systems: making the case for the
need of diversication, Int. J. Sustain. Built Environ. 4 (2015) 1e11.
[93] X. Qin, Y. Mo, L. Jing, Risk perceptions of the life-cycle of green buildings in
China, J. Clean. Prod. 126 (2016) 148e158.
[94] C. Ward, A. Yates, V. Brown, Assessing the Performance of Sustainable
Buildings in China: Synergies between BREEAM and the Chinese Assessment
Standard for Green Building (Three Star), Building Research Establishment
Ltd, Watford, United Kingdom, 2017.
[95] E. Soulti, D. Leonard, The Value of BREEAM. Watford, United Kindom,
Building Research Establishment Ltd, 2016.
[96] X. Mao, H. Lu, Q. Li, A Comparison Study of Mainstream Sustainable/green
Building Rating Tools in the World. Management and Service Science
(MASS'09), IEEE, 2009, pp. 1e5.
[97] C. Egbu, M. Arif, M. Syal, V. Potbhare, M. Syal, M. Arif, et al., Emergence of
green building guidelines in developed countries and their impact on India,
J. Eng. Des. Technol. 7 (2009) 99e121.
[98] A. Tinker, R. Burt, Greening the construction curriculum, Int. J. Constr. Educ.
Res. 1 (2004) 26e33.
[99] Y.S. Lee, S.-K. Kim, Indoor environmental quality in LEED-certied buildings
in the US, J. Asian Archit. Build. Eng. 7 (2008) 293e300.
[100] A. Ofori-Boadu, D.-G. Owusu-Manu, D. Edwards, G. Holt, Exploration of
management practices for LEED projects: lessons from successful green
building contractors, Struct. Surv. 30 (2012) 145e162.
[101] M.J. Trowbridge, K. Worden, C. Pyke, Using green building as a model for
making health promotion standard in the built environment, Health Aff. 35
(2016) 2062e2067.
[102] K. Kokame, More than Just a Glass Face: what Makes a" Green" or" Sus-
tainable" Building, Exactly?, 2017.
[103] S. Altomonte, S. Schiavon, Occupant satisfaction in LEED and non-LEED
certied buildings, Build. Environ. 68 (2013) 66e76.
[104] R.J. Cole, M. Jose Valdebenito, The importation of building environmental
certication systems: international usages of BREEAM and LEED, Build. Res.
Inf. 41 (2013) 662e676.
[105] CASBEE, CASBEE Homepage, 2017. Retrieved 15 April 2017, http://www.ibec.
or.jp/CASBEE/english/.
[106] A. Haapio, Towards sustainable urban communities, Environ. Impact Assess.
Rev. 32 (2012) 165e169.
[107] NZGBC, Green Star Practitioner Course, 2016. Auckland, New Zealand.
[108] LEED, LEED Update, 2017. Retrieved 10 February 2017, http://www.usgbc.
org/resources/leed-v4-building-design-and-construction-current-version.
[109] M. Han, G. Chen, L. Shao, J. Li, A. Alsaedi, B. Ahmad, et al., Embodied energy
consumption of building construction engineering: case study in E-town,
Beijing, Energy Build. 64 (2013) 62e72.
[110] U. EIA, Energy Information Administration international Energy Outlook,
2010 report DOE/EIA-0484.
[111] F. Abanda, L. Byers, An investigation of the impact of building orientation on
energy consumption in a domestic building using emerging BIM (Building
Information Modelling), Energy 97 (2016) 517e527.
[112] M. Aksoezen, M. Daniel, U. Hassler, N. Kohler, Building age as an indicator for
energy consumption, Energy Build. 87 (2015) 74e86.
[113] P. Joseph, S. Tretsiakova-McNally, Sustainable non-metallic building mate-
rials, Sustainability 2 (2010) 400e427.
[114] M. Attom, F. Abed, M. Elemam, M. Nazal, N. ElMessalami, The effect of
treated waste-water on compaction and aompression of ne soil. World
Academy of Science, Engineering and Technology, Int. J. Civ. Environ. Struct.
Constr. Archit. Eng. 10 (2016) 1088e1092.
[115] A. Gupta, A. Kumar, Composites materials: addressing the climate change,
Asia Pac. Bus. Rev. 6 (2010) 78e89.
[116] NZGBC, Green Star Technical Manual v3.1, 2016. Retrieved 27 April 2017,
https://www.nzgbc.org.nz/Attachment?ActionDownload&Attachment_
id694.
[117] BREEAM, BREEAM International New Construction 2016, BRE Global Ltd,
2016.
[118] L. Schweber, The effect of BREEAM on clients and construction professionals,
Build. Res. Inf. 41 (2013) 129e145.
[119] E.B. Hupp, Recent trend in green buildings laws: potential preemption of
green building and whether retrotting existing buildings will reduce
greenhouse gases and save the economy, Urban Lawyer (2009) 489e499.
[120] S.-N. Boemi, O. Irulegi, M. Santamouris, Energy Performance of Buildings:
Energy Efciency and Built Environment in Temperate Climates, Springer,
2015.
[121] A. Guz, J. Rushchitsky, Scopus: a system for the evaluation of scientic
journals, Int. Appl. Mech. 45 (2009) 351.
[122] A. Aghaei Chadegani, H. Salehi, M.M. Yunus, H. Farhadi, M. Fooladi,
M. Farhadi, et al., A Comparison between Two Main Academic Literature
Collections: Web of Science and Scopus Databases, 2013.
[123] BREEAM, BREEAM Communities 2012, BRE Global Ltd, 2012.
[124] A. Darko, A.P.C. Chan, Critical analysis of green building research trend in
construction journals, Habitat Int. 57 (2016) 53e63.
[125] S.G. Little, Graduate education of the top contributors to the school psy-
chology literature: 1987-1995, Sch. Psychol. Int. 18 (1997) 15e27.
[126] H. Yuan, L. Shen, Trend of the research on construction and demolition waste
management, Waste Manag. 31 (2011) 670e679.
[127] D. Gibson, Awash in green: a critical perspective on environmental adver-
tising, Tul. Envtl LJ 22 (2008) 423.
[128] P. Eichholtz, N. Kok, J.M. Quigley, The economics of green building, Rev. Econ.
Stat. 95 (2013) 50e63.
[129] S. Heeg, N. Bitterer, Communities of practice and transnational standards:
changing building practices in Warsaw's commercial property sector, Glob.
Netw. 15 (2015) 343e359.
[130] A. Seintou, A Comparison of LEED and BREEAM Green Building Assessment
Tools and Their Relevance for Greece, 2015.
[131] R.A. Fenner, T. Ryce, A comparative analysis of two building rating systems,
Part 1 Eval. Eng. Sustain. 161 (2008) 55.
[132] Y.J. Siew R, C.A. Balatbat M, G. Carmichael D, A review of building/infra-
structure sustainability reporting tools (SRTs), Smart Sustain. Built Environ. 2
(2013) 106e139.
[133] D. Crawley, I. Aho, Building environmental assessment methods: applica-
tions and development trends, Build. Res. Inf. 27 (1999) 300e308.
[134] R. Lowton, Construction and the Natural Environment, Butterworth-Heine-
mann Oxford, 1997.
[135] G.K. Ding, Sustainable constructiondthe role of environmental assessment
tools, J. Environ. Manag. 86 (2008) 451e464.
[136] S. Liyin, Y. Hong, A. Grifth, Improving environmental performance by
means of empowerment of contractors, Manag. Environ. Qual. Int. J. 17
(2006) 242e257.
[137] J.A. Wiley, J.D. Beneeld, K.H. Johnson, Green design and the market for
commercial ofce space, J. Real Estate Financ. Econ. 41 (2010) 228e243.
[138] S. Tucker, M. Ambrose, D. Johnston, P. Newton, S. Seo, D. Jones, Lcadesign: an
Integrated Approach to Automatic Eco-efciency Assessment of Commercial
Buildings, 2003.
 Resources, Conservation & Recycling 127 (2017) 820

Contents lists available at ScienceDirect

Resources, Conservation & Recycling

journal homepage: www.elsevier.com/locate/resconrec

Full length article

Will green building development take o? An exploratory study of barriers MARK

to green building in Vietnam

Hong-Trang Nguyena, , Martin Skitmorea, Matthew Graya, Xiaoling Zhangb,
Ayokunle Olubunmi Olanipekuna
a
School of Civil Engineering & Built Environment, Science and Engineering Faculty, Queensland University of Technology (QUT), Gardens Point Campus, Brisbane, 4001,
Australia
b
Department of Public Policy, Urban Research Group, City University of Hong Kong, Tat Chee Avenue, Kowloon, Hong Kong, China

A R T I C L E I N F O A B S T R A C T

Keywords: Green building (GB) is one of the most eective solutions to increase the eciency of buildings through resource
Green building utilisation and recycling, mitigating the negative impact of the construction industry on the environment. As a
Vietnam construction innovation, GB has faced numerous challenges to its penetration into a market crowded with
Barriers conventional buildings. Studies of GB barriers have been conducted around the world, including the United
Factor analysis
States, Europe, Australia and Asia, but they are scarce in Vietnam and limited to individual perspectives.
Exploratory ndings
This paper identies 41 barriers to GB in Vietnam from the literature and validates them by a survey of 215
construction professionals and government ocers. Principal Component Analysis in Exploratory Factor
Analysis is used to reveal that, while legislative and institutional barriers are widely perceived as the most
challenging obstacles, social and cognitive barriers as a whole represent the main hindrances involved. Final
remarks include policy recommendations for GB adoption in Vietnam and suggestions for further research.

1. Introduction
Vietnams rapid economic growth has adversely aected its infra-
structure and the environment. The increasing demand for buildings,
growing population and over-urbanisation, predicted insecurity of en-
ergy supply, and environmentally detrimental and negative impacts of
climate change are creating the need for a more sustainable built en-
vironment (Nguyen and Gray, 2016). Buildings, in general, consume
more than 30% of total global nal energy use (Berardi, 2017) and a
large amount of raw materials, such as 70% of timber globally (Sev,
2009; Thilakaratne and Lew, 2011). Conventional buildings also add to
environment pollution by generating a signicant amount of waste
during their lifecycle (Chau et al., 2010; Li et al., 2016).
Green building (GB) emerged from the green movement around
1970s-1980s as a solution to meet building demand while reducing the
construction industrys energy consumption (Retzla, 2010). Studies
have shown that the greening technologies and design applied in GB
can increase the eciency of buildings by up to ten times in terms of
resource utilisation (Green building: project planning & cost estimating,
2011). Compared to average conventional buildings, certied GBs in
Australia and New Zealand emit only 1/3 greenhouse gases, consume
1/3 electricity and potable water, and recycle almost 96% of
demolition waste (BCI Economics, 2014). In this study, GBs are dened
as those embracing the principles of lower environmental impact
through greater energy eciency, lower energy demand, reduced water
usage, improved indoor quality and minimising construction waste
(OLeary, 2008 as cited in Yang and Yang, 2009).
It is argued by a number of construction professionals and GB ex-
perts in Vietnam that the adoption of GB in the building market is slow
and still in its infancy (Le, 2008; Pham, 2015; Solidiance & VGBC,
August 2013). GB adoption faces numerous barriers against its progress
to nd a niche or be in the mainstream market (as referred in the fol-
lowing section). After the rst certied building dating back to 2010,
GBs can now be seen in large urban areas throughout Vietnam, mainly
in two metropolitan cities Hanoi and Ho Chi Minh City as several
demonstration projects of large corporations (Solidiance & VGBC,
August 2013). In 2013, there were 41 certied and registered GB pro-
jects with 7 dierent rating systems (see Appendix A), among which,
the Leadership in Energy and Environmental Design (LEED) Green
Building Rating System and LOTUS a set of market-based green
building rating tools developed by the Vietnam Green Building Council
(VGBC) are the two primary GB certication tools
(Solidiance & VGBC, August 2013). Updated data obtained from the
U.S. Green Building Council (USGBC), VGBC and the International

Corresponding author.
E-mail address: hongtrang.nguyen@hdr.qut.edu.au (H.-T. Nguyen).

http://dx.doi.org/10.1016/j.resconrec.2017.08.012
Received 14 May 2017; Received in revised form 12 August 2017; Accepted 12 August 2017
Available online 24 August 2017
0921-3449/ 2017 Elsevier B.V. All rights reserved.
H.-T. Nguyen et al.
Finance Corporation (IFC)-World bank group shows the existence of
121 GB projects in Vietnam up to 2017, including 84 LEED, 27 LOTUS
and 11 IFC EDGE green building certication system projects. Fig. 1
presents the total number of GB projects, mainly design as-built. From
20102016, there have been only 46 certied projects with rating tools
applied (Fig. 2). The statistic demonstrates a stronger trend towards
international certication (LEED and EDGE); however, the localised
tool (LOTUS) is currently attracting more attention. In comparing LEED
and LOTUS, Solidiance & VGBC (August 2013) point out that the former
is more recognised while the latter is more applied and costs less.
2. Literature review
The literature review comprises a review of the barriers to GB in
dierent contexts and government interventions as part of measures to
promote GB projects.
2.1. Barriers to GB projects in developed, developing markets and in
Vietnam
The small number of GB projects each year and in total are reected
by point A in Appendix B, indicating the slow progress of GB adoption.
This graph is also used by Homan and Henn (2008) to demonstrate GB
adoption in the U.S. in 2008, when there were approximately 1000
LEED certied buildings, comparing to approximately 106,000 current
listed LEED projects on the USGBC website. Diusion of innovation
theory (Meade and Islam, 2006) and barrier to entry theory can ex-
plain the slow progress in GB adoption. As GB the concept is still
considered an innovation (Potbhare et al., 2009), it will take con-
siderable time and eort to increase the number of initial and early
adopters (Appendix C), while barriers to entry are factors that make it
9
Resources, Conservation & Recycling 127 (2017) 820
Fig. 1. Total number of GB projects categorised by rating tools.
Fig. 2. Certied GB projects from 2010 to 2016 categorised by rating
tools.
impossible or unprotable for a company to try to start selling its
products in a particular market (Evans, 2006).
The many barriers and challenges hindering GB adoption have been
well documented by numerous studies in the green construction eld. A
review of related publications including general GB, sustainable
housing (SH), green oce and energy ecient building (EEB) iden-
ties 41 key GB barriers in dierent markets, as summarised in
Appendix D. The existing literature is also clustered into developed,
developing markets and Vietnam to identify the similarities and dif-
ferences between the challenges to adopting GB in dierent levels of
market maturity and economic development.1
In terms of developed markets, Yang and Yang (2015) classify the
barriers to sustainable housing in Australia into technical and design
factors, economic factors, socio-cultural factors and institutional factors
in reference to Spangenbergs (2002) sustainability prism. The study
identies economic factors as the most signicant, followed by in-
stitutional factors. This conrms that the housing industry in Australia
prioritises economic benets over other softer values and that there is
considerable concern over the inecient policy-making mechanism
involved. Similar barriers are recognised in the U.S. by Mulligan et al.
(2014), who state that GB costs are the most frequently reported barrier
and that the low awareness of incentive policies is resulting in industry
players being less likely to adopt GB. GB projects in Singapore are
highly likely to be associated with more risks, including those common
to constructions projects and those closely related to green construc-
tion, such as the Use of new construction methods and technology
and Unclear requirements of clients (Zhao et al., 2016). Yau
(2012a,b), through studies in Hong Kong, stresses the information
1
Developed markets include Australia, New Zealand, United States, Singapore and
Hong Kong, while developing markets include India, South East Asia, Malaysia and China.
H.-T. Nguyen et al.
asymmetry between sellers and buyers around the environmental per-
formance of green housing, where buyers are not fully aware of the
operational benets. Without a clear signal, such as eco-labelling, to
reveal the hidden benets, the consumers will be less likely to pay more
for green housing discouraging green housing developers.
Regarding studies in developing market, Zhang et al. (2011a) reveal
that nancial considerations are the biggest barriers, while lack of
motivation, lack of economic incentives and weak enforcement of leg-
islation are also major obstacles to adopting GB in China (Shen et al.,
2017). Isa et al. (2013) also argue that the high economic risks asso-
ciated with GB investment and inadequate studies of the cost-benets
involved are the main hindrances to GB in Malaysia. Lack of education
and limited GB examples also highly inuence GB adoption (Isa et al.,
2013).
Comparing the two markets, high initial costs are the most re-
cognised GB barrier. Studies have shown a maximum extra cost of 4%
compared to conventional buildings, which is often oset to some ex-
tent by savings in operational costs (Braman et al., 2013). Lack of
professional training and technical knowledge of market players and
legislation issues are mentioned in several studies of developing mar-
kets. Overall, research in developing markets has revealed fewer bar-
riers than in developed markets. This may illustrate the maturity of the
GB adoption process in developed markets in comparison with devel-
oping markets, as the greater adoption rate reveals more hindrances
with regards to psychological aspects (Homan and Henn, 2008). Al-
though there are dierences between the GB barriers perceived by
studies with the two backgrounds, the adoption of GB in developed and
developing markets generally faces similar barriers.
Studies of the GB barriers in Vietnam are scarce and most related
information is from the viewpoints of academia and consultants. The
only study with an appropriate methodology is a report by
Solidiance & VGBC (August 2013), in which more than 20 industry
leaders (suppliers, architects, contractors and project consultants) were
interviewed. The report identies ve main barriers to GB growth in
Vietnam, comprising low electricity price, lack of government in-
centives, limited supply of skilled employees with GB awareness, short-
term thinking and misaligned incentives between building developers
and users, low awareness and price sensitivity discouraging property
developers. In addition to the report, we reviewed seven key articles
relating directly to GB in Vietnam. These were found by conducting a
search with English and Vietnamese terms barriers to GB in Vietnam
and ro cn i vi cng trnh xanh in Google and ltering out irre-
levant results such as news or announcements of GB projects. The ar-
ticles were obtained from the Architecture Magazine of Vietnam Asso-
ciation of Architects, Asia Life Magazine, Asia Green Building, the Vietnam
Green Building Database and Network, National Energy Eciency
Programme and Ecology global network. However, it is noted that
several websites republished one article, demonstrating the lack of a
comprehensive study of GB in Vietnam. 24 barriers were found in these
key references and are summarised in Appendix D.
2.2. Government interventions to mitigate GB barriers
Governments involvement is considered as one of the essential and
eective ways to promote GB in many recent studies from Asia such as
Malaysia (Chan et al., 2009), Hong Kong (Gou et al., 2013; Qian et al.,
2016); Singapore (Hwang et al., 2017); China (Qian and Chan, 2010;
Zhang and Wang, 2013); the United States (Mellross and Bud Fraser,
2012; Mulligan et al., 2014); Australia (Zuo et al., 2012); and Europe
(van Bueren, 2009). Shai and Othman (2006) suggest that govern-
ments can stimulate and ensure the development of a sustainable con-
struction industry both indirectly, through legislation and planning
control, and directly, through their involvement as client, designer,
supervisor and/or producer in the construction process. Ho et al.
(2010) reveal that public leadership of green procurement determines
overall eectiveness and stimulates the practice in the Hong Kong
Resources, Conservation & Recycling 127 (2017) 820
private sector. Zhang et al. (2011b) propose a green strategy plan to
guide actions on the more systematic use of green technologies in
China.
The government can positively or negatively aect the demand for
GB through nancial incentives and tax reductions (Isa et al., 2013).
The Malaysian government, for example, has acted as a facilitator since
2007, when launching the Green Building Mission to raise awareness
(Shai and Othman, 2007). They consulted the private sector and non-
prot organisations in an open dialogue of critical issues, solutions and
recommendations for sustainable building and construction. Buildings
certied with the Green Building Index are allowed to apply for tax and
stamp duty exemptions (Isa et al., 2013). The Singapore government
implemented three successful Green Building Masterplans and incentive
mechanisms to promote GB across the state (Hwang et al., 2017). Eli-
gible GBs in Singapore receive up to 2% gross oor area (GFA) bonus. A
similar GFA concession scheme is provided in Hong Kong with max-
imum 10% GFA (Qian et al., 2016). In the U.S., the government can
allow a higher oor area ratio or lower tax burden for GB developers
(Choi, 2009).
Standards and codes are also considered eective instruments to
lead the construction industry towards more environmentally friendly
development. Energy standards for sustainable design and construction
have been established in several countries including India, Abu Dhabi
and Turkey, where the United States and United Kingdom standards
have been adapted to local conditions (Komurlu et al., 2015). The En-
ergy Conservation Building Code launched by the Government of India
aims at developing voluntary minimum energy performance standards
for large commercial buildings, expressed in terms of energy con-
sumption per m2 of area (Kumar et al., 2010).
However, Chan et al. (2009) argue that it is debatable which gov-
ernment intervention instruments are the most eective and ecient
tools for promoting GB. The question of whether a government should
be applying a mix of economic and regulatory tools, focusing more on
market-based instruments or setting up an institutional framework
consisting of volunteer individuals and organisations, depends on three
factors: the current situation of the market system, economic develop-
ment and the political environment.
3. Research methods
A questionnaire survey was employed here to help understand the
current situation of GB adoption in Vietnam. To validate the barriers
involved, an instrument consisting of 25 questions divided into 4 parts
was developed and tested in 3 phases, and distributed to more than 500
Vietnamese construction companies and professionals.
3.1. Design of the survey
Part 1 solicits the respondents opinions concerning the current GB
market and their familiarity with the GB concept, projects and certi-
cation; part 2 investigates the motivation for participating in GB pro-
jects and suggested solutions; part 3 involves ranking the barriers and
part 4 is concerned with details of the respondents organisations. The
survey clearly introduces the concept of GB used in the study, with an
image demonstrating the measures involved in greening a building.
The survey combines open-ended questions concerning the situation
and recommendations for GB adoption with quantitative questions to
rank the barriers on a Likert scale from 1 (not at all inuential) to 5
(extremely inuential) with a side choice of 0 (dont know) (Croasmun
and Ostrom, 2011). Respondents were encouraged to identify any in-
appropriate barriers on the list or other barriers missing from the list,
and asked to suggest possible means of promoting GB adoption.
The questionnaire was developed in English in consultation with
four scholars to test its adequacy and accuracy. It was then translated
into Vietnamese and back translated separately into English for com-
parison to detect any errors in translation. In the pilot phase, both
10
H.-T. Nguyen et al. Resources, Conservation & Recycling 127 (2017) 820

English and Vietnamese versions were tested by 17 academic and Table 1

construction professionals in both industry and government to ensure Demographic background of respondents.
the appropriateness of the length and language, adequacy of barriers
Demographic Frequency Valid Percent
and limit any foreseeable misunderstandings. After this phase, barriers characteristics (%)
with multiple meanings and that could cause confusion (such as
Inadequate/inecient scal incentives) were separated until they Organisation scale International 38 17.67
National 83 38.60
each presented single meaning. The resulting 48 barriers were then
Multi-cities/provinces 50 23.26
nalised and recoded as shown in the following section, with some Within a province/city 43 20.00
examples being added to clarify their meaning. Other 1 0.47

Industry players Architecture consultant 16 7.44

3.2. Targeted respondents and type of survey rm
Building contractor 7 3.26
Building owner 17 7.91
Two types of survey were applied: a web-based survey and survey Engineering consultant 18 8.37
by interview. A web-based survey built on the internet is easy to dis- rm
tribute and reach a large number of potential respondents, while a Environment 7 3.26
survey by interview involves the interviewer reading the questions from consultant rm
Estimation audit rm 2 0.93
the questionnaire and recording the answers on the questionnaire
Financial institution 2 0.93
(Oishi, 2003). This helps ensure a high valid response rate and that all Real estate developer 4 1.86
response options are considered. The web-based questionnaire was sent Real estate distribution 2 0.93
to construction stakeholders mainly in Hanoi and Ho Chi Minh City, agency
Other professional 24 11.16
where most of the certied GB is located. The survey by interview was
used when the respondents schedule was tight and answering the Government Education Government agency 76 35.35
questions in interview mode was preferred. The questionnaire was Construction related 40 18.60
University
distributed to a total of 523 recipients through dierent channels to
gain responses from stakeholders expressing a genuine interest in GB, Position in organisation Directorial level 30 13.95
Managerial level 73 33.95
such as the Ministry of Construction; VGBC executive leaders and their
Expert level 97 45.12
members; and Energy Eciency for Building workshops. The number of Other 15 6.98
completed responses is 225 with a relatively high response rate of 43%.
Years of experience Less than 5 years 58 26.98
Participation in the survey was voluntary. 510 years 58 26.98
1015 years 29 13.49
1520 years 39 18.14
4. Results and ndings
More than 20 years 31 14.42

(n = 215)
Of the 225 completed responses, 1 was unable to be opened due to
technical issues in the database, 8 were duplicates and therefore deleted
and 1 contained over 30% missing critical data and was also deleted
Table 2
leaving 215 responses available for further analysis (Hair, 2006). The Involvement in GB projects and certicates.
maximum missing data (either unanswered or answered as 0) for a
barrier is 6.48% indicating that all barriers may be retained according Frequency Valid
Percent
to the Hair (2006)s rule of thumb. Mean substitution is used to handle
missing values as this is the most widely used method and considered GB involvement Always 17 7.91
appropriate for less than 10% missing data (Hair, 2006). Often 45 20.93
Sometimes 73 33.95
Rarely 36 16.74
4.1. Analysis of respondent proles Never 44 20.47

Certicate(s) of the most LEED 5 2.33

Table 1 summarises the respondents and their organisations pro- recent project LOTUS 5 2.33
les. The majority (79.53%) are working in multiple cities/provinces EDGE 3 1.40
and above and therefore expected to understand the construction in- HQE 1 0.47
dustry and the GB situation in dierent contexts throughout Vietnam. LEED & LOTUS 4 1.86
LEED & EDGE 1 0.47
The survey covers a diverse background of construction organisations QCVN 09:2013, 1 0.47
comprising all relevant stakeholders. 47.91% of the respondents work LOTUS
at the managerial and directorial levels and 46.05% have worked for Others 4 1.86
more than 10 years. Their high positions and long working experience None/Don't know 191 88.84
(n = 215)
in the construction industry signies the validity and reliability of the
responses. Regarding the respondents familiarity with GB, Table 2 in-
dicates that 62.79% of the respondents have been engaged in a GB 4.2. Perspectives of the respondents on the current situation of GB adoption
project more than rarely, however, 88.84% of all respondents are ei-
ther unaware of the type of GB certicate for their most recent project Some 147 respondents stated their opinions regarding the GB status
or none was issued. The number of certicates does not equal the quo. Overall, they believe that, after 6 years, green buildings are still a
number of projects as ve respondents mentioned seeking multiple GB new concept and their number in growing slowly. This growth is mainly
certicates from two dierent rating tools. attributed to the industrial buildings of international organisations. As
Cronbachs alpha is 0.954 for the 48 listed barriers, which is very one respondent put it, [the GB market is] pushed by international
good according to Nunnally (1978), indicating that the data is reliable clients, rather than locals. Many others also claim that local investors
and suitable for further analysis. Investigating the item-total statistics lack motivation to pursue GB, as it is widely perceived that prots or
for individual variables also shows that Cronbachs alpha value cannot economic benets are valued over other sustainable aspects in the form
be improved by deleting any variables.

11
H.-T. Nguyen et al.
of social and environmental benets. The main reason why GB certi-
cation is sought is to increase the market value of a company or its
building. They honestly do not care about GB. They just [want to]
apply this to raise the building level and it is an aspect for attraction.
In a more detailed response,
Green factories were built by multi-national corporations [] to
sign contracts with high standard markets such as the U.S. or
Singapore. Green oces are built aimed at international companies
while green multi-storey residential buildings are invested in for
marketing reasons and are targeted at middle-high income house-
holds.
Some noticed that investors are unwilling to adopt GB involving
public budgets. As one respondent added: public spending on this type
of building unlikely to be approved due to the high initial costs of GB.
There are unied opinions of the popularity of information con-
cerning GB and it is noteworthy that the perception of stakeholders has
started to change. GB is attracting increased attention from the gov-
ernment and Architecture Universities. Many responses point out that
most construction professionals have a raised awareness of GB through
conferences, workshops and television programmes. In contrast, the
public has limited information, leading to a lack of interest from cus-
tomers and investors. As one respondent commented, seeking GB in-
formation takes a long time and there is no reliable source.
GB is believed to have a great potential to become the vital trend in
construction, although respondents identied the numerous challenges
it is facing, such as the lack of available suppliers and local consultants,
investors and project teams unfamiliarity with GB requirements, lack of
knowledge sharing and awareness, and a hesitance to commit to higher
investment. The need for policy is also stressed, as it is crucial in giving
a clear signal to the market.
4.3. Descriptive analysis of the barriers to GB
Table 3 presents the key descriptive values of the 48 barriers from 1
(not at all inuential) to 5 (extremely inuential). The mean values range
from 2.95 (BR33. Larger homes and smaller households (e.g. a one gen-
eration household may increase energy consumption) to 4.14 (BR40. Slow
and unwieldy administration process in policymaking). 7 out of 10 highest-
ranking items are related to government and policy, while the re-
maining 3 are cost related. The standard deviations of the barriers are
generally above 1 (0.91.28) indicating a considerable dierence in
responses regarding the inuence of listed barriers.
Slow policymaking and the lack of a comprehensive policy package
for sustainability in Vietnam are perceived as the biggest challenges to
GB. This is dierent to studies in other developed and developing
markets, in which the economic and cost barriers are the highest
ranked. Responses to the open-ended questions in show there is a
considerable concern over the slowness of the government response to
changes in the construction market. According to the respondents, de-
spite GB becoming a focus in academic forums and attracting the at-
tention of both construction professionals and the public, there has not
been an explicit program to promote the adoption and development of
GB. Price sensitivity and high initial costs are relatively high at 3.96
and 3.95/5, respectively, indicating the similarity between the per-
ception of Vietnam construction professionals and the respondents in-
volved in studies in other countries. Lack of data and knowledge is also
perceived to be a large hindrance to the application of GB with in-
sucient cost-benet data and lack of technical understanding be-
tween the project stakeholders having the same mean value of 3.85/5.
It is noteworthy that larger homes and smaller households was
ranked the lowest, with several respondents stating that this is not
happening in Vietnams high-density cities. Reluctance to adopt
changes was also given a low mean value of 3.33, signifying that the
construction market in Vietnam is perceived as suciently dynamic.
12
Resources, Conservation & Recycling 127 (2017) 820
4.4. Exploratory factor analysis of the GB barriers
Exploratory Factor analysis (EFA) using Principal Component
Analysis (PCA) is carried out to reduce the number of barriers to a set of
signicant variables, examine the interrelations among the variables
and identify the underlying structure of those variables. To assess the
suitability of the data for EFA, a preliminary test is conducted including
correlation analysis, the Kaiser-Meyer-Olkin (KMO) Measure of
Sampling Adequacy (MSA) and Bartlett's Test of Sphericity.
The correlation matrix shows the 10 variables correlate highly
(r > 0.7). As this may mean the two variables explain each other in-
stead of being explained to any great extent by other variables (Hair,
2006). Based on suggestions of the survey respondents, 5 variables are
removed from the analysis. The KMO and Bartlett values for the re-
duced dataset reach 0.902 (meritorious according to Hutcheson and
Sofroniou, 1999, cited in Field, 2009) and 5141.092 (df = 903) re-
spectively. Through the Anti-image Matrices, the minimum KMO value
for individual variables is 0.782, which is well above the 0.5 threshold
(Field, 2009). The Bartlett's Test of Sphericity is signicant at the 0.000
level and therefore the set of 43 variables have sucient correlations
and is suitable to proceed to EFA.
The PCA is initially conducted using Varimax rotation under the
presumption that there is no relationship between components. Loading
the 43 variables freely into various components with eigenvalue > 1
results in the extraction of 9 components, explaining 65.06% of total
variance. The Component Transformation Matrix (Appendix E) shows
the correlations between components, rejecting the assumption that the
components are not related. Carrying out PCA again using Direct Ob-
limin rotation results in 9 components being extracted with an eigen-
value > 1, explaining 65.06% of total variance. From the scree plot, the
point of inexion is at 5 components (Appendix F), which suggests the
extraction of 4 components according to Field (2009). EFA is then re-
peated iteratively following two conditions; rst, the number of com-
ponents is xed at 4; second, variables with factor loading less than 0.4
or cross loading greater than 0.4 are deleted (using the suggestion of
Hair (2006) applied to a sample size of more than 200). Deleting
variables sequentially in this way until all conditions are met results in
a set of 39 variables loaded under 4 components. This accounts for
51.89% of the variance of the reduced dataset. Table 4 shows the nal
EFA analysis. To distinguish the four components further, all variables
are recoded into four groups.
Component 1 with 9 variables represents Social and Cognitive
Barriers (SB); it is the most inuential factor with the highest eigen-
value of 12.737, explaining more than 32% of the total variance. The 6
variables in Component 2 reect Economic and Cost Barriers (EB) the
second most important factor, with an eigenvalue of 2.945 that explains
7.5% of the variance in the data set. Component 3, comprising 11
variables, appears to represent Legislative and Institutional Barriers
(LB). Component 4 is associated with the technical requirements and
knowledge for GB, consisting of 9 variables that all have negative
loadings, signifying that they are Technical and Knowledge Barriers
(TB). LB has an eigenvalue of 2.578 while TBs eigenvalue is 1.976,
explaining approximately 6.6% and 5% of the total variance respec-
tively.
The Component Correlation Matrix in Table 5 shows the inter-
relationships between the 4 components. It is evident that EB is rela-
tively independent while SB correlates highly with TB and LB.
4.5. Validating the PCA results
The reliability of the scale is examined by assessing internal con-
sistency with Cronbachs alpha coecient and item-total statistics. The
nal datasets reliability is 0.944, with Cronbachs alpha values of the 4
components of: SB: 0.896, EV: 0.827, LB: 0.904 and TB: 0.881all of
which are well above the recommended value of 0.7 (Field, 2009). The
item-total statistics show that these values will not increase should any
H.-T. Nguyen et al. Resources, Conservation & Recycling 127 (2017) 820

Table 3
Barriers inuencing the adoption of GB.

Code Barriers Mean Std. Dev

BR40 Slow and unwieldy administration process in policy making 4.14 0.9
BR41 Lack of a comprehensive code/policy package to guide action on sustainability 4.08 0.93
BR20 Lack of an explicit nancing mechanism 3.99 0.93
BR21 Inadequate scal incentives 3.97 0.91
BR26 Price sensitivity (e.g. developers/owners hesitate to pay more for up-front costs) 3.96 1
BR45 Inappropriate attitude of governmental agencies 3.96 1.01
BR16 High initial costs 3.95 0.97
BR38 Lack of collaborative integration between related government agencies 3.9 1.02
BR22 Inecient scal incentives 3.89 0.93
BR6 Insucient cost-benet data from interdisciplinary research 3.85 1.08
BR13 Lack of technical understanding of designers, builder and project teams 3.85 1.1
BR43 Confusion arising from parallel policies/legislation 3.85 1
BR19 Split incentives due to ownership structure (e.g. developers pay for up-front costs, whilst operation cost saving belong to the occupants) 3.84 0.98
BR46 Weak enforcement of legislation 3.84 1.08
BR9 Lack of professional education and training 3.79 1.04
BR10 Lack of methods to consistently dene and measure green features 3.78 1.01
BR28 Lack of public awareness about GB 3.76 1.1
BR17 Long payback period 3.75 1
BR5 Lack of information of the options/practices related to GB when projects start 3.74 1.16
BR11 Lack of a reliable tool to assess GBs 3.74 1.11
BR48 Lack of well- known sources of information 3.72 0.93
BR39 Lack of a stakeholder communication network 3.71 1
BR15 High risks associate with investment (e.g. no guarantee in being certied after registration, uncertainty in higher return on investment) 3.7 1.17
BR7 Lack of integrated design for life cycle management 3.69 1.01
BR29 Lack of expressed interest from clients 3.64 1.13
BR44 Negative impacts of public policy (e.g. subsidies for domestic materials, inappropriate tari system) 3.64 1.1
BR30 Lack of expressed interest from project teams 3.59 1.08
BR37 Dierent levels of regional economic development 3.59 1.15
BR42 Duplication of policies/legislation 3.58 1.05
BR14 Lack of renewable energy application in existing infrastructure (e.g. solar or wind power) 3.56 1.16
BR18 Incurred cost in seeking for certication (e.g. registration and assessment fee) 3.55 1.06
BR2 Unreliable sustainable technology 3.54 1.2
BR27 Misconception about GB 3.52 1.2
BR47 Unorganised nature of construction industry 3.5 1
BR23 Inappropriate pricing of electricity and other energy commodities (e.g. not high enough to push energy eciency) 3.48 1.17
BR12 Lack of demonstration projects 3.46 1.13
BR36 Lack of GB movement 3.46 1.1
BR1 Unavailable sustainable technology (e.g. solar panels) 3.43 1.22
BR34 Lack of social science in climate change 3.36 1.18
BR25 Insucient brand recognition and competitive advantage 3.34 1.09
BR32 Behaviour of occupants (e.g. occupants consume more electricity when using energy saving equipment) 3.34 1.21
BR35 Lack of social science in natural resource preservation 3.34 1.16
BR4 Unreliable sustainable materials 3.33 1.17
BR8 Dierent accounting methods in estimating project cost 3.33 1.2
BR24 Reluctant to adopt changes (e.g. new concepts, new construction technologies) 3.33 1.33
BR31 Contested functionality for end users 3.3 1.14
BR32 Unavailable sustainable materials (e.g. unbaked bricks) 3.14 1.28
BR33 Larger homes and smaller households (e.g. a one generation household may increase energy consumption) 2.95 1.19

of the variables be deleted. It is evident, therefore, that the scale is
suciently reliable for the results to be interpreted.
The scale is assessed to check its convergent validity and dis-
criminant validity, where Convergent validity is the degree of con-
dence that a trait is well measured by its indicators and Discriminant
validity is the degree to which measures of dierent traits are un-
related (Alarcon and Sanchez, 2015). To inspect the convergent va-
lidity of the scale, it is necessary to assess the correlation matrix
(Ngacho and Das, 2014). The mean value of inter-item correlations is
0.303 and the minimum inter-item correlations within each component
are SB: 0.203; TB: 0.219, which are statistically signicant at the 5%
level and EB: 0.294; LB: 0.242, statistically signicant at the 1% level,
indicating valid convergence. The discriminant validity of the scale is
assessed through the average variance extracted (AVE) using the pat-
tern matrix and component correlation matrix. According to the For-
nell-Larcker testing system, the levels the AVE for each construct
should be greater than the squared correlation involving the constructs
(Alarcon and Sanchez, 2015). As Table 6 indicates, the four components
are validly discriminant.
5. Description of the four main components and discussion
5.1. Component 1 represents the current social and cognitive conditions,
which narrows the entrance for GB, or in short as Social and cognitive
barriers (SB) containing 13 barriers
SB accounts for 32.659% of total variance and is considered the
most important of the 4 constructs. The highest loading is Lack of
public awareness of GB (0.71), followed by Lack of expressed interest
from project teams (0.685) and Misconceptions about GB (0.678). As
mentioned in Section 5.2, the respondents believe there has been a rise
in awareness of construction professionals, but the public has only been
provided with limited, and sometimes misleading, information. A
number of property investors have advertised their projects with pos-
ters lled with trees and named them either eco or green; while Qian
and Chan (2010) stress Akelofs (1970) conclusion that, if the public is
given inappropriate information about GB and green labelling remains
unregulated, it will result in an asymmetric information environment
in which property developers and other market players may engage in
opportunistic behaviour and avoid genuine GBs and products. In a

13
H.-T. Nguyen et al. Resources, Conservation & Recycling 127 (2017) 820

Table 4
Summary of nal EFA results.

Old code New code Rotated factor loadings

1 2 3 4

Lack of public awareness about GB BR28 SB1 0.710

Lack of expressed interest from project teams BR30 SB2 0.685
Misconceptions about GB BR27 SB3 0.678
Contested functionality for end users BR31 SB4 0.671
Larger homes and smaller households (e.g. 1 generation household, increases energy consumption) BR33 SB5 0.629
Lack of expressed interest from clients BR29 SB6 0.627
Behaviour of occupants (e.g. occupants consume more electricity when using energy saving equipment) BR32 SB7 0.624
Lack of social science in climate change BR34 SB8 0.593
Reluctance to adopt changes (e.g. new concepts, new construction technologies) BR24 SB9 0.583
Insucient brand recognition and competitive advantage BR25 SB10 0.575
Lack of well-known sources of information BR48 SB11 0.494
Lack of GB movement BR36 SB12 0.491
Dierent levels of regional economic development BR37 SB13 0.431
Long payback period BR17 EB1 0.809
High initial costs BR16 EB2 0.796
High risks associated with investment (e.g. no guarantee in being certied after registration, uncertainty of higher BR15 EB3 0.696
return on investment)
Split incentives due to ownership structure (e.g. developers pay for up-front costs, while operation costs belong to the BR19 EB4 0.664
occupants)
Incurred cost in seeking for certication (e.g. registration and assessment fee) BR18 EB5 0.650
Lack of an explicit nancing mechanism BR20 EB6 0.471
Weak enforcement of legislation BR46 LB1 0.822
Inappropriate attitude of governmental agencies BR45 LB2 0.811
Confusion arising from parallel policies/legislation BR43 LB3 0.801
Duplication of policies/legislation BR42 LB4 0.771
Negative impacts of public policy (e.g. subsidies for domestic materials, inappropriate tari system) BR44 LB5 0.761
Slow and unwieldy administration process in policy making BR40 LB6 0.700
Lack of a comprehensive code/policy package to guide action on sustainability BR41 LB7 0.507
Lack of collaborative integration between related government agencies BR38 LB8 0.507
Unorganised nature of the construction industry BR47 LB9 0.412
Lack of a stakeholder communication network BR39 LB10 0.411
Inecient scal incentives BR22 LB11 0.404
Insucient cost-benet data from interdisciplinary research BR6 TB1 0.813
Lack of integrated design for life cycle management BR7 TB2 0.800
Lack of technical understanding of designers, builder and project teams BR13 TB3 0.751
Lack of demonstration projects BR12 TB4 0.680
Lack of professional education and training BR9 TB5 0.600
Lack of renewable energy applications in the existing infrastructure (e.g. solar or wind power) BR14 TB6 0.554
Lack of information of the options/practices related to GB when projects start BR5 TB7 0.540
Lack of a reliable tool to assess GBs BR11 TB8 0.539
Dierent accounting methods in estimating project cost BR8 TB9 0.530
Eigenvalues 12.737 2.945 2.578 1.976
% of variance 32.659 7.551 6.611 5.067
0.896 0.827 0.904 0.881

Extraction Method: Principal Component Analysis.

Rotation Method: Oblimin with Kaiser Normalization.
Rotation converged in 10 iterations.
KMO MSA = 0.902.
Bartletts Test of Sphericity = 4570.601.
Signicance = 0.000.

Table 5 Table 6
Component Correlation Matrix. Comparison of AVE and the squared correlations.

Component SB EB LB TB Component Average variance extracted based on Pattern Matrix in Table 4

SB 1.000 0.220 0.463 0.420 SB 0.365

EB 0.220 1.000 0.260 0.285 EB 0.476
LB 0.463 0.260 1.000 0.344 LB 0.423
TB 0.420 0.285 0.344 1.000 TB 0.399

Extraction Method: Principal Component Analysis.

Component correlation Squared correlation based on the Component
Rotation Method: Oblimin with Kaiser Normalization.
Correlation Matrix in Table 5

recently published article in the Architecture Magazine of Vietnam As- SB-EB 0.048
sociation of Architects, (Nguyen, 2016) elaborates eight misconceptions SB-LB 0.214
SB-TB 0.176
leading to this low public awareness. In summary, the misconceptions EB-LB 0.067
are: GB is perceived as having many trees, as green is literally un- EB-TB 0.081
derstood; architects add trees in their perspective drawing of the LB-TB 0.118
buildings to make them look attractive and call them green buildings or

14
H.-T. Nguyen et al.
green architecture; GB only applies to new or energy ecient buildings,
or buildings with certicates; GB is expensive; GB depends solely on the
clients or local governments; and GB is only a product of the con-
struction process. Although the article only claims to be the individual
view of the author and has not clearly categorised those misconcep-
tions, it provides insights into why the public has a low awareness of GB
and the project teams express little interest in achieving GB. Moreover,
the survey participants explain that aordable housing is more critical
and GB is considered as a nice-to-have feature, therefore the public pays
more attention to other criteria such as price and location.
Additionally, the item Lack of well-known sources of information
can be theoretically associated with either the institutional factor or
knowledge factor since this variable appears to be regarded as a reliable
established database. The analysis illustrates that this variable is loaded
under Social and cognitive barriers, indicating that lacking the da-
tabase makes it dicult to select and obtain correct information for GB,
leading to communication problems and ultimately hindering the
raising of social awareness (Gou et al., 2013).
5.2. Component 2 denotes Economic and cost barriers (EB), the economic
situation and costs with 6 variables associated with GB that prevent its
adoption
EB explains 7.551% of the total variance and is ranked the second
most important factor. Long payback period has the highest loading
of 0.809. The payback period is generally an important criterion mea-
suring the economic eciency of a project. The benets of GB are
mostly gained from energy and water savings, and productivity in-
creases in the operation phase, which may last several decades. Gou
et al. (2013) claim that the return on investment generally takes 20
years and accrues to the nal owners or users of the building, not the
developers. Therefore, the developers are less likely to adopt GB solely
because of its long-term savings. Responses to the open-ended question
concerning the status quo of GB adoptions also agree that investors tend
to focus on such economic benets as attracting more house-buyers/
renters and raising real-estate prices. This aligns with the report of
Solidiance & VGBC (August 2013), which states that property devel-
opers in Vietnam often prioritise short-term prot over a long-term
returns.
High initial costs are often listed as the largest obstacle in studies of
the barriers to GB in other markets (Mulligan et al., 2014; Zhang et al.,
2011a) and is the second highest loading under EB at 0.796. Gan et al.
(2015), while investigating the opportunities for sustainable construc-
tion from perspective of buildings owners in China, note that high
initial investment coupled with a long payback period present sig-
nicant barriers to owners. GB is widely considered as requiring ad-
ditional costs for either design or green technologies and/or materials.
Those costs are borne by the investor and are not easily passed to te-
nants or end-owners (Gou et al., 2013). In Vietnam, developers are
highly sensitive to price and often favour low-cost designs or conven-
tional technical solutions from local suppliers without green building
materials or technologies (Solidiance & VGBC, August 2013). The short-
term thinking of property developers, who pay more attention to short-
term prot than a long-term return, poses a hindrance that can be
helped overcome by an improved public awareness of GB. The slow-
down of the real estate market due to more restrictive lending condi-
tions and oversupply across several market segments increases price
sensitivity and causes an increased hesitation of property developers
and buyers to invest in GB.
15
Resources, Conservation & Recycling 127 (2017) 820
5.3. Component 3 with 11 variables embodies Legislative and institutional
barriers (LB)
LB is the third important construct, explaining 6.611% of the var-
iance. The highest loading is in Weak enforcement of legislation
(0.822), followed by Inappropriate attitude of governmental agencies
and Confusion arising from parallel policies/legislation (0.811 and
0.801, respectively). The ndings are similar to the situation in main-
land China, where the government lacks serious enforcement or proper
implementation of legal controls over the Energy Conservation Law and
building standards (Qian and Chan, 2010). As Vu (2015) points out, the
building standards in Vietnam are not enforced or strictly followed,
considerably aecting its GB market and construction industry.
However, the reviews also revealed that although developers are
aware of these incentives, they do not always take advantage of them.
One reason is that developers timetable for a project sometimes cannot
incorporate the response time needed by a local government.
Developers need to make quick decisions but governments prefer to
move slowly and observe due process. However, the reviews also
revealed that although developers are aware of these incentives, they
do not always take advantage of them. One reason is that developers
timetable for a project sometimes cannot incorporate the response time
needed by a local government. Developers need to make quick decisions
but governments prefer to move slowly and observe due process.
However, the reviews also revealed that although developers are aware
of these incentives, they do not always take advantage of them. One
reason is that developers timetable for a project sometimes cannot
incorporate the response time needed by a local government.
Developers need to make quick decisions but governments prefer to
move slowly and observe due process. However, the reviews also
revealed that although developers are aware of these incentives, they
do not always take advantage of them. One reason is that developers
timetable for a project sometimes cannot incorporate the response time
needed by a local government. Developers need to make quick decisions
but governments prefer to move slowly and observe due process.
In terms of the inappropriate attitude of the authorities, Gou et al.
(2013) review U.S. GB development to nd that the developers do not
always take advantage of the nine popular incentives oered by the
government there. The reason is that the governments tend to move
slowly and observe due process, which cannot meet the demand for
quick decision making by developers. Furthermore, respondents in the
survey claim that the authorities in Vietnam follow a 5-year-period,
which negatively aects short-term vision and decisions. Corruption is
another likely serious issue that prevents transparency in procurement
and other construction project processes (Kenny, 2007).
It is noteworthy that Slow and unwieldy administration process in
policy making, being ranked the highest of all the listed barriers, has a
loading of 0.700. Evidenced from the policies issued, the 2012 National
Strategy on Green growth was the rst to mention GB and the objective
of its promotion. Since then, there has been only one National
Construction Code enacted on energy saving in buildings, the QCVN
09:2013, which has been criticised as dicult to follow and not fully
enforced. The regulatory environment is still undeveloped and support
from the government for GB is limited to conferences and orientation,
providing little incentive to help GB penetrate the construction market
(Solidiance & VGBC, August 2013).
H.-T. Nguyen et al.
5.4. Component 4, containing 9 items with negative loadings, represents the
technical requirements and knowledge necessary for adopting more GB,
which implies that those items are statistically Technical and knowledge
barriers (TB) to GB
TB is the last component extracted and explains only 5.067% of the
total variance. The highest loading is found in Insucient cost-benet
data from interdisciplinary research (-0.813). This type of data is more
obtainable in countries such as the U.S. (Kats, 2009; Nalewaik and
Venters, 2009), U.K. (Chegut et al., 2014), Australia (BCI Economics,
2014) and China (Liu et al., 2014), where GB has occurred in large
numbers and has been the focus of research since 2000. In Vietnam,
however, it is not yet fully studied. Respondents from the survey state
that GB has only been constructed in the last 5 years and there is a lack
of demonstration projects to collect and investigate the cost-benet
data.
Lack of integrated design for life cycle management and Lack of
technical understanding of designers, builder and project teams are the
second and third of the variables under TB with rotated factor loadings
of 0.800 and 0.751. The surveys participants commented that the
project team and construction workers have not yet acquired su-
ciently deep knowledge and necessary skills related to GB design, ma-
terials and technology. This increases the cost and time of the design
and construction phase of GB projects, thus increasing total cost.
6. Conclusions and policy recommendations
GB in Vietnam is still in its early stages and facing numerous chal-
lenges/barriers. This study collects and analyses the opinions of 215
professionals to investigate the current situation and major challenges.
Legislative barriers are ranked the highest. Both industry players and
government ocers participating in the study expressed serious con-
cerns regarding the slow response and unwieldly policymaking process
of the government in reacting to changes and new trends in the market.
As Vietnam is a one-party country and the government maintains a high
level of control over the market, the lack of a clear signal from the
authorities to either endorse or disapprove GB has had a considerable
impact on both construction professionals and the public.
PCA of EFA is applied to reveal four main components preventing
GB adoption, namely Social and Cognitive, Economic and Cost,
Legislative and Institutional barriers and Technical and Knowledge
requirements. This is similar to Yang and Yang (2015) study of sus-
tainable housing in Australia, in which the barriers are also categorised
into four factors comprising technological and design, economic, so-
ciocultural and institutional factors. However, while these study nd-
ings show that the economic factor is the most important inuence in
implementing sustainable housing in Australia, this study revealed that
social and cognitive barriers explain the largest amount of total var-
iance, accounting for the major challenges for GB adoption in Vietnam.
It can be seen that when GB development is still in its early stages, the
awareness of the construction industry and the market for genuine
green features that distinguish between a GB and a conventional
building are less than adequate. This results in inappropriate informa-
tion and false green labelling on buildings. Consequently, the public is
soon disappointed and sceptical of green labelling, leading to other
obstacles in the GB adoption pathway such as low demand and hesi-
tation to invest in green properties.
The Vietnam government deploying its leadership role and pro-
viding increased support through policy instruments to address the GB
Appendix A
Table A1.
16
Resources, Conservation & Recycling 127 (2017) 820
barriers would help in further implementing the 2012 National Green
Growth Strategy and towards a sustainable construction industry.
Having one agency, similar to the Singapore Building and Construction
Agency, responsible for promoting GB projects and obtaining support
from all relevant departments would improve the eciency of the de-
cision-making framework for GB development. This decision-making
model could be rst piloted in Hanoi and Ho Chi Minh City before
considering application to the whole country.
The government is needed to be more responsive to the sustainable
trend in the construction industry by promulgating a strong legal
statement coupling regulations with incentives to stimulate a greater
market demand for GB. This could start with issuing a clear guideline of
what is genuine GB, regulate green labelling and develop a reliable
database for green technology, products and materials. These policies
provide a clear denition of a genuine green building project that can
help prevent greenwash by increasing the awareness of both con-
struction professionals and the public. In the current economic and
social conditions, it is unlikely that the government would oer grants
or soft loans for GB developers. Such advocacy policies as investing in
demonstration projects and integrating aordable housing schemes and
GB schemes through green procurement such as requiring green fea-
tures at the tendering stage, would incentivise more GB suppliers.
Expedited permit and tax exemptions are also two potential widely used
policies to encourage GB projects. For instance, eligible GB certied
projects should be considered as meeting the National Construction
Code on energy saving in buildings.
Training and knowledge sharing workshops and short courses about
GB design, materials and technologies such as energy usage simulation
software would be useful for both industry professional and govern-
ment ocers. Systematically including sustainability and green design
standards in engineering and architecture courses would support the
long-term development of GB by building the knowledge, primary ex-
perience and interest relating to GB that are essential for students to
apply in future GB projects (Kelly, 2007).
A limitation of the study is that over 80% of the respondents either
did not know what certication their recent project had or had nothing
certied with GB rating systems. Also, the SDs of the variables ranging
around 1 suggests that the respondents may not be well informed in
judging what the barriers are; and approximately 50% of the variance
explained is relatively low for a Factor Analysis after rotation. Future
research in Vietnam could be based on the results of this study to ex-
pand to more professionals outside Hanoi and HCMC and compare the
responses between dierent types of respondents and areas with dif-
ferent economic growth rates. More cross-cultural studies are needed to
investigate which GB policies may be most suitable for Vietnam and
other similarly placed countries from the lessons learned to date in
other countries and the mechanisms that could best catalyse the
adoption of GB.
Acknowledgement
The study was supported by Queensland University of Technology,
Australia and Institute of Environmental Science and Engineering,
National University of Engineering, Vietnam. The authors would like to
express their gratitude to USAID Vietnam Clean Energy Program and
Mien Tay Construction University and all the survey participants for
their great support in data collection. The authors would like to also
thank all the reviewers for providing in-depth comments and their in-
valuable contributions.
H.-T. Nguyen et al. Resources, Conservation & Recycling 127 (2017) 820

Table A1
Rating systems applied in Vietnam.

Rating system Organisation Country of Denition

origin

Leadership in Energy & Environmental U.S. Green Building Council (USGBC) United States A point based rating system that rewards points across several
Design (LEED) areas that address sustainability issues such as water, energy,
materials.
LOTUS Vietnam Green Building Council (VGBC) Vietnam A set of voluntary market-based green building rating systems
developed by the VGBC specically for the Vietnamese built
environment.
Excellence in Design for Greater International Finance Corporation World United States Certify based on EDGE standard that articulates a universal
Eciencies (EDGE) bank group denition for a green building: 20 percent less energy use, 20
percent less water use, and 20 percent less embodied energy in
materials.
Green Star Green Building Council Australia Australia Australia's trusted mark of quality for the design, construction and
operation of sustainable buildings, t-outs and communities.
Green Mark Building & Construction Authority Singapore A benchmarking scheme that incorporates internationally
recognised best practices in environmental design and
performance.
Green Globe Standard Green Globe Ltd. United States A structured assessment of the sustainability performance of travel
and tourism businesses and their supply chain partners
EarthCheck Australian Government Sustainable Tourism Australia A scientic benchmarking certication and advisory group for
Co-operative Research Centre travel and tourism developed based on the international standards
relative to greenhouse gas protocols, responsible tourism and
certication.

Appendix B

Fig. B1.

Fig. B1. Adoption of green construction (adapted from Homan and

Henn, 2008, p. 394).

Appendix C

Fig. C1.

Fig. C1. Stylised diusion curves (adapted from Meade and Islam,
2006).

17
H.-T. Nguyen et al. Resources, Conservation & Recycling 127 (2017) 820

Appendix D

Table D1.

Table D1
Barriers to GB perceived in developed, developing markets and in Vietnam.

No Barrier to GB adoption Key references

Developed market Developing market Vietnam

1 Unavailable/unreliable sustainable technology/ (Gou et al., 2013) (Teng et al., 2015) (Tatarski, 2013)
materials
2 Insucient cost-benet data from interdisciplinary (Chan et al., 2009) (Samari et al., 2013) (Le, 2014)
research
3 Lack of integrated design for life cycle management (Mulligan et al., 2014) (Qian and Chan, 2010)
4 Lack of professional education and training (Yang and Yang, 2015) (Isa et al., 2013; Samari et al., (Le, 2008; Solidiance & VGBC, August 2013)
2013)
5 Lack of methods to consistently dene and measure (Gou et al., 2013) (Samari et al., 2013) (Pham, 2015)
sustainability
6 Lack of information (Bond, 2011; Yau, 2012b) (Zhang et al., 2011a) (Vu, 2015)
7 Lack of demonstration projects (Chan et al., 2009) (Potbhare et al., 2009)
8 Lack of technical understanding of designers, builders (Li et al., 2011; Mulligan et al., (Ahn et al., 2013; Isa et al., (Solidiance & VGBC, August 2013)
and project teams 2014) 2013)
9 Dierent accounting methods (Chan et al., 2009) (Le, 2014)
10 High risks associated with investment (Yang and Yang, 2015; Zhao (Qian and Chan, 2010)
et al., 2016)
11 High initial costs (Ahn et al., 2013; Li et al., (Shen et al., 2017) (Le, 2014; Vu, 2015)
2011)
12 Inadequate/inecient scal incentives (Yang and Yang, 2015) (Samari et al., 2013; Shen (Le, 2014)
et al., 2017)
13 Long payback period (Ahn et al., 2013; Gou et al.,
2013)
14 Inappropriate pricing of electricity and other energy (Qian and Chan, 2010) (Solidiance & VGBC, August 2013; Tatarski,
commodities 2013)
15 Lack of an explicit nancing mechanism (Gou et al., 2013) (Qian and Chan, 2010) (Le, 2014)
16 Costs incurred in seeking certication (Gou et al., 2013) (Sayyed and Do, 2015)
17 Split incentives due to ownership structure (Bond, 2011) (Solidiance & VGBC, August 2013)
18 Reluctance to adopt change (Choi, 2009)
19 Insucient brand recognition and competitive (Yang and Yang, 2015)
advantage
20 Lack of social science in climate change and natural (Yang and Yang, 2015)
resource preservation
21 Misconception and lack of public awareness (Chan et al., 2009; Yau, 2012a) (Teng et al., 2015) (Solidiance & VGBC, August 2013; Tatarski,
2013)
22 Contested functionality for end users (Yang and Yang, 2015)
23 Behaviour of occupants (Mulligan et al., 2014) (Ahn et al., 2013; Chen et al.,
2017)
24 Larger homes and smaller households (Bond, 2011)
25 Lack of interest from clients (Gou et al., 2013) (Samari et al., 2013) (Solidiance & VGBC, August 2013)
26 Lack of interest from project teams (Gou et al., 2013) (Potbhare et al., 2009)
27 Lack of GB movement (Potbhare et al., 2009) (Le, 2014; Pham, 2015)
28 Dierent level of regional economic development (Teng et al., 2015)
29 Lack of collaborative integration (Yang and Yang, 2015) (Zhang et al., 2011a) (Pham, 2015)
30 Lack of a stakeholder communication network (Choi, 2009; Li et al., 2011) (Zhang et al., 2011a) (Pham, 2015)
31 Slow and unwieldy administration processes in (Chan et al., 2009) (Qian and Chan, 2010)
certifying and policy making
32 Lack of a comprehensive code/policy package to guide (Yang and Yang, 2015) (Isa et al., 2013) (Sayyed and Do, 2015)
action on sustainability
33 Duplication and confusion arising from parallel (Yang and Yang, 2015)
policies/legislation
34 Negative impact of public policy (Shai and Othman, 2006) (Minh Do and Sharma, 2011)
35 Inappropriate attitude of government agencies (Chan et al., 2009) (Samari et al., 2013)
36 Weak enforcement of legislation (Qian and Chan, 2010) (Vu, 2015)
37 Unorganised nature of the construction industry (Potbhare et al., 2009)
38 Lack of well know sources of information (Gou et al., 2013) (Potbhare et al., 2009)
39 Price sensitivity (Solidiance & VGBC, August 2013)
40 Constraints of existing infrastructure (Tatarski, 2013)
41 Lack of sustainable energy (Tatarski, 2013)

Appendix E

Table E1.

18
H.-T. Nguyen et al. Resources, Conservation & Recycling 127 (2017) 820

Table E1
First EFA result Component Transformation Matrix.

Component 1 2 3 4 5 6 7 8 9

1 0.516 0.491 0.409 0.278 0.292 0.239 0.238 0.152 0.158

2 0.510 0.546 0.198 0.570 0.144 0.193 0.080 0.055 0.106
3 0.462 0.385 0.458 0.558 0.028 0.103 0.073 0.305 0.084
4 0.438 0.487 0.348 0.396 0.498 0.152 0.147 0.025 0.000
5 0.088 0.204 0.449 0.008 0.548 0.177 0.159 0.566 0.268
6 0.189 0.111 0.092 0.137 0.068 0.603 0.362 0.580 0.298
7 0.127 0.002 0.468 0.271 0.325 0.037 0.376 0.286 0.601
8 0.026 0.098 0.147 0.181 0.485 0.674 0.344 0.334 0.127
9 0.090 0.107 0.108 0.067 0.000 0.144 0.703 0.174 0.648

Extraction Method: Principal Component Analysis.

Rotation Method: Varimax with Kaiser Normalization.

Appendix F

Fig. F1.

Fig. F1. Second EFA result Scree plot of components.

References
Ahn, Y.H., Pearce, A.R., Wang, Y., Wang, G., 2013. Drivers and barriers of sustainable
design and construction: the perception of green building experience. Int. J. Sustain.
Build. Technol. Urban Dev. 4 (1), 3545. http://dx.doi.org/10.1080/2093761X.
2012.759887.
Alarcon, D., Sanchez, J.A., 2015. Assessing convergent and discriminant validity in the
ADHD-R IV rating scale: user-written commands for average variance extracted
(AVE), composite reliability (CR), and heterotrait-Monotrait of correlations (HTMT).
In: Paper Presented at Spanish STATA Meeting 2015. Madrid, Spain. (Retrieved from
http://www.stata.com/meeting/spain15/abstracts/materials/spain15_alarcon.pdf).
BCI Economics, 2014. Green Building Market Report Australia/New Zealand 2014.
(Retrieved from http://www.bciaustralia.com/wp-content/uploads/2014/12/BCI.
Economics.Green_.Building.Market.Report.pdf).
Berardi, U., 2017. A cross-country comparison of the building energy consumptions and
their trends. Resour. Conserv. Recycl. 123, 230241. http://dx.doi.org/10.1016/j.
resconrec.2016.03.014.
Bond, S., 2011. Barriers and drivers to green buildings in Australia and New Zealand. J.
Prop. Invest. Finance 29 (4/5), 494509. http://dx.doi.org/10.1108/
14635781111150367.
Braman, J., James, M., Kats, G., 2013. Greening Our Built World: Costs, Benets, and
Strategies. Island Press.
Chan, E.H.W., Qian, Q.K., Lam, P.T.I., 2009. The market for green building in developed
Asian citiesthe perspectives of building designers. Energy Policy 37 (8),
30613070. http://dx.doi.org/10.1016/j.enpol.2009.03.057.
Chau, C.K., Tse, M.S., Chung, K.Y., 2010. A choice experiment to estimate the eect of
green experience on preferences and willingness-to-pay for green building attributes.
Build. Environ. 45 (11), 25532561. http://dx.doi.org/10.1016/j.buildenv.2010.05.
017.
Chegut, A., Eichholtz, P., Kok, N., 2014. Supply, demand and the value of green buildings.
Urban Stud. 51 (1), 2243. http://dx.doi.org/10.1177/0042098013484526.
Chen, H., Chen, F., Huang, X., Long, R., Li, W., 2017. Are individuals environmental
behavior always consistent?An analysis based on spatial dierence. Resour.
Conserv. Recycl. 125, 2536. http://dx.doi.org/10.1016/j.resconrec.2017.05.013.
Choi, C., 2009. Removing market barriers to green development: principles and Action
projects to promote widespread adoption of green development practices. J. Sustain.
Real Estate 1 (1), 107138.
Croasmun, J.T., Ostrom, L., 2011. Using likert-Type scales in the social sciences. J. Adult
Educ. 40 (1), 19.
Evans, M., 2006. At the interface between theory and practice policy transfer and
lesson-drawing. Public Admin. 84 (2), 479489. http://dx.doi.org/10.1111/j.1467-
9299.2006.00013.x.
Field, A.P., 2009. Discovering Statistics Using SPSS: and Sex, Drugs and Rock'n'roll Vol. 3
SAGE, London.
Gan, X., Zuo, J., Ye, K., Skitmore, M., Xiong, B., 2015. Why sustainable construction?:
Why not? An owner's perspective. Habitat Int. 47, 6168.
Gou, Z., Lau, S.S.-Y., Prasad, D., 2013. Market readiness and policy implications for green
buildings: case study from Hong Kong. J. Green Build. 8 (2), 162173. http://dx.doi.
org/10.3992/jgb.8.2.162.
Green building, 2011. Green Building: Project Planning & Cost Estimating. RSMeans,
Hoboken, N.J.
Hair, J.F., 2006. Multivariate Data Analysis Vol. 6 Pearson Prentice Hall, Upper Saddle
River, N.J.
Ho, L.W., Dickinson, N.M., Chan, G., 2010. Green procurement in the Asian public sector
and the Hong Kong private sector. Natural Resources Forum Vol. 34. Wiley Online
Librarypp. 2438.
Homan, A.J., Henn, R., 2008. Overcoming the social and psychological barriers to green

19
H.-T. Nguyen et al.
building. Org. Environ. 21 (4), 390419. http://dx.doi.org/10.1177/
1086026608326129.
Hwang, B.-G., Shan, M., Xie, S., Chi, S., 2017. Investigating residents perceptions of green
retrot program in mature residential estates: the case of Singapore. Habitat Int. 63,
103112. http://dx.doi.org/10.1016/j.habitatint.2017.03.015.
Isa, M., Rahman, M.M.G.M.A., Sipan, I., Hwa, T.K., 2013. Factors aecting green oce
building investment in Malaysia. Proc.-Social Behav. Sci. 105, 138148.
Kats, G., 2009. Greening Our Built World: Costs, Benets, and Strategies 276.
Kelly, W.E., 2007. Introducing standards and sustainable design. J. ASTM Int. 4 (7), 111.
http://dx.doi.org/10.1520/JAI101070.
Kenny, C., 2007. Construction, Corruption, And Developing Countries. (Retrieved from
https://ssrn.com/abstract=996954).
Komurlu, R., Arditi, D., Gurgun, A.P., 2015. Energy and atmosphere standards for sus-
tainable design and construction in dierent countries. Energy Build. 90 (2015),
156165. http://dx.doi.org/10.1016/j.enbuild.2015.01.010.
Kumar, S., Kapoor, R., Rawal, R., Seth, S., Walia, A., 2010. Developing an energy con-
servation building code implementation strategy in India. Paper Presented at ACEEE
Summer Study on Energy Eciency in Buildings(Retrieved from http://www.aceee.
org/les/proceedings/2010/data/papers/2174.pdf).
Le, T.B.T., 2008. Kin trc xanh v nhng vn ang tn ti Vit Nam [Green ar-
chitecture and barriers in Vietnam]. Architecture Magazine of Vietnam Association of
Architects.
Le, T.B.T., 2014. Xa b quan nim cho rng chi ph cao khi xy dng cng trnh xanh
[Eliminating misconceptions about green building costs]. Architecture Magazine of
Vietnam Association of Architects.
Li, Y.Y., Chen, P.-H., Chew, D.A.S., Teo, C.C., Ding, R.G., 2011. Critical project man-
agement factors of AEC rms for delivering green building projects in Singapore. J.
Constr. Eng. Manage. 137 (12), 11531163. http://dx.doi.org/10.1061/(ASCE)CO.
1943-7862.0000370.
Li, Y., Zhang, X., Ding, G., Feng, Z., 2016. Developing a quantitative construction waste
estimation model for building construction projects. Resour. Conserv. Recycl. 106,
920. http://dx.doi.org/10.1016/j.resconrec.2015.11.001.
Liu, Y., Guo, X., Hu, F., 2014. Cost-benet analysis on green building energy eciency
technology application: a case in China. Energy Build. 82, 3746. http://dx.doi.org/
10.1016/j.enbuild.2014.07.008.
Meade, N., Islam, T., 2006. Modelling and forecasting the diusion of innovation a 25-
year review. Int. J. Forecast. 22 (3), 519545. http://dx.doi.org/10.1016/j.ijforecast.
2006.01.005.
Mellross, M., Bud Fraser, 2012. Developing municipal policy and programs to accelerate
market transformation in the building sector. J. Green Build. 7 (4), 4661. http://dx.
doi.org/10.3992/jgb.7.4.46.
Minh Do, T., Sharma, D., 2011. Vietnam's energy sector: a review of current energy po-
licies and strategies. Energy Policy 39 (10), 57705777. http://dx.doi.org/10.1016/j.
enpol.2011.08.010.
Mulligan, T.D., Mollaolu-Korkmaz, S., Cotner, R., Goldsberry, A.D., 2014. Public policy
and impacts on adoption of sustainable built environments: learning from the con-
struction industry playmakers. J. Green Build. 9 (2), 182202. http://dx.doi.org/10.
3992/1943-4618-9.2.182.
Nalewaik, A., Venters, V., 2009. Cost benets of building green. Cost Eng. 51 (2), 2834.
Ngacho, C., Das, D., 2014. A performance evaluation framework of development projects:
an empirical study of Constituency Development Fund (CDF) construction projects in
Kenya. Int. J. Project Manage. 32 (3), 492507.
Nguyen, H.-T., Gray, M., 2016. A review on green building in vietnam. Proc. Eng. 142,
314321. http://dx.doi.org/10.1016/j.proeng.2016.02.053.
Nguyen, H.K., 2016. Nhng nhn thc sai lm v Cng trnh Xanh Vit Nam [The
misconceptions about Green buildings in Vietnam]. Architecture Magazine of
Vietnam Association of Architects.
Oishi, S., 2003. In: How to Conduct In-person Interviews for Surveys. United States.
Pham, D.N., 2015. Pht trin cng trnh xanh Vit Nam Thc trng v xut
[Developing green building in Vietnam status quo and recommendations]. Tp Ch
Kin Trc Vit Nam [J. Vietnamese Arch.] (12/10/2015).
Potbhare, V., Syal, M., Korkmaz, S., 2009. Adoption of green building guidelines in de-
veloping countries based on U.S. and India experiences. J. Green Build. 4 (2),
158174.
Qian, Q.K., Chan, E.H.W., 2010. Government measures needed to promote building en-
ergy eciency (BEE) in China. Facilities 28 (11/12), 564589. http://dx.doi.org/10.
Resources, Conservation & Recycling 127 (2017) 820
1108/0263277101106662.
Qian, Q.K., Fan, K., Chan, E.H.W., 2016. Regulatory incentives for green buildings: gross
oor area concessions. Build. Res. Inf. 44 (5-6), 675693. http://dx.doi.org/10.1080/
09613218.2016.1181874.
Retzla, R., 2010. Developing policies for green buildings: what can the United States
learn from the Netherlands. Sustain. Sci. Pract. Policy 6 (1), 2938.
Samari, M., Godrati, N., Esmaeilifar, R., Olfat, P., Mohd Wira Mohd, S., 2013. The in-
vestigation of the barriers in developing green building in Malaysia. Modern Appl.
Sci. 7 (2), 1. http://dx.doi.org/10.5539/mas.v7n2p1.
Sayyed, A.M., Do, N.D., 2015. Green Buildings in Vietnam Barriers in National
Technical Codes and Standards [Pht Trin cng trnh xanh ti Vit Nam Nhng
vn lin quan n Quy Chun Tiu chun Xy dng]. (Retrieved from J.
Vietnamese Arch. website: http://kientrucvietnam.org.vn/phat-trien-cong-trinh-
xanh-tai-viet-nam-nhung-van-de-lien-quan-den-quy-chuan-tieu-chuan-xay-dung/).
Sev, A., 2009. How can the construction industry contribute to sustainable development?
A conceptual framework. Sustain. Dev. 17 (3), 161173. http://dx.doi.org/10.1002/
sd.373.
Shai, F., Othman, M.Z., 2006. Sustainable buildings in south-East asia: opportunities and
implementation. Proceedings of the Conference on Sustainable Building South-East
Asia (SB04SEA) 19.
Shai, F., Othman, M.Z., 2007. Sustainable building in the Malaysian context.
International Conference of Sustainable Building Asia.
Shen, L., Zhang, Z., Long, Z., 2017. Signicant barriers to green procurement in real estate
development. Resour. Conserv. Recycl. 116, 160168. http://dx.doi.org/10.1016/j.
resconrec.2016.10.004.
Solidiance, VGBC, 2013. Is There a Future for Green Buildings in Vietnam? (August).
(Retrieved from http://www.solidiance.com/whitepaper/is-there-a-future-for-green-
buildings-in-vietnam.pdf).
Tatarski, M., 2013. Green buildings in vietnam. Asia Life Magazine.
Teng, J., Zhang, W., Wu, X., Zhang, L., 2015. Overcoming the barriers for the develop-
ment of green building certication in China. J. Hous. Built Environ. http://dx.doi.
org/10.1007/s10901-015-9445-6.
Thilakaratne, R., Lew, V., 2011. Is LEED leading Asia?: An analysis of global adaptation
and trends. Proc. Eng. 21, 11361144. http://dx.doi.org/10.1016/j.proeng.2011.11.
2122.
van Bueren, E., 2009. Greening Governance: an Evolutionary Approach to Policy Making
for a Sustainable Built Environment. IOS Press, Amsterdam.
Vu, H.P., 2015. Th trng Cng trnh Xanh ti Vit Nam: tim nng v c hi [Green
building market in Vietnam: potential and opportunities]. Arch. Mag. Vietnam Assoc.
Arch.
Yang, Z., Yang, J., 2009. Sustainable housing implementation through mutual benets to
stakeholders: a decision making approach. In: Paper Presented at CRIOCM2009
International Symposium on Advancement of Construction Management and Real
Estate. Nanjing, China.
Yang, J., Yang, Z., 2015. Critical factors aecting the implementation of sustainable
housing in Australia. J. Hous. Built Environ. 30 (2), 275292. http://dx.doi.org/10.
1007/s10901-014-9406-5.
Yau, Y., 2012a. Eco-labels and willingness-to-pay: a Hong Kong study. Smart Sustain.
Built Environ. 1 (3), 277290. http://dx.doi.org/10.1108/20466091211287146.
Yau, Y., 2012b. Willingness to pay and preferences for green housing attributes in Hong
Kong. J. Green Build. 7 (2), 137152. http://dx.doi.org/10.3992/jgb.7.2.137.
Zhang, Y., Wang, Y., 2013. Barriers' and policies' analysis of China's building energy ef-
ciency. Energy Policy 62, 768773. http://dx.doi.org/10.1016/j.enpol.2013.06.
128.
Zhang, X., Liyin, S., Wu, Y., 2011a. Green strategy for gaining competitive advantage in
housing development: a China study. J. Clean. Prod. 19, 157167. http://dx.doi.org/
10.1016/j.jclepro.2010.08.005.
Zhang, X., Platten, A., Shen, L., 2011b. Green property development practice in China:
costs and barriers. Build. Environ. 46 (11), 21532160. http://dx.doi.org/10.1016/j.
buildenv.2011.04.031.
Zhao, X., Hwang, B.-G., Gao, Y., 2016. A fuzzy synthetic evaluation approach for risk
assessment: a case of Singapore's green projects. J. Clean. Prod. 115, 203213. http://
dx.doi.org/10.1016/j.jclepro.2015.11.042.
Zuo, J., Ben, R., Pullen, S., Qian, S., 2012. Achieving carbon neutrality in commercial
building developments Perceptions of the construction industry. Habitat Int. 36,
278286. http://dx.doi.org/10.1016/j.habitatint.2011.10.010.
20
 Construction and Building Materials 83 (2015) 16

Contents lists available at ScienceDirect

Construction and Building Materials

journal homepage: www.elsevier.com/locate/conbuildmat

A study on the color change benets of sustainable green building

materials
Yuan-Hsiou Chang a,, Po-Hsien Huang b, Bing-Yu Wu a, Shang-Wen Chang a
a
Department of Landscape Architecture and Environmental Planning, MingDao University, No. 369, Wen-Hua Rd., Peetow, ChangHua 52345, Taiwan
b
College of Design (Master of Arts Program), MingDao University, No. 369, Wen-Hua Rd., Peetow, ChangHua 52345, Taiwan

h i g h l i g h t s

 Green building materials should be endued spatial art and entertaining quality.
 Measure the RGB values of bricks at different temperatures and times.
 Groups A to D, and mixed with allochroic powders of different specications.

a r t i c l e i n f o a b s t r a c t

Article history: Environmental issues have become a topical subject in recent years. Numerous recycling resources can be
Received 16 September 2014 found in our living environment, such as fallen leaves, wood chips, recovered iron powder, waste
Received in revised form 3 February 2015 newspaper, waste concrete, reservoir silt, etc., which are utilizable waste materials. Related regulations
Accepted 21 February 2015
stipulate that the waste blending ratio of recycling green building materials should be higher than
Available online 12 March 2015
50%. In this study, three waste materials, including wood chips, concrete, and waste newspaper, were
mixed with gypsum and dissolved in thermochromic material, which is made into bricks. The thermal
Keywords:
radiation of sunlight can be absorbed by the bricks to change the hue. The experimental modules were
Thermochromic
Green building material
divided into ABCD groups, which were mixed with allochroic powder of different specications. The
Waste material RGB values of bricks at different temperatures and hours were measured by a color analyzer. The results
RGB showed that the rate of change in the RGB values of the ABCD groups is higher than 10.9% when the day
Mosaic Art night temperature difference exceeds 5 C. These allochroic bricks can be applied to the external walls of
buildings, providing landscape, building, and interior designers with another media for artistic creation.
2015 Elsevier Ltd. All rights reserved.

1. Introduction for the development and design of electrothermal household

In recent years, environmental issues, including green building
materials, have been a topical subject. Color-changing green
building materials can enhance the willingness to use and beatify
the green buildings. According to related regulations in Taiwan,
the usage rate of indoor green building materials shall be higher
than 45% of the total area, and that of outdoor materials shall be
higher than 10%. This suggests that the use of green building
materials is widely accepted. Lin [12] added printing paste in
thermochromic microcapsule prints, and used temperature change
to display the human imprint, called body symbols. Huang [7]
combined thermochromic pigments with electrothermal textiles
Corresponding author. Tel.: +886 937523685; fax: +886 4 8782134.
E-mail addresses: f89622050@ntu.edu.tw (Y.-H. Chang), shuyun38@yahoo.com.
tw (P.-H. Huang), j61up379210@gmail.com (B.-Y. Wu), csw@mdu.edu.tw
(S.-W. Chang).
textiles. Liu [13] applied the photochromic staining technique to
mobile communication products. Chen [5] used thermochromic
powder to observe whether there was current or heat conveyance.
Regarding nondestructive inspection methods, Jung [9] used allo-
chroic coating material to observe the distribution and shape of
the cavities and pores inside objects with the naked eye. Wu [23]
coated allochroic coating material on the surface of concrete speci-
mens, and as the thermal conductivity of concrete is different from
that of reinforcing steel bars, the surface color changed at different
speeds during the course of heat transfer. Annerel and Taerwe [2]
changed the color of concrete, studied the color space, and used an
assessment instrument to detect the corresponding re risk and
re damage. Short et al. [22] indicated that a re-damaged con-
crete structure is usually evaluated by visual inspection. If the color
turns from the normal color into pink or red, such signicant color
change means the concrete strength is damaged during heating,
thus, contributing to the structural damage detection rate.

http://dx.doi.org/10.1016/j.conbuildmat.2015.02.065
0950-0618/ 2015 Elsevier Ltd. All rights reserved.
2 Y.-H. Chang et al. / Construction and Building Materials 83 (2015) 16
Cement mortar properties, which are important factors for eval-
uating high temperature, can be inspected at high temperature
by color, surface temperature, image analysis, and quantized
brightness distribution [15]. Lin and Luo [11] indicated that col-
ored asphalt pavement can create a better visual environment by
enhancing driving safety and smoothness, and has better UV
resistance.
Allen et al. [1] and Bartlett et al. [3] indicated that European
countries developed the concept of recycling earlier than Japan
or the U.S., while the U.K. set a goal to achieve zero carbon emis-
sions from houses by 2016. The Ministry of Culture of the
Taiwan [16] indicated that the waste from building demolition
accounted for over 85%, which should be used efciently to reduce
the impact of waste on the environment. Kim et al. [10], Roulet
[20], and Zhang [24] found that about 40% of resources from build-
ing demolition were reused, and 60% were sent to dump areas,
thus, the impact on the environment could be reduced by com-
pletely planning the 60% waste. Velasco et al. [18] suggested that
bricks made of waste were environmentally friendly. Monalisa
et al. [17] pointed out that the latest trend for building materials
was to reuse surplus and unused materials, and recycling such
waste materials could reduce the consumption of natural
resources, thus, reducing energy consumption and pollution.
Jiang [8] proposed the blending ratio of the regenerated green
building materials and the recycled waste need to achieve for more
than 50%. Zhang [25] suggested that traditional bricks are made of
high temperature kilned clay or OPC concrete, meaning high
energy consumption and carbon emissions. The production of
waste-based bricks has been widely researched for environmental
protection and sustainable development, and waste recycled build-
ing materials have become the trend. Sergio et al. [21] mentioned
that burnt waste ceramics contributed to energy saving and cera-
mic performance. According to a comparison between earthen
gypsum and industrial gypsum (cement), the production of
earthen gypsum consumes relatively less energy, and the produc-
tion ow is simple. The process of mineralmade, general building
cement accounts for 6385% of overall mineral energy, and pro-
duces CO2, which highlights the importance of natural building
materials.
In terms of the principle of allochroic microcapsules, chromatics,
and hue evaluation, Lu [14] proposed that the color of ther-
mochromic dye could be changed by controlling temperature,
solvent polarity, and pH value for molecular rearrangement. Thus,
the molecules of organic dyestuffs and pigments could be rear-
ranged to create different thermochromic materials. The New
Prismatic Enterprise Co. [19] indicated that the color change princi-
ple of allochroic microcapsule is color development at low tem-
perature and achromaticity at high temperature. At temperatures
ranging between 15 C and 70 C, each temperature results in 15
colors, which could be mixed with each other. Moreover, pigments
of other products and multistage color changes are allowed. Chang-
chian [4] found that the RGB color lights are of an additive mix-
ture. The sum of three color lights is white, the difference of them
is black, and the gray level color is between black and white. The
pairwise color mixtures of color light RGB are three primary colors
of pigment, i.e. R + G = Yellow, G + B = Cyan, B + R = Magenta. In
1931, the International Commission on Illumination selected the
standard wavelengths of basic stimulating RGB color mixtures as
700.0 nm, 546.1 nm, and 435.8 nm. Chen [5] used anti-UV water-
proof weather resistant coating material, a light stabilizer, and
antioxidant to protect the allochroic powder. Moreover, he dened
the hue values of three primary colors, yellow (R value 255, G value
255, B value 0), blue (R value 0, G value 0, B value 255), and red (R
value 255, G value 0, B value 0). In terms of yellow allochroic
powder 31 C, the allochroic powder turns yellow when the
temperature is 31 C, it is colorless at high temperature, and only
develops color at low temperature. The color analyzer used by
Chang-chian [4] could measure the RGB and HSL values of an
objects surface color, and the surface coating colors of different
cement mortar specimens were measured using a color analyzer.
2. Research hypotheses
2.1. Null hypothesis (H0)
The three waste materials performed no color difference under
the same temperature conditions.
2.2. Alternative hypothesis (H1)
The three waste materials performed color difference under the
same temperature conditions.
3. Materials and methods
3.1. Research materials
In terms of the procurability evaluation of waste materials, the micromolecules
of waste newspaper, wood chips, and concrete blocks were mixed with allochroic
powder and gypsum powder to create thermochromic bricks. The layers from bot-
tom to top of each waste material brick included a 1.19 cm bottom layer, a 0.3 cm
allochroic layer, and a 0.01 cm surface protection coating, for a total thickness of
1.5 cm.
Brick size was unied at 5 cm  5 cm  1.5 cm (L  W  H), and according to
Gao et al. [6], the gypsum board was re proof and sound proof. Therefore, the
anhydrite was mixed with allochroic powder and different wastes to create bricks.
The mold was a 7 cm  7 cm  2 cm square, hollow, plastic mold. The brick making
procedure is described as follows. For the bottom layer, wastes were made into
micromolecules smaller than 0.3 cm, and mixed with gypsum and water. For the
material proportions, 15 g (25%) of gypsum, 60% waste and 15% water were mixed
with 0.5 ml of antioxidant and stabilizer respectively for 1 min. The mixture was
poured into a mold at a thickness of 1.19 cm. For the allochroic layer, 1.52 g allo-
chroic powder (8%) was mixed with gypsum, accounting for 60%, and water
accounting for 32%, to make the allochroic layer. The allochroic layer was 0.3 cm
thick, and dried for about 24 h. For surface protection coating, 0.01 cm thick
weather resistant surface protection coating was applied after the experiment
was completed. The experimental modules were divided into ABCD groups accord-
ing to the allochroic powder proportion. Each group contained three materials, and
allochroic powder at different temperatures was added, as shown in Table 1. Group
A used the contrasting colors of blue orange pigments (0.5 g model: acryliuqe301)
with allochroic powder (blue 25 C, 2 g). Group B was mixed with allochroic powder
of two temperatures (yellow 31 C, 1 g, blue 25 C, 1 g). Group C was mixed with
allochroic powder of three temperatures (yellow 31 C, 0.5 g, blue 25 C, 0.5 g, red
20 C, 0.5 g). Group D was mixed with allochroic powder of three temperatures
(yellow 40 C, 0.5 g, blue 31 C, 0.5 g, red 20 C, 0.5 g). The actual photo of the
completed bricks is as shown in Table 2.
In terms of experimental apparatuses and equipment, color analyzer TECPEL
Tech-Link TES 135 was used for RGB analysis, and a digital thermometer was used
for brick temperature measurement within a range of 10 C to +70 C. The digital
camera was a Sony DSC-W620, with 14.1 megapixels. Soil moisture and acidity
meter DM-15 was used for brick moisture distribution, with a measuring range
of: 18.
3.2. Research design
The ABCD groups were tested outdoors, and the experimental site was the
Sustainable Environment and Building Laboratory at MingDao University in
Taiwan. The groups were tested from September 25, 2012 to November 5, 2012.
The test bricks were placed on an outdoor cement oor, observed hourly from
5:00 a.m. to 10:00 p.m., and measured by color analyzer. The color analyzer was
afxed to the brick surface for ve times of rapid measurement, and the average
value was taken. The rate of change in the RGB of the various groups was analyzed
Table 1
Specications of allochroic powder for ABCD groups.
Groups A B C D
Allochroic powder
Yellow None 31 C (1 g) 31 C (0.5 g) 40 C (0.5 g)
Blue 25 C (2 g) 25 C (1 g) 25 C (0.5 g) 31 C (0.5 g)
Red None None 20 C (0.5 g) 20 C (0.5 g)
 Y.-H. Chang et al. / Construction and Building Materials 83 (2015) 16
Table 2
Brick experiment modules.
Group
Material
A B
Wood
Newspaper
Concrete
Sun
Thermo Brick
-meter
Fig. 1. RGB hue measurement method.
(data area was 0255), and the difference was determined in order to learn the
color change efciency of various groups, thus, providing a good reference for plac-
ing bricks outdoors in the future. The experimental mode is as shown in Fig. 1.
3.3. Statistical analysis
In statistics, one-way analysis of variance (one-way ANOVA) is a technique used
to compare means of three or more samples (using the F distribution). In this study,
one-way ANOVA was selected and SPSS statistical software was adopted.
4. Results and discussion
4.1. RGB color change efciency analysis of wood chip material in four
modules
4.1.1. Group A
According to the measured RGB data of Group A, the R value
was greater than the GB values, the R value changed obviously
from 9 a.m. to 10 a.m., and increased by 23.1%, reaching the full
value of 255. The R value was 40% higher than the G value and
47.8% higher than the B value at 10 a.m., and the RGB decreased
at 18:00 p.m. The R value decreased by 101 between 18:00 p.m.
and 10:00 p.m. In terms of overall rate of change in RGB of
Group A, R value was 40%, G value was 31.7%, and B value was
21.5%. This group mainly turned orange and purple; however, the
color changes occurred in the morning and evening when the tem-
perature was low, as shown in Fig. 2(a).
4.1.2. Group B
According to the measured RGB data of Group B, the maximum
rate of change in R value from 5:00 a.m. to 6 a.m. was as high as
28.2%, and then the RG became smooth. The R value increased by
only 6% from 6:00 a.m. to 6:00 p.m.; whereas, the B value
3
C D
decreased slightly by 10.5% at 10 a.m., and then increased, the dif-
ference between the G and B values was 18.4% at 12 p.m. The over-
all RGB began to decrease at 6:00 p.m., and R value had the
maximum decrease amplitude of 30.5%. In terms of rate of change
in RGB of Group B, the R value was 30.5%, the G value was 20.78%,
and the B value 10.9%, as shown in Fig. 2(b).
4.1.3. Group C
The measured RG values of Group C began to increase at
10:00 a.m., with an R value of 20.3%, and a G value of 24.3%. The
difference between the G value and B value was 34.1% at
12:00 p.m., while the RG tended to decrease at 2:00 p.m. The R
value decreased by 80 from 2:00 p.m. to 10:00 p.m. In terms of rate
of change in the overall RGB of Group C, R value was 29%, G value
was 22.7%, and only B value had the minimum rate of change of
1.17%, which is because only 31 C yellow allochroic powder acts
at that time, and the B value was lower, as shown in Fig. 2(c).
4.1.4. Group D
According to the measured RGB values of Group D, the RG chan-
ged slightly, and only increased at 12:00 p.m., the R value was 5.4%,
the G value was 4.7%, and then the RG values began to decrease.
The R value decreased by 23 from 12:00 p.m. to 10:00 p.m. The dif-
ference between B value and R value was 20.3% at 12:00 p.m. The B
value was special, as it increased by 8.6% from 5:00 a.m. to
12:00 p.m., and decreased by 26.2% from 12:00 p.m. to
10:00 p.m., thus, the rate of change was higher than RG. In terms
of rate of change in overall RGB of Group D wood chips, the R value
was 9%, the G value was 12.5%, and the B value was 26.2%, as
shown in Fig. 2(d).
4.2. Comparison of RGB color change efciency of wood chip material
ABC groups
The ABC groups of wood chips are divided into RGB for analysis;
AB groups had the maximum R value, higher than Group C by
36.8%. As Group C was mixed with three kinds of allochroic pow-
der, the data were small at low temperatures. On the contrary,
the R value of Group A was 100% from 11:00 a.m. to 7:00 p.m., as
Group A was mixed with only 25 C allochroic powder, thus, it can-
not change when the temperature is higher than 25 C. Group A
was 16.4% higher than Group B at 12:00 p.m., and 45.4% higher
than Group C. The rate of change in Group B from 6:00 a.m. to
6:00 p.m. was only 2.3%. In terms of the overall rate of change in
R value, Group A was 40%; Group B was 29.8%; and Group C was
4 Y.-H. Chang et al. / Construction and Building Materials 83 (2015) 16
Fig. 2. RGB values of wood chip bricks in ABCD groups.
31.3%. It was observed that the rate of change in R value of the ABC
groups is higher than 29.8%, as shown in Fig. 3(a).
The G value began to change at 5:00 a.m., and Group B had the
highest data, which was higher than the AC groups by 41.1%. Due
to the specications of the allochroic powder added in Group C,
the data are small at low temperatures. Group A was mixed with
ordinary orange pigment, thus, the G value was relatively small.
Group A did not change from 10:00 a.m. to 6:00 p.m., as the
25 C allochroic powder of Group A did not take effect at high tem-
perature. On the contrary, the G value of Group C was changed by
24.3% from 10:00 a.m. to 6:00 p.m., Group B was higher than AC
groups at 12:00 p.m., 26.6% higher than Group A; and 29% higher
than Group C. In terms of overall rate of change in the G values
Fig. 3. RGB comparison values of wood chip brick in ABC groups.
of ABC groups, Group A was 31.7%; Group B was 17.6%; and
Group C was 29.8%. It was observed that the rate of change in G
value of the ABC groups during the day was higher than 17.6%,
as shown in Fig. 3(b).
The B value began to change at 5:00 a.m., and Group B had the
highest data, which was higher than the AC groups by 45.4%. As
Group A was mixed with ordinary orange pigment, the B value
was low at the beginning. Group A was largely changed by 19.6%
from 6:00 a.m. to 8:00 a.m. As the 25 C blue allochroic powder
of Group A took effect, Group B was higher than Group A by
15.6% at 12:00 p.m.; and 44.7% higher than Group C. On the con-
trary, Group C was changed by only 1.17% over the entire day. In
terms of overall rate of change in B value of the ABC groups,
Group A was 21.5%; Group B was 10.9%; and Group C was 1.1%.
It was observed that the rate of change in the B value of the AB
groups was higher than 10.9% during the day, while that of
Group C was only 1.1%, as shown in Fig. 3(c).
4.3. Comparison of RGB color change efciency of three materials of
Group D
Group D had the best performance among the four groups, thus,
the color change efciencies of the three materials of Group D are
discussed in-depth. In terms of R value at 5:00 a.m., the waste
newspaper was higher than wood chips and concrete, with a maxi-
mum difference of 8.6%. The overall R value of waste newspaper
was higher than wood chips and concrete. The waste newspaper
was changed obviously by 5.8% at 8:00 p.m. On the contrary, the
variation of concrete during the day was 2.7% only from
11:00 a.m. to 1:00 p.m., and the waste newspaper and wood chips
changed slightly from 11:00 a.m. to 1:00 p.m. The waste newspa-
per was changed by only 0.3% from 11:00 a.m. to 1:00 p.m.,
whereas, the concrete increased by 6.27% from 5:00 a.m. to
12:00 p.m., and decreased by 12.1% from 12:00 p.m. to
 Y.-H. Chang et al. / Construction and Building Materials 83 (2015) 16 5

10:00 p.m. The R value of wood chips was changed by 9% over the Table 3
entire day; waste newspaper was 13.3%; and concrete was 12.1%, ANOVA analysis results for group D.

as shown in Fig. 4(a). Dependent (I) (J) Mean p Description

The G value of waste newspaper was higher than wood chips variable Group Group Difference value
and concrete at 5:00 a.m., with the maximum difference of 14.9%. R 1 2 25.889() .000 Signicant
The overall G value of waste newspaper was higher than wood 1 3 9.722() .003 Signicant
chips and concrete. The waste newspaper changed obviously at 2 3 16.167() .000 Signicant

8:00 p.m., as it decreased by 5.8%. On the contrary, the concrete G 1 2 42.833() .000 Signicant
was largely changed by 19.6% from 8:00 a.m. to 3:00 p.m. during 1 3 16.222() .015 Signicant
2 3 26.611() .000 Signicant
the day, while the other materials had no signicant change from
8:00 a.m. to 3:00 p.m. The wood chip was changed by 4.7% only B 1 2 34.444() .000 Signicant
1 3 57.278() .000 Signicant
from 11:00 a.m. to 1:00 p.m., and the variation in the G value of 2 3 22.833() .025 Signicant
wood chips was 12.9% over the entire day; waste newspaper was

18%; and concrete was 26.6%, as shown in Fig. 4(b). The mean difference is signicant at the .05 level. Group 1 indicated wood chips,
Group 2 indicated waste newspaper and Group 3 indicated concrete blocks.
The B value of wood chips was higher than waste newspaper
and concrete at 5:00 a.m., with a maximum difference of 29.4%.
results of ANOVA implied that the three waste materials performed
The overall B value of wood chips was higher than waste newspa-
color difference under the same temperature conditions.
per and concrete. The wood chip was obviously changed by 12.1%
at 7:00 p.m. On the contrary, the waste newspaper and concrete
highly increased from 5:00 a.m. to 12:00 p.m., waste newspaper 5. Conclusions
was 26.6%; and concrete was 25.8%. They decreased from
2:00 p.m. to 3:00 p.m., waste newspaper was 22.3%; and concrete The ndings showed that the temperature on the day of mea-
was 18%. Wood chips were higher than concrete by 12.1% at surement of the ABC groups was 2127 C, and the daynight tem-
12:00 p.m., and the variation in the B value of wood chips was perature difference exceeded 7 C, in terms of overall rate of
18.4% over the entire day; waste newspaper was 34.9%; and con- change in RGB, the R value was 40% for Group A; G value was
crete was 30.1%, as shown in Fig. 4(c). 31.7%; B value was 21.5%, R value was 30.5% of Group B; G value
was 20.7%; B value was 10.9%, R value was 30.1% of Group C; G
value was 29%; B value was 22.7%. It was observed that the rate
4.4. Hypothesis test results for Group D of change in RGB of the ABC groups outdoors over the entire day
was higher than 10.9%. The temperature on the day of measure-
Since Group D had the best performance among the four groups, ment of Group D wood chips, waste newspaper, and concrete
one-way ANOVA statistical method was used to test this group. was 2531 C, and the daynight temperature difference exceeded
The results for ANOVA are list in Table 3 and it can be found that 6 C. In terms of overall rate of change in RGB, R value was 9% of
the statistical tests are all signicant (p < 0.01). The statistical wood chips; G value was 12.5%; B value was 26.2%, R value was
13.3% of waste newspaper; G value was 18%; B value was 35.6%,
and the R value was 12.1% of concrete; G value was 25.8%; and B
value was 27.8%. It was observed that the rate of change in RGB
of three outdoor materials of Group D over the entire day was
higher than 12.1%. Our results supported the hypothesis that the
allochroic powder color-change mode maintains but color varies
with the colors of recycling wastes. Future researchers may refer
to the above results for adjustment in order to change colors.

References

[1] Allen D, Bauer D, Bras B, Gutowski T, Murphy C, Piwonka T, et al.

Environmentally benign manufacturing: trends in Europe, Japan, and the
USA. J Manuf Sci Eng 2002;124(4):90820.
[2] Annerel E, Taerwe L. Methods to quantify the colour development of concrete
exposed to re. Constr Build Mater 2011;25:398997.
[3] Bartlett, H., Cook, A., Hines, C., Hoyes, R., (2004). Waste minimization and
material reuse at Eden Project.
[4] Chang-chian, S.Y. (2009), Fundamental Research on Improvement of Urban
Heat Island Effect Effect of Thermophysical Properties on Surface
Temperature, Masters thesis, Department of Civil and Ecological
Engineering, I-Shou University.
[5] Chen, R.C. (2009), Measurement of Sunlight Insulation by Camouage Paint
Coated on Transparent Glass, Masters thesis, Department of Electrical
Engineering, National Changhua University of Education.
[6] Gao JG, Jin Y, Wu ZC, Wang M, Liang XL. Study on white and colored PVAc
coatings based on anhydrite powders with different granularities. J Anhui Univ
Technol Sci 2009;2(3).
[7] Huang, L.U., (2009). The Design of Thermochromic Home Textiles by Using
Electric Heating Techniques, Shu-Te University.
[8] Jiang, J.M. (2005). Evaluation manual for green building material. Architecture
and building research institute, ministry of the interior in Taiwan.
[9] Jung PL. Study of thermal sensitive coating application in non-destructive
testing. National Chiao Tung University; 2009.
[10] Kim J, Rigdon B. Qualities use and examples of sustainable building materials.
National Pollution Prevention Center for Higher Education. Ann Arbor
1998:3223.
[11] Lin DF, Luo HL. Fading and color changes in colored asphalt quantied by the
Fig. 4. RGB comparison among different materials of Group D. image analysis method. Constr Build Mater 2011;18:25561.
6 Y.-H. Chang et al. / Construction and Building Materials 83 (2015) 16
[12] Lin SH. Body Space the Creation Discourse of Shu Hsia Lin. National Taipei
University of Education; 2008.
[13] Liu FG. The study of the photochromic and surface treatment technique apply
on the mobile telephone. National Chiao Tung University; 2008.
[14] Lu, C.C. (2008), A Study of Synthesis of Thermochromic Dyes, Masters thesis,
Department of Applied Chemistry, Chaoyang University of Technology.
[15] Luo HL, Lin DF. Study the surface color of sewage sludge mortar at high
temperature. Constr Build Mater 2007;21:907.
[16] Ministry of Culture of the Taiwan (2005), Challenge 2008 Intensied Program
of National Development, Executive Yuan.
[17] Monalisa B, Bhattacharyya SK, Minocha AK, Deoliya R, Maiti S. Recycled
aggregate from C&D waste & its use in concrete a breakthrough towards
sustainability in construction sector: a review. Constr Build Mater
2014;68:50116.
[18] Muoz Velasco P, Morales Ortz MP, MendvilGir MA, MuozVelasco L. Fired
clay bricks manufactured by adding wastes as sustainable construction
material a review. Constr Build Mater 2014;63:97107.
[19] New Prismatic Enterprise Co., Ltd (2012), <http://www.colorchange.com.tw/
zhtw/index.php/>.
[20] Roulet CA. Indoor environment quality and energy use in buildings. Energy
Environ 2001;33:18391.
[21] Sergio NM, Carlos MFV. On the production of red clay bricks from waste
materials: a critical update. Constr Build Mater 2014;68:599610.
[22] Short NR, Purkiss JA, Guise SE. Assessment of re damaged concrete using
colour image analysis. Constr Build Mater 2001;15:915.
[23] Wu HT. A feasibility study of thermal sensitive coating as alternative steel bar
position testing for RC members. National Chiao Tung University; 2009.
[24] Zhang F. Framework for building design recyclability. U.S.: University of
Kansas School of Engineering; 2008. 211212.
[25] Zhang L. Production of bricks from waste materials a review. Constr Build
Mater 2013;47:64355.
 Journal of Cleaner Production 163 (2017) S68eS78

Contents lists available at ScienceDirect

Journal of Cleaner Production

journal homepage: www.elsevier.com/locate/jclepro

Sustainable buildings for healthier cities: assessing the co-benets of

green buildings in Japan
Osman Balaban a, Jose A. Puppim de Oliveira b, c, d, e, f, g, *
a
City and Regional Planning Department, Middle East Technical University, Ankara, 06800, Turkey
b
Fundaa~o Getulio Vargas (FGV), Sa~o Paulo School of Business Administration (FGV/EAESP) and Brazilian School of Public and Business Administration
(FGV/EBAPE), Brazil
c
COPPEAD Institute, Federal University of Rio de Janeiro (COPPEAD/UFRJ), Brazil
d
School of International Relations and Public Affairs (SIRPA), Fudan University, China
e
United Nations University International Institute for Global Health (UNU-IIGH), Kuala Lumpur, Malaysia
f
United Nations University Institute for the Advanced Study of Sustantability (UNU-IAS), Tokyo, Japan
g
MIT-UTM Malaysia Sustainable Cities Program (2015e2016), Malaysia/USA

a r t i c l e i n f o a b s t r a c t

Article history: High concentrations of people and economic activities in urban areas have strengthened the links be-
Received 4 March 2015 tween cities, health and the environment. Cities are not only responsible for environmental and health
Received in revised form problems but also they hold the key for a greener economy and a sustainable future. Urban built envi-
17 December 2015
ronment is a policy eld where appropriate policies and actions could yield signicant human and
Accepted 27 January 2016
ecological benets. Among different elements of urban built environment, buildings deserve particular
Available online 12 February 2016
attention due to their large contribution to environmental and health problems. The concept of sus-
tainable (green) building is a recent response to address the problems that stem from the building sector.
Keywords:
Green buildings
However, the widespread implementation of the concept is hindered by signicant challenges. This
Sustainability paper argues that manifestation of multiple benets that sustainable buildings deliver could help
Co-benets overcome some of these challenges. The paper presents the extent to which green buildings could
CO2 reduction generate co-benets, and underlines the opportunities and barriers to push green building agenda
Monetary benets forward.
Health benets The results indicate that green and sustainably renovated buildings could yield signicant benets in
terms of energy and CO2 reduction, cost savings, and improved health situation for building users. The
case study buildings with the best two performances are found to achieve 33% and 26% reduction in
energy use intensity, and 38% and 32% reduction in CO2 emissions intensity in comparison to benchmark
values. Reduction in energy consumption in the top two buildings corresponds to an energy cost saving
of $ 1e1.5 Million per year per building. Furthermore, the top two buildings are found to provide
improved healthy environment due to improved indoor and ambient air quality, better thermal comfort
and more natural lighting indoors. Making more explicit the multiple benets of sustainable buildings
needs further consideration in this regard. We recommend that the public sector could take key actions
to accelerate the number of green buildings including scal support, technical assistance and policy
reforms.
2016 Elsevier Ltd. All rights reserved.

1. Introduction: sustainable buildings for healthier cities

Cities now accommodate more than half of the world's popu-

* Corresponding author. United Nations University International Institute for
Global Health (UNU-IIGH), UKM Medical Center, 56000 Cheras, Kuala Lumpur,
Malaysia.
E-mail addresses: obalaban@metu.edu.tr (O. Balaban), japo3@yahoo.com
(J.A. Puppim de Oliveira).
lation and the majority of its crucial economic activities. They are
key for achieving the Sustainable Development Goals (SDGs) and
there is an specic goal (SDG 11) for cities (UN, 2015). High con-
centrations of people and economic activities in urban areas have
strengthened the links between cities, health and the environment,

http://dx.doi.org/10.1016/j.jclepro.2016.01.086
0959-6526/ 2016 Elsevier Ltd. All rights reserved.
 O. Balaban, J.A. Puppim de Oliveira / Journal of Cleaner Production 163 (2017) S68eS78
including climate change (Costello et al., 2009). On the one hand,
cities are responsible for between 67 and 76% of global energy use
and considered to be both the causes and victims of local and global
environmental problems (Puppim de Oliveira et al., 2011; Balaban,
2012a; Seto et al., 2014). On the other hand, urban life is associated
with a growing number of people with certain non-communicable
health problems, such as diabetes and cardio-vascular diseases
related to high levels of obesity, bad eating habits and lack of
physical activities (Bai et al., 2012). The increasing role of cities in
shaping global environmental and health outcomes has increased
the attention on urban policies to address those challenges. Such
policies mostly refer to interventions into key spatial elements in
cities, and range from regional scale to building scale (Balaban and
Puppim de Oliveira, 2014).
The co-benets approach addresses climate change mitigation
concerns, while also addressing specic local problems or helping
achieve specic development targets (Puppim de Oliveira, 2013).
The approach emerges as a winewin strategy or a means to achieve
more than one outcome with a single policy (Puppim de Oliveira
et al., 2013b). While one of these outcomes is denitely reduction
in GHG emissions, the others can range from improved air quality
or health conditions in cities to economic benets and savings.
Improving urban built environment could denitively yield a series
of the co-benets above. The delivery of a local co-benet along
with the climate co-benet can help in engaging policy and
decision-makers to take action for climate change mitigation,
which is normally not in their top priority list, especially in
developing nations.
Strengthening the governance of different urban sectors is key
to generate co-benets and achieve a greener economy and
healthier cities (Puppim de Oliveira et al., 2013a). Among different
sectors of urban development, the building sector deserves
particular attention due to its contribution to environmental
problems, especially global warming and low air quality. Urban
buildings are among major sources of excessive resource use and
energy consumption, and thereby potentially are large greenhouse
gas (GHG) emitters. Moreover, buildings shape human health
directly, as urban dwellers spend large part of their lives inside
buildings.
The building sector is the largest energy consumer exceeding
industry and transport sectors in many cities and regions, such as
the European Union (EU) and the United States (Wang et al., 2012;
Juan et al., 2010). Buildings' share in total nal energy use is 39% in
the UK and 37% in both the EU and the US (Juan et al., 2010; Perez-
Lombard et al., 2008). Forecasts and analyses indicate that energy
use in built environment will grow by 34% by 2030, in which shares
of domestic and non-domestic sectors will be 67% and 33%
respectively (Perez-Lombard et al., 2008). High use of energy in the
building sector has increased the sector's share in total GHG
emissions. The sector is responsible for 15% of global GHGs, in
which shares of commercial and residential buildings are 2/3 and 1/
3 of this value respectively (Baumert et al., 2005). In the EU, energy
consumption in building stock contributes to 25% of its total CO2
emissions (Uihlein and Eder, 2010). Share of buildings in total en-
ergy use and associated GHG emissions are lower in most devel-
oping countries, though the building sector in China was already
responsible for 25% of total energy consumed in the country in the
last decade (Jiang and Tovey, 2009). Developing countries will
surpass developed ones in energy use in urban buildings, as future
urban population growth will take place mostly in developing
countries. The annual growth rate of new building construction was
around 7% in China and 5% in India, as opposed to only 2% in the
developed world in mid 2000s (Baumert et al., 2005). Proliferation
of energy use and GHG emissions in urban built environment have
made energy efciency and saving strategies a policy priority
S69
particularly for developing building regulations in many countries
(Perez-Lombard et al., 2008).
Along with GHG emissions, building sector is also known to be
responsible for health or wellbeing related problems in cities. In
developing nations, the many of the urban poor live in low-quality
buildings that are highly vulnerable to adverse environmental
impacts due to either being located on hazardous sites or without
adequate services in slum areas. Poor residents of slums are
exposed to various health risks and illness originating from un-
sanitary housing and indoor air pollutants (Ahmad and Puppim de
Oliveira, 2015). For example, a cholera outbreak due to ground
water contamination from insufcient sanitation measures resul-
ted in death of 1500 slum residents in 1988 in Delhi (Roy, 2005).
Health-related impacts of buildings are not limited to slums. Pre-
vious research has shown that design of ofce buildings may have
signicant inuence on their occupants' health and wellbeing
(WorldGBC, 2014). An investigation on the relationship between
view quality, day lighting and sick leave of employees in adminis-
tration ofces of Northwest University (Washington State, USA) has
concluded that employees in ofces with better daylight and views
took 6.5% fewer sick days (Elzeyadi, 2011). Another study concluded
that good indoor air quality led to reduction in absences of em-
ployees due to health problems. Milton et al. (2000) have found
that short-term sick leave was 35% lower in ofces ventilated with
greater supply rates of outdoor air. A case study conducted in
Singapore indicated that naturally ventilated buildings had caused
lower thermal discomfort when compared to air-conditioned
buildings, which were overcooled and caused up to one-third of
their occupants to experience cooler thermal comfort sensations
(De Dear et al., 1991). Thus, relevant policies in building sector not
only help mitigate global and local environmental problems but
also help improve health and living conditions of people living in
cities.
The concept of sustainable (or green) building is a recent
response to address environmental and health problems that stem
from buildings and reduce impacts of the building sector on nat-
ural environment, as well as on people. Although denitions vary,
sustainable building refers to application of sustainability princi-
ples to design, construction and management of buildings so as to
mitigate environmental footprints of building sector and its sur-
roundings, and consequently on humans (Balaban, 2012b; Tan
et al., 2011). More specically, sustainability in building con-
struction and operation aims at minimization of environmental
impacts and resource utilization as well as maximization of utility
and investment returns in the building sector (Ding, 2008). There
are two major strategies for making buildings more sustainable or
greener. The rst one is the construction of new (green) buildings,
which represents a key policy to achieve urban sustainability by
changing the built environment (Cidell and Cope, 2014). The sec-
ond strategy is the sustainable renovation of existing buildings,
which is an alternative to new construction given high investment
costs of new buildings (Juan et al., 2010). In the last decades, the
attention on construction of green buildings and renovation of
existing buildings with green technologies has grown consider-
ably. Major outcomes of this attention are the establishment of
green building councils and introduction of certication systems
to assess environmental performance of buildings and certify best
practices.
Despite the progress in development of sustainable building
concept, greening buildings has not taken place on a wider scale in
both developed and developing countries (Rode et al., 2011). The
widespread implementation of green building construction and
renovation is hindered by various challenges. Some of the challenges
are related to fundamental factors of building construction and
renovation like cost, maintenance and operation (GhaffarianHoseini
S70 O. Balaban, J.A. Puppim de Oliveira / Journal of Cleaner Production 163 (2017) S68eS78
et al., 2013). Furthermore, institutional and policy challenges like
low awareness on green buildings, confusion over implementation
process and low coordination among key agencies have proved to
limit green building activity (Van Schaack and BenDor, 2011).
The manifestation of benets that green and renovated build-
ings deliver, particularly in health, could help overcome the chal-
lenges towards sustainable buildings. So far, most research has
focused on energy performance of buildings in consideration of
increased energy use in built environment. Assessment of building
energy performance can help ascertain and monitor the efciency
of energy use in buildings as well as motivate building owners and
tenants to improve the energy performance of their buildings
(Wang et al., 2012; Ding, 2008). Various methods, such as
performance-based and feature-specic approaches;
measurement-based and calculation-based methods; indicators as
primary energy use and environmental load, have been developed
to evaluate building performance with regard to energy and sus-
tainability aspects (Wang et al., 2012; Juan et al., 2010; Heiselberg
et al., 2009). Yet, there is no one size ts all solution and no
unanimous agreement on which method to choose and employ
(Wang et al., 2012). Conversely, with the incorporation of new
concepts like carrying capacity, and user comfort and satisfaction
into building sustainability assessment, the assessment methods
are becoming more diverse (Bendewald and Zhai, 2013; Gou et al.,
2013). Thus, this paper is also an attempt to provide new insights
into assessment of green and renovated buildings based on the co-
benets approach. The paper departs from the idea that main-
streaming of co-benets approach into building performance
assessment can help manifestation of other benets than energy
savings, such as economic returns, resource security and improved
health situations.
The co-benets approach, as applied in this research, is different
from the Life Cycle Assessment (LCA), which is a method to evaluate
the environmental impacts of a product through all stages of its life
cycle. The LCA methodology aims at assessing the environmental
impacts of a system from cradle to grave (EPA, 2006). However,
the co-benets approach usually aims to nd out the multiple
benets of an intervention to a system at a particular part of the life
cycle of that system. In building sector, for instance, LCA includes
the entire life cycle of a building including design, construction,
operation and demolishing stages, and attempts to assess the total
environmental impacts of the building in terms of energy and
material uses as well as environmental releases. However, the co-
benets approach in this research focuses only on the operation
stage of a building, which is generally responsible from 80% of the
total energy use in a building's life cycle (Ramesh et al., 2010), and
attempts to manifest the multiple benets of green design tech-
niques and technologies utilized in a building. Moreover, co-
benets approach deals with reduction in energy use and its
other associated benets, whereas LCA evaluates resource and
material use along with energy consumption.
Currently, the use of co-benets approach in performance
assessment of buildings is limited to some recent research
(Ardentea et al., 2011; Jiang et al., 2013) and thus not sufciently
covered in the literature. This paper aims to contribute to this
emerging approach by applying it to the assessment of sustain-
ability performance of both green and renovated buildings using
the case of green buildings in the Greater Tokyo Area (GTA)1 in
Japan. In order to understand co-benets in buildings, this paper
1
Greater Tokyo Area (GTA) is a large metropolitan area centered around the
Tokyo Metropolitan Government (TMG) including several prefectures containing
cities like Yokohama and Kawasaki. It is the world's largest urban area with a
population estimated in 38 million inhabitants (UNDESA, 2014).
sets out to (a) apply the co-benets approach to building perfor-
mance assessment and manifest the major environmental, eco-
nomic and health benets of the case study buildings, (b) discuss
the most common green design techniques and technologies used
in the Japanese building sector, and (c) highlight the opportunities
and barriers to promote sustainable (green) buildings as part of
urban ecological infrastructure for healthier cities.
2. Research methodology
2.1. The context of Japan
GHG emissions in Japan increased 9% from levels of 1990,
reaching 1.37 billion tons by 2007 (Takemoto, 2011). Residential
and commercial buildings are major sources of increasing emis-
sions. For instance in Tokyo, residential and commercial buildings
were responsible for almost half of the CO2 emitted in 2008 (TMG,
2011a). Therefore, one major focus of climate policy in Japan is the
building sector, in which city and sub-national governments have
been leading many initiatives (Puppim de Oliveira, 2011).
Tokyo Metropolitan Government (TMG) has taken the lead in
Japan in addressing buildings-related environmental problems. At
present, the Cap and Trade Program and the Green Building Pro-
gram are the most important policy frameworks that regulate en-
ergy efciency in building sector in the GTA. The roots of both
policy frameworks date back to early 2000s, since then reduction of
CO2 emissions has become an important policy goal for TMG. The
Cap and Trade Program (Tokyo CTP) was launched in April 2010, as
the world's rst city-based cap and trade program including
buildings (Roppongi et al., 2016). Tokyo CTP is a mandatory emis-
sions reduction system and covers 1300 large CO2-emitting facil-
ities2 in commercial and industrial sectors (Nishida and Hua, 2011).
Almost all of the high-rise buildings in Tokyo are included in the
Tokyo CTP, which requires targeted facilities to reduce their emis-
sions by 25% in two ve-year periods from 2010 to 2020. The
program also includes an emission trading system that enables
facility owners to sell their excess reductions or purchase others'
excess reductions (Nishida and Hua, 2011).
While the Tokyo CTP targets existing buildings, the Tokyo Green
Building Program (Tokyo GBP) focuses on new buildings with the
aim of improving environmental performance of new building
construction. The program requires owners or developers of all
new buildings with total oor space exceeding 5000 m2 to conduct
an environmental performance evaluation and publish the Building
Environmental Plan, which presents the evaluation results on
TMG's website (TMG, 2011a; TMG, 2011b). The major aims of the
Tokyo GBP are to encourage building owners to apply
environmentally-friendly design principles based on TMG guide-
lines and to create a market to value green buildings highly (TMG,
2011a, 2011b).
Furthermore, Japan has its own green building evaluation and
rating system named the Comprehensive Assessment System for
Built Environmental Efciency (CASBEE). It is a voluntary and non-
regulatory program developed by the Japan Sustainable Building
Consortium during the early 2000s to promote sustainable build-
ings. The CASBEE system evaluates a building in terms of its envi-
ronmental quality and performance (Q), and its environmental load
on the external environment (L). In 2008, the CASBEE was revised
in a way to add an explicit CO2 reduction target to the system.
Yokohama City in GTA has introduced the CASBEE Yokohama in
2005. According to the CASBEE Yokohama, owners of buildings
2
The report can be found on the following link: http://www.tepco.co.jp/
corporateinfo/company/annai/shiryou/images/kankyo.pdf.
 O. Balaban, J.A. Puppim de Oliveira / Journal of Cleaner Production 163 (2017) S68eS78
exceeding a total oor space of 2000 m2 are obligated to conduct
self-assessments based on the CASBEE Yokohama guidelines and
report the results to city government during the planning stage of
construction. The city also introduced the CASBEE certication
system, which is of voluntary nature, in order to encourage building
owners to improve environmental performance of their buildings.
2.2. Data collection
This paper is based on a case study research method (Ragin and
Becker, 1992), which is appropriate to analyze problems in social
sciences that need in-depth understanding of the context and
cannot be addressed with quantitative data only. The research was
carried out in several steps. First, a literature review on the rela-
tionship between the building sector and environmental issues
including human health was made. In addition to the literature
review, the policy and legal frameworks that regulate sustainable
(green) buildings in Japan were examined. During these steps,
necessary information was obtained from various academic publi-
cations, governmental and nongovernmental documents between
2012 and 2015.
The data and information used to analyze the case studies in the
buildings were obtained through semi-structured interviews. We
have conducted 11 interviews with 24 people in order to collect
quantitative data and qualitative information. Interviewees were
(a) owners of the case study buildings, (b) managers of the case
study buildings, (c) design and construction experts of the case
study buildings, (d) ofcials of Yokohama City and Tokyo Metro-
politan Government, and (e) academic experts who are specialized
on building energy efciency in Japan. The interviews were semi-
structured and interviewees were allowed to bring up new issues
in line with the general discussion during the interviews. Most of
the interviews were conducted in 2012 but we had follow-up cor-
respondence with some of the interviewees via emails and follow
up recent in the literature between 2013 and 2015 in order to get
additional information. Although we did not follow a rigorous set of
questions, certain inquiries were raised during the research in-
terviews. These inquiries were as follows:

Current status of green and sustainable building construction in
Japan,

Major policy and legal frameworks that regulate construction
and renovation of green buildings in Japan,

Most common green design techniques and technologies
currently applied in the Japanese building sector,

Major opportunities and challenges to promote sustainable
(green) buildings in Japanese cities,

Quantitative data on energy consumption in case study
buildings.
2.3. Case study selection
Seven case study buildings located in Greater Tokyo Area (GTA)
were examined in the research. The reasons to focus on GTA in this
research are two-fold. Firstly, it is the largest and the richest urban
agglomeration in the world, where crucial economic activities,
powerful public and private institutions and key international or-
ganizations are concentrated. The headquarters of the biggest
Japanese companies together with regional branches of some
multinational corporations are located in GTA. Secondly, the gov-
ernments of Tokyo and Yokohama are some of the leaders among
Japanese cities to develop innovative policies for urban develop-
ment and environmental management. Therefore, GTA showcases
Japan in many aspects including new and innovative urban policies
S71
and state-of-the-art urban technologies. Moreover, after being
elected as an Olympic City in 2020, Tokyo plans to show case its
green initiatives. Considering the current developments in green
building construction and renovation in Tokyo Metropolitan Gov-
ernment and City of Yokohama, GTA has been selected as the case
study area of the research.
Case study buildings were identied based on certain features,
such as occupation status, dominant function and size in order to
facilitate a sound analysis, as well as access to the building infor-
mation. In the case selection, priority was given to buildings with
green certication or undergone sustainable renovation processes.
We aimed to analyze both green and renovated buildings to see the
differences in their performances. Four of the case study buildings
(A, B, C and D) were designed and constructed as certied green
buildings. These four buildings had been evaluated and certied by
the CASBEE system. The remaining three buildings (E, F and G) were
renovated as green buildings, i.e. these buildings have gone through
renovation processes in which they were equipped with some
green technologies to increase their energy and resource efciency.
We have also given priority to large ofce buildings in selection of
case study buildings. Although urban buildings show a greater
variety (including ofces, industrial buildings, residential apart-
ments, sports halls and convention centers and hotels), large ofce
buildings deserve particular attention due to their high energy and
resource use. Besides, urban residents spend most of their time in
their work places and it is mainly the service sector and ofce
buildings, where people in cities are employed. So, if there is a link
between human health and urban buildings, ofce buildings are
among the most appropriate places to focus on. Therefore, the
dominant use of the case study buildings is ofce use but in most of
them additional public or commercial functions exist. Table 1
presents the key information on case study buildings.
Data availability and accessibility has limited the selection of
case study buildings, even though we collected general information
about the building sector in Japan from the interviews. Building
owners and managers in Japan usually regard quantitative data on
energy and resource consumption in their buildings as commercial
information and tend not to share such data with third parties.
Furthermore, there were challenges to reach quantitative data on
energy and resource consumption through city governments, as
building owners usually add condentiality notice for such data
they submitted to municipalities. These challenges made it difcult
to increase the sample size of the case study research. Owners or
managers of various green or renovated buildings in GTA were
contacted in order to make research interviews and collect data.
Some of them did not accept our request to interview them due to
concerns over commercial condentiality. Thus, priority was given
to buildings with accessible contact persons and required data, and
we ended up with 7 cases. Given the limitations on sample size, we
are not in a position to make generalizations for the entire Greater
Tokyo Area and for all types of buildings in the GTA. However, the
sample size of this research is sufcient to provide new insights on
how effective green and renovated buildings are in generation of
co-benets. There are published papers in the literature, which are
based on empirical research with lower samples (see Ardentea
et al., 2011; Bendewald and Zhai, 2013; Jiang et al., 2013). More-
over, many of the interviews addressed general questions about the
building sector in Japan that went beyond the specic buildings.
2.4. Methods for data analysis
The co-benets of case study buildings were calculated or
manifested in terms of environmental benets, economic benets
and health benets. Environmental benets comprise of reductions
in (a) energy use intensity and (b) CO2 emissions intensity. Economic
S72 O. Balaban, J.A. Puppim de Oliveira / Journal of Cleaner Production 163 (2017) S68eS78

Table 1
Basic features of the case study buildings.

Building name Occupation status Quality status Total oor space Functional status Location

A Owner occupied Green building (certied) 92,000 m2 Ofce building with public gallery Yokohama
B Tenant occupied Green building (certied) 95,220 m2 Ofce building with commercial facilities Yokohama
C New buildinga Green building (certied) 114,539 m2 Ofce building with a shopping mall Yokohama
D New buildinga Green building (certied) 90,134 m2 Ofce building with commercial facilities Yokohama
E Tenant occupied Renovated building 393,000 m2 Ofce building with commercial facilities Yokohama
F Tenant occupied Renovated building 82,602 m2 Ofce building Tokyo
G Tenant/owner occupied Renovated Building 25,331 m2 Ofce building Tokyo

Note: Due to the request by owners and managers of the case study buildings, names of the buildings are undisclosed and each case study building is named with a letter.
a
These building were not in use at the time of the eldwork, but were supposed to be rented out soon after.

benets originate from cost-savings from reduced energy con- Box 1

sumption in a building. There are other co-benets of green and
sustainable buildings, such as the health improvement. Health
benets are inevitable outcomes of green and sustainable build-
ings, even though the benets may not be quantiable because of
their nature or lack of data.
The green technologies that are applied to make buildings more
sustainable also enable the occupants of these buildings to live in
healthier indoor and outdoor environments. Four main health
benets are observed in case study buildings based on the use of
sustainable strategies and green technologies. These health bene-
ts are (a) better indoor air quality, (b) more natural lighting in-
doors, (c) better ambient air quality and less heat to pedestrians
and (d) improved thermal comfort. Health benets are not very
easy to quantify. Long-term in-depth research is required for sound
quantication of health benets delivered by sustainable build-
ings. Due to lack of available data from the case study buildings, we
could not make a precise quantication of the health benets of
the case study buildings. On the other hand, an assessment of the
health benets could be made on the applied green strategies
(Table 2). By considering the green strategies applied in case study
buildings, we identied the health benet(s) delivered by the
buildings. For each health benet that a case study building de-
livers, a plus () sign is given in Table 3. Therefore, each plus ()
sign corresponds to one of the likely four health benets. For
instance, the building with four plus signs was found to provide all
of the four health benets from (a) to (d) specied above, whereas
the building with one plus sign provides only one of the four health
benets.
Energy use intensity, which is the total energy use per square
meter per year in a building, was calculated as per the equation
given in Box 1. There are three major sources of energy use in the
case study buildings. The rst is the electricity consumption for
lighting, ventilation, appliances, hot water supply, etc. The second
and third sources are for heating and cooling of the buildings based
on the consumption of heated water and cold water from District
Heating and Cooling Centers (DHCS). We collected the numerical
data on electricity, heated water and cold water consumption from
building owners or managers during the eldwork. The energy data
collected during the eldwork belonged to 2010 and 2011. In order
to calculate the total annual energy use of a building in a single unit,
we used the conversion factors for electricity, heated water and
cold water specied in the Energy-Saving Law of Japan. The con-
version factors are 9.76 MJ/kWh for electricity and 1.36 MJ/MJ for
district heat and cold water. These factors are widely used in Jap-
anese building sector by building owners and managers to calculate
total energy use of buildings and compare energy performances of
buildings. Details of calculation of total annual energy use of a
building are given in Box 2.
Likewise, CO2 emissions intensity was calculated per square
meter per year based on total energy use in a building that consists
Equation to calculate Energy Use Intensity of a building
EUI TEU/FAB
EUI: Energy Use Intensity (MJ/m2/yr); total energy con-
sumption per square meter per year
TEU: Total Annual Energy Use (MJ)
FAB: Floor Area of a Building (m2)
Box 2
Equation to calculate Total Annual Energy Use of a building
TEU [(ELU*9.76)(HWU*1.36)(CWU*1.36)]
TEU: Total Annual Energy Use (MJ); the sum of energy uses
for heating, cooling, ventilation, lighting, all appliances, hot
water supply, etc.
ELU: Total Annual Electricity Consumption (kWh)
HWU: Total Annual Heated Water Consumption (MJ)
CWU: Total Annual Cold Water Consumption (MJ)
9.76 is the conversion factor for electricity (MJ/kWh)
1.36 is the conversion factor for heated water and cold water
(MJ/MJ)
of annual electricity consumption and annual heated water and cold
water consumption. To make this calculation, specic CO2 emission
factors for electricity and natural gas reported by Tokyo Electric
Power Company (TEPCO) and Tokyo Gas were used. According to the
TEPCO Environmental Indicator Performance Record, CO2 emission
factor for Tokyo electricity (including Yokohama) is 0.384 kg-CO2/
kWh for 2009.2 Likewise, Tokyo Gas Group CSR Report 2011 in-
dicates the CO2 emission factor for Tokyo electricity as 0.384 kg-
CO2/kWh for 2010. Besides, in the latter report, CO2 emission factor
of steam and cooling water in Tokyo (including Yokohama) is listed
as 0.057 kg-CO2/MJ for the period of 2007e2010.3 Total CO2 emis-
sions and CO2 emissions intensity of case study buildings were
calculated as per the equation given in Box 3.
The energy use intensity and CO2 emissions intensity gures of
the case study buildings were evaluated against benchmark levels
in order to see the extent to which energy consumption and CO2
emissions had been reduced in the buildings. Benchmark levels are
the average values of annual energy consumption per square meter
3
The report can be found on the following link: http://www.tokyo-gas.co.jp/csr/
report_e/environment/06_09.html.
 O. Balaban, J.A. Puppim de Oliveira / Journal of Cleaner Production 163 (2017) S68eS78
Box 3
Equations to calculate Total CO2 Emissions and CO2 Emissions
Intensity of a building
CO2EMT [(ELU*0.384)(HWU*0.057)(CWU*0.057)]/
1000
CO2EMI CO2EMT/FAB
CO2EMT: Total CO2 Emissions (tons/yr); total annual CO2
emissions of a building
CO2EMI: CO2 Emissions Intensity (kg/m2/yr); total annual
CO2 emissions per square meter of a building
ELU: Total Annual Electricity Consumption (kWh)
HWU: Total Annual Heated Water Consumption (MJ)
CWU: Total Annual Cold Water Consumption (MJ)
FAB: Floor Area of a Building (m2)
0.384 kg-CO2/kWh is the CO2 emission factor of electricity in
the GTA
0.057 kg-CO2/MJ is the CO2 emission factor of steam and
cooling water in the GTA
Box 4
Equations to calculate Monetary Benefits (Cost Savings)
TES [(EUIBM-EUI)*FAB]
ELS [(TES*SHE)/9.76]
HCS [(TES*SHC)/1.36]
CSB [(ELS*18y) (HCS*5.6y)]/1,000,000
TES: Total Energy Saving (MJ); total energy saved in a
building per annum
EUIBM: Benchmark for Energy Use Intensity (MJ/m2/yr)
EUI: Energy Use Intensity of a Building (MJ/m2/yr)
FAB: Floor Area of the Building (m2)
ELS: Total Annual Electricity Saving in the Building (kWh)
SHE: Share of Electricity Consumption in Building's Total
Energy Consumption (%)
HCS: Total Annual Heating and Cooling Energy Saving in
the Building (MJ)
SHC: Share of Heated Water and Cold Water Consumption
in Building's Total Energy Consumption (%)
CSB: Cost Savings of the Building (million yen)
9.76 is the conversion factor for electricity (MJ/kWh)
1.36 is the conversion factor for heated water and cold water
(MJ/MJ)
18y (JPY) is the unit price of electricity (Yen)
5.6y (JPY) is the unit price of heating and cooling energy
(Yen)
and CO2 emissions per square meter in ofce buildings in Greater
Tokyo Area for the years 2011 and 2012 respectively. Benchmark
values were taken from ofcial documents provided by the TMG
and Japan Sustainable Building Consortium (JSBC). The benchmark
value for energy use intensity (2306 MJ/m2/yr) was determined
through a comprehensive research titled the Database for Energy
Consumption of Commercial Buildings between 2007 and 2011
(JSBC, 2012a; JSBC, 2012b). The benchmark for CO2 emissions in-
tensity was determined by the TMG based on the reports submitted
in accordance with the Tokyo Carbon Reduction Reporting Program
for Small and Medium-scale Facilities (TMG, 2012). The CO2 emis-
sions benchmark, which is 99.6 kg/m2/yr, is the value that applies
to semi-large-sized buildings that include complex commercial
S73
facilities for the year 2012 (TMG, 2012). Since we had difculties in
nding updated benchmark values for CO2 emissions intensity of
large-scale ofce buildings in the GTA, we had to use the bench-
mark for semi-large sized mixed-use buildings.
As one of the major co-benets of green buildings, monetary
gains were calculated by using total amount of energy savings in
case study buildings. This calculation was based on assumptions
that energy savings bring monetary benets to users of buildings.
In order to calculate economic benets, unit prices of electricity,
steam and cold water (for indoor heating and cooling) were used.
Unit prices of electricity (JPY18/kWh) and heating and cooling en-
ergy (JPY5.6/MJ) were taken from reports by the Energy Conser-
vation Center of Japan (ECCJ) and the Minato Mirai 21 District
Heating and Cooling Company respectively.4 Box 4 presents the
details of calculations of economic benets.
3. Results of the research in the case study buildings
3.1. Sustainable strategies and green technologies in case study
buildings
Green or renovated buildings are equipped with design strate-
gies and advanced integrated technologies to reduce energy and
resource consumption as well as to increase living and comfort
conditions. There are two basic design paradigms of strategies and
technologies applied to buildings in order to make them green and
sustainable; passive design and active design (Rode et al., 2011).
In passive design, natural elements such as air-ow and sunlight
are used to provide a comfortable indoor environment while
reducing energy demand for heating, ventilation and air condi-
tioning (HVAC) applications. Conversely, active design is based on
the use of newer technology and state-of-the-art systems to
improve energy efciency and reduce energy demand and resource
consumption in buildings. The mainstream approach in Japanese
building sector is to apply both paradigms to new building con-
struction and building renovations. In all of the case study build-
ings, application of both paradigms has been observed, although
with varying degrees. Table 2 presents the common design stra-
tegies and integrated technologies observed in case study build-
ings. The use of strategies and technologies listed in Table 2 has led
to the sustainability performance of case study buildings shown in
Table 3 and explained in Section 3.2. Moreover, these strategies are
known to provide a better indoor air quality, thermal comfort and
more daylight in buildings, which in turn may inuence the health
and wellbeing of the occupants in positive ways.
3.2. Co-benets of case study buildings
The results of the case study analysis are presented in Table 3.
The results indicate that green buildings can yield signicant
environmental, economic and health benets. The case study
building with the best performance in this research (Building A) has
an energy use intensity of 1537 MJ/m2/yr, which is 33% less than the
average energy use intensity of ofce buildings in the GTA in 2011.
Likewise, CO2 emissions intensity in this building is calculated as
around 62 kg per square meter, 38% less than the average of semi-
4
(a) For unit price of electricity, please see the report titled Guidebook on En-
ergy Conservation for Buildings: 2010/2011 by the ECCJ from the following link:
http://www.asiaeec-col.eccj.or.jp/brochure/pdf/guidebook_for_buildings_2010-
2011.pdf, (b) For unit price of heating and cooling energy, please see the report
titled MinatoMirai 21 District Heating and Cooling prepared by the Minato Mirai
21 District Heating and Cooling Company. Same information can be found on the
company's website from the following link: http://www.mm21dhc.co.jp/english/
faq/index.php#qes6.
S74 O. Balaban, J.A. Puppim de Oliveira / Journal of Cleaner Production 163 (2017) S68eS78

Table 2
Sustainable design strategies and green technologies in case study buildings.

Design Design strategy Denition and major benets of the strategy Use of strategy in Observed Health benets
paradigm case buildings environmental
benet

Passive design ECO-VOID SYSTEM An empty channel in the middle of the building, designed to Exists in A & B Energy saving: Healthier indoor
bring more natural light and fresh air into the building. Eco- Electricity saving environment: Better
void systems are combined with sun-tracking sensors and of 15% is achieved in indoor air quality and
mirrors on rooftop to catch the sun's movement and send Building B more natural lighting
more sunlight down the void. The system is also supported
with automatic lighting, which change intensity to
minimize electricity consumption when sunlight is
sufcient to light up each oor. Eco-voids also serve as
ventilation systems where used air is pushed out of the
building by using temperature and pressure differences.
SPECIAL FAADE Vertical pillars on facades are designed accordingly not to Exists in A, B, C, D & Energy saving: Healthier indoor
DESIGNS block the diffusion of natural light from openings to indoor F Triangular pillars environment: More
environment. In some faade designs, vertical pillars are bring 3 times more natural lighting
triangular rather than rectangular in shape in order to get natural lighting
more sunlight through windows. Pillars are also kept as thin indoors than
as possible to bring in more natural lighting. rectangular ones
EXTERNAL LOUVERS Louvers on building faades are used to avoid the direct Exists in A & C Energy saving: Healthier indoor
entrance of solar radiation into indoor environment. The Louver system environment: More
louver system helps reect sunlight into the building in of Building A delivers natural lighting
appropriate ways to prevent the building from overheating. a reduction
The need for indoor cooling and associated energy use is of 115,400 kgCO2 in
thus reduced. Some louver systems encourage the diffused 2009 by
reection of natural light towards the ceiling surface to controlling sunlight
increase illumination efciency with the help of daylight entrance
sensors that control the lighting equipment. into the building
ROOFTOP AND ON- Green surfaces on rooftops, also applied to existing Exists in A, B, C, D & Energy saving: Healthier outdoor
SITE GREENERY buildings as part of renovation schemes. Most buildings also E Natural cool down environment: Better
have greenery on site. Plantation of greenery on rooftops effect on buildings ambient air quality and
and sites help carbon sequestration, air quality less heat to pedestrians
improvement and also help cool down the building by nearby
reducing the UHI effect.
WATER RETAINING Pavements that retain water on rooftops and on site. The Exists in A, B & D Energy saving: Healthier outdoor
PAVEMENTS strategy aims to mitigate UHI effect and cool down Natural cool down environment: Better
buildings naturally and reduce energy use for indoor effect on buildings ambient air quality and
cooling. less heat to pedestrians
nearby
Active design DISTRICT HEATING Central systems that provide buildings with steam for All buildings Energy saving: Healthier indoor
AND indoor heating, cold water for indoor cooling and hot water connected to DHCS Efcient use of environment: Improved
COOLING SYSTEMS supply. Due to collective generation of steam and cooling energy for indoor thermal comfort
(DHCS) water, DHCSs are more energy efcient than stand-alone heating and
ones, and help achieve large energy savings and internal cooling
space savings.
BUILDING ENERGY Computerized energy management systems that reduce Exists in A & B Energy saving: Healthier indoor
MANAGEMENT energy use effectively without any adverse impact on Efcient use of environment: Improved
SYSTEMS (BEMS) internal comfort and safety. energy for indoor thermal comfort
heating and cooling
LED LIGHTS LED lights are better than normal lighting appliances, as Exists in all Energy saving:
they provide same amount of illumination with lower buildings Reduced energy use
energy use. for indoor lighting
LOW-E DOUBLE- Double-glazed glass panes sandwich air for insulation and a Exists in B, C & D Energy saving: Healthier indoor
GLAZED WINDOWS special metallic lm coating behind the glass pane enhances Reduced energy use environment: Improved
insulation performance. The system allows sunlight into the for indoor cooling thermal comfort
building but insulates excess heat and reduces energy use.
ON-SITE Solar PV panels on rooftops aim to replace part of non- Exists in A, C & D Energy saving:
RENEWABLE renewable energy use with clean energy. Yet, electricity Building A generate
ENERGY SOURCES generated by PV systems is minimal at present. 43.800 kWh of
electricity per year
RAINWATER These systems are used to save water. Harvested water is Exists in A, B, C, D, E Water saving:
HARVESTING used in toilets and for irrigation of rooftop or on-site &G Reduced water use
SYSTEMS gardens.
 O. Balaban, J.A. Puppim de Oliveira / Journal of Cleaner Production 163 (2017) S68eS78 S75

Table 3
Results of the analysis of the case study buildings.

Building name Rank Environmental benets Economic benets Health benets

Energy consumption CO2 emissions reduction

reduction

Total annual Energy Reduction Total CO2 Reduction Cost savings (yen) a) indoor air quality
energy use use intensity rate* CO2 emissions rate* b) natural lighting
(Thousand MJ/yr) (MJ/m2/yr) emissions intensity c) ambient air quality
(tons/yr) (kg/m2/yr) d) thermal comfort

Building A 1 141,379 1537 33.4% 5680 61.7 38.0% 183 million

Building B 2 161,615 1697 26.4% 6478 68.0 31.7% 145 million
Building C 3 217,595 1900 17.6% 8730 76.2 23.5% 118 million
Building F 4 161,008 1949 15.5% 6448 78.1 21.6% 73 million
Building D 5 182,542 2025 12.2% 7289 80.9 18.8% 60 million
Building E 6 No Data No Data No Data No Data 103.1 0% No Saving
Building G 7 79,877 3153 0% 3204 126.5 0% No Saving
Average values Av. 157,336 2043 11.4% 6305 85.0 14.6% 116 million Not applicable

*Reduction rate as compared to benchmark values determined by TMG and JSBC for the years 2011 and 2012. Benchmark values are 2306 MJ/m2/yr for energy use intensity
and 99.6 kg/m2/yr for CO2 emissions intensity.

large sized mixed-use buildings in Tokyo in 2012. Based on the
reductions in energy consumption and CO2 emissions, the case
study building with the best performance is found to yield an
annual economic benet of approximately JPY 183 Million
(approximately USD 1.5 Million in 11/2015) to its occupants, cor-
responding to JPY 2000 per square meter. Building B, which has the
second best performance, also delivers substantial amount of
environmental and economic benets like the Building A.
Furthermore, the two case study buildings with the top two per-
formances are also found to provide all of the likely four health
benets (Table 3).
When average values of all case study buildings are considered
(last row of Table 3), important environmental and economic ben-
ets are also observed. The energy use intensity in all case study
buildings analyzed is 2043 MJ/m2/yr, which corresponds to 11.4%
reduction compared to the benchmark level. The associated CO2
emissions of average annual energy consumption in case study
buildings are calculated as 85 kg per square meter, 14.6% less than
the benchmark (Table 3). Furthermore, the average economic benet
yielded by all case study buildings is calculated as JPY 116 million per
year, corresponding to around JPY 1000 per square meter. Finally, in
all case study buildings, there is at least one health benet that
emerges from active and passive design strategies applied.
Among the case study buildings examined, best performances
mostly belong to green buildings, especially the ones that are
already in use. The top two performances belong to Building A and
Building B, which were designed and built as green buildings and
have been in use for some years. They are followed by another
green building, Building C, which was about to be occupied at the
time of the eldwork. On the other hand, it has been observed that
existing renovated buildings may perform as well as green build-
ings. This is mostly due to wider implementation of District Heating
and Cooling Systems (DHCs) and Energy Service Companies
(ESCOs) in Japan. Building F is a good example of an energy-efcient
renovated building, as energy use intensity and CO2 emissions in-
tensity in this building are respectively 15.5% and 21.6% lower than
benchmark values. When health benets are considered, renovated
buildings are found to score lower than green buildings. Building F,
which has the top performance among renovated buildings, pro-
vides its occupants with two health benets (indicated with two
plus signs), which are more natural lighting indoors and improved
thermal comfort.
Actual performances of green buildings are better than their
planned performances mainly because of good energy management
during operation phase. Efcient use of energy in large commercial
buildings has for some time been a policy priority and a signicant
concern for national and local governments as well as building
owners and managers in Japan. The energy shortage caused by the
accident in Fukushima Nuclear Power Plant after the Tohoku
Earthquake and Tsunami in 2011 has increased such concerns over
energy consumption in the building sector. Owners and managers of
large commercial buildings within the supply area of Tokyo and
Tohoku power companies were asked by national and local gov-
ernments to reduce energy consumption in their buildings by 15%. In
line with this request, several measures and strategies were intro-
duced to cut down energy use in large commercial buildings in the
GTA. For instance, managers of Building A have introduced three
particular strategies in this respect: lunch-time darkening, turning
off the lights at 8 pm and 9 pm every night so as to darken the ofces
with no staff and shutting down heating and cooling system at 6 pm
every day. The rst two strategies were calculated to reduce elec-
tricity consumption for lighting by 17.4%. In sum, such measures and
strategies have been effective in improving energy efciency of
green buildings, leading to better actual performances than planned.
Another interesting nding is that owner-occupied buildings
had better performance than tenant-occupied ones. Although there
is only one owner-occupied building (Building A) among the case
study buildings, better performance of owner-occupied buildings
was also veried by the interviewees during the eldwork.
Considering the monetary gains from energy and resources savings,
buildings owners do not hesitate to invest in green technologies in
owner-occupied buildings. Monetary benets constitute signicant
returns on their investments. Yet, in tenant-occupied buildings,
building owners tend not to invest much in such technologies, as
monetary gains would go to tenants.
Performance of case study buildings in terms of reduced energy
and resource consumption is based mainly on efciency improve-
ments. Cleaner and renewable energy sources are not in place yet.
In all case study buildings, share of renewable energy in total en-
ergy supply was either non-existent or very marginal. However,
increasing attention on use of geothermal energy and ground
source heat pumps in building sector may be an opportunity for
future initiatives in Japan. Despite limited progress in use of
renewable energy in the building sector, performances of green and
renovated buildings in major Japanese cities are superior to their
international counterparts. For instance, in Jiang and Tovey's
research (2010), the CO2 emissions intensity in their case study
buildings were 178 kg CO2/m2/year in Beijing and 119 kg CO2/m2/
year in Shanghai, whereas the average CO2 emissions in case study
buildings in this research was 85 kg CO2/m2/year.
S76 O. Balaban, J.A. Puppim de Oliveira / Journal of Cleaner Production 163 (2017) S68eS78

4. Discussion are on voluntary basis. Regulatory and mandatory programs are

very recent and they stem from policy frameworks that are not
4.1. Challenges or barriers to sustainable buildings specically for building construction. Some of the interviewees
noted that there were no mandatory regulations or standards
The interviews conducted during the eldwork helped us iden- regarding energy and environmental efciency in the Building Act
tify the major barriers that hinder widespread implementation of of Japan.
sustainable (green) buildings in Japan. According to the in-
terviewees, initial investment costs are the main barrier to promote
4.2. Opportunities for sustainable buildings
sustainable buildings in Japan at present, as green technologies and
measures generally result in high investment costs. There are not
Our interviews also provided us with information to discuss the
many incentives from the Japanese government for real estate and
key opportunities for wider and better implementation of sus-
construction companies in this respect. Therefore, the major benet
tainable (green) buildings in Japan. Political will and commitment
to building owners is the cost savings from reduced energy con-
can be considered as one of the major success factors in promotion
sumption overtime for the occupants and trading opportunity in
of green and renovated buildings in Japan. There is a general
case of emission reductions. Companies, which are interested in
consensus among public and private agencies that in order to tackle
constructing a green building or retrotting their buildings, have to
global environmental problems and energy scarcity the focus
bear the upfront costs by themselves, and wait for the payback
should be on crucial sectors of urban development. The building
period to get returns on their investments. As per our interviewees,
sector is one of them, where policy initiatives to address environ-
payback period of green building technologies in Japan is around ten
mental problems including climate change have been introduced
years, which may be long for companies with limited resources. For
by public authorities. Tokyo's Cap and Trade Program (Tokyo CTP)
this reason, main players in green building market in Japan are now
was negotiated during many years and required political commit-
big companies with sufcient resources. At present, green buildings
ment from the authorities and other stakeholders (Roppongi et al.,
in the GTA are either the HQ buildings of large corporations or
2016). The interviews conducted during the eldwork have shown
leasehold buildings of big construction and real estate rms.
that public ofcials are well-aware of the problem and have sig-
As an outcome of the previously situation, owner-occupied
nicant motivation for further improvements.
buildings seem to have advantages over leasehold buildings, as
Corporate social responsibility (CSR) of private sector companies
concerns over return in investment are higher in case of the latter,
is common among private companies in Japan. Many companies
as the owner itself benets from energy savings. For this reason,
undertake voluntary actions to address environmental problems
pioneers and the leading examples of green buildings, such as
like climate change as part of their CSR. All building owners and
building A, are generally owner-occupied ones. However, green
managers interviewed have conrmed that good company image
building construction for rental purposes is increasing in recent
and improving their CSR were among the main motivations behind
years in Japan. The interviewees conrmed that big construction
their actions regarding green building construction or building
companies are investing in green building construction for rental
renovation for sustainability.
purposes, as there is also a growing interest in the demand side
Lastly, competition in the sector seems to be effective in pro-
(tenants), so as to develop technologies and innovative solutions to
moting green and sustainable buildings in Japan. As new green
export later.
buildings are coming to the market with superior design strategies
Fragmentation of legal and institutional frameworks is another
and technologies, this motivates construction and real estate
signicant barrier. Several policy and legal frameworks have been
companies to construct green buildings or renovate their buildings
developed by different public bodies in Japan with regards to
in order to attract tenants displaying their technologies. Japan has
green and renovated buildings, making the entire system too
at least ve big construction companies that have high institutional
complicated to follow and comply with. The interviews have
and innovative capacity. These companies tend to develop and
shown that companies with limited nancial and human re-
import new green technologies and therefore are willing to invest
sources have many difculties in this respect. Furthermore, there
in green buildings, which is an important opportunity for future.
are various public authorities involved in the system and in some
cases responsibilities are divided among them in not always ef-
cient ways. For instance, responsibilities regarding energy con- 5. Conclusion
sumption in buildings are divided between the Ministry of Land,
Infrastructure, Transport and Tourism (MLIT) and the Ministry of In order to achieve sustainable development goals, a large urban
Economy, Trade and Industry (METI) based on stages of con- transformation is necessary (McCormick et al., 2013) as well as a
struction. MLIT is responsible to deal with energy-related issues different public management agenda (Puppim de Oliveira et al.,
before and during the construction of buildings and then METI is 2015). Sustainable or green buildings, as application of sustain-
in charge of the same issues when construction is over and the ability principles to building sector, can be an effective strategy to
building is put in use. In Japan, the institutional complexity is address adverse environmental impacts and fundamental to create
known to hinder the achievement of energy efciency goals set by healthier and more ecological cities. This research presents the
policy and legal frameworks, as widely conrmed by our extent to which green and renovated buildings could generate co-
interviewees. benets, and underlines the opportunities and barriers to push
The complicated nature of policy frameworks hinders promo- sustainable buildings agenda forward. The research was limited to
tion of sustainable buildings in Japanese cities. Policy frameworks buildings in the GTA, what limits the scope of the study. Never-
related to building energy and environmental efciency, such as theless, because GTA is one of the leading urban regions in the
the Tokyo CTP and the CASBEE, are complicated and time- world in terms of building policies, many of the lessons and rec-
consuming. Our interviewees have mentioned that a certain ommendations can be useful for cities and countries that are
level of in-house expertise was required to follow and comply starting to develop green building initiatives. Based on the results
with these frameworks. Therefore, companies with limited re- of the research, following points are drawn as major conclusions,
sources are discouraged to implement green technologies in their policy implications and recommendations to eliminate barriers and
new building construction investments. Moreover, most initiatives utilize opportunities.
 O. Balaban, J.A. Puppim de Oliveira / Journal of Cleaner Production 163 (2017) S68eS78
Construction of green buildings or sustainable renovation of
existing ones can help mitigate carbon emissions by reducing en-
ergy demand and increasing energy efciency in buildings.
Furthermore, green and sustainable buildings can also provide
their inhabitants with healthier living and working environments
with improved thermal comfort and more natural ventilation and
lighting. Along with environmental and health benets, higher
returns on investment in green buildings are also very likely to
occur. However, there are various challenges to overcome in order
to deepen the co-benets of green and sustainable buildings.
Certication systems alone are not enough for a widespread
development of green buildings. Support mechanisms of various
sorts should be introduced to help companies with limited human
and nancial resources to advance in the construction and rent of
green buildings. Financial support and incentive mechanisms are
crucial in this respect, as well as proper regulations. Financial
support should be provided to assist companies during the payback
period of their green investments. Particularly, tax incentives and
long-term loans that will be paid back by cost-savings could be a
plausible policy option. As part of supportive mechanisms and co-
ordination among agencies (Van Schaack and BenDor, 2011), re-
visions should be made to policy and legal frameworks to make
them less complicated, straightforward and well-integrated to
facilitate policy implementation.
Building owners are in a better position to green buildings
compared to tenants, so better communication between owners
and tenants could help latter become more aware and knowl-
edgeable about legal frameworks to achieve energy and environ-
mental efciency. Governments should develop mechanisms to
increase owner and tenant communication and collaboration. In a
similar direction, mechanisms are needed to raise awareness of and
provide more information to basic consumers within the building
sector. Finally, regarding building green codes and certications we
recommend based on the literature (World GBC, 2014; Elzeyadi,
2011; Milton et al., 2000) that they go beyond the typical envi-
ronmental criteria and include other issues such as health (e.g.,
natural light, ventilation and indoor quality) as well as incentives to
physical activity of the occupants, such as using the stairs for short
internal trips, as well as behavior change in the use of energy or
water.
Acknowledgments
The authors are grateful to the Scientic and Technological
Research Council of Turkey (TUBITAK) and the United Nations
University Institute of Advanced Studies (UNU-IAS) who supported
the research through their postdoctoral research programmes. We
thank the interviewees for providing invaluable information and
two anonymous reviewers, who gave constructive comments in the
reviewing process.
References
Ahmad, S., Puppim de Oliveira, J.A., 2015. Fuel switching in slum and non-slum
households in urban India. J. Clean. Prod. 94 (2015), 130e136.
Ardentea, F., Beccali, M., Celluraa, M., Mistretta, M., 2011. Energy and environmental
benets in public buildings as a result of retrot actions. Renew. Sustain. Energy
Rev. 15 (2011), 460e470.
Bai, X., Nath, I., Capon, A., Hasan, N., Jaron, D., 2012. Health and wellbeing in the
changing urban environment: complex challenges, scientic responses, and the
way forward. Curr. Opin. Environ. Sustain. 4 (2012), 465e472.
Balaban, O., 2012a. Climate change and cities: a review on the impacts and policy
responses. METU J. Fac. Archit. 29 (1), 21e44.
Balaban, O., 2012b. The negative effects of construction boom on urban planning
and environment in Turkey: unraveling the role of the public sector. Habitat Int.
36 (1), 26e35.
S77
Balaban, O., Puppim de Oliveira, J.A., 2014. Understanding the links between urban
regeneration and climate-friendly urban development: lessons from two case
studies in Japan. Local Environ. Int. J. Justice Sustain. 19 (8), 868e890.
Baumert, K.A., Herzog, T., Pershing, J., 2005. Navigating the Numbers: Greenhouse
Gas Data and International Climate Policy. World Resources Institute, Wash-
ington, D.C.
Bendewald, M., Zhai, Z., 2013. Using carrying capacity as a baseline for building
sustainability assessment. Habitat Int. 37 (2013), 22e32.
Cidell, J., Cope, M.A., 2014. Factors explaining the adoption and impact of LEED-
based green building policies at the municipal level. J. Environ. Plan. Manag.
57 (12), 1763e1781.
Costello, A., Abbas, M., Allen, A., Ball, S., Bell, S., Bellamy, R., Friel, S., Groce, N., Johnson, A.,
Kett, M., Lee, M., Levy, C., Maslin, M., McCoy, D., McGuire, B., Montgomery, H.,
Napier, D., Pagel, C., Patel, J., Puppim de Oliveira, J.A., et al., 2009. Managing the
health effects of climate change: Lancet and University College London Institute for
Global Health Commission. Lancet 373, 1693e1733, 2009.
De Dear, R.J., Leow, K.G., Foo, S.C., 1991. Thermal comfort in the humid tropics: eld
experiments in air conditioned and naturally ventilated buildings in Singapore.
Int. J. Biometeorot. 34, 259e265.
Ding, G.K.C., 2008. 2008. Sustainable construction e the role of environmental
assessment tools. J. Environ. Plan. Manag. 86, 451e464.
Elzeyadi, I.M.K., 2011. Daylighting-bias and Biophilia: Quantifying the Impact of
Daylighting on Occupants' Health. Available at: http://www.usgbc.org/sites/
default/les/OR10_Daylighting%20Bias%20and%20Biophilia.pdf (accessed 15.02.
15.).
EPA, 2006. Life Cycle Assessment: Principles and Practice. EPA/600/R-06/060, May
2006. Ofce of Research and Development, U.S. Environmental Protection Agency.
GhaffarianHoseini, A.H., Dahlana, N.D., Berardi, U., GhaffarianHoseini, A.,
Makaremi, N., GhaffarianHoseini, M., 2013. Sustainable energy performances of
green buildings: a review of current theories, implementations and challenges.
Renew. Sustain. Energy Rev. 25 (2013), 1e17.
Gou, Z., Prasad, D., Lau, S.S.-Y., 2013. Are green buildings more satisfactory and
comfortable? Habitat Int. 39 (2013), 156e161.
Heiselberg, P., Brohus, H., Hesselholt, A., Rasmussen, H., Seinre, E., Thomas, S., 2009.
Application of sensitivity analysis in design of sustainable buildings. Renew.
Energy 34 (2009), 2030e2036.
Jiang, P., Tovey, N.K., 2009. Opportunities for low carbon sustainability in large
commercial buildings in China. Energy Policy 37, 4949e4958.
Jiang, P., Tovey, N.K., 2010. Overcoming barriers to implementation of carbon
reduction strategies in large commercial buildings in China. Build. Environ. 45
(4), 856e864.
Jiang, P., Donga, W., Kung, Y., Geng, Y., 2013. Analysing co-benets of the energy
conservation and carbon reduction in China's large commercial buildings.
J. Clean. Prod. 58 (2013), 112e120.
JSBC, 2012a. DECC: Database for Energy Consumption of Commercial Buildings.
JSBC, Japan Sustainable Building Consortium. Available at: http://www.jsbc.or.
jp/decc_english/pdf/decc-pamphlet.pdf (accessed 14.11.15.).
JSBC, 2012b. DECC: Database for Energy Consumption of Commercial Buildings:
Organized Statistical Data. JSBC, Japan Sustainable Building Consortium.
Downloadable from. http://www.jsbc.or.jp/decc_english/index.html (accessed
14.11.15.).
Juan, Y.K., Gao, P., Wang, J., 2010. A hybrid decision support system for sustainable
ofce building renovation and energy performance improvement. Energy Build.
42 (3), 290e297.
McCormick, K., Anderberg, S., Coenen, L., Neij, N., 2013. Advancing sustainable ur-
ban transformation. J. Clean. Prod. 50, 1e11.
Milton, D.K., Glencroos, P.M., Walters, M.D., 2000. Risk of sick leave associated with
outdoor air supply rate, humidication and occupant complaints. Indoor Air 10,
212e221.
Nishida, Y., Hua, Y., 2011. Motivating stakeholders to deliver change: Tokyo's cap
and trade program. Build. Res. Inf. 39 (5), 518e533.
Perez-Lombard, L., Ortiz, J., Pout, C., 2008. A review on buildings energy con-
sumption information. Energy Build. 40 (3), 394e398.
Puppim de Oliveira, J.A., 2011. Why an air pollution achiever lags on climate policy?
The case of local policy implementation in Mie, Japan. Environ. Plan. A 43 (8),
1894e1909.
Puppim de Oliveira, J.A., 2013. Learning how to align climate, environmental and
development objectives: lessons from the implementation of climate cobenets
initiatives in urban Asia. J. Clean. Prod. (Elsevier) 58 (1), 7e14. http://dx.doi.org/
10.1016/j.jclepro.2013.08.009.
Puppim de Oliveira, J.A., Balaban, O., Doll, C.N.H., Moreno-Penaranda, R.,
Gasparatos, A., Iossifova, D., Suwa, A., 2011. Cities, biodiversity and governance:
perspectives and governance challenges for the convention on biological di-
versity at the city level. Biol. Conserv. 144 (5), 1302e1313.
Puppim de Oliveira, J.A., Doll, N.H., Balaban, O., Jiang, P., Dreyfus, M., Moreno-
Pen~ aranda, R., Dirgahayani, P., 2013a. Governance processes to steer the
greening of the urban economy. J. Clean. Prod. (Elsevier) 58 (1), 138e152.
Puppim de Oliveira, J.A., Doll, C.N.H., Kurniawan, T.A., Geng, Y., Kapshe, M.,
Huisingh, D., 2013b. Promoting winewin situations in climate change mitiga-
tion, local environmental quality and development in Asian cities through co-
benets. J. Clean. Prod. 58 (1), 1e6.
Puppim de Oliveira, J.A., Jing, Y., Collins, P., 2015. Public administration for devel-
opment: Trends and the way forward. Public Administration and Development
35 (2), 65e72.
S78 O. Balaban, J.A. Puppim de Oliveira / Journal of Cleaner Production 163 (2017) S68eS78
Ragin, C.C., Becker, H.S., 1992. What Is a Case? Exploring the Foundations of Social
Inquiry. Cambridge University Press, Cambridge, UK.
Ramesh, T., Prakash, R., Shukla, K.K., 2010. Life cycle energy analysis of buildings: an
overview. Energy Build. 42 (10), 1592e1600.
Rode, P., Burdett, R., Soares Goncalves, J.C., 2011. Buildings: investing in energy and
resource efciency. In: United Nations Environment Programme (UNEP), to-
wards a Green Economy: Pathways to Sustainable Development and Poverty
Eradication, pp. 331e374.
Roppongi, H., Suwa, A., Puppim de Oliveira, J.A., 2016. Innovating in Sub-national
Climate Policy: the Mandatory Emissions Reduction Scheme in Tokyo. Climate
Policy (forthcoming). http://dx.doi.org/10.1080/14693062.2015.1124749.
Roy, D., 2005. Urban Poor Increasingly Made Homeless in India's Drive for More
beautiful Cities. City Mayors. http://www.citymayors.com/development/india_
urban1.html (accessed 14.02.15.).
Seto, K.C., Dhakal, S., Bigio, A., Blanco, H., Delgado, G.C., Dewar, D., Huang, L.,
Inaba, A., Kansal, A., Lwasa, S., McMahon, J.E., Mller, D.B., Murakami, J.,
Nagendra, H., Ramaswami, A., 2014. Human settlements, infrastructure and
spatial planning. In: Pichs-Madruga, O.,R., Sokona, Y., Farahani, E., Kadner, S.,
Seyboth, K., Adler, A., Baum, I., Brunner, S., Eickemeier, P., Kriemann, B.,
Savolainen, J., Schlomer, S., von Stechow, C., Zwickel, T., Minx, J.C. (Eds.), Climate
Change 2014: Mitigation of Climate Change. Contribution of Working Group III
to the Fifth Assessment Report of the Intergovernmental Panel on Climate
Change. Cambridge University Press, Cambridge, United Kingdom and New
York, NY, USA. Available at: http://www.ipcc.ch/pdf/assessment-report/ar5/
wg3/ipcc_wg3_ar5_chapter12.pdf.
Takemoto, K., 2011. Measures to address climate change in Japan and overseas. In:
Onishi, T., Kobayashi, H. (Eds.), Low-carbon Cities: the Future of Urban Planning.
Gakugei Shuppan-Sha, Kyoto, Japan, pp. 33e58.
Tan, Y., Shen, L., Yao, H., 2011. Sustainable construction practice and contractors'
competitiveness: a preliminary study. Habitat Int. 35 (2), 225e230.
TMG e Tokyo Metropolitan Government, 2011a. On the Path to a Low-carbon City:
Tokyo Climate Change Strategy, International Environment Cooperation Section,
Bureau of Environment. TMG, Environmental Document No:23026, Tokyo, Japan.
TMG e Tokyo Metropolitan Government, 2011b. Low Emission Buildings Top 30 in
Tokyo, International Environment Cooperation Section, Bureau of Environment.
TMG, Environmental Document No:23025, Tokyo, Japan.
TMG e Tokyo Metropolitan Government, 2012. Handbook on Self-assessment In-
dicator (CO2 Emission Benchmark) (Brief Version). Bureau of Environment,
TMG, Tokyo, Japan.
Uihlein, A., Eder, P., 2010. Policy options towards an energy efcient residential
building stock in the EU-27. Energy Build. 42 (6), 791e798.
UN-United Nations, Transforming our world: The 2030 Agenda for Sustainable
Development. Resolution adopted by the General Assembly, Seventieth session
(A/RES /70/1) (25 September), 2015. Available from www.un.org/pga/wp-
content/uploads/sites/3/2015/08/120815_outcome-document-of-Summit-for-
adoption-of-the-post-2015-development-agenda.pdf.
UNDESA, 2014. United Nations, Department of Economic and Social Affairs, Popu-
lation Division, World Urbanization Prospects: the 2014 Revision. Highlights
(ST/ESA/SER.A/352).
Van Schaack, C., BenDor, T., 2011. A comparative study of green building in urban
and transitioning rural North Carolina. J. Environ. Plan. Manag. 54 (8),
1125e1147.
Wang, S., Yan, C., Xiao, F., 2012. Quantitative energy performance assessment
methods for existing buildings. Energy Build. 55 (2012), 873e888.
WorldGBC, 2014. Health, Wellbeing and Productivity in Ofces: the Next Chapter
for Green Building. Report by the World Green Building Council. Available at:
http://www.worldgbc.org/activities/health-wellbeing-productivity-ofces/
(accessed 15.02.15.).
 Journal of Cleaner Production 153 (2017) 600e607

Contents lists available at ScienceDirect

Journal of Cleaner Production

journal homepage: www.elsevier.com/locate/jclepro

Evolving green building: triple bottom line or regenerative design?

Zhonghua Gou a, *, Xiaohuan Xie b
a
School of Environment (Architecture)/Urban Research Programme, Grifth University, Australia
b
School of Architecture and Urban Planning, Shenzhen University, China

a r t i c l e i n f o a b s t r a c t

Article history: The research aims to envision the next generation green building. It starts from a critical review of green
Received 29 June 2015 building concepts and practices. The critiques mainly come from two perspectives: one is triple bottom
Received in revised form line and the other is regenerative design, which require that green building should take a holistic
7 February 2016
approach to sustainability as well as raise its benchmark. Revisiting green building rating systems (such
Accepted 16 February 2016
Available online 24 February 2016
as LEED), the article found that the green building concept and framework is being evolved to embrace
sustainability critiques not in a way of bringing in more ambiguous, complicate indicators but through
leverage, linkage and contextualization. This article also argues that the rhetoric debate on triple bottom
Keywords:
Green building
line and regenerative design does not help to push forward building practices towards more sustainable
Triple bottom line built environments. It is more important to evolve the current engineering approach (thermal insulation
Regenerative design and efciency) to benchmarking and measuring building performance. An ecological approach (thermal
Sustainability dissipation and ltration) is anticipated for next generation green building practices.
LEED 2016 Elsevier Ltd. All rights reserved.

1. Introduction measurement tools have individually and collectively made sig-

Green building usually refers to a building and using process
aiming to reduce the overall impact of the built environment on
human health and the natural environment by efciently using
energy, water, and other resources and by reducing waste, pollution
and environmental degradation (USGBC, 2009). As a result of
increased interest in green building concepts and practices, a
number of countries and areas have developed tools for designing
and measuring green buildings, which can also let government
regulators, building professionals and developers embrace green
building with condence. Well-known tools such as BREEAM
(United Kingdom), LEED (United States and Canada), DGNB (Ger-
many), Green Star (Australia), Green Mark (Singapore) and CASBEE
(Japan) have helped the professionals quantify environmental
performance in an explicit way. These tools mainly adopt a credit
and score awarding system for design features that can minimize a
building's environmental impact in categories such as location and
site, conservation of water, energy, and materials, and occupant
comfort and health. The number of credits or scores generally de-
termines the level of achievement. These assessment or
* Corresponding author. Science, Engineering and Architecture (G39) 3.40,
Grifth University Gold Coast Campus, QLD 4222, Australia.
E-mail addresses: gouzhonghua@gmail.com, z.gou@grifth.edu.au (Z. Gou).
nicant contributions to understanding of building-related envi-
ronmental impacts.
However, they are facing intensive critiques on their capacity to
dene a sustainable built environment that is more complex and
synergistic. Although these methods are continuously updated
both in content and for different kind of applications, the update is
usually driven by marketing needs and seldom takes into account
the critiques raised in theoretical and empirical research. This
article reports a review of these critiques and suggestions on green
building concepts and practices, aiming to anticipate the next
generation green building.
2. Methodology and framework
Basically, the research methodology is literature review. An
exhaustive literature search was conducted using Scopus and Web
of Science and searching keywords are one or any combinations of
green building review standards design. Initially, 206
articles are found. After preliminarily screening title and abstract
and eliminating duplicates, 115 articles remain for the further se-
lection. The second round selection is based on three research aims:
to identify critiques; to nd out suggestions; and to revisit green
building concepts and practices. Finally, 64 articles fall into the
three aims (Table 1). Among all, 31 empirical as well as theoretical
studies are found on comparing green building standards, and

http://dx.doi.org/10.1016/j.jclepro.2016.02.077
0959-6526/ 2016 Elsevier Ltd. All rights reserved.
 Z. Gou, X. Xie / Journal of Cleaner Production 153 (2017) 600e607 601

Table 1
Review aims, themes and references.

Review aims Review themes Sources

To identify critiques Green Building Scope,
Weighting and Indicators/Environmental
Performance and Social and Economic Impacts Dammann and Elle, 2006; Ding, 2008; Gething and Bordass, 2006; Gou et al., 2013a;
To nd out suggestions Alternative frameworks: SPeAR; REGEN;
LENSES; Peter & Wills Framework
To revisit green building LEED; HK-BEAM; BREEAM; Green Star;
concepts and practices CASBEE and so on
(Alwaer et al., 2008; Burnett et al., 2005; Burnett and Yik, 2001; Chew and Das, 2008;
Choguill, 2008; Cole, 1998, 1999, 2005; Conte and Monno, 2012; Cooper, 1999;
Gou et al., 2013b; Haapio and Viitaniemi, 2008; Horvat and Fazio, 2005; Kaatz et al., 2006;
Kimata, 1999; Kohler, 1999; Liu et al., 2006; Ltzkendorf and Lorenz, 2006; Ng et al., 2013;
Papamichael, 2000; Robinson, 2004; Shari and Murayama, 2013; Todd et al., 2001;
Todd and Geissler, 1999; Wallhagen and Glaumann, 2010; Zhang et al., 2011;
Zuo and Zhao, 2014) 31
(Clegg, 2012; Cole, 2011; Cole et al., 2011; Cole et al., 2013; Cooper, 2012;
du Plessis, 2011; Hoxie et al., 2011; Mang and Reed, 2011; Newton, 2013;
Pedersen Zari, 2011; Plaut et al., 2011; Reed, 2007; Svec et al., 2011; Tainter, 2012;
Williams, 2012) 15
(Alyami et al., 2013; Becker, 2004; Berardi, 2013; Burnett, 2007; Chau et al., 2000;
Geng et al., 2012; Gou and Lau, 2014; Hiete et al., 2011; Lee and Burnett, 2006;
Lombardi and Brandon, 2007; Murakami et al., 2011; Olgyay and Herdt, 2004;
Retzlaff, 2008; Schweber and Haroglu, 2014; Scoeld, 2013; Tam et al., 2004;
Tam, 2007; WB., 2003) 18

examining green building environmental performance and social
and economic impacts. 15 articles look for suggestive, alternative
design guidelines or frameworks for sustainable building practices.
The explorative frameworks are mainly developed by architectural
companies and research institutes. These explorations inspired the
research to revisit current green building rating systems. 18 articles
focus on some key green building standards to nd implications to
address critiques and embrace explorations. Besides the 64 articles,
relevant books, reference guides and reports are reviewed for more
in-depth and comprehensive discussion.
3. Critiques
Table 2 selects some of literature to show key appraisals as well
as criticisms based on the rst literature review. Basically, green
building assessment and rating follow a structure of scopes,
weightings, credits and points in a stringent way, which is easily
understood, communicated and applicable.
Review of existing green building design indicators and
coverage tends to nd that the emerging importance of issues such
as social and economic sustainability, life-cycle assessment and
climate change were not yet fully addressed or answered in these
tools (Cole, 2005). Most of the tools were focused too much on
environmental sustainability while did not do well with respect to
the coverage of social, economic, and institutional aspects of sus-
tainability (Zhang et al., 2014). Most tools were originally devel-
oped to reect national or local priorities of sustainability issues.
However, they have been directly used or adapted for use in other
countries as they have gained wide markets throughout the world.
For example, LEED, originated from the U.S. had been applied to
more than 30 countries. Arguably, importing these tools from one
nation to others caused problematic consequences especially on
economic and social sustainability. To address these weaknesses, a
standardized methodology and generalized framework with spe-
cic environmental criteria for changing and ne-tuning were
needed. To reduce biases and conicts, it is suggested that perfor-
mance criteria or credits reect national, regional, and cultural
varieties by assigning weights to various credits according to the
local and regional conditions.
The review of measurement and benchmark of these green
building concepts and practices pointed to the deciency of mea-
surement of environmental performance. The measurement and
benchmark green building which lays the foundation for the
common attributes of different green building tools is based on

Table 2
Summary of comparative studies of different green building rating systems.

Reference Strengths Weaknesses Opportunities

(Chew and Das, 2008) Lucidity and user friendliness Reluctance, insufcient transparency Develop a common language among key actors
and complexity
(Alwaer et al., 2008) Quantitative methods Inexibility, partiality, unfairness Differentiate negative and positive performance
(Kaatz et al., 2006) Fostering sustainable construction Lack of quality of social and Clearly dening desired outputs and outcomes
technical processes
(Todd et al., 2001) An attractive and simple checklist system Negative aspects of the building Include negative effect to push performance
are not reected in the
overall score
(Cole, 1998) A clear understanding building-related Unable to offer different levels Reecting globalization and standardization
environmental issues of assessment output
(Ltzkendorf and Meeting the current requirements Less addressing economic, An assessment result for all dimensions
Lorenz, 2006) social and performance facets of sustainable development
(Haapio and Covering different types of buildings and Uncertainties in the calculations, Envision transforming from today towards future
Viitaniemi, 2008) different labels and certicates analyses and interpretations
of the results
(Conte and Organized framework and structure Little respecting the complexity Identify relationships between buildings,
Monno, 2012) and dynamism that affects built environment and nature
regional contexts.
(Alyami and Reecting current status of sustainable Lack of priorities on certain Balance completeness in the coverage
Rezgui, 2012) development in buildings sustainability issues. and simplicity of use
602 Z. Gou, X. Xie / Journal of Cleaner Production 153 (2017) 600e607
reducing negative impacts (Fig. 1), such as reducing resource use
and reducing energy consumptions. It has been used consistently to
describe buildings that have a less negative environmental impact
compared with that of typical buildings. A green building's energy
and water savings are discernible by the extent to which it achieves
the performance standards, such as saving energy by 30%. However,
the information is often of relativity and does not delineate what is
a sustainable building. By contrasting the levels of environmental
performance of the baseline or benchmarks (Burnett, 2007), it was
argued that the absolute levels of performance of the baseline or
benchmarks, as well as the targets for environmental sustainability,
were largely unknown. As performance standards rise with more
buildings becoming green in future, the green building tools have to
be raised incrementally. It is becoming increasingly evident that
focusing on getting more points for doing less harm as encour-
aged by current green building tools, will not necessarily produce
design solutions that support and strengthen the human-nature
system.
In sum, these critiques pointed out two ways moving forward
green building concepts and practices: one is expanding the indi-
cator system of green building to more holistically cover sustain-
ability; the other is changing the benchmark of green from
reducing to increasing for a positive development. To address the
rst, the current green building design and assessment tools needs
to compose a more comprehensive set of indicators and more
exible framework to be adapted to different contexts. For the
latter, it needs to address co-existence and co-evolution of build-
ings and natures by regenerating buildings or creating something
new.
4. Explorations
There are a number of suggestive frameworks for dening and
benchmarking sustainable building. This article selects four most
representative frameworks (Fig. 2): Arup Arup SPeAR (Sustainable
Project Appraisal Routine), REGEN, LENSES (Living Environments in
Natural, Social and Economic Systems), and Peter and Willis
Fig. 1. The benchmark of green building based on reducing negative impacts (Adapted
from Cole, R.J., 2011).
Framework. They are developed by architectural companies and
research institutes. They all found weaknesses of current green
building concepts and practices, and aimed to develop alternative
frameworks.
First of all, looking at their compositions and expressions, we
will nd that they have a common assumption of sustainable
design as a circle and cycle. The most explicit is the Perkins & Will
framework that sets resource-related design strategies within cy-
cles e from nature and back to nature (Cole et al., 2011). It sets
human needs, interactions and resource ows within and inter-
dependent of the constraints and opportunities afforded by natural
systems. Specically, it tracks material, energy and water ow from
nature, through human systems and back into nature. A critical role
of buildings becomes engaging in the resource (energy, water and
materials) ows to support the maintenance of ecosystem func-
tions and to provide necessary services. To achieve this goal, this
framework proposes four quadrants of the cycles representing
producing, using, recycling and replenishing. To intervene the
resource ows, this framework also covers approaches and strate-
gies within the physical bounds of the site and those beyond the
bounds of the site.
The second commonality is about coverage. They seem to be
more ambitious to dene sustainability as well as its indicators. For
example, the REGEN framework is composed of nested systems
(Svec et al., 2011). At the broadest level, components of life are
organized into four quadrants: robust and resilient natural systems,
high-performing constructed systems, prosperous economic sys-
tems and whole social systems; at the next level, components of life
include water, ora, fauna, energy systems, transportation systems,
capital, employment, food, social justice, public health etc. The
LENSES framework uses a similar layered visual model to illustrate
interconnections and assists users in seeing and understanding
whole systems (Plaut et al., 2011). In total there are three lenses:
Foundational Lens representing principles, underlying themes and
core values of sustainability, Aspects of Place Lens containing key
aspects of the built environment, and Flows Lens including various
elements that ow throughout a place. The lenses are designed to
spin on a centre pivot, which encourages users to contemplate
interconnectedness of the various elements.
Third, they all provide a conceptual design framework to guide
dialogue rather than quantitative requirements or criteria. For
example, REGEN envisions that a project team can input basic in-
formation about their project type, scale and location and the tool
will instantly populate with everything that is known within the
tool about that place and its current state of health. In this way, a
place-based dialogue can begin among community leaders and
decision-makers. This view could stimulate dialogue about the data
that are or are not available for the region and also whether those
ndings coincide with the perceptions of local people. The dialogue
can continue to consider potential combinations of strategies that
might be most appropriate in that place to enhance the compo-
nents toward a greater state of health. In addition, an open space is
left on each lens to suggest that designers can determine whether
any further pertinent topics or issues should be added to the lens.
To shift away from rules and regulations that may lead to contex-
tually inappropriate solutions, LENSES uses descriptive metrics
under each aspect to allow for exibility and contextually appro-
priate solutions.
Fourth, these frameworks explicitly distinguish negative and
positive impacts and emphasize on creating positive outcomes.
Most strategies impact multiple components sometimes posi-
tively and sometimes negatively. For example, the assessment
on each indicator in SPeAR has ve different rating levels which
range between 3 and 1 (ARUP, 2012). A rating of 3 is colored
dark green representing best case and a rating of 1 is dark red
 Z. Gou, X. Xie / Journal of Cleaner Production 153 (2017) 600e607 603

Fig. 2. Four alternative design frameworks for sustainable building (upper left: REGEN; upper right: LENSES; lower left: Perkins & Will; lower right: SPeAR) (Adapted from Cole
et al., 2011, Svec et al., 2011; Plaut et al., 2011; and ARUP, 2012).

representing worst case. RGEN also features these positive and
negative impacts in a complex web of connections. By entering
at one or more components, participants will discover the
strategies that are connected to the components. In this way,
multiple-benet strategies can be visually identied and then
explored. Different from LEED that has rigid criteria for each
indicator and each credit or score has to have a numeric result to
compare against the benchmark, some of the credits in these
frameworks can be quantied while some require a subjective
ranking.

Table 3
What green building can learn from alternative design frameworks.

Green building frameworks Alternative design frameworks

Design principle Reduce, reuse, recycle, etc. Replacement, renewal, rebirth, etc.
Diagram A list of building related sustainability issues A cyclical processes of regeneration by design
Decision-making Depending on international and national design codes, regulations, etc. Depending on local context and design professionals' decision making
Approach Scoring and weighting A framework for dialogue
Measurement Performance Resource ow
Objective Quantity (e.g. resource saving) Quality (e.g. resource upgrading)
Flexibility Low (e.g. structured template) High (e.g. no structured template)
Quantication Scores Partial/No quantication
Outcome Green tiers Partial/No tangible outcome
604 Z. Gou, X. Xie / Journal of Cleaner Production 153 (2017) 600e607
Table 3 summarizes key differences between green building
design and explorative sustainable design. Compared to current
green building's conservative thinking, these explorative frame-
works tend to be more proactive and positive. However, they do not
have specic requirements on how to design or assess these vari-
ables. These frameworks just open up a dialogue about adoption of
regenerative approaches and processes. Application of these
frameworks largely depends on the context in which they are used
and on designers who are using them. These frameworks do not
generate a new rating system or level of certication, and no
comparable measurements and outcomes are generated from these
frameworks. Therefore, using these frameworks is conned to the
early stage of designing a project. They can complement existing
green building rating systems by allowing dialogue, reection and
learning, thus intriguing unique solutions for specic places and
contexts, especially on the resource ow that is an important
measurement of the impact of a building on the nature.
5. Revisit green building evolution
There are quite a number of studies examining the green
building standards and their revisions. Rather than examining
rhetorical advancements or technical improvements, this revisit
interrogates the green building framework, benchmark and mea-
surement based on triple bottom line and regenerative design that
are the two main critiques facing green building concepts and
practices. Particularly, this article uses LEED as a case study for this
interrogation. LEED provides an international tool dening green
building concepts as well as guiding their practices. It evolves
through several generations in past decades. LEED for New Con-
struction (NC) v1.0 was released in 2000 as the rst LEED design
tool mainly for new commercial ofce buildings. LEED NC v2.0 and
LEED NC v2.2 were released in 2005 and LEED NC v3 in 2009 to
cover other building types including ofces, libraries, churches,
hotels and government buildings. Using NC as a template, LEED for
Commercial Interiors, Neighborhoods, Healthcare, Operation etc.
were one by one released. In 2013, LEED NC v4 is published rep-
resenting state-of-the-art green building tools (USGBC, 2013). This
article examines LEED evolution from v3 to v4, aiming to under-
stand how to the current situations as well as the ways forward.
5.1. Framework
First of all, we need to acknowledge the fact that green or sus-
tainable building rating systems are building-centric. Table 4
summarizes main aspects covered in most recent green building
standards. They have similar aspects which cover a building's
environmental impact from the global scale (e.g. site, land, emis-
sions, etc.), through the local scale (e.g. transport, energy, water,
Table 4
Aspects covered in building environmental assessment methods.
GBL 2014 for Civic BREEAM 2014 for LEED 2013 for new construction CASBEE 2010 for new
building design new construction and major renovations
- Land Saving and - Management - Integrative Process
Outdoor - Health and - Location and
Environment Wellbeing Transportation
- Energy Saving and - Energy - Sustainable Sites
Utilization - Transport - Water Efciency
- Water Saving and - Water - Energy and Atmosphere
Utilization - Materials - Material and Resources
- Material Saving and - Waste - Indoor Environmental
Utilization - Land Use and Quality
- Indoor Environment Ecology - Innovation
Quality - Pollution - Regional Priority
etc.), and to the building scale (e.g. indoor environments, man-
agement, etc.). Under each aspect, there are supportive indicators
or credits to measure the performance. Even though these methods
try to encompass as many sustainability indicators as possible in a
simple checklist system, these indicators are not able to cover all
important sustainability issues. Following the consciousness of
climate change and natural resources depletion, different assess-
ment frameworks, systems and tools have tended to privilege a few,
specic environmental indicators such as energy and water
assessment. Few of them seemed to include social and economic
indicators of sustainability. On the other hand, although the triple-
bottom line concept referring to the three dimensions of social,
environmental and economic sustainability is well known, there is
no consensus established regarding the selection of the social and
economic performance indicators for buildings. Rather than adding
more ambiguous indicators or aspects into the green building rat-
ing systems, it is more important to understand how to use the
current frame to contextualize buildings in a larger socio-economic
context (Gou and Lau, 2014).
The most signicant response to regenerative design is a new
category Integrative Process to encourage an open dialogue for an
early analysis of optimizing energy, water and materials ows in
buildings. The intention is enhanced by new credits respectively in
Water, Energy and Material. For example, Building-Level Water
Metering, Building-Level Energy Metering and Advanced En-
ergy Metering, and Building Life-cycle Impact Reduction are new
credits in LEED v4 to track the resources uses and ows.
The response to social sustainability could be detected in a
new category Location and Transport that highlights the sig-
nicant role of transport related energy consumptions. The
innovation is that this category could be alternatively achieved if
the design is certied by LEED for Neighborhood Development
(ND) that is more focused on walkability, a sense of place, social
cohesion and stability, and resiliency (Weshah and Sadeghpour,
2011). Other standards such as Japan CASBEE has a similar
assessment method to neighborhood and community frame-
works (CASBEE-City) rather than solely on an individual building
(Murakami et al., 2011). These large scale frameworks tend to
appreciate how a part of the whole city moves towards some pre-
dened goals of sustainable urban development and begin to give
the right weight and place the proper attention to social issues
usually underestimated by the same systems when evaluating
buildings. For a larger urban context, LEED v4 has an important
new credit: Site Assessment that assesses site conditions before
design to evaluate sustainable options and inform related de-
cisions about site design. The site assessment shall include
topography, hydrology, climate, vegetation, soils, human use and
health effects etc. This is an important revision to address the
regional and local context.
Green mark 2013 for Green star 2014 for BEAM plus 2012 for
construction new buildings design & as built new buildings
- Energy - Energy Efciency - Management - Site Aspects
- Resources and - Water Efciency - Indoor - Material Aspects
Materials - Environmental Environment - Energy Use
- Off-site Environment Protection Quality - Water Use
- Indoor Environment - Indoor Environmental - Energy - Indoor
- Quality of Service Quality - Transport Environmental
- Outdoor Environment - Other Green Features - Water Quality
on Site - Materials - Innovations and
- Land Use and Additions
Ecology
- Emissions
 Z. Gou, X. Xie / Journal of Cleaner Production 153 (2017) 600e607
Although there is no direct indicator for economical sustain-
ability, we can still grasp the indication through credits on
building product disclosure and optimization in the category of
Materials and Resources. It is a very important step to push
green product suppliers and manufacturers to disclose the life
cycle environmental impact of their product; where and how they
get their raw materials; what is in their product; and whether
there is anything hazardous. By disclosure, their products can be
more attractive in the market. Disclosure is a basic step towards
further greener and cleaner production. Green consumers are
more aware of how and where to source and select products and
how their behavior would impact the environment (Zhang et al.,
2011). Consequently, suppliers and manufacturers have to be
more environmental-friendly on their production because they
need to be totally transparent to disclose information related to
environmental and health impacts (Espinoza et al., 2012). Trans-
parency and disclosure inevitably elevate the market entry for
green building products.
Obviously, green building has a well-established framework
and this framework has been tried and proved as effective tool in
building industry. The effect of green building in sustainable
development never relies on the coverage or scope of indicators.
The effect is radiant (Fig. 3). Green building has the capability of
further stimulating green building market by asking the market to
provide green products and to beat out uncertied products that
may be environmental unfriendly. The aspect of indoor environ-
ments for occupant health, productivity and well-being is another
attraction to the real estate market (Gou et al., 2013a). The green
building is also linked to a larger society via its neighborhoods
and communities. The framework is adaptive to address regen-
erative design thinking such as upcycling, upgrading and regen-
eration in energy, water and materials, and also to track their
ows by metering, monitoring and ingredients disclosure. The
explorative design frameworks, such as Arup SPeAR (Sustainable
Project Appraisal Routine), REGEN, LENSES (Living Environments
in Natural, Social and Economic Systems), and Peter and Willis
Framework, can be applied in the integrative design process for an
open dialogue in early design stage. In sum, the concept of green
building is exible to embrace both triple bottom line and
regenerative design.
Fig. 3. Radiant effects of green building.
605
5.2. Benchmark
What's really challenging is embracing critiques in green
building practices. The measurement and benchmark of green
building performance is dominated by engineering standards and
methods. For example, LEED assess a building's energy perfor-
mance using ASHRAE (American Society of Heating, Refrigerating,
and Air-Conditioning Engineers) as a baseline and the assessment
result is percentage of saving of the proposed design compared to
the baseline. Up to 18 credits go to Optimize Energy Performance.
According to a large scale survey of energy uses in 121 LEED
buildings (Turner and Frankel, 2008), the median energy use in-
tensity for LEED buildings is 69 kBtu/sf/yr (British thermal units per
square foot per year), which is 24% below the average for all com-
mercial building stock in U.S. Although the benchmark shows a
relative reduction of energy uses, it could not tell the absolute or
direct impact of a building on the natural environment.
To benchmark both negative and positive impacts of a building
on the natural environment, Olgyay and Herdt proposed ecosys-
tems services criteria to benchmark green buildings. The ecosystem
services not only include energy, water, and materials, but also
cover soil, food, etc. Based on the ecological footprint carrying ca-
pacity baseline, the quantities of ecosystem services can be
measured in (ecosystem productivity)*(land area)/(year) (Olgyay
and Herdt, 2004). They also used a farmhouse as an example to
show how the negative impact becomes positive through the
measuring its resources consumptions and ecosystem productivity.
Albeit the case is atypical, the method provides a possible solution
to benchmark regenerative design by using an ecological approach.
5.3. Measurement
The shifting from engineering to ecology should not conne to
the benchmark of building energy performance; it must also
happen to the measurement of design practices. In Optimize En-
ergy Performance, the measurement heavily relies on ASHRAE
standards. The design is measured and assessed in terms of how
well insulated the building envelope and glazing systems are. In
practice, U-value, R-value, air-tightness, shading coefcients are
common design criteria for building energy efciency. These
simplied factors resulted in more and more insulated green
buildings (sealed curtain walls and full air-conditioning), which
largely rejects energy and resources owing into or through
buildings. Without bringing energy and resources such as heat,
light, wind and water into buildings, it is impossible to regenerate
or create new energies and resources. For a regenerative design,
green building needs an ecological design solution which should be
non-isolated, non-steady, non-equilibrium, and dissipative.
As shown in Fig. 4, green building based on the engineering
approach rejects kinetic energy and resources coming into build-
ings; while regenerative design needs an open or permeable
building to receive these energy and resources, to use them to
Fig. 4. Shifting design practices from insulation to ltration.
606 Z. Gou, X. Xie / Journal of Cleaner Production 153 (2017) 600e607
create a comfortable space, to transform them into new energy and
resources, and to feed-back to the nature. It requires that green
building bring as much as possible heat, light, wind and water into
buildings and use design and technologies to transform or lter
them into desirable amount and form. Numerous design and
technologies can be found for this transformation or ltration: such
as low-exergy heating or cooling, breathing walls, water treatment
and so on. However, employments of these design and technologies
require a new building form with dissipative structure. Otherwise,
the technologies just become additions or attachments rather than
an integrative part of a building.
Shifting green building practices from insulation to ltration is
not easy, because insulation is deeply imbedded in the modernity
of architecture. Kiel Moe (2014) articulated the roles of the various
agents inherent in the technological momentum of insulation and
its associated practices: architects, engineers, scientists, materials,
equations, thermodynamics, codes, test standards, entrepreneurs,
academics, marketing and consumers. The science theory about
energy, thermodynamics simply and reductively applied to build-
ing design through standards, codes and single indices that domi-
nate current green building practices. The phenomenon is also
reected on the current situation of human comfort, which is based
on state-steady assumption that human comfort is achieved in
equilibrium of heat losses and gains and it needs a neutral envi-
ronment for comfort (Gou et al., 2013b), and that to do so, it is
necessary to seal the building and to use full air conditioning.
A new design approach for regenerative sustainability goes
beyond the epistemology of energy efciency and conservation. It
needs an ecological approach to introduce heat, light, wind and
water into buildings and to design energy hierarchies to transform
them. The ecological design is not just adding more greenery.
The ecological design approaches must go beyond an engi-
neering understanding of efciency, insulation and reduction.
Otherwise, it just makes green building literarily, outwardly green.
The ecological design approach for next generation green building
is aimed for architectural expressions of energy and resources hi-
erarchies and ows in buildings. There must be in-depth inter-
disciplinary research between architecture and ecology.
6. Discussion
The building-centric concept of green and sustainability is
practical, realizable since the building industry has a long history
and experience of praxis. The exible framework of green building
makes it receptive to cover more sustainability aspects through
leveraging building industry and real estate market, linking
neighborhoods and communities, and contextualizing in a larger
urban context. The way to move forward green building is not
about bringing more complicate, ambiguous indicators.
The benchmark and measurement used in green building must
be signicantly evolved to practice sustainability. The engineering
approach to benchmarking and measuring building performance
blocks the way towards a more sustainable built environment. The
engineering approach of benchmark and measurement in building
industry is historical, which accumulatively shaped the form, space
and materiality of modern architecture. It also lays the foundation
of designing a green building. The core value of the engineering
approach is efciency, reduction, insulation and neutrality. To
change this situation, there must be at least two evolutions: the
rst is a new benchmark of green building energy performance that
shows not only negative impacts but also positive impact of a
building may have on nature or earth; the second is a new mea-
surement of green building design that measure how much en-
ergies from nature a building receives and how these energies are
transformed and regenerated in buildings. The two evolutions must
happen reciprocally, synergistically.
Actually, regenerative strategies on upgrading and upcycling
energy and resources are not new. Books such as The Upcycle:
Beyond SustainabilitydDesigning for Abundance (Mcdonough
and Braungart, 2013), Regenerative Design for Sustainable Devel-
opment (Lyle, 1994) and Positive Development: From Vicious
Circles to Virtuous Cycles through Built Environment Design
(Birkeland, 2008) collected a number of strategies and technolo-
gies. Technology is not the main barrier. A new benchmark and
measurement is expected to produce new architectural practices
and forms that embed these strategies rather than attach them into
buildings.
7. Conclusion
This article examines the state-of-art thoughts and critiques on
sustainability, such as triple bottom line and regenerative design,
and their implications to green building evolutions. Although the
green building concept and framework is building centric, it is
receptive to these sustainability thoughts and critiques in ways of
leverage, linkage and contextualization. However, the rhetoric
debate on sustainability does not help much to push forward the
building practice towards more a sustainable built environment.
The evolution of green building must happen in architectural
practices. To do so, what we need is not only a benchmark indi-
cating both negative and positive impacts, but also a measurement
of regenerative design practices to produce new, post-modern
building form, space and materiality that can receive, absorb,
transform and lter energy and resources. The new measurement
can replace the current insulation-based engineering practice to-
wards an open, dissipative structure. In sum, the next generation
green building should be physical instead of rhetorical. If we see the
current generation green building is rhetorically dened by
concept, framework, indicators and rating systems; we anticipate
that the next generation should be more physically dened in new
architectural form.
References
Alwaer, H., Sibley, M., Lewis, J., 2008. Different stakeholder perceptions of sus-
tainability assessment. Archit. Sci. Rev. 51, 48e59.
Alyami, S.H., Rezgui, Y., 2012. Sustainable building assessment tool development
approach. Sustain. Cities Soc. 5, 52e62.
Alyami, S.H., Rezgui, Y., Kwan, A., 2013. Developing sustainable building assessment
scheme for Saudi Arabia: Delphi consultation approach. Renew. Sustain. Energy
Rev. 27, 43e54.
ARUP, 2012. SPeAR handbook 2012. ARUP.
Becker, J., 2004. Making sustainable development evaluations work. Sustain. Dev.
12, 200e211.
Berardi, U., 2013. Clarifying the new interpretations of the concept of sustainable
building. Sustain. Cities Soc. 8, 72e78.
Birkeland, J., 2008. Positive Development: from Vicious Circles to Virtuous Cycles
through Built Environment Design. Routledge.
Burnett, J., 2007. City buildingsdeco-labels and shades of green! Landsc. Urban
Plan. 83, 29e38.
Burnett, J., Chau, C.K., Lee, W.L., 2005. Green buildings: how Green the label? HKIE
Trans. 12, 1e8.
Burnett, J., Yik, F.W.H., 2001. Framework of building environmental assessment
methods. HKIE Trans. 8, 1e7.
Chau, C.K., Lee, W.L., Yik, F.W.H., Burnett, J., 2000. Towards a successful voluntary
building environmental assessment scheme. Constr. Manag. Econ. 18, 959e968.
Chew, M.Y.L., Das, S., 2008. Building grading systems: a review of the state-of-the-
art. Archit. Sci. Rev. 51, 3e13.
Choguill, C.L., 2008. Developing sustainable neighbourhoods. Habitat Int. 32, 41e48.
Clegg, P., 2012. A practitioner's view of the Regenerative Paradigm. Build. Res. Inf.
40, 365e368.
Cole, R.J., 1998. Emerging trends in building environmental assessment methods.
Build. Res. Inf. 26, 3e16.
Cole, R.J., 1999. Building environmental assessment methods: clarifying intentions.
Build. Res. Inf. 27, 230e246.
 Z. Gou, X. Xie / Journal of Cleaner Production 153 (2017) 600e607
Cole, R.J., 2005. Building environmental assessment methods: redening intentions
and roles. Build. Res. Inf. 33, 455e467.
Cole, R.J., 2011. Transitioning from green to regenerative design. Build. Res. Inf. 40,
39e53.
Cole, R.J., Busby, P., Guenther, R., Briney, L., Blaviesciunaite, A., Alencar, T., 2011.
A regenerative design framework: setting new aspirations and initiating new
discussions. Build. Res. Inf. 40, 95e111.
Cole, R.J., Oliver, A., Robinson, J., 2013. Regenerative design, socio-ecological systems
and co-evolution. Build. Res. Inf. 41, 237e247.
Conte, E., Monno, V., 2012. Beyond the buildingcentric approach: a vision for an
integrated evaluation of sustainable buildings. Environ. Impact Assess. Rev. 34,
31e40.
Cooper, I., 1999. Which focus for building assessment methods e environmental
performance or sustainability? Build. Res. Inf. 27, 321e331.
Cooper, I., 2012. Winning hearts and minds or evidence-driven: which trajectory for
regenerative design? Build. Res. Inf. 40, 357e360.
Dammann, S., Elle, M., 2006. Environmental indicators: establishing a common
language for green building. Build. Res. Inf. 34, 387e404.
Ding, G.K.C., 2008. Sustainable constructiondthe role of environmental assessment
tools. J. Environ. Manag. 86, 451e464.
du Plessis, C., 2011. Towards a regenerative paradigm for the built environment.
Build. Res. Inf. 40, 7e22.
Espinoza, O., Buehlmann, U., Smith, B., 2012. Forest certication and green building
standards: overview and use in the U.S. hardwood industry. J. Clean. Prod. 33,
30e41.
Geng, Y., Dong, H., Xue, B., Fu, J., 2012. An overview of Chinese green building
standards. Sustain. Dev. 20, 211e221.
Gething, B., Bordass, B., 2006. Rapid assessment checklist for sustainable buildings.
Build. Res. Inf. 34, 416e426.
Gou, Z., Lau, S.S.-Y., 2014. Contextualizing green building rating systems: case study
of Hong Kong. Habitat Int. 44, 282e289.
Gou, Z., Lau, S.S.-Y., Prasad, D., 2013a. Market readiness and policy implications for
green buildings: case study from Hong Kong. Coll. Publ. 8, 162e173.
Gou, Z., Prasad, D., Siu-Yu Lau, S., 2013b. Are green buildings more satisfactory and
comfortable? Habitat Int. 39, 156e161.
Haapio, A., Viitaniemi, P., 2008. A critical review of building environmental
assessment tools. Environ. Impact Assess. Rev. 28, 469e482.
Hiete, M., Khlen, A., Schultmann, F., 2011. Analysing the interdependencies be-
tween the criteria of sustainable building rating systems. Constr. Manag. Econ.
29, 323e328.
Horvat, M., Fazio, P., 2005. Comparative review of existing certication programs and
performance assessment tools for residential buildings. Archit. Sci. Rev. 48, 69e80.
Hoxie, C., Berkebile, R., Todd, J.A., 2011. Stimulating regenerative development
through community dialogue. Build. Res. Inf. 40, 65e80.
Kaatz, E., Root, D.S., Bowen, P.A., Hill, R.C., 2006. Advancing key outcomes of sus-
tainability building assessment. Build. Res. Inf. 34, 308e320.
Kimata, N., 1999. Japanese expectations for green building assessments. Build. Res.
Inf. 27, 294e299.
Kohler, N., 1999. The relevance of green building challenge: an observer's
perspective. Build. Res. Inf. 27, 309e320.
Lee, W.L., Burnett, J., 2006. Customization of GBTool in Hong Kong. Build. Environ.
41, 1831e1846.
Liu, Y., Prasad, D., Li, J., Fu, Y., Liu, J., 2006. Developing regionally specic environ-
mental building tools for China. Build. Res. Inf. 34, 372e386.
Lombardi, P., Brandon, P., 2007. The multimodal system approach to sustainability
planning evaluation. In: Deakin, M., Mitchell, G., Nijkamp, P., Vreeker, R. (Eds.),
Sustainable Urban Development, The Environmental Assessment Methods, vol.
2. Routledge, Oxon, pp. 47e64.
Ltzkendorf, T., Lorenz, D.P., 2006. Using an integrated performance approach in
building assessment tools. Build. Res. Inf. 34, 334e356.
Lyle, J.T., 1994. Regenerative Design for Sustainable Development. John Wiley &
Sons, Inc, New York, N.Y.
Mang, P., Reed, B., 2011. Designing from place: a regenerative framework and
methodology. Build. Res. Inf. 40, 23e38.
Mcdonough, W., Braungart, M., 2013. The Upcycle: beyond Sustainability for
Abundance. North Point Press, New York.
607
Moe, K., 2014. Insulating Modernism: Isolated and Non-isolated Thermodynamics
in Architecture. Birkh auser.
Murakami, S., Kawakubo, S., Asami, Y., Ikaga, T., Yamaguchi, N., Kaburagi, S., 2011.
Development of a comprehensive city assessment tool: CASBEE-city. Build. Res.
Inf. 39, 195e210.
Newton, P.W., 2013. Regenerating cities: technological and design innovation for
Australian suburbs. Build. Res. Inf. 41, 575e588.
Ng, S.T., Chen, Y., Wong, J.M.W., 2013. Variability of building environmental
assessment tools on evaluating carbon emissions. Environ. Impact Assess. Rev.
38, 131e141.
Olgyay, V., Herdt, J., 2004. The application of ecosystems services criteria for green
building assessment. Sol. Energy 77, 389e398.
Papamichael, K., 2000. Green building performance prediction/assessment. Build.
Res. Inf. 28, 394e402.
Pedersen Zari, M., 2011. Ecosystem services analysis for the design of regenerative
built environments. Build. Res. Inf. 40, 54e64.
Plaut, J.M., Dunbar, B., Wackerman, A., Hodgin, S., 2011. Regenerative design: the
LENSES Framework for buildings and communities. Build. Res. Inf. 40,
112e122.
Reed, B., 2007. Shifting from sustainability to regeneration. Build. Res. Inf. 35,
674e680.
Retzlaff, R.C., 2008. Green building assessment systems: a framework and com-
parison for planners. J. Am. Plan. Assoc. 74, 505e519.
Robinson, J., 2004. Squaring the circle? Some thoughts on the idea of sustainable
development. Ecol. Econ. 48, 369e384.
Schweber, L., Haroglu, H., 2014. Comparing the t between BREEAM assessment
and design processes. Build. Res. Inf. 42, 300e317.
Scoeld, J.H., 2013. Efcacy of LEED-certication in reducing energy consumption
and greenhouse gas emission for large New York city ofce buildings. Energy
Build. 67, 517e524.
Shari, A., Murayama, A., 2013. A critical review of seven selected neighborhood
sustainability assessment tools. Environ. Impact Assess. Rev. 38, 73e87.
Svec, P., Berkebile, R., Todd, J.A., 2011. REGEN: toward a tool for regenerative
thinking. Build. Res. Inf. 40, 81e94.
Tainter, J.A., 2012. Regenerative design in science and society. Build. Res. Inf. 40,
369e372.
Tam, C.M., Tam, V.W.Y., Zeng, S.X., 2004. Environmental performance assessment in
China and Hong Kong. Build. Res. Inf. 32, 110e118.
Tam, V.W.Y., 2007. The effectiveness of the green building evaluation and labelling
system. Archit. Sci. Rev. 50, 323e330.
Todd, J.A., Crawley, D., Geissler, S., Lindsey, G., 2001. Comparative assessment of
environmental performance tools and the role of the green building challenge.
Build. Res. Inf. 29, 324e335.
Todd, J.A., Geissler, S., 1999. Regional and cultural issues in environmental perfor-
mance assessment for buildings. Build. Res. Inf. 27, 247e256.
Turner, C., Frankel, M., 2008. Energy Performance of LEED for New Construction
Buildings. U.S. Green Building Council.
USGBC, 2009. Green Building and LEED Core Concepts. U.S. Green Building Council.
USGBC, 2013. LEED V4 User Guide. U.S. Green Building Council, Washington, DC.
Wallhagen, M., Glaumann, M., 2010. Design consequences of differences in building
assessment tools: a case study. Build. Res. Inf. 39, 16e33.
WB, T., 2003. Understanding the Green Building Toolkit: Picking the Right Tool for
the Job. USGBC Greenbuilding International Conference & Expo, Pittsburgh,
USA.
Weshah, N., Sadeghpour, F., 2011. Measuring the sustainability of existing com-
munities using LEED for neighbourhood development (LEED-ND) rating system.
ICSDC 2011, 611e619.
Williams, K., 2012. Regenerative design as a force for change: thoughtful, optimistic
and evolving ideas. Build. Res. Inf. 40, 361e364.
Zhang, X., Platten, A., Shen, L., 2011. Green property development practice in China:
costs and barriers. Build. Environ. 46, 2153e2160.
Zhang, X., Wu, Y., Shen, L., Skitmore, M., 2014. A prototype system dynamic model
for assessing the sustainability of construction projects. Int. J. Proj. Manag. 32,
66e76.
Zuo, J., Zhao, Z.-Y., 2014. Green building researchecurrent status and future agenda:
a review. Renew. Sustain. Energy Rev. 30, 271e281.
 Journal of Cleaner Production 164 (2017) 209e220

Contents lists available at ScienceDirect

Journal of Cleaner Production

journal homepage: www.elsevier.com/locate/jclepro

Key credit criteria among international green building rating tools

I.M. Chethana S. Illankoon a, Vivian W.Y. Tam a, b, *, Khoa N. Le a, Liyin Shen c
a
School of Computing Engineering and Mathematics, Western Sydney University, Locked Bag 1797, Penrith, NSW 2751, Australia
b
College of Civil Engineering, Shenzhen University, China
c
Faculty of Construction Management and Real Estate, Chongqing University, Shapingba District, Chongqing, China

a r t i c l e i n f o a b s t r a c t

Article history: The construction industry has a signicant contribution towards numerous adverse environmental im-
Received 23 March 2016 pacts. Therefore, green building concept has gained wide recognition. In line with this, numerous in-
Received in revised form ternational green building rating tools have been developed providing a yardstick for measuring green
19 June 2017
building performance. These rating tools have different credit criteria for evaluating the green building
Accepted 23 June 2017
Available online 24 June 2017
performance. According to the existing literature, there are many researches comparing different green
building rating tools on specic credit criteria such as Energy. However, there is a clear lack of research
on establishing a baseline to develop new green building rating tools and to evaluate existing green
Keywords:
Green building rating tools
building rating tools. Therefore, this research aims to establish key credit criteria based on an extensive
Key credit criteria literature study and evaluate these criteria based on widely used eight green building rating tools. The
Green buildings comparison analysis is based on a quantitative measure, namely, a normalised score, which is obtained
through allocating credit points of selected green building rating tools to the established key credit
criteria. The comparison result is presented with radar diagrams and bar charts. This research established
seven key credit criteria for these rating tools which are namely (1) Site, (2) Energy, (3) Water, (4) Indoor
Environment Quality (IEQ), (5) Material, (6) Waste and pollution, and (7) Management. It is found that
Energy criterion is the most widely considered key credit criteria and then followed by IEQ and Water
criteria. Apart from that, credit criteria such as Triple bottom line reporting, Education and awareness,
Economic aspects relating to various costs, Sustainable designing and planning and Stakeholder re-
lations are identied as possible credit criteria which can be included in developing the rating tools in
future. These key credit criteria can be adopted as a baseline to develop new green building rating tools,
and it provides fruitful results to develop the existing tools further.
2017 Elsevier Ltd. All rights reserved.

1. Introduction
The construction industry and building sector have a signicant
contribution to many adverse environmental impacts (Abidin,
2010; Tan et al., 2011). In the United Kingdom, out of many sec-
tors of the economy, construction process and buildings use most of
the energy and emit the highest amount of carbon dioxide (CO2)
(European information service commission, 2012). According to
Pink (2012), building construction contributes to about 26% of
waste and also considered as one of the major sectors which
signicantly emits greenhouse gases globally (Reidy et al., 2011)
leading to detrimental environmental impacts. Therefore, there is a
* Corresponding author. School of Computing Engineering and Mathematics,
Western Sydney University, Locked Bag 1797, Penrith, NSW 2751, Australia.
E-mail address: vivianwytam@gmail.com (V.W.Y. Tam).
clear need to develop the construction industry and the building
sector in a more sustainable manner. As a result, green building
concept gained its momentum (Hoffman and Henn, 2008).
With the development of green buildings, a yardstick was
required to evaluate green buildings' performance (Crawley and
Aho, 1999). Therefore, many assessment tools and green building
rating systems were put into practice around the world (Gowri,
2004; Haapio and Viitaniemi, 2008; Reed et al., 2011; Sinou and
Kyvelou, 2006) such as Building Research Establishment Environ-
mental Assessment Method (BREEAM), Leadership in Environ-
mental and Energy Design (LEED) and Green Star. These green
building rating tools are designed for assessing and evaluating
building performance from planning, designing, constructing, op-
erations (Sachin and Jha, 2012) and demolition based on the credit
criteria. All these credit criteria are developed to ensure the well-
being of the building occupants and the environment at large.
Further, in most of these rating tools, credit points are given to each

http://dx.doi.org/10.1016/j.jclepro.2017.06.206
0959-6526/ 2017 Elsevier Ltd. All rights reserved.
210 I.M.C.S. Illankoon et al. / Journal of Cleaner Production 164 (2017) 209e220
of these credit criteria and nally sum it up to a single score to
arrive at the specic certication of building (Gowri, 2004; Haapio
and Viitaniemi, 2008; Reed et al., 2011; Sinou et al., 2006).
However, according to the World Green Building Council (2015),
there are many countries that have green building councils. These
countries use their own green building rating systems or use the
most common and established rating tools for the green building
rating. The declared set of credit criteria identied by each rating
tool (such as Management, Water efciency, Energy etc.) analyses
how well or poorly a building performs and likely to perform (Cole,
2005). Therefore, the set of credit criteria identied by each green
building rating tool has a critical impact on the evaluation of the
building performance. According to Lu et al. (2017), to pursue
sustainable development, appropriate measurements are critical. In
other words, developing the key credit criteria to evaluate green
buildings are signicant. Further, if the set credit criteria does not
reect the required performance of the building, the attempt to
develop buildings in a more environmentally and socially respon-
sible way, would be in vain.
Various existing studies have presented the application of these
rating tools. Certain studies have compared different tools based on
the effectiveness of each rating tool (Gowri, 2004). There are
studies developed assessing the performance of green technologies
in achieving certain credit points (Nelms et al., 2005). Some other
studies are on further developments on rating tools focusing on its
applications (Ltzkendorf and Lorenz, 2006). According to Delai
and Takahashi (2011) research carried out has found that there is
not a single initiative analysed that tackles all sustainability issues
and in fact there is no consensus around what should be measured
and how. Therefore, it appears that there is limited existing study
examining comparatively the credit criteria adopted in different
tools.
1.1. Problem statement
According to Papajohn et al. (2016) there are many green
building rating tools including sets of parameters to assess the
sustainability of the building. However there is no any framework
or established key credit criteria to provide a basis in evaluating
green buildings (Papajohn et al., 2016). Further, there are certain
researches on comparison of green building standards in different
countries emphasizing different aspects. Some scholars focused on
evaluating the differences of structural systems among different
standards, such as object, content, mechanism, process, index cat-
egories, method and weight setting pointed out the differences
among different standards (Zhang et al., 2017). For example, certain
studies evaluated existing green building rating tools to develop
new rating criteria for certain countries (Vyas and Jha, 2016). Sallam
and Abdelaal (2016) evaluated water efciency criteria of widely
used green buildings rating tools compared to a proposed baseline.
Similarly, there are many studies analysing the energy use and
assessment comparing widely used green building rating tools
(Chen and Lee, 2013; Lee, 2012; Lee and Burnett, 2008; Schwartz
and Raslan, 2013). Andrade and Bragana (2016) carried out a
comparative analysis on how dwellings are evaluated by ve green
building rating tools based on the purpose of assessment, sus-
tainability dimensions considered, indicators addressed, life cycle
phases considered by the indicators, type of indicators, measure-
ments, aggregation processes and life cycle phases during which
the assessment. Pushkar and Shaviv (2016) also compared ve
main green building rating tools in terms of shearing layers namely
site, structure, skin, services, space and stuff. Similarly there are
many researches comparing different green building rating tools
focusing on a specic criterion such as energy and water. However,
it can be seen that, there are signicant inefciencies in the existing
literature on a baseline for the key credit criteria for green building
evaluation. Different green building rating tools evaluate based on
different criteria. Therefore, aim of this research is to identify and
establish key credit criteria for green building rating tools and to
compare and contrast the ways in which these established key
credit criteria are addressed in widely used green building rating
tools. Initially baseline key credits criteria are identied through an
extensive literature and these were evaluated based on the widely
used green building rating tools. Through this comparison it is
possible to identify the extent to which the identied key credit
criteria are addressed by the existing green building rating tools
and also it provides a solid basis to develop new green building
rating tools as well.
2. Establishing key credit criteria for green buildings
According to the U.S. Environment Protection Agency [EPA]
(2014) green buildings are designed to reduce the overall impact
of the built environment on human health and the natural envi-
ronment by efcient use of energy, water, and other resources,
protecting occupant health and improving employee productivity
and reducing waste, pollution and environmental degradation.
Apart from the consideration towards the environment, major-
ity of the denitions on green buildings focus on health and well-
being of the humans within the buildings (Cassidy et al., 2003;
Chan et al., 2009; United States Green Building Council, 2007),
and also other certain denitions have a consideration on the cost
as well (Gowri, 2004; U.S. Environment Protection Agency [EPA],
2014).
Similarly, Ltzkendorf and Lorenz (2006) illustrated that green
building focus on the environmental and health-related attributes
of buildings, while sustainable building approach led to the in-
clusion of economic and social aspects that resulted in a substan-
tially widened scope. This fact is further strengthened by Shari and
Soebarto (2012a), from their research on applying green concept
and sustainability concepts on a case study building. Therefore in
this research, a green building is identied as an environmentally
friendlier building with the efcient use of energy, water and other
resources and providing a better living and working environment
for the occupants. Further economic aspects must also be consid-
ered throughout the life cycle of the building. Therefore, a green
building should satisfy environmental, social and economic criteria
of sustainability which is commonly identied as the triple bottom
line. According to Zuo and Zhao (2014), green building is one of the
measures being put forward to mitigate signicant impacts of the
building stock on the environment, society and economy.
Green building rating tool is a yardstick which measures the
extent to which the buildings satisfy the green building re-
quirements. Therefore, the criteria used to evaluate the buildings
must represent the parameters which are required to make a green
building. As illustrated earlier, these parameters are three-fold
including environmental, social and economic criteria. However,
according to Zuo and Zhao (2014), environmental aspect of green
building are widely considered whereas other dimensions of sus-
tainability of green building, especially social and economic sus-
tainability is largely overlooked.
Vyas and Jha (2016), evaluated widely used green building
assessment tools such as BREEAM, LEED, SB-Tool, CASBEE, LEED-
India, Green Rating for Integrated Habitat Assessment (GRIHA)
and Eco-housing to develop a suitable assessment tool for India.
This research extracted nine components for green building
assessment namely; site selection, environment, building resources
and re-use, building services and management, innovative con-
struction techniques, environmental health and safety, mechanical
systems, indoor air quality and economy (Vyas and Jha, 2016).
 I.M.C.S. Illankoon et al. / Journal of Cleaner Production 164 (2017) 209e220
Similarly, Berardi (2015), mentioned green building assessment
criteria namely Sustainable sites, Energy efciency, Water ef-
ciency, Material and resources, IEQ, Water and pollution and
Other (including economic aspects and innovation).
Similarly, seven credit criteria were identied for developing a
rating tool for green store buildings in China (Yu et al., 2015). These
credit criteria are Landscape, Energy efciency, Water efciency,
Material and resources, IEQ, Construction management and
Operation management. It was illustrated that due to the
specialized characteristics of stores, such as signicant depth, high
occupant density and intensive use of air conditioning, credit
criteria such as IEQ, Energy consumption and Operational man-
agement should be given priority. The signicance of these criteria
depends on these specialized characteristics. Therefore, when
identifying the credit criteria, it is a necessary focus on the type of
building that is considered. In this green building rating tool, the
weightages for these credit criteria are given as follows; Landscape
- 15%, Energy efciency - 35%, water efciency
10%, Material and
resources
15% and IEQ- 25%.
Chandratilake and Dias (2015) proposed six credit criteria and
33 credit points for the assessment of green buildings. The main six
credit criteria included Site, Energy efciency, Water efciency,
Materials, IEQ and Waste and pollution. Ye et al. (2015) evalu-
ated the green building standards in China and identied that there
are three layers for the structure of green building standard system
in China, namely; basic layer, general layer and specialized layer.
According to Ye et al. (2015), basic layer provides the basis for the
other standards to develop and the general layer is expected to
provide measures for green buildings such as compliance guide-
lines. The specialized layer supports the standards in basic and
general layer with specialized content and specic provisions.
Further, credit criteria in this layer included Land use efciency,
Energy efciency, Water efciency, Material efciency, Ambient
indoor environment quality and Building functions. However, Ye
et al. (2015) further concluded that these standards still need to
include specialized functions such as Heat island, Ambient wind
environment, Flood and stormwater management and Vertical
planning and full decoration. Similarly, to develop a national green
building rating system for Malaysia, Hamid et al. (2014) suggested
that Energy efciency, Water efciency, IEQ, Site management,
Material and resources, Innovation, Transport, Water and
emission and Project management must be considered as credit
criteria. However, most of these rating tools concentrated on
environmental pillar of sustainability in green buildings. Certain
researches slightly identify the social parameter, but the economic
parameter is not considered.
Liu et al. (2013) analysed the current assessment tools appli-
cable in China and came up with a new rating tool for building
assessment named as Building Sustainability Score (BSS). This rat-
ing tool covered the whole building life cycle from inception to the
demolition stages. Further, it separately illustrated on environ-
mental, social and economic parameters of sustainability. To cover
the environmental sustainability, it focuses on Sustainable sites,
Sustainable material, Sustainable design, Heritage conservation,
Energy, Water, Waste, Noise, Emissions and Resources. In the
economic perspective, it focused on Land cost, Professional fees,
Construction cost, Operating cost, Occupancy cost, Demolition
cost, Salvage value and Other costs and charges. In social
parameter, certain credit criteria were identied, namely; Impact
on community, Urban integration, Proximity to facilities/acces-
sibility, Health and safety of work environment, Occupant's
health and comfort, Stakeholder relations, Occupier satisfaction
and productivity and Local impacts. Compared to other tools, this
rating tool was rather illustrative on each of the credit criteria.
Alyami and Rezgui (2012) developed an assessment tool for the
211
Middle East and North African region. Considering the environ-
mental consideration of the region the main credit criteria identi-
ed in the study were Management, IEQ, Sustainable sites,
Energy, Water and waste management, Material, Economic as-
pects, Quality of services, Pollution and Risk and innovation.
Similarly, to develop an assessment tool for ofce buildings in
Malaysia (Shari, 2011; Shari and Soebarto, 2012b), many credit
criteria are considered based on the triple bottom line; social,
environmental and economic sustainability. Credit points were
further developed for each credit criteria in this research study. In
terms of social sustainability; Education and awareness, Support
for social cohesion, Accessibility, inclusiveness of opportunities,
Human health and well-being, Cultural and heritage aspects and
Local people and employment were identied. For environmental
credit criteria, Land use and impacts on ecology, Supports
resource management, Emissions to air, Emissions to land/soil
waste, Emissions to water, Impacts on adjacent properties, Non-
renewable energy consumption and Portable water consumption
were reported. Economic sustainability related credit criteria were
also considered and for which Triple bottom line accounting and
Efciency, effectiveness and exibility was identied. This detailed
framework was identied as Malaysia Ofce Building Sustainability
Assessment (MOBSA) framework.
Wei et al (2010) developed a comprehensive and scientic rat-
ing tool based on life cycle assessment method. In this method, six
credit criteria were included for the assessment, namely; Land
saving and outdoor environment, Energy saving and utilization,
Material saving and utilization, Water saving and utilization, IEQ
and Economy. Each of these credit criteria was sub-divided into
more concrete indexes throughout the life cycle of the building.
Similarly, Ali and Al Nsairat (2009) developed a green building
rating tool for Jordan. Jordan is one of the countries with lack of
water resources, thereby Water efciency criterion is given a
higher priority in the rating tool. The water efciency parameter
included 27.7% of the credit points (Ali and Al Nsairat, 2009). This is
then followed by the Energy efciency criterion. Ali and Al Nsairat
(2009) also identied the main credit criteria for the rating tool
which are Site, Energy efciency, Water efciency, Material,
IEQ, Waste and pollution and Cost and economics. In this
research, it is argued that, for developing countries like Jordan,
economic pillar of sustainable development is essential and
therefore, it is necessary to include the last credit criteria i.e. Cost
and economics to the rating tool. Therefore, in this green building
rating tool, 10% of the credit points are attributed to economic
criteria. In this green building tool all the three aspects, namely
environmental, social and economic are represented through
different credit criteria.
To develop an approach to quantify the sustainable value of
industrial buildings, San-Jose et al. (2007) illustrated on ve main
credit criteria to evaluate the environmental impact. These
included Location, Construction materials, Energy and water
consumption, Inuence of the construction and regenerations
phase and Waste management. Liu et al (2006) argued that there
are two factors considered in developing an environmental build-
ing tool, namely performance factors and decision factors. It was
further illustrated that performance factors focus on targets and
results and decision support factors focus on strategies and pro-
cesses. It was also argued that these two factors were identied in
many rating tools. For performance factors, Sustainable environ-
ment and Health and well-being were initially considered. It was
then further illustrated as Natural resource consumption, Envi-
ronmental load and IEQ, Site/outdoor environment quality for
each sub category. Apart from that, for decision factors, Sustainable
technology, Sustainable design, Sustainable plan and Sustain-
able management were considered.
212 I.M.C.S. Illankoon et al. / Journal of Cleaner Production 164 (2017) 209e220
Tam et al. (2004), identied six management performance in-
dicators and seven operational performance indicators for devel-
oping a green rating tool. The seven credit criteria on operational
performance indicators included Maintenance of equipment, Air
pollution control, Noise pollution control, Water pollution con-
trol, Waste pollution control, Ecological impact and Energy
consumption. The management performance indicators were
concerned with management efforts to inuence environmental
performance. However, as discussed earlier, the Management
criteria is not much discussed in the selected green building rating
tools except for BREEAM, Green Star and GBI. However, in this
research, Tam et al. (2004) identied a separate section for man-
agement performance indicators illustrating the signicance of
management aspect in green building life cycle. Therefore, in
developing green building rating tools, it is worth focusing on the
Management criteria as well.
Based on the previous research on developing new green rating
tools and identifying the gaps on rating credit criteria it is evident
that most of these researches identify similar types of credit criteria
to be included in their respective rating tools (Table 1). Almost all
the researchers identied the credit criteria Site, Water, Energy,
IEQ, Material and Waste and pollution criteria as key credit
criteria (Table 1). Further, Management criterion is also considered
in many research studies, and a higher priority is given (Liu et al.,
2006; Salehudin et al., 2012; Tam et al., 2004).
However, according to literature, certain researches focus on
aspects such as Cost and economy (Ali and Al Nsairat, 2009), In-
uence of construction and regeneration phase (San-Jose  et al.,
2007) which are mainly due to the specic requirements of the
projects. Further, in certain research studies economic and social
impacts were also considered (Liu et al., 2013; Shari and Soebarto,
2012b) in detail. However, this aspect was not concerned directly
by the majority. In certain past studies (Hamid et al., 2014),
Transport was considered as one of the credit criteria. However,
this aspect was mostly covered through Pollution criterion in most
of the studies (Ali and Al Nsairat, 2009; Chandratilake and Dias,
2015). Therefore, in this research, Transport was considered un-
der Waste and pollution criterion and a separate key credit crite-
rion was not given to Transport criterion. Similarly, in detailed
frameworks such as MOBSA and BSS, certain credit points were
given prominence. As an example, in BSS, Noise, Occupant's
health and comfort and Occupier satisfaction are considered
separately for assessment as credit criteria. However, other re-
searches covered this through IEQ criterion.
According to Table 1, the newly developed rating tools also have
given a higher consideration on the key credit criteria such as Site,
Water, Energy, IEQ, Material, Waste and pollution and
Table 1
Key credit criteria identied.
Site Water Energy
Vyas and Jha (2016)
Berardi (2015)
Chandratilake and Dias (2015)
Ye et al. (2015)
Yu et al. (2015)
Hamid et al. (2014)
Liu et al. (2013)
Salehudin et al. (2012)
Shari (2011)
Wei et al. (2010)
Ali and Al Nsairat (2009) e e
San-Jose et al. (2007)
Liu et al. (2006)
Tam et al. (2004)
Based on Table 3
Management. According to the literature, the triple bottom line
parameters are to be considered in establishing key credit criteria.
When considering the seven key credit criteria given in Table 1, the
environmental, social and economic parameters can be embedded
to the evaluation. Key credit criteria such as IEQ and Waste and
pollution can represent social parameters of green buildings and
Management key credit criteria can focus on the economic aspects
as well. Further, all these key credit criteria except Management
key credit criteria have a direct impact on the environmental
parameter as well. This shows that the green building features can
be mainly summarised and measured focusing on those main credit
criteria. However, based on the literature, there are other factors
which are considered in developing new rating tools. Apart from
that, the main focus is on these seven criteria illustrated in Table 1.
Therefore, these seven credit criteria namely Site, Water, Energy,
IEQ, Material, Waste and pollution and Management were
established in this study as the key credit criteria.
3. Research methodology
According to Saunders et al. (2009), there are two approaches to
a literature review namely; deductive approach and inductive
approach. This research uses the deductive approach, whereas the
key criteria are identied based on the literature, and nally these
criteria are tested based on the widely used green building rating
tools. Therefore, initially, an extensive literature review is carried
out to establish the key credit criteria (Section 2). The literature is
sourced from journal papers, conference proceedings, thesis and
books. Afterwards, widely used green building rating tools are
selected which is illustrated in detail in Section 3.1.
The next step was to allocate each credit point of each rating to
the relevant key credit criteria. As an example, water quality is one
of the credit points in BREEAM rating tool. This is attributed to
Water criterion with its relevant credit point (1 point). Likewise,
all credit points of each tool were attributed to the relevant key
credit criteria. The basis of allocating the credit criteria is illustrated
in Section 3.2.
After attributing all credits points to the relevant established key
credit criteria, the nal scores were calculated. Once the scores
were established, these were normalised on the basis of 100 to
illustrate the importance of each key credit criteria. Based on the
normalised scores, radar diagrams were developed for each of the
rating tools to analyse the different credit criteria covered by
different rating tools. This process is illustrated in Fig. 1.
According to Fig. 1, nally, a comparison of the weight distri-
bution of the key credit criteria for each of the selected tools is
carried out. Apart from the radar diagrams, bar charts were
IEQ Material Waste and pollution Management
e
e
e e
e
e
e
e e
e
e
 I.M.C.S. Illankoon et al. / Journal of Cleaner Production 164 (2017) 209e220
Literature review
Selecting 8 main green building Establishing key credit criteria
rating tools representing 5 for green building ratings
regions
Allocating credit points of each of the
selected green buildings rating tool to
the established key credit criteria
Calculation of normalised scores
Developing radar diagrams and
comparison charts
Comparing the weight distribution of the
key credit criteria for each of the
selected tools
Fig. 1. Research methodology.
developed to compare each of the key credit criteria. Each of these
selected green building rating tools should obtain minimum credit
points to obtain a certication. These minimum scores are then
identied and normalised. The horizontal lines in the bar charts
represent these minimum normalised scores for each of the green
building rating tool except for CASBEE. As illustrated earlier in this
paper, CASBEE rating tool does not allocate credit points. Therefore,
minimum credit point calculation for certication is not calculated
for CASBEE rating tool.
3.1. Eight selected green building rating tools
This paper has used eight well established green building rating
tools from different regions of the world. The selection of these
rating tools were based on the classication provided by the World
Green Building Council (2015). According to the council, there are
71 green building council members, and out of which there are 27
countries with established green building councils. Established
member is dened as one that is fully operational displaying sta-
bility and national positioning (World Green Building Council,
2015). These member countries of World green building council
classied under ve basic geographic regions (1) America, (2)
Europe, (3) Asia-Pacic and (4) Middle East and North Africa and (5)
Africa. Therefore, this research focused on these ve regions and
the member countries of the World Green Building Council.
Initially, an extensive study was carried out focusing the 71
green building council members, identifying the mostly used green
rating tools in the respective regions. In these 71 countries, there
are countries with their own green building rating tools, and there
are certain countries adopting well-established green building
rating tools. Further, in certain countries established green building
rating tools such as LEED and BREEAM are mostly used even though
there are country-specic green building rating tools as well. In
such circumstances, if there is a widely accepted tool within the
213
region that was selected as the representative of that region for this
study. As an example, AQUA (Alta Qualidade Ambiental) process is
used in Brazil; however, LEED is widely used (Gomes et al., 2008).
There were LEED certied projects in practically all regions of Brazil,
and as of July 2013, the number of projects registered totalled 769
(over 33 million m2 undergoing certication), with 109 certied
(Ernst & Young Global Limited & Green building council Brazil,
2013). Therefore, in such cases, LEED was selected to this research
because it is widely used and accepted compared to AQUA within
the country.
On the other hand, the majority of the countries in the Asia-
Pacic region have their own rating tools. Further, in Asia Pacic
region, country-specic green building rating tools are widely used
and accepted. Therefore, all the widely accepted tools in the region
are considered in this research. All the green building rating tools
identied in the research is reported in Table 2 together with the
countries and the representing regions.
In the selected eight green rating tools, there are different
schemes available. As an example, in LEED there are main ve
schemes available namely; (1) Building design and construction (2)
Interior design and construction (3) Building operations and
maintenance (4) Neighbourhood development and (5) Homes
(United States Green Building Council [USGBC], 2015). This research
focuses on the new construction of green buildings. Therefore, for
each green building rating tool focusing on new construction is
selected for the study. For certain tools such as BREEAM and LEED,
there are different versions available. In such circumstances the
latest version was selected for analysis. Further, in these rating
tools, there are different schemes for different types of buildings
such as schools, non-residential buildings and residential buildings.
In such cases, the relevant rating tools related to non-residential
buildings are considered for the study. The main reason for
selecting new construction non-residential buildings is the major-
ity of projects certied are newly constructed non-residential
buildings (Green Building Council of Australia, 2015; United
States Green Building Council [USGBC], 2015). Further, there are
different credit criteria available in each of the green building rating
tools. These different credit criteria and the scheme used for this
study are identied in Table 3. Further, the number of credit points
allocated for each of these rating tools is also given in Table 3.
3.2. Attributing scores to key credit criteria
Each of these green building rating tools identied in the pre-
vious section has different credit criteria for the assessment of
green buildings (Table 3). There are certain credit criteria consid-
ered in common by most of the rating tools. For example, Energy
and IEQ criteria are addressed by all selected rating tools (Table 3).
Further, Water criterion is also directly considered by all the rating
tools except for CASBEE rating. Although a direct credit criterion is
not established on water efciency for CASBEE, in the Resources
and material credit criteria, the credit points such as water saving,
rainwater re-use and grey water re-use are considered in detail
similar to the other rating tools (CASBEE, 2015; Japanese
Sustainable Buidling Consortium & Institute for Building
Environment and Energy Conservation, 2014).
Material and resources and Sustainable sites are other credit
criteria which are established by the majority of the rating tools
except for Green Mark (Building Construction Authority, 2013).
However, in Green Mark, Environmental performance criterion
covers up a wide range of aspects. It has credit points covering on
sustainable construction, sustainable products, refrigerant
management and greenery provision which all add up to the
environmentally friendly material, resources and sustainable use of
sites (Building Construction Authority, 2013).
214 I.M.C.S. Illankoon et al. / Journal of Cleaner Production 164 (2017) 209e220

Table 2
Green building rating tools.

Region Assessment tool Countries which use the assessment tool

America LEED Argentina, Brazil, Canada, Chile, Peru, United States of America
Europe LEED Poland, Spain, Sweden, Turkey
BREEAM Croatia, Germany, Netherlands, Poland, Spain, Sweden, Turkey, United Kingdom
Asia-Pacic LEED Chinese Taipei, India
BEAM Plusa Hong Kong
Green Mark Singapore
CASBEEb Japan
GBIc Malaysia
IGBCd India
Green Star Australia, New Zealand
South Africa Green Star South Africa
Middle East and North Africa LEED Jordan, United Arab Emirates
BREEAM United Arab Emirates
a
BEAM Plus e Building Environmental Assessment Method (from Hong Kong).
b
CASBEE - Comprehensive Assessment System Built Environment Efciency (from Japan).
c
GBI e Green Building Index (from Malaysia).
d
IGBC e Indian Green Building Council Rating (from India).

Table 3
Credit criteria of selected green rating tool.

LEED (Building Design and BREEAM (BREEAM New Construction e Green Star (Design and As Green Mark (Non-Residential New
Construction
115 credit points) international e 130 credit points) Built e 100 credit points) Buildings version 4.1e183 credit points)

Location and transport (20) Management (23) Management (14) Energy efciency (116)
Sustainable sites (10) Health and wellbeing (17) Indoor environment quality (17) Water efciency (17)
Water efciency (12) Energy (27) Energy (22) Environmental protection (42)
Energy and atmosphere (35) Transport (12) Transport (10) Indoor Environmental quality (8)
Material and resources (14) Water (9) Water (12) Other green features (7)
Indoor environmental quality (18) Material (11) Material (14)
Regional priority (4) Waste (6) Land use and ecology (6)
Integrative process (1) Land use and ecology (12) Emissions (5)
Accredited professional (1) Pollution (13) Innovation (10)
Innovation (5) Innovation (10)

Green Building Index IGBC Rating (IGBC Green BEAM Plus (BEAM Plus New Building CASBEE (CASBEE for new construction)
(Non-Residential e 94 credit points) New Building
96 credit points) version 1.2e140 credit points)

Energy efciency (35) Sustainable architecture & design (5) Site aspects (24) Indoor environment (Q)
Indoor environmental quality (21) Site selection and planning (14) Material aspects (23) Quality of services (Q)
Sustainable site planning & Water conservation (18) Energy use (48) Outdoor environment (Q)
management (16) Energy efciency (28) Water use (10) Energy (L)
Material and resources (11) Building material & resources (16) Indoor environmental quality (35) Resources & materials (L)
Water efciency (10) Indoor environmental quality (12) Innovation and additions (5) Off -site environment (L)
Innovation (7) Innovation & development (7)

Almost all the selected rating tools have Innovation criterion
included in the rating tools. This is to reward new innovative ideas
which are not covered by any of the given credit points. Since this
credit criterion is not specically identied with detailed credit
points, credit points from Innovation criterion are excluded from
this research study.
In certain instances, the key credit criteria do not perfectly
overlap with the credit points given in the rating tools. Therefore,
attributing credit points to the identied key credit criteria was
difcult in certain instances. As a result of that, if there is any credit
point which does not t into these seven key credit criteria, it is
separately attributed. There were certain credit points, which can
be classied under two credit criteria. As an example, low emitting
material in LEED system can be identied in Material criterion and
as well as IEQ criterion (United States Green Building Council,
2014). In such cases, it is attributed to IEQ criterion because that
credit point is used to provide a better IEQ.
Waste and pollution criterion includes credit points governing
both construction and operational waste, air pollution due to fossil
fuel combustion, air and noise pollution during the construction
and light pollution. Site criterion includes all credit points
covering the selection of a site with the minimum impact on the
environment. Management criterion considers all the manage-
ment attributes including quality management, procurement se-
lections and construction management of the project.
In certain tools, credit criteria identied does not perfectly
overlap. As an example, in Green Mark, provision of daylight is
classied under the Energy criterion. However, according to the
classication purposes for this study daylight provision is attrib-
uted to IEQ criterion. In such cases, that particular credit point (Eg;
daylight) is attributed to the relevant key criterion which is more
applicable for the comparison. Although credit points from Inno-
vation criterion are excluded from the study, in certain rating tools,
credit points for accredited professional were identied in the
Innovation criterion. In such circumstances, that point is allocated
in Management criterion.
CASBEE rating tool does not allocate points to each credit criteria
(CASBEE, 2014). However, each credit point is evaluated based on a
scale ranging from level 1 to level 5. For credit points to be evalu-
ated on a scale, these credit points are to be equally important.
Further, if there are no weighting factors given all credit points are
assumed to be of equal importance, and there is no order of
importance for credit points (Ding, 2008; Todd et al., 2001).
Therefore, when allocating points for key credit criteria, each credit
 I.M.C.S. Illankoon et al. / Journal of Cleaner Production 164 (2017) 209e220 215

point is given the value of 1. When all the credit points are
attributed, the researcher arrived at the nal percentages for each
key credit criterion for each rating tool.
In certain rating tools such as BREEAM, Green Mark and IGBC,
there are certain pre-requisites to be fullled (Building
Construction Authority, 2013; Building Research Establishment
Environment Assessment Method, 2014; Indian Green Building
Council, 2015). However, there are no points allocated for those
requirements. Therefore, when allocating scores for each credit
criterion, these are not taken into consideration.
4. Analysis of the comparison
As illustrated in the research methodology section, after the key
credit criteria were established scores were attributed and nor-
malised. The values are presented in Table 4. Based on the scores
arrived, the radar diagrams were developed to further compare the
key credit criteria and the relevant green building rating tools
(Fig. 2).
4.1. Similarities among diagrams
According to Fig. 2, LEED, GBI and Green Plus are similar in the
context with the same pattern of credit allocation among key credit
criteria. The pattern of the diagram for Green Mark is also some-
what similar to LEED pattern, although the massive consideration
on Energy criterion is an exception (Fig. 2). Similarly, BREEAM and
Green Star share the same radar pattern following the same pattern
in credit allocation. According to Fowler and Rauch (2006), Green
Star is developed based on the BREEAM standard, which explains
the similarity. IGBC rating system is also somewhat similar to the
BREEAM diagram, but the credit points covering the Management
criterion are considerably lower compared with BREEAM. Further,
it is interesting to note that CASBEE follows a very different pattern
in the radar diagram.
4.2. Comparison of key credit criteria and scores
According to the comparison, Energy criterion has the highest
consideration on all rating tools except for CASBEE (Fig. 3).
However, in Green Mark, Energy is given the highest priority
compared to other categories with about 49.73% of the total score
(Table 4). According to Kamaruzzaman et al. (2016), the reason
for signicant concentration on Energy credits by most of the
green rating tools is because there will be an upward trend in
energy demand in the future. In a similar study for energy use
and assessment considering HK-BEAM, BREEAM and LEED illus-
trated that the performance levels of the baseline buildings are
comparable (Lee and Burnett, 2008). However, it was concluded
that it is most difcult to score credits under BREEAM (Lee and
Burnett, 2008). After a comparison among BREEAM, BEAM Plus
and CASBEE, LEED was found to be the most stringent and
relatively less exible in its assessment criteria in term of energy
use (Lee, 2012). However, despite this stringent criteria, actual
consumption gures of LEED certied buildings are comparable
to BREEAM and BEAM Plus (Lee, 2012). In this research study
also, the impact from Energy is similar among most of the green
building rating tools.
IEQ criterion is given the second priority, and in CASBEE, this is
given much consideration whereas gaining 25.30% of the total
scores (Table 4). The main reason for this higher consideration on
IEQ in CASBEE is the increasing concern about sick building syn-
drome in Japan (Nakayama and Morimoto, 2009). In a similar study
comparing green building rating tools for refurbishment projects, it
was concluded that Energy and IEQ are dominant themes in all
assessment schemes (Kamaruzzaman et al., 2016). However, it is
interesting to note that according to research in Arizona focusing on
post occupancy survey for a green certied building highlighted an
inconsistency between the LEED points earned for IEQ and the
actual level of occupant satisfaction (El Asmar et al., 2014). Further
El Asmar et al. (2014), illustrated the for improvement in the rating
system in such a way that correlates the awarded LEED rating with
the actual performance of the building during the occupation
phase, as opposed to the intended performance during the design
and construction stages. Therefore, it illustrates a need to evaluate
this scores further and identify whether these sub-criteria on IEQ
actually represents occupant satisfaction.
Water criterion is given a similar focus on the radar diagram in
each tool where the normalised scores are ranging from 7% to 19%
where BEAM Plus and CASBEE being the lowest and IGBC being the
highest (Table 4). According to Zhang et al. (2017), LEED in America
and British Codes follow similar water-saving indicators such as
reduction in water consumption, innovative waste water technol-
ogy, water saving and water-efcient technology. In this research
study also there is a similar allocation of scores in BREEAM, which is
the British rating tool and LEED is visible. However, according to
Zhang et al. (2017), in Material criteria, LEED focus on improving
the recycling rate of building materials and use ratio of local ma-
terials, and strengthen the building materials recycling to promote
green building materials performance. However, main concerns of
British codes are on adopting a method of centralized purchasing,
so as to save building materials consumption by controlling the

Table 4
Scores for key credit criteria for each rating tool.

Site Energy Water IEQ Material Waste and pollution Management Other Total

LEED Score 17 35 15 18 12 12 1 5 115

% 14.78 30.43 13.04 15.65 10.43 10.43 0.87 4.35 100.00
BREEAM Score 14 30 15 15 13 18 23 2 130
% 10.77 23.08 11.54 11.54 10.00 13.85 17.69 1.54 100.00
Green Star Score 7 24 14 17 14 11 12 1 100
% 7.00 24.00 14.00 17.00 14.00 11.00 12.00 1.00 100.00
Green Mark Score 8 91 20 35 18 4 7 0 183
% 4.37 49.73 10.93 19.13 9.84 2.19 3.83 0.00 100.00
GBI Score 9 37 11 21 6 6 3 1 94
% 9.57 39.36 11.70 22.34 6.38 6.38 3.19 1.06 100.00
BEAM plus Score 13 48 10 32 19 12 1 5 140
% 9.29 34.29 7.14 22.86 13.57 8.57 0.71 3.57 100.00
IGBC Score 11 28 19 12 13 5 2 6 96
% 11.46 29.17 19.79 12.50 13.54 5.21 2.08 6.25 100.00
CASBEE Score 6 7 6 21 10 4 2 27 83
% 7.23 8.43 7.23 25.30 12.05 4.82 2.41 32.53 100.00
216 I.M.C.S. Illankoon et al. / Journal of Cleaner Production 164 (2017) 209e220

Fig. 2. Radar Diagram for Green Rating Tools based on key credit criteria.

Fig. 3. Comparison between each key credit criteria.

materials procurement channels (Zhang et al., 2017). In this
research, according to Table 4 Material criterion is also well rec-
ognised by the rating tools, where more than 10% of points are
allocated related to the Material criterion except for GBI (about
6.38%). Irrespective of the underlying strategies as identied by
Zhang et al. (2017) both BREEAM and LEED has the similar pattern
in Material criteria in terms of normalised scores.
LEED, BREEAM and Green Star rating tools give a higher
consideration on Waste and pollution criterion compared to the
other tools. According to Table 3, only BREEAM and Green Star have
separate categories for Waste and pollution criterion, but still, this
aspect is covered by most of the rating tools. However, except for
BREEAM and Green Star, the rest of the rating tools have a mini-
mum focus on the Management criterion. Radar diagrams of
BREEAM and Green Star run centred to the centre point of the radar
diagram (Fig. 2). Therefore, it is possible to illustrate that these two
rating tools cover most of the key credit criteria in a more balanced
approach.
 I.M.C.S. Illankoon et al. / Journal of Cleaner Production 164 (2017) 209e220
4.3. Pre-requisites of rating tools which are not considered for the
credit point allocation
Many green building rating tools have certain requirements to
be met prior to credit point allocation. All the rating tools
considered in this study except for GBI and CASBEE have pre-
requisites to be satised before applying for credit points. These
requirements are not given any points but are mandatory, and if
not fullled, the building is not awarded with the relevant certi-
cation. Therefore, it can be concluded that these mandatory re-
quirements are very much signicant in building evaluation.
However, in this research, these signicant mandatory re-
quirements are not considered as these do not allocate any credit
points. The pre-requisites for each rating tool can be briey cat-
egorised into Table 5.
In BREEAM, there were certain minimum overall percentage
scores given for each rating level. Apart from that, in BREEAM, all
requirements were given credit points. Therefore, BREEAM was not
identied in Table 5. According to Table 5, pre-requisites of LEED,
IGBC and BEAM Plus focused on the key credit criteria namely;
Site, Water, Material, Energy and IEQ.
According to Green Star, GHG emissions and sustainable sites
are the only pre-requisites identied. Construction activity pollu-
tion prevention, which is attributed to Sites criterion is considered
as a prerequisite in LEED rating tool. Apart from that, credit criteria
attributed to Water such as outdoor/indoor water use reduction
and water metering were identied as pre-requisites in LEED.
Maintaining the minimum levels of energy performance, refrig-
erant management and Indoor Air Quality (IAQ) performance were
also covered as pre-requisites for LEED.
Similar to the radar diagrams, in Green Mark has given focus on
Energy criterion in pre-requisites as well. Green Mark has estab-
lished minimum levels of energy usage in the pre-requisite section
also. In IGBC rating, minimum standards for energy, IAQ and water
efciency were set out as pre-requisites. Other than that, adhering
to local regulations and soil erosion control were pre-requisites in
IGBC.
In BEAM Plus minimum energy performance attributing to
Energy criterion, water quality survey and minimum water
saving performance attributing to Water criterion were identied
as pre-requisites. Further, minimum ventilation performance
attributing to IEQ criterion was also given as a pre-requisite.
4.4. Minimum scores to obtain certication
According to the literature, there are certain minimum scores to
obtain the lowest certication in each green building rating tool. In
Fig. 3 the horizontal lines show the normalised scores required for
minimum certication. The highest required score is from GBI, and
the lowest is BREEAM (Fig. 3). According to Fig. 3, in LEED, BEAM
Plus and Green Mark the minimum normalised score required for
certication is signicantly lower than the normalised score allo-
cated to Energy criteria. This shows the signicant consideration
given on the Energy criteria by the rating tools. However, as given
Table 5
Pre-requisites of each rating tool.
Rating Tool Site Water Energy
LEED
Green Star e e
Green Mark e e
IGBC
BEAM Plus
217
in the literature, green buildings cater for all the three triple bottom
line aspects. Therefore, concentrating on one criterion does not
cater the requirements of developing a green building. As an
example, if a building obtains all the credit points in one criterion
alone does not ensure that it operates as green buildings. However,
in this situation where the minimum normalised score required for
certication is lesser than the normalised score of Energy criteria,
there is a possibility that a building might be given a green certi-
cation, although it does not focus on other green requirements
such water, IEQ and so on.
The minimum credit requirement in BREEAM is slightly lower
than that of the Energy criteria (Fig. 3). Therefore, LEED BEAM
Plus and Green Mark certication can be obtained by focusing on
the Energy criteria. However, in Green Star, IGBC and GBI the
minimum credit point requirement is higher than the key credit
criteria with the highest normalised score (Fig. 3). Therefore, equal
consideration must be given to all the key credit criteria when
obtaining green certication.
4.5. Credit points which are not covered by the key credit criteria
The majority of the credits points of the rating tools are covered
through the key credit criteria selected in this study. However, the
credits which are not covered by the key credit criteria are below 5%
for all the rating tools (Table 4) except for IGBC and CASBEE rating
tools. In IGBC rating tool about 6.25% of the credit points are not
covered by the key credit criteria. This amounts to a total of 6 credit
points. The credit points which are not covered through the key
credit criteria included design considerations such as passive ar-
chitecture (2 points), integrative design approach (1 point),
providing basic facilities for construction workers (1 point),
optimisation of structural design (1 point) and universal design
(1 point). When these credit points are considered, except for
providing basic facilities for construction workers, the rest focus on
the design considerations. Providing facilities for construction
workers is identied by both GBI and IGBC.
In CASBEE, about 32.53% of credit points are not covered by the
key credit criteria. This includes 27 credit points in total. These
covered many aspects such as earthquake resistance, seismic
isolation and vibration damping system, exibility in oor layout,
spatial margins and a wide range of different parameter which are
very specic to the region.
In LEED rating system 1 credit point is allocated to integrative
process, which is not covered by the key credit criteria. However,
this credit point is focused on the cost effectiveness of the project
outcome which is similar to the Cost and economy criterion dis-
cussed in the literature (Ali and Al Nsairat, 2009; Wei et al., 2010).
The remaining 4 credit points in LEED are for the Regional priority
criterion applicable to the United States as given by USGBC. Simi-
larly, Kamaruzzaman et al. (2016) illustrated that neither BREEAM
nor LEED includes consideration of social and economic aspects and
most green building rating tools lack evaluation of nancial aspects,
which is contrary to the ultimate principle of sustainable
development.
IEQ Material Waste and pollution Management
e e
e e e
e e e e
e e
e e
218 I.M.C.S. Illankoon et al. / Journal of Cleaner Production 164 (2017) 209e220
4.6. Differences of CASBEE
When compared to other rating tools, CASBEE rating tool has
many different credit points. The radar diagram is considerably
different from the rest, together with the scoring system. Credit
criteria which are not covered by the rating tools are considerably
high amounting to about 32.53%. The rating tool itself is different
from other rating tools. As pointed out in the literature, this tool
does not directly allocate points, but rather calculate the Building
Environment Efciency (BEE) score to rate the building based on
environmental quality and load. According to Suzer (2015), CASBEE
has the objective to take into account the problems specic to
Japan. This illustrates the different credit points illustrated in the
rating tool such as resistance to earthquakes which is specic to
the region. Further, this fact is strengthened by Sev (2011) stating
that mass transit is not considered in CASBEE which is different
from other tools, which is because it is already the most typical
form of transportation in Japan.
4.7. Credit criteria which identied in the literature but not covered
by the rating tools
In the literature review, there are many credit criteria which are
identied for developing green building rating tools. The majority
are similar and identied in the key credit criteria. However, there
are certain credit criteria which are not or rarely identied in the
rating tools but yet illustrated in the literature. These credit criteria
must be given consideration.
Economic aspects are discussed by many researches (Ali and Al
Nsairat, 2009; Wei et al., 2010). Further, Liu et al. (2013) discussed
this aspect in broader terms indicating Land cost, Professional
fees, Construction cost, Operating cost, Occupancy cost, De-
molition cost, Salvage value and Other costs and charges.
However, this is not given that much of consideration in many
rating tools although in LEED, 1 credit point is allocated in inte-
grative process which is discussed earlier in this paper. Similarly,
Zhang et al. (2017), compared BREEAM, LEED and Chinese stan-
dards for green building evaluation and concluded that it is
necessary to pay attention to the relationship between the
buildings' economic performance and environmental perfor-
mance, and the evaluation indicators should be in harmony with
each other. This shows the need to consider the economic aspects
of green building development and the clear lack of consideration
of economic indicators in credit criteria of almost all the green
building rating tools.
Although sustainable designing and planning consideration are
identied in the literature (Liu et al., 2013) it is not identied except
in IGBC and CASBEE rating systems. Protection of cultural heritage
is another criterion identied in the literature (Salehudin et al.,
2012; Shari, 2011). However, it is again provided with points in
CASBEE directly, and in certain tools such as BEAM Plus, it is noti-
ed in the selection of sites.
Credit criteria focusing on social sustainability such as Educa-
tion and awareness, Inclusiveness of opportunities and Local
people and employment are identied by Shari (2011), but not
considered in the rating tools. Similarly, in that study, economic
parameter included novel aspects such as Triple bottom line ac-
counting and Efciency, effectiveness and exibility which are
also not identied by the rating tools considered here. Stake-
holder relation is another criterion which is identied in the
literature (Liu et al., 2013) and not included in the rating tools.
Resilience (adaptation and mitigation) identied by the study in
Malaysia (Salehudin et al., 2012) is once again only identied in
CASBEE rating tools and not given consideration in other tools in
this study.
5. Conclusion
This paper established the key credit criteria to evaluate green
buildings. Initially, with an extensive study, widely used eight rat-
ing tools are identied. The green rating tools identied are LEED,
BREEAM, Green Star, GBI, Green Mark, BEAM Plus, IGBC rating and
CASBEE. The extensive literature study concluded that the key
credit criteria can be identied as Site, Energy, Water, IEQ,
Material, Waste and pollution, and Management. Finally, these
criteria are evaluated based on the widely used green building
rating tools. Based on the analysis of the key credit criteria, the
conclusions can be derived as follows;
- It was evident that these key credit criteria sum up the majority
of the credit points discussed in rating tools considered in the
study. Further, the majority of the credit criteria of six out of
eight rating tools could be successfully allocated into these key
credit criteria except for IGBC and CASBEE. Therefore, these
seven key credit criteria can be established as the main pa-
rameters in evaluating green buildings.
- Energy criterion has the highest consideration followed by
Water; and IEQ criteria respectively in green building rating
tools. In contrast, Management criterion is not that much
considered in the tools even though it is identied in the liter-
ature to a greater extent.
- The radar diagrams are similar in shape for LEED, Green Mark
and GBI. Further, BREEAM and Green Star also show a similar
shape and have a more balanced approach in point allocation.
- CASBEE rating tool follows a different allocation of credit points,
and also it focuses on many credit criteria which are not iden-
tied by others. The reason to this is the difference in
geographical location, and CASBEE is developed to cater those
requirements of that region.
- The credit criteria which are identied in the literature but not
included in the rating tools can be further evaluated and
included in developing these rating tools. Further, in developing
green building rating tools, it is better to focus on economic and
social parameters because most of the credit criteria which
identied in the literature but not considered in rating tools falls
into these pillars of sustainability. For a building to be certied
as a green building, it needs to be environmentally, socially and
economically sustainable. However, as illustrated in Section 4.5,
social and economic pillars are overlooked in existing green
building rating tools as well. Therefore, to provide a better
evaluation, these criteria must also be taken into consideration
in developing green building rating tools.
- In certain rating tools, there is a signicant emphasis given to a
single criterion. Therefore, there is a possibility of obtaining a
green certication only fullling that one particular criterion
even though all the other key credit criteria are overlooked or
even completely ignored. This must be signicantly considered
in developing green building rating tools so that the rating tool
can focus on all the key credit criteria to develop green building
rating tools to ensure the essence of the green building concept.
This research has identied many green building rating tools
used worldwide. However, based on the extent of usage, this
research is only limited to eight green building rating tools.
Therefore, further research can be developed focusing on the other
green building rating tools which are eliminated from this study.
There are certain credit criteria which are identied in the literature
but not identied by green building rating tools. Further research
can be undertaken on these credit criteria and identify the neces-
sity whether these must be identied in the future development of
the existing rating tools.
 I.M.C.S. Illankoon et al. / Journal of Cleaner Production 164 (2017) 209e220
This research identied the key credit criteria for green building
rating tools. This can be used as a baseline when developing new
green building rating tool. Further, the key credit criteria are
compared against eight widely used green building rating tools and
identied the focus given by each of these rating tools towards the
key credit criteria. This provides a clear understanding to the de-
velopers on the signicant areas which need proper attention when
obtaining green building rating for a specic building. Similarly, the
research ndings such as credit criteria not identied in green
building rating tools (Section 4.7) and comparison on minimum
normalised scores for green certication and normalised scores for
each criterion (Section 4.4) can be used to further develop the
existing tools as well.
Acknowledgements
The authors wish to acknowledge the nancial support from the
Australian Research Council (ARC), Australian Government (No:
DP150101015).
References
Abidin, N.Z., 2010. Investigating the awareness and application of sustainable
construction concept by Malaysian developers. Habitat Int. 34 (4), 421e426.
http://dx.doi.org/10.1016/j.habitatint.2009.11.011.
Ali, H.H., Al Nsairat, S.F., 2009. Developing a green building assessment tool for
developing countrieseCase of Jordan. Build. Environ. 44 (5), 1053e1064. http://
dx.doi.org/10.1016/j.buildenv.2008.07.015.
Alyami, S.H., Rezgui, Y., 2012. Sustainable building assessment tool development
approach. Sustain. Cities Soc. 5, 52e62. http://dx.doi.org/10.1016/j.scs.
2012.05.004.
Andrade, J., Bragana, L., 2016. Sustainability assessment of dwellings e a com-
parison of methodologies. Civ. Eng. Environ. Syst. 33 (2), 125e146. http://
dx.doi.org/10.1080/10286608.2016.1145676.
Berardi, U., 2015. Sustainability assessments of buildings, communities, and cities.
In: Klemes, J.J. (Ed.), Assessing and Measuring Environmental Impact and Sus-
tainability. Butterworth-Heinemann, Oxford, UK, pp. 497e545.
Building Construction Authority, 2013. BCA Green Mark for New Non-residential
Buildings Version NRB/4.1. Retrieved from Singapore.
Building Research Establishment Environment Assessment Method, 2014. BREEAM
International New Construction Technical Manual (SD 5075 1.0:2013). Retrieved
from.
CASBEE, 2014. CASBEE for Building New Construction, 2014 edition. Institute for
Building Environment and Energy Conservation, Tokoyo, Japan.
CASBEE, 2015. An Overview of CASBEE. Retrieved from: http://www.ibec.or.jp/
CASBEE/english/overviewE.htm.
Cassidy, R., Wright, G., Flynn, L., 2003. White paper on Sustainability: a Report of the
Green Building Movement. Building Design and Construction. Reed business
information, Clearwater.
Chan, E.H.W., Qian, Q.K., Lam, P.T.I., 2009. The market for green building in devel-
oped Asian citiesdthe perspectives of building designers. Energy Policy 37 (8),
3061e3070. http://dx.doi.org/10.1016/j.enpol.2009.03.057.
Chandratilake, S., Dias, W., 2015. Ratio based indicators and continuous score
functions for better assessment of building sustainability. Energy 83, 137e143.
http://dx.doi.org/10.1016/j.energy.2015.02.007.
Chen, H., Lee, W.L., 2013. Energy assessment of ofce buildings in China using LEED
2.2 and BEAM Plus 1.1. Energy Build. 63, 129e137. http://dx.doi.org/10.1016/
j.enbuild.2013.03.031.
Cole, R.J., 2005. Building environmental assessment methods: redening intentions
and roles. Build. Res. Inf. 33 (5), 455e467. http://dx.doi.org/10.1080/
09613210500219063.
Crawley, D., Aho, I., 1999. Building environmental assessment methods: applications
and development trends. Build. Res. Inf. 27 (4e5), 300e308. http://dx.doi.org/
10.1080/096132199369417.
Delai, I., Takahashi, S., 2011. Sustainability measurement system: a reference model
proposal. Soc. Responsib. J. 7 (3), 438e471.
Ding, G.K.C., 2008. Sustainable constructiondthe role of environmental assessment
tools. J. Environ. Manag. 86 (3), 451e464. http://dx.doi.org/10.1016/j.jenvman.
2006.12.025.
El Asmar, M., Chokor, A., Srour, I., 2014. Occupant satisfaction with indoor envi-
ronmental quality: a study of the LEED-certied buildings on the Arizona State
University campus. In: ICSI 2014: Creating Infrastructure for a Sustainable
World, pp. 1063e1070.
Ernst & Young Global Limited, & Green building council Brazil, 2013. Sustainable
Buildings in Brazil. Retrieved from: http://gbcbrasil.org.br/sistema/
docsMembros/1311141211060000005990.pdf.
European information service commission, 2012. Construction Sector Overview in
the UK. Retrieved from: http://www.prismenvironment.eu/reports_prism/UK_
219
PRISM_Environment_Report_EN.pdf.
Fowler, K.M., Rauch, E.M., 2006. Sustainable Building Rating Systems Summary
(PNNL-15858). Retrieved from: http://www.pnl.gov/main/publications/
external/technical_reports/PNNL-15858.pdf.
Gomes, V., Silva, M., Lamberts, R., Takaoka, M.V., Ilha, M., 2008. Sustainable Building
in Brazil (Paper presented at the Proceedings of the World Sustainable Building
Conference, Melbourne, Australia).
Gowri, K., 2004. Green building rating systems: an overview. ASHRAE J. 46 (11), 56.
Green Building Council of Australia, 2015. Green Star Project Directory. Retrieved
from: http://www.gbca.org.au/project-directory.asp.
Haapio, A., Viitaniemi, P., 2008. A critical review of building environmental
assessment tools. Environ. impact Assess. Rev. 28 (7), 469e482. http://
dx.doi.org/10.1016/j.eiar.2008.01.002.
Hamid, Z.A., Zain, M.Z.M., Hung, F.C., Noor, M.S.M., Roslan, A.F., Kilau, N.M., Ali, M.C.,
2014. Towards a National Green Building Rating System for Malaysia.
Hoffman, A.J., Henn, R., 2008. Overcoming the social and psychological barriers to
green building. Organ. Environ. 21 (4), 390e419.
Indian Green Building Council, 2015. IGBC Green New Building Rating System
(Version 3.0). India.
Japanese Sustainable Buidling Consortium, & Institute for Building Environment
and Energy Conservation, 2014. CASBEE for Building New Construction, 2014
edition (Retrieved from).
Kamaruzzaman, S.N., Lou, E.C.W., Zainon, N., Mohamed Zaid, N.S., Wong, P.F., 2016.
Environmental assessment schemes for non-domestic building refurbishment
in the Malaysian context. Ecol. Indic. 69, 548e558. http://dx.doi.org/10.1016/
j.ecolind.2016.04.031.
Lee, W.L., 2012. Benchmarking energy use of building environmental assessment
schemes. Energy Build. 45, 326e334. http://dx.doi.org/10.1016/j.enbuild.
2011.11.024.
Lee, W.L., Burnett, J., 2008. Benchmarking energy use assessment of HK-BEAM,
BREEAM and LEED. Build. Environ. 43 (11), 1882e1891. http://dx.doi.org/
10.1016/j.buildenv.2007.11.007.
Liu, Ding, G.K., Samali, B., 2013. Building Sustainable Score (BSS)da hybrid process
approach for sustainable building assessment in China. J. Power Energy Eng. 1
(05), 58. http://dx.doi.org/10.4236/jpee.2013.15009.
Liu, Prasad, D., Li, J., Fu, Y., Liu, J., 2006. Developing regionally specic environmental
building tools for China. Build. Res. Inf. 34 (4), 372e386. http://dx.doi.org/
10.1080/09613210600766328.
Lu, Y., Geng, Y., Liu, Z., Cote, R., Yu, X., 2017. Measuring sustainability at the com-
munity level: an overview of China's indicator system on National Demon-
stration Sustainable Communities. J. Clean. Prod. 143, 326e335. http://
dx.doi.org/10.1016/j.jclepro.2016.12.105.
Ltzkendorf, T., Lorenz, D., 2006. Using an integrated performance approach in
building assessment tools. Build. Res. Inf. 34 (4), 334e356. http://dx.doi.org/
10.1080/09613210600672914.
Nakayama, K., Morimoto, K., 2009. Risk factor for lifestyle and way of living for
symptoms of sick building syndrome: epidemiological survey in Japan. Jpn. J.
Hyg. 64 (3), 689e698. http://dx.doi.org/10.1265/jjh.64.689.
Nelms, C., Russell, A.D., Lence, B.J., 2005. Assessing the performance of sustainable
technologies for building projects. Can. J. Civ. Eng. 32 (1), 114e128.
Papajohn, D., Brinker, C., El Asmar, M., 2016. Uncovering Key Criteria to Assess
Sustainability Rating Systems for the Built Environment. Paper presented at the
Construction research congress, San Juan, Puerto rico.
Pink, B., 2012. Year Book 2012. (1301.0). Australian bureau of statistics, Canberra.
Pushkar, S., Shaviv, E., 2016. Using shearing layer concept to evaluate green rating
systems. Archit. Sci. Rev. 59 (2), 114e125. http://dx.doi.org/10.1080/
00038628.2014.966051.
Reed, R., Wilkinson, S., Bilos, A., Schulte, K.-W., 2011. A Comparison of International
Sustainable Building ToolseAn Update. Paper presented at the The 17th Annual
Pacic Rim Real Estate Society Conference, Gold Coast.
Reidy, C., Lederwasch, A., Ison, N., 2011. Dening Zero Emission Buildings Review
and Recommendations: Final Report. Retrieved from: http://www.asbec.asn.au/
research/.
Sachin, V.G., Jha, K.N., 2012. Comparative Study of Rating Systems for Green
Building in Developing and Developed Countries. Paper presented at the Third
International Conference on Construction in Developing Countries (ICCIDCeIII)
Advancing Civil, Architectural and Construction Engineering & Management,
Bangkok, Thailand.
Salehudin, M.S., Prasad, D.K., Osmond, P.W., Khamis, M.T., 2012. Sustainable Resort
Development: Malaysian Case Studies. Paper presented at the International
Conference on Tourism Management and Tourism Related Issues, Nice, France.
http://www.researchgate.net/prole/Paul_Osmond/publication/265051293_
Sustainable_resort_development_Malaysian_case_studies/links/
5591f10108aed6ec4bf8535e.pdf.
Sallam, I., Abdelaal, M.R.M., 2016. Relative weight of water efciency credits: as an
indicator to enhance buildings' environmental assessment tools performance.
Archit. Sci. Rev. 59 (5), 423e431. http://dx.doi.org/10.1080/00038628.
2015.1107526.
San-Jose , J., Losada, R., Cuadrado, J., Garrucho, I., 2007. Approach to the quanti-
cation of the sustainable value in industrial buildings. Build. Environ. 42 (11),
3916e3923. http://dx.doi.org/10.1016/j.buildenv.2006.11.013.
Saunders, M., Lewis, P., Thornhill, A., 2009. Research Methods for Business Students,
5 ed. Person Education, England.
Schwartz, Y., Raslan, R., 2013. Variations in results of building energy simulation
tools, and their impact on BREEAM and LEED ratings: a case study. Energy Build.
220 I.M.C.S. Illankoon et al. / Journal of Cleaner Production 164 (2017) 209e220
62, 350e359. http://dx.doi.org/10.1016/j.enbuild.2013.03.022.
Sev, A., 2011. A comparative analysis of building environmental assessment tools
and suggestions for regional adaptations. Civ. Eng. Environ. Syst. 28 (3),
231e245. http://dx.doi.org/10.1080/10286608.2011.588327.
Shari, Z., 2011. Development of a Sustainability Assessment Framework for
Malaysian Ofce Buildings Using a Mixed-methods Approach (PhD thesis).
University of Adelaide, Adelaide, Australia. Retrieved from: https://digital.
library.adelaide.edu.au/dspace/bitstream/2440/73200/7/03appendices.pdf.
Shari, Z., Soebarto, V., 2012a. Green vs. Sustainability Performance Assessment ;A
Case Study of an Ofce Building in Putrajaya, Malaysia. Paper presented at the
Proceedings - 28th International PLEA Conference on Sustainable
Architecture Urban Design: Opportunities, Limits and Needs - Towards an
Environmentally Responsible Architecture, PLEA 2012.
Shari, Z., Soebarto, V., 2012b. Green vs. Sustainability Performance Assessment: a
Case Study of an Ofce Building in Putrajaya, Malaysia. Paper presented at the
PLEA Conference (28th: 2012: Lima, Peru).
Sinou, M., Kyvelou, S., 2006. Present and future of building performance assessment
tools. Manag. Environ. Qual. Int. J. 17 (5), 570e586. http://dx.doi.org/10.1108/
14777830610684530.
Sinou, M., Kyvelou, S., Sinou, M., Kyvelou, S., 2006. Present and future of building
performance assessment tools. Manag. Environ. Qual. Int. J. 17 (5), 570e586.
http://dx.doi.org/10.1108/14777830610684530.
Suzer, O., 2015. A comparative review of environmental concern prioritization:
LEED vs other major certication systems. J. Environ. Manag. 154, 266e283.
http://dx.doi.org/10.1016/j.jenvman.2015.02.029.
Tam, C., Tam, V.W., Tsui, W., 2004. Green construction assessment for environ-
mental management in the construction industry of Hong Kong. Int. J. Proj.
Manag. 22 (7), 563e571. http://dx.doi.org/10.1016/j.ijproman.2004.03.001.
Tan, Y., Shen, L., Yao, H., 2011. Sustainable construction practice and contractors'
competitiveness: a preliminary study. Habitat Int. 35 (2), 225e230. http://
dx.doi.org/10.1016/j.habitatint.2010.09.008.
Todd, J.A., Crawley, D., Geissler, S., Lindsey, G., 2001. Comparative assessment of
environmental performance tools and the role of the Green Building Challenge.
Build. Res. Inf. 29 (5), 324e335. http://dx.doi.org/10.1080/09613210110064268.
U.S. Environment Protection Agency [EPA], 2014. Green building. Retrieved from:
http://archive.epa.gov/greenbuilding/web/html/about.html.
United States Green Building Council, 2007. Making the Business Case for High
Performance Green Buildings. Retrieved from 1800 Massachusetts Ave, NW
Suite 300 Washington, DC 20036: http://www.usgbc.org/Docs/Member_
Resource_Docs/makingthebusinesscase.pdf.
United States Green Building Council, 2014. LEED V4 for Building Design and
Construction. US Green Building Council, Washington, DC.
United States Green Building Council [USGBC], 2015. LEED. Retrieved from: http://
www.usgbc.org/.
Vyas, G.S., Jha, K.N., 2016. Identication of green building attributes for the devel-
opment of an assessment tool: a case study in India. Civ. Eng. Environ. Syst. 33
(4), 313e334. http://dx.doi.org/10.1080/10286608.2016.1247832.
Wei, B., Zhang, B., Luo, W., 2010. Research on Assessment Method of Green Build-
ings in China. Paper presented at the ASME 2010 4th International Conference
on Energy Sustainability.
World Green Building Council, 2015. About WorldGBC. Retrieved from: http://www.
worldgbc.org/.
Ye, L., Cheng, Z., Wang, Q., Lin, H., Lin, C., Liu, B., 2015. Developments of green
building standards in China. Renew. Energy 73, 115e122. http://dx.doi.org/
10.1016/j.renene.2014.05.014.
Yu, W., Li, B., Yang, X., Wang, Q., 2015. A development of a rating method and
weighting system for green store buildings in China. Renew. Energy 73,
123e129. http://dx.doi.org/10.1016/j.renene.2014.06.013.
Zhang, Y., Wang, J., Hu, F., Wang, Y., 2017. Comparison of evaluation standards for
green building in China, Britain, United States. Renew. Sustain. Energy Rev. 68,
262e271.
Zuo, J., Zhao, Z.-Y., 2014. Green building researchecurrent status and future agenda:
a review. Renew. Sustain. Energy Rev. 30, 271e281. http://dx.doi.org/10.1016/
j.rser.2013.10.021.
 International Biodeterioration & Biodegradation xxx (2017) 1e7

Contents lists available at ScienceDirect

International Biodeterioration & Biodegradation

journal homepage: www.elsevier.com/locate/ibiod

Fungal microbiomes associated with green and non-green building

materials
Kanistha Coombs a, Stephen Vesper b, Brett J. Green c, Mikhail Yermakov a,
Tiina Reponen a, *
a
Department of Environmental Health, University of Cincinnati, P.O. Box 670056, Cincinnati, OH 45267-0056, United States
b
United States Environmental Protection Agency, 26 W. M. L. King Drive, Mail Stop 314, Cincinnati, OH 45268, United States
c
Centers for Disease Control and Prevention, National Institute for Occupational Safety and Health, 1095 Willowdale Road, Morgantown, WV 26505, United
States

a r t i c l e i n f o a b s t r a c t

Article history: Water-damaged buildings can lead to fungal growth and occupant health problems. Green building
Received 14 March 2017 materials, derived from renewable sources, are increasingly utilized in construction and renovations.
Received in revised form However, the question as to what fungi will grow on these green compared to non-green materials, after
15 June 2017
they get wet, has not been adequately studied. By determining what fungi grow on each type of material,
Accepted 28 July 2017
the potential health risks can be more adequately assessed. In this study, we inoculated green and non-
Available online xxx
green pieces of ceiling tile, composite board, drywall, and ooring with indoor dust containing a complex
mixture of naturally occurring fungi. The materials were saturated with water and incubated for two
Keywords:
Mycobiome
months in a controlled environment. The resulting fungal microbiomes were evaluated using ITS
Fungal growth amplicon sequencing. Overall, the richness and diversity of the mycobiomes on each pair of green and
ITS sequencing non-green pieces were not signicantly different. However, different genera dominated on each type of
Green product material. For example, Aspergillus spp. had the highest relative abundance on green and non-green
ceiling tiles and green composite boards, but Peniophora spp. dominated the non-green composite
board. In contrast, Penicillium spp. dominated green and non-green ooring samples. Green gypsum
board was dominated by Phialophora spp. and Stachybotrys spp., but non-green gypsum board by Myr-
othecium spp. These data suggest that water-damaged green and non-green building materials can result
in mycobiomes that are dominated by fungal genera whose member species pose different potentials for
health risks.
2017 Elsevier Ltd. All rights reserved.

1. Introduction
Green building materials are derived from recycled or renew-
able sources (US EPA, 2017). For example, gypsum board, composite
board or ceiling tiles can be made of recycled materials. Bamboo
ooring is an example of a readily renewable product compared to
ooring composed of virgin wood. The building industry and
homeowners are utilizing more green-building materials, which
should make the built environment more sustainable (Steinemann
et al., 2017). However, it is also important to determine if green
products are susceptible to more or different fungal growth
* Corresponding author.
E-mail address: Tiina.Reponen@uc.edu (T. Reponen).
compared to the products they are replacing (Thatcher and Milner,
2016).
Fungal growth on moisture-damaged building materials can
lead to health effects including asthma and other respiratory
problems (WHO, 2009). The growth of fungi on green and non-
green product pairs has been compared in three earlier studies
(Hoang et al., 2010; Huang et al., 2015; Mensah-Attipoe et al., 2015).
Hoang et al. (2010) inoculated green and non-green product pairs
with either Aspergillus niger spores or by allowing the materials to
be naturally inoculated by placing sterile pieces of each in a home
and allowing airborne fungal cells to settle on each piece before
testing began. The fungal growth was visually assessed by
measuring the area of the surface contaminated by fungal growth.
Under either inoculation method, fungal growth was comparable
on green and non-green products. Huang et al. (2015) inoculated
green and non-green building materials with Aspergillus brasiliensis

http://dx.doi.org/10.1016/j.ibiod.2017.07.018
0964-8305/ 2017 Elsevier Ltd. All rights reserved.

Please cite this article in press as: Coombs, K., et al., Fungal microbiomes associated with green and non-green building materials, International
Biodeterioration & Biodegradation (2017), http://dx.doi.org/10.1016/j.ibiod.2017.07.018
2 K. Coombs et al. / International Biodeterioration & Biodegradation xxx (2017) 1e7
and Penicillium funiculosum and found no differences in visually
assessed fungal growth on each pair of materials. Mensah-Attipoe
et al. (2015) used cultivation and an enzyme bioassay to compare
fungal growth on green and non-green product pairs inoculated
with three fungi: Aspergillus versicolor, Cladosporium cladospor-
ioides or Penicillium brevicompactum. No signicant differences in
the growth of these three fungi on green and non-green building
materials were found. However, there are about 1.5 million fungal
species (Hawksworth, 2001) and testing each mold separately in
such studies is not practical. Therefore, in our tests, we inoculated
green and non-green materials with a complex mixture of fungi
naturally occurring in indoor dust.
Cultivation has previously been used to assess fungal contami-
nation in eld samples (Hyv arinen et al., 2002). This method,
however, will detect only fungi that are able to grow on the culture
media used. The populations of fungi, or mycobiome, can be
studied by using ITS amplicon sequencing (Schoch et al., 2012).
Hoisington et al. (2014) used this technology to evaluate the com-
plex mycobiome of a retail store. Using this technology, the iden-
tication of fungi in the indoor environment has recently provided
new insights into the health effects of previously overlooked fungi,
such as the fungal species placed in the genus Cryptococcus
(Dannemiller et al., 2014). Next-generation sequencing method
have also been used to analyze bacterial biomass in building ma-
terials (Adamiak et al., 2017; Laiz et al., 2011). The objective of this
study was to evaluate the similarities and differences in the
mycobiome developed on green compared to non-green building
products.
2. Materials and methods
2.1. Selection of building materials
Based on consultation with a Leadership in Energy and Envi-
ronmental Design (LEED) specialist at the U.S. Green Building
Council (http://www.usgbc.org), four different types of most
commonly used green and non-green building materials were
chosen for this study. The green building materials included
bamboo ooring (GreenFloors, Fairfax, VA, USA), wheat mineral
board (Kirei, Solana Beach, CA, USA), Sheetrock gypsum board (CGC
Corporation, Mississauga, Ontario, Canada) and Armstrong Acous-
tical ceiling tiles (Armstrong World Industries, Hilliard, OH, USA).
The main components of the two rst building materials are
organic material (bamboo and wheat stalks), whereas sheetrock
gypsum board contains up to 95% of pre-consumer recycled con-
tent and acoustical ceiling tiles which contain up to 82% recycled
content which include both pre- and post-consumer waste, as well
as materials including recycled newspaper, mineral wool, perlite,
jute and cornstarch. The respective non-green building materials
included pine hardwood ooring (BLC Hardwood Flooring, Macon,
GA, USA), oriented strand particle board (LP Building Products,
Binghamton, NY, USA), conventional gypsum board (Continental
Building Products, Herndon, VA, USA) and conventional ceiling tile
(SpectraTile, Middlebury, IN, USA).
2.2. Collection and preparation of inoculating dust
Indoor dust containing a complex mixture of naturally occurring
fungi was used to inoculate the tested building materials. The dust
was collected from ve indoor locations by vacuuming oors (Filter
Queen Majestic; HMI Industries Inc., Seven Hills, OH) as previ-
ously described (Cho et al., 2006). The collected dust was pooled
together and sifted using a 355-mm sieve to ensure homogeneity
and exclude large particles. The resulting dust pool was then stored
at
20  C before inoculating the building materials.
Please cite this article in press as: Coombs, K., et al., Fungal microbiomes associated with green and non-green building materials, International
Biodeterioration & Biodegradation (2017), http://dx.doi.org/10.1016/j.ibiod.2017.07.018
2.3. Preparation, inoculation, and incubation of building materials
Each building material was cut into three, identical 25 cm2
pieces and then gamma irradiated with a minimum dose of 25
kGray to reduce any biological contamination. Each piece was then
placed in 20 mL of deionized and autoclaved water to establish a
high water activity and for the ease of spreading the dust suspen-
sion. The sieved dust was suspended in 0.05% Tween 80 solution to
obtain a dust concentration of 50 mg/mL and 0.5 mL of this sus-
pension was inoculated on each building material to provide a nal
dust load of 1 mg/cm2.
The inoculated building materials were then placed in eight
different, 5.3-liter plastic containers (1 container for each of the 8
building material types) to avoid cross-contamination between
building materials as previously described (Seo et al., 2008). The
containers were purchased from a local hardware store and
disinfected by rinsing with 70% ethanol. The containers were
aerated with lter-sterilized air (pore size, 0.2 mm; GE Osmonics
Inc., MN) once a day for 10 min at a ow rate of 0.53 L/min
(Murtoniemi et al., 2003). Inoculated building material samples
were incubated at room temperature (23 1  C) and a relative
humidity of 98% (1%) to simulate ooding situations, for two
months. Two months at high humidity (95%) has been shown to
be sufciently long time for mold growth on several types of
building materials (Johansson et al., 2012). The humidity was
achieved by placing a saturated K2SO4 solution (150 g/liter) at the
bottom of each container (Korpi et al., 1998). The temperature
and humidity in each container were monitored daily using a
humidity-temperature pen (Fisher Scientic Company, Pitts-
burgh, PA).
2.4. Sample preparation for genomic DNA extraction
After the 2-month incubation period, 10 mm diameter auto-
claved cork-borers (Fisher Scientic) were used to scoop out
approximately ve to six circular pieces (thickness ~ 3 mm) of each
building material. The weight of each circular piece varied from
1.5 g to 4.6 g, depending on the building material. The bores were
then pooled together and placed in a sterile mortar and ground
with liquid nitrogen for approximately 2 min or until a ne con-
sistency was obtained as previously described (Ettenauer et al.,
2012). The ground material was then transferred to 50 mL falcon
tubes and homogenized by manually shaking the powder-like
samples by hand. If not used for genomic DNA (gDNA) extraction
immediately, the samples were stored in
20  C.
Genomic DNA was extracted from each building material sam-
ple (50 mg) using the MOBIO PowerLyzer PowerSoil DNA isola-
tion kit following the manufacturer's instructions (Carlsbad,
California). An extract of DNA from each sample was sent to the
Research and Testing Laboratory (Lubbock, Texas) for Illumina
MiSeq sequencing.
2.5. Illumina MiSeq analysis
Research and Testing Laboratory performed the Illumina MiSeq
sequencing. Forward and reverse fusion primers were used to
amplify the ITS1 regions from the DNA sample. The forward primer
included the (50 -30 ) Illumina i5 adapter (AATGATACGGCGACC-
ACCGAGATCTACAC), an 8-10bp barcode, a primer pad, and the
ITS1F primer (CTTGGTCATTTAGAGGAAGTAA). The reverse fusion
primer included the (50 -30 ) Illumina i7 adapter (CAAGCAGAA-
GACGGCATACGAGAT), an 8-10bp barcode, a primer pad, and the
unlabeled ITS2 primer (GCTGCGTTCTTCATCGATGC). The ampli-
cation was performed and visualized as previously described
(Kozich et al., 2013; MacIntyre et al., 2015).
 K. Coombs et al. / International Biodeterioration & Biodegradation xxx (2017) 1e7
The sequences were clustered into OTUs dened at the level of
97% sequence identity using the UPARSE algorithm, after going
through de-noising and chimera checking (Edgar, 2013). The de-
noising was done to remove short sequences, singleton se-
quences, and noisy reads. Next, the USEARCH global alignment al-
gorithm and the RDP Classier against a proprietary database
(Research and Testing Laboratory) of high-quality sequences
derived from the GenBank (as they existed on December 2014)
were used to query the centroid sequence from each cluster.
The output was analyzed using a python program, internally
developed at the Research and Testing Laboratory, which assigned
taxonomic information to each sequence and then computed and
wrote the nal analysis les. The data have been deposited with
links to BioProject accession number PRJNA380961 in the NCBI
BioProject database (https://www.ncbi.nlm.nih.gov/bioproject/).
2.6. Statistical analyses
Fungal diversity was assessed using two indices. First, Chao1
richness estimator was calculated to determine the overall richness
(i.e., number of distinct organisms present within the samples)
ni ni
1
Schao1 Sobs
2n2 1
where ni is the number of operational taxonomic units (OTUs) with
abundance i.
0
Second, Shannon diversity (H ) was calculated to assess the
overall diversity, which is determined by both richness and even-
ness (the distribution of abundance among distinct taxa):
0
X
R
H pi ln pi
I1
where R is richness and pi is the relative abundance of the ith OTU.
Rarefaction curves of Chao1 Richness estimate and Shannon
Diversity were prepared by rarefying between 100 and 10,000
reads with a step size of 100 reads and 10 iterations per step. Dif-
ferences in the diversity indices between building material types
were analyzed by using an ANOVA. All analyses were conducted in
Fig. 1. Comparison of green and non-green building materials using Chao1 richness and Shannon's diversity indices. The blue line illustrates the mean value of each group (green
and non-green). Each circle represents either the richness or diversity value for a building material type. There were no signicant differences in Chao1 richness or Shannon
diversity between green and non-green materials. (CT ceiling tile; GB gypsum board; CB composite board; FL ooring).
Please cite this article in press as: Coombs, K., et al., Fungal microbiomes associated with green and non-green building materials, International
Biodeterioration & Biodegradation (2017), http://dx.doi.org/10.1016/j.ibiod.2017.07.018
3
R using the vegan (Oksanen et al., 2013), labdsv (Roberts, 2010),
DESeq2 (Anders and Huber, 2010), and phyloseq (McMurdie and
Holmes, 2013) packages.
3. Results
The mycobiome analysis resulted in 176,520 OTUs from all green
building materials and 281,265 OTUs from all non-green building
materials, after quality trimming. Based on this data, the Chao1
richness and Shannon's diversity indices were calculated for green
and non-green building materials (Fig. 1). The mean richness of
fungal taxa on non-green building materials was higher than on
green materials, but the difference was not statistically signicant.
The mean diversity was approximately the same between green
and non-green building materials, although green ooring had a
much higher Shannon diversity index (1.75) compared to non-
green ooring (1.18) (Fig. 1).
Fig. 2 shows the relative abundance of the fungal genera
detected on all building materials by ITS amplicon sequencing.
Aspergillus spp. had the highest relative abundance on green and or
non-green ceiling tiles and green composite boards. However,
Peniophora spp. dominated non-green composite board and
accounted for about 65% of the fungal OTUs. In contrast, Penicillium
spp. accounted for about 40% and 75% of fungal OTUs on green and
non-green ooring samples, respectively. Phialophora spp. followed
by Stachybotrys spp. dominated fungal growth on green gypsum
board but, on non-green gypsum board, Myrothecium spp. followed
by Phialophora spp. dominated (Fig. 2). (Both the USEARCH and RDP
classiers were used in this analysis, since the RDP is proprietary.
Any differences observed between the two classiers did not affect
the overall results of the analysis.)
Fig. 3 shows the double dendrogram for the distance between
sample types, based on weighted-pair linkage (y-axis) and asso-
ciations or co-occurrence of the 25 most common genera on each
building material (x-axis). The results demonstrated that the type
and classication of the building material were independent of
the mycobiome that resulted. For example, the mycobiome from
the non-green ceiling tile and green ooring were more closely
related than the mycobiomes from their matched pair of mate-
rials. In addition, the sequencing data showed that certain genera
4 K. Coombs et al. / International Biodeterioration & Biodegradation xxx (2017) 1e7

Fig. 2. Genera detected, in all green and non-green building materials, using ITS amplicon sequencing using RDP-classier with a condence threshold of 80%. (Taxons below 1% of
relative abundance were categorized as Other and depicted by the light gray squares.) (G green; NG non-green).

co-colonized, independent of building material (x-axis). The
strongest example of this association was between Stachybotrys
spp. and Aspergillus spp. but Penicillium spp. and Exophiala spp.
with Cryptococcus spp. (Filbasidiella spp.) and Candida spp. to a
lesser extent.
4. Discussion
There have been a few previous studies of fungal growth on
green and/or non-green building materials (Hoang et al., 2010;
Huang et al., 2015; Mensah-Attipoe et al., 2015). Hoang et al.
(2010), in a component of their study called Natural Inocula-
tion, left pieces of sterile green building materials to collect
settled dust for ve days in a home. These pieces were then satu-
rated with water and placed in an approximately 90% relative hu-
midity environment or, in other experiments, non-saturated pieces
were placed in the high humidity chamber. In either case, they
found that the different types of green building materials were
colonized at different rates. However, the colonization was only
estimated by visual observations and no attempt was made to
identify or quantify the resulting fungi.
Huang et al. (2015) were primarily interested in the impact of
impregnation of nano-metal particles into green and non-green
building materials on fungal growth. However, as part of their
study, they inoculated green building materials with one Aspergillus
spp. and one Penicillium spp. and incubated the samples at 85%
relative humidity. Under those conditions, they did not see differ-
ences in fungal colonization between green and non-green building
materials. However, the quantication of fungal growth was only
based on visual ratings.
In another study, Mensah-Attipoe et al. (2015) tested the growth
of three fungi, one Aspergillus spp., one Penicillium spp. and one
Cladosporium spp., on two types of green and non-green building
materials. The materials were incubated at 95e97% relative hu-
midity for a number of weeks. Based on culturing and biomass
estimates, there were no difference in the fungal growth on these
green and non-green building materials.
There are many reasons that our results appear to be different
from these previous studies. The previous studies of green and non-
green building materials only tested for the growth of one, a few or
airborne fungi. In our study, vacuumed-oor dust, collected from
multiple indoor sources, was used to inoculate green and non-
green building materials. This dust mixture was used to represent
the fungal populations that might accumulate over many months
or years, ensuring the presence of a wide spectrum of fungi for
potential colonization.
Another difference between our study and previous studies,
except for Hoang et al. (2010), was that we saturated the pieces of
building material with water, before placing them at high relative
humidity. However, perhaps the most important difference be-
tween our study and previous studies was our use of next gener-
ation sequencing to evaluate the fungal mycobiome produced on
the building materials.
The mycobiomes on the green and non-green materials produced
a richness and diversity of fungal OTUs that were not signicantly
different but dominating fungal genera were specic to the various
materials. These differences in mycobiomes was also demonstrated
by the linkages shown in Fig. 3. Some apparently unrelated materials,
e.g., non-green ceiling tile and green ooring, produced more similar
mycobiomes than materials in the same class. In some cases, co-
colonization by some genera were independent of building mate-
rial. Therefore, the distinction between green and non-green building
materials may not be the driving force in determining differences in
fungal growth, but other factors like microbial competition, chemical
composition, moisture and nutrient availability may be more
important (Mensah-Attipoe et al., 2015).
Although green and non-green materials both supported a rich
and diverse mycobiome, these data highlight that the fungal ex-
posures that result may be very different depending on the mate-
rial. These differences could have health implications, although the
identication of the actual species within these genera would help
to elucidate the risk of adverse health effects.
Aspergillus spp. OTUs dominated the fungal growth on the green
ceiling tile and to a lesser extent the non-green ceiling tile.

Please cite this article in press as: Coombs, K., et al., Fungal microbiomes associated with green and non-green building materials, International
Biodeterioration & Biodegradation (2017), http://dx.doi.org/10.1016/j.ibiod.2017.07.018
 K. Coombs et al. / International Biodeterioration & Biodegradation xxx (2017) 1e7 5

Fig. 3. Double dendrogram based upon the predominant fungal genera detected, in all green and non-green building materials. The heat map represents the relative percentages of
the most abundant fungal genera identied from each sample; white fractions indicate the absence of the fungi. The distance between samples, based on weighted pair linkage, is
shown on the y-axis whereas connectedness of the 25 most abundant fungal genera are provided on the x-axis.

Aspergillus spp. OTUs also dominated the green composite board
whereas Peniophora spp. dominated the non-green composite bord.
The genus Aspergillus includes many infectious fungal species
(Richardson and Warnock, 2012). Peniophora is a genus that causes
white rot of wood and includes some plant pathogenic species
(Nagy et al., 2016) but is generally not a source of human pathogens.
Penicillium spp. OTUs were very common on non-green ooring
and to a lesser extent on the green ooring samples, but the later
was also colonized by Exophilia spp., Candida spp., and Cryptococcus
spp. Penicillium species are generally not pathogens (Richardson
and Warnock, 2012), but Exophiala is a genus that includes black
yeasts, some of which are pathogenic species (Cheikh-Ali et al.,
2015). Candida is a genus whose members are a part of the
endogenous human ora but also contains some important human
pathogens (Ma et al., 2015; Suhr et al., 2016). The genus Crypto-
coccus (Filbasidiella) also includes species that can cause infections,
especially for immunocompromised people (Maziarz and Perfect,
2016).
Green gypsum board was dominated by the genus Phialophora
which contains more than 40 species, most of which are commonly
found in soil or on decaying wood but some can also be human
pathogens (Brandt and Warnock, 2003). Myrothecium, the genus
that dominated non-green gypsum board, is a widely distributed
genus often found growing on materials made of cellulose but is not
a human pathogen (Ahrazem et al., 2000). Although pathogenicity
was emphasized in this discussion, almost any fungus is a potential
source of allergens, but allergenic potential is highly dependent on
the fungal species.
Similar to a previous culture-based study (Hyv arinen et al.,
2002), we found Penicillium spp. and Aspergillus spp. in all build-
ing materials. However, we also detected several genera, such as
Myrothecium, Peniophora. and Cryptococcus, that have not been
reported in previous studies that used culture-based analysis of
building material samples.
There are several limitations to our study. The mold growth was
only tested on building materials derived from one vendor, and
other products may behave differently. Another limitation of our
study was that the materials were only tested under water-
saturated conditions. Hydrophilic genera may be overrepresented
compared to genera that are more xerophilic. In the future, we plan
to test a more comprehensive set of building materials under a
wider set of environmental conditions. However, in spite of these
limitations, the results presented demonstrate that, under the
conditions tested, an inoculum made of a mixture of dusts can
result in differences in the fungal colonization of green and non-
green building materials.
The ITS amplicon sequencing analysis itself has several recog-
nized limitations. For example, the use of the 97% cutoff is based

Please cite this article in press as: Coombs, K., et al., Fungal microbiomes associated with green and non-green building materials, International
Biodeterioration & Biodegradation (2017), http://dx.doi.org/10.1016/j.ibiod.2017.07.018
6 K. Coombs et al. / International Biodeterioration & Biodegradation xxx (2017) 1e7
upon methods established during the Human Microbiome Project
to interrogate 16S amplicon data. This cutoff has not been sys-
tematically reviewed or shown to be appropriate for fungal ITS
sequencing data. Tonge et al. (2014) found that some fungi cannot
be amplied by specic conserved primer pairs and suggested
that a multi-region approach be taken for other amplicon-based
metagenomic studies. This was not done in our study and may
be a limitation. Also, the sequencing-by-synthesis approach has
been reported to be more sensitive to sequence complexity (Tang
et al., 2015). Illumina sequencing has also been reported to have
biases associated with mold ITS sequencing. For example, primers
ITS2 and ITS3 designed to amplify ITS1 and ITS2 regions cause
biased amplication towards the Ascomycota and Glomeromycota
(Bellemain et al., 2010). Primers ITS1-F, ITS1 and ITS5 have been
shown to be biased towards the amplication of the Basidiomycota.
Primers specic to amplifying only ITS1 were chosen, which has
been suggested to cause the least amount of bias (Bellemain et al.,
2010; Bokulich and Mills, 2013). Nevertheless, the next generation
sequencing revealed different fungal populations on green and
non-green materials that has not been shown in prior studies.
5. Conclusions
The mycobiomes that developed on green compared to non-
green building materials were dominated by different fungal
genera.
Notice
The U.S. Environmental Protection Agency (EPA) through its
Ofce of Research and Development funded and collaborated in the
research described here. It has been subjected to the Agency's peer
review and has been approved as an EPA publication. Mention of
trade names or commercial products does not constitute
endorsement or recommendation by the EPA for use. The ndings
and the conclusions in this report are those of the authors and do
not necessarily represent the views of the NIOSH.
Acknowledgements
The authors are grateful for nancial support from the National
Institute for Occupational Safety and Health (NIOSH) Pilot Research
Training Program (PRP) of the University of Cincinnati Education
and Research Center grant (No.T42-OH008432).
References
Adamiak, J., Otlewska, A., Tafer, H., Lopandic, K., Gutarowska, B., Steringer, K.,
~ ar, G., 2017. First evaluation of the microbiome of built cultural heritage by
Pin
using the Ion Torrent next generation sequencing platform. Int. Biodeterior.
Biodegrad. (in press) http://dx.doi.org/10.1016/j.ibiod.2017.01.040.
Ahrazem, O., Gomez-Miranda, B., Prieto, A., Bernabe, M., Leal, J.A., 2000. Hetero-
geneity of the genus Myrothecium as revealed by cell wall polysaccharides.
Arch. Microbiol. 173, 296e302.
Anders, S., Huber, W., 2010. Differential expression analysis for sequence count data.
Genome Biol. 11, R106.
Bellemain, E., Carlsen, T., Brochmann, C., Coissac, E., Taberlet, P., Kauserud, H., 2010.
ITS as an environmental DNA barcode for fungi: an in silico approach reveals
potential PCR biases. BMC Microbiol. 10, 189.
Bokulich, N.A., Mills, D.A., 2013. Improved selection of internal transcribed spacer-
specic primers enables quantitative, ultra-high-throughput proling of fungal
communities. Appl. Environ. Microbiol. 79, 2519e2526.
Brandt, M.E., Warnock, D.W., 2003. Epidemiology, clinical manifestations, and
therapy of infections caused by dematiaceous fungi. J. Chemother. 15 (Suppl. 2),
36e47.
Cheikh-Ali, Z., Glynou, K., Ali, T., Ploch, S., Kaiser, M., Thines, M., Bode, H.B., Macia-
Vicente, J.G., 2015. Diversity of exophillic acid derivatives in strains of an
Please cite this article in press as: Coombs, K., et al., Fungal microbiomes associated with green and non-green building materials, International
Biodeterioration & Biodegradation (2017), http://dx.doi.org/10.1016/j.ibiod.2017.07.018
endophytic Exophiala sp. Phytochemistry 118, 83e93.
Cho, S.H., Reponen, T., Bernstein, D.I., Olds, R., Levin, L., Liu, X., Wilson, K.,
Lemasters, G., 2006. The effect of home characteristics on dust antigen con-
centrations and loads in homes. Sci. Total Environ. 371, 31e43.
Dannemiller, K.C., Mendell, M.J., Macher, J.M., Kumagai, K., Bradman, A., Holland, N.,
Harley, K., Eskenazi, B., Peccia, J., 2014. Next-generation DNA sequencing reveals
that low fungal diversity in house dust is associated with childhood asthma
development. Indoor Air 24, 236e247.
Edgar, R.C., 2013. UPARSE: highly accurate OTU sequences from microbial amplicon
reads. Nat. Methods 10, 996e998.
Ettenauer, J.D., Pinar, G., Lopandic, K., Spangl, B., Ellersdorfer, G., Voitl, C.,
Steringer, K., 2012. Microbes on building materialseevaluation of DNA
extraction protocols as common basis for molecular analysis. Sci. Total Environ.
439, 44e53.
Hawksworth, D.L., 2001. The magnitude of fungal diversity: the 1.5 million species
estimate revised. Mycol. Res. 105, 1422e1432.
Hoang, C.P., Kinney, K.A., Corsi, R.L., Szaniszlo, P.J., 2010. Resistance of green building
materials to fungal growth. Inter Biodeter Biodeg 64, 104e113.
Hoisington, A.J., Maestre, J.P., King, M.D., Siegel, J.A., Kinney, K.A., 2014. Impact of
sampler selection on the characterization of the indoor microbiome via high-
throughput sequencing. Build. Environ. 80, 274e282.
Huang, H.-L., Lin, C.-C., Hsu, K., 2015. Comparison of resistance improvement to
fungal growth on green and conventional building materials by nano-metal
impregnation. Build. Environ. 93, 119e127.
Hyvarinen, A., Meklin, T., Vepsa la
inen, A., Nevalainen, A., 2002. Fungi and actino-
bacteria in moisture-damaged building materialsdconcentrations and di-
versity. Int. Biodeterior. Biodegrad. 49, 27e37.
Johansson, P., Ekstrand-Tobin, A., Svensson, T., Bok, G., 2012. Laboratory study to
determine the critical moisture level for mould growth on building materials.
Int. Biodeterior. Biodegrad. 73, 23e32.
Korpi, A., Pasanen, A.L., Pasanen, P., 1998. Volatile compounds originating from
mixed microbial cultures on building materials under various humidity con-
ditions. Appl. Environ. Microbiol. 64, 2914e2919.
Kozich, J.J., Westcott, S.L., Baxter, N.T., Highlander, S.K., Schloss, P.D., 2013. Devel-
opment of a dual-index sequencing strategy and curation pipeline for analyzing
amplicon sequence data on the MiSeq Illumina sequencing platform. Appl.
Environ. Microbiol. 79, 5112e5120.
Laiz, L., Romanowska-Deskins, A., Saiz-Jimenez, C., 2011. Survival of a bacterial/
archael consortium on building materials as revealed by molecular methods.
Int. Biodeterior. Biodegrad. 65, 1100e1103.
Ma, X., Baron, J.L., Vikram, A., Stout, J.E., Bibby, K., 2015. Fungal diversity and
presence of potentially pathogenic fungi in a hospital hot water system treated
with on-site monochloramine. Water Res. 71, 197e206.
MacIntyre, D.A., Chandiramani, M., Lee, Y.S., Kindinger, L., Smith, A.,
Angelopoulos, N., Lehne, B., Arulkumaran, S., Brown, R., Teoh, T.G., 2015. The
vaginal microbiome during pregnancy and the postpartum period in a Euro-
pean population. Sci. Rep. 5, 8988.
Maziarz, E.K., Perfect, J.R., 2016. Cryptococcosis. Infect. Dis. Clin. N. Am. 30, 179e206.
McMurdie, P.J., Holmes, S., 2013. phyloseq: an R package for reproducible interactive
analysis and graphics of microbiome census data. PLoS One 8, e61217.
Mensah-Attipoe, J., Reponen, T., Salmela, A., Veijalainen, A.M., Pasanen, P., 2015.
Susceptibility of green and conventional building materials to microbial
growth. Indoor Air 25, 273e284.
Murtoniemi, T., Hirvonen, M.R., Nevalainen, A., Suutari, M., 2003. The relation be-
tween growth of four microbes on six different plasterboards and biological
activity of spores. Indoor Air 13, 65e73.
Nagy, L.G., Riley, R., Tritt, A., Adam, C., Daum, C., Floudas, D., Sun, H., Yadav, J.S.,
Pangilinan, J., Larsson, K.H., Matsuura, K., Barry, K., Labutti, K., Kuo, R., Ohm, R.A.,
Bhattacharya, S.S., Shirouzu, T., Yoshinaga, Y., Martin, F.M., Grigoriev, I.V.,
Hibbett, D.S., 2016. Comparative genomics of early-diverging mushroom-
forming fungi provides insights into the origins of lignocellulose decay capa-
bilities. Mol. Biol. Evol. 33, 959e970.
Oksanen, J., Blanchet, F.G., Kindt, R., Legendre, P., Minchin, P.R., O'Hara, R.,
Simpson, G.L., Solymos, P., Stevens, M.H.H., Wagner, H., 2013. Package vegan.
Community Ecology Package, Version 2.
Richardson, M.D., Warnock, D.W., 2012. Fungal Infection: Diagnosis and Manage-
ment. John Wiley & Sons.
Roberts, D., 2010. labdsv: Ordination and Multivariate Analysis for Ecology. 2010, R
Package Version 1.4-1.
Schoch, C.L., Seifert, K.A., Huhndorf, S., Robert, V., Spouge, J.L., Levesque, C.A.,
Chen, W., Fungal Barcoding Consortium; Fungal Barcoding Consortium Author
List, 2012. Nuclear ribosomal internal transcribed spacer (ITS) region as a uni-
versal DNA barcode marker for Fungi. Proc. Natl. Acad. Sci. U. S. A. 109,
6241e6246.
Seo, S.C., Reponen, T., Levin, L., Borchelt, T., Grinshpun, S.A., 2008. Aerosolization of
particulate (1>3)-beta-D-glucan from moldy materials. Appl. Environ. Micro-
biol. 74, 585e593.
Steinemann, A., Wargocki, P., Rismanchi, B., 2017. Ten questions concerning green
buildings and indoor air quality. Build. Environ. 112, 351e358.
Suhr, M.J., Banjara, N., Hallen-Adams, H.E., 2016. Sequence-based methods for
detecting and evaluating the human gut mycobiome. Lett. Appl. Microbiol. 62,
209e215.
 K. Coombs et al. / International Biodeterioration & Biodegradation xxx (2017) 1e7 7

Tang, J., Iliev, I.D., Brown, J., Underhill, D.M., Funari, V.A., 2015. Mycobiome: ap- (4), e93849. Apr 11.
proaches to analysis of intestinal fungi. J. Immunol. Methods 421, 112e121. US EPA, 2017. Green building. https://archive.epa.gov/greenbuilding/web/html/
Thatcher, A., Milner, K., 2016. Is a green building really better for building occu- (Accessed 29 March 2017).
pants? A longitudinal evaluation. Build. Environ. 108, 194e206. WHO, 2009. WHO guidelines for indoor air quality: dampness and mould. WHO
Tonge, D.P., Pashley, C.H., Gant, T.W., 2014. Amplicon-based metagenomic analysis Regional Ofce for Europe, Geneva.
of mixed fungal samples using proton release amplicon sequencing. PLoS One 9

Please cite this article in press as: Coombs, K., et al., Fungal microbiomes associated with green and non-green building materials, International
Biodeterioration & Biodegradation (2017), http://dx.doi.org/10.1016/j.ibiod.2017.07.018
 Renewable and Sustainable Energy Reviews 75 (2017) 13921403

Contents lists available at ScienceDirect

Renewable and Sustainable Energy Reviews

journal homepage: www.elsevier.com/locate/rser

Building energy for sustainable development in Malaysia: A review MARK

a,b, b a,c
Pervez Hameed Shaikh , Nursyarizal Bin Mohd. Nor , Anwer Ali Sahito ,
Perumal Nallagowndenb, Irraivan Elamvazuthib, M.S. Shaikhc
a
Department of Electrical Engineering, Mehran University of Engineering and Technology, Jamshoro, Pakistan
b
Universiti Teknologi Petronas, Department of Electrical and Electronics Engineering, Bandar Seri Iskandar, 31750 Tronoh, Perak, Malaysia
c
Department of Chemical Engineering, Mehran University of Engineering and Technology, Jamshoro, Pakistan

A R T I C L E I N F O A BS T RAC T

Keywords: Malaysia is located in Southeast Asia near the equator within the typical tropical climatic zone. The ecient use
Malaysia of energy is vital due to the dependency on fossil resources that are being exhausted, which ultimately cause CO2
Building emissions. Economic development and population growth are deemed to aect the growing energy demand in
Energy eciency the country. Therefore, sustainability, energy security, and climate change are crucial challenges for the power
Sustainability
sector in Malaysia. The aforementioned issues can be tackled with energy ecient measures in the building
Review
sector. Buildings in Malaysia consume 14.3% of the overall energy and 53% of only electrical energy is being
consumed in residential and commercial sectors. Therefore, energy eciency in buildings is crucial in order to
reduce the energy use and improve the local environmental sustainability. This paper discusses a review on the
building energy scenario, the policy perspectives, building energy eciency programs along with landmark
buildings and their characteristics. Besides, the potential of renewable energy resources in buildings and various
prospective issues and challenges faced by the country have also been discussed. The signicant review content
thus benets researchers, scientists and practitioners for a better understanding on energy eciency and the
sustainable measures that have been so far taken. The review also puts forward some actions to promote
building energy eciency and conservation.

1. Introduction energy resources, and consequently alleviates the growing energy

Energy is a lifeline and crucial element for the social, economic and
sustainable development of various countries. Due to rapid infrastruc-
ture development and economic growth, this continues to aect the
growing energy demand in Malaysia. This energy demand is inuenced
by population growth, per capita income, and demographic changes
(such as increasing urbanization and economic growth). The increase
in energy consumption recorded in 2012 was 7.5% and expected to rise
in the range of 68% in subsequent years [1]. However, challenges of
sustainability, energy security, rapid exhaustion of indigenous fossil
resources and climate change have made the country to take into
account the building energy eciency in its policy road map. Hence,
ecient usage of energy is signicant for preserving the available
demand. Moreover, in 2009, Malaysia ranked 52 on the climate change
performance index, an instrument that evaluates and compares 90% of
the global CO2 emissions of 57 countries [2]. One of the potential
sectors that appear to be tackling these aforementioned challenges is
the building sector. Since buildings and the built environment con-
tribute signicantly to the greenhouse gas (GHG) emissions.
Malaysia is located in Southeast Asia near the equator with
coordinates of 2 30 N and 112 30 E, and a total area of 329,750
sq. km. It is divided into two parts by the South China Sea; named as
Peninsular Malaysia bordering the south of Thailand, and East
Malaysia bordering northern Singapore and the Indonesian islands.
Its climate is generally hot and humid (tropical) throughout the year
with an average rainfall of 250 cm a year, and an average temperature

Abbreviations: ACEM, Association of Consulting Engineers Malaysia; ASHRAE, American Society of Heating, Refrigerating and Air Conditioning Engineers; BIPV, Building
Integrated Photovoltaic; EE, Energy Eciency; EQ, Environment Quality; FiT, Feed-in-Tari; GBC, Green Building Council; GBI, Green Building Index; GEF, Global Environment
Facility; GGC, Green Grading and Certication; GHG, Green House Gas; GWp, Giga Watt Peak; GoM, Government of Malaysia; IEM, Institution of Engineers Malaysia; IN, Innovation;
MBIPV, Malaysia Building Integrated Photo-Voltaic; MEWC, Ministry of Energy, Water and Communications; MEGTW, Ministry of Energy, Green Technology and Water; MoW,
Ministry of Works; MR, Materials and Resources; NGO, Non-Government Organization; PAM, Malaysian Institute of Architects; PTM, PusatTenaga Malaysia; PWD, Public Works
Department; RE, Renewable Energy; SSPM, Sustainable Site Planning and Management; UNDP, United Nations Development Program; WE, Water Eciency; WGBC, World Green
Building Council

Corresponding author at: Department of Electrical Engineering, Mehran University of Engineering and Technology, Jamshoro, Pakistan.
E-mail address: engr.pervezhameed@gmail.com (P.H. Shaikh).

http://dx.doi.org/10.1016/j.rser.2016.11.128
Received 27 May 2015; Received in revised form 26 August 2016; Accepted 4 November 2016
Available online 15 November 2016
1364-0321/ 2016 Elsevier Ltd. All rights reserved.
P.H. Shaikh et al. Renewable and Sustainable Energy Reviews 75 (2017) 13921403

Fig. 1. Sectorial nal energy consumption of Malaysia [1].

Fig. 3. Fuel mix of Malaysia electricity generation [1].
of 27 C [5]. These typical subtropical climatic conditions of Malaysia
closely aect the indoor environmental comfort conditions in build-
ings.
Malaysia's overall energy demand for the year 2014 is shared by
various sectors, such as Industry 25%, commercial & residential 14%,
transport 47%, agriculture 2% and non-energy 12.0%, as depicted in
Fig. 1. The electrical energy consumption in Industry is 45.9%,
commercial 32.3%, residential 21.2%, transport 0.2% and agriculture
0.4% [1] in the year 2014 as shown in Fig. 2. This represents nearly
14.3% of the overall energy. Of which 53% of electrical energy is being
consumed in residential and commercial sectors, which mainly com-
prise of buildings; this may include some non-buildings that are
relatively small contributors, such as water and sewage treatments,
street out-door lightings and losses. Moreover, industrial building-
related facilities have not been taken into account, which may surely
increase the percentage of energy consumed in buildings. Thus, it is a
leading contributor of greenhouse gas (GHG) emissions for the country
according to resources utilized to generate electrical energy. Since, only Fig. 4. Chronological building energy consumption in Malaysia [1].

80.9% of energy is being supplied through fossil resources, the rest is

being supplied through renewables at 3.2% and hydro 15.9%. as shown
in Fig. 3 [1]. The fuel mix has been comparatively diversied as
compared to the year 2012 that is 92.4% fossil fuel, renewables 0.2%
and hydro 7.4%. This scenario leads Malaysia towards sustainable and
environment friendly future of buildings. Since, it has almost reduced
its dependency on fossil fuel by 10%, besides almost doubled its
hydroelectric and solar resources and added the use of biomass and
biogas as renewable resources. The chronic electrical energy consump-
tion in Malaysia's residential and commercial sectors is shown in Fig. 4
[1], which shows a linear increase in consumption over the years. This
also depicts the growing energy demands in contrast to the industrial
sector which was surpassed in the year 2006, and has continued to
increase yearly till date. Further, it will increase in the future due to
climate changes and economic developments. Furthermore, building

Fig. 5. Building energy consumption in Kwh per Captia for various Countries.

Fig. 2. Sectorial electrical energy consumption of Malaysia [1].
energy consumption in kilo watt hour (kWh) per capita for normalized
population has been depicted in Fig. 5. The total electricity consump-
tion in kWh per population has been obtained from the key energy
statistics 2015 report from the international energy agency [3].
Whereas the percentage building energy consumption was reported
elsewhere [4], therefore, the kWh per capita energy consumption in
building has been computed. The developed countries such as Canada,
Qatar, Singapore, and USA have been consuming highest per capita
electricity consumption in buildings. Whereas, the developing indus-
trialized countries are taking the lead in medium per capita consump-
tion. In addition, Malaysia's per capita electricity consumption falls in
the industrialized state having 2434 kWh/capita consumption in

1393
P.H. Shaikh et al.
buildings. The underdeveloped and developing countries have lowest
per capita consumption in buildings as demonstrated in Fig. 5.
Besides outdoor environment conditions, the behavior of energy in
buildings is signicantly inuenced by various factors, such as con-
struction material and location, appliances used inside the building, its
specic use and type, occupancy pattern, user's behavior. Moreover,
90% of people spend most of their time inside buildings, thus they are
the central and most dynamic part of indoor building envelope. Due to
the rising quality of life, the building's energy consumption has
increased dramatically over a few decades. Therefore, the landscape
of energy in a building and its indoor environment seem to be the
major challenge for the research community, government and society
in the country.
This paper aims to review the current scenario on building energy
in Malaysia, and discusses the policies, programs, and landmark
building and their characteristics. The paper has been organized
systematically in order to conduct the literature review on building
energy in Malaysia. This analyzes and identies various aspects that are
useful for the research community at large, practitioners, and stake-
holders to get in-depth and systematic knowledge on the case of
Malaysia's building energy. The information on building energy is quite
scattered in the literature; hence it is challenging for practitioners and
policy makers to identify the key factors for the purpose of advance-
ments in building energy projects in the world, specically in Malaysia.
Therefore, an attempt has been made to review, analyze and assess the
building energy scenario, and identify the key factors to mobilize this
sector in the world, and Malaysia for sustainable future of buildings
energy demands.
1.1. Motivation of review
So far various reviews have been conducted; these include energy
eciency in buildings, considering air conditioning, and articial
lighting for sustenance of occupants comfort [6]. Chua et al. presented
the green initiatives along with their progress and development;
mainly, the national green technology policy (NGTP) and green
building index (GBI) [7]. ShingChyi et al. studied Malaysia's energy
development considering renewable energy and energy eciency
aspects [8]. Hashim and Shin have studied the progress and develop-
ment of renewable energies over the past decade [9]. Hawl et al.
reported ve major initiatives, which included renewable energy,
energy eciency in commercial buildings, Kyoto protocol, Malaysian
Building Integrated Photovoltaic (MBIPV) program and Biomass [10].
Ong et al. studied the current energy scenario and exploration of
alternative energies considering biomass, solar, wind and mini-hydro
for ensuring energy security and reliability [11]. Ahmad et al. reported
the main sources of alternative energies and their potential with their
solutions for selecting Malaysia's future energy [12]. Oh et al. examined
and reported the energy policy issues, challenges and their intricacy
[13]. Chua et al. presented the outlook of feed-in-tari (FiT) from the
perspective of the renewable energy (RE) policy [14]. Oh et al. reviewed
eorts of various energy eciency programs and carbon trading
potential by the Government of Malaysia (GoM) [15]. Manan et al.
presented a framework for putting into practice a Malaysian energy
eciency award considering the current energy situation and issues
relevant to the implementation of energy eciency [16]. Besides, Foo
[17] has addressed the energy security and green developments
oering various opportunities, dynamic pressure, and coping strategies
in Malaysia. In addition, the renewable and non-renewable scenario
and research breakthroughs along with joint co-operations for the
promotion of green energy management have been outlined. The
details of previous reviews have overlapped with elements of energy
eciency in buildings; however, a clear gap is identied for the energy
situation in Malaysian buildings. In this paper, the building energy
scenario, the policy perspectives, building energy eciency programs
along with landmark buildings and their characteristics have been
1394
Renewable and Sustainable Energy Reviews 75 (2017) 13921403
discussed. Besides, the potential of renewable energy resources in
buildings of Malaysia and various prospective issues and challenges
have been reviewed and critically discussed.
The contents of this paper are organized as follows; Section 2
reviews the various energy policy perspectives considering energy
supplies, energy eciency and management, and renewable energy
policy matters in Malaysia. Section 3 discusses the showcase buildings
in the country for promoting energy eciency measures, waste and
water management, and renewable energy resource integration.
Section 4 discusses the potential of renewable energy and its integra-
tion in buildings. Section 5 presents the issues and challenges
concerning buildings and nally the conclusion has been presented in
Section 6.
2. Energy policy perspectives
Policy trends have evolved since the discovery of fossil petroleum,
promoting the awareness of the signicance of energy eciency (EE) in
Malaysia's Energy Development (MED) goals. The MED framework is
primarily tied to the National Energy Policy (NEP) - 1979, National
Depletion Policy (NDP) - 1980, Fuel Diversication Policy (FDP) -
1981, Four Fuel Diversication Policy, and Renewable Energy and the
Fifth Fuel Policy - 2000. Moreover, with the rising oil prices and
degradation of environmental concern in 2001, the Government of
Malaysia (GoM) introduced renewable energy into the energy mix with
a signicant concern on energy eciency and sustainability. The
primitive history of several energy acts and policies in national energy
development are comprehensively discussed in the chronological order,
as follows [8] and as depicted in Fig. 6:
National Petroleum Policy (NPP), 1975, represents the optimal
utilization of petroleum resources, its regulations, operational manage-
ment, and economic, social and environmental safety concerns for the
petroleum industry.
National Energy Policy (NEP), 1979, formulated an energy strategy
and objectives for the long-term ensuring secure, ecient and envir-
onmental sustainability. Its supply objective oers the provision of
secure, adequate and cost-eective energy resources considering both
conventional and non-conventional resources. The objective of energy
utilization is to be ecient and overcome waste and a non-productive
consumption prole.
National Depletion Policy (NDP), 1980, limits the over exploitation
of oil and gas reserves. This also oers a fuel diversity plan for the
reduction of oil dependency and emphasis on hydro and coal in an
energy mix.
Electricity Supply Act (ESA), 1990, provides the regulation and
licensing of the generation, transmission and distribution of electrical
supplies.
Gas Supply Act (GSA), 1993, provides the regulation and licensing
of gas for its consumers, installations, appliances and safety.
Fifth Fuel Policy (FFP), 2000, promotes the potential of renewable
energy resources in an energy supply mix.
Energy Commission Act (ECA), 2001, provides technical, safety and
performance regulations for electrical energy and gas supplies. It also
deals with energy eciency and renewable energy challenges.
National Biofuel Policy (NBP), 2006, aimed at fuel diversication
policy at reducing dependency on fossil fuels and promoting palm oil
demand.
National Green Technology Policy (NGTP), 2009, promotes sus-
tainable development, low carbon technology and conserving resources
and environment (development and application of products, equip-
ment and systems). This would help alleviate the anthropogenic eects
of human activities. The NGTP's satisfactory criteria are reducing
environmental degradation, and are providing low/zero greenhouse
gas (GHG) emissions, safe usage and promotion of an improved
healthy environment for quality of life. Conservation of natural
resources and the utilization of energy and encouragement of renew-
P.H. Shaikh et al. Renewable and Sustainable Energy Reviews 75 (2017) 13921403

incentives strategy have been intensied and elaborated for the

attainment of MED targets. Furthermore, the tenth MP (20112015)
conferred green technology, its products, appliances and systems along
with their applications and adoption through public awareness, com-
mitment and advocacy programs. It strengthens the expansions of
research, innovation, development and its commercialization through
the appropriate mechanism. In the 21st century, Malaysia is supposed
to face various dynamic challenges as it moves through the uncharted
pathway of globalization. Thus, keeping in view, the rising energy
trends and the national economic developments are considered to be
aligned in the Malaysian Plan (MP).
The Government of Malaysia (GoM) over the past three decades has
developed its key policy and strategies in order to attain the nation's
planned objectives. These have been primarily designed to alleviate the
challenges of energy security, eciency and environmental impacts to
meet the growing energy demand of the country. Thus, making possible
to attain sustainability, reliability and security of energy supplies for
the continuous progression in economy and society. It is currently
focusing on alternative energy objectives to lessen the energy depen-
dency on fossil resources that ultimately leads to mitigate the environ-
mental challenge. Currently, the various renewable energy projects
have been embarked to materialize, and penetration mechanisms have
been incorporated with concerted eorts by the Government of
Malaysia (GoM) policy initiatives and various stakeholders interest.
This has oered the boost in utilizing renewable energy technologies
and biomass including palm oil, rice husk, wood and biomass co-
generation projects. This has been encouraged especially through the
private sector for small power generation projects that includes mini-
hydro, solar, wind, biogas and biomass etc.

3. Building energy eciency programs and developments

3.1. Landmark building models

The Government of Malaysia (GoM) is leading in the energy

eciency measures through setting up of the stateofart energy
Fig. 6. Development ow chart for Malaysia energy eciency legal frameworks.
ecient and green buildings. In relation to that, it has displayed
energy ecient buildings of which the Low Energy Oce (LEO) is the
ables in the country's energy diversity are additional benets. Others
rst energy ecient building that was built in the country, housing the
are the utilization of energy and its application of green technology,
Ministry of Energy, Green technology and Water. The Green Energy
and demand side management (DSM) programs along with the
Oce (GEO) is another energy ecient building built by the
adoption and application of green technology in the construction,
Government, the rst green building in Malaysia and was followed by
maintenance, demolition and management in buildings.
the development of the Diamond Building. These buildings serve as
The economic planning unit (EPU) of Malaysia is continuously
landmark projects to encourage more energy ecient and green
striving for its economic and social development. In view of the rapidly
buildings to be built in the future especially in the private sector.
growing trends over a decade, national economic development has
been aligned and envisioned in the Malaysian Plan (MP) and policies.
3.1.1. Low energy oce (LEO)
The energy development has been the key emphasis of the country.
This building aimed at promoting the energy eciency and devel-
During the seventh MP (19962000), sustainable development of
oping capacity of Malaysian building industry, is momentous for being
depleting fossil energy resources and its diversication were ensured
a national demonstration project. The Government of Malaysia (GoM)
for an adequate generation capacity. In addition, the infrastructure for
needs their Ministry of Energy, Water and Communication (MEWC) to
transmission and distribution were highlighted. Alternative energy
display their building for energy eciency and conserve the overall
sources and ecient utilization of energy were also a part of the plan.
environmental impact. The building design was supported under the
Moreover, focus was given on the existing strategy of the 7th MP
Danish International Development Assistance (DINIDA) program that
during the eighth MP (20012005) for sustainable energy resources;
was requested and granted.
majorly, with ve fuels for the energy mix including oil, gas, coal, hydro
The 10% extra cost target for the energy eciency measures inside
and renewables. The security, quality and adequacy of energy supply
the building have been conrmed with its design and building tender.
eorts were strengthened. In relation to that, emphasis was rst given
Besides that, the simulation modeling with the Energy-10 tool has
in this plan on energy eciency (EE) for encouraging ecient usage of
predicted more than 50% energy savings, followed by subsequent
electrical energy, gas supply and renewable energies. Additionally, this
energy monitoring. Thus, adding to the vital credibility for signicant
plan also promoted incentives for EE, renewable energy and supply
energy savings and environmental benets that can be predicted and
quality. The ninth MP (20062010) reinforced the EE initiatives in the
achieved within the building sector of Malaysia. The building design
8th MP; it also broadened its EE vision to various sectors includes
was supposed to have an energy consumption of less than 135 kWh/
transport sector, along with commercial, industrial and governmental
m2/year but the prediction has been shown to have an energy index
buildings. Besides that, it also intended to decrease fossil fuel depen-
that is approximately 100 kWh/m2/year.
dency and exploit alternate resources. Renewable energy and EE
The energy eciency measures that contribute to the aforemen-

1395
P.H. Shaikh et al.
tioned energy index include green environment creation around and on
top of the building. Orientation optimization was with preference to the
north and south window facing and the minimum solar radiation,
space planning, insulated building roof and facades, natural ventila-
tion, and ecient cooling system. Optimized day lighting along with
automated and ecient articial lightings is controlled based on
daylight and occupancy. Moreover, the energy ecient oce equip-
ment is followed by an energy management system to meet the
occupants comfort index with minimum energy costs. In addition to
that, the LEO building also exhibits the use of renewable energy as a 3-
kWp grid connected photovoltaic system is installed on the roof top
[18].
3.1.2. Green tech Malaysia building
Malaysia Energy Center (MEC) locally known as Pusat Tenaga
Malaysia (PTM), formerly called the zero energy oce (ZEO) building
was developed in 2005 and was planned to be displayed as the most
energy ecient oce building in Malaysia. However, it is ocially
Malaysia's rst GBI certied and green rated oce building; now,
commonly known as the green energy oce (GEO) building. The GEO
building was rst project of its kind in South East Asia. It was planned
to display a sustainable energy ecient oce building in Malaysia and
in ASEAN countries and that the commercial building can be inde-
pendent of the grid supply. The construction of the building utilized
advanced green technologies with the combination of energy eciency
(EE), renewable energy and rainwater harvesting system. The GEO
building does not consume electricity more than the generated
electricity from its renewable energy sources on site. This is the only
building in Malaysia that has integrated EE and renewable energy both
in one working demonstrator building. The building has photovoltaic
(BIPV) panels integrated into the design, provides electricity around
120, 000 kWh/year that fullls 50% of its energy needs. It possesses
four dierent types of solar cells (including mono-crystalline, poly-
crystalline, semi-transparent and amorphous) which are integrated
aesthetically and architecturally into the building design. The built
design faces both north and south utilizing 100% of the natural day
light. Moreover, it optimizes sunlight through strategically positioned
workspaces, reective ceilings and mirrored lighted shelves along with
sky lighting and tunneling. Energy ecient or sensor controlled
articial lamps have been installed in the building where required.
Radiantly cooled oor-slabs are embedded in the oors, which are
more ecient than pumping air around the building. Besides that, it
also features a rainwater-harvesting system used for topping-up the
condenser cooling system, irrigation and general cooling purposes [19].
The design of the GEO building is considered sustainable and
energy ecient thus utilizing little fossil fuel with an energy index of 65
kWh/m2 year in contrast to conventional oce buildings of 250 300
kWh/m2 year. The building normally focuses on green technology
innovation in order to minimize energy demand, ecient usage of
fossil fuel considering climate concerns, and renewable energy utiliza-
tion; thus, not compromising user environmental comfort and safety.
3.1.3. Diamond building
The Diamond Building was constructed in 2010 and has been
certied by GBI to showcase its sustainable design. The design features
include reduction in fossil fuels, energy eciency, water conservation,
sustainable building materials, waste reduction, indoor environment
quality, management of trac and transport, and thorough construc-
tion and demolition plans. Its diamond shape view aects the climatic
design of the building with four self-shading slanting sides, an inverted
pyramid and sharp pointed corners demonstrating its name. Moreover,
the intended design of the faade cladding appears like a diamond ring.
It is the rst building to obtain the highest Platinum rating of both
green building certications, namely, the Green Building Index (GBI)
and Singapore's Green Mark. The building has also won several awards,
such as the ASEAN Energy Awards (AEA), 2012, and the ASHRAE
1396
Renewable and Sustainable Energy Reviews 75 (2017) 13921403
technology award, 2013, in 2nd place. This building was designed for
the fulllment of the lowest energy consumption building in South East
Asia. Thus, maintaining the criterion, which is a building energy index
of 135 kWh/m2/year or lower; this is according to code of practice on
EE and renewable energy use for non-residential buildings of the
Malaysian Standard (MS) 1525: 2001. The building has a targeted
Building Energy Index (BEI) of 85 kWh/m2/year, excluding PV solar
energy, compared to typical new oce buildings in Malaysia and the
Southeast Asian region, which have energy indices within the range of
200300 kWh/m2/year. The building design captures natural daylight
abundantly from both the faade and atrium. Moreover, the highest
oor has a light trough, automated blinds, varying window size and
reective aluminum panels along with reected roof light, which are
used to optimize the daylight into the deepest oor space area. Light
sensors are also incorporated inside the building to encourage the
optimal usage of daylight. Moreover, the occupants are encouraged to
utilize LED task lights and ecient T5 lighting tubes. The energy
ecient strategies of day lighting, radiant oor cooling and ecient
articial lightings possess the capability to reduce CO2 emissions up to
1,673 metric tons per annum. Besides that, thin lm solar panels
(suitable for tropical climate zones) have been integrated on the roof
with the capacity of 71.4 kWp. Thus, reducing the building energy
consumption by 10%. The eciency of these cells is 1400 kWh/kWp,
which is signicant in contrast to conventional solar PV that is
1150 kWh/kWp [20].
The building employs recycled materials that represent 31% of the
material cost employed in the content in dry walls, ceiling boards,
carpet and oor nishes. It also constitutes water ecient ttings that
save around 67% of the portable water compared with the conventional
water ttings. Furthermore, 35% of the portable water consumption is
saved from harvesting the rainwater for toilet, irrigation, and grey
water usage. In addition, 10% of the parking spaces are designated to
serve car pool and fuel-ecient vehicles, secure bicycle racks and
public transportation services. Thus, various energy saving features
have been incorporated into the building design at an extra cost of 6%
of the base building cost; this has resulted in a simple payback period of
12.3 years. During building operations, the energy monitoring systems
add credibility to the substantial energy savings and achieve indoor
environmental benets.
3.2. Malaysia green building confederation (MGBC)
The like-minded group of companies was coined the green building
council (GBC) for Malaysia in their very rst meeting on May 05, 2007
[21]. This non-prot and non-governmental organization (NGO) was a
rigorous eort to guide and spur the building industry towards
sustainable built solutions. Furthermore, in compliance to the
Malaysian Registrar of Societies requirement, the name was conse-
quently altered to the Malaysian Green Building Confederation
(MGBC) and is the only building organization in Malaysia that is
supported by the world green building council (WGBC). Its vision is to
make buildings and communities green, and within the reach of all
Malaysians. This promotes green buildings for sustainable built
environments for one and all. Thus, it has reformed the way of its
planning, designing, construction, maintenance and operation in the
building sector. It also promotes green building programs, technolo-
gies, design practices and processes. Green labels for liable and
sustainable measures, besides considering other requirements of social,
economic and environmental benets. Its core objectives are to involve
professionals, policymakers and society that embrace green practices in
the building industry, which respects the Malaysian environmental
eects on their indoor climate comfort.
The MGBC technical committee on rating tools commenced and
established the inventive framework, initial benchmarks and classica-
tions of the Green Building Index (GBI). In forming that, the Malaysian
Institute of Architects (PAM), and The Association of Consulting
P.H. Shaikh et al.
Engineers Malaysia (ACEM) funded and provided resources in the
development of a green building rating tool catered to the specic
needs of the Malaysian landscape. Generally, taking advantage of the
perception of involving participants from these two organizations has
turned out to be the best t providing the acquaintance and expertise of
the local building industry. Provisionally, MGBC plays an active role in
GBI with the support, promotion and channeling of the industry input
for the improvement of locally grown green building rating tools.
Moreover, MGBC works in partnership with other professional orga-
nizations, such as the Institution of Engineers Malaysia (IEM) as well
as the American Society of Heating, Refrigerating and Air Conditioning
Engineers (ASHRAE) Malaysia. In addition, various links with public
and private sector universities have been established with a diverse
representation of stakeholders including governmental organizations,
professional institutions, academicians, contractors, manufacturers
and others related to the building and construction industry. MGBC
is Malaysia's leading green building NGO that encourages the launch of
building industry products and services with an eco-label framework
and green pages in Malaysia, striving for a cleaner environment.
3.3. Green building index (GBI)
GBI was launched in April 2009, with the help of the Malaysian
Institute of Architects (MIA) and the Association of Consulting
Engineers Malaysia (ACEM) supported by MGBC along with the
building industry [22]. Green Grading and Certication (GGC) of
buildings in Malaysia through the GBI rating tool provides an
opportunity to the building developers, stakeholders and owners for
the design and construction of sustainable green buildings. These
buildings must be able to provide energy and water savings, healthier
indoor environment, public transport connectivity, adoption of recy-
cling, and the reduction of the inhabitant's carbon footprints.
Malaysia's GBI rating tool is like LEED in the USA, Green Star in
Australia, and Green Mark in Singapore and BREEAM in the UK as
shown in Table 1. Along with their comparative benchmark analysis of
the surveys, the assessments from these tools are also shown in Table 1.
Furthermore, considering holistic approach these rating tools with-
in their respective countries proposes the specic targeted character-
istic within their building industry. In that, BREEAM is primarily
focusing on environmental assessments and technological research in
building sector. Besides, LEED oers the certication for buildings to
perform environment friendly in both indoor and outdoor climate of
building envelope. The design and construction of buildings to attain
sustainability is oered by both green star (GS) and the green mark
(GM), however primitively NABERS focuses on the operation perfor-
mance targets that measures and rate the building energy utilization.
Built Green Canada is a voluntary program for supporting the green
practices in building sector for attaining green future. China's 3-star
rating tool encourages the stakeholders for green developments of
envelopes and attains sustainability. The development and promotion
of energy, environment and ecological sustainable techniques and
policies are been oered by CASBEE. HKBEAM oers eco-eciency
and sustainability for building practices to utilize less energy resources.
KGBC focuses on the facilitation for transforming best practices in
building sustainability. Relatively, GBI looks for the design and
operation of the buildings for overall impact analysis of the built
environment. It proposes Energy eciency, sustainable site and
management, indoor environmental quality, water eciency, materials
and resources and innovation. These aforementioned factors make
Malaysia on the cutting edge for the transformation of building sector.
Ultimately, these designs and developments lead the researchers and
practitioner not only to implement in their countries but also may
advance those ideas for further enhancements may be obtained in the
buildings.
These countries have embarked for sustainable development trends
in green buildings. Thus, transforming their building envelopes on
1397
Renewable and Sustainable Energy Reviews 75 (2017) 13921403
either regulated entirely, voluntary adoption of building codes and
guidelines and standards or a mix of all. Moreover, the Malaysia has
embarked for green building practices for cutting edge benets of
energy savings and reduction in greenhouse gas target attainments.
The widespread adoption of green building practices could realize the
outcomes of security of energy supplies, enhanced competitiveness
among stakeholders and success towards green developments.
The Malaysian Government (GoM), through the support of the
MGBC by its Ministry of Energy, Green Technology and Water
(MEGTW) along with the Public Works Department (PWD) under
the Ministry of Works (MoW) is compassionate of an objective,
unbiased and impartial Green Building Assessment and Certication
Scheme, professed and pursued by the MGBC through its continued
support of the GBI. However, more than 550 buildings have signed up
to be certied under the GBI and only 214 have achieved their GBI
certications as of March 31, 2013 [21].
The GBI has been specically developed considering Malaysia's
tropical environmental and developmental context with social and
cultural needs. It has been formed to establish a common language and
measurement standards that dene green buildings. It aims to provide
a better environment for all by promoting integrated whole building
designs. It also oers environmental leadership by recognition and
reward, to reduce negative environmental impacts by transforming the
built environment. It ensures future relevancy of new buildings,
refurbishes, and upgrades existing buildings for the overall quality
improvement of building stock throughout the country. GBI provides
certication after assessing points, various benchmarks for three years
after which the building will be reassessed for its ecient and
sustainable operation. These buildings are awarded with four types of
ratings including Certied, Silver, Gold and Platinum depending on the
scores achieved through the energy eciency measures. The GBI rating
tool has various benchmarks that include enhanced energy eciency
(EE) through orientation, natural light harvesting, indoor solar heat
gain, ensuring regular and proper maintenance, testing and commis-
sioning along with adopting the best practices in building services and
promoting the use of renewable technology. Furthermore, attaining
good indoor environment quality (EQ), such as indoor air quality,
acoustics, visual and thermal comfort, involving low volatile organic
materials, quality air ltration, appropriate control of air temperature,
movement and humidity levels. In addition, sustainable site planning
and management (SSPM) with easy access to public transportation,
landscaping, community services and open spaces, thus, avoiding and
conserving environmentally sensitive locations, feasible construction
for storm water management and reduction of the strain of existing
infrastructure capacity are also considered. Promotion of sustainable
and environment friendly use of materials and resources (MR),
implementation of suitable waste collection and a recycle management
framework are yet other considerations. The harvest and reuse of
rainwater and water saving ttings to attain water eciency (WE) are
also considered. Consequently, the innovative (IN) design initiatives
are the criteria that can deal with the challenging objectives of GBI
[34].
In critical evaluation, the green tool indexing for building due to
their roles and nature are highly dependent on location and environ-
ment. A survey of various rating tools have been studied shows
moderate climatic zones. Of-which Malaysia's GBI and Singapore's
GREENMARK have been designed for the tropical climate zone so far
within the region. Though the operational factors of GREENMARK are
for tropical climate but the score preferences have been have been
customized for the country. This only includes energy and water
eciency preferences, while transport has already been up to mark,
thus less priority have been given. However, GBI diers markedly
depending on local climatic variations, development progressions and
existing resources.
The GBI existence within the country pose a positive sign provides
opportunities for the developers, designers, practitioners and stake-
P.H. Shaikh et al. Renewable and Sustainable Energy Reviews 75 (2017) 13921403

Table 1
GBI rating tool for building with their benchmark in various Countries.

Sr. # Ref. Year Country Rating tool Abbreviation Benchmark Observations

1 [23] 1990 UK Building Research BREEAM Energy, t ransport, land use, ecology, The tool presents the world's foremost
Establishment pollution, water, health and wellbeing, environmental assessment method and rating
Environmental Assessment materials, waste and management system for buildings. It sets standards for
Method sustainable building design construction and
operation, use and measures building
environmental performance. It focuses on low
carbon and impact designs, minimizing energy
demands within the building.
2 [24] 1998 USA Leadership in Energy and LEED Energy and atmosphere, transport, water LEED certification provides independent, third
Environment Design efficiency, sustainable site, indoor party verification that the building project is an
environmental quality, materials and environmentally responsible. It provides green
resources, innovation in design and building certification that recognizes best-in-
construction class building strategies and practices, design,
operation and construction of high performance
green buildings. Thus ensures buildings are
environmentally compatible, provide a healthy
work environment and are profitable
3 [25] 2003 Australia Green Star GS Energy, materials, ecology, land use, It is the trusted mark of quality for the design
indoor environmental quality, emissions, and construction of sustainable buildings, fit-
management and innovation outs and communities. It has also grown into a
comprehensive rating system for various types
of projects, from apartment buildings to
schools, university buildings, hospitals, offices,
shopping malls and industrial facilities. The
Performance measures of your building's,
identification of opportunities for improvement
and realize the many benefits of sustainable
building operations
4 [26] 2005 Singapore Green Mark GM Energy efficiency, environmental Green Mark is an initiative to drive the
protection, water efficiency, indoor construction industry towards more
environmental quality, innovation and environment-friendly buildings. It is intended
green features to promote sustainability in the built
environment and raise environmental
awareness among developers, designers and
builders when they start project conception and
design, as well as during construction.
5 [27] 2009 Malaysia Green Building Index GBI Energy efficiency, sustainable site and This tool focuses on enhancing the efficiency of
management, indoor environmental resource use that include; energy, water, and
quality, water efficiency, materials and materials. Besides, decreasing the impact of
resources and innovation. buildings on human health and the
environment during its lifecycle, with the better
placement, design, construction, operation,
maintenance, and removal. The motto of the
Green Buildings Indexis to design and operate
buildings that can reduce the overall impact of
the built environment on its surroundings.
6 [28] 2003 Canada Built Green Canada BuiltGreenCan Energy conservation, efficiency, indoor This is an industry oriented voluntary program,
environment quality, emissions, water which promotes green building practices in
recycle, waste management, design and order to reduce the environmental impact of
construction innovation. buildings. Thus, benefits the homebuilder, the
community, and the environment, and offer
everyone an prospect to choose a green
future.
7 [29] 2006 China Three Star System 3-Star Land savings and outdoor environment, China's nascent green building market is the
Energy savings, Water savings, Materials introduction of the rating system in the country.
savings, Indoor environmental quality, The purpose is to create a voluntary rating
Operations and management system that will encourage green developments
and ensure energy sustainability.
8 [30] 2004 Japan Comprehensive CASBEE Energy use and GHG emissions, water use, This deal with the buildings, that consume and
Assessment System for materials and their safety, biodiversity, discard resources and energy in enormous
Built Environment land use and indoor environment. quantities, to act instantly for the development
Efficiency and promotion of techniques and policies that
are capable to assist the drive towards energy,
environment sustainability and ecological
quality of the buildings.
9 [31] 1996 Hong Kong Hong Kong Building HKBEAM Lessen energy, reduce water, material Green buildings use less energy and reduce
Environmental Assessment usage, comfort, life cycle analysis water and material usages than conventional
Method buildings, which in turn limit greenhouse gas
emissions, thus, turned toeco-efficiency and
sustainability. Thus, provide healthier, high
quality, durable and efficient working and living
environments for building occupants.
10 [32] 2000 Korea Korea Green Building KGBC Energy conservation, efficiency, water and This tool primarily focuses on environmental
Council waste management best practices to facilitate the transformation of
(continued on next page)

1398
P.H. Shaikh et al.
Table 1 (continued)
Sr. # Ref. Year Country Rating tool Abbreviation
11 [33] 1998 Australia The National Australian NABERS
Built Environment Rating
System
holders to build sustainable buildings. This can oer energy and water
savings, indoor environment comfort, accessible public transport and
recycling and green landscaping their societies and projects. Besides,
for heat islanding eect the green rating promotes open spacing and
landscaping. It also encourages the harvesting rain water. In spite of
various handful practices in Malaysia, the reality is so far fairly
convincing. Since, the practice has been obliged by the limited number
of buildings. This could be due to unawareness, limited budgets,
government in-eective policies, market penetration challenges, real-
estate worth of building, community services obligations. Therefore, it
is suggested that GBI tool should be entirely accessible to attain the
national ve year development targets set by the government and oer
various awareness programs for convincing results from the built
sector.
4. Renewable energy potential in buildings
Renewable energy in buildings has been designed to enhance the
energy security and interdependence on utility supplies whilst reducing
long-term energy costs and environmental impact. Malaysia's energy
eciency strategy constitutes environment friendly solutions that will
not only help reduce building energy costs but also provide the tools to
reduce carbon footprints. Moreover, embracing the best energy e-
cient measures in buildings available so far is not enough; the energy
would still be required to power day-by-day building operations. This
can be achieved with building integrated renewable energy resources to
power the building for its operation for making the building zero or low
energy dependent.
Renewable energy includes energy that has been derived from
natural processes that do not involve the consumption of exhaustible
resources; meaning that the energy can be reproduced in a short
period. So far, various renewable resources are available, such as
biomass, solar, hydropower, biofuel, wind, geothermal etc. However,
the major renewable energy technologies that are commonly adopted
and are feasible to be easily integrated into buildings include solar
photovoltaic (PV), solar water heaters (SWH), wind turbines and their
hybrids. Moreover, biomass can be utilized for some specic remote
area buildings subject to the availability of organic materials like plant
and animal waste.
PV is one of the most promising renewable energy technologies in
achieving sustainable development. In Malaysia's urban and suburban
areas, photovoltaic systems are mounted and installed on rooftops or
facades of the residential as well as non-residential buildings (oces,
malls, hotels, schools etc.). These systems are termed as building-
integrated photovoltaic (BIPV) and help to increase the power gener-
ated per unit oor area of the building. Transforming solar energy as a
viable alternative supplement for the electricity grid and buildings in
Malaysia. The project of MBIPV was ocially launched on July 25th,
2005, by the Ministry of Energy, Water and Communications (MEWC).
The Government of Malaysia (GoM) initiated this project with the co-
nancer Global Environment Facility (GEF) and was distributed
through the United Nations Development Program (UNDP). During
the span of the 9th Malaysian Plan (MP) from 2006 to 2010, the
MBIPV project was the last for the promotion and development of
renewable energy in the country's planning documents.
The objective was to induce Building Integrated Photovoltaic
(BIPV) technology for the long-term cost reduction and decrease of
Renewable and Sustainable Energy Reviews 75 (2017) 13921403
Benchmark Observations
the global sustainable building industry.
Energy use, greenhouse gas emissions, Set operational performance targets and
Water, Waste, comfort, local bio-diversity, measure that can rate the actual performance
and water flows, toxic materials transport. within the building envelopes.
the greenhouse gas (GHG) emissions via its integration within the
building design. This was along with the development of the sustain-
able market for BIPV that would generate widespread application.
Moreover, this project was supposed to establish market development
and set targets for the follow-up in the 10th Malaysian Plan (MP). The
BIPV technology and enhancement of the national capacities on three
major areas included (i) education and policy, (ii) technical skill and
market implementation, and (iii) technology development support. It is
expected over the lifetime of the BIPV project, that it will avoid 65.1 kt
of CO2 emissions from primarily the power sector, contributing
towards the objectives of the national energy policy [34]. The main
components of the MBIPV project were to ensure (a) Services,
awareness and a capacity-building program, (b) Market enhancement
and infrastructure development, (c) Policies and a nancing mechan-
ism, and (d) Industry development and technology localization.
Moreover, the target was to increase the BIPV capacity to 330% and
have a reduction of the BIPV unit cost by 20%, both against the
baseline [36]. Besides that, the BIPV plan was to grow its capacity by
30% annually with an average cost reduction of 30% from the year
20102020. MBIPV technology is signicantly contributing to the
potential renewable energy in urban regions where the bulk of
Malaysia's energy is consumed. This project has oered synergy to
various demand side management and energy eciency programs;
thus, recognizing the long-term potential of solar energy specically in
buildings. Technically, BIPV is able to generate 11GWp of electricity
depending on the available roof spaces of residential and commercial
buildings in Malaysia. This potential capability would produce 12,000
GWh of peak electricity, which could curtail 20% of the current
electricity demand of Malaysia [35].
SURIA 1000 is another of Malaysia's national BIPV programs
targeting the residential and commercial sectors, which will develop a
new market. The Government of Malaysia (GoM) with the support of
the United Nations Development Program (UNDP), global environ-
mental facility (GEF), Suruhanjaya Tenaga and the private sector,
funds the project. The project will provide direct opportunities to the
public and industry to be involved in renewable energy and environ-
mental protection initiatives. It targets at least 1,000 kWp of building
integrated photovoltaic (BIPV) installations in residential and com-
mercial buildings. These allow buildings to generate their own elec-
tricity from solar energy and eectively reduce reliance on conventional
electricity from the utilities. Thus, the project will facilitate the creation
of a sustainable BIPV market upon the completion of the program [35].
The Solar Water Heating (SWH) System is the ultimate solution,
fullling the energy needs for hot water and space heating that requires
a signicant proportion of the building's energy consumption. Thus,
combining the latest technology and sustainable design will provide a
system that caters to the needs of the hot water requirements in the
buildings. The SWH system is designed to t naturally onto building
rooftops as the collector tank that can be installed both above and
under the roof; thus, giving a choice to have a trendy roof design.
Moreover, it has been conceptualized to create a smooth integration
between the functional and aesthetic parts of your roof. There are
several advantages of SWH systems for buildings including the
minimization of electricity use by just utilizing the natural resource
of the sun. It provides the comfort of a warm shower during rainy days
or cold mornings and eliminates the potential of electrical hazards.
Hence, minimizing the impact on the environment through the ecient
1399
P.H. Shaikh et al.
and environmentally friendly use of energy.
The renewable wind energy conversion in Malaysia is a serious
consideration by the government. Considering that the tropical weather
of Malaysia is normally inuenced with monsoon climate conditions
due to its coordinates along latitude and longitude, the tropical climate
throughout the year gives hot summers with light winds. However, the
potential for wind energy generation in Malaysia depends on the
availability of the wind resource that varies with location. The utmost
potential is in east peninsular Malaysia with an annual vector resultant
wind speed of 4.1 m/s [37]. This wind potential varies with location.
Therefore, for buildings integrated with wind turbines, it must require
a detailed study of on-site wind potential for estimating its perfor-
mance. Besides that, it is highly recommended for wind energy systems
in commercial tourist resorts and hotels or nearby shore locality
buildings to be studied. Wind energy is considered as a green power
technology with minor impacts on the environment. Therefore, funding
for research and development in this eld of renewable energy should
be allocated with the objectives of solving fundamental problems and
product development.
Buildings in Malaysia are yet heavily dependent on utility supply
systems. The implementation of various renewable energy policies and
programs in buildings by the Government of Malaysia (GoM) has
increased the awareness of the sustainable energy system. Despite the
eort for renewable energy options in buildings, the Government of
Malaysia (GoM) needs to promote the maximum of its potentials. The
Malaysian Plans also support the utilization of renewable energies and
alternative energies in the generation mix, but unfortunately, the
penetration and acceptability from the society is quite unsupportive
due to the lack of awareness of long term benets of these technologies.
However, there is a gradual increase of awareness campaigns for
installation of various renewable technologies that ultimately motivates
the consumers for their interests in these technologies and particularly
cost savings.
5. Discussion and viewpoints
The unprecedented transitions in the urban landscape have been
experienced in Malaysia since half a century. The iconic PETRONAS
Twin Towers, Kuala Lumpur international airport and township in
Putrajaya are the landmark symbols for its development in the
international arena. Besides, fast and sustained economic growth and
determination for the sustainable development within the country
boosts various sectors to take charge. In context to that sustainable
practice in the built environment has huge potential for advanced
developments and transitions have been observed.
5.1. Rationale impact of green buildings
In Malaysia, so far the directed eorts have been initiated towards
sustainable building industry. The promising factors making possible
building sector sustainability includes rating tool, transforming gener-
ous ownership from the stakeholders, enhanced knowledge and
awareness dissemination campaigns among public, Government of
Malaysia (GoM) interests and sustenance, support from the local
manufacturers and suppliers and competitive market based approach.
However, the unpromising factors include public interests and de-
mands, status quo in rules and regulations, developers, population,
project cost and construction players awareness.
The iconic green buildings so far did not attract much of the
consumers towards the adaptation of the technology, due to the
purposeful awareness among the building consumers and the capital
investment for their retrotting. The impact can be quantiable in
terms of human health, living quality and climate change. Besides,
higher costs for buying ecient equipment usually unpersuasive by the
consumers. This is one of the signicant barriers for application of
energy regulations for buildings within the country as a result of
1400
Renewable and Sustainable Energy Reviews 75 (2017) 13921403
meager funding opportunities that has lagged behind for technical
expertise attainment. Thus, the crucial hindrance in production ability
for energy ecient and cost-eective products and services along with
their implementation, stipulation and compliance has been observed. If
sudden change can be observed in the building industry, the country's
most liability sector would turned out to be energy ecient and
conserve huge amount of energy and costs.
Malaysia's impact on extensive development of infrastructure and
buildings has been primarily on the environment. The building sector
contributes towards domestic wealth, property investments and assets
generation has grown with the exponential rise in population. Thus, the
perception for green building industry has sought out holding various
positive and negative views of the stakeholders. However, the eective
ways have been under consideration, initiated through motivating
young generation for keeping their environment green. The positive
attitude have been developed and ultimately educating the eective
system. In addition, campaigns have to be conducted about global
climate challenges for building a society with mentally more environ-
ment friendly attitude.
It has been observed through the literature regarding the strategies
adopted to promote green aspects in building sector includes; showcase
energy ecient buildings, public awareness campaigns, incentives on
less energy consumption, use of ecient appliances thus targeting
general public and private sector with pulling strategy. However,
bounding them with energy ecient practices, codes and other
mandatory requirements lead them with push strategy. This also
includes energy eciency measures, smart and sustainable designs
and use of renewable energy technologies. In addition, the Government
of Malaysia (GoM) proposes their 5-year plans for up gradation and
innovations that have been penetrated within the local market. These
push and pull strategic forms leads to noticeable environmental
benets along with safeguard consumers from rise in energy prices,
enhance comfort level, alleviate capital cost of ownership, enhance
reliability and support added market value of the building.
Thus, in making green choices for Malaysia's building industry, the
behavioral aspects are crucial in order to attain sustainability targets.
So far these green practices are primarily government driven to
mobilize resident's behavior for attaining long term socio-economic
benets. Moreover, green buildings have the potential for business
transition at the corporate level. It also attracts the customers and
building users, depending on their level of understanding and aware-
ness regarding social, environmental and economy savings. The rapid
transition can be expected once the complete life cycle assessments,
awareness, signicant benets, and technological advancements ac-
cepted by the consumers, owners and tenants.
5.2. Behavioral aspect for green choice
The behavior among the users, technology and performance rating
tool has been found inevitable to signicantly improve building
performance. Thus study regarding attitude of consumers towards
building energy savings would oer considerable part in Malaysia's
construction industry. Building sustainability throughout the delivery
process and its lifecycle assessment in improving functional require-
ments would be associated with the roles and habits of the consumers.
Therefore, vesting building users as benchmark for building perfor-
mance evaluation helps enhance quality, sensitivity and simultaneously
improve technical performance of this sector. Towards eective learn-
ing process for the needs of occupants and their changing attitudes
would be sophisticated in attaining sustainability.
Individuals and organizational behavioral characteristics impede
the energy regulation practices within buildings. The implementation
of energy standard strategies and opportunities are usually overlooked
and changing attitudes and behaviors of consumers are quite challen-
ging. This bounded rationality among consumers argues about the
human actions and decide partly on rationale basis such as tendency to
P.H. Shaikh et al. Renewable and Sustainable Energy Reviews 75 (2017) 13921403

ignore small energy opportunities, organizational letdowns, theft and Table 2

non-payment of bills, traditions, life styles, corruption, energy exper- Corporate parameters and their characteristics for green buildings.
tise transition, traditional knowledge and non-suitability of technology
Sr. # Corporate Characteristics
etc. Hence, these challenges disregard the voluntary agreements that parameter
are assumed to promote energy eciency and conservation practices,
thus, poses the adverse impact on energy regulation practices within 1 Economic Creation of green jobs
the country. This in most countries a common barrier due to the Create foreign direct investments (FDIs) for
export and manufacturing
political instability, corruption etc.
Conventional fuel price volatility

5.3. Socio-economic benets

Security
investor
provision for renewable energy

Economic development drive

This is signicant to consider the building energy performance can Market

conditions
growth for creation of stable

be observed as an owner or tenant energy consumer and a real-estate

business developer. This in terms of short term incentives that are
Simple, transparent policy structure helps
encourage new start-ups and innovators
energy and cost savings, transaction price enhancements and interests 2 Political Demonstrate commitment to RE deployment
Increase energy security and autonomy
in energy performance would allure to consumers for investment in the
business. The owners in such a case may be fascinated with other Promote a more decentralized and
democratized form of
reasons for attaining energy performance may include there, living electricity system
standard, cost spending on energy and technology availability etc. They Create mechanism for achieving RE and
emissions reduction
targets
usually focus on eciency due to rising prices for energy, thus, follows
the market demand to remain competitive and up-to-date property
stakes within the country instead of obsolete structures.
Increase
policies
the stakeholder base supporting RE

Besides, there are listed companies stakeholders that have to look 3 Social Impartial distribution of wealth
for corporate social responsibility (CSR) that not only includes Empowerment of citizens and communities
sustainability and environmental aspects but energy conservation and Public support enhancement for renewable
resource utilization through direct stake
eciency as prime responsibility. In context to that Malaysian con-
Enhanced disclosure to renewables
struction industry plan for the year 20052015 states the mandatory
changes to drive the local construction market within the country [38].
Encourage
communities
activities of citizens and

Climate and environment protection

Landscape
Thus, an attempt to track sustainability for long terms and also ensure
and cityscape must comprise of
sustainable capabilities of the stakeholders has been proposed to
renewable energy
enhance. It has been challenging for the building industry in 4 Environmental Carbon emission and pollution reductions
Malaysia to make certain of nancial aordability to the owners/ Energy eciency measures Encouragement
tenants and businesses, employment prospects in the sector, benet to Reduction on fossil fuel dependency
the environment, protable returns, competitiveness and maintenance
of future generation needs. Moreover, the emphasis on the possibility
its determination towards attaining energy eciency overall in energy
for stakeholders and developers to alleviate expenditures, materials
conversion, transmission and utilization. In general, it seems that the
cost and increase future prots.
Government of Malaysia (GoM) has a stronger focus on energy supply
and its use in buildings; this is based on energy supply security,
5.4. Corporate transitions of green buildings
reliability and competitiveness in the industry. Although in the
presence of various obstacles in securing building energy eciency,
The practice of developing structures and processes that are
such as the lack of incentives for promoting demand side management,
involved for entire resources eciency of building's life cycle are
awareness, inadequate measures to ensure quality services, fragmented
characterized in green structures. These environment friendly struc-
and dispersed building energy programs, lack in legal and regulatory
tures buildings implicates favorable impacts on society and economy.
frameworks, standards of occupant's indoor comfort, there is a need for
Socially these building structures quality living and working eciency
attention to this area. Besides that, inadequate research and develop-
of the consumers, whereas, the economically it saves life cycle costs to
ment progress and more importantly the appropriate building inte-
the owners and consumers. Besides, they can be leased or sold more
grated renewable energy options as well as their policy, market
rapidly due to their attributes oering the possibility of huge prots.
penetration, promotion and funding matters along with energy and
The corporate transition involves social, environmental, political and
resource eciency, sustainable transport and waste management are
economic viability of building envelopes as shown in Table 2.
paramount challenges and need to be stepped-up.
In order to cater to local prevailing climatic conditions, it would
6. Prospective issues and challenges
require a specic building envelope design [39]. Considering the
aforementioned scenario of Malaysia, various other factors that aect
The country has undergone over 50 years of fast growing indus-
the nal energy demand in buildings are its shape, orientation, the
trialization, with 59% annual growth. It has a relatively high rate of
ratio between the external building surface and building volume,
economic growth, and a signicant spurt in CO2 emission due to its
window size etc. Thus, the benets of refurbishing and creating new
emerging economy. Tactlessly, the development process of the country
building designs should be evaluated for the entire life cycle analysis
has been quite unsustainable so far; thus, there is a need for a holistic
(LCA) from its construction, operation and demolition phases.
sustainable approach. The building energy eciency can play a vital
Moreover, some focus should be made to establish standardized
role towards sustainable energy and alleviating the environmental
requirements for building assessment tools for the investigation,
impact. The Government of Malaysia (GoM) has already recognized
assessment and measurement of building sustainability. Eorts should
the potential benets and signicance of building energy eciency
be taken considering the standards like ASHRAE-55 [40] and EN15251
hence, striving for the eective measurements to ensure economic and
[41] in order to establish indoor environmental parameters, such as
environmental sustainability in connection with energy within the
thermal, visual, humidity, air quality and air speed that aid building
buildings sector.
energy managers to allow environmental conditions acceptable to the
In relation to that, Malaysia should strive to enhance and increase

1401
P.H. Shaikh et al.
majority of the users.
Malaysia buildings and technologies are the point of discussions
within the business community due to sustainability challenges. Along
with this market competition and commercial pressure lean towards
performance rating, that is what needed to push for sustainable
practices. The real steps for change would be the businesses are
encouraged to utilize resources and develop their own services and
products. The number of opportunities is available such as large
developers incorporate environmental considerations in their property
projects; also public banks within the country initiated their own CSR
program for sustainable oces. In similar manner businesses can
certify their sustainability criteria whereas tenants can demand certain
building standards. Even banks can lend their loan to ensure sustain-
able practices for large development projects that would be the policy
criteria to meet the issues of sustainability.
The building energy policy needs to ensure the expansion of the
scope of the Malaysian Standard MS1525 code for inclusion of new
buildings, comfort related issues, water and waste management, and
the renewable resource integration within the buildings. In addition, is
the placement of certain incentives on the follow-up of the MS1525
ratings in buildings that can be given in the form of taxes and stamp
duty exemptions.
Energy audits can play a signicant role and it has been demon-
strated that energy savings of about 10% or more can readily be
available at low or no cost, just with best practices and reducing
wastage in the buildings. Although, the Government of Malaysia (GoM)
is auditing and retrotting some of the buildings and complexes to be
refurbished into energy ecient facilities and has shown approximately
20% reductions of energy with only the retrotting strategy. This can be
a kick-start activity for Government of Malaysia (GoM) and may be
subjected to government buildings at their early stages.
7. Conclusion
Malaysia's rapid economic growth oers the energy and environ-
mental challenges for sustainable developments in the present and
future. The key in achieving balance between the economic growth,
energy and environment that we use and live in is through sustainable
developments. Building energy eciency is a prominent sector that can
help lessen the problems concerning the depletion of energy resources,
and the deterioration of the environment. Broadly, it involves two sets
of strategies to minimize the need of energy in buildings; that is
through energy eciency measures and integration of renewable
energy technologies to meet the building energy demand in the
country. This article has discussed up-to-date energy consumption in
buildings and energy eciency measures within the building sector.
The policies and laws so far implemented for the sustainable develop-
ments have included energy eciency and the potential of renewable
energy resources in the Malaysia's industry. The state-of-the-art de-
signs of buildings have been proposed in the country as landmarks;
thus, playing the prominent role of energy eciency programs. The
Malaysia's building industry heading towards the comprehensive
attainment of green development in the country with various potential
impacts so far. The cause by maturing its policy plans thus transform-
ing its framework from government regulated to self-regulated indus-
try.
i) Devised policy mechanisms for energy security, eciency and
environment challenges to be tackled.
ii) Certication of green buildings to motivate consumers through
energy eciency
iii) Provision of incentives for conserving and savings.
iv) Utilization of renewable and alternative energies in the generation
mix within building sector.
v) Public awareness for building energy wastage and its methods to
tackle.
1402
Renewable and Sustainable Energy Reviews 75 (2017) 13921403
vi) Educating young generation for eciency and conservation
following campaigns.
vii) Consumer's behavior is changing at slow pace, but so far eective
within the sector.
viii) Developing the real-estate market for energy ecient buildings.
ix) Competitive environment has been developed within the technol-
ogy market turning consumers to think about their energy costs.
x) Promote suitable nancial instruments such as tax relief, feed in
tari mechanism, capital grants in order to oer nancial rewards
to all stakeholders.
xi) Sustainability services would have wealth opportunities for the
growth of social, economic and environmental business percep-
tion within the country.
This also considers the prospective issues and challenges faced by
the building industry with their potential impact to-date. Moreover,
there is further potential of research to be conducted in the building
sector for the proper life cycle analysis, policy development and most
importantly the methodologies for providing awareness to the building
users in the country.
Acknowledgment
The authors are thankful to Universiti Teknologi Petronas,Malaysia
for their support and motivation to conduct research. They are also
grateful to Mehran University of Engineering and Technology for their
technical support on the entire tenure of higher studies. In addition,
they are gratied to unanimous reviewers for their valuable comments/
suggestions to improve the manuscript quality.
References
[1] Tenaga Suruhanjaya. Energy Commission, National Energy Balance, ISSN: 0128
6323, http://www.st.gov.my; 2014.
[2] Dixon J. Is Climate Change On Malaysias Agenda? Posted on July 8, 2009. Filed
under: Climate Change, http://envdevmalaysia.wordpress.com/2009/07/08/is-
climate-change-on-malaysias-agenda/; 2009 [Accessed 01.12.13].
[3] International Energy Agency, Key World Energy Statistics, "Energy Indicators for
2013", 2015, pp. 4957.
[4] Shaikh PH, Nor NBM, Nallagownden P, Elamvazuthi I, Ibrahim TA. Review on
optimized control System for building energy and comfort management of smart
sustainable buildings. Renew Sustain Energy Rev 2014;34:40929.
[5] http://geography.about.com/library/cia/blcmalaysia.html, [accessed 12.0.14].
[6] Kwong QJ, Ali YA. Review of energy eciency potentials in tropical buildings
Perspective of enclosed common areas. Renew Sustain Energy Rev
2011;15:454853.
[7] Chua SC, Oh TH. Green progress and prospect in Malaysia. Renew Sustain Energy
Rev 2011;15:285061.
[8] Chua SC, Oh TH. Review on Malaysia's national energy developments: key policies,
agencies, programmes and international involvements. Renew Sustain Energy Rev
2010;14:291625.
[9] Hashim H, Ho WS. Renewable energy policies and initiatives for a sustainable
energy future in Malaysia. Renew Sustain Energy Rev 2011;15:47807.
[10] Haw LC, Salleh E, Jones P. Renewable energy policy and initiatives in Malaysia.
ALAM CIPTA. Int J Sustain Trop Des Res Pract 2006;1(1):3340.
[11] Ong HC, TMI Mahlia, Masjuki HH. A review on energy scenario and sustainable
energy in Malaysia. Renew Sustain Energy Rev 2011;15:63947.
[12] Ahmad S, Abidin MZ, Kadirb A, Shae S. Current perspective of the renewable
energy development in Malaysia. Renew Sustain Energy Rev 2011;15:897904.
[13] Oh TH, Pang SY, Chua SC. Energy policy and alternative energy in Malaysia: issues
and challenges for sustainable growth. Renew Sustain Energy Rev
2010;14:124152.
[14] Chua SC, Oh TH, Goh WW. Feed-in tari outlook in Malaysia. Renew Sustain
Energy Rev 2011;15:70512.
[15] Oh TH, Chua SC. Energy eciency and carbon trading potential in Malaysia.
Renew Sustain Energy Rev 2010;14:2095103.
[16] Manan ZA, ShiunLJ , Wan Alwi SR, Hashim H, Kannan KS, Mokhtar N, Ismail AZ.
Energy eciency Award system in Malaysia for energy sustainability. Renew
Sustain Energy Rev 2010;14:227989.
[17] Foo KY. A vision on the opportunities, policies and coping strategies for the energy
security and green energy development in Malaysia [November]. Renew Sustain
Energy Rev 2015;51:147798.
[18] Roy AK, Mahmood AR, Olesen OB, Lojuntin S, Tang CK. low energy oce building
in putrajaya, Malaysia. Case studies and innovations. in: Proceedings of the World
Sustainable Building Conference, Tokyo; 2005, pp. 44653.
[19] PutrajayaPerdanaBerhad, http://www.p-perdana.com/view-roject.php?
P.H. Shaikh et al.
Cat=construction, [accessed 05.01.14].
[20] Energy Commission Diamond building, http://www.st.gov.my/index.php/about-
us2/energy-commission-diamond-building.html, [accessed 19.01.14].
[21] Malaysia Green Building Confederation, http://www.mgbc.org.my/, [accessed 24.
03.14].
[22] Green Building Index Home, http://www.greenbuildingindex.org/; 2010
[accessed 10.05.13].
[23] http://www.breeam.org/, [accessed 12.11.13].
[24] http://www.leed.net/, [accessed 15.11.13].
[25] Green Building Council Australia, http://www.gbca.org.au/green-star/, [accessed
01.10.13].
[26] Building and Construction Authority Singapore, http://www.bca.gov.sg/,
[accessed 22.11.13].
[27] Green Building Index, http://www.greenbuildingindex.org/why-green-buildings.
html, [accessed 25.11.13].
[28] Built Green Canada, http://www.builtgreencanada.ca/, [accessed 27.11.13].
[29] Institute for Building energy eciency, http://www.institutebe.com/energy-
policy/Ecient-Buildings-in-China.aspx, [accessed 02.01.14].
[30] Comprehensive Assessment System for Built Environment Eciency, http://www.
ibec.or.jp/CASBEE/english/overviewE.html, [accessed 12.11.13].
[31] Hong Kong Building Environmental Assessment Method, http://www.
beamsociety.org.hk/en_about_us_1.php, [accessed 12.11.13].
[32] Peter Chan, Chu Charles, HK-BEAM (Hong Kong building environmental
Assessment method): assessing healthy buildings, HK-BEAM Society, pp. 197206.
[33] National Australian Built Environment, http://esci-ksp.org/?Project=national-
1403
Renewable and Sustainable Energy Reviews 75 (2017) 13921403
australian-built-environment-rating-system-nabers & task_id=250, [accessed 12.
11.13].
[34] Green Building Index, http://www.greenbuildingindex.org/how-GBI-works2.
html#Classication, [accessed 05.12.13].
[35] Malaysia building integrated photovoltaic http://www.mbipv.net.my/content.asp?
Zoneid=1 & categoryid=3, [accessed 06.11.13].
[36] Chen Wei-nee. (Technical Advisor MBIPV Project KeTTHA), Status of Building
Integrated Photovoltaic (BIPV) in Malaysia, September 30; 2010.
[37] Chiang EP, Zainal ZA, AswathaNarayana PA, Seetharamu KN. Potential of renew-
able wave and oshore wind energy sources in Malaysia, Marine Technology
Seminar; 2003.
[38] Shamsuddin Siti Mazzuana, Zakaria Rozana, Mohamed Sarajul Fikri. Economic
Attributes in Industrialised Building System in Malaysia. Procedia - Soc Behav Sci
2013;105:7584.
[39] Yang L, Lam JC, Tsang CL. Energy performance of building envelopes in dierent
climate zones in China. Appl Energy 2008;85:80017.
[40] American Society of Heating, Refrigerating and Air-Conditioning Engineers-
ASHRAE.ANSI/ASHRAE Standard 55-2010: The design of sustainable buildings
for occupant comfort.GA: American Society of Heating, Refrigerating and Air-
Conditioning Engineers; 2010.
[41] European Standard, EN 15251. Indoor environmental input parameters for design
and assessment of energy performance of buildings addressing indoor air quality,
thermal environment, lighting and acoustics, CEN, European Committee for
Standardization; 2007.
 Urban Forestry & Urban Greening 20 (2016) 328337

Contents lists available at ScienceDirect

Urban Forestry & Urban Greening

journal homepage: www.elsevier.com/locate/ufug

Is greening the building envelope economically sustainable? An

analysis to evaluate the advantages of economy of scope of vertical
greening systems and green roofs
Katia Perini , Paolo Rosasco
University of Genoa, Department of Architectural Sciences, Stradone S. Agostino, 37, 16123 Genoa, Italy

a r t i c l e i n f o a b s t r a c t

Article history: A wide replication of green envelopes can be a good opportunity to improve urban environment
Received 24 November 2015 conditions, as demonstrated by several studies. Greening systems increase also building envelope per-
Received in revised form 1 July 2016 formances; however their economic sustainability has not been fully investigated. This study evaluates
Accepted 10 August 2016
the economic sustainability of two combined greening systems installed on an ofce building: a vertical
Available online 3 October 2016
greening system and a green roof, and it evaluates the advantages of economy of scope. The Cost-Benet
Analysis on two different combinations of vertical greening and green roofs considers personal benets
and costs over their life cycle. The results demonstrate the advantages of economy of scope, due to the
additional benets coming from the combination of two different systems. The results show that the tax
incentives and the combination of green systems can make the installation and the maintenance costs
economically sustainable during the life span of a greening system; this could lead to a wider diffusion
of greening systems with higher environmental and aesthetic performances.
2016 Elsevier GmbH. All rights reserved.

1. Introduction the plant species used), maintenance, system weight, obtainable

A wide replication of green envelopes can be a good opportu-
nity to improve urban environment conditions, mitigating urban
heat island phenomenon (Fioretti et al., 2010; Onishi et al., 2010;
Ottel et al., 2010; Taha, 1997). The possible integration modalities
of green elements in architecture are many, with a major or a minor
inuence on the project conception and on the formal and func-
tional characteristics (Perini, 2013). Vegetated roofs, traditionally
widespread in northern Europe, may use different plant species,
for both their inuence on architectural aesthetic and the micro-
climatic improvements obtainable (Dunnett and Kingsbury, 2008;
Fioretti et al., 2010). The many products available on the market
propose several integrated solutions for proper drainage, water-
proong, and roof protection depending on the vegetation type,
such as grass and bigger or smaller shrubs (Bianchini and Hewage,
2012a; Bouvet and Montacchini, 2007). These are commonly classi-
ed in: intensive, semi-intensive and extensive solutions and have
different uses, stratigraphy and vegetation (Dunnett and Kingsbury,
2008). For every type of green roof substrate thickness (given by
Corresponding author.
E-mail addresses: kperini@arch.unige.it (K. Perini), rosasco@arch.unige.it
(P. Rosasco).
microclimatic benets, inuence on architectural aesthetic, costs,
and use are different (Bianchini and Hewage, 2012b; Carter and
Keeler, 2008).
Vertical greening systems are made by simple climbing plants,
supporting structures for their growth or planter boxes placed at
several heights with a shading function; other provide the possi-
bility to cultivate species otherwise not suitable for growing on
vertical surfaces, thanks to the disposition of pre-vegetated panels,
dened as living wall systems (Khler, 2008; Perini et al., 2012).
These systems entail very different initial costs (i.e. in a range of
3315 D /m2 ), maintenance (i.e. in a range of 327 D /m2/ year) and
disposal (i.e. in a range of 31220 D /m2 ) (Perini and Rosasco, 2013).
1.1. Green envelopes performances at building scale
Studies conducted on green roofs and vertical greening systems
demonstrate that systems provide several benets, both social and
personal (Bianchini and Hewage, 2012b; Perini and Rosasco, 2013).
A green roof can reduce the energy demand for heating during
winter season thanks to its insulation properties; during summer,
vertical and horizontal building surfaces covered by plants improve
thermal comfort reducing the energy demand for air conditioning
(Alexandri and Jones, 2008; Kosareo and Ries, 2007; Perini et al.,
2011).

http://dx.doi.org/10.1016/j.ufug.2016.08.002
1618-8667/ 2016 Elsevier GmbH. All rights reserved.
 K. Perini, P. Rosasco / Urban Forestry & Urban Greening 20 (2016) 328337
Permpituck and Namprakai (2012) show that green roofs (10 cm
and 20 cm substrate thickness) compared to a bare roof reduce the
heat transfer (respectively by 59% and 96%) and energy consump-
tion (respectively by 31% and 37%). Similar studies demonstrate
that green roofs also reduce the heat ow between 51% and 63%
(Morau et al., 2011). During summer a wet green roof can increase
the heat dissipation through evapo-transpiratory cooling, reducing
the energy demand for air conditioning (Barrio, 1998). With high
solar radiation (1400 W/m2 ), a surface temperature differs between
a bare roof and a soil roof under a dense vegetation layer by up to
31,4 C (Wong et al., 2003).
Studies demonstrate that a vertical green layer can contribute to
the building envelope performances by creating an extra stagnant
air layer, which has an insulating effect (Perini et al., 2011), and
reducing the energy demand for air-conditioning up to 4060% in
Mediterranean climate (Alexandri and Jones, 2008; Mazzali et al.,
2012).
Another relevant benet of green roof systems regards
stormwater management, with a reduction in stormwater runoff
in a range of 60%100%, depending on systems characteristics, and
climatic conditions (Hashemi et al., 2015; Nawaz et al., 2015; Wong
and Jim, 2014), while improving also water quality (Vijayaraghavan
and Joshi, 2015; Vijayaraghavan et al., 2012).
Vegetation and other layers of green roofs or vertical greening
systems can increase the roof longevity from 20 to 40 years (Clark
et al., 2005). Studies demonstrate that green roofs and plants along
a facade improve also the aesthetic of a building and its real estate
value (Francois et al., 2002; Gao and Asami, 2007; Peck et al., 1999).
An intensive or extensive green roof is similar to a green area: Peck
et al. (1999) demonstrate that the real estate value of a building can
increase from 6 to 15% with the presence of a green roof or green
wall.
Studies investigated also the relation between worker produc-
tivity and the presence of vegetation: employees in ofce buildings
who had view on green area (garden, etc.) increase their produc-
tivity (Kaplan et al., 1988).
1.2. Green envelope environmental benets
Greening systems in dense urban areas provide relevant social
benets, mainly related to air quality improvement, also due to
lower greenhouse gas output production, mitigation of urban heat
island (UHI) effect, improvement of urban wildlife and plant species
biodiversity, increasing also the quality of urban space (Dunnett
and Kingsbury, 2008; Goddard et al., 2010; Onishi et al., 2010).
Vegetation improves air quality: gaseous pollutants can be
dissolved or sequestrated through stomata on plants and leaves
(McPherson et al., 1994). Tan and Sia (Tan and Sia, 2005) sampled
roof temperatures and other air quality parameters both pre and
post green roof installation in Singapore; using light sensors, vol-
ume aerosol samplers and particle counters they found that acid
gaseous pollutants, carbon mass levels and ambient green roof
surface temperature dropped signicantly after the installation of
green roofs. A green roof located in the urban dense area of Chicago
can absorb up to 52% of O3 , 27% of NO2 , 14% of PM10 and 7% of SO2
(Yang et al., 2008).
High levels of pollution in the atmosphere and the cementi-
cation of urban cause the Urban Heat Island (UHI) phenomenon,
resulting in the dramatic two to ve degree Celsius temperature dif-
ference between cities and their surrounding suburban and rural
areas (Taha, 1997). Though the UHI phenomenon has regional-scale
impacts on energy demand, air quality, and public health, mitiga-
tion strategies, such as urban forestry, living (green) roofs, and light
colored surfaces, could be implemented at the community level
(Rosenzweig et al., 2006). Although UHI can be mitigated with large
amount of surfaces with higher albedo (e.g. green areas) (Rizwan
329
et al., 2008), larger green areas like urban parks may be more effec-
tive (Petralli et al., 2006). Akbari (2005) shows that the mitigation
of the urban heat island effect with trees, green roofs and green
facades can reduce the U.S. national energy consumption for air
conditioning up to 20%, saving of more than $10 billion per year in
energy costs.
1.3. Economic sustainability of greening systems
The economic sustainability of green roofs has been investigated
by several authors. Wong et al. (2003) evaluate the economic sus-
tainability of intensive and extensive green roofs and demonstrate
that only extensive green roofs are economically sustainable, due
to higher installation and maintenance costs for intensive green
roofs.
Bianchini and Hewage (2012b) evaluated, by means of a Cost
Benet Analysis (CBA), the economic sustainability of intensive and
extensive green roofs, demonstrating that both are economically
sustainable from social and personal point of view (respectively
Net Present Value NPV- of 3606 $/m2 and 5715 $/m2 ); in their
case study the two authors considered a tax incentive of 48 $/m2 ;
so the nancial risk for installing any green roofs type is very low.
Other studies (Carter and Keeler, 2008; Clark et al., 2008) show
the economic sustainability of green roofs compared to traditional
roofs calculating the NPV by means of CBA. In a case study located in
Flanders, Claus and Rousseau (2012) discovered that an extensive
green roof in Flanders is economically sustainable in two case sce-
narios (base and best, with public subsidies). In the worst scenario
or without subsidies, the systems analysed are not economically
sustainable.
A study conducted by Perini and Rosasco (2013) demonstrates
that in an ordinary scenario of cost and benet values a direct green
facade with a well grown Hedera helix and an indirect green facade
with the vegetation supported by a plastic mesh can be economi-
cally sustainable, due to the low installation and maintenance costs
during a life span of 50 years. For the other systems analysed (indi-
rect green facade with planter box with steel mesh and living wall
system) economic indicators show that they are not sustainable
even in a best case scenario. The authors suggest that the eco-
nomic sustainability of such systems can be signicantly increased
by reducing the initial costs for promoters; this can be achieved
through government incentives. For example, the city of New York
enhanced installation of green roofs allowing one-time tax abate-
ment of 48,50 $/m2 (up to $100,000 or the buildings tax liability,
whichever is less) wherever the green roof covered at least 50% of
the total roof area (NYC Energy Efciency Corporation (NYCEEC),
2015).
1.4. Aim of the study
The aim of the study is to evaluate the economic sustainability
of two combined greening systems installed on an ofce building:
a vertical greening system and a green roof, taking into account
economy of scope.
Previous studies evaluate the economic sustainability of single
greening system: green roof or vertical greening; none evaluate the
economic benets and costs of combined greening system (green
roofs + green facade); in fact it is interesting to evaluate if there
are additional benets coming from the combination of two dif-
ferent systems, e.g. reduced installation and maintenance costs.
Moreover, tax incentives are higher, especially for new buildings,
as benets are as well. The present economic evaluation takes into
account the social benets only in qualitative terms; because of
the small size of the greened surface (vertical and horizontal) the
social benets obtainable are very low compared to the personal
economic benets (Perini and Rosasco, 2013). This does not mean
330 K. Perini, P. Rosasco / Urban Forestry & Urban Greening 20 (2016) 328337
Fig. 1. System A: extensive green roof and indirect green facade. (For interpretation
of the references to colour in this gure legend, the reader is referred to the web
version of this article.)
Fig. 2. System B: intensive green roof and indirect green facade with planter boxes.
(For interpretation of the references to colour in this gure legend, the reader is
referred to the web version of this article.)
that these benets are insignicant but that they can be taken into
account only in a large scale of evaluation (districts or urban areas).
2. Methodology
This study develops a CBA for two different combinations of
vertical greening and green roof installed on an ofce building con-
sidering personal benets and costs over their life cycle. The CBA
was created to verify the economic sustainability of public projects
in USA and has been already used to evaluate different vertical
green systems and green roofs (Carter and Keeler, 2008; Clark et al.,
2008; Perini and Rosasco, 2013).
The combinations of greening systems are the following:
1. System A: extensive green with 5 cm substrate thickness planted
with sedum + indirect green facade with a well grown Hedera
helix supported by a steel mesh (Fig. 1);
2. System B: intensive green roofs with 20 cm substrate thickness
planted with plant and shrubs + indirect green facade combined
with steel planter boxes with a well grown Hedera helix sup-
ported by a steel mesh (Fig. 2).
This study is based in the city of Genoa, a dense city in the north-
ern part of Italy facing on the Mediterranean sea. This location is
considered to evaluate costs and benets (installation costs, energy
savings for heating and cooling, real estate value) inuenced by a
specic location. The two systems analysed are installed on an ofce
building. This was designed for the CBA according the local regula-
tions (Comune di Genova, 2010) and considering the most common
characteristics and technologies. The building envelope is made
of a double brick wall with an air cavity and mineral wall (thick-
ness of insulation material 8 cm; according to the local regulations;
Regione Liguria, 2012). The vertical greening systems are applied
to the south facade (total surface without windows of 215 m2 ). The
green roof total surface is 225 m2 .
The economic sustainability of each solution is calculated by
means of two indicators:
1. the Net Present Value (NPV), i.e. the discounted value of benets
less costs that occur during the period of life considered;
2. Pay Back Period (PBP), i.e. length of time required to recover the
cost of the investment. This indicator is relevant in order to know
when the economic benets occur during the life span of each
system.
The CBA is founded on the discounting method of costs and ben-
ets during the lifespan in order to calculate their equivalent values
referred to the same period (normally, the moment of the evalu-
ation) and the two indicators of economic sustainability. The life
cycle of each system is considered to develop this analysis. The
life expectancy of the vertical greening systems is assumed to be
50 years (Dunnett and Kingsbury, 2008; Ottel et al., 2011). The
maximum lifespan of a green roof is about 55 years (Acks, 2006);
while, the minimum has been estimated as about 40 years (Clark
et al., 2008). In this study, a lifespan of 50 years is assumed for both
greening systems. Water pipes of the automated watering systems
needed for the indirect greening systems combined with planter
boxes and intensive green roof are assumed to be replaced every
7.5 years due to crystallizing of salts (Ottel et al., 2011). The bene-
ts related to the installation of vertical greening systems depend
on the plants growing speed. For indirect greening system the full
covering of the facade by Hedera helix is estimated after 15 years
(Bellomo, 2003) and the benets are calculated after 10 years from
installation. For indirect greening system combined with planter
boxed, benets are calculated after three years to allow a complete
coverage.
The discounted rate was assumed equal to 3,5%, i.e. an average
private discount rate which reects the capital cost of a private
investor in the last four years.
This CBA is in part based on published data from other green
roof and wall researches and practices to estimate their (positive)
effects. This may introduce some bias and indicates that this work is
subjected to revision as experience increase with more and better
data obtained from researches on vertical green and green roofs.
3. Data collection and calculation
3.1. Costs
For each greening system cost and benets are estimated
within their lifespan (Table 1); some of the installation works
as provisional structure (scaffolding) or costs related to technical
installation (e.g. irrigation) can be used for both greening system
(green facade and green roof). Hence the installation costs of each
system (green facade + green roof) are lower compared to the sum
of the two different single installations (economies of scope).
The costs considered for the vertical greening System A are the
following: pot structure at ground level, installation of vertical sup-
porting structure (steel mesh) and Hedera helix plants; no irrigation
is needed for System A. For System B: installation of vertical sup-
 K. Perini, P. Rosasco / Urban Forestry & Urban Greening 20 (2016) 328337
Table 1
Greening system and percentage increase in real estate value.
System R. E. value R.E. value
increment increment
(%) (D /m2 )
A roofs higher values were found with an increase of house property
Indirect green facade Extensive 2.5 55.00
green roof 2.0 44.0
Total 4.5 99.0
B
Indirect green facade with planter 3.5 77.0
boxes Intensive green roof 8.5 187.0
Total 12.0 264.0
porting structure (steel mesh), pots and plants of Hedera helix. The
same irrigation system can be used for both greening systems,
allowing a saving of about of 6000 D .
The installation costs of both systems are calculated considering
the use of only one scaffolding structure.
During the lifespan of 50 years the annual maintenance costs
consists of different elements, depending on the greening system
type. For the vertical greening System A, pruning to be carried out
every year with costs differing from 3rd to 5th year and compared
to the remaining years of service life, while for System B since a
watering system is needed maintenance includes also the water
pipes and water supply.
In addition once per year the substitution of some plant species
is calculated. For both systems a cladding renovation is considered
at the 50th years (instead of the 35th year, because of the protection
developed by the vertical green layer).
The installation costs of green roofs (extensive System A and
intensive System B) include different layers (waterproong and
root barrier, drainage layer, growing medium: 5 cm substrate thick-
ness for extensive green roof and 20 cm substrate thickness for
intensive green roof). In addition along the perimeter of both roofs
a steel railing is installed while only for the intensive green roof
a stone pavement path and an irrigation system are installed.
For both green roofs, an increase of horizontal roof structure costs
related to the higher weight is considered (in total about 2500 D
for extensive green roof and D 3150 for intensive green roof).
For the economic evaluation of the two systems, the differ-
ent installation and disposal costs of the green roof compared to
a traditional roof are considered as a higher additional cost: for
the installation the difference considered is about 63 D /m2 for
extensive green roof and 138 D /m2 for intensive green roof (com-
prehensive of design cost) while for disposal cost the difference is
20 D /m2 and 8 D /m2 . The costs during the lifespan are estimated at
the time of valuation (2015) and indexed using the annual ination
rate.
The disposal costs of each element (vertical supporting system,
plants, etc.) are considered at the end of their lifespan. They include
the greening systems disposal (removal of plants and structures,
transport to landll, and dump taxes), and the cladding (plaster)
and rooftop renewal. These costs for all the greening systems ana-
lysed were obtained from product forms and information provided
by companies and by the regional price lists (Unioncamere Liguria,
2012).
3.2. Benets
3.2.1. Property value
The presence of vegetation in urban areas can affect the eco-
nomic value increasing property price or rent due to aesthetic
aspects (greening systems can improve the aesthetic quality of
buildings) and, in the case of walkable green roofs, providing recre-
ational and liveable spaces: according to Peck et al. (1999) a green
331
wall would yield the same property increase as a good tree cover
and therefore a value increase interval for a property of 615% with
R.E rent a midpoint of 10.5% can be estimated. Lower values (increase 3.9%
increment of the property value) are estimated by Francois et al. (2002) using
(D /m2 /year)
a regression model for hedges or green walls. In the case of green
2.20 values in New York City of 16.2% compared with houses without
1.76
green roof (Ichihara and Cohen, 2011). According to Tomalty and
3.96
Komorowski (2010) the green roof type highly affects the property
price increase: 20% for recreational green roofs and 7% for pro-
3.08
7.48
ductive green roofs (including vegetables and fruit). The location
10.56 affects the inuence of vegetation: Gao and Asami (2007) applied a
hedonic pricing of greenery founding that an increase in greenery
quality level would increase land price by 1.4% in Tokyo and by 2.7%
in Kitakyushu.
Since the present study is based in Genoa, it considers the effects
on the real estate values of this city in terms of rent variation
due to the presence of greening systems on the building. Accord-
ing to Sdino (1998), vertical green and green roofs are relevant
to three (of 26) real estate features which contribute in the real
estate value of buildings: building related to typology and aes-
thetic of the building; pollution related to level of noise and air
pollution perceptible inside the building; green related to the
presence of green/green areas (also not directly accessible) closed
to the building. The contribution of each feature in real estate value
(estimated in terms of percentage) is related to the building within
the real estate market of Genoa (Sdino selects 8 locations: cen-
tral area, peripheral area, semi peripheral area, historic centre,
etc.; Sdino, 1998). For building feature, the percentage contri-
bution varies from a minimum value of 3.8 for semi-peripheral
location to 8.2 for historic areas; for the acoustic pollution fea-
ture the percentage contribution varies from a minimum value of
0.3 for historic areas to 12.7 for a semi-peripheral location; for
the green feature the percentage varies from a minimum value
of 0.8 for a peripheral location to 3.5 for semi-peripheral loca-
tion.
In this study, the average percentage feature contribution for
a central and a semi peripheral location is considered; due to the
installation of vertical greening systems only on a facade of the
building (3 sides are no-greened) and to the different type of green
systems installed, the estimated average increase of real estate are
represented in the second column of Table 1.
For the estimation of the total incremental value, these percent-
ages are multiplied to the average real estate value for this type
of buildings in Genoa collected by the OMI (Real Estate Market
Watch Agency Land Provincial Bureau of Genoa) in the second
semester of 2014 within the locations considered; the value esti-
mated for building ofces is 2200 D /m2 . In order to estimate the
incremental value due to the presence of green systems, the value
is multiplied to the percentage feature contribution (3td column
Table 1). By applying an annual capitalization rate of 4% (the rate
is estimated by the values published by the OMI for this type of
buildings) an annual increase in rental income is estimated. In fact,
for this type of property (ofce building), the rental market is more
signicant.
For System A, the annual increases of rent related to the specic
locations assumed in this study is 2.20 D /m2 due the presence of
the indirect green facade and 1.76 D /m2 due the presence of the
extensive green roof; for System B the annual increase of rent is
3.08 for indirect green facade with pot and 7.48 D /m2 for intensive
green roof (as the latter can be used by employees as a small garden)
(4th column Table 1).
Considering the total ofces surface of 384 m2 within the build-
ing, the annual increases of building rent due the presence of green
installations is about 1520 D for System A and 4050 for System B.
 332
Table 2
Personal costs and benets of Systems A and B (included value added tax).

System A Category Cost Time frame Cost (D /m2 ) Benet Time frame Benet (D /year)
*
Steel indirect green Initial Dig + pot One time 425.09 Energy saving for heating Annual 1150th year 5.80
facade Supporting system + transport One time 104.63 Energy saving for cooling Annual 1150th year 903.14
Installation of steel mesh One time 76.98 Increase income property Annual 1150th year 843.48
Plant species and installation One time 1.54
Mainteinance Pruning Annual 35th year 0.52
Annual 649th year 2.59

K. Perini, P. Rosasco / Urban Forestry & Urban Greening 20 (2016) 328337

Cladding renovation One time 50th year 258.31 Cladding longevity One time 35th year 14,196.06 ***
Disposal Green layer disposal One time 50th year 50.04
Extensive green roof Initial All layers One time 134.24 Tax reduction Annual 110th year 3,285.04
Design: One time 4.39 Energy saving for heating Annual 150th year 41.71
Mainteinance Pruning Annual 249th year 2.09 Energy saving for cooling Annual 150th year 363.47
Disposal Green layer and membranes One time 50th year 38.40 Increase income property Annual 150th year 674.78
Roof longevity One time 25th year 13,894.51 ***
**
Other costs Design One time 3,787
**
Scaffold One time 18,220
**
Municipality fees One time 1,260

System B
Steel indirect green facade with Initial Plant species One time 26.15 Energy saving for heating Annual 4-50th year 5.80
planter boxes with planter boxes Supporting system + transport One time 104.63 Energy saving for cooling Annual 450th year 903.14
Installation of steel mesh One time 76.98 Increase income property Annual 450th year 1,180.87
Planter boxes One time 26.15
Design One time 18.14
Mainteinance Pruning Annual until 49th year 1.31
Irrigation (H2 O) Annual 1.60
Plant species replacement (5%) Annual until 49th year 5.19
Cladding renovation One time 50th year 240.25 Cladding longevity One time 35th year 20,826.25 ***
Disposal Green layer disposal One time 50th year 59.45
Intensive green roof Initial All layers One time 209.20 Tax reduction Annual 110th year 4,457.94
Irrigation system One time 33.64 Energy saving for heating Annual 150th year 63.71
Design One time 6.41 Energy saving for cooling Annual 150th year 605.78
Mainteinance Plants Annual until 49th year 4.65 Increase income property Annual 1-50 150th year 2,867.83
Irrigation (H2 O) Annual 1.28 Roof longevity One time 25th year 13,246.10 ***
Irrigation system Annual 349th years 1.97
Disposal Green layer and membranes One time 50th year 48.00
**
Other costs Design One time 5,288
**
Scaffold One time 18.220
**
Municipality fees One time 1.260
*
D /ml of pot lenght.
**
D (total cost).
***
D (value discounted to rst year).
 K. Perini, P. Rosasco / Urban Forestry & Urban Greening 20 (2016) 328337 333

3.2.2. Energy saving for heating and air conditioning Table 3

Cost savings of Systems A and B compared to single green facade + green roof.
The economic benets deriving from to the installation of green-
ing systems are also related to the reduction of energy demand for Item System Saving Saving* Saving** (%)
air conditioning and heating. The annual energy demand for air con- (D /mq.) (D /year)
ditioning has been calculated thanks to a simulation model (Termo Installation A 7.47 6.6
Microsoftware) of the virtual building used in this analysis. A liter- B 11.20 7.7
ature review allowed the calculation of the input data used for the Irrigation system A
simulations. maintenance B 0.11
Kotsiris et al. (2012) examined on a test cell located in Athens A 0.52 0.5
Design
(Greece) different green roof systems scenarios. The estimated B 0.89 0.5
thermal transmittance of the green roof component with a 20 cm *
Annual cost saving (calculated at 1st year of life span).
deep perlite mix substrate were 0.525, 0.492, 0.489, 0.435 and **
On installation total cost.
0.441 for moisture contents of 49.26%, 48.54%, 47.35% 41.56% and
40.18% respectively. The estimated U-values for the substrate with
10 cm deep perlite mix were 0.651, 0.55 and 0.548 Wm2 K1 for energy saving of 10% for air conditioning is considered; the annual
moisture contents 36.61%, 33.28% and 32.95%, respectively. In each benet for both vertical green is 903.14 D (Table 2).
case, a linear relation seems to exist between the determined ther-
mal transmittances of the green roof substrates and their moisture
3.2.3. Longevity
contents. According to these results, the substrates thermal con-
Both green roofs and vertical greening systems reduce the fre-
ductivities increase when the water content of the substrate ranges
quency of intervention for maintenance thanks to a protective
from 0.05 to 0.7 Wm1 K1 (Ouldboukhitine et al., 2012).
action: leaves and other layers involved delay the decay of the
This study calculates the potential energy saving due to the
underlying surface caused by UV rays, temperature changes, acid
installation of the green roofs (A, B), to this end, assumptions were
rain, ice, and air pollution reducing the deterioration (Peck et al.,
made starting from the results obtained by Kotsiris et al. (2012), and
1999; Wong et al., 2010, 2003). According to several studies, the
considering the worst case scenario in terms of moisture content
lifespan of green roof is in a range of 40-55 years (Bianchini and
(thermal transmittance with highest moisture content assumed).
Hewage, 2012b; Clark et al., 2008; Kosareo and Ries, 2007; Saiz
For the intensive green roof (20 cm substrate) 0.525 Wm2 W1
et al., 2006). Conventional roofs need maintenance every 25-30
was assumed (moisture content 49.26%); for the extensive green
years (Di Giulio, 2003). Therefore the presence of green roofs allows
roof (5 cm substrate), 0.909 Wm2 W1 (moisture content 37.5%).
a reduction of maintenance costs compared to a conventional roof,
Considering the different thermal transmittance and insulation
resulting in an economic benet. In this study, a life span for inten-
properties of the two green roof systems analysed in this study, the
sive and extensive green roofs of 50 years is assumed instead of 30
estimated total annual economic benet for heating is 41.47 D for
years assumed for an ordinary roof. The saving for longevity roof
extensive green roof and 63.71 D for intensive green roof (Table 2).
in System A discounted to the rst year amounts to 13,894 D
Green roofs improve the energy savings for cooling if installed
while in System B is 13,246 D (Table 3).
on a well-insulated roof because of the additional cooling effect of
For vertical surfaces, the frequency of maintenance of a plas-
evapotranspiration on the building shell in Greece (Kotsiris et al.,
tered facade (complete remaking of the coating layers and painting)
2012). The energy saving due to a 20 cm substrate thickness, con-
depends on the quality of the plaster and the environmental con-
sidering an insulated roof according Greek EPBR, is in a range
ditions (pollution, precipitation frequency, etc. (Di Giulio, 2003):
of 11.8915.45% depending on the green roof type and substrate
from 25 and 30 years or more.
(perlite, pumice, rock wood). Simulations for a one-storey ofce
In this study it is estimated that without a green layer the ren-
building show that in summer, no advantage is achievable adopting
ovation of the facade would have to be realized in the 35th year
a short-sedum vegetation, while good performances are achieved
while green lengthens the coating lifetime by 15 years (incremental
by tall gramineous vegetation (8.2% cooling demand in Rome, 8.5%
value assumed in the current examination for all solutions of con-
in Amsterdam (Ascione et al., 2013). The estimated annual cost for
sidered). Therefore, at the end of the 50th year (the end of the life
cooling for the whole building without greening systems is 9,031
cycle assumed for this study), a maintenance of the plaster facade
D (only for the last oor is 4,846 D ); the percentage of saving for
must be done.
cooling indicated from literature for the presence of an extensive
The longevity benet is equal to the cost recovery that should
green roof ranges from 5 to 10%, while for an intensive green roof
have been borne at 35th year and the lower cost at 50th year due
from 10 to 15%. In this study average values are assumed; so the
to a better condition of the plaster. The vertical building surface
annual saving for cooling is 363.47 D for extensive green roof and
requires at that point removal of all of plaster facade (1st layer,
605.78 D for intensive green roof (Table 2).
2nd layer and surface nishing) in the case of System A (indirect
To calculate the energy savings for heating, due to the increase of
green facade), remaking and subsequent painting, while for System
the insulating properties with vertical greening systems, the addi-
B building surface requires for most of the area only the 2nd layer
tional thermal resistance is assumed to be 0.09 Km2 W1 . This value
and surface nishing.
is used for both systems analysed due to stagnant air layer in and
The saving for plaster longevity discounted to the rst year
behind the foliage (Perini et al., 2011). The annual economic benet
amounts to 14,196 D for System A and 20,896 D for System B.
is 5.80 D (Table 2).
The potential energy saving for air conditioning which can be
obtained with vertical greening systems depends on the climate. 3.2.4. Tax reduction
Insulation material moderates the prevailing temperature differ- In Italy, about 328 local municipalities regulate the installa-
ence between the outside and inside (Mazzali et al., 2012; Ottel, tion of green roofs; 22 oblige to cover part of new roof with
2011; Scarpa et al., 2014): in this study, due the presence of verti- a green roof while 23 incentive green roof installation (Cresme
cal facade and considering the location used for this study (Genoa, and Legambiente, 2013). For new public buildings some local
Italy) and the exterior wall stratigraphy, in System A and B an municipalities establish also a minimum surface to be covered by
vegetation instead of realizing an equivalent green area on the
ground (Cresme and Legambiente, 2013).
334 K. Perini, P. Rosasco / Urban Forestry & Urban Greening 20 (2016) 328337

110 110
100 100
90 tax incenves 90 Green
80 only for green 80 system as a
70 roof
NPV (/m2)

NPV (/m2)
70 whole
60
60
50
tax incenves 50
40 for both 40 Single green
30 greening
20
30 systems
systems
10 20
0 10
System A System B 0
System A System B
Graph 1. System A and B: NPV for two cases: with tax incentives only for green roof
and with tax incentives for both greening systems. Graph 3. System A and B: NPV obtained considering single green system as a whole
(with tax incentives only for green roof).

4.2. System B: intensive green roof and indirect green facade with
planter boxes

The System B analysed in this study shows positive NPV values,

Graph 2. System A and B: PBP for two cases: with tax incentives only for green roof
and with tax incentives for both greening systems.
although 50% lower of System A, due to the higher installation costs
and the higher maintenance needs (irrigation system, plants sub-
stitution, etc). The value is equal to 29.27 D /m2 (Graph 1). A similar
trend results for the PBP with a value of 20 years (Graph 2).
Also for this system, the economic sustainability signicantly
improves in the case of tax incentives considered also for the verti-
cal greening system: the NPV results amount to 85.80 D /m2 while
the PBP decreases from 20 to 9 years. Comparing this result with
System A, a major decrease in PBP can be noticed, due to the higher
installation costs of the system and, consequently, the higher tax
incentives.

4.3. Overview

The results of the CBA show that the economic sustainability

Building owners can exploit a tax relief between 50% and 65% of
the initial costs related to energy saving interventions (e.g. thermal
insulation) spread over a time period of 10 years (Decree Law n.
63).
Since greening the building envelope ensures a substantial
energy saving, as shown in the present study, the Decree Law n.
63/2013 can be applied to obtain the 65% tax incentives (applied
on the installation costs) for green roof installation. For extensive
green roof, the annual tax relief (from 1 st year to 10th) year is 3,347
D while for intensive green roof is 4,513 D (Table 2).
In the case of green facades tax relief cannot be applied, although
such systems can signicantly increase performances of the build-
ing envelope.
4. Discussion and analysis
4.1. System A: extensive green roof and indirect green facade
The values obtained from the economic indicators show that
System A is economically sustainable. The NPV is positive and equal
to 57.40 D /m2 (Graph 1). The PBP (i.e. number of years needed for
the discounted economic benets to reach the costs) is 14 years
(Graph 2).
Both values assume the use of tax incentives only for the green
roof (65% of installation costs).
If tax incentives were assumed for both greening systems, the
NPV would be 72% higher (99,38 D /m2 ); the PBP 8 years lower.
These values highlight the importance of tax incentives for the
economic sustainability of such systems.
of greening systems depends on the installation and maintenance
costs: for System A the economic indicator show the full sustain-
ability of the system; for System B the economic benets (energy
savings for heating and air conditioning, and longevity of plaster
facade) balance the higher costs of installation and maintenance
during the life span.
However the combination of two systems obtains higher eco-
nomic performance, compared to a single green installation (green
facade and green roof).
Assuming the installation of both a green roof and a green facade,
the combined use of some elements (scaffolding, irrigation) and
unique design determine some economies of scope, with a total
cost saving of 7.1% for System A and 8.2% for System B (Table 3).
Beyond the specicity of the case study examined, the CBA
shows that the integration of two greening systems (i.e. green
roof + vertical greening system) improves the value of two indi-
cators of economic sustainability compared to those obtained
considering the two green systems separately (Graph 3).
For System A, the NPV of the two green systems separately and
only with tax incentives for green roof is 49.68 D /m2 , while con-
sidering a system as a whole it is equal to 57.40 D /m2 ; for System B
the values are respectively 17.02 D /m2 and 29.27 D /m2 (Graph 3).
The combination of two systems reduces also the PBP: for Sys-
tem A, it is 14 instead of 17 while for System B 20 years instead of
27 years (Graph 4).
The sensitivity analysis shows how the variables inuence the
NPV unitary value, considering the personal costs and benets
(with tax reduction only for green roof). For System A the non-
economic factors which negatively inuence the NPV value are
installation and maintenance costs (Graph 5); the same trend is
noticed for System B, although the irrigation system and the main-
 K. Perini, P. Rosasco / Urban Forestry & Urban Greening 20 (2016) 328337 335

Table 4
Percentage variation of the variables that annul the NPV.

Variable Percentage variation (%)

System A System B

En. saving for heating

En. saving for cooling 41,1
Tax reduction 77,7 23,3
Longevity facade 73,5
Longevity roof
Property value 90,7
Ination rate +321
Discount rate +171 +168,0
Installation cost +45,0 +26,4
Maintenance cost +66,0 +19,8
Graph 4. System A and B: PBP obtained considering single green system as a whole
(with tax incentives only for green roof).
Discount and ination rates are the less relevant (positively or neg-
60% Saving heang
atively) factors.
Even if the tax incentives have a negative social economic
Saving cooling
40% impact, this is the key factor for a wider diffusion of green envelopes
with positive social effects.
NPV (/m2) variaon (%)

Tax reducon
20%
Longevity facade Table 4 shows the percentage variation for each variable
0% annulling the NPV value; the results underline that for both sys-
Longevity roof
tems the most critics variables are installation and maintenance
-20% Property value cost: for System A, if the installation cost increase about 45%, the
Inaon rate NPV is equal to zero. For system B, the same effect occurs with a
-40%
20% increase of the maintenance cost. This happens due to the high
Discount rate
-60% relevance of such cost within during the life spam. For System B
-20% -15% -10% -5% 0% 5% 10% 15% 20% Installaon cost also tax reduction plays an important role: with a reduction of 23%
Variaon Maitenance cost the economic sustainability is not veried (Table 4).
Otherwise the NPV diminish but is never equal to zero even if
Graph 5. System A Sensitivity analysis for the personal economic factors. some variable dont explain their positive effect: ve in System A
(saving heating and cooling, longevity facade, longevity roof and
ination rate) and three in System B (saving heating, longevity roof
100% Saving heang and property value).
80%
Saving cooling
60%
5. Conclusion
NPV (/mq.) variaon (%)

40% Tax reducon

20% Longevity facade

The present study evaluates the economic sustainability of two
0%
Longevity roof combined greening systems installed on an ofce building: a ver-
-20%
Property value
tical greening system and a green roof.
-40%
The CBA compares the personal benets and costs over the life
-60% Inaon rate
cycle of two combined solutions (green roof + vertical greening sys-
-80%
Discount rate tem) evaluating also separately installation costs and benets.
-100%
Installaon cost
The results highlight two important aspects:
-20% -15% -10% -5% 0% 5% 10% 15% 20%

Variaon
Graph 6. System B Sensitivity analysis for the personal economic factors.
tenance cost of the indirect green facade with planter boxes have
a major negative inuence (an increase of 20% reduce about 100%
the NPV) (Graph 6).
For both systems the most relevant economic factor that pos-
itively inuenced the NPV is tax reduction: with a 20% increase
(from 65% to 80%) the unitary NPV increases up to 46% for Sys-
tem B and about 100% for System B (from 33.78 D /m2 to 69.85
D /m2 because of the higher installation cost used to calculate the
tax reduction). In Italy this could be possible with the use of tax
incentives also for vertical greening systems.
Worth mentioning that although social benets are not consid-
ered in this study (due to the difculty of estimating the effects of
a single facade), a wider diffusion of greening systems can play an
important role for improving environmental quality of dense urban
areas, therefore tax incentives should be considered as social costs.
Economic saving for heating and cooling, which can be increased
with a careful design and material choice, is relevant as well.
Maitenance cost tax incentives play an important role for the economic sustain-
ability of greening systems: tax incentives not only for green roofs
installations but also for vertical greening systems have posi-
tive effects on the global economic results (in Italy as in other
countries such systems are not considered for tax incentives).
additional benets derive from the combination of two differ-
ent systems due to lower installation and maintenance costs,
demonstrating the advantages of economy of scope. This is rele-
vant especially for System B because of its higher installation and
maintenance costs.
Although all the single greening systems analyzed extensive
green roof, indirect green facade, intensive green roof, and indirect
green facade with planter boxes can be economically sustainable,
for the case of intensive green roofs and vertical green facade with
planter box the economic sustainability is at the edge of accept-
ability; otherwise, the combination of two systems signicantly
improves NPV and PBP, especially in the case of System B.
The results show that the tax incentives and the combination of
green systems can make the installation and the maintenance costs
economically sustainable during the life span of a greening system;
336 K. Perini, P. Rosasco / Urban Forestry & Urban Greening 20 (2016) 328337
this may result in a wider diffusion of greening systems with higher
environmental and aesthetic performances.
Acknowledgements
Luca Capanna, Ing. Dr. Enrica Cattaneo and Umberto Valle are
acknowledged for their fundamental help for the energy saving
calculations. The vertical greening systems companies and Peirano
Vivai (Genoa) that provided the data needed for this analysis are
also acknowledged.
References
Acks, K., 2006. A Framework of Green Roof Cost-Benet Analysis: Initial Estimates,
In: Green Roofs in the New York Metropolitan Region. Research Report.
Rosenzweig, C., Gafn S., Parshall L. (Eds.), NASA/Goddard Institute for Space
Studies and Columbia University Center for Climate Systems Research, pp.
41-52. Permalink: http://escholarship.org/uc/item/4qs5f42s https://www.nps.
gov/tps/sustainability/greendocs/rosenzweig-sm.pdf.
Akbari, H., 2005. Energy Saving Potentials and Air Quality Benets of Urban Heat
Island Mitigation, Lawrence Berkeley National Laboratory. Link: http://
escholarship.org/uc/item/4qs5f42s.
Alexandri, E., Jones, P., 2008. Temperature decreases in an urban canyon due to
green walls and green roofs in diverse climates. Build. Environ. 43, 480493,
http://dx.doi.org/10.1016/j.buildenv.2006.10.055.
Ascione, F., Bianco, N., deRossi, F., Turni, G., Vanoli, G.P., 2013. Green roofs in
European climates Are effective solutions for the energy savings in
air-conditioning? Appl. Energy 104, 845859, http://dx.doi.org/10.1016/j.
apenergy.2012.11.068.
Barrio, E.P.D., 1998. Analysis of the green roofs cooling potential in buildings.
Energy Build. 27, 179193, http://dx.doi.org/10.1016/S0378-7788(97)00029-7.
Bellomo, A., 2003. Pareti Verdi: Linee Guida Alla Progettazione/Antonella Bellomo.
Esselibri, Napoli.
Bianchini, F., Hewage, K., 2012a. How green are the green roofs? Lifecycle analysis
of green roof materials. Build. Environ. 48, 5765, http://dx.doi.org/10.1016/j.
buildenv.2011.08.019.
Bianchini, F., Hewage, K., 2012b. Probabilistic social cost-benet analysis for green
roofs: a lifecycle approach. Build. Environ.
Bouvet, D., Montacchini, E., 2007. La Vegetazione Nel Progetto. Uno Strumento Per
La Scelta Delle Specie Vegetali. Con CD-ROM. Sistemi Editoriali, Napoli.
Carter, T., Keeler, A., 2008. Life-cycle cost-benet analysis of extensive vegetated
roof systems. J. Environ. Manage. 87, 350363, http://dx.doi.org/10.1016/j.
jenvman.2007.01.024.
Clark, C., Talbot, B., Bulkley, J., Adriaens, P., 2005. Optimization of green roofs for air
pollution mitigation. In: Third North American Green Roof Onference:
Greening Rooftops for Sustainable Communities. The Cardinal Group,
Washington, DC, Toronto, pp. 482497.
Clark, C., Adriaens, P., Talbot, F.B., 2008. Green roof valuation: a probabilistic
economic analysis of environmental benets. Environ. Sci. Technol. 42,
21552161.
Claus, K., Rousseau, S., 2012. Public versus private incentives to invest in green
roofs: a cost benet analysis for Flanders. Urban For. Urban Green. 11,
417425, http://dx.doi.org/10.1016/j.ufug.2012.07.003.
Comune di Genova, 2010. Regolamento Edilizio Comunale. Comune di Genova,
21-May-2010. Permalink: http://www.comune.genova.it/sites/default/les/
regolamento edilizio comunale.pdf.
Cresme Ricerche and Legambiente, 2013, Linnovazione Energetica in Edilizia.
Rapporto Onre 2013. Permalink: http://www.legambiente.it/sites/default/les/
docs/sito onre 2013 min.pdf.
Di Giulio, R.D., 2003. Manuale Di Manutenzione Edilizia. Valutazione Del Degrado E
Programmazione Della Manutenzione, 3rd ed. Maggioli Editore.
Dunnett, N., Kingsbury, N., 2008. Planting Green Roofs and Living Walls. Timber
Press, Portland, Or.
Fioretti, R., Palla, A., Lanza, L.G., Principi, P., 2010. Green roof energy and water
related performance in the Mediterranean climate. Build. Environ. 45,
18901904, http://dx.doi.org/10.1016/j.buildenv.2010.03.001.
Francois, D.R., Marius, T., Yan, K., Paul, V., 2002. Landscaping and house values: an
empirical investigation. J. Real Estate Res. 23, 139162.
Gao, X., Asami, Y., 2007. Effect of urban landscapes on land prices in two Japanese
cities. Landsc. Urban Plan. 81, 155166, http://dx.doi.org/10.1016/j.
landurbplan.2006.11.007.
Goddard, M.A., Dougill, A.J., Benton, T.G., 2010. Scaling up from gardens:
biodiversity conservation in urban environments. Trends Ecol. Evol. 25, 9098.
Hashemi, S.S.G., Mahmud, H.B., Ashraf, M.A., 2015. Performance of green roofs with
respect to water quality and reduction of energy consumption in tropics: a
review. Renew. Sustain. Energy Rev. 52, 669679, http://dx.doi.org/10.1016/j.
rser.2015.07.163.
Ichihara, K., Cohen, J.P., 2011. New York City property values: what is the impact of
green roofs on rental pricing? Lett. Spat. Resour. Sci. 4, 2130, http://dx.doi.
org/10.1007/s12076-010-0046-4.
Khler, M., 2008. Green facadesa view back and some visions. Urban Ecosyst. 11,
423436, http://dx.doi.org/10.1007/s11252-008-0063-x.
Kaplan, S., Talbot, J.F., Kaplan, R., 1988. Coping with daily hassles: the impact of the
nearby natural environment. Project Report. USDA Forest Service, North
Central Forest Experiment Station, Urban Forestry United Cooperative
Agreement 23-85-08.
Kosareo, L., Ries, R., 2007. Comparative environmental life cycle assessment of
green roofs. Build. Environ. 42, 26062613, http://dx.doi.org/10.1016/j.
buildenv.2006.06.019.
Kotsiris, G., Androutsopoulos, A., Polychroni, E., Nektarios, P.A., 2012. Dynamic
U-value estimation and energy simulation for green roofs. Energy Build. 45,
240249, http://dx.doi.org/10.1016/j.enbuild.2011.11.005.
Mazzali, U., Peron, F., Scarpa, M., 2012. Thermo-physical performances of living
walls via eld measurements and numerical analysis, Eco-Architecture IV, WIT
Transactions on Ecology and The Environment, Vol.165. WIT Press, http://dx.
doi.org/10.2495/ARC120231, ISSN 1743-3541 (on-line).
McPherson, E.G., Nowak, D.J., Rowntree, R.A., 1994. Chicagos Urban Forest
Ecosystem: Results of the Chicago Urban Forest Climate Project. (includes
Executive Summary). Forest Service General Technical Report (nal) (No.
PB-94-203221/XAB; FSGTR-NE186). Forest Service. Northeastern Forest
Experiment Station., Delaware, OH (United States).
Morau, D., Libelle, T., Garde, F., 2011. Performance evaluation of green roof for
thermal protection of buildings In Reunion island. Energy Procedia 2nd
International Conference on Advances in Energy Engineering (ICAEE) 14,
10081016, http://dx.doi.org/10.1016/j.egypro.2011.12.1047.
NYC Energy Efciency Corporation (NYCEEC), 2015. GBEE Financing & Incentives
Green Roof Tax Abatement [WWW Document]. NYC Energy Efciency
Corporation (NYCEEC), URL http://www.nyc.gov/html/gbee/html/incentives/
roof.shtml (accessed 11.24.15.).
Nawaz, R., McDonald, A., Postoyko, S., 2015. Hydrological performance of a
full-scale extensive green roof located in a temperate climate. Ecol. Eng. 82,
6680, http://dx.doi.org/10.1016/j.ecoleng.2014.11.061.
Onishi, A., Cao, X., Ito, T., Shi, F., Imura, H., 2010. Evaluating the potential for urban
heat-island mitigation by greening parking lots. Urban For. Urban Green. 9,
323332, http://dx.doi.org/10.1016/j.ufug.2010.06.002.
Ottel, M., van Bohemen, H.D., Fraaij, A.L.A., 2010. Quantifying the deposition of
particulate matter on climber vegetation on living walls. Ecol. Eng. 36,
154162, http://dx.doi.org/10.1016/j.ecoleng.2009.02.007.
Ottel, M., Perini, K., Fraaij, A.L.A., Haas, E.M., Raiteri, R., 2011. Comparative life
cycle analysis for green facades and living wall systems. Energy Build. 43,
34193429, http://dx.doi.org/10.1016/j.enbuild.2011.09.010.
Ottel, M., 2011. The Green Building Envelope. Delft University of Technology, The
Netherlands.
Ouldboukhitine, S.-E., Belarbi, R., Djedjig, R., 2012. Characterization of green roof
components: measurements of thermal and hydrological properties. Build.
Environ. 56, 7885, http://dx.doi.org/10.1016/j.buildenv.2012.02.024.
Peck, S.W., Callaghan, C., Kuhn, M.E., Bass, B., 1999. Greenbacks from Green Roofs:
Forging a New Industry in Canada, Status Report on Benets, Barriers and
Opportunities for Green Roof and Vertical Garden Technology Diffusion.
Environmental Adaptation Research Group, Canada.
Perini, K., Rosasco, P., 2013. Costbenet analysis for green facades and living wall
systems. Build. Environ. 70, 110121, http://dx.doi.org/10.1016/j.buildenv.
2013.08.012.
Perini, K., Ottel, M., Fraaij, A.L.A., Haas, E.M., Raiteri, R., 2011. Vertical greening
systems and the effect on air ow and temperature on the building envelope.
Build. Environ. 46, 22872294, http://dx.doi.org/10.1016/j.buildenv.2011.05.
009.
Perini, K., Ottel, M., Haas, E.M., Raiteri, R., 2012. Vertical greening systems, a
process tree for green facades and living walls. Urban Ecosyst. 16, 265277,
http://dx.doi.org/10.1007/s11252-012-0262-3.
Perini, K., 2013. Progettare Il Verde in Citta: Una Strategia Per larchitettura
Sostenibile. F. Angeli, Milano.
Permpituck, S., Namprakai, P., 2012. The energy consumption performance of roof
lawn gardens in Thailand. Renew. Energy 40, 98103, http://dx.doi.org/10.
1016/j.renene.2011.09.023.
Petralli, M., Prokopp, A., Morabito, M., Bartolini, G., Torrigiani, T., Orlandini, S.,
2006. Ruolo delle aree verdi nella mitigazione dellisola di calore urbana: uno
studio nella citt di Firenze. Riv. Ital. Agrometeorol. 1, 5158.
Regione Liguria, 2012. Regolamento Regionale 13 Novembre 2012. N. 6.
Regolamento di attuazione dellarticolo 29 della legge regionale 29 maggio
2007 n. 22, cos come modicata dalla legge regionale, 30 luglio 2012 n. 23
recante: Norme in materia di energia. Permalink: http://www.bur.
liguriainrete.it/archiviole/B 000000169912201000.pdf.
Rizwan, A.M., Dennis, L.Y., Liu, C., 2008. A review on the generation, determination
and mitigation of Urban Heat Island. J. Environ. Sci. 20, 120128.
Rosenzweig, C., Solecki, W.D., Slosberg, R.B., 2006. Mitigating New York Citys heat
island with urban forestry, living roofs, and light surfaces. New York City
regional heat island initiative.
Saiz, S., Kennedy, C., Bass, B., Pressnail, K., 2006. Comparative life cycle assessment
of standard and green roofs. Environ. Sci. Technol. 40, 43124316, http://dx.
doi.org/10.1021/es0517522.
Scarpa, M., Mazzali, U., Peron, F., 2014. Modeling the energy performance of living
walls: validation against eld measurements in temperate climate. Energy
Build. 79, 155163, http://dx.doi.org/10.1016/j.enbuild.2014.04.014.
Sdino, L., 1998. Valore e caratteristiche immobiliari di un immobile, In: Contributi e
riessioni economiche, estimative e nanziarie per le professioni immobiliari.
Atti del primo corso per Agenti Immobiliari, Tecnocopy, Genova, 117160.
 K. Perini, P. Rosasco / Urban Forestry & Urban Greening 20 (2016) 328337
Taha, H., 1997. Urban climates and heat islands: albedo, evapotranspiration, and
anthropogenic heat. Energy Build. 25, 99103, http://dx.doi.org/10.1016/
S0378-7788(96)00999-1.
Tan, P.Y., Sia, A., 2005. A pilot green roof research project in Singapore. In:
Proceedings of the Third Annual Greening Rooftops for Sustainable
Communities Conference, Washington DC.
Tomalty, R., Komorowski, B., 2010. The Monetary Value of the Soft, Benets of
Green Roofs.
Unioncamere Liguria, 2012. Prezzario Opere Edili. Regione Liguria, 2012.
Vijayaraghavan, K., Joshi, U.M., 2015. Application of seaweed as substrate additive
in green roofs: enhancement of water retention and sorption capacity. Landsc.
Urban Plan. 143, 2532, http://dx.doi.org/10.1016/j.landurbplan.2015.06.006.
Vijayaraghavan, K., Joshi, U.M., Balasubramanian, R., 2012. A eld study to evaluate
runoff quality from green roofs. Water Res. 46, 13371345, http://dx.doi.org/
10.1016/j.watres.2011.12.050.
337
Wong, G.K.L., Jim, C.Y., 2014. Quantitative hydrologic performance of extensive
green roof under humid-tropical rainfall regime. Ecol. Eng. 70, 366378, http://
dx.doi.org/10.1016/j.ecoleng.2014.06.025.
Wong, N.H., Tay, S.F., Wong, R., Ong, C.L., Sia, A., 2003. Life cycle cost analysis of
rooftop gardens in Singapore. Build. Environ. 38, 499509.
Wong, N.H., Kwang Tan, A.Y., Chen, Y., Sekar, K., Tan, P.Y., Chan, D., Chiang, K.,
Wong, N.C., 2010. Thermal evaluation of vertical greenery systems for building
walls. Build. Environ. 45, 663672, http://dx.doi.org/10.1016/j.buildenv.2009.
08.005.
Yang, J., Yu, Q., Gong, P., 2008. Quantifying air pollution removal by green roofs in
Chicago. Atmos. Environ. 42, 72667273, http://dx.doi.org/10.1016/j.
atmosenv.2008.07.003.
 Available online at www.sciencedirect.com

ScienceDirect
Energy Procedia 78 (2015) 1629 1634

6th International Building Physics Conference, IBPC 2015

Relevance of Acoustic Performance in Green Building Labels and

Social Sustainability Ratings
Franz Dolezala*, Christina Spitzbart-Glasla
a
Holzforschung Austria, Franz Gill-Strae 7, Vienna 1030, Austria

Abstract

Several initiatives have been launched to increase sustainability in building industry. All of them contain a shift in focus from
energy consumption to a wide variety of indicators for the full life cycle. This implies a broader view, not only based on the
ecological, but on the economic and social performance of buildings as well. A closer look on internationally acting Green
Building Labels reveals that acoustic performance and noise protection is seen as an important part of the social sustainability
aspects of a building. Thus, the approach of how to consider the acoustic performance and impact on rating results vary heavily.
2015
2015TheTheAuthors.
Authors. Published
Published by by Elsevier
Elsevier Ltd.Ltd.
This is an open access article under the CC BY-NC-ND license
Peer-review under responsibility of the CENTRO CONGRESSI INTERNAZIONALE SRL.
(http://creativecommons.org/licenses/by-nc-nd/4.0/).
Peer-review under responsibility of the CENTRO CONGRESSI INTERNAZIONALE SRL
Keywords: building acoustics, sound insulation, noise protection, social sustainability, Green Building Labels

1. Introduction

The significant contribution of the building sector to global energy and resource flows, as described for example
by [1, 2, 3] has been use as a main argument for political, regulative and voluntary action to decrease their
environmental impacts and increase their sustainable performance alike.
Nowadays holistic approaches include, beside energy use and Greenhouse gas emissions, aspects of economic
and social sustainability. According to the general definition of sustainability ecological, economic and social
aspects and consequences also called the three columns of sustainability (figure 1) are taken into account to
analyse and assess buildings. This is already pictured in relevant voluntary, horizontal standards for the assessment,

* Corresponding author. Tel.: +43-1-7982623; fax: +43-1-7982623-50.

E-mail address: f.dolezal@holzforschung.at

1876-6102 2015 The Authors. Published by Elsevier Ltd. This is an open access article under the CC BY-NC-ND license
(http://creativecommons.org/licenses/by-nc-nd/4.0/).
Peer-review under responsibility of the CENTRO CONGRESSI INTERNAZIONALE SRL
doi:10.1016/j.egypro.2015.11.241
1630 Franz Dolezal and Christina Spitzbart-Glasl / Energy Procedia 78 (2015) 1629 1634

developed by CEN/TC 350 Sustainability of construction works since 2005 according the European Commissions
mandate with all aspects of sustainability included.
A different strategy with the same goal of achieving transformation to a more sustainable building sector can be
seen in Green Building Labels (GBLs), assessment and rating schemes which can be characterized according to
Sinha et al. [4] as integrated building practices that aim to significantly reduce the environmental footprint of a
building in comparison to standard practices.

Fig. 1. Three columns of sustainability with respective aspects for analysis (Own drawing, based on EN 16309)

2. Methodology

Sustainability assessment of buildings is related to a variety of different issues. One of them is the acoustic
performance of the analysed structure, the surroundings and service equipment. The aim of this paper is to analyse
how acoustic performance is assessed in different GBLs and relevant standards. The focus of investigation was on
labels from German speaking countries and labels with significance beyond the borders of their country of origin.
The objective was to figure out, if sound protection is seen as an important issue of sustainability, which acoustic
characteristics are considered and which methodological approaches are used for rating. Analysis is based on the
GBLs web pages and publications on criteria, assessment and credits. To find out the impact of acoustic properties
on GBLs rating results, the different assessment schemes had to be investigated. Finally, interrelation between
acoustic performance of building components and the environmental impact of building materials, calculated
according to life cycle assessment (LCA) methods, was studied. LCA is based on calculations using Ecosoft v5.0
software [5] with baubook database and own data from ECO2/ecotimber research project [6]. They cover production
phase from cradle to gate (A1 to A3) according EN 15978 [7].

3. Standardisation of acoustic performance as sustainability criteria

Though noise is a subjective phenomena and strongly related to the individual perception, surveys, carried out in
different European countries and summarised by Lang in [8] show annoying acoustic situations for a significant
amount of inhabitants. Figures from the European Commission indicate that more than 100 Million people are
exposed to annoying sound levels with different resulting effects like hearing impairment, hypertension, heart
 Franz Dolezal and Christina Spitzbart-Glasl / Energy Procedia 78 (2015) 1629 1634 1631

disease, annoyance, and sleep disturbance. Considering the importance of this topic for health and wellbeing, noise
protection became an important indicator for social sustainability aspects of buildings.
The respective standard, EN 16309 Sustainability of construction works - Assessment of social performance of
buildings - Calculation methodology, does not give benchmarks. Instead it provides information about what and
how to assess by suggesting related standards for calculation, measuring and single number rating for the assessment
of acoustic characteristics. A closer look at this standard shows that so called Acoustic characteristics are a
subchapter in Health and Comfort in the Methods for assessment of social performance section (figure 1).
There, they are one out of several social aspects like indoor air quality and thermal characteristics that are related to
building physics. However, the section also contains qualitatively assessed aspects like visual comfort and spatial
characteristics.

3.1. EN 16309:2014 Chapter 7.4.4 Acoustic characteristics

According to EN 16309, acoustic characteristics are defined by airborne and impact sound insulation of
separating walls and floors, the sound insulation of the external envelope, the noise level including service
equipment noise, and the reverberation time. Further it is mentioned that different types of use and airborne as well
as impact sounds shall be taken into account. An additional note states that acoustic quality of a building can be
determined by calculation using EN 12354 series of standards or through measurements in laboratories or in situ. It
is indicated that the acoustic performance of the building varies heavily with the quality of workmanship and the
actual situation encountered and that laboratory measurements depend on testing accuracy.

3.2. EN 16309:2014 Chapter 7.5.2 Noise

Further acoustic related aspects can be found in the chapter Impacts on the neighbourhood in the subchapter
called Noise (figure 1). It is aimed at noise emissions from the building and a resulting disturbance of the
neighbourhood. As the relevant descriptor the emitted sound pressure level in dB(A) is suggested. In case the
assessment is based on a design, sound insulation and sound barriers should be examined for their potential to
contribute to control of noise emitted from the building.

4. Green Building Labels

Green Building Labels (GBLs) are voluntary, third party certification schemes which assess sustainability of
buildings with numerous indicators for ecologic, economic and social performance. They have the aim to assess how
well a building or a building project meets a specified set of sustainability aspects by developing a certification
system. Each of these aspects is addressed by various indicators and benchmarks. These certification schemes can be
seen as instruments to assess sustainability with a significant intrinsic marketing potential. Mainly high-class
buildings and lighthouse projects are certified for promotional purposes since certification is a complex process
causing additional costs. Each system takes the trinity of sustainability into account, but not all of them are already
in compliance with the European standards developed by CEN TC 350. The reason for this is that GBLs already
existed before related standards were finished or even before European Commission gave mandate to CEN/TC 350
[4] in 2004 to elaborate these kinds of standards. However, the process to adopt these standards by at least the
European labels seems to be on the way. Labels chosen for analysis are shown in table 2.

4.1. General characteristics of Green Building Labels

The international network of World Green Building Councils (WGBC) indicates at the time of investigation 100
members from Argentina to Zimbabwe [9], mainly national councils. Green building rating systems are constantly
evolving and differ from country to country, but fundamental principles persist from which the diverse methods are
derived: location, structure design efficiency, energy efficiency, water efficiency, materials efficiency, indoor
environmental quality, operations and maintenance optimization, reduction of waste and toxic substances and cost
efficiency. The aim of each label is the optimization of as many of these principles as possible.
1632 Franz Dolezal and Christina Spitzbart-Glasl / Energy Procedia 78 (2015) 1629 1634

In the last few years a shift away from qualitative approaches, towards a scientifically informed, quantitative
evaluation of performance through LCA can be determined. Though LCA, a technique to assess environmental
impacts, is widely recognized as the best way to evaluate environmental impacts, it is not yet part of all green
building labels. Nevertheless, at least European schemes already use LCA and provide their users with the required
databases, although exhaustive lists of building materials and constructions are still under development. Apart from
databases, calculation tools are made available as well. This shall make sure that data and methods are consistent in
order to get comparable results from diverse assessors and buildings. Since different building types require different
methods and aspects to consider, each GBL offers systems for several building categories.

Table 1. Selection of European and international Green Building Labels analysed. (Sources: [3, 10, 11, 12, 13, 14, 15])
BREEAM DGNB HQE LEED MINERGIE ECO TQB
Full title Building Research Deutsches Haute Qualit Leadership in - Total Quality
Establishments Gtesiegel Environne- Energy & Building
Environmental Nachhaltiges mentale Environmental
Assessment Method Bauen Design
Country of UK Germany France USA Switzerland Austria
origin
Established in 1990 2007 1996 1998 2006 2009
Responsible Building Research Deutsche Association U. S. Green MINERGIE sterreichische
organisation / Establishment Gesellschaft fr HQE Building public association Gesellschaft
company (BRE) former Nachhaltiges association Council fr
state-run but since Bauen - non-profit Nachhaltiges
1972 private association organisation Bauen -
consultancy association
Number of 7330 since 2008 691 (January Not available 35.202 (January 1113 (January 99 (March
buildings (January 2015) 2015) 2015) 2015) 2014)
certified

4.2. Impact of acoustic performance on Green Building assessment results

A critical review with focus on acoustic indicators leads to the conclusion that acoustic aspects influence results
of GBLs quite differently (figure 2). Usually indicators follow roughly already standardised descriptors. It is obvious
that benchmarks correspond to general noise protection levels in the particular country of origin of the GBL. Some
internationally oriented systems allow application of regional requirements.

5. Sound insulation and LCA - acoustic quality and environmental impact of building elements

Improved sound insulation is reflected directly in rating results, but it also has impact on the ecological quality of
a building. Measures lead to an increased amount of material with related environmental impacts. A case study on
typical walls illustrates the relation between environmental impact and acoustic performance. Starting with cross
laminated timber board (CLT, 1), an improvement of Rw can be reached by mounting a flexible shell filled with
mineral wool (2). In a further step (3), the shell is separated completely from the CLT element. In another variation
(4), insulation in the cavity is replaced by cellulose fibre, a recycling product. In addition (5), a concrete wall with
flexible shell is analysed to show different results for mineral structures. The LCA calculations reveal the
interconnection between acoustic performance and environmental impact of the different measures (figure 3).
 Franz Dolezal and Christina Spitzbart-Glasl / Energy Procedia 78 (2015) 1629 1634 1633

Fig. 2. Average and maximum possible impact of acoustic aspects on results of GBLs for new buildings:
Rating schemes for residential buildings (RB, SRB = small residential buildings, LRB = large residential
buildings) and non-residential buildings (NRB, OB = office buildings), * = not mandatory. (Sources: [16, 17,
18, 19, 20, 21, 22, 23, 24, 25])

The results of this brief case study show that a higher amount of layers in the structure usually improves acoustic
performance, but increases the environmental impact. However, simple measures such as an air gap without any
ecological impact can lead to higher sound insulations. Furthermore, results indicate that use of appropriate and
possibly renewable materials with smaller environmental impact such as cellulose insulation may improve credits for
ecological sustainability.

6. Conclusions

Sustainability in the construction sector is no longer reduced to low energy demand during use phase of a building
but includes a variety of indicators covering the whole life cycle. Moreover the definition of sustainability is
extended from ecology to further aspects of economic and social sustainability. All these aspects are already covered
by a set of voluntary, horizontal standards where acoustic quality of a building is seen as an important issue,
summarised under social building performance.
GBLs are voluntary, usually private, certification schemes for sustainability of buildings. They do not fulfil
mentioned standards. Nevertheless, each of them has its unique approach to building acoustics, usually strongly
related to the national regulations of the country of their origin. More ambitious certification schemes, usually
implemented in countries with advanced building acoustic standards, go beyond established standards.
The given example in this survey shows that efforts for higher acoustic quality of building components can have
impact on the ecological performance of the whole building and counterbalance advantages already gained in the
rating. Therefore, measures to improve sound insulation of a component always have to be considered
comprehensively. Opportunities for solid wood walls have been shown in the paper, but in general, application of
renewable materials with comparable properties can be seen as the easiest method to decrease ecological impact.
Harmonisation of GBLs cannot be expected in the medium term since this would lead to the loss of their unique
selling point. However, standards will be adopted by at least the European labels step by step. Acoustic aspects and
benchmarks wont be harmonised as long as there are no common standards for building acoustic quality in Europe.
This leads to the interesting situation, that an assessed building can be forced to fulfil the acoustic requirements of a
label which are more demanding than the national ones. Considering this, GBLs seem to provoke some kind of
movement and, in the best case, knowledge transfer about better sound insulation and noise protection in buildings.
1634 Franz Dolezal and Christina Spitzbart-Glasl / Energy Procedia 78 (2015) 1629 1634

Fig. 3. Environmental impact and acoustic performance of walls with different measures to improve sound
insulation, calculated for production (before use) phases A1-A3 according to EN 15978 [9] and converted
into an index with wall 1 (CLT only) as base value (1,00). GWP Process: global warming potential; AP:
acidification potential; EP: eutrophication potential; POCP: photochemical ozone creation potential; PE nr:
primary energy non-renewable; PE r: primary energy renewable ; Rw: sound reduction index.

7. References

[1] Kuittinen M et.al. (ed.). Wood in carbon efficient construction. CEI-Bois. Brussels 2013. ISBN: 978-9-0820-9080-2.
[2] Wittstock B, Albrecht S, Colodel CM, Lindner JP. Gebude aus Lebenszyklusperspektive - kobilanzen im Bauwesen. In: Bauphysik 31.
Ernst und Sohn (31), p. 917. Berlin 2009.
[3] Ebert T, Eig N, Hauser G. Zertifizierungssysteme fr Gebude. Nachhaltigkeit bewerten. Internationaler Systemvergleich. Zertifizierung und
konomie. Institut fr internationale Architektur-Dokumentation GmbH und Co-KG. Redaktion DETAIL. Mnchen 2010.
[4] Sinha A, Gupta R, Kutnar A. Sustainable development and green buildings. Drv. ind., 64(1): 45-53. 2013.doi: 0.5552/drind.2013.1205.
[5] sterreichisches Institut fr Baubiologie und -kologie. ECOSOFT 3.4.2: Software for the ecological assessment of building components and
buildings. http://www.ibo.at/de/ecosoft.htm, actual version: ECOSOFT 5.0, including IBO-database. Vienna 2012.
[6] Dolezal F, Mtzl H. ECO2/ecotimber Wood in sustainable constructions. Final report. FFG. Project 839368. Vienna 2013.
[7] EN 15978: 2012 Sustainability of construction works - Assessment of Environmental performance of buildings Calculation method.
European Committee for Standardisation.
[8] Lang J. Schallschutz in Europa. In: Bauphysik Kalender 2014: Raumakustik und Schallschutz. p. 121-182. Ernst & Sohn GmbH und Co. KG.
Berlin. 2014. ISBN: 978-3-433-03050-9.
[9] World Green Building Council (online). http://www.worldgb.org [Accessed on 15 January 2015].
[10] BREEAM (online). http://www.breeam.org/index.jsp, http://www.breeam.org/about.jsp?id=66, [Accessed on 15. January 2015].
[11] DGNB (online). http://www.dgnb-system.de/de/, http://www.dgnb-system.de/de/projekte/ [Accessed on 13. January 2015].
[12] HQE (online). http://assohqe.org/hqe/, http://www.behqe.com/hqe-in-the-world/cartography-of-projects [Accessed on 15. January 2015].
[13] LEED (online). http://www.usgbc.org/leed, http://www.usgbc.org/projects [Accessed on 15. January 2015].
[14] MINERGIE (online). http://www.minergie.ch/, http://www.minergie.ch/gebaeudeliste.html [Accessed on 15. January 2015].
[15] GNB (online). https://www.oegnb.net/, https://www.oegnb.net/zertifizierte_projekte.htm [Accessed on 13. January 2015].
[16] BREEAM UK New Construction. Technical Manual, SD5076: 2.0, 2014.
[17] DGNB Kriterium TEC1.2 Schallschutz fr Neubau Wohngebude, 2012, Upgarde 2013.
[18] DGNB Kriterium TEC1.2 Schallschutz fr Neubau Bro- und Verwaltungsgebude, 2012, Upgrade 2013.
[19] DGNB Kriterium SOC1.3 Akustischer Komfort fr Neubau Bro- und Verwaltungsgebude, 2012, Upgrade 2013.
[20] HQE Scheme Environmental Performance Non Residential Building. Certified by Cerway. 2013.
[21] HQE Assessment Scheme for Environmental Performance of Residential Buildings. Certified by Cerway 2014.
[22] LEED BD-C: Data Centers, v4. Acoustic performance (online). http://www.usgbc.org [Accessed on 15. January 2015].
[23] MINERGIE-ECO Vorgabenkatalog und Umsetzungsanweisungen. Kleine Wohnbauten (2011) Neubauten, 2014.
[24] MINERGIE-ECO Vorgabenkatalog und Umsetzungsanweisungen. Neubauten, Version 1.2, 2014.
[25] GNB sterreichische Gesellschaft fr Nachhaltiges Bauen Wohnbau 2010 W 2.2, 2014.
 Available online at www.sciencedirect.com
Available online at www.sciencedirect.com
ScienceDirect
ScienceDirect
Energy
Available
Available Procedia
online
online 00 (2017) 000000
atatwww.sciencedirect.com
www.sciencedirect.com
Energy Procedia 00 (2017) 000000
www.elsevier.com/locate/procedia
ScienceDirect
ScienceDirect
www.elsevier.com/locate/procedia

Energy Procedia
Energy Procedia 00
115(2017)
(2017)000000
5969
www.elsevier.com/locate/procedia
International Conference Alternative and Renewable Energy Quest, AREQ 2017, 1-3 February
International Conference Alternative and2017,
Renewable
Spain Energy Quest, AREQ 2017, 1-3 February
2017, Spain
Building a Green Home Using Local Resources and Sustainable
Building aTheGreen Home Using
15th International Local
Symposium Resources
on District Heating and Sustainable
and Cooling
Technology in Jammu Region A Case Study
Technology in Jammu Region A Case Study
Assessing the feasibility of using the heat demand-outdoor
temperature function for aAbhineylong-term
Guptadistrict
*
Abhiney Gupta*
heat demand forecast
* Asst. Prof., Department of Architecture & Landscape Design , Shri Mata Vaishno Devi University, Kakryal, Katra, J&K, 182320, India.
* Asst. Prof., Department ofa,b,c
I. Andri a a Mata Vaishno Devi
b University, Kakryal, Katra,
*, A. Pina , P. Ferro , J. Fournier ., B. Lacarrire , O. Le Corre
Architecture & Landscape Design , Shri c J&K, 182320, India. c

Abstract
a
IN+ Center for Innovation, Technology and Policy Research - Instituto Superior Tcnico, Av. Rovisco Pais 1, 1049-001 Lisbon, Portugal
Abstract b
Veolia Recherche & Innovation, 291 Avenue Dreyfous Daniel, 78520 Limay, France
c
Constructing aDpartement Systmes
green building is annergtiques
important et Environnement
step towards building - IMT Atlantique, 4 rue Alfred
an environment free Kastler, 44300impact
of negative Nantes,by
France
conserving and
Constructing
reducing usage a of
green building
natural is an important
non-renewable step Indias
resources. towardsGreenbuilding an environment
Building Council [IGBC]free ofhighlights
negative the
impact by conserving
fact that more than twoand
reducing
billion sq.usage
ft. of of natural non-renewable
registered green building resources. Indias
footprint exist Green[1].
in India Building Council [IGBC] highlights the fact that more than two
billion sq.Metros
ft. of registered
are workinggreen building
towards footprint exist
popularizing in India
the green [1]. movement and registering buildings for green certification.
building
AbstractMetros
Whereas, in smallare working
towns and towards popularizing
cities across India such theconcept
green building
is still in movement
its natal and registering
stage. With thebuildings for green
ever increasing certification.
population and
Whereas,
urbanization, in small towns and of
the requirement cities across India
affordable such concept
sustainable houses isisneed still of
in the
its natal
hour. stage. With the ever increasing population and
urbanization, Thisthe
District heating requirement
networks
research areof
article affordable
commonly
aims sustainable
addressed
at developing a greenhouses
in the is need
literature
residence ofastheone
in Jammu hour.
of the
city, wheremost
theeffective
concept ofsolutions for decreasing
sustainability is new. The the
greenhouse
research Thisgas
focuses research
on article
emissions
local from aims
resources atbuilding
developing
theavailable a green
sector.
and These
utilizing residence
systems
natural inrequire
Jammuefficiently;
resources city,investments
high whereestablishing
the concept of sustainability
whichgreen
are returned is new.
through
roofs, planting theThe
treesheat
to
research
control
sales. the focuses
Due overall ontemperature
to the local resources
changed climateavailable
and provide and utilizing
better
conditions air
andquality; natural
building resources
andrenovation
making efficiently;
an policies,
effort towards establishing
heat conserving
demand green
in the roofs,
resources planting
futureand treesthe
reducing
could to
decrease,
control
carbon the overall
foot
prolonging print. temperature
the investment returnandperiod.
provide better air quality; and making an effort towards conserving resources and reducing the
carbon
The mainfootscope
print. of this paper is to assess the feasibility of using the heat demand outdoor temperature function for heat demand
forecast.
2017 TheThe Authors.
districtPublished
of Alvalade,by Elsevier
locatedLtd.in Lisbon (Portugal), was used as a case study. The district is consisted of 665
2017
2017 The
buildings Authors.
Thethat
Authors. Published
Published by
by Elsevier B.V.
Peer-review undervaryresponsibility
in both of Elsevier
construction Ltd. and
the organizing
period committee
typology.of AREQ 2017.
Three 2017.
weather scenarios (low, medium, high) and three district
Peer-review
Peer-review under responsibility of the organizing committee
committee of of AREQ
renovation underscenariosresponsibility
were developedof the organizing
(shallow, intermediate, AREQ To
deep). 2017.estimate the error, obtained heat demand values were
comparedGreen
Keywords: withbuildings; Sustainable
results from a dynamicArchitecture;
heat demandWatermodel,
and Energy Conservation.
previously developed and validated by the authors.
Keywords:
The results Green buildings;
showed that Sustainable
when onlyArchitecture;
weather change Waterisand Energy Conservation.
considered, the margin of error could be acceptable for some applications
Introduction
1.(the error in annual demand was lower than 20% for all weather scenarios considered). However, after introducing renovation
Introduction
1.scenarios, the error value increased up to 59.5% (depending on the weather and renovation scenarios combination considered).
The value
Making of slopegreen
buildings coefficient
is needincreased
of the hour on average
as it is awithin the range
step towards theofmost
3.8%effective
up to 8% per decade,
optimal that corresponds
utilization to the
of land, energy
Making
decrease
and water buildings
inwhile
the numbergreenofisaheating
assuring need
leastofdisruptive
the hour
hours as
useit of
of 22-139h is anatural
step towards
during the thein
heating
resources most
the effective
season (depending
process optimal
of on theutilization
creating a healthyofenvironment.
combination land,
of energy
weather and
and water while
Itrenovation
promotes assuring
scenarios
conservation aofleast
considered). disruptive
On the other
perishable use of natural
hand,
non-renewable function resources
intercept and
resources in thealso
increasedprocess
for of creating
the7.8-12.7%
cost theadecade
and per healthy environment.
(depending
environmental on the
issues
Itcoupled
promotes scenarios). The values
conservation suggested could
of perishable be used to modify
non-renewable resources the andfunction
also parameters
the cost and for the
thescenarios considered,
environmental and
issues
improve the accuracy of heat demand estimations.

2017 The Authors. Published by Elsevier Ltd.

*
Correspondingunder
Peer-review Author Tel no.: +91-9419134708
responsibility of the Scientific Committee of The 15th International Symposium on District Heating and
*
Corresponding
E-mail address: Author
Cooling. Tel no.: +91-9419134708
abhiney.gupta@smvdu.ac.in
E-mail address: abhiney.gupta@smvdu.ac.in
1876-6102
Keywords:Heat
2017demand;
The Authors. Published
Forecast; Climatebychange
Elsevier Ltd.
1876-6102
Peer-reviewunder
2017responsibility
The Authors. of
Published by Elsevier
the organizing Ltd. of AREQ 2017.
committee
Peer-review under responsibility of the organizing committee of AREQ 2017.

1876-6102 2017 The Authors. Published by Elsevier Ltd.

Peer-review under responsibility of the Scientific Committee of The 15th International Symposium on District Heating and Cooling.
1876-6102 2017 The Authors. Published by Elsevier B.V.
Peer-review under responsibility of the organizing committee of AREQ 2017.
10.1016/j.egypro.2017.05.007
60 Abhiney Gupta / Energy Procedia 115 (2017) 5969
2 Abhiney Gupta/ Energy Procedia 00 (2017) 000000

associated with the processing and transport of these materials. A huge rise in the construction of green non-residential
buildings is observed. The most popular amongst them being office of the federal environmental executive [2],
Environmental Protection Agency (EPA) [3], U.S department of energy, [4], University Tower at The New School in
New York's Greenwich Village [5] etc. across the globe. However, it has been observed that the concept of green
architecture is still not so common among the masses due to lack of exposure and primarily because of human tendency
to follow rat race and go for fashionable lifestyle. Another major obstruction towards creating green buildings
especially homes is the layout and planning of cities and towns particularly in Indian scenario which does not cater
for the basic necessities like employing rain water harvesting techniques for the town, proper sewerage plants etc.
Live example that depicts total failure of even posh towns in metros becomes quite evident during monsoons when
we find water clogging everywhere leading to total chaos on roads resulting in huge traffic problem. Cities like
Mumbai, Delhi which in a way are far advanced and ahead in terms of planning, designing and research fall prey to
this menace. The problem is further aggravated by the pigeon-hole size cutouts for plots which are done by
municipality keeping in mind only the revenue generation aspect and not considering the sun movement, the flow of
air direction, proper plantation of towns etc. which are crucial in building green homes. The concept of green buildings
to create healthy and natural environment is further nullified as long as the residential houses are not designed keeping
in mind the green architecture as they constitute a huge percentage of built environment. If in future, architects and
engineers work together in framing municipal bye-laws with the prime focus towards developing green residences;
we can expect a huge conscious deliberation towards a healthy environment and human life.
This research article aims at developing a green residential house in Jammu region of J&K, India, using
indigenous materials readily available. Jammu is located at 32.73N 74.87E at an altitude of 327 m (1,073 feet) [16].
The city experiences sub-tropical climate with heavy monsoons from June to September. The temperature varies from
20 C. to 460 C. during extreme winters and summers respectively.

(a) Map of India [16] (b) Map of Jammu and Kashmir [16] (c) Terrain of Jammu and Kashmir [16]

Figure 1(a) to (c): Maps depicting Jammu district in the state of Jammu and Kashmir, India.

The research focuses on utilizing water, solar and other forms of resources efficiently; establishing green
roofs and planting trees to control the overall temperature of the house; enhancing indoor air quality using skylights,
well-connected corridors along with lawns and courtyards and above all an effort towards reducing the carbon foot
print.
The paper is structured as follows: In section II we discuss the exiting green buildings / houses existing in
India. Section III proposes the various concepts incorporated in designing a greenhouse for Jammu region using
readily available energy-efficient and eco-friendly materials. It further discusses the technicality, issues and the
drawings in conceptualizing this model. Section IV provides the conclusion.

2. Related Work

The concept of green buildings in early times was mainly with the perspective of designing commercial complexes;
 Abhiney Gupta / Energy Procedia 115 (2017) 5969 61
Abhiney Gupta/ Energy Procedia 00 (2017) 000000 3

but with the enormous benefits associated with it, the concept is aggressively been extended to planning towns, cities,
homes, etc. The concept of green architecture wherever deployed promotes sustainable development by avoiding
degradation of the environment and by preserving natural resources leading to create a healthy environment. This
section throws light on some of the important green buildings / homes developed in India in recent times.
Dhyanalinga, situated in Coimbatore, India, is the largest mercury based live linga in the world [6]. The
construction of Dhyanalinga [6] is in itself a marvellous piece of work, where a dome is built without using materials
like cement, steel and concrete but with burnt bricks, mud mortar stabilized with lime, sand alum and some herbal
additives. To eliminate steel and concrete, huge blocks of granite were used. It was designed by Sadhguru in
collaboration with Satprem (Auroville Earth Institute [13]). The elliptical dome is 76 feet in diameter and 33 feet high.
Literature reveals that twenty-eight ventilators are placed on the top of the lintel beams with stone slabs arranged in
the shape of the triangle so as to provide light and ventilation [6]. The central opening is covered by a gold plated
linga-shaped copper dome, which blocks direct light and acts as a ventilator at the top. The copper Linga above the
dome vents out hot air from the dome so that the cool air passes in through the vault and ventilators [6]. It is said that
the dome is designed in such a way that a life span of approximately 5000 years is expected.
The state government of Tamil Nadu allocated Rs.1,080 crore for construction of 60,000 houses in Madurai
district for construction of solar power green houses for the poor. The houses have been built by incorporating rain
water harvesting system where in the entire cost of the project was borne by the State government [7]. Each house has
five solar-powered CFL lights. The Rural development and Panchayat Raj took up the construction of houses with the
Tamil Nadu Energy Development Agency (TEDA) for providing the solar equipment [8].
VVIP circuit house shows 42.04 % reduction in energy consumption as compared to GRIHA benchmark [9].
To reduce the impact of building on natural environment, sustainable site planning was done by incorporating effective
measures to prevent soil erosion, employing effective storm water management using trenches, etc. Phytorid
technology based STP was installed for treating water for reusing it for landscape irrigation [9]. An additional 35 kL
of storage tank was installed to collect rainwater for use in the building [10]. The building is optimally oriented and
faade is designed such that the heat gain is minimised and daylight is maximised. Environmental performance index
(EPI) of the building is reduced to 89.16 kWh/m2 /yr from the benchmark EPI of 153.82 kWh/m2 /yr with the help of
high efficiency faade; optimizing artificial lighting and using high efficiency VRV system for air-conditioning [9].
Another example of green building can be seen in SIDBI Training Centre in Bhubaneswar showing 35.2%
reduction in energy consumption [11]. It focused on employing sustainable site planning by conserving fertile soil and
reusing site landscaped areas. For conserving water and for reducing the annual demand, the use of low flow flush
fixtures was made. Windows to wall ratio (WWR) was set to 16.2%. 93% of total living area is day-lit and meets
daylight factor as prescribed by National Building Code (NBC) [9]. Renewable energy technologies like solar photo-
voltaic (PV) panels of capacity of 12kWp were installed. Use of low energy materials can be seen through fly ash
bricks for block work; Portland Pozzolona Cement (PPC) for structural concrete; vitrified tiles, ceramic tiles and kota
stone for flooring; and mineral board and gypsum board for false ceiling [11].
New Administrative Building for Indian Railway Institute of Civil Engineering in Pune has 75% reduction
in energy consumption. Sustainable planning of the site was done by preserving existing trees and planting native
trees on site [12]. It made use of low flow fixtures to achieve 67% water consumption, deployed 100% waste water
treatment and made use of effective drip and sprinkle irrigation system [9]. It incorporate Passive Architectural Design
Strategies such as internal space planning to reduce heat gain in a regularly occupied space on each floor and shaded
atrium for better ventilation. Energy consumption was reduced by making use of high Solar Reflectance Index (SRI)
roof paint and 1.5 inch thick over deck insulation; using 14 inch thick fly ash double wall with 2 inch insulation. It
also focused on maximum utilization of daylight so as to minimize use of artificial light [9]. The internal lighting load
was further minimized by using T5 lighting fixtures and LEDs [9].
The various building design techniques discussed throw light on the fact that developing green buildings/
homes, do not cost extra. Simple methodologies when incorporated like orientation of the building, using indigenous
materials, conservation of natural resources, climate of the region, topography of the neighborhood along with
conventional wisdom can result in cost-effective as well as energy-efficient green buildings.
62 Abhiney Gupta / Energy Procedia 115 (2017) 5969
4 Abhiney Gupta/ Energy Procedia 00 (2017) 000000

3. Proposed Green House Concepts

Incorporating a technique like water conservation or using green materials, or for that matter effective utilization of
solar energy does not suffice a green building. For making a building green, a holistic view of adopting various features
has to be conceptualized and incorporated for proper amalgamation, which in a way is cost-effective as well as useful
to the mankind for achieving a healthy comfortable lifestyle. This section throws light on the various techniques/
methodologies adopted in designing a green home by effective space planning (with ground coverage 40%) and using
cost effective indigenous materials easily available in this region of the country.

3.1 Daylight harvesting:

Daylight harvesting is well taken in designing the building as it contributes majorly towards energy conservation. The
plot admeasuring 50x100 (width x depth) is aligned along North-South axis with 50 tilt towards East. The building
is set-out in a manner leaving sufficient set-backs in North, East and South directions. Large windows having width
of 7 feet have been proposed for bedrooms, kitchen and living room; which promote active daylight harvesting; the
absence of which would otherwise have left a heavy dependency on artificial lighting. Figure 2 and 3 show the layout
plans of ground floor and first floor respectively; indicating the sun movement and orientation of the building with
the building set-backs.

G1 = FRONT LAWN A= MAIN HOUSE (G.F)

G2 = SIDE GREEN B= BASEMENT OFFICE D= RENTAL ANNEXE
G3 = REAR COURT C= SERVANT QTR. E= MAIN HOUSE (F.F)

Figure 2: Ground Floor Plan showing space distribution along Figure 3: First Floor Plan showing space distribution
with green spaces around.
 Abhiney Gupta / Energy Procedia 115 (2017) 5969 63
Abhiney Gupta/ Energy Procedia 00 (2017) 000000 5

Most of these large-sized windows are facing north and east so as to avoid the harsh sun during summers. However,
special consideration has been given to protect wide windows along south or west either by planting shading trees
(P&Q in figure 4) or by designing deep verandahs (R in figure 4) and cantilever balconies (S in figure 5) for avoiding
the heat gain at daytime during summers. P and Q in figure 4 represent the position earmarked for planting trees as
natural shading devices to the west-facing window in the rear courtyard. R in figure 4 depicts the deep veranda
providing shade to the west-facing window, thus avoiding heat gain in the building during summers. Further, S in
figure 5 represents the cantilever balcony again used to protect the south-facing windows from direct heat gain.

Figure 4: Wide windows are protected by existing tree (Q) and Figure 5: Wide windows are also protected by cantilever balcony (S)
proposed tree (P) or by deep verandahs (R) proposed at site.

Figure 6(a) and 6(b) further reflect the special provision given in the master bed room on the first floor for
harnessing east sun through skylights in the form of ventilators. The significance of these ventilators lie in their ability
to harness early morning sun rays and also provide cross-ventilation, thus removing the hot polluted air from the room.
Figure 6(c) also indicates single ventilator which provides a source of ventilation (light and air) to the dark corridor
space in a well-defined manner, taking care of utility and architectural aesthetics.
64 Abhiney Gupta / Energy Procedia 115 (2017) 5969
6 Abhiney Gupta/ Energy Procedia 00 (2017) 000000

(a) (b)

Figure 6 (a) & (b): Section and view showing provision for harnessing east sun into the master bed room through skylight in the form of
ventilator.
CORRIDOR

MASTER BED
ROOM

(c) (d)

Figure 6(c) & (d): Light and air ventilation of dark corridor space done in a way keeping architectural aesthetics in mind.

Daylight is further harnessed by utilizing the solar energy through the use of solar water geyser. To cater to the need
of hot water in washrooms and kitchen; panel of solar water heaters are planted on roof to harness the solar energy
efficiently for hot water generation. Energy savings due to daylight harvesting are enormous because of substantial
daylight available throughout the year in this region of J&K. Solar water heaters are well placed along south-side for
maximum absorption of sunlight throughout the day. The efficacy of incorporating this feature is not only limited to
energy conservation but also in terms of cost due to heavy requirement of hot water during winters in the complex as
it caters to the need of office space, main house, tenant annexe and servant quarter.

3.2 Heating, Ventilating and Air-Conditioning (HVAC) system

The building is designed keeping in mind the concept of well-insulated structure wherein less heat is generated,
absorbed and simultaneously is well-ventilated to expel the indoor polluted air. Normally, HVAC systems are powered
 Abhiney Gupta / Energy Procedia 115 (2017) 5969 65
Abhiney Gupta/ Energy Procedia 00 (2017) 000000 7

by motors; however, in this case a proxy HVAC system is designed by making use of indigenous materials; green
building concepts and through proper ventilation. Setting up a motor able HVAC system is not desirable due to longer
power cuts; heavy power consumption and for subsequent carbon footprints. In the proposed model insulation to the
building is provided by making use of concrete bricks in a rat-trap fashion (figure 7) and by framing windows using
double glass with air insulation supported by un-plasticized ply-vinyl chloride (UPVC) frames which is a certified
green material [14]. Although, UPVC window frames are costlier than conventional hard wood frames but they have
an edge over them because of the ability to provide insulation, and when used with insulated walls (rat-trap) results in
considerable reduction in the usage of air-conditioners, thereby resulting in reducing the running cost. These are the
small efforts taken in the direction towards reducing carbon footprints.

Furthermore, to make the ventilating system effective, the building is oriented in North-South axis, with
connecting passages between different sections and connecting front lawns with side and back courtyards so as to
ensure proper engulfing of the building with greenery and achieving cross ventilation.

Figure 7: Air movement (SE-NW) on the ground floor showing cross ventilation of the rooms.

3.3 Green materials

Natural and waste materials such as stone tile for flooring; gravel, crushed rock and waste stone pavers etc. for
driveways and walkways [15] are extensively used in this project. Using scrap chipped off slate materials as shown in
figure-8 on the exterior of the building, besides increasing the aesthetic appearance; has enormous other benefits too.
Being natural, it emits no carcinogens or irritants. They have no emission of volatile organic compounds (VOCs) and

Figure 8: Waste slate been used on the exterior facade.

66 Abhiney Gupta / Energy Procedia 115 (2017) 5969
8 Abhiney Gupta/ Energy Procedia 00 (2017) 000000

hence are not hazardous. Such waste slate tiles; which are readily available as junk make the project cost-effective.
Cladding the exterior of building with such material facilitates easy and cheap maintenance as it avoids annual
painting.

UPVC frames have been used for windows and ventilators due to added advantage over conventional wooden
frames. These frames are certified green material which are light, strong, durable, water-resistant, termite-proof, and
dust-proof and need very less maintenance. Such UPVC frames are even hermetically insulated for effective sound
and heat insulation. Fly ash cement bricks made as per the BIS standards in India are more reliable and long lasting
than conventional clay bricks. Fly ash cement bricks are of uniform shape and size; hence do not require plaster on
the outer face of the building including boundary walls.

(a) (b)

Figure 9 (a) & (b): Arrangement of rat-trap technique with corner reinforcement for earth-quake resistance

The walls made by such bricks even consume less mortar as compared to locally available conventional B-class
clay bricks. Fly ash cement bricks even have high compressive strength compared to normal bricks leading to nearly
no wastage during transport and handling. Such bricks absorb very less water as compared to conventional bricks,
thus saving on money on water during construction. These fly ash bricks are further placed in rat-trap technique,
leading to considerable saving of 25% in bricks. The cavity induced in the brick wall helps in achieving thermal
insulation, resulting in coolness during summers and warmth during winters. The windows are fixed with insulating
glass consisting of two panes enclosing a hermetically-sealed air space; resulting in reduction of thermal gains and
losses. Such glass proves to be very effective in making the building cooler during summers by reducing heat gains;
and warm during winters by reducing thermal losses; thus maintaining the interior comfort level. Apart from thermal
insulation of the building, these glasses even insulate interiors from unwanted outside noise pollution.

Low volatile organic compounds (VOC) paints are considered over regular paints as they are environment friendly
and cause less toxic emissions. Such paints emit very less odour and do not affect the air quality, making them suitable
for home application. Low VOC paint of 80 grams of VOC/ litre of paint is used for the project in order to comply
with the green building standards. Although they are expensive than the conventional paints, but by using such paints
along with waste slate cladding on part of the facade considerably balances the overall cost of the exterior finishes.

Light emitting diode (LED) fixtures are used in the project as they are energy-efficient due to less electricity
consumption (15% of the energy used by halogen bulb) and have long life which proves to be cost-effective as far as
running cost is concerned. Such light fixtures also provide great output in terms of lumen and yet create less yet
making them cool to touch. Normally, LED light fixtures have a long life span of up to 80,000 hours, thus saving on
the maintenance cost of the lamp, which would have been used otherwise. Since LED lights have no filaments, they
can withstand great intensity of vibration and shock; making them quite durable. LED lights even operate at low
voltage, so their handling is easy during maintenance; and even prove eco-friendly due to absence of mercury or other
harmful gases, otherwise present.

3.4 Water Conservation

 Abhiney Gupta / Energy Procedia 115 (2017) 5969 67
Abhiney Gupta/ Energy Procedia 00 (2017) 000000 9

The proposed greenhouse model has both front and back lawns and also a section of roof being used for creating
roof garden. Besides giving aesthetics to the building, these green lawns also aid in providing purified fresh air and
good ventilation to the building. But maintaining of these lawns comes with a cost. Water is a natural resource but it
is in huge scarcity during summer seasons, especially in the region. Water conservation is crucial to maintain lush
green lawns throughout the year.

Conservation of water can be done by either judiciously utilizing water or by preserving the water from rain
during rainy season. Reduction in water consumption is achieved by making use of rain-water harvesting schemes and
utilization, primarily for watering the plants, maintaining the kitchen gardens and for flushing purposes. Thus, rain
water collection tank is made which collects roof water routed through rain water pipes only. Such collected rain water
is preserved for gardening purpose majorly during months when there is scarcity of water, due to less rainfall. Water
conservation is further achieved by making use of low discharge water fixtures from GROHE. Employing effective
rain water harvesting technique resulted in saving of water by up to 25%.

3.5 Roof garden

Roof garden is also an essential part of the house which has been developed keeping in mind its ecological
benefits. Besides providing natural habitat for wildlife and the aesthetic benefits associated with it; roof gardens
provide enormous temperature control for the upper floors of the house. The section of the roof selected for roof
garden is majorly flat roof and the roof gardening concept is supported on stands thereby maintaining air gaps in
between the planters and the roof. Sufficient circulation space is kept for maintenance of the plants and the planter
boxes are made out of the most economical stone available with minimum joints. These planters are providing shade
to the roof thereby reducing the effect of direct heat on the concrete slab.

Further, soft hedge arrangement is provided all along the balcony and terrace by providing cement troughs about
9 inches wide and 1 foot deep providing healthy arrangement for growth of ficus panda (shrub). Such arrangement
has been incorporated as an alternate to the conventional railing options. It also accounts for an added advantage in
reinforcing the green concept through visual impact and climatically.

Figure 10: Schematic section showing raised and Figure 11: Schematic section showing cement trough
removable roof planters for planting seasonal with ficus panda in the form of green railing
vegetables; thus providing shade and insulation to the
roof slab.

3.6 Building Insulation

68 Abhiney Gupta / Energy Procedia 115 (2017) 5969
10 Abhiney Gupta/ Energy Procedia 00 (2017) 000000

In any building, walls and roof constitute major portion of the exposed surface. As already discussed in section-
3.3, the walls of the building are designed by using rat-trap technology; thus achieving considerable thermal insulation.
Apart from walls, special consideration is given in providing roof insulation by using industrial thermocole sheets of
40 mm thickness and 25 kg/cu.cm. density, resulting in enormous heat insulation. Furthermore and as already
mentioned in section-3.3, window openings are fixed with UPVC frames with hermetically insulated glass, resulting
in building insulation in all respects.

3.7 Solar Energy harnessing

As already mentioned in section-3.1, the solar energy is very well harnessed in hot water generation. Glass tube
solar water heater is used for the project with twin-glass tube technology which is highly efficient with maximum
solar absorption by inner tubes. It has been noticed that solar water heating systems usually cost more to purchase and
install than conventional water heating systems. However, a solar water heater can usually save in the long run. On
average, there has been considerable drop of more than 70% in water heating bills around the year. Also, because the
sun is free, one is protected from future fuel shortages and price hikes.

4. Conclusion

This paper focused on the effort of using indigenous materials and resources in a way to make an energy-efficient
green building having minimum impact on the environment by reducing the heavy dependency on the consumption
of natural resources like wood, water etc. Using green materials like low VOC paint, hermetically insulated glass,
UPVC window frame, LED lighting system, etc. are costlier than the conventional materials readily available, but
they tend to save more on maintenance and running cost during its life time. Further, operating energy consumption
was reduced considerably by relying on solar energy for heating purposes; using rat trap bond for proper insulation;
and by effectively placing the windows for inflow of cool air in the building. Water consumption was reduced
considerably by making use of recycled rainwater for watering the plants and maintaining lawn and kitchen garden.
Special emphasis was given to the cross ventilation of the rooms including proper ventilation of bathrooms and
kitchen; orientation of these rooms also kept dust mites, mold growth and dampness away, which otherwise is very
common in Indian houses. The greenhouse designed is further low on maintenance as its construction involved
extensive use of natural and eco-friendly materials. This work is a step towards making my part of the world green
having minimum carbon footprint and to provide a healthy environment to its occupants by taking care of simple
needs of providing good ventilation, natural lighting and healthy surroundings.

References
[1] Azhar, S., Carlton, W. A., Olsen, D., & Ahmad, I. (2011). Building information modelling for sustainable design and LEED rating
analysis. Automation in construction, 20(2), 217-224.
[2] Howard, J. L. (2003). The Federal Commitment to Green Building: Experiences and Expectations. Federal Executive, Office Of The Federal
Environmental Executive, Washington.
[3] Kats, G. (2003). Green building costs and financial benefits (p. 1). Boston, MA: Massachusetts Technology Collaborative.
[4] Efficiency, E. (2009). Buildings energy data book. US Department of Energy. http://buildingsdatabook. eere. energy. gov/. John Dieckmann
is a director and Alissa Cooperman is a technologist in the Mechanical Systems Group of TIAX, Cambridge, Mass. James Brodrick, Ph. D.,
is a project manager with the Building Technologies Program, US Department of Energy, Washington, DC.
[5] Kibert, C. J. (2012). Sustainable construction: green building design and delivery. John Wiley & Sons.
[6] Mishra, S. P., Ali, S. M., Pradhan, A., Mohapatra, P., & Singh, V. (2013). Increasing energy efficiency in India by the use of green
building. International Journal of Renewable Energy Technology, 4(4), 406-415.
[7] Floor, V., & Maaligai, E. S. Government of Tamil Nadu.
[8] Sasikumar, N., & Jayasubramaniam, P. (2013). Solar energy system in India.Journal of Business and Management, 7(1), 61-68.
[9] Smith, R. M. (2015). Green building in India: a comparative and spatial analysis of the LEED-India and GRIHA rating systems. Asian
Geographer, (ahead-of-print), 1-12.
[10] http://www.teriin.org/files/green-tour-press-release.pdf
[11] http://www.sidbi.com/
 Abhiney Gupta / Energy Procedia 115 (2017) 5969 69
Abhiney Gupta/ Energy Procedia 00 (2017) 000000 11

[12] Pandit, B. D. N., Patankar, M., & Prem, M. A. (2010). Financing Eco-Housing in India: A Review. Housing Finance International
(Online), 25(2), 23.
[13] Maini, S. (2005). Earthen architecture for sustainable habitat and compressed stabilised earth block technology. The Auroville Earth Institute,
Auroville Building Center-India.
[14] "Injection molding process for unplasticized polyvinyl chloride." U.S. Patent 2,890,491, issued June 16, 1959.
[15] Foth, M., & Sanders, P. S. (2008). Impacts of social computing on the architecture of urban spaces. Augmented urban spaces: Articulating
the physical and electronic city, 73-91.
[16] http://www.mapsofindia.com/
 ScienceDirect
Energy Procedia 00 (2017) 000000
Availableonline
Available onlineatatwww.sciencedirect.com
www.sciencedirect.com
www.elsevier.com/locate/procedia

ScienceDirect
ScienceDirect
Energy
EnergyProcedia
Procedia122 (2017) 000000
00 (2017) 751756
www.elsevier.com/locate/procedia

CISBAT 2017 International Conference Future Buildings & Districts Energy Efficiency from
Nano to Urban Scale, CISBAT 2017 6-8 September 2017, Lausanne, Switzerland

Sustainability assessment
The 15th of a laboratory
International Symposium on Districtbuilding:
Heating and case study of
Cooling
highest rated laboratory
Assessing building
the feasibility in Singapore
of using using Green Mark
the heat demand-outdoor
temperature function for arating system
long-term district heat demand forecast
Sushanth Babua,*, Adrian Lamanoa, Priya Pawara
I. Andria,b,c*, A. Pinaa, P. Ferroa, J. Fournierb., B. Lacarrirec, O. Le Correc
a
Energy Research Institute @ NTU, RTP/BX-03, 50 Nanyang Drive, Singapore 637553, Singapore
a
IN+ Center for Innovation, Technology and Policy Research - Instituto Superior Tcnico, Av. Rovisco Pais 1, 1049-001 Lisbon, Portugal
b
Veolia Recherche & Innovation, 291 Avenue Dreyfous Daniel, 78520 Limay, France
c
Dpartement Systmes nergtiques et Environnement - IMT Atlantique, 4 rue Alfred Kastler, 44300 Nantes, France

Abstract
Abstract intensive buildings pose a distinctive challenge in sustainable building design, since they represent energy guzzling
Laboratory
spaces due to unique operation and energy demanding activities. Academic Block North (ABN), a laboratory intensive building in
District heating
Singapore begs to networks
differ fromarethis
commonly addressed in the
norm by demonstrating 42% literature as one compared
energy savings of the most to aeffective
buildingsolutions for based
constructed decreasing the
on code
greenhouse gas emissions from the building sector. These systems require high investments which are returned
standards. This paper highlights the process of sustainability assessment of ABN to achieve 126 points to go beyond Green Mark through the heat
sales. Due
Platinum to the for
standards changed climate conditions
a non-residential building. and
Suchbuilding renovation
an approach policies, can
and framework heatbedemand
applied in the future
to other couldto decrease,
buildings achieve
prolonging the investment return period.
higher energy efficiency and sustainability benchmarks.
The main
2017 Thescope of this
Authors. paper isby
Published to Elsevier
assess the feasibility of using the heat demand outdoor temperature function for heat demand
Ltd.
forecast.
2017 TheThe
Authors. Published
district of by Elsevier
Alvalade, locatedLtd.
in Lisbon (Portugal), was used as a case study. The district is consisted of 665
Peer-review
Peer-review under
under responsibility
responsibility of
of the
the scientific
scientific committee
committee of the
of the CISBAT
scientific committee
2017 of the
International CISBAT 2017 Future
Conference International
buildings that
Conference vary
Future in both construction
Buildings & Districts period
Energyand typology.
Efficiency Three
from Nanoweather
to scenarios
Urban Scale. (low, medium, high) andBuildings &
three district
Districts Energy
renovation Efficiency
scenarios from Nano(shallow,
were developed to Urban intermediate,
Scale deep). To estimate the error, obtained heat demand values were
comparedBuilding
Keywords: with results from aevaluation,
performance dynamic heat demand
Laboratory model,Energy
Building, previously developed
Efficiency, Indoor and validatedQuality,
Environment by the Sustainable
authors. building design,
The results
Green showed
Mark, Green that when only weather change is considered, the margin of error could be acceptable for some applications
Infrastructure
(the error in annual demand was lower than 20% for all weather scenarios considered). However, after introducing renovation
scenarios, the error value increased up to 59.5% (depending on the weather and renovation scenarios combination considered).
The value of slope coefficient increased on average within the range of 3.8% up to 8% per decade, that corresponds to the
decrease in the number of heating hours of 22-139h during the heating season (depending on the combination of weather and
renovation scenarios considered). On the other hand, function intercept increased for 7.8-12.7% per decade (depending on the
coupled scenarios). The values suggested could be used to modify the function parameters for the scenarios considered, and
improve the accuracy of heat demand estimations.
* Corresponding author. Tel.: +65-6592-3279; fax: +65-6694-6217.
2017 The Authors. Published by Elsevier Ltd.
E-mail address: sushanth@ntu.edu.sg
Peer-review under responsibility of the Scientific Committee of The 15th International Symposium on District Heating and
Cooling.
1876-6102 2017 The Authors. Published by Elsevier Ltd.
Peer-review under responsibility of the scientific committee of the CISBAT 2017 International Conference Future Buildings & Districts
Keywords: Heat demand; Forecast; Climate change
Energy Efficiency from Nano to Urban Scale.

1876-6102 2017 The Authors. Published by Elsevier Ltd.

Peer-review under responsibility of the Scientific Committee of The 15th International Symposium on District Heating and Cooling.
1876-6102 2017 The Authors. Published by Elsevier Ltd.
Peer-review under responsibility of the scientific committee of the CISBAT 2017 International Conference Future Buildings &
Districts Energy Efficiency from Nano to Urban Scale
10.1016/j.egypro.2017.07.391
752 Sushanth Babu et al. / Energy Procedia 122 (2017) 751756
2 Sushanth Babu et al. / Energy Procedia 00 (2017) 000000

1. Introduction

In order to address climate change and reducing CO2 emissions, Singapore has committed to reducing its emission
index by 36% from 2005 levels by 2030 [1]. As non-residential commercial buildings consume about 37% of the total
electricity [2], the building sector has a critical role in reducing the national energy consumption and carbon emissions.
Moreover, laboratory buildings are highly energy intensive due to their unique operation and energy requirements and
on an average end up using 5 to 10 times more energy per square foot than office buildings [3]. The main reason for
the high-energy consumption in laboratory facilities, is the requirement to provide high ventilation rates and the
associated air conditioning loads.
Being a leading advocate for green buildings, Singapore has set up an ambitious target of having 80% green
buildings by 2030 [4]. Spearheading this movement is the Green Mark (GM) green building rating scheme, launched
in 2005 to provide a platform to asses and improve the overall environmental credentials of buildings. Although the
GM scheme was launched more than two decades ago, little has been publicized in literature, especially with regards
to the building performance results while compared to more popular green building rating scheme like LEED which
have been studied in detail [5] [6] [7] [8] [9]. There has been sporadic mention of GM in studies that compare the
assessment criteria between different green building rating schemes [10] [11] and an assessment of the awareness of
GM rating scheme by the occupants of the GM building as well as general public [12]. In this study, the results of
using GM as a sustainability assessment criterion for a real building located in Singapore is highlighted.

2. Case Study

The case study building is located at the Nanyang Technological University (NTU) campus in Singapore, and is
surrounded by four existing buildings as shown in Figure 1. The building is a seven-story academic building with a
Gross Floor Area (GFA) of 29,578 m2. More details of this building can be found in Table 1. This building is a multi-
tenanted, laboratory intensive building. It is estimated to allocate 70% of the occupied space as laboratory spaces and
the rest as office spaces.

Table 1: Project brief

Site Area 5,742 m2

Location 61 Nanyang Drive, Singapore 637335
GFA 29,578 m2
Building Footprint 4,942 m2
No. of Floors 7
Building Height 30.95 m
Building Orientation North

Figure 1: Building Site Plan

The project team conducted design charrettes with the major stakeholders of the building to establish key project
performance indicators based on the GM assessment criteria. Based on these performance indicators, technology
recommendations were made to achieve these targets. For a more realistic understanding of the amalgamation of the
technologies and performance, building modelling and energy simulations were performed. Finally, the design was
developed via an iterative process to review the existing technology recommendations and results of the simulations.
These changes led to achieving the requirements of the GM assessment criteria.
In the assessment of ABN, the BCA GM for New Non-Residential Buildings (Version NRB/4.1) is considered. To
achieve a GM Award, the prerequisite requirements in different GM Rating sections must be fully obtained according
to the new non-residential building criteria [13]. ABN in its aspiration to strive for higher energy savings qualified for
the GM Incentive Scheme Design prototype (GMIS-DP) for which the building targeted to achieve beyond GM
Platinum; and demonstrate energy savings of at least 40% better than current base code or equivalent [14]. This scheme
 Sushanth Babu et al. / Energy Procedia 122 (2017) 751756 753
Sushanth Babu et al. / Energy Procedia 00 (2017) 000000 3

ensures that the energy efficiency goals of the target building are established quite early in the design stage and hence
better performing buildings can then be designed via iterative simulations by the Environmentally Sustainable
Designers (ESD) consultants. The team from Energy Research Institute @ NTU (ERI@N) were the designated ESD
consultants for this project driving the sustainability design of the project.

3. Results and discussion

The building scored an impressive 126 points out of the total 190 points as summarized in Table 2 and successfully
surpassed the requirements of the various benchmarks in GM assessment criteria as shown in Figure 2. The following
sections discuss these results in detail.

Table 2: Points summary for ABN

Scored
Section Number Criteria Available Points Minimum Points
Points
1 Energy Efficiency 116 30 83

2 Water Efficiency 17 10

3 Environmental Protection 42 24
20
4 Indoor Environmental Quality 8 5

5 Other Green Features 7 4.5

TOTAL 190 50 126

Figure 2: ABN GM score comparison with GM rating requirement

3.1. Energy Efficiency

3.1.1. Thermal performance of building envelope

This section assesses the thermal performance of the building envelope based on the Envelope Thermal Transfer
Value (ETTV) [15] based on the guidelines provided by the BCA. Based on passive design features of the building
which include, but are not limited to using a low-e double glazed unit (U value : 1.6 Wm2K; SC : 0.30; VLT : 0.40) ,
employing shading devices, use of cool paints (U Value : 0.73 Wm2K) and low window to wall ratio (0.198), some of
which are highlighted in Figure 3(a) the building achieves an ETTV of 18.3 W/m2 [16] compared to a baseline of 50
W/m2 (12 points).

3.1.2. Air conditioning system

The building utilizes innovative cooling strategies like passive displacement cooling in offices in which the air
movement relies on natural convection instead of the fan power, high efficient HVAC equipment as well as control
754 Sushanth Babu et al. / Energy Procedia 122 (2017) 751756
4 Sushanth Babu et al. / Energy Procedia 00 (2017) 000000

strategies, use of heat pipe to dehumidify the air without the use of additional energy finally leading to a design system
efficiency of 0.57 kW/RT compared to baseline of 0.70 kW/RT.

Figure 3: (a) Contributing factors to low ETTV (b) Building Integrated Photo-Voltaics (BIPV) canopy

Apart from this, permanent measuring instruments to monitor chilled water efficiency, provision of variable speed
controls for chilled water pumps and cooling tower fans for better part-load plant efficiency, as well as, sensors to
regulate outdoor air flow rate to acceptable limits of indoor CO 2 concentration, are provided at ABN for continuous
monitoring by the facilities team (42 points). A summary of simulated energy performance results is shown in Table
3.

Table 3: Simulated energy performance and savings of ABN [17]

Description Reference Model (a) Proposed Model (b) Savings (c) = (a)-(b) Improvement (c)/(a)
kWh kWh kWh
Lighting (AC) 946,665 428,940 517,725 54.7%
Lighting (NON AC) 401,525 110,698 290,827 72.4%
Air-Conditioned Plant 2,358,983 1,364,855 994,128 42.1%
Air System Fans 576,991 305,236 271,755 47.1%
Heat Pump 865,129 - - -
MV Fans 84,884 62,716 22,168 26.1%
Lifts 57,065 46,223 10,842 19.0%
Receptacle Equipment 1,767,075 1,767,075 0 0.0%
Domestic Water Systems 9,984 9,984 0 0.0%

Total 7,068,300 4,095,725 2,972,575 42.1%

Power Generation (PV) 145,728.00 -

Overall Savings (%) 3,949,997 44.1%

Energy Efficiency Index
286.64 184.15
EEI (kWh/m2/year)
 Sushanth Babu et al. / Energy Procedia 122 (2017) 751756 755
Sushanth Babu et al. / Energy Procedia 00 (2017) 000000 5

3.1.3. Daylighting and artificial lighting

At least 80% of the building common areas (corridors) are daylit (0.5 points). Extensive use of energy efficient
LED lights, decoupled task and ambient lighting, as well as, motion sensors lead to energy savings of 56.6% over
code compliant baseline building (12 points).

3.1.4. Common areas ventilation, lifts and energy efficient practices and features
The design team utilized computational fluid dynamics simulations to design naturally ventilated staircases and lift
lobbies and mechanical ventilation in toilets and corridors [16]. The lifts are Variable Voltage and Variable Frequency
Drive (VVVFD) lifts with sleep mode to conserve energy during periods of non-usage. Energy efficient features like
use of heat pipes, sun pipes in toilets contribute as energy efficient practices (15 points).

3.1.5. Renewable energy

The building BIPV on the canopy shown in Figure 3 (b) and it is estimated that 2.73% of energy consumption of
the building may be replaced by the renewable solar energy generated (13.6 points).

3.2. Water efficiency

Water efficiency of the building is ensured by using Water Efficiency Labelling Scheme (WELS) certified fittings.
The building also has provision for water meters to monitor major water usage and all these meters are linked to the
BMS for leak detection. In order to reduce the use of potable water for cooling purpose, the cooling water treatment
system achieves minimum 7 cycles of concentration at acceptable water quality (9.5 points).

3.3. Environment protection

This section encourages projects to adopt building design, construction practices and materials that are sustainable.
ABN uses recycled concrete aggregate and has a low concrete usage index of 0.45 (5 points). The building also uses
environmentally friendly products like modular green roof tray, drainage mats, water proofing membrane, carpet
flooring, autoclaved aerated concrete blocks, pre-cast lightweight concrete panels, acoustic and green labelled ceiling
boards, composite timber flooring, vinyl flooring, green labelled external paint system, partition wall system and
rockwool insulation. All of these products are certified by approved local certification body and are applicable for
non-structural building components and construction garnering 4.75 points in this section. The building uses extensive
greenery to achieve a Green Plot Ratio [18] of 3.82 (5 points). The project team has good environmental credentials
and follows good environmental management practices like providing a building user guide and provision for facilities
and recycle bins for storage of segregated recycled waste (5.25 points). Apart from this, the building is easily
accessible to bus stops and has provision for covered walkway to facilitate connectivity and use of public transport (2
points). ABN commits to use refrigerants with 0 ozone depletion potential and a refrigerant leak detection system at
critical areas of plant rooms containing chillers and other equipment (2 points).

3.4. Indoor environmental quality

The occupied spaces of the building are designed with good ambient sound levels as recommended in SS553 (1
point). The building is designed to reduce indoor air pollutants by opting for low VOC paints and environmentally
friendly adhesives (2 points). High frequency ballasts are used in luminaires (1 point).

3.5. Other green features

ABN adopts a demolition protocol to ensure at least 35% of crushed concrete waste was sent to approved recyclers
with proper facilities (2 points). ABN also caters for a siphonic rain water discharge system at roof (1 point). Apart
from these features, a live building performance dashboard for tenants and visitors was installed so as to educate the
users and visitors of the building to its energy saving and sustainability features, especially since the majority of the
users would be students (0.5 point). An automated fumehood control has been adopted in the laboratories which uses
756 Sushanth Babu et al. / Energy Procedia 122 (2017) 751756
6 Sushanth Babu et al. / Energy Procedia 00 (2017) 000000

a motion sensor to automatically close the sash when not in use. This helps in conserving energy from the fumehoods
when not in use (0.5 point).

4. Conclusion

The case study of ABN highlights the methodologies and innovations within the sustainability assessment
framework of GM to help deliver a high performance and sustainable green building. This sustainability assessment
framework is a key driver for improving energy efficiency, water efficiency, environmental protection, indoor
environmental quality and other green features in a building. Moreover, achieving a high rating in sustainability
assessment schemes can also contribute to transparency in energy use in buildings and educate the users of their
contribution to reduced energy consumption and CO2 emissions. Further study may be done in understanding the
actual performance during the measurement and verification stage of the building to understand the gaps of the current
assessment. An assessment scheme for laboratory buildings could be developed in the future based on these learnings.

Acknowledgements

We would like to acknowledge BCA and ODFM (Office of Development & Facility Management, NTU) for co-
funding this project via BCAs Green Mark Incentive Scheme Design Prototype (GMIS DP). The various
sustainable designs were done by the consultants, namely ADDP Architects, Squire Mech Pte Ltd and AECOM
Singapore Pte Ltd under the leadership of ODFM. ERI@N did the simulations studies for sun path, daylight analysis,
natural ventilation analysis, building energy modelling and laboratory & office electrical load measurement. Finally,
we would also like to acknowledge the other members of the research team at ERI@N, specifically, Mr. SESHADRI
Bharath, Mr. SAPAR Majid Bin Haji, Ms. WU Xiaoying and Ms. ZHOU Jian for their contributions to the project.

References
[1] Singapore's Government. Singapores intended nationally determined contribution (INDC). 3 July 2015. 05 March 2017.
http://www4.unfccc.int/ndcregistry/PublishedDocuments/Singapore%20First/Singapore%20INDC.pdf.
[2] Energy Market Authority. Singapore Energy Statistics 2016. June 2016. 05 January 2017.
https://www.ema.gov.sg/cmsmedia/Publications_and_Statistics/Publications/SES/2016/Singapore%20Energy%20Statistics%202016.pdf.
[3] U.S. Environmental Protection Agency . Laboratories for the 21st Century: An Introduction to Low-Energy Design . Aug 2008. 05 March
2017. http://www.i2sl.org/documents/toolkit/epc_3-0_508.pdf.
[4] Building Construction Authority (BCA). 3rd Green Building Masterplan. Sept 2014. 5 March 2017.
https://www.bca.gov.sg/GreenMark/others/2nd_Green_Building_Masterplan.pdf.
[5] Peng W, Chao M, Jun W, Yongze S, Xiangyu W. A decade review of the credits obtained by LEED v2.2 certified green building projects.
Building and Environment 2016; 102: 167178.
[6] Yamany S.E, Afifi M, Hassan A. Applicability and Implementation of U.S. Green Building Council Rating System (LEED) in Egypt (A
Longitudinal study for Egyptian LEED Certified Buildings). Procedia Environmental Sciences 2016; 34: 594604.
[7] Altomonte S, Schiavon S. Occupant satisfaction in LEED and non-LEED certified buildings. Building and Environment 2013; 68: 6676.
[8] Boarin P, Guglielmino D, Pisello A.L, Cotana F. Sustainability Assessment of Historic Buildings: Lesson Learnt from an Italian case Study
through LEED Rating System. Energy Procedia 2014; 61: 1029-1032
[9] Hua C, Lee W.L. Energy assessment of office buildings in China using LEED 2.2 and BEAM Plus 1.1. Energy and Buildings 2013; 63:
129137.
[10] Xiaosen H, Yu A. T.W, Zezhou W. A comparative analysis of site planning and design among green building rating tools. Journal of
Cleaner Production 2017; 147: 352-359.
[11] Kamaruzzaman S.N, Lou E.C.W, Zainon N, Zaid N.S.M, Wong P.F. Environmental assessment schemes for non-domestic building
refurbishment in the Malaysian context. Ecological Indicators 2016; 69: 548-558
[12] Bozovic-Stamenovic R, Kishnani N, Tan B.K, Prasad D, Faizal F. Assessment of awareness of Green Mark (GM) rating toolby occupants
of GM buildings and general public. Energy and Buildings 2016; 115: 55-62.
[13] Building Construction Authority. BCA Green Mark for New Non-Residential Buildings Version NRB/4.1. Jan 2013. 05 March 2017.
https://www.bca.gov.sg/GreenMark/others/gm_nonresi_v4.1.pdf.
[14] Building Construction Authority. BCA GMIS-DP. 2015. 05 March Oct. https://www.bca.gov.sg/greenmark/gmisdp.html.
[15] BCA. Code on Envelope Thermal Performance for Buildings. 2008. 09 April 2017.
https://www.bca.gov.sg/PerformanceBased/others/RETV.pdf
[16] Pawar P, Wu X, Babu S. Passive Design Integration in High Performance Lab Intensive Building in the Tropics. 15th International
Conference on Sustainable Energy Technologies SET. Singapore, 2016.
[17] Lamano A, Zhou J, Babu S, Pawar P. Scientific planning and support initiative for laboratory intensive building: a case study in singapore.
International Joint Conference 2nd ICEA & 17th SENVAR. Surabaya, Indonesia, 2017.
[18] Ong, B.L. Green plot ratio: an ecological measure for architecture and urban planning. Landscape and Urban Planning 2003; 63.4: 197-211.
 Available online at www.sciencedirect.com

ScienceDirect
Procedia - Social and Behavioral Sciences 101 (2013) 120 129

AicQoL2013 Langkawi
AMER International Conference on Quality of Life
HolidayVillaBeach Resort & Spa, Langkawi, Malaysia, 6-8 April 2013
"Quality of Life in the Built and Natural Environment"

Achieving Sustainable Development: Accessibility of green

buildings in Malaysia
Chua Fuh Yiing*, Naziaty Mohd Yaacob, Hazreena Hussein
University of Malaya, Faculty of Built Environment, Department of Architecture, Kuala Lumpur 50603 Malaysia

Abstract

Both Universal Design (UD) and Green Building Design (GBD) aim to achieve sustainability in the built
environment. In Malaysia, the introduction of Green Building Index (GBI) is a reinforcement of GBD agenda
although not made mandatory to comply. At the same time, the Persons With Disabilities Act 2008 Malaysia (PWD
Act) promotes strongly UD. Both the GBI and PWD Act are in support of Sustainable Development (SD) in terms of
environmental protection and social equity, respectively. This study provides a critical analysis of how these two SD
instruments are either being corroborated or compromised or complemented through the practice of providing
accessibility to PWDs in green buildings.

2013
2013TheTheAuthors.
Authors. Published
Published Ltd. Open
by Elsevier
by Elsevier Ltd.access under CCand
Selection BY-NC-ND license.under responsibility of the Association of
peer-review
Selection
Malaysian and/or peer-review under responsibility
Environment-Behaviour of the Association
Researchers, AMER (ABRA of Malaysian Environment-Behavior Researchers,
Malaysia).
AMER (ABRA malaysia).
Keywords: Accessibility; green building; sustainable development; universal design

1. Introduction

For more than forty years, SD has dominated the global environmental discourse and guiding
ecosystem protection (Walsh, 2004; EPA, 2008). SD is interpreted and promoted by the initiatives of
Health Building, Green Building Congress, Sustainable Building International Conference and
Sustainable City International Conference, where SD and human health are the global development goal,
constructa balance
between"sustainability","green" and"healthy" SDenvironment (Chiang, 2005). It can be problematic,
however, if there is no connection between a sustainable building and its accessibility, including safety

*
Corresponding author. Tel.: 016-2335202.
E-mail address: fuhyiing@siswa.um.edu.my.

1877-0428 2013 The Authors. Published by Elsevier Ltd. Open access under CC BY-NC-ND license.
Selection and/or peer-review under responsibility of the Association of Malaysian Environment-Behavior Researchers, AMER (ABRA malaysia).
doi:10.1016/j.sbspro.2013.07.185
 Chua Fuh Yiing et al. / Procedia - Social and Behavioral Sciences 101 (2013) 120 129 121

and usability by all people (Walsh, 2004; Tay, 2011). The study focuses on the accessibility of the built
-Year
Development Plans. A review of Malaysia legislative, regulative mechanisms and policies in the
literature review showed gaps identifying the lack of designing and constructing accessibility for human
needs and an imbalance in adopting policies separating accessibility from sustainability. Using case

2. Literature review

2.1. Sustainable Development (SD): national plans, legislation and policies

SD ensures the well-being of humans by integrating social equity, economic viability, and
environmental conservation and protection.According Agyeman (200),Pinfield (1997),Redclift(1987)
andCampbell(1996), SD addresses three vital areas:
People living today are entitled to justice and equal rights
Environmental degeneration must be eliminated
Future generations must not be impoverished as a result of current actions
SDconcept was adoptedin Malaysia during the 1992 NGO Forum for RioC10 Malaysia - Chapter of 40
of Agenda 21. Planning byMalaysia constitutes a National Plan where SD was outlined as one of the
goals (see Tables 1 and 2).Table 1 shows that accessibility was introduced much later in the Tenth

mentioned only in general regarding infrastructure. The Town and Country Planning Act included
sustainable development as shown in Table 2.

Table 1.

Malaysian Plan Key Emphasis

Seventh Malaysia Plan SD
(1996-2000)
Eighth Malaysia Plan SD of energy resources and renewable.
(2001-2005)
Ninth Malaysia Plan SD covering social, economic and environmental aspects.
(2006-2010)
Improvingaccessibility to and within the country, enhancing transportation links and communication
services and internet at entry points.
Tenth Malaysia Plan Improving the standard and sustainability of quality of life through better access to healthcare, public
(2011-2015) transport, electricity and water.
AFFIRM framework (Awareness, Faculty, Finance, Infrastructure, Research and Marketing) was
established to promote the implementation of SD in the construction industry. Green building as part
of SD is a better future for next generations (Sood et al.,
2011).
122 Chua Fuh Yiing et al. / Procedia - Social and Behavioral Sciences 101 (2013) 120 129

Table 2. Planning legislation that referred to SD in Malaysia

Legal Regulation Remarks

Town and Country Section 2A (2) National Physical Planning Council. The functions are to promote the framework of
Planning Act 1976 the national policy, town and country planning as an effective and efficient instrument for the
(Act 172) improvement of the physical environment and towards achieving theSD

Section 8 (3) The statement is to formulatethe policy and general proposals of the State Authority,
respecting the development and use of land, including improvement measures of the physical living
environment, communications, traffic management, socio-economic well-being and the promotion of
economic growth, and for facilitating SD.

(4) In formulating the policy and general proposals under paragraph (3)(a), the State Director shall
secure that the policy and proposals are justified by the results of his survey under section 7 and by
any other information that he may obtain, and shall have regards to current policies respecting the
social and economic planning and development and the environmental protection of the State and the
nation.

Table 3. National policy on the environment and technology in Malaysia

National Policy Key Emphasis

National Policy on the
Economic, social and cultural progress through environmentally SD
Environment (2002)
SD
Energy: seek to attain energy independence and promote efficient utilization
National Green
Environment: conserve and minimize the impact on the environment
Technology (2009)
Economy: enhance the national economic development through the use of technology
Social: improve the quality of life for all

Table 3 shows that the national policies in green environment and technology was created and

2.2. Green Building (GB)

US Green Building Council states the function of GB is to significantly reduce or eliminate the
negative impact of buildings on the environment and the building occupants (LEED, 2004). Golstein
(2011) further elaborated that GB is designed for economic and environmental performance, considering
the local climate and cultural needs, and providing for the health, safety and productivity of its occupants.
In Malaysia, the Green Building rating system - Green Building Index (GBI) was launched in May
2009, corresponding to the national policies on the environment and technology (Table 3). The GBI was
designed based on other international rating systems such as BREEAM (Building Research Establishment
Environmental Assessment Method) a
Design). The GBI defines GB as to focus on increasing the efficiency of resource use (energy, water and
materials) while reducing building impact on human health and the environment through better sitting,
design, construction, operation, maintenance and removal . Table 4 compared the different countries

in many countries. However, in Malaysia in 2005, the

 Chua Fuh Yiing et al. / Procedia - Social and Behavioral Sciences 101 (2013) 120 129 123

Table 4. Breakdown of different categories in therating systems

Name of BREEAM LEED Green Star Green Mark GBI

Rating Tools
Origin & years UK, 1990 US, 1993 Australia, 2003 Singapore, 2005 Malaysia, 2009
introduced
Categories Energy use Energy and Energy Energy efficiency Energy efficiency
atmosphere
Transportation Transport Water efficiency Indoor
Water Water efficiency Water Environmental environmental
quality (IEQ)
Ecology Sustainable Sites protection
Materials and Indoor Sustainable Site
Land Use and management
resources environmental
Materials quality (IEQ) Materials and
Indoor
Pollution resources
environmental Innovation
Health and well quality (IEQ) Water efficiency
being Innovation
Developer Building Research United States Green Building Building and Green Building
Establishment (BRE) Green Building Council of Construction Index SdnBhd
Council (USGBC) Australia Authority (BCA)
(GBCA)

2.3. Accessibility and Universal Design (UD): definitions and building regulations

The built environment should be designed to cater for Persons with Disabilities (PWD) to promote
universal accessibility. PWDs are persons who have long term physical, mental, intellectual or sensory
impairments, which in interaction with various barriers may hinder their full participation in society. The
seven principles of UD (see Table 5):

Table 5. UD Principles (Center for Universal Design, North Carolina State University, 1997)

Principle Design description

Equitable use
Flexibility in use
Simple and intuitive use
Perceptible information
Tolerance for error
Low physical effort
Size and space for approach
and use
Useful and marketable to people with diverse abilities
Accommodates a wide range of individual preferences and abilities
Easy to understand, regardless of the user's experience, knowledge, language skills, or
concentration level
Communicates information effectively to the user, regardless of ambient conditions or the
user's sensory abilities.
Minimizes hazards and the adverse consequences of unintended actions.
Used efficiently, comfortably and with a minimum of fatigue.
Appropriate size and space for approach, reach, manipulation and use regardless of the user's
body size, posture or mobility.
124 Chua Fuh Yiing et al. / Procedia - Social and Behavioral Sciences 101 (2013) 120 129

Table 6. Regulative instruments of accessibility in Malaysia.

Legal Regulation Year Key words / phrases quoted

Act:
Street, Drainage 1991 Section 3 Interpretation
and Building Act
1974 (Act 133) accessible to a street or back lane or where the owner of the premises by himself or his tenant
has the right to use or commonly does use the street or back-lane as a means of access to or
drainage from the premises.
Section 9 (7b) Private persons making new streets
Any person without the permission in writing of the local authority plants any hedge in such
manner that any part thereon is in any direction less than twenty feet from the centre of the
carriageway of any street, not being a public street, or less than forty feet from the opposite side
of any road or path which is used or intended to be used as the means of access to two or more
houses exclusive of the width of any footway which the local authority requires should be liable

the application of the local authority, make a mandatory order against the offender.
Section 12 Declaration of public streets
Where street works have been executed to the satisfaction of the local authority under this Part
in respect of a private street, which is not less than forty feet wide, then on the request in any
other case, of the several frontagers of such private street or part of a private street as together
have an annual value of more than fifty per centum of the total annual value of the premises
fronting on, adjoining, abutting on or adjacent or accessible to such private street or part of the
private street, as the case may be.
Town and Country 1995 Section 21. Application for planning permission
Planning Act 1976 (3) Where the developer involves the erection of a building, the local planning authority may
(Act 172) amended give written directions to the applicant in respect of any of the following matters, that is to say
act 1995 (Act A the owner of the premises by himself or his tenant has the right to use or commonly does use the
933) street or back-lane as a means of access to or drainage from the premises.
PWD Act 2008 2008 Section 2. Interpretation
(Act 685)
usable by all people, to the greatest extent possible, without the need for adaptation or
specialized design and shall include assistive devices for particular groups of PWD where this is
needed.
Part IV. Promotion and development of the quality of life and wellbeing of PWD. Chapter 1
Accessibility.
Section 26 Access to public facilities, amenities and services and buildings.
PWD shall have the right to access to and use of, public facilities, amenities, services and
buildings open or provided to the public on equal basis with persons without disabilities, but
subject to the existence or emergence of such situations that may endanger the safety of PWD
For the purposes of subsection (1), the Government and the providers of such public facilities,
amenities, services and buildings shall give appropriate consideration and take necessary
measures to ensure that such public facilities, amenities, services and buildings and the
improvement of the equipment related thereto conform to universal design in order to facilitate
their access and use by PWD
Section 27 Access to public transport facilities
Section 28 Access to education
Section 29 Access to employment
Section 30 Access to information, communication and technology
Section 31 Access to cultural life
Section 32 Access to recreation, leisure and sport
Rule:
Uniform Building 1991 By-Law 34A(1)
By-Law 1984 By All public buildings shall provide with access to enable disable persons to get into, out of and
Law 34A(1) within the building & be designed with facilities for used by disabled persons. The requirements
Amended in 1991 of this by-law shall be complied with MS 1184 and MS 1183.

2005 By-Law 35. Access from a street.

Every building to be erected on a site which does not front a street shall have access from a
street and the means, nature and extent of the access shall be in accordance with a layout plan
approved by the competent planning authority or the local authority.
 Chua Fuh Yiing et al. / Procedia - Social and Behavioral Sciences 101 (2013) 120 129 125

In Malaysia, regulative instruments that promote UD and accessibility for PWDs have existed since
1990 with the adoption of Malaysian Standards, and in 2008, the PWD Act was enacted (Table 6). A
comparative analysis of the building regulations and legislation against the general PWD Act showed

After UD was defined in the PWD Act in 2008, this in turn influenced the policies in Malaysia after
the establishment of the PWD Act (Yaacob, Hashim, 2010, 2010a). Before 2008, the use of the word
r interpretation by the architect, and it was stated

Building By-
modif
The incorporation of UD in the PWD Act paved a way to combine and make SD policies in Malaysia
to be clearer in the implementation aspects for Currently, the Malaysian
example could be contrasted with the City of Columbus and Franklin (USA), where the establishment of
the AWARE Manual for Sustainable Accessible Living incorporated GB and UD in Sustainable Rating
System (City of Columbus and Franklin County, 2013). Another UD and Green Home Survey Checklist
developed by Sandler (2010) are designed for building livable, energy-efficient homes and apartments
that people of all ages and abilities can use, enjoy and adapt to suit their changing needs. Other countries
may still lag behind in this endeavor, due to legislational, attitudinal, professional conducts (Samari et al.,
2013), which arguably includes Malaysia.

3. Case study

The objectives are to examine the condition of the facilities provided and to examine the compliance to
the requirement of UD in MS prior to achieving the goal of SD in MalaysiaNational Five Year
Development Plans. The level of provision and functional of the facilities in the case studies building is
evaluated.

3.1. Methods

Data collection was made via direct observation using access audit checklist. The access audit
checklist was created to be based on the Malaysian standards and the UBBL(Yaacob, Omar, Rahim et.al.
(2011); Yaacob, Hashim, Hashim 2009) to assess the fit between the building users and the built
environment.This can helped to identify workplace design factors that might be barriers to users with
disabilities, as well as users not yet experiencing a disability. The area assessedare divided into two
sections: external environment (pedestrian walkway, disabled car park, external ramp, external step ramp,
general obstruction and external staircase) and internal environment (building entrance foyer, doors, room
& spaces, barrier free toilet, barrier free shower area, urinal area, fire escape, corridors, internal step
ramp, internal ramp, staircase, lift, special telephone,ATM, directional sign & symbol, guiding block,
restaurant &cafeteria and others). Video recording and photos are taken for further qualitative analysis of
the current facilities condition.Three government office buildings were assessed:
126 Chua Fuh Yiing et al. / Procedia - Social and Behavioral Sciences 101 (2013) 120 129

Kettha Low Energy Office (LEO) in Putrajaya and PTM Green Energy Office (GEO)in Bangiare two
green certified government office buildings, located in non-residential existing building (NREB)
category and non-residential new construction (NRNC) category, respectively.
The Ministry of Women, Family and Community Development (KPKWM) in Putrajayais a non-green
certified building, chosen according to the consideration of UD and accessibility of PWD during pre-
construction stage.

3.2. Analysis and findings

The results showed that KPWKM building (score of 65 of 90) provides better accessibility to building
users, followed by LEO(score of 51 of 90)and GEO (score of 44 of 90) (see Table 7).This means, the
majority of the facilities provided in the KPWKM meets 75% of the requirements while less than 50% for
the facilities in GEO building. The best practice facility provided is barrier free toilet, while the worst
practice is lacking installation of guiding block and special phone.
The findings are divided in two: Firstly, way-finding and secondly, architectural design elements. The
issues of way finding elements like signages, guiding block and Braille information are found in three
buildings. Signage and signals are a problem to recognize accessibility signs for building users. Both the
-
The fire staircase at latter building is not accompanied with a pictogram or fire escape plan for building
users. Voice announcement and tactile signs are not installed for users who are vision impaired. The
signages installed at KPWKM are easily identified and Braille information are accompanied at certain
signages if necessary. In addition, the importance of the guiding block in enhancing the accessibility of
people with vision impaired andpeople with learning disability were neglected in three buildings.

Table 7. Findings of direct observation using access audit checklist

a b c d e f g h i j k l m n o p q r s t u v Total
Score
LEO - - - - 51/90
GEO - - - - 44/90
KPWKM - - - - 65/90

Legends for score:

Score Description
1 All requirements are not met / facility is not provided even though it is necessary
2 25% of the requirements met
3 50% of the requirements met
4 75% of the requirements met
5 All requirements met / facility is not provided, but it is not necessary
 Chua Fuh Yiing et al. / Procedia - Social and Behavioral Sciences 101 (2013) 120 129 127

Legends for environments:

Internal Environment External Environment

a External barrier free pedestrian walkway f Building entrance foyer
b Disabled car park g Door
c External step ramps h Room & spaces
d External ramp i Barrier free toilet
e External staircase j Barrier free shower area
k Urinal area
l Fire escape
m Internal step ramp
n Ramp (interior)
o Staircase (interior)
p Lift
q Special phone
r ATM
s Directional signage & symbol
t Guiding block
u Restaurant & cafeteria
v Bus & taxi station

Table 8. Summary of findings

GEO LEO KPWKM

Accessibility:
Vision Impaired: Inaccessible Inaccessible Moderate access for people
with vision impaired.
Lacking of connecting guiding
block & information Braille
from one space to another.
People with physical Difficult to access Moderate access Accessible
/ mobility impaired
Learning Difficulties Difficult to access Difficult to access Accessible
Hearing Impaired Difficult to access Difficult to access Accessible
Able People Accessible Accessible Accessible
Safety:
Difficult Moderate Acceptable
All fire staircases were locked Lacking of safety curb at
due to security reason. Certain external pathway.
fire extinguishers are not
installed at the designated
area.
Usability:
Difficult Moderate Acceptable
External ramp, footpath, Pathway, staircase, ramp and
driveway &signages are not in internal way-finding
accordance to UBBL & M.S.
Savings are seen in both
energy and water.
128 Chua Fuh Yiing et al. / Procedia - Social and Behavioral Sciences 101 (2013) 120 129

Both LEO and GEO did

However, theconnectivity was not properly done and is missing
entrance and adjacent bus station at KPWKM building. In terms of architectural design elements, many
problems are identified at the staircase and ramp. The staircase posed major usability problems for
persons with mobility impairment, visions impairment and learning difficulties. The fire escape staircases
at GEO were locked due to security reasons and this is useless for the purpose of fire escape. Other issues
found in both LEO and GEO staircases were the handrails that did not provide accurate tactile and
sensory cues to show the presence and locations of steps / landing. Building users might not be able to
grab the handrails if they lose their balance momentarily at the landing as the handrails of the staircase
were lacking with the required 300mm horizon extension parallel to the floor at the top and bottom risers.
The sloped walking surface at both LEO and GEO buildingsproved difficult for wheelchair users to use
when approaching the pedestrian walkway. In addition, extra efforts were required to access the external
ramp by the wheelchair users as the gradient of the ramp is not in accordance to the MS

4. Limitations of the study

Direct observations using the access audit checklist provides a standard way of getting data where the
researcher tried to obtain as close as possible reliable data to truly examine the research objective. Due to
time and costs constraints, participant observation technique, using real disabled persons would have been
a more reliable technique. A simulation exercise using wheelchairs and blindfold of a researcher was
conducted instead. Although limited, it was able to give a more diverse set of data rather than just ticking
boxes for the access audit checklist.Another limitation is one of the case study government office
buildings was not cooperative and gave limited access for the researcher, who managed to however got
access to main areas and not all areas.

5. Recommendations and conclusion

GB should be fully accessible in order to fully compliant to the goal of the National Five Year
Development Plans. Both LEO and GEO buildings were designed for persons who do not have sensory
problems whereas persons lacking sensory abilities were not designed for. It is highly advisable for both
building managements to plan and provide solutions and facilities for accessibility, communication and
information formats in visual, auditory and tactile form. KPWKM building was designed, in comparison
to the green-certified buildings to be more accessible to all users but still not accessible for vision-
impaired persons, especially for the connectivity aspects to the surrounding environment. SD includes

continuous changes to achieve development and redress the imbalance of green-certified buildings
objectives. It is recommended that Government interventions be in placed in terms of regulatory and
monitoring support including incentives and proper guidelines is also encouraged. To ensure successful
implementation of SD, the introduction of GB compliance to the regulatory requirements including
accessibility standards for all different and diverse needs are very necessary to achieve the aim stipulated
in the PWD Act Malaysia for equal opportunities to be given for all in all areas of life.Future studies
recommended based on the results of this study is to perform a qualitative research using case studies by
interviewing disabled persons including those with sensory impairment in terms of using green-certified
buildings, from the perspective of employment.
 Chua Fuh Yiing et al. / Procedia - Social and Behavioral Sciences 101 (2013) 120 129 129

References

Agyeman, J. and T. Evans (2003)."Toward Just Sustainability in Urban Communities: Building Equity Rights with Sustainable
Solutions." Annals of the American Academy of Political and Social Science 590 (RethinkingSustainable Development , Nov.,
2003), 35-53. rd
Arikisamy, A., (2007).Country Paper on Malaysia reported to UNESCAP, Accessed on 23 December 2007
(http://www.worldenable.net/cdpf2006/papermalaysia.htm)
Chen, R. K. et al. (2007). Rehabilitation Services and Education in Four Asian Countries: Thailand, South Korea, Singapore, and
Malaysia. Rehabilitation Education, 21(4), 231-240.
Chiang, C.M. (2005).Earth sustainability & human health concept design. International Conference on Sustainable Culture and
Creation 15-17 April 2005.
City of Columbus and Franklin County, (2013). AWARE Manual for Sustainable Living. (Accessed on 13 th April 2013)
(http://development.columbus.gov/uploadedFiles/Development/Housing_Division/Document_Library/AWARE%20Manual_F
ebruary2011.pdf).
Economic Planning Unit. (2010). Tenth Malaysia Plan 2011 2015.Malaysia: Malaysia Government.
Green Building Index. (2009). Retrieved from www.greenbuildingindex.org.
Laws of Malaysia, Act 658, People with Disabilities (2008) Part IV, Promotion and Development of the Quality of Life and
Wellbeing of Persons with Disabilities. Percetakan Nasional Berhad, Kuala Lumpur.
Laws of Malaysia, Street, Drainage and Building Act 1974 (Act 133). International Law Book Services, Selangor.
Laws of Malaysia, Town and Country Planning Act 1976 (Act 172) & Order. International Law Book Services, Selangor.
Laws of Malaysia, Uniform Building By-Laws 1984. International Law Book Services, Selangor.
Milad Samari, Nariman Godrati, Reza Esmaeilifar, Parnaz Olfat& Mohd Wira Mohd Shafiei. (2013). The Investigation of the
Barriers in Developing Green Building in Malaysia. Modern Applied Science,7(2), 2013.
National Green Technology Policy. Malaysia: Ministry of Energy, Green Technology and Water; 2009.
Samari, M. (2012). Sustainable Development in Iran: a Case Study of Implementation of Sustainable Factors in Housing
Development in Iran. IPEDR, 37. Singapore: ACSIT Press.
Suhaida Mohd Sood, Dr. K. H. Chua, Dr. Leong Yow Peng. (2011). Sustainable Development in the Building Sector: Green
Building Framework in Malaysia.ST-8: Best Practices & SD in Construction Paper #: 08-02.
Syazwani Abdul Kadir and Mariam Jamaludin (2012).Applicability of Malaysian Standards and Universal Design in Public
Buildings in Putrajaya. Asian Journal of Environment-behaviour studies, 3, 9, July 2012.
Tay Hao Giang (2011). Sustainable Fire Safety Engineering for Architects. Seminar on Building Plan Submission What Bomba
Wants at Malaysian Institute of Architects 13 August 2011.
Walsh, C.J.. (2004) Rio de Janeiro Declaration on Sustainable Social Development, Disability & Ageing.Designing for the 21st
Century III Rio de Janeiro, Brazil : 7th - 12th December, 2004.
World Business Council for Sustainable Development. (1996). Eco-efficient Leadership for Improved Economic and Environmental
Performance. Geneva.
Yaacob,N.M., Omar,Z., Rahim, A.A. (2011) Manual Akses Audit 1 Malaysia sebagai Garispanduan Untuk Fasilitator Rekabentuk
Sejagat, Majlis Akta OKU, KPWKM, KPKT, DBKL, UIAM, Kuala Lumpur.
Yaacob, N.M., Hashim, N.R. (2010). Malaysia: An Overview of Policies on Accessibility and Universal Design. International
Symposium for Promotion of Universal Design Based Environments in Asian Region. Japanese Association for an Inclusive
Society (JAIS). Tokyo, 26-27 June 2010.
Yaacob,N.M. (2010a). Malaysia: An Overview of Policies on Accessibility and Universal Design. International Conference:
Embracing Diversity and Creating Disability-Sensitive Communities. Kuching, Sarawak 28-29 July 2010.
Universiti Malaysia Sarawak.
Yaacob,N., Hashim,N.R., Hashim,H.A.(2009). Achieving social equity by addressing the needs of disabled people in heritage
building conservation in Malaysia. The International Journal of Environmental, Cultural, Economic & Social Sustainability,
5(4), 51-68.
 Available online at www.sciencedirect.com

ScienceDirect
Procedia Engineering 142 (2016) 314 321

Sustainable Development of Civil, Urban and Transportation Engineering Conference

A Review on Green Building in Vietnam

Hong-Trang Nguyena,*, Matthew Graya
a
Queensland University of Technology, 2 George St, Brisbane, QLD 4000, Australia

Abstract

Following market reforms in 1986 Vietnam has transformed from a poor closed economy to a low middle income economy. Like
other developing countries, economic growth has placed significant pressure on both infrastructure and environment, particularly
the pressure of increasing housing demand, energy consumption, and waste and pollution management. In response to the
development challenges and the green movement globally, the government has initiated actions to promote green building to
promote more sustainable development. However, green building adoption in Vietnam is still criticised as being slow and lacking
governmental support. This paper proposes that promoting green building could solve three inter-connected challenges hindering
sustainable development, and provides a comparative review of progress.
2016
2016TheTheAuthors.
Authors. Published
Published by Elsevier
by Elsevier Ltd. is an open access article under the CC BY-NC-ND license
Ltd. This
(http://creativecommons.org/licenses/by-nc-nd/4.0/).
Peer-review under responsibility of the organizing committee of CUTE 2016.
Peer-review under responsibility of the organizing committee of CUTE 2016
Keywords: green building; Vietnam; sustainable development; climate change

1. Introduction

Vietnam is a developing country located in South East Asia. The country has a total mainland of 330,966.9km2,
which stretches from North to South along the Gulf of Tonkin with 3,260km of coastline, and consists of two typical
topographies, small but very productive areas, such as the Mekong- and Red River deltas and large areas of less
productive, mountainous terrain [1-3].
The one-party Communist state went through a political and economic reform in 1986 [4], achieved a fast and
remarkable development, and became one of the success stories in the world in terms of both economic growth and
poverty reduction [5, 6]. Since then, the country has transformed from a poor closed economy to a low middle
income economy with 1755 US dollars per capita in 2012 [The World Bank 2014, as cited in 6], and maintained a

* Corresponding author. Tel.: +61-449-796-958.

E-mail address: hongtrang.nguyen@.hdr.qut.edu.au

1877-7058 2016 The Authors. Published by Elsevier Ltd. This is an open access article under the CC BY-NC-ND license
(http://creativecommons.org/licenses/by-nc-nd/4.0/).
Peer-review under responsibility of the organizing committee of CUTE 2016
doi:10.1016/j.proeng.2016.02.053
 Hong-Trang Nguyen and Matthew Gray / Procedia Engineering 142 (2016) 314 321 315

growth rate at approximately 7.3% per year between 1995 and 2008 [7].
However, the economic growth has significantly increased pressure on both the infrastructure and environment,
particularly pressure of increasing demand for buildings, energy consumption, and waste and pollution management.
The green movement in the world has placed green building in a high priority as it is able to meet the building
demand while mitigating the negative impacts of construction industry. Following the movement to deal with its
own development problems, Vietnam necessitates green building in its pathway to sustainability.

2. Inter-connected challenges Vietnam is facing on its pathway of development

2.1. Overgrowing population and urbanisation leading to increasing demand for buildings

Since the 1986 reforms, urbanisation has accelerated and its population begun to grow, corresponding with the
economic development. Like other countries in Asia, Latin America and Africa, the country has also experienced
over-urbanisation concerning the fast pace and scale of urbanisation without correspondingly benefits the urban
production [8, 9]. In both theory and statistical data, this phenomenon is directly related to the proportion of
population living in urban areas [10, 11]. The current population of Vietnam is 90.7 million and it is predicted to
grow up to 108.7 million in 2049 with 58.8% of the population residing in urban areas [3, 12]. As there is a two-
sided link between population and housing [13], this growth in population and over-urbanisation will create a huge
demand on buildings in the coming years. Construction statistical data showed that each year, the average of
housing floor areas constructed increased by 115.9% from 2005 to 2013, presented in Fig. 1. [14]. In 2014,
according to Ministry of Construction, 92 million m2 housing floor was built, increasing the average floor per people
to 20.6m2, in which, the average one in urban areas is 23m2/pp and in rural areas is 19.5m2/pp. Up to 2014, the total
area of housing floor constructed is approximately 1,873.65 million m 2.

Fig. 1. Areas of housing floor were constructed from 2005 to 2013 [adapted from 14]

2.2. Predicted insecurity of energy supply

High growth rate of the economy, industrialisation, over-urbanisation and increasing population are believed to
be the drivers of energy demand. Total demand increased by 9.3 per cent annually between the years 1990 2007;
and it is estimated to increase by 5.5 per cent annually up to the year 2025. Currently, energy production relies
primarily on fossil fuel, including coal, oil, gas, followed by hydro and other renewable energy [15]. The reliance on
fossil fuel has made the energy system of Vietnam carbonised even faster than the world average, Chinas and
newly industrialised countries (Fig. 2.a).
However, reserve of oil and gas will not be enough for energy production beyond 25 year time-horizon,
according to Do et.al [16]. Additionally, due to limited reserve generation capacity and rain-fall dependency of
hydro, the national electricity system has experienced power shortages relatively frequently in the dry season. In a
long term, studies since 2011 have pointed out that Vietnam will become a net importer of energy in a decade when
316 Hong-Trang Nguyen and Matthew Gray / Procedia Engineering 142 (2016) 314 321

the demand surpasses the domestic energy production around 2015 (Fig. 3) [7, 15, 16]. It is also projected that in
2025, the nation will need to import approximately 49 per cent of its total primary energy needs. Scholars have
suggested that the government should promote energy efficiency, develop market-based energy pricing and
incorporate energy plans with other programs to form a long-term policy package [15, 16]. Even an increase as
small as US 7.5 cent/kWh in the electricity tariff would drive up the prices of all other factors, thus, it is hard to
implement at one time, especially when Vietnam is facing a high inflation rate [17]. Therefore, in the meantime,
energy efficiency would be one of the main solutions to deal with the energy shortage.

a b

Fig.2. (a) Carbon intensity; (b) Energy intensity (PPP) over time for Vietnam, China, newly industrialised countries (NIC) and the global average
[adapted from 18]

Fig. 3. Primary energy demand and supply balance [adapted from 16]

2.3. Environmental detriment and negative impacts of climate change

Vietnam has witnessed environmental detriment due to economic development, urbanisation, industrialisation,
energy consumption and consumption of natural resources [6]. Economic growth effects, industrialisation, energy
intensity and growing population release pollution and increase CO 2 emission [19-21]. Currently the electricity
prices for manufacture are low and subsidised; it has made Vietnam more appeal to those industries that are high
energy intensity such as steel and cement [16]. This contributes to the energy intensity of the economy and carbon
emission (Fig. 2. b). There is also evidence of a positive relationship between urbanisation and emissions although it
is argued that the impact of urbanisation on CO2 emission is not statistically significant [20, 22, 23]. The pollution is
predicted to be persistent along with the economic growth as the relationship between GDP and pollution remains
positive in both short and long term, proven that the environmental Kuznets curve hypothesis does not exist in the
countrys context [6].
Due to the excessive CO2 and other greenhouse gas emissions, the world is experiencing climate change and
global warming. Vietnams long coast line in addition to low-lying and densely populated delta regions make it
vulnerable to present climate extremes and future climate changes [24]. Currently, the country is suffering from
more frequent strong typhoons during the monsoon season, volatile rainfall patterns and droughts in different extents
 Hong-Trang Nguyen and Matthew Gray / Procedia Engineering 142 (2016) 314 321 317

and locations [25, 26]. In the near future, it is also forecasted to be one of the five nations in the world most severely
impacted by rising sea-levels and one of six countries in Pacific-Rim region most vulnerable to climate change [2,
27, 28]. As most areas are within 60km of the coastline, Carew-Reid [2] predicted that inundation from a one meter
sea level rise will result in the loss of 4.4% of Vietnams territory, which include coastal areas and the Mekong river
delta region, affecting 6 million people in 2100. Since the economy backbone of the nation falls in its coastal zone
and the lowlands near the coast, which are rich in natural and socio-economic assets, the loss will directly impact its
wealth and standard of living [26].
Additionally, more severe droughts, storm intensity, flooding and changes in rainfall pattern as consequences of
climate change will affect aquaculture, agriculture and food production [2, 29]. Agriculture plays an important role
in the Vietnam economy, making up 21% of GDP, the climate related damages will directly threaten food security
and social welfare [30]. Rural areas where almost all of the agricultural activities take place and which have low
adaptive capacity are extremely vulnerable to natural disasters. The change in climate pattern and frequency of
climate shocks has negative effects on household income and expenditure, threatening their livelihood [31]. This
adds to the economic pressure that has pushed people in rural areas seeking for employment and education
opportunities in the cities to diversify their income from agriculture dependency a livelihood strategy called rural-
urban migration [32]. Census data revealed that the rural-urban migration strongly influences the urban population
and also over-urbanisation, creating a greater demand for buildings [11].

3. The green building movement as a solution to mitigate the negative impact of the construction industry

3.1. Impacts of the construction industry and buildings

Given the large demand for buildings in Vietnam in the near future, the construction industry is predicted to
gained more focus and investment. However, this industry is unarguably one of the main contributors to global
warming and the largest polluters affecting the environment. Its impacts on climate change have been addressed by
numerous scholars and researchers [33-35]. The construction industry produces half of worldwide CO2 emissions
and consumes almost 50% of all global resources [36]. 36% of total electricity usage in Vietnam is reportedly
consumed by this section [37]. Ortiz, Castells [38] cite a number of research accusing the industry of high-energy
consumption, solid waste generation, GHG emissions, external and internal pollution, environment damage and
resource depletion. Although it makes the development path more challenging, this industry is considered as
having a great potential to contribute to sustainable development through improvements in its long lasting products
[39, 40].
Buildings affect humans and the environment in countless ways [41]. As we spend about 90% of our time in
indoor activities, buildings can positively and negatively impact on our living environment [U.S Environmental
Protection Agency, 2004, as cited in 42, Klepeis; Tsang etal., 1995, as cited in 43]. They provide shelter and protect
us from natural extremes [41], however, buildings release volatile organic compounds which pose serious risks to
our health [42]. Buildings consume 50% of energy generated and 70% of all timber as well as a considerable
proportion of raw materials globally [36, 39, 44]. A significant amount of wastes is also produced during their
lifecycle, from construction, operation and demolition processes [39, 44]. Buildings contribute to air pollution, noise
pollution, waste pollution and water pollution [34].

3.2. The green building movement

Green building (hereinafter referred to as GB) is defined by US Green Building Council [2007, as cited in 41] as
the practice of creating and using healthier and more resource-efficient models of construction, renovation,
operation, maintenance and demolition. Kibert (2004) further defines green/sustainable buildings as the facilities
which are the outcomes of sustainable construction for the purpose of promoting occupant health and resource
efficiency, minimizing the impacts of the built environment on the natural ecology system [as cited in 45]. A more
specific definition stated by Hu, Geertman [46] refers to green housing as environmentally-friendly buildings which
are resource-efficient, energy-saving, heath-improved and comfortable for living. In this study, green buildings are
those embrace the principles of lower environmental impacts through greater energy efficiency, lower energy
demand, reduce water usage, improve indoor quality and minimise construction waste [O'Leary, 2008 as cited in
318 Hong-Trang Nguyen and Matthew Gray / Procedia Engineering 142 (2016) 314 321

47].
The GB movement started in 1970s in Europe and US. It is first considered as a solution to reduce energy
consumption to deal with instable energy markets after an oil embargo imposed by Organization of Petroleum
Exporting Countries (OPEC) [48]. Gradually, GB gained serious attention from government, industry players and
scholars as a promising innovation to mitigate building related environment problems such as excessive
consumption of energy and water [Retzlaff, 2009, as cited in 46, Nelms et al. 2005, Sparks, 2007 as cited in 49, 50].
Consequently, GB is now considered as a means to achieve low carbon construction towards sustainability [41, 51,
52].
From those purposes, GB is often designed to achieve positive environment performance and assessed by GB
rating tools, which also comprise environment related criteria such as sustainable sites and transport, energy and
water efficiency, environmentally friendly materials, indoor air quality improvement [33, 53, 54]. The benefits of
GB are generally accepted as resource efficiency, health improvement of occupants and waste reduction during the
building lifecycle [36, 55]. GB has been believed to bring direct economic benefits to their owners as they are able
to save lifecycle costs, improve occupant productivity and performance, and increase their competitive advantage
[56]. As an innovation, GB is proved that it has increased average rents and prices value of early adopters more
than that of later entrants [57]. Furthermore, it would also bring indirect economic and environmental benefits to the
surrounding communities [57, 58]. A GB market report by BCI Economics [59] showed that buildings certified by
Green Starthe sustainable building assessment tool used widely in Australia and New Zealandbring significant
positive effects. Those buildings only emit one third of GHGs, use a third of electricity, consume half of portable
water compared to average Australian buildings, and also recycle almost 96% of demolition waste. GB practices,
thus, are able to contribute greatly in reducing greenhouse gas, mitigating climate change impacts and maintaining
energy security.
As GB brings both tangible and intangible benefits, the movement is gaining momentum and has become a
global trend [36, 41, 60]. The Green Building Council network and Green Building Certifications are now present in
93 states and tertiaries worldwide and has significantly accelerated global GB practices [61, 62]. From a
comparative study of global GB evaluation tools, Reed, Wilkinson [60] show a considerable increase in the number
and maturity of international sustainable building organisations through a large number of projects registering and
seeking certificates in last 10 years, illustrating the successful progress of this initiative.
In Southeast Asia, Green Building Councils were formed in six countries with their associated green building rating
systems, including Brunei, Green Ship of Indonesia, Green Building Index of Malaysia, Building for Ecologically
Responsive Design Excellence of Philippines, Green Mark of Singapore and LOTUS of Vietnam [62] with an
increasing number of buildings being certified. However, scholars point out that the concept of sustainability is still
relatively new in the region, many important stakeholders in the construction industry are not aware of the GB
concepts [63].
In Vietnam, Solidiance and VGBC [64] claim that the development of the GB market is still in its initial stages
although it has obtained increasing attentions from both the industry and government, and become a topic of recent
real estate fora and conferences [50, 65]. After the first building was certified in 2008, GB can now be seen in large
cities throughout the country, mainly in two major metropolitan areas Hanoi and HoChiMinh City. In terms of
organisation setting, the Vietnam Green Building Council was established in 2007 and joined World Green Building
Council Network as an Associated Group. The Council has played a considerably important role in promoting GB
practices such as engaging construction experts in developing LOTUS - a GB certification developed for Vietnams
conditions - and organising regular nationwide training courses about green buildings solutions. Comparing
Leadership in Energy & Environmental Design (LEED) and LOTUS, industry leaders point out that LEED is
considered having higher recognition while LOTUS has higher applicability and lower implementation cost [64].
The LOTUS assessment tools include: LOTUS-NR for non-residential buildings; LOTUS-R for residential
buildings; LOTUS-BIO for Building in Operation; and LOTUS Interiors and LOTUS Homes are under
development. In 2013, there were 21 LEED projects and 9 LOTUS projects in the total of 41 projects certified as
Green building. Until now, there are 34 LEED projects and 14 LOTUS projects. Based on the small ratio of the
number of GB projects on the area of floors constructed each year, the adoption of GB is still in its initial stages
(Spot A in Fig. 4.). It shows a stronger trend towards the international certification and limited recognition of
LOTUS - the localised sustainability assessment tool. This could be the result of majority of GB projects investors
being multinational companies while domestic ones still hesitate about investing in GB [64].
 Hong-Trang Nguyen and Matthew Gray / Procedia Engineering 142 (2016) 314 321 319

Fig. 4. The adoption curve for green construction [adapted from 66]

Another organisation - Green Building Council Vietnam (GBCVietnam) - was established in 2011 as a national
government-sponsored council, demonstrating an official advocacy for GB adoption [67]. This council consists of
19 academia and scholars who are experienced in GBs attributes. They are developing the National Green Building
Development Strategy for 2020-2030 and a Green Building Assessment Criterion System under contracts with a
government agency. Those documents will form an important legal foundation for the development of GB. Pham
[67] as the vice chairman of GBCV - also believes that GB movement in Vietnam is still at its infancy without an
adequate attention from the public.
Comparing the number of GB with other peer countries in the region such as Indonesia with 23 LEED projects
and 105 GREENSHIP projects or Philippines with 142 LEED projects [68, 69] illustrates a slow progress of green
building adoption in Vietnam. While Vietnam has limited programs addressing renewable energy and energy
efficiency, and has yet provided GB regulations, the other two countries have implemented numerous financial and
advocacy incentives to encourage investment in renewable energy and GB, including feed-in-tariff, net metering,
soft loan schemes for renewable energy producers and environmentally friendly investment, and GB guidelines [70].
It is argued that the Vietnam government necessitates stronger actions to promote GB provided the worsen effect of
climate change and all the development challenges.

4. Conclusion

With all the benefits that GB could bring, it should be considered as a solution for the development related
challenges and increasing demand for buildings in Vietnam, including growing population and over-urbanisation,
predicted insecurity of energy supply, and environmental detriment and negative impacts of climate change.
However, the GB adoption in Vietnam is still criticised as being slow and lacking governmental support. It is
recommended that the government needs to take stronger actions such as ratifying regulations or offering incentives
to promote GB towards sustainable development.

Acknowledgements

This paper is a part of a Doctorate degree undertaken in Queensland University of Technology (QUT). The
authors would like to express the deepest gratitude towards the sponsorship of QUT and the support of IEEE,
Vietnam. The authors also appreciate comments of two anonymous reviewers in preparing this paper.

References

[1] A.W. Thulstrup, Livelihood Resilience and Adaptive Capacity: Tracing Changes in Household Access to Capital in Central Vietnam. World
Development. 74 (2015) 352-362.
[2] J. Carew-Reid, Rapid Assessment of the Extent and Impact of Sea Level Rise in Viet Nam. Climate Change Discussion Paper 1, ed. P.-J.
Meynell, ICEMInternational Centre for Environmental Management, Brisbane, Australia, 2007.
[3] General Statistics office of Vietnam. Average population by province. 2015; Available from:
https://www.gso.gov.vn/SLTKE/pxweb/en/02.%20Population%20and%20Employment/-/E02.03-
07.px/table/tableViewLayout1/?rxid=5a7f4db4-634a-4023-a3dd-c018a7cf951d.
320 Hong-Trang Nguyen and Matthew Gray / Procedia Engineering 142 (2016) 314 321

[4] L. Steer and K. Sen, Formal and Informal Institutions in a Transition Economy: The Case of Vietnam. World Development. 38(11) (2010)
1603-1615.
[5] F. Tarp, D. Roland-Holst, and J. Rand, Economic structure and development in an emergent Asian economy: evidence from a social
accounting matrix for vietnam. Journal of Asian Economics. 13(6) (2003) 847-871.
[6] U. Al-Mulali, B. Saboori, and I. Ozturk, Investigating the environmental Kuznets curve hypothesis in Vietnam. Energy Policy. 76 (2015) 123-
131.
[7] K.T. Pham, M.B. Nguyen, and H.D. Nguyen, Energy supply, demand, and policy in Viet Nam, with future projections. Energy Policy. 39(11)
(2011) 6814-6826.
[8] J. Beall and S. Fox, Cities and development, Routledge, Milton Park, Abingdon, Oxon; New York, 2009.
[9] Y.W. Bradshaw, Urbanization and underdevelopment: a global study of modernization, urban bias, and economic dependency. American
Sociological Review. 52(2) (1987) 224-239.
[10] N.V. Sovani, The analysis of" over-urbanization". Economic Development and Cultural Change. (1964) 113-122.
[11] General Statistics Office of Vietnam, Vietnam Population and Housing Census 2009 - Migration and Urbanization in Vietnam: Patterns,
Trends and Differentials, Ministry of Planning and Investment, Editor. 2009.
[12] Ministry of Planning and Investment, Population projection for Vietnam 2009-2049, G.S. Office, Editor. 2011.
[13] C.H. Mulder, Population and housing: A two sided relationship. Demographic Research. 15 (2006) 401-412.
[14] General Statistics office of Vietnam, Area of housing floors constructed in the year by region, G.S.o.o. Vietnam, Editor. 2015.
[15] D.L. Nguyen, A critical review on Energy Efficiency and Conservation policies and programs in Vietnam. Renewable and Sustainable
Energy Reviews. 52 (2015) 623-634.
[16] T. Minh Do and D. Sharma, Vietnam's energy sector: A review of current energy policies and strategies. Energy Policy. 39(10) (2011) 5770-
5777.
[17] K.Q. Nguyen, Impacts of a rise in electricity tariff on prices of other products in Vietnam. Energy Policy. 36(8) (2008) 3145-3149.
[18] A. Zimmer, M. Jakob, and J.C. Steckel, What motivates Vietnam to strive for a low-carbon economy? On the drivers of climate policy in
a developing country. Energy for Sustainable Development. 24 (2015) 19-32.
[19] Z.H. Lee, et al., An overview on global warming in South East Asia: CO2 emission status, efforts done and barriers. Renewable &
Sustainable Energy Reviews. 28 (2013) 71-81.
[20] I. Martnez-Zarzoso and A. Maruotti, The impact of urbanization on CO2 emissions: Evidence from developing countries. Ecological
Economics. 70(7) (2011) 1344-1353.
[21] R.M. Shrestha, G. Anandarajah, and M.H. Liyanage, Factors affecting CO2 emission from the power sector of selected countries in Asia and
the Pacific. Energy Policy. 37(6) (2009) 2375-2384.
[22] P. Poumanyvong and S. Kaneko, Does urbanization lead to less energy use and lower CO2 emissions? A cross-country analysis. Ecological
Economics. 70(2) (2010) 434-444.
[23] Y. Li, et al., Does urbanization lead to more direct and indirect household carbon dioxide emissions? Evidence from China during 1996
2012. Journal of Cleaner Production. 102 (2015) 103-114.
[24] W. Neil Adger, Social Vulnerability to Climate Change and Extremes in Coastal Vietnam. World Development. 27(2) (1999) 249-269.
[25] S. Lohmann and T. Lechtenfeld, The Effect of Drought on Health Outcomes and Health Expenditures in Rural Vietnam. World
Development. 72 (2015) 432-448.
[26] V. Hoang, Housing and Climate Change: Adaptation Strategies in Vietnam, in: B. Yuen and A. Kumssa, Editors, Climate Change and
Sustainable Urban Development in Africa and Asia, Springer Netherlands, 2011.167-192.
[27] Intergovernmental Panel on Climate Change, Climate Change 2007: Impacts, Adaptation and Vulnerability. Assessment Report of the
Intergovernmental Panel on Climate Change, ed. M.L. Parry, et al., Cambridge University Press, Cambridge, UK, 2007.
[28] Standard & Poors Financial Services LLC. Climate Change Is A Global Mega-Trend For Sovereign Risk. May 2014 [cited 2015 September
1]; Available from:
https://www.globalcreditportal.com/ratingsdirect/renderArticle.do?articleId=1318252&SctArtId=236925&from=CM&nsl_code=LIME&sou
rceObjectId=8606813&sourceRevId=1&fee_ind=N&exp_date=20240514-20:34:43.
[29] M.R.M. van Dijk, W. van Rooij, and H. Hilderink, Land Use Dynamics, Climate Change, and Food Security in Vietnam: A Global-to-local
Modeling Approach. World Development. 59 (2014) 29-46.
[30] The World Bank Group. Vulnerability, Risk Reduction, and Adaptation to Climate Change - Vietnam. 2011; Available from:
http://sdwebx.worldbank.org/climateportalb/doc/GFDRRCountryProfiles/wb_gfdrr_climate_change_country_profile_for_VNM.pdf.
[31] M. Arouri, C. Nguyen, and A.B. Youssef, Natural Disasters, Household Welfare, and Resilience: Evidence from Rural Vietnam. World
Development. 70 (2015) 59-77.
[32] L.D. Nguyen, K. Raabe, and U. Grote, RuralUrban Migration, Household Vulnerability, and Welfare in Vietnam. World Development. 71
(2015) 79-93.
[33] M. Samari, et al., The Investigation of the Barriers in Developing Green Building in Malaysia. Modern Applied Science. 7(2) (2013) 1.
[34] L.Y. Shen and V.W.Y. Tam, Implementation of environmental management in the Hong Kong construction industry. International Journal
of Project Management. 20(7) (2002) 535-543.
[35] C.M. Tam, V.W.Y. Tam, and W.S. Tsui, Green construction assessment for environmental management in the construction industry of Hong
Kong. International Journal of Project Management. 22(7) (2004) 563-571.
[36] R. Thilakaratne and V. Lew, Is LEED leading Asia?: An analysis of global adaptation and trends. Procedia Engineering. 21 (2011) 1136-
1144.
[37] Vietnam: Construction sector goes green, in Asia News Monitor Bangkok. Feb 2015.
[38] O. Ortiz, F. Castells, and G. Sonnemann, Sustainability in the construction industry: A review of recent developments based on LCA.
Construction & Building Materials. 23(1) (2009) 28-39.
[39] A. Sev, How can the construction industry contribute to sustainable development? A conceptual framework. Sustainable Development. 17(3)
(2009) 161-173.
[40] J. Pinkse and M. Dommisse, Overcoming barriers to sustainability: an explanation of residential builders' reluctance to adopt clean
 Hong-Trang Nguyen and Matthew Gray / Procedia Engineering 142 (2016) 314 321 321

technologies. Business Strategy and the Environment. 18(8) (2009) 515-527.

[41] E.H.W. Chan, Q.K. Qian, and P.T.I. Lam, The market for green building in developed Asian citiesthe perspectives of building designers.
Energy Policy. 37(8) (2009) 3061-3070.
[42] S. Kim and E. Paulos, inAir: measuring and visualizing indoor air quality, in Proceedings of the 11th International Conference on Ubiquitous
Computing, ACM Orlando, Florida, USA. 2009.81-84.
[43] L.E. LaRosa, T.J. Buckley, and L.A. Wallace, Real-Time Indoor and Outdoor Measurements of Black Carbon in an Occupied House: An
Examination of Sources. Journal of the Air & Waste Management Association. 52(1) (2002) 41-49.
[44] C.K. Chau, M.S. Tse, and K.Y. Chung, A choice experiment to estimate the effect of green experience on preferences and willingness-to-pay
for green building attributes. Building & Environment. 45(11) (2010) 2553-2561.
[45] M. Xiaoping, L. Huimin, and L. Qiming, A comparison study of mainstream sustainable/green building rating tools in the world, in
International Conference on Management and Service Science. 2009.1-5.
[46] H. Hu, S. Geertman, and P. Hooimeijer, The willingness to pay for green apartments: The case of Nanjing, China. Urban Studies. 51(16)
(2014) 3459-3478.
[47] Z. Yang and J. Yang, Sustainable housing implementation through mutual benefits to stakeholders : a decision making approach., in
CRIOCM2009 International Symposium on Advancement of Construction Management and Real Estate Nanjing, China. 2009.
[48] R. Retzlaff, Developing policies for green buildings: what can the United States learn from the Netherlands. Sustainability: Science,
Practice, & Policy. 6(1) (2010) 29-38.
[49] X. Zhang, S. Liyin, and Y. Wu, Green strategy for gaining competitive advantage in housing development: a China study. Journal of Cleaner
Production. 19 (2011) 157-167.
[50] Vietnam: Vietnam buildings set to go green, in Asia News Monitor Bangkok. Jun 2015.
[51] S. Mensah, J. Ayarkwa, and G. Nani. Framework for modeling sustainable construction practices towards low carbon construction. in
Proceedings 8th Construction Industry Development Board (cidb) Postgraduate Conference. University of the Witwatersrand, Johannesburg,
South Africa. 2014
[52] K.J. Oneill and D.C. Gibbs, Towards a sustainable economy? Socio-technical transitions in the green building sector. Local Environment.
19(6) (2014) 572-590.
[53] J.A. Todd, Crawley, D., Geissler, S., & Lindsey, G., Comparative assessment of environmental performance tools and the role of the Green
Building Challenge. Building Research & Information. 29(5) (2001) 324-335.
[54] K.H. Ting, Tropical green building rating systems: a comparison between Green Building Index and BCA Green Mark. Business
Engineering and Industrial Applications Colloquium. (2012) 263-268.
[55] Y. Mao and G. Yang, Sustainable development drivers for green buildings: Incremental costs-benefits analysis of green buildings. Advanced
Materials Research. 374 (2012) 76-81.
[56] A. Nalewaik and V. Venters, Cost benefits of building green. Cost Engineering. 51(2) (2009) 28-34.
[57] A. Chegut, P. Eichholtz, and N. Kok, Supply, Demand and the Value of Green Buildings. Urban Studies. 51(1) (2014) 22-43.
[58] G. Kats, Greening Our Built World: Costs, Benefits, and Strategies, Island Press. 2009.276.
[59] BCI Economics, Green Building Market Report Australia/New Zealand 2014, Australia. 2014.
[60] R. Reed, et al., A comparison of international sustainable building toolsAn update., in The 17th Annual Pacific Rim Real Estate Society
Conference Gold Coast. 2011.16-19.
[61] Green Building Council of Australia. World Green Building Council. Jan 2009; Available from:
https://www.gbca.org.au/about/international/world-green-building-council2/.
[62] R. Reed and A. Krajinovic-Bilos, An Examination of International Sustainability Rating Tools: an Update, in 19th PRRES Pacific Rim Real
Estate Society Conference Melbourne, Australia. 2013.1-23.
[63] F. Shafii and M.Z. Othman. Sustainable buildings in South-East Asia: Opportunities and implementation. in Proceedings of the Conference
on Sustainable Building South-East Asia (SB04SEA). 2006
[64] Solidiance and VGBC, Is there a future for green buildings in Vietnam? August 2013.
[65] Vietnam: Vietnam developers told to start thinking 'green', in Asia News Monitor Bangkok. Nov 2011.
[66] A.J. Hoffman and R. Henn, Overcoming the Social and Psychological Barriers to Green Building. Organization & Environment. 21(4)
(2008) 390-419.
[67] D.N. Pham, Pht trin cng trnh xanh Vit Nam Thc trng v xut [Developing green building in Vietnam - status quo and
recommendations], in Tp Ch Kin Trc Vit Nam [Journal of Vietnamese Architecture] Hanoi. 2015.
[68] U.S. Green Building Council. Project Directory. 2015 [cited 2015 September 9]; Available from: http://www.usgbc.org/projects.
[69] Green Building Council Indonesia. Rating Tools. 2015 [cited 2015 September 2]; Available from: http://www.gbcindonesia.org/2012-08-
01-03-25-31/2012-08-02-03-43-34/rating-tools.
[70] H.-T. Nguyen, M. Gray, and M. Skitmore, Comparative study on green building supportive policies of Pacific-Rim countries most
vulnerable to climate change, in 22th Pacific Rim Real Estate Society Conference Sunshine Coast, Australia. January 2016.
 Available online at www.sciencedirect.com

ScienceDirect
Procedia Economics and Finance 5 (2013) 747 756

International Conference on Applied Economics (ICOAE) 2013

Sustainability components affecting decisions for green building

projects
K.I. Vatalisa, O. Manoliadisb, G. Charalampidesa, S. Platiasa, S. Savvidisa
a
Technological Educational Institution of Western Macedonia Greece
Dept. of Geotechnology and Environmental Engineering Koila Kozani 50100.
b
Demokritus University of Thrace, Department of Civil Engineering, Xanthi Greece.

Abstract

Construction process is the broad mechanism for the realization of human settlements and the creation of infrastructure
that supports development. This includes the extraction and beneficiation of raw materials, the manufacturing of
construction materials and components, the construction project cycle from feasibility to deconstruction, and the
management and operation of the built environment In Greece, the complex problems shared by cities are evidence of the
impacts of urban sprawl. This research aims to investigate the sustainability components affecting decisions for green
building projects. The research method is based on a questionnaire survey of thirty two participants who asked to assess
nine sustainability components namely: Life cycle assessment, energy efficiency and renewable energy, water efficiency,
environmentally preferable building materials and specifications, waste reduction, toxics reduction, indoor air quality,
smart growth and sustainable development and environmentally innovative projects, which affect the decisions for green
building projects. The respondent results indicate how participants prioritized the sustainability components ensuring a
better quality of life inside buildings based on the principals of green buildings economy. Energy efficiency and
renewable energy is considered of high priority followed by the reduction of toxic materials, indoor pollution and water
saving.

2013
2013TheThe Authors.
Authors. Published
Published by Elsevier
by Elsevier B.V.
B.V. Open access under CC BY-NC-ND license.
Selection
Selection and/or
and/or peer-review
peer-review underunder responsibility
responsibility of the Organising
of the Organising CommitteeCommittee of ICOAE 2013.
of ICOAE 2013

Kewwords: sustainability, green building projects, Life cycle assessment

1. Introduction

The Earths ecosystems today are at a critical point. Human activities currently lead to irreversible
losses of important ecosystem functions. Buildings and construction works have the largest single share in
global resource use and pollution emission. In OECD countries the built environment is responsible for
around 25-40% of total energy use, 30% of raw material use, 30-40% of global greenhouse gas emissions and

2212-5671 2013 The Authors. Published by Elsevier B.V. Open access under CC BY-NC-ND license.
Selection and/or peer-review under responsibility of the Organising Committee of ICOAE 2013
doi:10.1016/S2212-5671(13)00087-7
748 K.I. Vatalis et al. / Procedia Economics and Finance 5 (2013) 747 756

for 30 to 40% of solid waste generation. In addition, in OECD countries, people spend almost 90% of their
life inside buildings. In the United States, the annual cost of building-related sickness is estimated to be at 58
billion $. Consequently, healthy and comfortable indoor environments contribute significantly to human
health and well-being and offer a large potential for reducing external costs to societies through lowering
diseases (Chwieduk, 2002).
Construction process is the broad mechanism for the realization of human settlements and the
creation of infrastructure that supports development. This includes the extraction and beneficiation of raw
materials, the manufacturing of construction materials and components, the construction project cycle from
feasibility to deconstruction, and the management and operation of the built environment (UNEP agenda 21,
1992).
Green construction refers to a structure and using process that is environmentally responsible and
resource efficient throughout a building's life-cycle: from siting to design, construction, operation,
maintenance, renovation, and demolition. Although new technologies are constantly being developed to
complement current practices in creating sustainability structures, the common objective is that green
buildings are designed to reduce the overall impact of the built environment on human health and the natural
environment.
US-EPA considers several projects types for sustainable construction. The projects must demonstrate
at least a 20% savings in energy, an increase in water efficiency, or utilize green storm water practices that
demonstrate new or innovative approaches to sustainable water management. This requires close cooperation
of the design team, the architects, the engineers, and the client at all project stages. The Green Building
practice expands and complements the classical building design concerns of economy, utility, durability, and
comfort.
As far as the legislative framework is concerned the European Directive 2002/91/EC, includes the
energy performance of buildings directive, which refers to the environmental information in energy
certificates, particularly CO2 emissions. Environmental performance is a major driving force for energy saving
(climate change, exhaustion of resources, nuclear waste, toxicity aspects, etc.). Reducing environmental
impact in the building sector requires appropriate evaluation methods (Jnsson, . 2000) allowing the
following: i) Environmental performance levels to be integrated into programmers (clients brief) by the
authorities (e.g. requirements in municipal policy and building programs), ii) Advice to be provided to
designers, architects and consultants, in order to reach such targets, iii) Guidance for efficient operation and
management of buildings, so that actual performance corresponds to design performance, iv) Methods and
tools to evaluate the most cost effective measures (actions) for energy savings and reduced environmental
impact over the whole life cycle (Jnsson, . 2000).
In Greece, the complex problems shared by cities are evidence of the impacts of urban sprawl:
increasing traffic congestion and commuting times, air pollution, inefficient energy consumption, loss of open
space and habitat, non-optimal allocation of economic resources and the loss of a sense of community. These
combined pressures, along with the challenges faced specifically by stakeholders of the built environment,
have led to a growing awareness of the need for change. In response to these pressures the green projects are
beginning to permeate the Greece construction industry as a possible strategy to meet the needs of clients and
contractors while ensuring business success in an increasingly competitive and constrained operational
environment (Vatalis et al., 2011).
Going towards green building projects in Greece a questionnaire survey was used in order to
investigate the preferences of clients, brokers, contractors, engineers and construction companies concerning
the real interest about the evolution of green building projects. Main purpose of this research is to estimate the
overall level of interest for green building projects in Greece including how adoption varies by sustainable
characteristics of the project, as well as the importance of weighted green components which affects the
decision of participants in an environmental perspective.
 K.I. Vatalis et al. / Procedia Economics and Finance 5 (2013) 747 756 749

2. Components of sustainable construction

Although new technologies are constantly being developed to complement current practices in
creating more sustainable buildings, the common objective is that green buildings are designed to reduce the
overall impact of the built environment on human health and the natural environment by the following goals
of sustainable building : (a) Life cycle assessment (LCA), (b) Energy Efficiency and Renewable Energy, (c)
Water Efficiency,
f d) Environmentally Preferable Building Materials and Specifications (e) Waste Reduction,
(f)Toxics Reduction (g) Indoor Air Quality, (h) Smart Growth and Sustainable Development, (i)
Environmentally Innovative materials and services (www.epa.gov).

2.1. Life Cycle Assessment, LCA

Life cycle assessment (LCA) is a procedure (Figure 1) to assess environmental impacts associated
with all the stages of a product's life from-cradle-to-grave (i.e., from raw material extraction through materials
processing, manufacture, distribution, use, repair and maintenance, and disposal or recycling). LCA can help
avoid a narrow outlook on environmental concerns by: a) compiling an inventory of relevant energy and
material inputs and environmental releases; b) Evaluating the potential impacts associated with identified
inputs and releases; c) Interpreting the results to help make a more informed decision. LCA is a holistic
procedure that requires the assessment of raw-material production, manufacture, distribution, use and disposal
including all intervening transportation steps necessary or caused by the product's existence. The life cycle
assessment process is defined under the ISO 14040/14044.
Especially in the buildings there is an interaction between all the stages of a building's life: for
example, if less is invested in the construction phase (e.g. using poor insulation), the investment needed for
use and maintenance will increase. So the question is: is it better to invest in construction rather than in use
and maintenance? (Bribian et al., 2009).

Fig. 1. Scheme of LCA by a) Tececo and b)Westwind hardwood inc. 2012

2.2. Energy efficiency and renewable energy in buildings

Buildings have a significant impact on energy use and the environment. Commercial and residential
750 K.I. Vatalis et al. / Procedia Economics and Finance 5 (2013) 747 756

buildings use almost 40% of the primary energy and approximately 70% of the electricity in the United States
(EIA, 2005). The energy used by the building sector continues to increase, primarily because new buildings
are constructed faster than old ones are retired. Electricity consumption in the commercial building sector
doubled between 1980 and 2000, and is expected to increase another 50% by 2025 (EIA, 2005).
Energy efficiency is simply the ratio of energy services out to energy input. It means getting the most
out of every unit of energy you buy. It is mainly a technical (and historical) process caused by stock turnover
where old equipment is replaced by newer more efficient ones. It is generally a by-product of other social
goals: productivity, comfort, monetary savings, or fuel competition. Measuring energy efficiency, particularly
on a macro scale, is fraught with methodological problems and is very hard to measure over time, and
between countries or sectors (Schipper and Haas, 1997). As pointed out by Hartley (1990), renewable energy
technologies produce marketable energy by converting natural phenomena into useful energy forms. These
technologies use the energy inherent in sunlight and its direct and indirect impacts on the Earth (photons,
wind, falling water, heating effects, and plant growth), gravitational forces (the tides), and the heat of the
Earths core (geothermal) as the resources from which they produce energy. Energy-efficient buildings use
less energy, cost less to operate, and improve comfort, saving money for homeowners and businesses.

2.3. Water efficiency

During the next years, water efficiency and conservation will become critical element in green
construction. Buildings consume 20% of the worlds available water and water resources become scarcer each
year, according to the United Nations Environmental Program. Water efficiency means using improved
technologies and practices that deliver equal or better service with less water. Drinking water systems can
implement water efficiency measures and still deliver an unchanged or improved level of service to
consumers while reducing overhead costs. Improving water efficiency reduces operating costs (e.g., pumping
and treatment) and reduces the need to develop new supplies and expand our water infrastructure. It also
reduces withdrawals from limited freshwater supplies, leaving more water for future use and improving the
ambient water quality and aquatic habitat (www.epa.gov).
The first step for increasing water efficiency at home is to reduce the use of drinking water for non-
consumption purposes. There are two ways to do this: collect rainwater and reuse indoor wash water. You can
install cisterns above or below ground that will collect and store run-off from rooftops and other impervious
surfaces; as well as from laundry machines, dishwashers, bathtubs and sinks (this is classified as grey water,
meaning that it does not include human waste or sewage).

2.4. Environmentally preferable building materials and specifications

During construction or demolition phase building materials and components are often discarded with
construction debris accounting for 28% of landfill waste in USA. The assessment of environmentally
preferable building materials begins with the establishing criteria for the evaluation of building materials. The
material criteria may differ per project. Criteria depend on if the project is a new construction, a renovation or
an existing building. According to Froeschle 1999 there are sixteen environmental material criteria listed in
Table 1. These criteria can help create more sustainable buildings. Project Specifications can help in three
directions a) in environmental procedures, b) in environmentally friendly building materials and c) in
environmental applications.

2.5 Waste building reduction

Construction and demolition waste management has become one of the major environmental problems in
many countries. There are two main kinds of building construction waste i) structure waste and ii) finishing
 K.I. Vatalis et al. / Procedia Economics and Finance 5 (2013) 747 756 751

waste (Skoyles and Skoyles, 1987). Concrete fragment, reinforcement bars, abandoned timber plate and
pieces are generated as structure waste during the construction phase. Finishing waste is generated during the
finishing stage of a building. Broken raw materials like mosaic, tiles, ceramics, paints and plastering materials
are wasted because of careless use. Bossink and Brouwers (1996) estimated from a study that about 1-10% by
weight of the purchased construction materials leave the sites of residential projects as waste. Ehshassi (1996)
found from a study of 86 housing projects in the Gaza strip that the materials loss resulting from direct and
indirect wastes was about 3.6-11%, which was significantly higher than the values that were normally allowed
(2 - 4.5%).

Table 1. Environmental material criteria for green buildings (Froeschle, 1999)

Criteria/variables
1 low toxicity
2 minimal emissions
3 low VOCs concentration reduce the amount of indoor air contaminants
4 recycled content
5 resource efficient
6 recyclable materials
7 reusable components
8 sustainable sources
9 durable materials
10 moisture resistant
11 energy efficient
12 water conserving
13 improved IAQ
14 healthful maintenance
15 local product
16 affordable material
Description
materials with reduced toxicity or nontoxic concentrations
products with low or no chemical emissions (VOCs, CFCs)
products with identifiable recycled content
products manufactured with reduced energy consumption wastes & GHGs
materials recyclable at the end of their useful life
building components that can be reused or salvaged
renewable natural materials harvested from sustainable sources
material comparable to conventional with long life expectancies
products that resist to moisture or inhibit the growth of contaminants
materials that help reduce energy consumption in buildings
products and systems that help reduce water consumption
systems or equipment that promote healthy IAQ
material that require simple and nontoxic cleaning
regional materials saving energy and transportation to the project site
building cost comparable to conventional material

2.6 Toxics building reduction

Many building materials emit air pollutants. Taking into consideration the reduction of toxic
emissions from building materials, the effort is focused on three groups of indoor air pollutants:
i)carcinogens, ii) irritants, and iii) odors. Human carcinogens, are few in number and cause severe
diseases, for which reason their use should be avoided to the greatest practicable extent. The eye and
airway irritants, are numerous and represent so many groups of chemical substances that great
prospects for substitution exist. The odors should in general be avoided. These materials are used today as
sealants, glues and adhesives paints, lacquers and wall/floor coatings (Andersen et al., 1982).

2.7 Indoor air quality, IAQ

Indoor air quality problems are not limited to homes. Many office buildings have significant air pollution
sources. Some of these buildings may be inadequately ventilated. For example, mechanical ventilation
systems may not be designed or operated to provide adequate amounts of outdoor air. Providing a good indoor
air quality in buildings does not refer to green buildings. People generally have less control over the indoor
environment in their offices than they do in their homes. As a result, there has been an increase in the
incidence of reported health problems. Some typical problematic VOCs compounds released from building
752 K.I. Vatalis et al. / Procedia Economics and Finance 5 (2013) 747 756

materials include formaldehyde, acetaldehyde, toluene, isocyanates, xylene, and benzene. VOCs are often
emitted at high levels and reduced to lower levels over time. In terms of indoor quality we mean air quality in
acceptable levels. The most important indoor air quality (IAQ) control measures include ventilation and
climate control Ventilation is viewed by many researchers as an essential process for the IAQ control. The
main ventilation considerations for the IAQ control according (Levin 1991) are: 1) Dilution by outdoor air
ventilation, 2) air intake locations, 3) building exhaust locations, 4) air cleaning and filtration, 5) space air
distribution, 6) heat recovery and 7) microbial control.

2.8 Smart growth and sustainable development

Sustainable development has been defined in many ways, but the most frequently quoted definition is from
Our Common Future, also known as the Brundtland Report (WCED 1987), as follows: Sustainable
development is development that meets the needs of the present without compromising the ability of future
generations to meet their own needs. It contains within two key concepts: a)the concept of needs, in particular
the essential needs of the world's poor, to which overriding priority should be given and b) the idea of
limitations imposed by the state of technology and social organization on the environment's ability to meet
present and future needs.
Within framework smart growth is an urban planning and transportation concept that concentrates growth
in compact walkable urban centers to avoid sprawl. Communities are using creative strategies to develop,
preserve natural lands and critical environmental areas, protect water and air quality, and reuse already
developed land, in the resources conservation by reinvesting in existing infrastructure and reclaiming historic
buildings. By designing neighborhoods that have shops, offices, schools, churches, parks, and other amenities
near homes, communities are giving their residents and visitors the option of walking, bicycling, taking public
transportation, or driving as they go about their business. A range of different types of homes makes it
possible for senior citizens to stay in their homes as they age, young people to afford their first home, and
families at all stages in between to find a safe, attractive home they can afford. Through smart growth
approaches that enhance neighborhoods and involve local residents in development decisions, these
communities are creating vibrant places to live, work, and play. The high quality of life in these communities
makes them economically competitive, creates business opportunities, and improves the local tax base (EPA,
2010).

2.9 Environmentally innovative projects and services

Environmental innovation in construction is the development of projects that contribute to

sustainable development. This includes a range of ideas, from environmentally friendly technological
advances to socially acceptable innovative paths towards sustainability. Rapid changes in the economy and
society create demands for new constructions of the built environment. Building innovations can provide the
critical component of a competitive strategy in the construction sector. Investments in projects and in
construction innovations and services are essential, but the initial high costs may make it difficult. A way to
measure the annual innovative variation in construction sector is a composite indicator that ranks
countries/economies/projects in terms of their environment to innovation and their innovation outputs. This
indicator is called global innovation index.

3. Materials and methods

The research method is based on a questionnaire survey of 32 participants who were asked to assess
nine sustainability components which affect the decisions for green building projects (Table 2). These were:
1) Life cycle assessment, 2) Energy efficiency and renewable energy of the buildings, 3) water efficiency, 4)
environmentally preferable building materials and specifications, 5) waste reduction, 6) toxics reduction, 7)
 K.I. Vatalis et al. / Procedia Economics and Finance 5 (2013) 747 756 753

indoor air quality, 8) smart growth and sustainable development and 9) Environmentally innovative projects.
The criteria for the selection of participants were: a) practitioners should have extensive working experience
in the green construction sector; b) clients should be interested to acquire a space in a green construction
project, c) Group or banking investors are willing to promote green building projects in Greece.

Table 2. Rating criteria of sustainability components

Components rating criteria Consideration Net
1 2 3 4 5 6 7 8 9 10 weight score
X1 Life Cycle Assessment 0.1 0.580
X2 Energy Efficiency & 0.15 1.159
Renewable Energy
X3 Water Efficiency 0.1 0.727
X4 Environmentally 0.1 0.597
Preferable Building
Materials & Specifications
X5 Waste Reduction 0.1 0.627
X6 Toxics Reduction 0.15 1.155
X7 Indoor Air Quality 0.1 0.747
X8 Smart Growth & 0.1 0.503
Sustainable Development
X9 Environmentally 0.1 0.717
Innovative Projects
Totals 1.0

A total of 32 participants were asked to fill the above questionnaire according to the intensity of the rating
criteria with a range from 1 to 10 as described in Table 3. The weights of components (Table 2) have been
defined according the international literature (Vatalis and Kaliambakos 2006) and the resulting net score
presents the value of rating x weight.

Table 3. Ranking importance of green components

Rank description of importance
1 indifferent
2 low importance
3 weak or slight importance
4 moderate importance
5 moderate plus
6 strong importance
7 strong plus
8 very strong or demonstrated importance
9 very-very strong
10 absolute importance

Thirty two questionnaires were returned from the participants whose identity described as follows: a)
clients with particular interest to live in green buildings, fifteen of them 15, b) brokers (seven) 7, c)
Construction engineers - Managers (five) 5, d) Contactors - developers (three) 3 and e) funds (two) 2.
754 K.I. Vatalis et al. / Procedia Economics and Finance 5 (2013) 747 756

4. Results and discussion

The respondent results indicate how participants prioritized the sustainability components. Energy
efficiency and renewable energy (X2) followed by toxics reduction in the buildings (X6) were the most
important component of the respondents. From the statistical analysis (Table 4 and Figure 2) of the answers
result that, the variables X2 (energy efficiency) and X3 (water efficiency) are linear correlated, with Pearson
correlation 0.387 and sig. 0.035. The X8 component (Smart growth and sustainable development) is linear
correlated with the X3 (Water efficiency) and X8 (Smart growth) components. The Pearson correlation for X8
(Smart growth) in relation with X3 (water efficiency) are -0.410 and sig. 0.024 while for X8 (Smart growth) in
relation X6 (toxic reduction) Pearson correlation is 0.481 and sig. 0.007.

Table 4. Descriptive statistics and assessment of variables

Mean SD 95% confidence rank
lower - upper
X1 5.8 1.71 5.16 - 6.43 8
X2 7.7 1.31 7.24 - 8.22 1
X3 7.2 2.04 6.50 - 8.03 4
X4 5.9 1.79 5.29 - 6.63 7
X5 6.2 1.59 5.67 - 6.86 6
X6 7.7 8.00 7.18 - 8.21 2
X7 7.4 1.43 6.93 - 8.00 3
X8 5.0 1.69 4.40 - 5.66 9
X9 7.1 1.20 6.71 - 7.61 5

Figure 2. Mean values of components

The ranking sustainability components (Table 4) indicate that the X2 component regarding the Energy
efficiency and renewable energy of the buildings is the most important component of the sustainable
construction. As second factor comes the X6 toxics reduction in the buildings. Third component is the indoor
air pollution (X7) affects all the income levels. Water efficiency (X3) remains the forth component in priority
of importance. Pressures today caused by lack of safe drinking water under the stress from national economic
sectors give us opportunities and provide incentives to initiate processes leading to improved water
management of building projects. For example the recycled water can satisfy most water demands, as long as
it is adequately treated to ensure water quality appropriate for large scale use. As a fifth component in order
of importance comes the preference of respondents to share Environmental innovative projects (X9).
Environmental innovation tries to respond in pollution abatement expenditures in building projects. Sixth
 K.I. Vatalis et al. / Procedia Economics and Finance 5 (2013) 747 756 755

priority is the waste reduction in buildings (X5). The rapid urbanization of Greece in recent years and the
irrational management of wastes are associated with environmental pressures, such as reduction of the quality
of life and the well-being of the population, followed by the environmentally preferable building materials and
specifications (X4). It is known that the materials from which a building is constructed make a significant
contribution to its overall impact on the environment. The conservation of material and improved techniques
reduce the environmental impact of buildings and create more resource-efficient models of construction,
renovation, operation and maintenance. Under these circumstances, Life cycle assessment (X 1) is assessed as
the eighth most important variable in sustainable construction. Finally, the success of the principle of smart
growth and sustainable development (X8) was ranked as the least important factor in sustainable construction.
Sustainable building with its multiple benefits for enterprises and the stakeholders, cooperating
organizations and consumers that have been pointed by the analysis, constitute a direct necessity this period of
time in Greece (Papadopoulos et al., 2012).

5. Conclusions

Buildings from the sustainable point of view are considered during the life cycle assessment a key
toward the improvement of environmental quality and energy conservation. The conclusions research are
that people should live in an environment that is designed and operates incorporating a) energy
efficiency and renewable energy, b) with reduction of toxic materials c) without indoor pollution, d) water
saving, e) with trust in environmentally innovative projects f) in waste minimization and pollution
prevention, g) reuse of friendly building materials in order to achieve sustainable development also ensuring
a better quality of life inside buildings based on the principals of green buildings economy. At the moment
due to the deep economic crisis there is no strategy for green construction projects in Greece. It is to be hoped
that the development of experience, knowledge of economic benefits and competence will encourage
developers, occupiers and authorities to support an interactive strategy among the different actors involved in
construction in the country.

References

Andersen, I., Seedorff, L., Skov A. (1982). A strategy for reduction of toxic indoor emissions.Environment International 8, 11-16.
Andersen, I. Seedorff, L. Skov, A. (1982) A strategy for reduction of toxic indoor emissions. Environment International (8)11-16.
Bossink, B.A.G. and Broouwers, H.J.H. (1996) Construction waste: quantification and source evaluation. Journal of Construction
Engineering and Management, 122(1), 5560.
Bribin, I.Z., Usn, A., Scarpellini, S. (2009) Life cycle assessment in buildings: State-of-the-art and simplified LCA methodology as a
complement for building certification. Building and the Environment.
Chwieduk, D. (2002). Towards sustainable energy buildings. Applied Energy, 76, 211-217.
EIA, Energy Information Administration (2005) Annual Energy Review 2004. www.eia.doe.gov/emeu/aer/contents.html. Wash-ington,
DC: U.S. Department of Energy,
Enshassi, A. (1996) Materials control and waste on building sites. Building Research and Information, 24(1), 314.
EPA, Environmental Protection Agency (2010). Life Cycle Assessment green construction web.
European Directive 2002/91/EC on the energy performance of buildings
Froeschle, L.M. (1999). Environmental assessment and specification of green building materials. The construction specifier 53-57.
Hartley D.L. (1990) Perspectives on renewable energy and the environment J.W. Tester, D.O. Wood, N.A. Ferrari (Eds.), Energy and the
environment in the 21st Century, MIT, Massachusetts.
Jnsson, . (2000). Tools and methods for environmental assessment of building products methodological analysis of six selected
approaches. Building and Environment, 35 (2000), pp. 223238
Levin H. (1991) Critical building design factors for indoor air quality and climate. Current status and predicted trends. Indoor air, 1, 79-
92.
Papadopoulos, I., Trigkas, M., Papadopoulou, A. (2012). The Entrepreneurial Marketing Strategy of Sustainable Building in Greece.
International Conference on Contemporary Marketin g Issues (ICCMI) 535-541.
756 K.I. Vatalis et al. / Procedia Economics and Finance 5 (2013) 747 756

Schipper, L., Haas, R. (1997) Cross-country comparisons of indicators of energy use, energy efficiency and CO2 emissions. Energy
Policy, 25 (79)
Skoyles, E.R. and Skoyles, J.R. (1987) Waste Prevention on Site, Mitchell Publishing, London.
United Nations Environment Programme, UNEP (1992) Environment for development. Environment and development Agenda. Agenda
21, Brazil.
Vatalis K., Manoliadis O., Charalampides G. (2011). Assessment of the economic benefits of sustainable construction in Greece. Int
journal of sustainable development and World ecology.18(5) 377-383.
Vatalis, K.I., Kaliampakos, D.C. (2006). An overall index of environmental quality in coal mining areas and energy facilities.
Environmental Management, 38(6), 1031-1045.
World Commission on Environment and Development, WCED (1987). Our common future. Oxford: Oxford University Press, 43.

http://www.epa.gov/greenbuilding/pubs/components.htm
http://water.epa.gov/infrastructure/sustain/wec_wp.cfm.
http://www.epa.gov/dced/about_sg.htm#principles
http://en.wikipedia.org/wiki/Green_building
http://www.wbdg.org/design/greenspec.php
 Journal of Building Engineering 11 (2017) 2529

Contents lists available at ScienceDirect

Journal of Building Engineering

journal homepage: www.elsevier.com/locate/jobe

Sustainability and green building rating systems: LEED, BREEAM, GSAS MARK
and Estidama critical analysis
Omair Awadh1
AESG Green Building Consultant, Dubai, UAE

A R T I C L E I N F O A BS T RAC T

Keywords: In the built environment, a green building rating system provides the project team a framework and a tool to
Sustainability help achieving a better sustainable development. The research presents how Green Building Rating Systems
Green building rating system (GBRSs) are environmental-oriented tools and should not be confused with Sustainability Assessment Systems;
the latter is dened by the sustainability three pillars; environmental, social and economic. Achieving a green
building certication does not necessarily mean that the building succeeded in achieving its environmental
targets. The nancial-driven and prescriptive implementation of GBRS are reasons behind a masked
sustainability outcome.
This paper presents an objective analysis between two internationally applied GBRSs; LEED and BREEAM,
and two particularly developed for the gulf region; Estidama and GSAS. Those four systems are analyzed with
respects to them addressing and prioritizing the sustainability pillars. The study also quantitatively discusses the
credit weighting given by these systems, focusing on energy and water criteria.
Limitations: of GBRSs application and possible areas of improvement have been highlighted, such as climate
change adaptability and the importance of sustainable communities and cities trend. The aim is to help
designers and construction stakeholders in dening the development sustainability targets and objectives,
without compromising on the local context and regional agenda.

1. Introduction Sustainability Rating Systems (SRSs) are considered to have three

Environment, society, and economy are the three pillars of sustain-
ability and the majority of sustainability rating systems have been
developed in line with those pillars [1].
According to Brundtland [2], sustainable development is a devel-
opment that meets the present needs and at the same time preserves
the resources for future to meet the next generations needs [2]. Mateus
and Bragana [3] dened the sustainable development as the best
trade-o between the three pillars; environmental, social, and econom-
ical, that strive for greater compatibility [3].
The sustainable growth debate is generally related to depending on
strategies developed over a range of time and space scales based on the
current practices and predictions [4]. Sustainability assessment tools
contribute to balancing between these dimensions or pillars (environ-
mental, social, and economical), and to enhancing practicality and
resiliency. Therefore, they should be able to consider constant techno-
logical development and multi-level applications [5]. The chart in Fig. 1
illustrates the concept of sustainability as a scale depends on time and
space.
stages [6];
(1) Classication: Environmental change expectations determine the
impact category based on various inputs and outputs.
(2) Characterization: Identify the impact of each input and output with
relation to their category.
(3) Valuation: Category weighting in comparison to other categories.
A Green Building Rating System (GBRS), as dened by Nguyen and
Altan [7], is a tool that the building industry uses to evaluate, enhance,
and/or promote developments sustainability. Those systems provide a
tool, guidance, and/or better insights into sustainability through
information analysis, valuations and comparisons [7]. They try to
facilitate the following:
1. Enhance buildings operational performance,
2. Minimize environmental impact,
3. Measure buildings eect on the environment, and
4. Objectively evaluate and judge buildings development.

E-mail address: omairawadh@gmail.com.

1
Oce 604, Cayan Business Centre, Barsha Heights, Dubai, UAE.

http://dx.doi.org/10.1016/j.jobe.2017.03.010
Received 4 August 2016; Received in revised form 24 March 2017; Accepted 27 March 2017
Available online 28 March 2017
2352-7102/ 2017 Elsevier Ltd. All rights reserved.
O. Awadh
Fig. 1. Sustainability as scale (time and space) dependent concepts. Source: Costanza &
Patten [4].
Knowing that there are substantial dierences between GBRSs,
sustainability-related outcomes could dier signicantly depending on
the system applied and the understanding and experience in sustain-
able design approaches of the project team [8,9]. With the focus on the
Gulf region, this paper looked at the sustainability practices in line with
the green building codes. The green building codes of Abu Dhabi and
Qatar have been assessed and compared to two of the most-applied
systems worldwide. An introduction to the study-related GBRSs is
presented hereafter.
1.1. BREEAM, LEED, GSAS, and Estidama
Estidama Pearl Rating System, GSAS, LEED and BREEAM, are
Total Quality Assessment (TQA) systems, whereby projects are
awarded points for prerequisites and optional credits that are grouped
under a number of categories.
The British Building Research Establishment Environmental
Assessment Method (BREEAM) was rst launched in UK, 1990.
International versions have been released for certifying projects world-
wide, and BREEAM International for New Construction 2016 is the
latest. This system's evaluation is expressed as a percentage of success
over total available points: 30% for pass classication, 45% for Good,
55% for Very Good, 70% for Excellent, and 85% for Outstanding. The
categories for new construction projects are; Management, Health &
Wellbeing, Energy, Transport, Water, Materials, Waste, Land Use &
Ecology, Pollution, and Innovation [10].
Leadership in Energy and Environmental Design (LEED) rating
system was rst released in 1998 by the US Green Building Council
(USGBC). LEED is the most popular and widely used green building
rating system. The last released LEED version 4 for New Construction
(NC) in 2014 has four levels of certication, depending on the point
thresholds achieved: Certied (4049 points), Silver (5059 points),
Gold (6079 points), and Platinum (80 points and above). There are
seven evaluation categories to obtain up to 126 possible points [11].
In 2009, an integrated and performance based green building
assessment rating system; GSAS, was established by the Gulf
Organization of Research and Development (GORD) in Qatar. The
Global Sustainability Assessment System (GSAS) was modeled on best
practices from the most established global rating schemes including,
but not limited to, BREEAM (United Kingdom), LEED (United States),
GREEN GLOBES (Canada), CEPAS (Hong Kong), CASBEE (Japan),
and the International SBTOOL. GSAS has 8 categories and 16 Stars
certication can be achieved [12].
Looking into Estidama, it is mostly developed using LEED and
BREEAM elements whilst applying the system to the unique local
needs and environment [13]. Estidama Pearl Rating System was
established by Abu Dhabi Urban Planning Council (UPC) in 2010.
26
Journal of Building Engineering 11 (2017) 2529
Under the Pearl Building Rating System (PBRS), ve levels of
certications can be obtained as follow; 1 Pearl (only prerequisites),
2 Pearl (prerequisites+60 points), 3 Pearl (prerequisites+85 points), 4
Pearl (prerequisites+115 points), and 5 Pearl (prerequisites+140
points). Eight categories are available in the PBRS with 180 total
available points [14].
In the author's opinion, the green building certication should not
be the target but rather the process itself. The aim of this study is to
identify the merits and limitations of GBRSs, and to highlight the need
for setting a project-specic sustainability objectives based on the
nature of the project, with relation to its context and regional targets.
2. Methodology
Four GBRSs have been selected based on how they best t the
objectives of the study and the area of the author's own experience.
Two of the most commonly applied international systems (BREEAM
International 2016 and LEED NC v4) and two regulatory systems in the
Gulf region (GSAS 2015 and Estidama PBRS v1.0) have been studied in
terms of their whole approach of addressing the three pillars of
sustainability.
Quantitative analysis has been conducted as a method for categor-
izing each system credits under these pillars. Literature reviews are
used as part of the discussion for support and further analysis. Taking
the case of new construction commercial buildings, weightings given by
these systems to energy and water categories and credits have been
identied.
3. Results and discussion
3.1. GBRSs and Sustainability
The variety of available GBRSs can be argued to enhance sustain-
able building design, directly and indirectly [3]. Brophy [8] study
conrms that these systems provide a good framework to integrate
sustainability measures into a development, and the enhancement is
relatively better when the project team are unfamiliar with sustainable
design concepts [8]. Similar to other systems, where the rating system
is used inappropriately it can result in a poor building performance
with a sustainability mask. In his study, Brophy concluded that (1) only
the design team commitment and expertise can guarantee the delivery
of appropriate sustainable building design, and (2) that these systems
must be simple to make them useful as design tools throughout the
construction development [8].
On the other hand, Fenner and Ryce [6] study concluded that such
systems could minimize the environmental unsustainability and fail to
address social and economic measures [6]. The same study also
summarized green assessment schemes critics as follow;
(4) No universal applicable scheme.
(5) Require regular on-going updates.
(6) Integrated approach is essential for ecient application.
(7) Assumptions are the base of environmental impact analyses.
(8) Occupancy and operation prole variations are somehow ne-
glected.
According to Castro et al. [15] and based on the division proposed
by ISO/AWI 21929; Energy, Materials, Waste and Pollution categories
are directly related to the environmental pillar. Water category falls
under environmental-economic, while Sustainable Sites category is
environmental-societal related. Indoor Environmental Quality and
Well-being categories are economic-societal related and transport
category is the only one that relates to the three pillars together [15].
In order to examine how GBRSs address the three pillars of sustain-
ability, the following four charts (Figs. 2, 3, 4 and 5) illustrate the
weighting given for environmental, social, and economic pillars. Credit
O. Awadh
Fig. 2. BREEAM International 2016 credits weighting of Environmental, Social and
Economic Pillars.
Fig. 3. LEED NC V4 credits weighting of Environmental, Social and Economic Pillars.
Fig. 4. GSAS 2015 credits weighting of Environmental, Social and Economic Pillars.
Fig. 5. Estidama PBRS V1.0 credits weighting of Environmental, Social and Economic
Pillars.
27
Journal of Building Engineering 11 (2017) 2529
points have been counted for the most related pillar, regardless to the
category it belongs to. A few credits are categorized as procedural;
these are related to commissioning and integrative process credits in
LEED, GSAS and Estidama, and responsible construction and com-
missioning credits in BREEAM. Procedural credits could have an
indirect inuence on one or more sustainability pillar.
BREEAM International 2016 for New Construction rating system
deemed to address the environmental, social, and economic pillars with
the least unbalanced weighting. However, all four rating systems give
the environmental pillar the most importance and the economic pillar
the least. Based on this, the four GBRSs assess the environmental
impact of developments rather than their sustainability. Cole [16]
argued that although GBRSs are environmental assessment methods,
they can certainly provide a useful framework for guiding project
decisions towards a sustainable design outcome [16].
When it comes to the economic pillar of sustainability, LEED has
not attributed any weighting for it; which is one element that gets the
most resistance. As design is most likely driven by cost, the economic
viability of a building is thoroughly covered automatically in project
decisions. However, and in most cases, operational and maintenance
costs are not considered. In the developing countries, where construc-
tion is continuously increasing, sustainability practices are more or less
driven by the green certication with less attention given to the
operation stage. Estidama operational system has been developed but
still in the piloting stage. In addition, operation and maintenance
rating systems for existing developments are available under LEED and
BREEAM which help in assessing and improving buildings environ-
mental practices during operation.
It must be noted that life cycle costing is an optional credit and is
being given more attention recently in the Middle East. Most of GBRSs
encourage considering the whole building life cycle assessment (LCA),
while the bar is being brought up to consider the life cycle design within
the integrative sustainable design approach. However, the design for
climate change impacts and future adaptability is a new trend in
buildings sustainable design which can be introduced through compu-
ter simulations and assessment tools.
In terms of the social pillar, it is at risk of not being adequately
covered in projects decision processes and not given signicant
weighting in GBRSs. BREEAM gives the social aspect the second
priority after the environmental aspect, around 19% of the system
available points. GSAS gives it around 13%, while Estidama and LEED
social related credits weighting does not exceed 10%. According to
Berardi [17], addressing the social aspect of sustainable development
requires contextual design and relating the building to its neighbor-
hood [17]. LEED and BREEAM have looked into this through the
neighborhood rating systems rather than building systems. The same is
applied to Estidama Pearl Community Rating System (PCRS). Based on
this, it is assumed that buildings are socially connected to their
community/ neighborhood only if they are part of a rated/certied
community. But in the case of building in a non-rated community, the
social shortfall in the GBRS is much valid yet.
USGBC is piloting LEED of Communities and LEED for Cities new
rating systems. The objectives of those newly introduced systems are
[18];
1. Improving quality of life through cities benchmarking, and
educating residents, visitors and business owners.
2. Verifying leadership through tracking and reporting progress
towards city's emissions targets and countries climate action goals.
In addition, consistently communicating the city's sustainability
performance and goals around the world.
3. Improving sustainability performance by adopting policies
that help to reduce energy, water, waste, pollution and CO2 at the
city scale, and in turn improve air and water quality.
O. Awadh
3.2. Comparison between GBRSs
Comparing the Energy category points weighting to the overall
available points within the same system, Energy category points
contribute the most in LEED, 26%, while it is around 2324% in
BREEAM, GSAS and Estidama. The second most contributing category
diers between the four. BREEAM gives Health & Wellbeing category
the second highest weighting, 16%. This category is related to Indoor
Environmental Quality and Occupants comfort. LEED gives the second
highest weighting to Location & Transportation category, 25%. Even
though LEED and BREEAM are the most internationally applied
systems, the dierence is clear on giving the second highest weighting
to out-of-building related category in LEED while it is indoor related
category in BREEAM.
The Water and Indoor Environment categories in GSAS have the
same weighting of 15% each; whereas the Water and Energy categories
also weigh the same at 24% in the Estidama rating system for
buildings. The scarcity of oil reserves resiliency and water shortage
in the Gulf region is mainly the reason of prioritizing Energy and Water
categories.
An in-depth comparison between the systems in relation to energy
and water eciency has been conducted to further present variations
between GBRSs. As the rating systems do not perfectly overlap, the
following comparison cannot be parallel presented.
3.3. Energy category comparison
When it comes to the Energy category; energy eciency, carbon
emissions reduction, and renewable energy credits are the rst to be
accounted for in most GBRSs. In addition, commissioning, measure-
ment and verication are highlighted in the four systems emphasizing
the importance of performance monitoring and testing. Lighting
systems impact has been addressed in all. Demand-based control and
the automation aspect are considered in LEED, Estidama and GSAS
through dierent approaches. Table 1 shows energy credits considered
in those GBRSs.
Renewable energy generation is highly encouraged in Estidama
through the allowance of 8 points under renewable energy generation.
Where 20% of annual energy demand is provided through renewable
energy, 8 points can be secured. BREEAM seems to be more demand-
ing when it comes to renewable energy weighting; maximum of 3
points for 30% contribution. Up to 3 points can be earned under LEED
for 10% renewable energy generation, while the same 10% entitles the
project for 1 point only under BREEAM. This variation could be related
to the local environment challenges, smart grid provisions, and
government subsidies.
As for energy eciency for new construction commercial projects,
BREEAM is the most stringent system to earn points under this credit
(maximum of 15 points that require 90% reduction below baseline is
achieved), keeping in mind that the energy baseline diers from system
to another. Estidama provides the same number of points (up to 15
points) under this credit with less energy reduction requirement (60%
Table 1
Energy related credits of BREEAM, LEED, GSAS, and Estidama.
Credit BREEAM LEED V4 Estidama GSAS
Energy Eciency
CO2 Emissions
Sub-Metering/ Measurement
Commissioning
Lighting
Renewable Energy
Demand Response
Automated Control
Peak Load Reduction
Journal of Building Engineering 11 (2017) 2529
Table 2
Water credits of BREEAM, LEED, GSAS, and Estidama.
Credit BREEAM LEED v4 Estidama GSAS
Baseline water consumption
Indoor water use reduction
Outdoor water use reduction
Leak detection system
Water metering
Flood risk
Water runo
Heat rejection - cooling tower
water
Water modelling during design
Rainwater/ graywater reuse
reduction below energy baseline). LEED v4 provides more points with
less energy reduction requirement; 50% reduction entitles for 18
points. It is worth mentioning that LEED v4 energy baseline is
following ASHRAE 90.1: 2010, which is more stringent than the
Estidama baseline of ASHRAE 90.1: 2007.
3.4. Water category comparison
BREEAM is more focused on water monitoring, ooding and
stormwater, which are signicant concerns where the system is
developed in, the UK. LEED, Estidama and GSAS prioritize water use
reduction in addition to waste water reuse. The ood risk aspect is only
considered in BREEAM while design water modelling is mentioned
under LEED v4 only. Water metering is not addressed within the GSAS
system only. Table 2 provides breakdown for water credits available
under each system.
Because of water scarcity in the gulf region, Estidama encourages
indoor water eciency the most. In oces, 15 points can be earned
where no more than 10.8 l/person/day of water is being consumed. In
BREEAM and LEED, the points available are 6 for oces project. No
more than 15 l/person/day of water shall be consumed in order to
achieve all 6 points. Water consumption prerequisite in BREEAM is
easy to comply with; 37 l/person/day or less. LEED and Estidama are
more stringent as interior water consumption baseline should not
exceed 25 and 27 l/person/day, respectively.
The dierences between GBRSs are related but not limited to; (1)
considering various and interrelated categories, (2) emphasizing the
need for communication or not, (3) prioritizing and weighting con-
cerns. Moreover, the structure of each system is not always accessible
and criteria do not perfectly overlap. The same study also indicated the
necessity of improving the communicability of the assessment systems
[19]. Lack of communicability could hinder the take-up rate of the
green building rating tools and also be a barrier to increasing the
knowledge about sustainability in the built environment [20]. Moktar
[21] research conrmed the impact variation as a result of adopting
dierent GBRSs, but all systems showed positive impact on the
environment, building operational performance and occupants well-
being [21].
According to Reed et al., each country or region should have its own
sustainability standard but at the same time, standardizing a rating
system should not consider the local environment as the highest
priority over global needs [20]. Voinov and Farle [22] study also
supports a case that global solutions should drive local level action
[22]. This will prioritize dierent subsystems sustainability based on
its place within the system hierarchy. Kibert [23] study stated that the
following parameters are the main contributors toward achieving
sustainable development [23];
1. Regulation and public policy integration
2. Finance and insurance industries
3. Education and construction stakeholders
28
O. Awadh
It can be argued that those systems that are policed more
stringently, through detailed reviews and construction site audits, can
oer higher substantiation of sustainability claims. Estidama is a very
good example supporting this statement where it is mandated for all
new projects within the emirate of Abu Dhabi, UAE. Masdar City is
another good example of setting a city sustainability targets and based
on those establishing the sustainability key performance indicators
(KPIs) on both, building and infrastructure levels. Masdar City, within
its context, plays a main role in supporting the country agenda and
educating its residents.
4. Conclusion
BREEAM, GSAS and Estidama systems give the highest weighting
to the Energy category while LEED prioritizes the Indoor
Environmental Quality category. Because of the energy aspect impor-
tance, enhanced energy performance credit is given the highest
weighting in the four systems. Achieving enhanced energy performance
and renewable energy related points under BREEAM is the most
rigorous. LEED is the most lenient in energy performance credits while
Estidama is lenient for renewable energy generation. On the other
hand, Estidama is the easiest to earn high number of points for water
reduction while LEED and BREEAM follow. Estidama and LEED
interior water minimum reduction requirement is more stringent than
BREEAM's. This constructive comparison shows the need to focus on
the process toward sustainable design rather than targeting the
certication or higher rating, as the last is subjective.
In terms of addressing the environmental, economic and social
pillars of sustainability, all four rating systems are focused on the
environmental pillar while giving the social pillar the least importance.
Despite the arguments of GBRSs ability of structuring environmental
criteria, they tend to help to include sustainability as part of the
decision-making more commonly, integral and consistently, in addition
to setting out a sustainability-focused design team.
It should be noted that this study does not consider the rigor of
application of a GBRS. The author would argue that GBRS is a useful
framework for guiding the environmental sustainability of a project but
it is also important to consider the sustainability targets of the project
with respect to overall social and economic perspectives. Nevertheless,
integrative approach, systematic analysis and innovative thinking need
to be adopted in conjunction with the assessment tools throughout the
project development. Life cycle design, climate change adaptability,
along with computer modelling and tools are the new trend in
sustainable buildings design.
The presented analysis highlights the importance of identifying a
project-specic sustainability targets in line with the contextual
objectives. Green Buildings can support their surroundings sustainable
growth but might not be able to address the social and economic
aspects. On the other hand, they can better serve a community or city
sustainability targets and collaborate toward a holistic approach.
29
Journal of Building Engineering 11 (2017) 2529
Acknowledgements
This research was supported by AESG Green Building Consultant.
References
[1] United Nations, Resolution adopted by the General Assembly. 60/1, Agenda items
46 and 120. 2005 World Summit Outcome, 2005.
[2] United Nations World, Commission on Environment and Development (WCED).
Our Common Future; Brundtland Report. Oxford University Press, 1987.
[3] R. Mateus, L. Bragana, Sustainability assessment and rating of buildings:
developing the methodology SBToolPT-H, Build. Environ. 46 (2011) 19621971.
[4] R. Costanza, B.C. Patten, Dening and predicting sustainability, Ecol. Econ. 15
(1995) 193196.
[5] L. Bragana, R. Mateus, H. Koukkari, Building sustainability assessment,
Sustainability 2 (2010) 20102023. http://dx.doi.org/10.3390/su2072010.
[6] R.A. Fenner, T. Ryce, A comparative analysis of two building rating systems. Part 1:
evaluation, Eng. Sustain. 161 (2007) 5563. http://dx.doi.org/10.1680/
ensu.2008.161.1.55.
[7] B.K. Nguyen, H. Altan, Comparative review of ve sustainable rating systems, Porc.
Eng. 21 (2011) 376386.
[8] V. Brophy, Building EnvironmentalAssessment a useful tool in the future delivery
of holistic sustainability? in: Proceedings of the 2014 World Sustainable Building
Conference, Barcelona: Paper 119, 2014.
[9] R.C. Retzla, Green building assessment systems: a framework and comparison for
planners, J. Am. Plan. Assoc. 74 (4) (2008) 505519. http://dx.doi.org/10.1080/
01944360802380290.
[10] BRE Global, BREEAM International New Construction 2016, Technical Manual
SD233 Issue: 1.0, 2016.
[11] U.S. Green Building Council. 2013. LEED Reference Guide for Building Design and
Construction, updated V4 October 1, 2014.
[12] Gulf Organisation for Research and Development, GSAS Technical Guide 2015,
Issue 2, 2015.
[13] K. Elgendy, Comparing Estidamas Pearls Rating System to LEED and BREEAM.
http://www.carboun.com/sustainable-urbanism/comparing-estidama%
E2%80%99s-pearls-rating-method-to-leed-and-breeam/ (02 May 2016), 2010.
[14] Abu Dhabi Urban Planning Council, Pearl Building Rating System: Design &
Construction, Version 1.0, April 2010, 2010.
[15] Md Castro, R. Mateus, L. Bragana, A critical analysis of building sustainability
assessment methods for healthcare buildings, Environ. Dev. Sustain 17 (1381)
(2014). http://dx.doi.org/10.1007/s10668-014-9611-0 (2015).
[16] R.J. Cole, Building environmental assessment methods: redening intentions, in:
Proceedings of the 2005 World Sustainable Building Conference, Tokyo, 2005, pp.
19341939.
[17] U. Berardi, Beyond sustainability assessment systems: upgrading topics by enlar-
ging the scale of assessment, SUSB 2 (4) (2011) 276282. http://dx.doi.org/
10.5390/SUSB.2011.2.4.276.
[18] M. Sparks, New certication now available: LEED for Cities and LEED for
Communities. http://www.usgbc.org/articles/new-certication-now-available-
leed-cities-and-leed-communities (15 March 2017), 2016.
[19] U. Berardi, Sustainability assessment in the construction sector: rating systems and
rated buildings, Sustain. Dev. (2011). http://dx.doi.org/10.1002/sd.532.
[20] R. Reed, A. Bilos, S. Wilkinson, K. Schulte, International comparison of sustainable
rating tools, JOSRE 1 (1) (2009).
[21] A.E. Moktar, Comparative Study of Building Environmental Assessment Systems:
Pearl Rating System, LEED and BREEAM. Dissertations for Sustainable Design of
Built Environment (SDBE). The British University in Dubai. http://bspace.buid.
ac.ae/handle/1234/127 (1 April 2016), 2012.
[22] A. Voinov, J. Farley, Reconciling sustainability, systems theory and discounting,
Ecol. Econ. 63 (2006) 104113.
[23] C.J. Kibert, The next generation of sustainable construction, Build. Res. Inf. 35 (6)
(2007) 595601.
 Geoforum 59 (2015) 133141

Contents lists available at ScienceDirect

Geoforum
journal homepage: www.elsevier.com/locate/geoforum

Building a green economy? Sustainability transitions in the UK building

sector
David Gibbs , Kirstie ONeill
Department of Geography, Environment & Earth Sciences, University of Hull, Hull HU6 7RX, United Kingdom

a r t i c l e i n f o a b s t r a c t

Article history: This paper explores the interest by policy makers to encourage and develop a green economy, with a
Received 27 May 2014 particular focus on UK government attempts to engender a shift in the mainstream building and con-
Received in revised form 27 October 2014 struction sector towards adopting green building methods and techniques. The building sector has been
Available online 9 January 2015
the focus of endeavours to engender a shift towards greener ways of working and building, due to its high
contribution to greenhouse gas emissions and associated concerns over enhanced global warming and
Keywords: climate change. The paper outlines the recent development of national UK policy on green building as
Green economy
exemplied in legislation for the Code for Sustainable Homes and in Building Regulations. These have
Green buildings
Socio-technical transitions
given rise to a particular set of responses to green building requirements that favour technological solu-
UK policy tions that can readily be accommodated by the existing system. In critiquing these developments we
Green building niche draw upon socio-technical sustainability transitions research, one strand of which has focused on the
Low carbon economy ways in which niche developments can challenge and disrupt existing regimes of practice. We do this
empirically through our research into the green building sector which has involved in-depth interviews
with a range of actors from the UK green building sector, including architects, building companies,
materials suppliers and policy makers. Respondents from within the green building niche are critical
of current UK legislation, and argue that its narrow conceptualisation fails to adequately encourage, or
recognise, what they would consider to be green building forms that will contribute to substantial
reductions in carbon emissions, nor does it respect locally appropriate building methods.
2014 Elsevier Ltd. All rights reserved.

Introduction
This paper explores the recent shift in interest by policy makers
to encourage and develop a green economy, with a particular focus
on UK government attempts to engender a paradigm shift in the
building and construction sector through mainstreaming green
building methods and techniques (Greenwood, 2012). The building
sector has been the focus of endeavours to engender a shift
towards greener ways of working and building, due to its high
contribution to greenhouse gas (GHG) emissions and associated
concerns over enhanced global warming and climate change. The
paper outlines the recent development of UK policy on green build-
ing as exemplied in legislation for the Code for Sustainable Homes
and in Building Regulations. These have given rise to a set of
responses to green building requirements favouring technological
solutions that are readily accommodated by the existing building
regime. In critiquing these developments we draw upon socio-
technical sustainability transitions research, one strand of which
Corresponding author.
E-mail addresses: d.c.gibbs@hull.ac.uk (D. Gibbs), k.oneill@hull.ac.uk (K. ONeill).
has focused on the ways in which niche developments can chal-
lenge and disrupt existing regimes of practice. Our empirical focus
is upon the niche green building sector outside the dominant
building regime, involving in-depth interviews with a range of
actors, including architects, building companies, materials suppli-
ers and policy makers. Respondents from within this green build-
ing niche are critical of current UK legislation, and argue that its
narrow conceptualisation fails to adequately encourage the main-
streaming of what they consider to be green building. From this
case study evidence, we argue that despite attempts by govern-
ment to engender a paradigm shift in the mainstream building
regime, the relevant legislation is framed in ways that will not
engender any substantial changes to that regime. Beyond a critique
of UK policy, we contribute to debates within the sustainability
transitions literature regarding how niche innovations interact
with, and inuence, the wider regime (Smith and Raven, 2012).
We question the extent to which the process of diffusion from
niche to mainstream in socio-technical transitions occurs in a lin-
ear and unproblematic fashion and the assumption that niche
actors aim to change the regime (Hielscher et al., 2011). In
addition, we explore a related question regarding the internal

http://dx.doi.org/10.1016/j.geoforum.2014.12.004
0016-7185/ 2014 Elsevier Ltd. All rights reserved.
134 D. Gibbs, K. ONeill / Geoforum 59 (2015) 133141
cohesiveness of niches. Thus despite general agreement on the
shortcomings of policy, respondents had conicting views on
how green buildings should be dened, and on the best ways to
implement these, indicating that socio-technical niches are less
homogeneous than has previously been conceptualised and that
these might be better conceived of as a set of nested sub-niches
(Hodson and Marvin, 2010; Seyfang and Longhurst, 2012). The
structure of the paper is as follows. In the next section we outline
the growing interest in the green economy and its adoption in the
form of a low carbon transition in the UK. The following section
examines the green building agenda in the UK and maps out the
main legislative framework. We then present the theoretical
framework by which we seek to understand the potential for a
green building transition in the UK, drawing on the sustainability
transitions literature. A subsequent section outlines the methods
used for our empirical study and in the nal two sections and
our conclusions we draw on this evidence to critique government
policy and to develop our theoretical arguments.
The green economy
Although a concern for integrating economic development with
environmental protection stretches back to the Brundtland Report
(World Commission on Environment and Development, 1987) and
the Earth Summit in 1992 (and beyond), in practical terms the two
have largely remained separate. It is only recently that Brundt-
lands call for integration between the two has given rise to the
idea that a green economy can be developed and become a main-
stream economic development policy. For example, UNEP (2011:
16) denes the green economy as low carbon, resource efcient,
and socially inclusive [where] growth in income and employment
should be driven by public and private investments that reduce
carbon emissions and pollution, enhance energy and resource ef-
ciency, and prevent the loss of biodiversity and ecosystem ser-
vices. For many policy makers, the idea of developing such a
green economy has become an attractive one. Although this is
rarely made explicit, such views draw upon ideas from ecological
modernisation the concept that we can combine environmental
improvements with forms of economic development that do not
differ radically from the current mainstream. For the most part,
more radical conceptualisations of what might constitute a green
economy remain marginal (Bina, 2013). Indeed, for many politi-
cians and policy makers, new environmental technologies, new
ways of working and greener consumption offer the opportunity
for a renewed round of capitalist accumulation (Stern, 2006). How-
ever, this is not to claim that these motivations for the green econ-
omy are purely economic. Developing a green economy is also seen
as a means to address concerns over enhanced global warming, cli-
matic change and sea level rise. In the process, however, the green
economy has often become transformed into the narrower concep-
tualisation of a low carbon economy where the aim is to reduce
carbon emissions as part of attempts to stabilise carbon levels in
the atmosphere (While et al., 2010). Thus national governments
have promoted the development of a low carbon economy linked
to targets for cutting national carbon emissions. For example, the
Climate Change Act (2008) committed the UK to an 80% reduction
in GHG emissions by 2050 over 1990 levels. In order to achieve
this, the then Labour Government produced a Low Carbon Transi-
tion Plan, setting out a road map by which different sectors would
contribute to this reduction target (HM Government, 2009a). For
homes and communities (i.e. domestic buildings) the Plan aimed
to cut emissions by 29% over 2008 levels by 2050 (ibid). The
government also produced a Low Carbon Industrial Strategy (HM
Government, 2009b) outlining how the UK economy could shift
towards low carbon development, producing both economic
benets and environmental improvement. One important sector
that contributes substantially to the national emissions total, and
where opportunities exist to reduce this contribution, is the build-
ing and construction sector, and governments have also sought to
encourage a shift towards a green and low carbon building
industry.
The green building agenda
The development and promotion of green building in the UK
has a history that dates back to the 1970s, with early developments
frequently driven by individuals and informal organisations moti-
vated by deep green views and a perception of a need for radical
social change1 (Smith, 2007; Lovell, 2008). A key point is that these
pioneers did not see green building as simply about low energy use
and reduced environmental impact. Rather, these were part of a
broader critique of society and its values at that time. Although
many of the ideas and technologies developed by these pioneers
have subsequently entered the mainstream, green building was lar-
gely conned to the margins for much of the 1970s and 1980s. From
the late 1990s onwards, green building entered mainstream debates,
albeit reframed as low energy, or low carbon building, through the
UK Governments response to climate change and the need to reduce
GHG emissions, as part of the Low Carbon Transition Plan. Green
building became a focus of attention under the low carbon agenda
because the built environment is a key source of carbon emissions
globally the UN estimates that the building sector is the single
largest contributor to global GHG emissions (UNEP, 2011). In the
UK, private domestic consumers are responsible for 30% of all nal
energy use in the UK (DTI, 2006) and buildings account for 40% of
UK emissions (HM Government, 2009b). Any low carbon transition
would therefore, of necessity, have to include a shift towards green
building.
The UK policy response has come through the revision of
national policies on domestic building standards. The previous
UK Labour government argued that the construction sector needed
to undergo a paradigm shift, rather than the incremental shifts
that had so far been characteristic of the sector (HM
Government, 2009b). As part of measures to achieve this, the then
Labour government introduced the Code for Sustainable Homes in
2006, which was intended to provide a single national standard to
guide industry in the design and construction of sustainable
homes. It is a means of driving continuous improvement, greater
innovation and exemplary achievement in sustainable home build-
ing (DCLG, 2006a: 4). This was intended to complement the sys-
tem of Energy Performance Certicates subsequently introduced
in 2007 under the European Unions Energy Performance of Build-
ings Directive (EPBD). The EPBD required that all new homes have
an Energy Performance Certicate (EPC) providing information
about the energy efciency/carbon performance of the home. The
Code for Sustainable Homes2 took a new whole home approach
based around nine key design categories energy/CO2, pollution,
water, health and well-being, materials, management, surface water
run-off, ecology and waste. The Code used a rating system from 16
stars, where 1 is the lowest (or entry level) and 6 the highest,
reecting exemplary development, based on performance against
these design categories. Under the Code, a Level 6 home is deemed
a zero carbon home, dened as having zero net emissions of carbon
dioxide (CO2) from all energy use in the home including heating,
1
For example, Brenda and Robert Vale who published their seminal work The
Autonomous House in 1975.
2
The Code for Sustainable Homes dealt with domestic properties, while BREEAM is
a similar mechanism specically for non-domestic properties. The Code was
voluntary for the private sector, but local authorities were given powers to set
mandatory Code targets for social housing.
 D. Gibbs, K. ONeill / Geoforum 59 (2015) 133141
lighting, hot water and all other energy use (Panagiotidou and
Fuller, 2013: 197). While based on performance, the Code was not
prescriptive in how builders should reach these levels in an attempt
to encourage innovative responses and cost-effective solutions.
The Government also announced a commitment that all new
homes in England would be zero carbon by 2016 and that all
new non-residential buildings would be zero carbon by 2019
(Fischer and Guy, 2009). Such measures were aimed at meeting
the EUs Energy Performance of Buildings Directive (2010/31/EU)
requirement for Nearly Zero Energy Building (NZEB). What the
UKs zero carbon target meant in practice was less clear, with def-
initions of zero carbon being contested by builders, architects and
policy organisations (McLeod et al., 2012). Under some denitions,
zero carbon could include on-site micro generation of electricity at
the level of a development rather than an individual dwelling,
which would still attain a high level Code rating (DCLG, 2007;
Fischer and Guy, 2009). In addition, offsetting, i.e. compensating
for emissions from a dwelling by low carbon power generation
off-site, was not ruled out, albeit left to a later date for a decision.
Moreover, although this had been raised as an important issue in
the consultation process for the new regulatory framework, gov-
ernment decided not to include embodied carbon (i.e. that embed-
ded within the building materials used in construction) in the
denition (DCLG, 2007; McManus et al., 2010). Despite this, the
2016 zero carbon target was ambitious compared to past policy
and represented an attempt to mainstream what had so far lar-
gely been niche green building practices (Greenwood, 2012). Gov-
ernment also developed an institutional framework to support and
encourage changing practice within the existing building regime
though the Zero Carbon Hub,3 a publicprivate partnership to
guide and support the zero carbon programme and to engage rele-
vant organisations, and the Technology Strategy Boards Low Impact
Buildings Innovation Platform.4 In total, the government saw the
Code for Sustainable Homes and its zero carbon targets as an oppor-
tunity for the building industry to engage with innovative responses
to building sustainable housing seen in niche developments and as a
means for rms to gain market advantage over competitors (DCLG,
2006a). Ironically, given subsequent developments, it was also
intended to give the market much greater regulatory certainty and
thus underpin the proposed paradigm shift in the building industry.
Government reports claimed that the levels of performance for
energy efciency indicate the future direction of Building Regula-
tions, bringing greater regulatory certainty for home builders, and
acting as a guide to support effective business and investment plan-
ning (DCLG, 2006a: 8) and that driving forward an ambitious
agenda of change with our house-building programme also allows
us to lead an emerging market in environmental technologies, push-
ing innovation and driving costs down (DCLG, 2006b: 10).
In 2013 the Conservative-Liberal Democrat coalition govern-
ment undertook a Housing Standards Review Consultation
(DCLG, 2013). As part of the Governments aims to simplify build-
ing standards and to get rid of red tape, both of which were sup-
posedly hampering the industry, the Consultation proposed
winding down the Code for Sustainable Homes. At the same time,
however, in the 2013 Budget announcement the government reaf-
rmed its commitment to implement zero carbon homes from
2016. A key element in this policy shift came through changes to
Part L of the Building Regulations, concerned with energy perfor-
mance targets for homes and other buildings, where such changes
were intended to continue with the road map towards zero car-
bon standards originally set out by the previous Labour adminis-
tration. Part L sets the minimum level required in order to meet
3 6
http://www.zerocarbonhub.org/.
4
https://www.innovateuk.org/built-environment.
135
Building Regulations and deals with specic areas, whereas the
Code encouraged the consideration of issues beyond energy con-
sumption and a holistic, whole-building approach. Under Part L,
developers are required to achieve energy performance targets
set through a National Calculation Methodology and to demon-
strate that their buildings will meet those targets (McManus
et al., 2010). The targets are expressed in terms of a Target Emis-
sions Rate (TER) in killogrammes of carbon dioxide per metre
square per year (kg CO2/m2 yr) and an energy demand target in
kilowatt-hours per metre square per year (kW h/m2 yr). The Gov-
ernments consultation paper argued that these revisions to Build-
ing Regulations effectively made the Code redundant. Despite
substantial criticism from those involved in developing the Code
(see BRE, 2013), the outcome of the consultation exercise led to a
Ministerial Statement5 in 2014 that the Code would indeed be
wound down and energy efciency standards incorporated into
Building Regulations, although at the time of writing the exact tran-
sitional arrangements were not clear.6 However, the Coalition gov-
ernment was not proposing that the green building agenda should
be abandoned, simply that there are other, in their view, more ef-
cient ways of achieving the same ends. On the face of it, therefore,
it could be argued that the 1970s green building pioneers had been
vindicated and their views were now about to become part of the
mainstream building regime, rather than being seen as alternative
and radical. From this perspective, it could be suggested that green
building had thus moved from the margins of acceptability in the
niche into a mainstay of government policy. However, as we will
illustrate, in the process the drive to mainstream green building
forms has been stripped of its more radical elements. Before critiqu-
ing these arguments in more depth, in the next section we discuss
sustainability transitions theory as a means to conceptualise the
apparent shift to green building.
Socio-technical sustainability transitions
In this paper we draw upon a body of work within social studies
of technology concerned with the transformation of technological
regimes, which emphasises the role of innovative technological
niches in effecting socio-technical transitions (Smith, 2003;
Geels, 2005; Grin et al., 2010). Within this literature on sustainabil-
ity transitions, the multi-level perspective (MLP) aims to encapsu-
late, and distinguish between, the relationships linking niches,
regimes and the overarching landscape (Rip and Kemp, 1998).
Within the MLP, innovation niches (e.g. the green building sector)
are dened as small-scale experimental and learning spaces for
new technologies, comprising either a single experiment or pro-
ject, or clusters of several experiments (Kemp et al., 1998), offering
protection from mainstream conditions and functioning as test-
beds for the emergence of new socio-technical constellations.
Socio-technical regimes operate at the meso-level (e.g. the building
and construction industry) forming relatively stable congurations
of institutions, techniques and artefacts, as well as rules, practices
and networks that determine the normal development and use of
technologies (Rip and Kemp, 1998; Berkhout et al., 2003). Regimes
are seen as largely physically and socially inert (Bulkeley et al.,
2010), leading to path dependency and lock-in (Berkhout, 2002;
Unruh, 2002; Genus and Coles, 2008). Regimes and niches are set
within the broader context of the socio-technical landscape,
encompassing cultural norms, values and persistent socio-
technical structures (Spth and Rohracher, 2010), representing
longer-term inuences on niche and regime actors (Seyfang and
5
https://www.gov.uk/government/publications/building-regulations-housing-
standards-review.
http://www.architectsjournal.co.uk/news/its-ofcial-government-to-scrap-code-
for-sustainable-homes/8660376.article.
136 D. Gibbs, K. ONeill / Geoforum 59 (2015) 133141

Haxeltine, 2012).7 Each of these categories are analytical rather Table 1

than ontological (Raven et al., 2010: 63), offering a heuristic for Categoriesa of interviewees.

understanding socio-technical change. Taking an MLP approach sees Sector No.

transitions occurring as a result of interaction between innovation Finance and policy staff 15
processes at the different levels. New socio-technical congurations Consultants 4
that may have matured in specic niches offer potential solutions to Builders 4
problems in the regime, either by conforming to regime conditions, Architects 4
Building material suppliers 7
or more radically challenging and transforming regime practices Energy consultants/installers 7
(Berkhout et al., 2003; Smith and Raven, 2012). These tensions are Other green building entrepreneurs 14
a product of changing circumstances in the regime itself or the wider Total 55
socio-technical landscape, acting as a driver for regime transitions,
a
where factors such as the UK governments low carbon transition We recognise that these categories are not xed and that
some participants operate across boundaries.
policies and Code for Sustainable Homes offer a challenge to incum-
bent technological regimes (Smith et al., 2010). Thus, landscape level
changes may put pressure on the regime and, if the regime is
Methodology
destabilised, opportunities may open up for niche innovations to
be mainstreamed (Schot and Geels, 2008). From a sustainability per-
Our research involved 55 in-depth interviews with respondents
spective, this potentially leads to a transition towards, in the context
from businesses in the green building sector and support organisa-
of this paper, green building becoming the socio-technical regime
tions, including banks and other sources of nance and business
(Truffer, 2008; Scrase and Smith, 2009).
advice (see Table 1), located across England and Wales. Potential
The question of whether niches can be actively encouraged or
research participants were identied from exhibitors at events
created through policy is an open question in transitions research
such as EcoBuild and GreenExpo, online membership databases
(Greenwood, 2012). For some, the stimulation of different niche-
of organisations like the Association for Environment Conscious
based innovations is intended to nurture sustainable alternatives
Building (AECB), internet searches and snowball sampling.
to existing practices (Sondeijker et al., 2006: 18). This has been
Research participants were approached by letter or telephone, with
taken furthest in attempts to manage transitions and to actively
the majority of interviews conducted face-to-face. Interview
promote niche developments through strategic niche manage-
schedules were based around a set of core questions given the
ment, particularly in Dutch government policies for transition
variety of businesses involved in the research, interviews were
management (Rip and Kemp, 1998; Kemp et al., 1998; Kemp and
semi-structured to allow exibility. All interviews were recorded,
Loorbach, 2006). Those niche actors less compatible with the exist-
transcribed and qualitatively analysed using Nvivo to structure
ing regime may nd it more difcult to break through into the
analysis themes. The focus of the research was upon private sector
mainstream, whereas some niche activities may be better aligned
small and medium sized enterprises (SMEs) and our interviewees
and more easily incorporated (Smith, 2003). In the latter case,
were largely drawn from the residential, rather than the non-
actors in the current regime may borrow convenient aspects of
domestic/commercial sector. While we recognise that the UK
niche activity, in the process losing the more radical and transfor-
building residential sector is dominated by a small number of large
mative aspects (Smith and Raven, 2012), as well as potentially
companies (which are a constituent part of the dominant regime)
changing the character of niches.
these have not been the subject of empirical investigation as from
Perhaps not surprisingly, actors in the existing regime will
a theoretical perspective we are specically interested in the role
tend to defend and extend the regime through incremental
of niche actors in stimulating a transition to a green building
change and innovation (Scrase and Smith, 2009). While niches
regime. Two key issues emerged from these interviews with niche
are important sources of innovation that may offer solutions for
green building practitioners. First, there was a general agreement
tensions in existing socio-technical regimes, adaptation or trans-
that much of the current interest and practice in green building
lation processes may be constrained by structures within the
in the UK was at a very supercial level, reecting limited under-
existing mainstream regime (Smith, 2006; Smith and Raven,
standing by both householders and the conventional building
2012; Hargreaves et al., 2013). Indeed, it may be that existing
regime. Second, despite agreement in this area, there was a consid-
socio-technical contexts close down spaces for alternative
erable divergence of opinions as to what did constitute green
approaches (Shove, 1998). Thus, niche innovations can only
building. In the next two sections of the paper we explore these
diffuse more widely if they link up with ongoing processes at
themes in more detail.
regime and landscape levels (Schot and Geels, 2008: 547). How-
ever, as Smith and Raven (2012: 1026) argue ideas and concep-
tualisations of how path-breaking innovations escape their Government policy: from niche to mainstream?
protective spaces and interact with wider regime change pro-
cesses are still poorly developed. In subsequent sections of the Respondents were especially critical of current UK regulations
paper we use this theoretical framework to explore the extent and green building legislation. This reects the particular way that
to which UK government policy efforts to encourage green build- the UK government has interpreted green buildings into a form
ing has led to niche activities challenging the existing building that focuses upon a low carbon agenda and the economic benets
regime. In doing so, we draw upon both secondary analysis and that arise from adopting this within the mainstream building
upon detailed empirical work with the green building sector. In regime. As Lovell (2008: 624) suggests, framing this as a low car-
the next section we provide brief details of the methods used bon discourse has been used partly as a way of distancing low
for the empirical work. energy housing technologies from the social and institutional con-
text in which they were initially developed. The approach and lan-
guage of the low carbon discourse coalition stands in strong
contrast to the deep green values and beliefs of the original
1970s sustainable housing movement. The consequence of the
7
See Raven et al. (2010) for a discussion of the ways that the terms niche, regime dominance of a low carbon discourse to frame policy and this lack
and landscape are interpreted within the transitions literature. of attention to the broader context means that there have been
 D. Gibbs, K. ONeill / Geoforum 59 (2015) 133141
particular outcomes that emphasise technological solutions which
require no changes in behaviour or lifestyles by household occu-
pants (Reid and Houston, 2013). Thus the effect has been to prior-
itise low energy technical innovations, such as wind turbines and
photovoltaic panels, over broader administrative changes such as
planning reforms or greater integration of sustainable develop-
ment into house builders decision making (Lovell, 2008).
The Code for Sustainable Homes came in for particular criticism
by our respondents as it was seen as encouraging these kinds of
high tech add-on technologies that they believed to be ineffective.
In this they were in agreement with other research which shows
that many practitioners believe current policy inhibits, rather
than facilitates, their efforts to take what they consider to be the
most sustainable design decisions (Greenwood, 2012: 167). As
one of our respondents commented:
one of the silly things about the Code...is that its not particu-
larly well thought out because for example to reach certain
Codes requires bunging on a solar thermal panel onto the house.
Now really if they thought about that there would be other
things that would be better to put on than just doing that but
thats what theyve stated so builders are coming along and say-
ing well we just need to bung a set of panels on the roof but
what theyre doing is theyre going for the cheapest possible,
and the smallest possible, which actually at the end of the day
isnt really making much difference at all. . .Its not just a case
of sticking something on the roof and away you go.
[Interview, Renewable energy consultant]
Respondents were very critical of the installation of these kinds
of renewable energy technologies both for new build and as an
add-on to existing buildings. This was also seen to have been
skewed by the UK governments feed-in tariff rate for renewable
technologies, which it was thought had encouraged existing home-
owners to invest in these technologies as a money saving (or even
money generating) device and was seen to have led to conven-
tional builders or new companies coming into the market with a
poor understanding of the overall impact on energy consumption
there will inevitably be a load of companies that are selling stuff
that actually is really terrible for your building. . .and will cause
more problems than it will remedy (Interview, Materials sup-
plier). Respondents argued that there should be a hierarchy of
measures whereby low tech and inexpensive solutions such as
insulation and low energy lighting should be tackled before renew-
able energy technologies and other high tech responses are
considered.
Advocates of Passivhaus were also critical of the Code for Sus-
tainable Homes.8 A Passivhaus is dened as a building, for which
thermal comfort can be achieved solely by post-heating or post-cool-
ing of the fresh air mass, which is required to achieve sufcient
indoor air quality conditions without the need for additional recir-
culation of air9 (see also NHBC, 2012). A Passivhaus is one that has
excellent thermal performance and exceptional air-tightness with
mechanical ventilation,10 but respondents argued that there are
substantial differences between Passivhaus standards and those
enshrined in the Code, such that a Passivhaus could receive a
low rating under the Code. A related point was that the Code
was designed for large-scale building companies which form the
mainstream building regime and was not appropriate for those
small companies or self-builders who are often involved with
Passivhaus:
8
Although Osmani and OReilly (2009) argue that the Code exceeds Passivhaus
standards on the grounds that it requires domestic energy use in level 6 homes to be
generated from renewable sources.
9
http://www.passivhaus.org.uk/standard.jsp?id=122, Accessed 13.3.14.
10
See www.passivhaus.org.uk for details.
137
were building very, very sustainable buildings. . .which will be
more sustainable than anything that the major house builders
do that meet Code 6 but it wont meet Code 6 because we cant
be part of the Sustainable Contractors Scheme and various
other things that you get points for. . .you cant do it when
youre a self builder or a very small company because its too
cost-prohibitive, so were never going to meet Code 6, yet well
be making something thats better, like in the spirit of the Code,
thats better than anything else that would be built.
[Interview, Green building company]
Moreover, clients for new build homes were seen as having very
limited understanding of the need to consider the lifetime running
costs of a building vis--vis the construction costs, and that (as
with Passivhaus) the running costs could be low enough to offset
the upfront additional building costs. Clients were seen (initially
at least) to favour very visible green technologies, such as photo-
voltaic (PV) solar panels or wind turbines, in order to indicate their
commitment to greener living, but were unwilling to make any
behavioural changes in their use of domestic energy or lifestyle
(cf Reid and Houston, 2013). Several respondents had experienced
tensions between such demands from customers and developers,
whose expectations reected the Code, in contrast with their
own views on what constituted a green building. Again, this was
most obvious with regard to renewable energy technologies where
clients expect a green builder to install these or offer them as
options, while our respondents saw these as green wash or green
bling and tried to persuade clients to think about alternative solu-
tions. Thus one respondent gave the example of a client saying:
we want to build an eco house and they were saying. . .we
want wind turbines and, what they imagined was a green
house. . . were possibly too purist about it in a way but I do nd
it fascinating because everybody you know, domestic customer
or everyone I talk to says, you know, oh Im putting solar panels
on my roof isnt that good?.
[Interview, Material supplier]
For our respondents, such technologies were seen as very low
on the list of priorities for green building and were seen as the
very icing on the cake once youve done everything else (Inter-
view, Material supplier). By contrast, the aim of our respondents
was to minimise energy demand at the outset and then look at
how to further reduce that demand. The consequence was that
they saw certain technologies as undesirable theres certain
things that we probably wouldnt consider, which again are a bit
greenwashy, like heat pumps particularly, air-source heat pumps
particularly, theyre evil! (Interview, Green architect/builder). In
this example, the respondent argued that air-source heat pumps
could use more electricity than they saved at times of the year
where there was a substantial difference between internal and
external air temperatures (such as in the UK) meaning energy
was required to heat the air. Respondents were equally vehement
about other types of energy generation and their embodied energy:
green energy is totally pointless unless it has a lifetime saving,
and by that I mean making a forty thousand pound wind tur-
bine is not green at all, ever, never. If they pretend theyre green
entrepreneurs they are lying to themselves and lying to the
public because it costs a heck of a lot more in terms of energy
to make the wind turbines than its going to pay back. So Im
a bit sceptical of people selling products because they are green
unless it adds up on the lifetime calculations.
[Interview, Renewable energy company]
Other research conrms this, with add on generating technolo-
gies having potentially high levels of embodied carbon, which was
specically excluded from the Code on the grounds that it is not
138 D. Gibbs, K. ONeill / Geoforum 59 (2015) 133141
currently realistic or practical to do so (McManus et al., 2010).
Renewable energy technologies were thus seen as a very narrow
denition of what green building involves, constituting high tech
solutions to problems that respondents believed require more
mundane solutions such as insulation and lagging but for clients
this was not very sexy stuff that doesnt sparkle and inspire
(Interview, Green business support organisation). The conse-
quences of a combination of client expectations and the Code for
Sustainable Homes is that a lot of what is being proposed. . .are
quite high embodied energy solutions arent they? And there is
that perception that its green architecture. . . even though all the
insulation is petrochemical based (Interview, Green architects).
For some of our respondents who had been involved with the
green building sector for a number of years, these were recent
shifts in emphasis within the sector and represented the dilution
in aims that had come about as elements of the green niche have
entered the mainstream:
ten, fteen years ago the emphasis wouldve been on the. . .you
know the hairier end of green building, which was much more
kind of rustic, the emphasis was on natural materials and what
they could achieve. . .and I think theres been quite a serious
shift, like 180 degrees shift from that. So, its, I mean people
are still doing that but. . .its become quite high-tech.
[Interview, Green building company]
One response within the niche has been to ignore the Code
for Sustainable Homes and to work to different sets of standards.
In addition to the Passivhaus standards mentioned above, the
Association for Environment Conscious Building (AECB) have
developed their own set of such standards, which seek to be less
prescriptive than the Code about the particular technologies and
appliances that designers are required to install. Their standards
assess building performance in absolute terms and are intended
to avoid assumptions about occupant behaviour (Greenwood,
2012:175). The AECBs CarbonLite programme is designed to pro-
duce low carbon and low energy buildings, for those green build-
ing companies adopting this discourse.11 However, these
strategies effectively mean that rms remain within the niche,
rather than engaging with the mainstream. While they may pro-
duce high quality buildings in environmental terms, these are
likely to be one-off buildings or small scale developments that
comprise local socio-technical projects rather than comprising a
niche level that challenges mainstream practice (Schot and Geels,
2008; Smith and Raven, 2012). The extent to which niche innova-
tions engage with and impact upon the wider regime will there-
fore depend upon the degree to which niche actors dene
themselves as an alternative to, or outside of, the mainstream.
Thus radical niches need not aim to displace the regime, indeed
the aim of some niche actors might be to play a more signicant
role alongside it, or offer new ideas for incorporation into existing
systems. Certainly some of our respondents were engaged in run-
ning countercultural businesses with the aim of making a modest
living and combining this with other interests, such as their family
or environmental campaigning. Based on their cultural and envi-
ronmental values, these niche actors had little interest in bridging
the niche-regime divide or attempting to engender a transition
towards sustainability in the building regime. This contradicts
other research where niche actors appear to be actively challeng-
ing the mainstream and lobbying for regulatory change (see for
example Schaltegger and Wagner, 2011). Indeed even amongst
our remaining respondents, only a small number were actively
engaged in attempts to shift and challenge mainstream regime
perceptions and ways of working, and most were fully engaged
11
See http://www.aecb.net/carbonlite/carbonlite-programme/ Accessed 18.3.14.
in keeping their businesses viable, with limited time and energy
for such broader system building activities (Smith, 2007; Horne
and Dalton, 2014).
Dening green building: divergence within the niche
As we have outlined, the green building movement originally
emerged from 1960s and 1970s countercultural movements con-
cerned about resource use, environmental damage, wastage and
energy intensity in conventional building methods, which were
seen as divorced from the specicities of place. While there is rec-
ognition that this did not give rise to a coherent and fully formed
alternative set of practices green building is not a monolithic
school of architecture and building: practitioners disagree over
trade-offs between various goals. . .there remains a sufciently dis-
tinctive collection of overarching values, ideas and practices from
which a socio-technical niche can be discerned (Smith,
2007:95). Niches are frequently presented as being homogeneous,
with the assumption that there are agreed practices with a major-
ity of niche actors working towards common goals, such as main-
streaming niche innovations into the dominant regime (Smith,
2006). With regard to this, there were some aims which the major-
ity of our respondents agreed upon. Thus, there was general agree-
ment that green building should comprise a whole house concept
that went substantially beyond that expressed in the Code for Sus-
tainable Homes or the minimum imposed by Building Regulations.
Overall there was a general view that green building was about
making good quality buildings to last, which demand less of the
environment and are connected with the locality, particularly
through the use of appropriate local materials. Respondents also
agreed that there were limits to the extent to which buildings
could be said to be completely green or sustainable:
sometimes youd struggle to say well, is this sustainable,
because its clearly not; its a compromise; I think thats what
weve always said. Well try to do it slightly better than its been
done before, were doing it often in excess of whats expected of
us, say, in terms of Building Regulations or whatever. And again,
thats always been our kind of ethos, we work beyond that, you
know. . .the building industry works to the minimum not the
maximum Building Regs are minimum, as soon as they hear
that, they stop. Our ethos was to. . .ignore that and see how
much we can get into a building and still make it viable.
[Interview, Green building company]
Despite agreement on some issues, however, our argument here
is that in reality the green building niche is heterogeneous and
incorporates a wide range of (sometimes conicting) views and
practices, rather than comprising a cohesive set of agreed practices.
Accordingly, green building can include a range of diverse
approaches to reducing the environmental impact of construction
and post-construction building use, from straw, hemp or rammed
earth installations to the more conventional brick and block build-
ings utilising the kinds of high tech solutions outlined in the previ-
ous section. Therefore, treating all green building practices as a
single niche is misleading. Rather, the green building niche can be
better described as a series of nested niches, or comprising clusters
of experiments (sub-niches) (Kemp et al., 1998), rather than just one
niche that is an alternative to the mainstream regime (Seyfang and
Longhurst, 2012). Green building can therefore comprise a variety of
niches (e.g. cob, rammed earth, straw bale building, retrot and so
on), each with conicting ideologies of green building. Some of these
are compatible with mainstream practice, while others substan-
tively challenge conventional building methods and philosophies.
Amongst our respondents there were clear differences of
opinion over what constituted green building. For one set of
 D. Gibbs, K. ONeill / Geoforum 59 (2015) 133141
respondents the key factor involved thinking about whole building
use, as opposed to the kinds of add-on energy generation technol-
ogies outlined in the previous section. In particular they high-
lighted the differences between energy usage once a building is
constructed and the energy embodied in the construction phase.
With regard to this, one area of contention was building to Passiv-
haus standards. Some interviewees were in favour (at times almost
evangelically so) of Passivhaus and argued that it is the only kind
of credible, measurable sort of way of building low energy (Inter-
view, Materials supplier) and constituted the greenest of the
green architectural construction forms (Interview, Materials sup-
plier). By contrast, other respondents were more cautious about its
value. In part this was due to some evidence that poor installation
of mechanical ventilation systems may be associated with poor
indoor air quality and health impacts (Zero Carbon Hub, 2013).
Respondents were also very critical of the high levels of embodied
energy involved in Passivhaus building materials, arguing that
although such buildings have very low energy use, it would take
a long time for this to offset the energy embodied in initial con-
struction. Another respondent was also sceptical of the value of
the Passivhaus approach given that it requires the active involve-
ment of its occupant (though note that this view rests on a partial
understanding of Passivhaus and a popular misconception that
windows cannot be opened12): We dont do Passivhaus; we have
reservations about whether Passivhaus is appropriate in this climate
for a start. And our view is that if people decide they are going to
open their windows then the Passivhaus thing is all up the creek
anyway (Interview, Green architect).
One architect characterised Passivhaus as comprising
unhealthy buildings wrapped in plastic in order to achieve Pas-
sivhaus requirements for air-tightness; he questioned the benets
of such an approach, arguing that natural, breathing walls with
intrinsic thermal properties are a better solution, (albeit acknowl-
edging that Passivhaus nal energy use is indeed low):
Passivhaus. . .Im still not convinced because it means sealing it
up super tight and then essentially managing the air within it,
so again youre living in a plastic building kind of thing, and
then all your air is, sort of moves around by this big fan unit,
and the gures for the amount of energy they use is tiny, you
know, and its denitely something to aspire to, its incredible
but Im just not convinced that I would necessarily want to live
in that kind of building you know, I think there must be a way of
doing it using... what they call breathing walls and having a
more natural feel, its about managing that air, its the key,
and I cant help thinking there might be a better way to do that,
but yeah, Passivhaus, 15 watts per metre squared per year
whatever, is nothing!.
[Interview, Green architect/builder]
This view was reinforced by another respondent who believed
that the same outcomes could be achieved through the use of more
traditional designs, for example using natural materials such as
straw:
its unhealthy to live in a sealed box, you know part of our phi-
losophy is to encourage our clients to open the windows. Not a
fan at all, I am in favour of airtight buildings but not using all
the tapes and stuff, just using good design you dont want
draughts round your windows and door frames and thats what
I mean by airtightness, just go back to traditional designs.
[Interview, Green building company]
12
See http://www.passivhaushomes.co.uk/myths-and-misconceptions-about-Pas-
sivhaus-1.html, Accessed 13.3.14.
139
This focus on more traditional designs and the use of natural
and locally-based materials was a theme that emerged from other
respondents. This involved the use of materials such as straw, lime,
cob, wood waste and wool, which were perceived to be natural,
breathable materials:
I do promote earth building materials for all of their benecial
properties because theyve got brilliant, brilliant properties,
so. . .we sell clay boards and clay plasters and theyre very good
for acoustics and moisture buffering and thermal mass and all
sorts.
[Interview, Green building company/materials supplier]
By comparison with designs such as Passivhaus, these materials
were also seen as better for the health of occupants:
I was coming really from the building performance point of
view and realised that it was much better for peoples health,
so when I built my own house I used low bre clay blocks,
self-insulating blocks, solid wall construction, hemp lime plas-
ters, natural paints. So I believe in it, I think its a good thing
to do.
[Interview, Materials supplier]
Some respondents also went on to argue that the use of these
materials helped to sequester CO2 within the building unless
youre building with straw, or hemp or timber, it takes so much
energy to make the ipping thing in the rst place. Whereas obvi-
ously straw and timber are carbon sinks, so thats true low carbon
building (Interview, Green architect). Many of these materials
could also be locally sourced which was also seen as a positive con-
tribution to low embodied energy building, as opposed to the
import of green building materials from Europe or China13. Return-
ing to the Code for Sustainable Homes, the Code specically does not
address embodied carbon and this was felt to be another shortcom-
ing. Even here there was a divergence of views between those
respondents who believed higher embodied energy is acceptable to
build low energy use buildings, and those others who argued for
both low energy use and low embodied energy in the building
materials.
Conclusions
In this paper we have attempted to show that the process of
changing current established regimes towards more sustainable
forms is a difcult process, even where there have been attempts
by government to engender the transformation through legislative
action. At one level, it can be argued that, as with other areas of
green practice, such as organic food or renewable energy, there
has been a shift towards greater environmental consciousness in
the building sector. Thus, as one of our respondents noted:
I think thats what the green movement, in a wider sense, has
done; its kind of made things that were seen as a bit fringe and
not quite acceptable, theyve made them more acceptable.
Theyve made them more every day. . .you know, its not a
strange thing anymore to talk about heating your house via
the sun.
[Interview, Materials grower/supplier]
However, the shift has so far been fairly minimal and taken on
specic forms. Far from inducing a paradigm shift the regulatory
framework in the UK for green building has effectively encouraged
the adoption of an ecological modernisation or eco-technic
13
This also contrasts with Passivhaus standards where due to a lack of UK domestic
capacity, windows need to be imported from Continental European suppliers (Lowe
and Oreszczyn, 2008).
140 D. Gibbs, K. ONeill / Geoforum 59 (2015) 133141

approach with an emphasis on technological, rather than holistic, appreciate the different socio-technical contexts in operation in
solutions. Our conclusions concur with Boschmann and Gabriel the mainstream and green building sectors. The result is that:
(2013: 10) who argue that technological solutions to green build-
the kinds of practice that are sufciently exible to work under
ing allows for a convenient business-as-usual approach to the use
such divergent contexts may not be particularly green they
and design of buildings that can be readily incorporated by the
cannot embody the green context that produced them (i.e.
existing building and construction regime. Moreover, these fail to
underpinning values and performance criteria) too strongly,
address the kinds of lifestyle changes advocated by early green
since this would limit their transferability. Transferability
building pioneers, leading householders to rely on smart house
requires them to be able to slot into the mainstream practices,
solutions without having to engage in behavioural change (Reid
or be susceptible to being added on, without too much distur-
and Houston, 2013). Indeed the Code for Sustainable Homes only
bance.
provides an assessment at one point in time and fails to address
[Smith, 2009: 102]
post-occupancy behaviour, which may actually increase energy
use (Greenwood, 2012). A failure to encourage and reward niche
A consequence may be that where some niche innovations, such
green designs has limited the extent of paradigm shifts in the
as the add-on energy technologies outlined in this paper, become
established building regime and has meant only minor elements
competitive and empowered to align with the mainstream regime,
from the niche have become mainstream. At the same time, the
the result is actually disempowering in terms of sustainable out-
mainstream building sector lacks both condence in, and the
comes (Smith and Raven, 2012). Rather than adopting these incre-
capacity to adopt, niche methods and technologies and is unwilling
mental changes to Building Regulations, a policy attempt to meet
to move away from traditional methods (Osmani and OReilly,
system transformation goals (such as zero carbon housing) would
2009). Current mainstream sector responses were denounced by
consider standards in the light of practices in existing low carbon
the former UK Housing Minister, Grant Shapps as Scandinavian-
housing niches and would point volume house builders (and con-
style, eco-bling in a call for British design responses to preserve
ventional householders) towards adopting practices found in those
the Great British home14 and to nd local responses to UK
niches (Scrase and Smith, 2009: 716). Given the level of expertise
demands. The problem here though is that, ironically perhaps, the
that exists in niche organisations such as the AECB, as well as the
former Minister fails to recognise that it is Governments own build-
demonstration effects of large scale building developments to zero
ing and housing regulations that have encouraged such cautious
carbon and Passivhaus standards in countries such as Germany,
responses. We have also seen how, despite continued interest in
Austria, Sweden and Switzerland, there is scope for a major gov-
encouraging green building, policy has not created the kind of regu-
ernment-funded demonstration programme and/or to mandate
latory certainty anticipated by the previous Labour government to
higher standards for carbon reduction, such as the Passivhaus stan-
drive change. Instead, UK zero carbon housing policy has been pla-
dard in order to encourage niche practices in the extant building
gued by disagreement and inconsistency.15
regime (Lowe and Oreszczyn, 2008; McLeod et al., 2012). As we
This situation seems unlikely to alter in the near future. Thus
have outlined, relying on niche actors to engender such changes
the whole concept of zero emissions buildings has been under
is unrealistic and fails to account for the fact that they may have
review in the UK. Rather than the kinds of whole house concept
little interest in, or capacity to effect, changes in regime practices.
proposed by our respondents which would involve mitigation of
In policy terms, we should perhaps not be thinking of trying to
energy use on-site, a revised denition of zero carbon involves
create one single transition scenario, but to open up possibility
the idea of allowable solutions which would include the use of,
spaces for experimentation which might t with the ideas out-
or investment in, renewable energy technologies which are not
lined here of multiple views within the niche and the possibility
on-site, such as large-scale wind or tidal energy sources, commu-
of multiple transition scenarios (Sondeijker et al., 2006). Thus there
nity heating, or the installation of energy-efcient appliances and
will be no one best way to a green building sector, but a multiplic-
advanced energy control systems for buildings that encourage
ity of scenarios, which may cohere into something that incorpo-
energy efciency (Greenwood, 2012: 169). This simply further
rates elements of the various sub-niches we outline here and
waters down the impact upon the mainstream building regime,
which responds to geographical specicity. Rather than rigid legis-
in part the result of lobbying by the sector in attempts to extend
lation, the role of policy should be to create the space for possibil-
the regime (Panagiotidou and Fuller, 2013). While allowable solu-
ities to emerge and for experimentation through collective
tions could potentially encourage the integration of energy and
enactment by a range of actors as well as encouraging engagement
buildings policies, the allowable solution most favoured by house
by the occupants of buildings rather than removing them from the
builders consulted by government on zero carbon homes policy
process (Schot and Geels, 2008). In so doing, this would recognise
was for the sector to pay into a fund that invests in carbon abate-
that the process of transition involves real world contestation,
ment projects located elsewhere (DCLG, 2014). This would have
complexity and chaos rather than the more linear progression
the potential effectively to give mainstream house builders a
envisaged in UK Government policies for the building sector
buy-out clause to rely on third parties to deliver zero carbon out-
(Raven et al., 2011).
comes through carbon offsetting while continuing to build to lower
energy standards (McLeod et al., 2012). From other research into
the green building sector, perhaps we should not be too surprised Acknowledgements
with this outcome. As Smith (2009: 98) points out the imposition
of environmental aims in Building Regulations are based on The research on which this paper is based was funded by the
judgements of what is deemed a reasonable demand upon the University of Hull. We are grateful to two anonymous referees
mainstream socio-technical regime. He argues that we should for their insightful and helpful comments which have substantially
expect this mismatch as a direct consequence of the failure to improved the paper. The usual disclaimers apply.

References
14
https://www.gov.uk/government/news/eco-homes-dont-have-to-be-eco-bling, Berkhout, F., 2002. Technological regimes, path dependency and the environment.
Accessed 13.03.14. Global Environ. Change 12 (1), 14.
15
http://www.theguardian.com/environment/2014/feb/13/storms-oods-climate- Berkhout, F., Smith, A., Stirling, A., 2003. Socio-Technological Regimes and
change-upon-us-lord-stern, Accessed 13.03.14. Transition Contexts. SPRU, University of Sussex.
 D. Gibbs, K. ONeill / Geoforum 59 (2015) 133141
Bina, O., 2013. The green economy and sustainable development: an uneasy
balance? Environ. Plann. C: Government Policy 31, 10231047.
Boschmann, E., Gabriel, J., 2013. Urban sustainability and the LEED rating system:
case studies on the role of regional characteristics and adaptive reuse in green
building in Denver and Boulder, Colorado. Geographical J.. http://dx.doi.org/
10.1111/j.1475-4959.2012.00493.x.
BRE, 2013. Housing Standards Review consultation: Response from BRE. BRE,
London.
Bulkeley, H., Castan-Broto, V., Maasen, A., 2010. Governing urban low carbon
transitions. In: Bulkeley, H., Castan-Broto, V., Marvin, S., Hodson, M. (Eds.),
Cities and Low Carbon Transitions. Routledge, London, pp. 2931.
Climate Change Act (c27), 2008. The Stationery Ofce, London.
Department for Communities and Local Government, 2006a. Code for Sustainable
Homes: A Step-change in Sustainable Home Building Practice. DCLG, Wetherby.
Department for Communities and Local Government, 2006b. Building a Greener
Future: Towards Zero Carbon Development. DCLG, Wetherby.
Department for Communities and Local Government, 2007. Building a Greener
Future: Policy Statement. DCLG, Wetherby.
Department for Communities and Local Government, 2013. Housing Standards
Review: Consultation. DCLG, London.
Department for Communities and Local Government, 2014. Next Steps to Zero
Carbon Hones Allowable Solutions, Government Response and Summary of
Responses to the Consultation. DCLG, London.
Department of Trade and Industry, 2006. UK Energy Sector Indicators 2006: A
Supplement to the Third Annual Report of the Energy White Paper Our Energy
Future Creating a Low Carbon Economy. DTI, London.
Fischer, J., Guy, S., 2009. Re-interpreting regulations: architects as intermediaries
for low carbon buildings. Urban Stud. 46 (12), 25772594.
Geels, F.W., 2005. Technological Transitions and System Innovations: A Co-
evolutionary and Socio-technical Analysis. Edward Elgar, Cheltenham.
Genus, A., Coles, A.M., 2008. Rethinking the multi-level perspective of technological
transitions. Res. Policy 37 (9), 14361445.
Greenwood, D., 2012. The challenge of policy coordination for sustainable
sociotechnical transitions: the case of the zero-carbon homes agenda in
England. Environ. Plann. C 30, 162179.
Grin, J., Rotmans, J., Schot, J., 2010. Transitions to Sustainable Development New
Directions in the Study of Long Term Transformative Change. Routledge, London.
Hargreaves, T., Longhurst, N., Seyfang, G., 2013. Up, down, round and round:
connecting regimes and practices in innovation for sustainability. Environ.
Plann. A 45, 402420.
Hielscher, S., Seyfang, G., Smith, A., 2011. Community Innovation for Sustainable
Energy, CSERGE Working Paper, 2011-03.
HM Government, 2009a. The UK Low Carbon Transition Plan. TSO, Norwich.
HM Government, 2009b. The UK Low Carbon Industrial Strategy. DBIS/DECC,
London.
Hodson, M., Marvin, S., 2010. Can cities shape socio-technical transitions and how
would we know if they were? Res. Policy 39, 477485.
Horne, R., Dalton, T., 2014. Transition to Low Carbon? An Analysis of Socio-
Technical Change in Housing Renovation, Urban Studies, published online 8
January 2014, doi: http://dx.doi.org/10.1016/1177/0042098013516684.
Kemp, R., Loorbach, D., 2006. Transition management: a reexive governance
approach. In: Voss, J.-P., Bauknecht, D., Kemp, R. (Eds.), Reexive Governance for
Sustainable Development. Edward Elgar, Cheltenham.
Kemp, R., Schot, J., Hoogma, R., 1998. Regime shifts to sustainability through
processes of niche formation: the approach of strategic niche management.
Technol. Anal. Strategic Manage. 10 (2), 175196.
Lovell, H., 2008. Discourse and innovation journeys: the case of low energy housing
in the UK. Technol. Anal. Strategic Manage. 20 (5), 613632.
Lowe, R., Oreszczyn, T., 2008. Regulatory standards and barriers to improved
performance for housing. Energy Policy 36, 44754481.
McLeod, R., Hopfe, C., Rezgui, Y., 2012. An investigation into recent proposals for a
revised denition of zero carbon homes in the UK. Energy Policy 46, 2535.
McManus, A., Gaterell, M., Coates, L., 2010. The potential of the code for sustainable
homes to deliver genuine sustainable energy in the UK social housing sector.
Energy Policy 38, 20132019.
141
NHBC Foundation, 2012. Lessons from Germanys Passivhaus Experience. BRE,
London.
Osmani, M., OReilly, A., 2009. Feasibility of zero carbon homes in England by 2016:
a house builders perspective. Build. Environ. 44, 19171924.
Panagiotidou, M., Fuller, R.J., 2013. Progress in ZEBsa review of denitions, policies
and construction activity. Energy Policy 62, 196206.
Raven, R.P.J.M., van den Bosch, S., Weterings, R., 2010. Transitions and strategic
niche management: towards a competence kit for practitioners. Int. J. Technol.
Manage. 51 (1), 5774.
Raven, R.P.J.M., Verbong, G.P.J., Schilpzand, W.F., Witkamp, M.J., 2011. Translation
mechanisms in socio-technical niches: a case study of Dutch river management.
Technol. Anal. Strategic Manage. 23 (10), 10631078.
Reid, L.A., Houston, D., 2013. Low carbon housing: a green wolf in sheeps clothing?
Housing Stud. 28 (1), 19.
Rip, A., Kemp, R., 1998. Technological change. In: Rayner, S., Malone, E. (Eds.),
Human Choices and Climate Change, vol. 2. Batelle, Columbus, OH, pp. 327399.
Schaltegger, S., Wagner, M., 2011. Sustainable entrepreneurship and sustainability
innovation: categories and innovations. Business Strategy Environ. 20, 222
237.
Schot, J., Geels, F., 2008. Strategic niche management and sustainable innovation
journeys: theory, ndings, research agenda and policy. Technol. Anal. Strategic
Manage. 20 (5), 537554.
Scrase, I., Smith, A., 2009. The (non-)politics of managing low carbon socio-technical
transitions. Environ. Politics 18 (5), 707726.
Seyfang, G., Haxeltine, A., 2012. Growing grassroots innovations: exploring the role
of community-based initiatives in governing sustainable energy transitions.
Environ. Plann. C 30, 381400.
Seyfang, G., Longhurst, N., 2012. Grassroots Innovation for Sustainability: A Niche
Analysis of Community Currencies, 3S working paper 2012-10. University of
East Anglia.
Shove, E., 1998. Gaps, barriers and conceptual chasms: theories of technology
transfer and energy in buildings. Energy Policy 26 (15), 11051112.
Smith, A., 2003. Transforming technological regimes for sustainable development: a
role for alternative technology niches? Sci. Public Policy 30 (2), 127135.
Smith, A., 2006. Green niches in sustainable development: the case of organic food
in the United Kingdom. Environ. Plann. C 24, 439458.
Smith, A., 2007. Translating sustainabilities between green niches and socio-
technical regimes. Technol. Anal. Strategic Manage. 19 (4), 427450.
Smith, A., 2009. Governance lessons from green niches: the case of eco-housing. In:
Murphy, J. (Ed.), Governing Technology for Sustainability. Earthscan, London,
pp. 89109.
Smith, A., Raven, R., 2012. What is protective space? Reconsidering niches in
transitions to sustainability. Res. Policy 41, 10251036.
Smith, A., Vo, J.-P., Grin, J., 2010. Innovation studies and sustainability transitions:
the allure of the multi-level perspective and its challenges. Res. Policy 39, 435
448.
Sondeijker, S., Geurts, J., Rotmans, J., Tukker, A., 2006. Imagining sustainability: the
added value of transition scenarios in transition management. Foresight 18 (5),
1530.
Spth, P., Rohracher, H., 2010. Energy regions: the transformative power of
regional discourses on socio-technical futures. Res. Policy 39, 449458.
Stern, N., 2006. The Economics of Climate Change: The Stern Review. Cambridge
University Press, Cambridge.
Truffer, B., 2008. Society, technology, and region: contributions from the social
study of technology to economic geography. Environ. Plann. A 40, 966985.
UNEP, 2011. Towards a Green Economy: Pathways to Sustainable Development and
Poverty Eradication, <www.unep.org/greeneconomy>.
Unruh, G., 2002. Escaping carbon lock in. Energy Policy 30 (4), 317325.
While, A., Jonas, A.E.G., Gibbs, D.C., 2010. From sustainable development to carbon
control: eco state restructuring and the politics of urban and regional
development. Trans. Inst. Br. Geographers 35 (1), 7693.
World Commission on Environment and Development, Our Common Future, 1987,
Oxford University Press; Oxford.
Zero Carbon Hub, 2013. Mechanical Ventilation with Heat Recovery in New Homes,
Final Report, London: Zero Carbon Hub, <www.zerocarbonhub.org>.
 Automation in Construction 83 (2017) 134148

Contents lists available at ScienceDirect

Automation in Construction
journal homepage: www.elsevier.com/locate/autcon

Building Information Modeling (BIM) for green buildings: A critical review MARK
and future directions
Yujie Lua, Zhilei Wub, Ruidong Changa, Yongkui Lib,
a
Department of Building, School of Design and Environment, National University of Singapore, Singapore
b
School of Economics and Management, Tongji University, Shanghai 200092, China

A R T I C L E I N F O A B S T R A C T

Keywords: Although a large number of studies on Building Information Modeling (BIM) have been conducted in the past
Building Information Modeling (BIM) decade, a lack of consensus remains among researchers and practitioners regarding the applications of BIM for
BIM software the development of green buildings, the activity of making buildings in a way that protects the natural en-
Green buildings vironment. As the usefulness of BIM has been widely recognized in the building and construction industry, there
Life cycle
is an urgent need to establish an up-to-date synthesis on the nexus between BIM and green buildings. After an in-
Review
depth review of hundreds of journal articles published from 1999 to 2016 and 12 widely used types of BIM
Sustainability
software, this study provides a holistic understanding and critical reection on the nexus between BIM and green
buildings, which is systematically illustrated by a Green BIM Triangle taxonomy. The proposed taxonomy
indicates that the nexus between BIM and green buildings needs to be understood based on three dimensions,
namely project phases, green attributes and BIM attributes. Following the proposed taxonomy, this paper sys-
tematically illustrated 1) the applications of BIM in supporting the design, construction, operation, and retro-
tting processes of green buildings; 2) the various functions of BIM for green building analyses such as energy,
emissions, and ventilation analysis; 3) the applications of BIM in supporting green building assessments (GBA);
and 4) research gaps and future research directions in this area. Through critical review and synthesis of BIM and
green buildings based on evidence from both academic research and industrial practices, this paper provides
important guidance for building researchers and practitioners to better align BIM development with green
building development in the future.

1. Introduction relevant challenges could be identied and eectively tackled. Since

The building and construction industry has been driven to adopt
green building strategies in light of increasing sustainability concerns
such as reducing CO2 emission and energy dependency on fossil fuels
[1,123,124]. As a revolutionary technology and process, Building In-
formation Modeling (BIM) has been regarded by many as a signicant
opportunity in the architecture, engineering and construction (AEC)
industry. BIM emerged as a solution to facilitate the integration and
management of information throughout the building life cycle [11],
thereby providing an opportunity for making the best use of the
available design data for sustainable design and performance analysis
[2]. As BIM and green building both continuously gain momentum,
growing AEC rms are embarking on green BIM practices [121]. An
online survey conducted by McGraw-Hill Construction investigated a
wide range of industry professionals who use BIM tools for delivering
green buildings, showing that BIM could signicantly facilitate green
construction and it is expected to be extensively used in the future if
1999, when the concepts and technologies related to BIM application
were rst discussed [1], continuous eorts have been made in exploring
the possibility of BIM in facilitating the development of green buildings.
Various functions of BIM have been studied, such as energy perfor-
mance simulation, lighting analysis, and construction and demolition
waste analysis. Dierent management aspects associated with BIM
adoption have been highlighted, such as its economic benets and or-
ganizational challenges [28]. A number of BIM applications have been
proposed and developed to seamlessly integrate sustainability analysis
into traditional design, construction, and operation processes.
Although BIM has been advocated for its potential to support green
building development in the past decades, few systematic literature
review was conducted to delineate the state-of-the-art development of
the connections between BIM and sustainable building development
based on both academic research and industrial practices [6,9]. Wong
and Zhou [11], for instance, presented an important review of the
academic research eorts in BIM and green buildings, but paid less

Corresponding author.
E-mail addresses: luy@nus.edu.sg (Y. Lu), bdgcr@nus.edu.sg (R. Chang), lyk@tongji.edu.cn (Y. Li).

http://dx.doi.org/10.1016/j.autcon.2017.08.024
Received 3 February 2017; Received in revised form 6 June 2017; Accepted 10 August 2017
Available online 29 August 2017
0926-5805/ 2017 Elsevier B.V. All rights reserved.
Y. Lu et al.
attention to systemically comparing the various BIM applications for
green buildings in the industry. A number of important research ques-
tions concerning the BIM-supported green building development re-
main unexplored, such as (1) the benet and additional value of using
BIM in green buildings throughout the project lifecycle; (2) the func-
tions that BIM software provides for a specic type of sustainability
analysis; (3) the potential of BIM applications to support green building
assessments (GBA) frameworks; and (4) the gaps between industry
development and academic research in the application of BIM for green
buildings.
In order to address the above-mentioned research questions, this
study conducts a critical review on the nexus between BIM and green
buildings based on both academic research and industrial practices.
Specically, over 500 journal articles from 28 key AEC journals pub-
lished (19992016), as well as 12 commonly used types of available
BIM software were critically reviewed. By examining the reviewed ar-
ticles and BIM software based on a stringent four-step taxonomy pro-
cess, this study proposes a Green BIM Triangle taxonomy to cate-
gorize current eorts connecting BIM and green buildings through three
dimensions, namely project phases, green attributes and BIM attributes
[12]. The taxonomy provides a useful tool for researchers and practi-
tioners to understand the current body of knowledge and helps to sti-
mulate future research.
The structure of the study is organized as follows. Section 2 dis-
cusses the research design of this study. Section 3 illustrates the pro-
posed Green BIM Triangle taxonomy in detail, discussing the lifecycle
of green projects supported by BIM, the latest BIM analytical functions
for addressing various green aspects, and BIM-supported GBA. Section 4
identies the gap of knowledge and future research directions, with
Section 5 concluding this article.
2. Research methodology
Connecting BIM and green buildings is the concept of green BIM,
which has been explored by previous studies based on several relevant
concepts such as green buildings [13], sustainable design [14], and
sustainable construction [15]. Wong and Zhou [11] summarized the
previous research on green BIM and dened green BIM as a model-
based process of generating and managing coordinated and consistent
building data during its project lifecycle that enhance building energy-
eciency performance, and facilitate the accomplishment of estab-
lished sustainability goals. To describe the scope and characters of BIM
applications for green buildings, this study follows this denition of
green BIM, which provides the key criteria for the selection of academic
articles and practical BIM software. The selected academic articles and
BIM software were examined based on a four-step classication and
review process, the result of which is the Green BIM Triangle tax-
onomy. Fig. 1 illustrates the research procedure of this study.
2.1. Selection of academic publications
The selection process of academic publications in this study draws
on the methodology adopted in other review articles, such as
[144,145]. The commonly adopted literature selection processes in
review articles include several steps, namely dening the used litera-
ture database and search rules, preliminary search and double-check
screening (literature ltration). To make the review results dependable
and rigorous, many review articles in the construction eld only review
literature published in peer-reviewed academic journals with high re-
putation in the eld, which are deemed to be of higher quality than
conference papers. In accordance with this principal, this study only
reviews journal articles on green BIM. Then, a process similar to
[144,145] was adopted to conduct preliminary search and literature
ltration, thereby identifying the articles most relevant to green BIM.
This process involves reading the titles and abstracts of the articles rst
to exclude the apparently irrelevant articles, and then reading the
135
Automation in Construction 83 (2017) 134148
whole articles to assess whether they directly analyze green BIM. The
detailed procedures are as follows.
Step 1: Select target journals. In order to acquire all possible papers
pertaining to BIM and green buildings, this study adopted three
criteria to select the journals for academic review. (1) The journal is
included in the Science Citation Index (SCI)-Expanded database or
Engineering Index (EI) Compendex database. (2) The journal is re-
cognized or encouraged by two world-recognized international as-
sociations for civil engineering and built environment, namely the
American Society of Civil Engineers (ASCE) that is dominated by
American researchers, and the International Council for Research
and Innovation in Building and Construction (CIB) dominated by
European scholars. And (3) the journal has an important impact and
prominent position in the research community of either BIM and
sustainability or building and construction industry. Based on the
above criteria, 28 widely acknowledged peer-reviewed journals
were identied as target journals for paper selection, as shown in
Table 1.
Step 2: Perform a search on BIM-related studies. This step aimed to
screen all BIM-related articles by using the search keywords of
Building Information Modeling or Building Information Model
or BIM. To determine the eligibility and level of relevance of the
article, all articles published in the above 28 journals from 1999 to
2016 were searched for the keywords via specic domains, such as
title, keywords or abstract. By manually selecting articles
specically related to BIM, a total of 550 BIM-related articles were
identied in this step.
Step 3: Identify the BIM application on green buildings based on the
denition of green BIM. In this step, 92 papers pertinent to green
buildings in the pre-identied BIM-related studies were rigorously
reviewed, while the remaining articles were partially reviewed as
supporting records. The distribution of the 92 articles in the 28
journals is shown in Table 1. It is worth mentioning that this study
mainly investigates the converging points between BIM and green
buildings, so overwhelming studies that only emphasize on either
one of the topics were referred only when needed.
2.2. Selection of BIM software used in AEC industry
In addition to academic studies, this study also reviews current BIM
software and applications that are developed to improve the sustain-
ability performance of buildings throughout their lifecycle phases. To
this end, based on the denition of green BIM, 12 types of popular BIM
software specically designed and developed to address green and
sustainable building issues were selected from the BIM Tools Matrix, the
industry-shared knowledge compiled by BIM Forum [16]. Table 2 pre-
sents an overview of the 12 types of BIM software.
It is important to note that there is no single satisfactory denition
of BIM [125]. An extensively referred denition is provided by Succar,
B. [128], who dened BIM as a set of interacting policies, processes
and technologies producing a methodology to manage the essential
building design and project data in digital format throughout the
building's life-cycle. This denition reveals that BIM is a methodology
comprised of interacting processes and technologies, serving for the
entire life cycle of buildings from architectural design to facility man-
agement, demolition and refurbishment of buildings. Various BIM ap-
plications exist, with some emphasizing the aspect of architectural de-
sign while others may focus on sustainability analysis. Based on a
systematic review of the literature, a structured questionnaire survey,
action learning, focus group discussions and email surveys, Abanda
et al. [126] provide one of the most holistic reviews of BIM applica-
tions, listing 122 BIM software systems including BIM systems for ar-
chitecture such as Vectorworks, for structural engineering such as Tekla
Structures and Robot Structural Analysis; for building service such as
Revit MEP and MagiCAD, for project management such as Synchro,
Y. Lu et al. Automation in Construction 83 (2017) 134148

Fig. 1. Research methods and procedure of this

Target journals 550 articles study.

28 journals Green BIM

Academic
studies
publication
s
BIM studies 92 articles
Selection
process
BIM BIM Tools 13 BIM
software Matrix applications

Domain of Similarity evaluation

objects Software Publication
Development of
Review
Green BIM
process
Triangle Taxonomy Properties of Taxonomy
objects development

Table 1 Vico and BIMMeasure, for facilities management such as Bentley Fa-
Review sources of 28 academic journals and the identied articles during 1999 to 2016. cilities and ArtrA, and for sustainability analysis such as Green Building
Studio and DesignBuilder. Similarly, Kassem et al. [127] propose pro-
Journals Number of articles (19992016)
tocols for BIM collaborative design that can be utilized at project level
BIMa BIM & green buildings to increase the consistency of information ow and BIM deliverables, by
using several BIM systems including Revit, Integrated Environmental
Architecture Science Review 1 1
Solutions Virtual Environment (IES-VE) and Navisworks as an example.
Advanced Engineering Informatics 49 9
Architectural Engineering and Design 15 3
These studies indicate that the family of BIM software systems should
Management holistically cover the various aspects of buildings, and tools for sus-
Australasian Journal of Construction 11 1 tainability analysis such as IES-VE are part of the BIM family. This is
Economics and Building further illustrated in Azhar and Brown [129] and Azhar et al. [95],
Automation in Construction 183 28
which found that there are three commonly used BIM-based sustain-
Building and Environment 6 5
Energy and Buildings 14 14 ability analyses software, namely Autodesk Ecotect (which has been
Building Research and Information 3 0 ended since 2015), Autodesk Green Building Studio (GBS), and IES-
Built Environment Project and Asset 7 0 VE. Similarly, these sustainability analysis tools are named as BIM
Management
analysis tools in the BIM Tools Matrix, compiled by BIM Forum. In
Construction Innovation 19 3
Construction Management and Economics 9 1
accordance with the above studies, this study selects and reviews 12
Computer-Aided Civil and Infrastructure 3 0 BIM analysis tools from the BIM Tools Matrix.
Engineering Most software programs are specially developed for the design
Engineering, Construction and Architectural 9 0 phase and used by architects, designers or engineers. Few can be used at
Management
the construction or operation phase. In regard to the functionality,
Facilities 5 2
International Journal of Project Management 4 1 these 12 types of software programs can contribute to the sustainability
ITcon - Journal of Information Technology in 84 8 analysis of green buildings in six aspects, including energy consump-
Construction tion, carbon emissions, natural ventilation, solar radiation and lighting,
Journal of Building Performance Simulation 14 4 acoustics, and water usage. The rst four aspects can be addressed by
Journal of Civil Engineering and Management 12 1
Journal of Computing in Civil Engineering 47 2
around ten types of software, while the last two aspects are only sup-
Journal of Construction Engineering and 29 3 ported by certain types. The details of these 12 types of BIM software
Management programs will be discussed in Section 3.2.
Journal of Engineering Design and 1 0
Technology
2.3. Review method and the development of Green BIM Triangle
Journal of Management in Engineering 17 3
Proceedings of Institution of Civil Engineers - 4 1 taxonomy
Civil Engineering
Project Management Journal 1 0 The review of the academic research and 12 types of BIM software
Smart and Sustainable Built Environment 1 1 identied above follows a stringent four-step process proposed by
The International Journal of Construction 2 1
Management
Fleishman and Mumford [12]. The outcome of this rigorous review
Total 550 92 process is the development of a Green BIM Triangle taxonomy, which
synthesizes the connections between BIM and green buildings into an
a
Note: no relevant papers are found for the following journals, including Intelligent overarching framework. The details of the four-step process developing
Buildings International, and International Journal of Disaster Resilience in the Built
the Green BIM Triangle taxonomy are as follows.
Environment.

Step 1: Specify the domain of objects to be classied. A classication

136
Y. Lu et al. Automation in Construction 83 (2017) 134148

Table 2
12 popular types of BIM software and their functions used for green analyses.

BIM software Green analysesa Usersb Usersc Supplier web link

E CE NV SD A W

Autodesk Green Building Studio A/D De/OM www.autodesk.com

Integrated Environmental Solutions Virtual Environment A/D/E/O De www.iesve.com
Bentley Hevacomp D/E/C De www.bentley.com
AECOsim E/C/D De www.bentley.com
EnergyPlus E/A De www.apps1.eere.energy.gov
HEED O/A/D/C De www.energy-design-tools.aud.ucla.edu/heed
DesignBuilder Simulation C/E/A De www.designbuilder.co.uk
eQUEST A/E/C De/C/OM www.doe2.com/equest
DOE2 A/E/C/U/G De www.doe2.com
FloVENT E De www.mentor.com
ODEON Room Acoustics Software A/E De www.odeon.dk
TRNSYS A/E De www.trnsys.com

a
E for energy, CE for carbon emissions, NV for natural ventilation, SD for solar and day lighting, A for acoustic, W for water.
b
A for architects, D for designers, E for engineers, O for owner, C for consultants, U for utility companies, G for government.
c
De for design, C for construction, OM for operation and maintenance.

system describes the structure and relationships among a set of
objects drawn from a certain domain, in which similar objects can
be assigned to a smaller number of categories [12]. In this study, the
domain of objects is the previously identied research articles and
BIM software.
Step 2: Dene and measure the essential properties of objects.
However, the selection of essential properties which represents the
basic building blocks of the taxonomy has seldom been studied.
There are few guidelines on dening what characters are admissible
and useful in classifying objects. One source of selecting variables is
from the body of underlying theories [17]. Based on the keywords of
reviewed papers and their underlying theories, this study categor-
ized all current functions and practices of green BIM based on three
dimensions, namely project phases, green attributes, and BIM
attributes. Specically, the project phases were identied based on
the theory of project management; the green attributes were pro-
posed from the sustainability baseline; and the BIM attributes were
derived from vital BIM features referred by keywords of the re-
viewed papers.
Step 3: Appraise the similarity and dierences of the reviewed pa-
pers and BIM software respectively based on the project phases
and green attributes identied above. For the research articles,
according to their research topics and aims, they were categorized
into dierent groups based on their level of similarity in the di-
mensions. For instance, Schlueter and Thesseling [18] as well as
Shrivastava and Chini [19] focused on the application of BIM for
energy analysis in the design phase, and thus were classied into the
same category, i.e. energy-design group. Likewise, other groups of
articles could be generated such as carbon emission-design group
and energy-construction group. For the 12 types of BIM software,
they were similarly examined and compared according to their
features in the project phases and green attributes dimensions.
For instance, both types of BIM applications, i.e. DOE2 and TRNSYS,
could conduct energy analysis and natural ventilation analysis for
the design phase.
Step 4: Determine whether the reviewed papers and applications
display sucient similarity to permit assignment to a common ca-
tegory. After identifying the specic groups, this study critically
examined the research articles and BIM applications within each
group, to reveal the research aims, contributions and gaps of
knowledge in each group of study or software. Subsequently, a
taxonomy was developed to synthesize the themes of the current
academic and industrial eorts in connecting BIM with green
buildings, as shown in Fig. 2, which is discussed in detail in the next
section.
3. The nexus between BIM and green buildings
There are two entities associated with green BIM, namely BIM and
green buildings. In terms of BIM, the key features of BIM are captured
by the BIM attributes dimension in the taxonomy, which represents
the analytical functions that BIM software can provide to the built en-
vironment. The essential features of BIM can be summarized into four
aspects, namely integrating with various databases, facilitating docu-
ment management, visualizing analytical processes and results, and
providing sustainability analyses and simulations.
In terms of green buildings, two important dimensions, namely the
project phases and green attributes are adopted to describe green
buildings. The project phases dimension captures the perspective of
project lifecycle. Any green project experiences a lifecycle process that
starts with project design, through construction, operation, main-
tenance, and ends with the demolish phase. The green attributes di-
mension includes sustainability considerations that could be addressed
by using BIM software, such as energy, thermal comfort, carbon emis-
sions, water, material waste, daylighting, natural ventilation, and
acoustics analysis.
As shown in Fig. 2, the three dimensions form a triangle where BIM
and green buildings have interactions. The interactions could be de-
composed into two aspects, namely how BIM could support the dif-
ferent phases and the whole lifecycle of green buildings (i.e. BIM at-
tributes-project phases); and how BIM could support the various
sustainability aspects of green buildings (i.e. BIM attributes-green at-
tributes). The dark green arrow in Fig. 2 denotes such impacts of BIM
on green buildings. Highly relevant to the green attributes, GBA, such
as the LEED framework, can provide a holistic evaluation on the various
green attributes. Therefore, a discussion on integrating BIM software
with various popular GBAs was provided in this study as well. To
summarize, the following sub sections address three important aspects
of BIM-green building nexus, namely 1) BIM-supported green project
lifecycles, 2) BIM functions for green issues, and 3) BIM-supported
green building assessment.
3.1. BIM-supported lifecycles of green buildings
3.1.1. BIM-supported designs of green buildings
Sustainability of buildings has become a critical consideration for
building design as decisions made in the early design stages has a sig-
nicant inuence on the actual environmental impacts of buildings
[2829]. Traditional design methods are limited in term of continually
analyzing sustainability during the design process due to fragmented
information [1]. A BIM model can be used as a database for data

137
Y. Lu et al.
exchange and integration based on the industry foundation classes (IFC)
[23]. Regarding the design phase, BIM allows for multi-disciplinary
information to be superimposed on one model, which creates an op-
portunity for sustainability measures to be incorporated throughout the
design process [20]. With the aid of these BIM applications, architects
and engineers can more eectively share information related to sus-
tainability, such as daylighting and energy consumption, and thus the
sustainability analysis can be seamlessly integrated into the design
process. BIM can also help designers utilize the existing building data
sets to optimize the default conguration for building performance si-
mulations during early phases of new building design [33].
To be specic, various BIM applications have been developed to
address sustainability issues in the design process. The majority of
green BIM applications are designed for building performance analyses
and simulations, such as energy performance analyses [8,18,19,3437],
CO2 emission analyses [28,38], lighting simulations [39] and some
integrated building performance optimization [40]. These BIM appli-
cations help designers by providing more integrated and visualized
views of building performance in the early design phase. For instance,
Schlueter and Thesseling [18] presented a prototypical tool, the Design
Performance Viewer (DPV), which enables instantaneous energy cal-
culations and graphical visualization of the resulting performance in-
dices, thereby assisting designers to make energy conservation deci-
sions. Another example illustrated the use of BIM to provide a powerful
visualized workow in control systems [24]. BIM also has great po-
tential in helping to minimize construction waste during project design
phases, especially at the concept and design development stages
[4244]. For example, various BIM-based estimation systems of con-
struction waste, which extract and process the component information
of each building element in a BIM model, have signicantly improved
waste estimation and planning [4547]. Similarly, BIM-based material
analysis tools have also been proposed to enable designers in simulating
architectural and structural design requirements and making necessary
design adjustments to reduce material waste, such as rebar waste [48].
Based on the above-detailed sustainability analyses, BIM can be
used to assess the impacts of various design alternatives on the building
performance so that designers can make more rational decisions en-
vironmentally. For instance, Jrade and Nassiri [30] integrated BIM with
138
Automation in Construction 83 (2017) 134148
Fig. 2. Green BIM Triangle taxonomy. (For interpretation of the
references to colour in this gure, the reader is referred to the
web version of this article.)
a decision-making approach (Entropy-TOPSIS), which can eciently
optimize the selection of sustainable building materials at the con-
ceptual design stage of building projects. Inyim et al. [31] introduced a
design optimization tool integrating BIM with Simulation of Environ-
mental Impact of Construction, to help designers fulll multiple sus-
tainable objectives in their decision-making process, such as objectives
related to construction time, initial construction cost, and CO2 emis-
sions. Similarly, Oti and Tizani [41] provided a BIM integrated system
combining three green indicators, i.e. life cycle costing, ecological
footprint and carbon footprint, to aid structural engineers in the sus-
tainability assessment of alternative design solutions.
3.1.2. BIM-supported construction of green buildings
It is widely acknowledged that construction process has a major
impact on the environment in terms of many aspects, such as carbon
emission [49], noise pollution, resource consumption and waste gen-
eration [42,146]. BIM software provides various ecient solutions to
mitigate these environmental impacts of the construction process. For
instance, a 3-D BIM model was proposed to measure the CO2 footprint
in a house construction process and to provide recommendations for
improving construction activity schedule and to reduce associated
emissions [49].
Existing studies highlighted that BIM technology could contribute to
waste reduction which is an important aspect of sustainable construc-
tion [51,52]. For instance, Shanghai Center, the tallest building in
China, has beneted from a new BIM-based lifecycle data management
approach that has helped the project to achieve a material waste rate of
4%, compared with the average level of 10% in China [50]. Similarly, a
BIM-based system was developed to provide early alerts of construction
waste to contractors [48], and likewise, a real-time BIM and System
Dynamics based methods was proposed to minimize construction waste
generated due to rework, lack of coordination, and poor integration of
building subsystems during the construction process [53].
3.1.3. BIM-supported operations of green buildings
Monitoring the sustainability performance of buildings in the op-
eration phase is very important as it could verify the actual perfor-
mance compared with the targets set in the design phase. This is a
Y. Lu et al.
complicated task as the information of buildings within operation phase
must be collected from dierent stakeholders in various phases. BIM
can support the supply, integration, and management of information
throughout the building lifecycle [57]. Consequently, BIM has been
considered as an invaluable tool in monitoring the sustainability per-
formance of buildings in their operation phase [58]. In a case study,
BIM was used as an enabling technology for cloud-based building data
services that integrated building data in the operational phase with a
focus on energy management [59]. Similarly, Yang and Ergan [60]
presented a BIM-based automated approach to help facility managers
streamline the process of troubleshooting HVAC-related problems.
However, the use of BIM for facility management (FM) during the
operation phase is still limited. Three major reasons have been identi-
ed: (1) lack of awareness about the benets brought by using green
BIM for operation management; (2) lack of clear denition of the data
exchange for operation management; and (3) lack of clearly dened use
cases in compliance with industry standards/guidelines for practi-
tioners to follow [61].
3.1.4. BIM-supported renovations and retrot of green buildings
Practitioners believe BIM applications provide feasible solutions to
address sustainability issues on project renovations [58]. Researchers
have also demonstrated examples of using BIM on retrotting/re-
novation projects. For example, Akbarnezhad et al. [62] proposed a
sustainable deconstruction strategy which uses the information pro-
vided by BIM to enable the retrieving of energy and capital invested in
building components. Similarly, Lagela et al. [63] presented a hybrid
method based on BIM and other information technologies to support
energy rehabilitation processes ranged from energy usage diagnoses to
retrotting decision-making. Woo and Menassa [64] provided the Vir-
tual Retrot Model (VRM), an aordable computational platform in-
tegrating BIM, energy simulation and other technologies to support
streamlined decision making of building retrot projects. Likewise,
Larsen et al. [21] proposed a new approach for analyzing energy per-
formance of retrot projects using BIM and 3D laser scanning.
BIM technology can benet waste management in demolition and
renovation projects [65]. For instance, a BIM-based prototype system
was developed for contractors to automatically and accurately estimate
the amount of renovation and demolition waste [66]. However, the
estimation of construction waste in new projects cannot be achieved,
and more eorts are needed to extend the applicability of existing BIM-
based system.
3.1.5. Summary of BIM-supported project lifecycles
To summarize, BIM could support various facets of green buildings
during their lifecycle, as shown in Fig. 3. Overall, current research
suggests that the benets of using BIM in the lifecycle process of green
projects can be categorized into three aspects. First, BIM data can be
exchanged among multi-disciplinary users with dierent analysis tools
of sustainability. For instance, a BIM-based modular web service fra-
mework can integrate the information necessary for green building
design, automate the design evaluation processes, and facilitate simple
updates on the building model on a common but distributed platform.
Second, BIM applications can provide visual information related to
Design Construction Operation
Faciliate data exchange Analyze various Help to monitor the
and integration environmental impacts sustainability
Provide visulized of construction process performance of
building performance Contribute to waste buildings
analysis and simulations reduction
Assess design Improve construction
alternatives productivity and
performance
Automation in Construction 83 (2017) 134148
building performance and process and thus enable project participants,
such as designers, contractors and owners, to make more environ-
mental-friendly decisions. For instance, a BIM-based energy consump-
tion assessment of a building was designed to provide a graphical vi-
sualization of energy performance indices [18]. Third, BIM could
enhance the communication and collaboration of various stakeholders
associated with green design, construction, and operation [25]. This
integrated platform oers a new paradigm for all stakeholders who are
working on the same project for a shared vision [26]. This strengthens
ties among all project parties who, in the building and construction
industry, had previously experienced fragmented relations.
Although various benets brought by green BIM applications have
been perceived, there is still debate on using BIM for green buildings. A
group of design and construction professionals believes that sustain-
ability is not the primary application of BIM, and instead they believe
project coordination and visualization are [67]. During the construction
process, BIM is considered by many as a means of improving quality
management and scheduling rather than sustainability [68]. Similarly,
an investigation revealed that, most BIM-enabled construction projects
are tightly coupled technologically, but divided organizationally [27].
This organizational division may be aggravated by some technical is-
sues of the BIM software, such as the weak interoperability between
dierent BIM software and across organizational boundaries. Besides,
mentality issues may also lead to a dissuasive attitude towards BIM-
based collaboration for sustainable construction. For instance, con-
struction practitioners may reject the use of BIM software as they be-
lieve BIM is currently too complicated to use and not a necessity within
the industry [8]. However, as more design and construction profes-
sionals understand the potential benets of BIM for green buildings, it
will become a vital tool for sustainable design and construction [67].
Existing BIM software and its green features are also mostly limited
to the project design phase and seldom extend to the project con-
struction or operation phases. Given that more types of BIM software
have developed the analytical capacity for an entire project lifecycle
[50], one can expect that the green BIM applications supporting the
whole lifecycle of green buildings will experience growth as well. For
example, eQUEST has begun to support detailed energy performance
analyses throughout the phases of construction documentation, com-
missioning, and post-occupancy [130].
3.2. BIM functions for major green issues
This section presents a detailed discussion of 12 types of BIM soft-
ware and investigates they can assist green buildings in 6 aspects,
namely energy consumption, carbon emissions, natural ventilation,
solar and lighting analysis, acoustics, and water usage.
The selected 12 types of software are highly diverse in their own
features, end users, and applicable stages, which are listed in Table 2.
For instance, ODEON Room Acoustics Software is designed for acoustic
analyses for special professionals. Other BIM software provides broad
and comprehensive sustainability analyses, such as Green Building
Studio (GBS). GBS is mainly used in the design phase, but it also serves
various end users, including architects, designers and engineers, as well
as other project participants whose work can benet from using BIM
Fig. 3. BIM-supported lifecycles of green projects.
Renovations
and retrofit
Support the retrieving of
energy and capital
investments
Benefit waste
management
139
Y. Lu et al.
applications, such as consultants, owners, and contractors [70]. An-
other example is Integrated Environmental Solutions Virtual En-
vironment (VE), which visualizes sustainability issues in project de-
livery and helps owners determine the most optimized green-design
solutions [71].
3.2.1. Energy performance analyses and evaluations
BIM software provides four major functions on energy performance
analyses and evaluations, namely 1) a whole building energy analysis,
2) detailed analyses for dierent energy conservation measures, 3) a
feasibility evaluation of renewable energy and, 4) a more eective
detection and diagnostics of energy faults.
1) First, BIM software has advantages in analyzing whole building
energy performance. One advantage is that BIM software improves
the usability of the whole building energy calculation by using
standard processes and parameters. Traditional analysis and as-
sessment methods of energy performance, for instance, the CAD-
based method, take a substantial amount of time and eort for
modeling. The implementation of these methods is largely depen-
dent on the assessors' skill and experience, and thus is subject to
problems associated with objectivity [72]. On the contrary, BIM
software follows a standard process to calculate whole building
energy consumption based on various parameters such as building
use patterns, building shape, materials, and weather conditions
[131]. These are generally default parameters retrieved from an
external database where information has already been collected
from surveys of standard practices. Consequently, such a calculation
is less dependent on an individual user's experience and knowledge.
2) Second, BIM software supports detailed analyses for dierent energy
conservation measures. For instance, during the building operation
phase, occupant behaviors have a signicant inuence on the whole
building energy use. Therefore, simulation applications of building
energy have incorporated occupant eects into the energy analysis
process to evaluate energy savings based on dierent scenarios of
schedules [73]. Factors associated with occupants such as occu-
pancy and equipment schedules are considered in the applications.
By comparing the results of various energy-saving measures pro-
vided by BIM software, users of the software can better optimize the
original solution.
3) Third, some types of BIM software, such as GBS and VE, can also
estimate the feasibility of adopting renewable energy, such as pho-
tovoltaic and wind power [20,70,71]. In most cases, the estimation
result is signicantly inuenced by the local context and thus re-
quires project-specic data to achieve higher accuracy. Due to the
diculty of data collection, some critical factors have not yet been
fully incorporated and considered in current BIM-based renewable
energy analyses. For instance, most types of BIM software have a
limited capacity of estimating the co-eects of shelters around the
building. This has led to a strand of research investigating the
concept of Inter-Building Eect (IBE). For instance, it has been re-
vealed that building's energy performance can be signicantly im-
pacted by surrounding buildings through mutual reection and
mutual shading [132]. Even though some studies e.g. [133] have
contributed to the understanding of IBE and how it may impact
building energy consumption, few studies have explored how IBE
impacts the potential of utilizing renewable energy in buildings.
4) Fourth, BIM software can support an online real-time fault detection
and diagnostics (FDD) of building energy to achieve more eective
energy performance maintenance over the lifecycle of buildings.
Such BIM-supported FDD approach provides a scalable and adap-
table information infrastructure that can integrate other energy
performance analysis and simulation technologies to streamline the
information exchange process, thereby closing the information gap
between facility managers and designers [61].
140
Automation in Construction 83 (2017) 134148
Although BIM software can contribute to energy performance ana-
lysis in various areas, as discussed above, the direct application of BIM
with preloaded energy performance properties in existing buildings is
still challenging because heat transfer condition of building elements
gradually degrades during the operational phase [74]. In order to ad-
dress this limitation, both semi-automated and automated methods for
BIM reconstruction are proposed, such as automatic as-is 3D modeling
methods from point clouds [7578] and image-based thermal BIM re-
construction methods [79,80]. By using as-is BIM as an input of BIM-
supported energy analysis, the gap between the energy performance
information in the as-designed BIM and as-is building conditions can be
signicantly shortened [80], and designers can model the current en-
ergy performance of existing buildings in a more reliable way.
In addition to the above technical functions, BIM software is also
capable of presenting energy analysis information in various ways.
Energy analysis results are typically presented on a yearly, monthly,
daily, and hourly basis. Most types of BIM software provide a user-
friendly interface that does not require users to have expertise in energy
analysis or computer programming. Several types of BIM software, such
as GBS, can even automatically convert estimated energy usage into
energy costs by using default utility rates [70]. However, some types of
BIM software, such as EnergyPlus, still provide a text-based user in-
terface in which the software can only read and output the information
as text les [68].
3.2.2. Carbon emissions analyses and evaluations
BIM software provides carbon emissions analyses and evaluations to
help the project achieve carbon neutrality. Current BIM software has
incorporated both building-system components and the external en-
vironment into carbon emissions analyses by using information such as
local electricity emissions, hydrocarbon production in the construction
site, and other energy conversion approaches. In order to assess how
such factors aect a building's carbon emissions throughout its life-
cycle, some types of BIM software use standard data from an external
global database. A typical case is the VE software which uses a global
database of weather information [71].
Besides carbon emissions analyses, current BIM software also pro-
vides alternative designs for carbon emission reduction, thereby
helping designers and engineers optimize their original designs towards
carbon neutrality. For instance, GBS can provide suggestions in se-
lecting local utility providers who discharge fewer emissions by using
renewable energy [70]. Liu et al. [82] developed a BIM-based multi-
objective optimization model, which aids designers to identify and
choose the optimal design scheme balancing carbon emission and cost
for their clients. Similarly, BIM software can simultaneously estimate
embodied and operational carbon over the life span of buildings, so
designers can make better decisions on material selection [81].
3.2.3. Natural ventilation system analyses and optimization
BIM software is applicable for ventilation analysis and optimization
to reduce building energy use as well as to raise a building's thermal
comfort level. Built on the key eects of building occupancy and
equipment, BIM software can estimate the potential capacity for natural
ventilation to handle the heating and cooling loads of buildings [20].
Based on the predicted results, BIM software helps users evaluate the
feasibility of using natural or mixed modes of ventilation strategies, e.g.
single-sided ventilation, cross-ventilation, whole-building ventilation,
chimneys, and opening controls. Such evaluation of the ventilation
strategies can assist users to select a reliable mechanical ventilation
system for the target project.
3.2.4. Solar radiation and lighting analyses
BIM software provides lighting impact analyses for both the exterior
and interior of buildings. Externally, BIM software incorporates a de-
tailed solar radiation analysis module to help designers and engineers
understand and optimize the impact of sun on a building. First, BIM
Y. Lu et al.
software could display the sun's position and path relative to a building
model at any time and location, which enables designers and engineers
to optimize the building's position and orientation at an early stage of
design. Second, BIM software supports the assessment of solar gain,
temperatures, and radiant exchange on the building surfaces. The as-
sessment results can be visualized and presented at any time interval of
the building thermal analysis. Third, several types of BIM software,
such as VE, can test the internal and external solar shading eect and
compare the simulated results with the expected design [71]. The
comparison can then be used as evidence to help designers select ap-
propriate shading systems.
Internally, BIM software adopts a detailed lighting-condition ana-
lysis to improve the utilization of natural daylight and visual comfort of
buildings. BIM software provides an overview of lighting conditions for
the whole building so that designers and engineers can visually appraise
how their lighting designs will perform. Besides, BIM software provides
a detailed point-by-point simulation by comparing natural and articial
light. In addition, the calculation can be adjusted based on dierent
weather conditions. To better simulate the local context, BIM software
such as DesignBuilder Simulation enables users to manually set custo-
mized parameters, such as the radiance level [83].
Despite the benets discussed above, one major issue has been
identied in the integration of green BIM with lighting and solar ra-
diation simulation, i.e. the lack of information for simulations. Most
researchers argue that BIM does not have all the information that is
necessary for creating the input les for lighting simulation tools, such
as Radiance and DAYSIM. To solve this issue, a new methodology,
ThermalOpt, was proposed as an automated BIM-based simulation
method intended for use in multidisciplinary design optimization en-
vironments [84]. Meanwhile, Landry and Breton [85] presented a de-
tailed workow of doing daylighting analysis using 3ds Max Design
from BIM software. Kota et al. [86] provided a new method to enable
direct integration of BIM with Radiance and DAYSIM. However, all the
above eorts focus on the integration of BIM with specic types of
lighting and solar radiation simulation tools. Therefore, future studies
could develop a general method applicable for the majority of existing
simulation tools.
3.2.5. Water usage analyses
BIM software supports water usage analyses mainly at design phase.
BIM software estimates water usage based on relevant factors e.g. the
type of building and number of occupants, and could automatically
convert the estimated results into water cost reports [70]. However, the
estimation is still rough due to limited factors considered in the ana-
lyses. Factors such as the project location and users' behavior may cause
large variances to the estimated result. It is suggested that future BIM
software should consider the full spectrum of eects impacting water
use. In addition, BIM software can help optimize a building's water
distribution system. For example, to help users make decisions on fu-
ture renovation of the waste systems, BIM software could provide fast
water capacity tests based on the water ow data that stored in its
model [88]. Similarly, a newly developed BIM-based application, LicA,
was proposed to perform the automated design code checking of water
distribution systems of buildings [87].
3.2.6. Acoustics analyses
BIM software enables architects to simulate acoustic performance at
earlier stages. Connecting BIM data with existing acoustic simulation
system can increase the level of automation and save simulation time.
For instance, a prototypical BIM-based acoustic simulation application
was proposed to reduce the simulation time from a few days to a few
minutes while maintaining or increasing accuracy [45]. Besides, this
application can re-simulate the result immediately whenever any up-
date is made in the original BIM model [45].
BIM-based acoustic simulation software provides multiple types of
outputs. For instance, visualized maps could be generated based on
141
Automation in Construction 83 (2017) 134148
simulation results to show various acoustic eects of the building.
Furthermore, some BIM software, such as ODEON Room Acoustics
Software, can present simulated acoustics in 3D audio eects and vi-
vidly broadcast over headphones or loudspeakers according to users'
customized requests [89]. Future BIM-based acoustic simulation soft-
ware could further integrate with emerging technologies, such as vir-
tual reality, to provide visual and audial experience in a more vivid
way.
3.2.7. Thermal comfort analyses
Green buildings are only eective when the occupants in the
buildings feel comfortable, which indicates the high importance of as-
suring thermal comfort in green buildings. According to the ANSI/
ASHRAE Standard 55-2013, thermal comfort is dened as that con-
dition of mind which expresses satisfaction with the thermal environ-
ment and is assessed by subjective evaluation [134]. There are six
primary factors that directly aect thermal comfort, including meta-
bolic rate, clothing level, air temperature, mean radiant temperature,
air speed and humidity [135]. Through simulating or monitoring these
factors, BIM applications help to evaluate occupants' thermal comfort.
For instance, a framework for the integration between wireless
sensor network (WSN) and BIM-based model was developed to measure
and record temperature and humidity in a spatial manner, thereby
partially monitoring thermal comfort and enabling asset managers in
facilities inspection [136]. Similarly, a case study is provided on the
ocial website of IES-VE, showing that IES thermal models could be
used to evaluate buildings with comfort issues, such as overheating and
underheating, and help to identify the reasons behind comfort issues
[137]. BIM applications could not only contribute to post-occupancy
monitoring of thermal comfort through integrating various sensors,
they can also help simulate and optimize thermal comfort in the design
stage. For instance, BIM could be used to conduct Computational Fluid
Dynamics (CFD) simulations to examine the air temperature and speed
around occupants in dierent positions in the oce, thereby optimizing
thermal comfort through properly arranging the occupants' positions
[138]. Similarly, based on models generated in Revit, IES-VE could be
used to simulate Fanger's predicted mean vote (PMV) and predicted
percentage of dissatised (PPD), which are widely used to reect
thermal comfort, thereby enabling the evaluation of indoor thermal
comfort through comparing the simulated data and comfort require-
ments in the standards [139].
3.2.8. Summary of BIM functions for green issues
The above-mentioned BIM applications are designed and developed
for various sustainability analyses, such as energy performance, CO2
emissions and lighting analyses. A few BIM applications have also
proposed solutions for water conservation and indoor air improvement.
Fig. 4 has summarized the main functions of BIM for green analyses.
However, most of these applications are designed specically for one
type of analysis and cannot address others. As a result, industry prac-
titioners may underutilize their capabilities in using these BIM appli-
cations [67]. In the future, a generic and integrated green BIM appli-
cation is needed that would allow a systematic analysis of a building's
whole environmental sustainability.
The dependence of BIM software on external database could gen-
erate potential risks for sustainability analysis. If the external database
has incomplete data, BIM software then has to use unmatched data to
input the default parameters, which leads to deviations in its calcula-
tions. For instance, Green Building Studio (GBS) may not be reliable to
conduct a whole building energy analysis for residential or industrial
buildings, as no data has been collected from residential or industrial
buildings in GBS's external database, i.e. the Commercial Buildings
Energy Consumption Survey (CBECS) [70]. Moreover, out-of-date data
provided by the external database also weakens the reliability of re-
levant analyses. It is suggested that timely maintenance and update of
the external database for BIM software is very important and should be
Y. Lu et al. Automation in Construction 83 (2017) 134148

BIM supported
functions for green
issues

Energy performance Carbon emission Natural ventilation Solar radiation and Thermal comfort
Water usage analyses Acoustics analyses
analyses analyses system analyses lighting analyses analyses

Estimation of the Solar radiation Simulation and

Whole building Carbon emission Water usage Acoustic performance
capacity for natural analyses for the optimization at the
energy analysis caculations estimation simulation
ventilation exterior of buildings design stage

Evaluation of various
Evaluations of Design alternatives for Enhanced visual and Monitoring comfort
natural or mixed Lighting-condition Optimization of water
different energy carbon emission audial effects of levels by integrating
modes of ventilation analysis distribution system
conservation measures reduction simulated acoustics sensors
strategies

Feasibility evaluations Point-by-point

of renewable energy lighting simulation

Fault detection and

diagnostics of energy
systems

Fig. 4. Main BIM functions for sustainability analyses.

paid more attention to. of BIM for the LEED certication process and the associated challenges
Moreover, since BIM serves as an open and collaborative database- as an illustrative case.
exchange platform, a foreseeable trend is the combination of green BIM
with other emerging technologies such as geographic information sys-
3.3.1. The value of BIM for end users in the GBA process
tems [90], cloud computing [50,9092], laser scanning [21,63], and
The value of BIM in facilitating the GBA process could be sum-
nanotechnology [69]. For instance, in order to eectively reduce ra-
marized into three aspects. First, BIM software can help users choose
dical pollution and waste in the AEC industry, a new building para-
eective strategies to achieve green building certication. For instance,
digm, i.e. using BIM and biotechnology, has been proposed [69]. Ac-
to achieve LEED certication, BIM software can help users determine
cording to this new paradigm, bio-nan robots produce building
the number of LEED points targeted and the level of LEED certication
materials by using carbon extracted from CO2 in the air and thus
they are pursuing [93]. Second, BIM software can interpret and esti-
buildings build themselves [69]. New research initiatives can also
mate credits for dierent GBA standards. With the aid of BIM software,
enhance BIM by providing new analyses or more reliable solutions
project participants can better understand the requirements of the
through various approaches, such as using social media, big data, and
credits and ensure that the building design, construction, and operation
human behaviors to engage stakeholders and increase the accuracy of
follow such certication requirements. Third, BIM software can facil-
simulations. Similar studies are foreseeable to advance sustainability
itate documentation management needed to apply for and maintain
research in the built environment to the next level.
GBA certicates. As a result, the management eciency and success
rate of applications could be improved, and the upfront management
costs of GBA applications could be reduced [92,94,95].
3.3. BIM-supported green building assessment (GBA)
LEED, as one of the most popular GBAs in the world, was developed
to provide building owners and operators a concise framework for
Following the six aspects of green analyses mentioned above, this
implementing practical and measurable green building design, con-
section discusses how BIM can holistically facilitate the green building
struction, and operation solutions [98]. Environmental sustainability
assessment (GBA) processes. GBA aims to provide comprehensive and
analysis is compulsory for all projects that pursue LEED certication.
quantitative assessments on building performance that is inuenced by
Previously, the LEED certication process and BIM model application
buildings' site selection, energy performance, carbon emissions, water
were two separate processes and performed by two teams. Recent stu-
eciency, indoor environment quality, and material consumption.
dies have proposed to streamline the LEED certication process by
Recently, several eorts have been made to integrate BIM software with
using BIM models that can store multi-disciplinary information used for
various GBAs, but there is still no systematic review of the connections
certication. Compared to traditional methods, BIM-supported GBA
between BIM software and popular GBAs. This study develops a matrix
methods could save substantial time and resources. For instance, 25
(shown in Table 3) to compare various GBA accreditation requirements
credits, or 75% of elective points in LEED-NC 2009, can be examined
and BIM-supported analyses for these requirements.
using BIM software.
A total of four global GBA standards have been examined in this
study, which include LEED (Leadership in Energy and Environmental
Design), BREEAM (Building Research Establishment Environmental 3.3.2. Challenges for integrating BIM with GBA
Assessment Methodology), Green Star, and BEAM Plus (Building While the majority of green practitioners recognize the value of
Environmental Assessment Method). For each one, related studies were BIM-LEED calculating tools for sustainable design and construction,
reviewed and analyzed to extract essential information in regard to the several challenges exist for popularizing these tools. The current BIM
usefulness of BIM. This study highlights the unique value provided by software is still insucient in providing an integrated analytical solu-
BIM software for the GBA process, as well as the improved eciency of tion for an individual GBA, as it does not have the capacity to si-
GBA process after using BIM. Subsequently, this study presents the use multaneously analyze all green aspects of buildings. Most types of BIM

142
 Y. Lu et al.

Table 3
BIM-supported green building assessments (GBAs).

Name of GBA LEED-NC 2009a BREEAM 2011 New Constructionb Green Star 2008c BEAM Plus 2010d

Country/region of practices USA UK Australia Hong Kong

Total credits and points
Minimal required credits
BIM-supported management related credits
BIM-supported site and transportation
related credits
BIM-supported energy and atmosphere/
emissions related credits
42 credits (7 required credits), 110 points
3/7 credits (SSp1, WEp1, EAp2)
N.a.
8 credits in sustainable site
1 credit (EAc1) with 54.3% points; 5 other
credits with limited support
49 credits (3 required credits), 100110 points 64 credits (2 required credits), 80 credits (9 required credits),
100110 points 100103 points
2/3 credits (Man 01, Man 04) N.a. 4/9 credits (SA P1, MA P4, EU P1,
WU P2)
10.4% points (Man 01, Man 02, Man 03, Man 04) No supported credits N.a.
2/5 credits (LE 01, LE 03) with 86.4% points in Land use and 25% points in Land use and Ecology, 2/15 credits (SA 7, SA 15) with
Ecology category. No supported credits in transport category and 45.5% points in transport 18.2% points
4/9 credits with 2/3 points 51.7% points in energy eciency 5/22 credits with 61.9%64.3%
points

143
BIM-supported water related credits All 3 water credits 2/4 credits (Wat 01, Wat 04) with 2/3 points 91.7% points in water eciency 2/5 credits with 44.4% points
BIM-supported materials and waste related All 7 credits in material and resource 2/5 material credits (Mat04, Mat05) with 2/3 points applicable; 95.2% points in material resource 7/16 credits with 59.1%63.6%
credits no supported waste credits points
BIM-supported indoor environment quality 7/10 credits with 2/3 points in indoor 4/6 credits (Hea 01, Hea 02, Hea 03, Hea 05) with 78.6% points 70.4% points 4/23 credits with 18.8%21.9%
related credits environment quality in health and wellbeing points
BIM-supported innovation related credits 1/2 credits (IDc2) All credits No supported credits IA 2 applicable, IA 1 and IA 3 not
applicable,
BIM-supported other credits Regional priority credit (3.6% of total N.a. N.a. N.a.
points)
Examples of available BIM software GBS Revit, GBS GBS Revit, VE

a
Cited references are [117,118,94,95].
b
Cited references are [12,96]. The results are based on new construction projects of commercial oce buildings; required credits are based on the level of passing; 110 points cover innovation credits.
c
Cited references are [97,119]. The results are based on commercial oce buildings; 110 points cover innovation credits.
d
Cited references are [120,121]. The results considered bonus credits; 103 points cover innovation credits.
Automation in Construction 83 (2017) 134148
Y. Lu et al.
software are designed to focus on one feature such as carbon emission
analysis or lighting analysis. These analytical features are optimized
individually due to limited interoperability among BIM functions. Thus,
currently BIM is still limited in holistically assessing both the en-
vironmental and social sustainability of buildings. Credits that currently
are not supported by BIM software mainly focus on four areas, namely
management (e.g. in Green Star), ecological issues (e.g. in BREEAM),
innovative techniques and performance (e.g. in BEAM Plus, Green Star,
LEED) and transportation conditions (e.g. in BREEAM). For instance, it
was discovered that the impact of buildings on biodiversity is dicult
to be addressed by BIM [96].
The reasons for the unsupported GBA in BIM could be a lack of
tangible evaluation rubrics. These unsupported credits usually have no
denitive evaluation approaches and are highly dependent on expert
experience and knowledge. For instance, innovation credits in LEED
require that the proposed project design present exceptional perfor-
mance above LEED requirements, or show innovative performance that
has not been previously addressed by LEED. A LEED panel committee
evaluates the innovativeness of the proposed design based on con-
textual documents and oral discussion, which is dicult to be auto-
mated using BIM software. An Australian case showed that 12% of GBA
credits, such as management issues, are almost impossible to be ad-
dressed by BIM software [97]. Future research of BIM software could
focus on the development of new functions which provide exible and
qualitative-based evaluation for these currently unsupported credits, as
well as the integration of dierent types of existing BIM-based green
analytical tools, thereby providing an integrated BIM-based platform
that supports various analytical functions covering all GBA aspects.
Several recent studies have demonstrated possibilities in this area of
research. For instance, Kensek et al. [147] have used the visual pro-
gramming language Dynamo with the BIM software Revit, to automate
the formula calculation for compliance for LEED Pilot Credit 55:
Avoiding Bird Collisions specically for the bird collision threat rating.
Another challenge is the complexity of traditional tools and users'
lack of appropriate BIM knowledge [58]. Alwan et al. [99], for instance,
demonstrated the feasibility of integrating LEED into BIM, but high-
lighted that high software complexity could be an issue if users do not
have sucient knowledge about BIM. It was discovered that due to
users' irregular and inaccurate update of BIM models, credits in LEED
certication are dicult to be documented by green BIM software [95].
Similarly, studies revealed that there are discrepancies between BIM-
supported and manual GBA results due to an inadequately developed
BIM model [95,99]. Even though Wu and Issa [92] proposed a new
paradigm in which project teams can leverage cloud-based BIM to au-
tomate and simplify LEED accreditation, there are no applicable case
studies to assess its performance and ecacy. Future research can
further simplify the operations of BIM tools thereby facilitating the
transition from traditional GBAs to BIM-based GBAs. Furthermore,
there is a lack of well-dened business goals and processes of using BIM
in LEED projects. Researchers have identied that current green BIM
practices are heavily technology-driven instead of process-driven. Wu
and Issa [2] proposed an integrated green BIM process map to more
clearly dene business processes and execution planning in LEED pro-
ject. Future research could further examine the industrial players'
business processes and goals of BIM application in LEED projects.
4. Research gaps and suggestions
To systematically conceptualize the nexus between BIM and green
buildings, this study constructed a taxonomy composed of three di-
mensions, namely BIM attributes, project phases and green attributes.
The taxonomy can be used as a framework to systematically consolidate
the existing studies and to better align the future research areas to the
existing ones. Based on the taxonomy, this study reviewed BIM-sup-
ported project lifecycle and BIM-supported green functions. This study
highlighted the dierences between industrial norms and academic
144
Automation in Construction 83 (2017) 134148
research, and between ideal situation and current capacities of green
BIM research. Followed by this comprehensive review, research gaps in
green BIM have been identied and summarized as follows.
1) The rst research gap is the weak interoperability among various
BIM applications. For instance, massive BIM data is dicult to be
directly adopted for a specic sustainability analysis [100103]. To
support the required green analyses, BIM data requires many mod-
ications which weakens the design benets. Data extraction and
data exchange are two key processes associated with the inter-
operability among BIM applications. In terms of optimizing the data
extraction process, Cemesova et al. [104] improved the IFC schema,
enabling the compilation between building fabric data from BIM
authoring tools and energy related information from specic low
energy design tools, such as Passive House Planning Package. Si-
milarly, Ladenhauf et al. [105] developed new algorithm that en-
abled automatic extraction of specic types of data from the BIM
model. Ahn et al. [106] developed IFCIDF interface to auto-
matically convert the building information of IFC into IDF, an input
le format for EnergyPlus. To improve the data exchange process
among BIM applications, a new framework was proposed based on
an open standard of BIM les [100]. Similarly, a physical BIM li-
brary was also developed for building thermal energy simulation
from an Object-Oriented Physical Modeling (OOPM) approach
[107]. Geyer [101] provided a semantic material-name matching
system to enable automatic data exchange between BIM and other
systems. These solutions are mainly designed to address the inter-
operability of le exchange or syntax commands, e.g. exchanging
les between two BIM applications. However, a large amount of BIM
applications, such as BIM-based energy analysis software, are suf-
fering from the low visualization interoperability that enables the
visualization of models being exchanged between two tools [23],
and the weak semantic interoperability that interprets the meaning
of models being exchanged. Thus, the visualization and semantic
interoperability worth to be further studied in the future.
2) The second gap arises from the limited capability of BIM applica-
tions supporting the construction and operation phases of green
projects. Currently, the development of green BIM applications
heavily skewed towards the project design phase where important
decisions concerning building sustainability are normally made
[18,58,108]. However, emerging green construction practices, such
as prefabricated buildings and lean construction, could be all linked
to green BIM applications, but few studies have focused on the ap-
plication of BIM in these topics. Future research could examine the
applicability of using BIM to address these green construction
practices. Meanwhile, in the building operation phase, facility
managers have gradually realized the benets brought by BIM-based
facility management (FM) applications [58]. An increasing number
of BIM vendors has also started to recognize the benets of BIM to
FM, and therefore has shifted their focus from the design phase to
the operation and maintenance stage [22]. This trend calls for more
research to develop BIM-enabled green FM.
3) Another research gap is the lack of clear industry standards or codes
for the various aspects of green BIM applications. Integrating mul-
tidisciplinary information in a single BIM model requires the access
to the BIM model by multiple users. However, there is lack of BIM
standards for model integration and management by multi-
disciplinary teams [26]. This is further supported by Kassem et al.
[127], who studied various BIM protocols such as AEC (UK) BIM
Protocol specic to Revit and Bently Building and Singapore BIM
Guide, and revealed that these protocols do not concurrently con-
sider enabling technologies and the variables aecting its deploy-
ment on projects such as interoperability required for dierent BIM
work-streams. Similarly, Chong et al. [140] examined 36 standards
and guidelines of BIM, revealing that even though the standards
stipulate the methodologies of BIM adoption to foster a
Y. Lu et al.
collaborative working environment, the standards paid little atten-
tion to the refurbishment and demolition of green buildings, and the
incorporation of GBA criteria into the standards. Meanwhile, few
studies on the best practices of green BIM have been presented for
the AEC industry [109], even though many studies have provided
valuable recommendations for implementing BIM in green projects.
In fact, appropriate guidance on the ecient execution of green BIM
applications is equally if not more important than the technological
development of green BIM applications. To this end, the industry
best practices should be researched and developed to guide BIM
implementation in the green built environment.
4) The fourth gap is the low industrial acceptance of green BIM ap-
plications, despite a large number of BIM studies have been con-
ducted. Issa and Anumba [110] have shown that research ndings
have hardly been adopted in AEC industrial practices. Complex
barriers exist hindering the wide application of BIM, which include
but not limited to lack of holistic industry codes, the lack of clear
ownership of the BIM data through copyright laws, the blurred re-
sponsibility for ensuring the accuracy of the BIM data due to the
integrated approach of BIM, and the industry's reluctance to change
existing work practices and habits [26]. Similarly, Ghaarianhoseini
et al. [141] suggested that the lack of widespread uptake of BIM is
linked to various risks and challenges including cyber security of
BIM tools, the unclear intellectual property and responsibility, the
incremental cost needed to input and review BIM data, and the re-
luctance from small construction enterprises. Education and training
is one way to bridge the above gap. However, Becerik-Gerber et al.
[111] discussed problems on the integration of BIM and sustain-
ability from the perspective of AEC educational programs in the
America. Project stakeholders may not be willing to adopt green
BIM because of the various interests involved in the supply chain of
AEC projects [91]. The future research should not only focus on
developing and evaluating the prototype of new green BIM software,
but also aim to investigate the actual needs from practitioners, and
raise their interests in green BIM.
5) The low accuracy of BIM-based prediction models is the fth re-
search gap. Current research has recognized the shortcomings of the
predicted approach to achieve high sustainability performance of
buildings. For instance, most green building certicates, such as
LEED, are based on predicted rather than actual performance [112].
However, complaints about the energy performance of LEED
buildings have been raised. An investigation of the LEED buildings'
energy performance revealed that 2835% of LEED buildings were
found to use more energy per oor area than the conventional
counterparts [113], which challenges the validity and legitimacy of
the LEED certicate. Therefore, a recent trend is to require all LEED
projects to track and report actual energy performance to bench-
mark their energy eciency [114]. The future development of green
BIM applications also needs to align with actual rather than pre-
dicted performance. Governments are advised to establish policies
that select green buildings based on a building's actual performance,
such as the UK Government BIM Task Force policy [115].
6) The last gap lies in the lack of appropriate project delivery methods
to leverage green BIM applications. The current BIM applications
provide an integrated design model which allows for synchronous
multi-disciplinary analysis, such as structural analysis, building
performance analysis, MEP (Mechanical, Electrical and Plumbing)
analysis, and material usage analysis [8]. This integrated design
approach enables and encourages a more eective project delivery.
For instance, many experienced construction professionals re-
sponded that BIM applications are essential conditions to adopt the
integrated project delivery methods [116]. Similarly, Bynum et al.
[67] argued that integrated project delivery approaches, e.g. Design-
Build, are the optimal project delivery methods to integrate BIM
with green buildings. Yet these preliminary results need to be fur-
ther investigated to explore the relationships between the adoption
145
Automation in Construction 83 (2017) 134148
of integrated project delivery approaches and green BIM applica-
tions.
The Green BIM Triangle taxonomy proposed in this paper maps
the nexus between BIM and green buildings. As a conceptual frame-
work, the nature of which is similar to other BIM frameworks such as
[142,143], the taxonomy aims to provide synthesized understandings
and knowledge of green BIM, which has not been explored by previous
studies. The taxonomy, together with its supporting information such as
Fig. 4, could be used to guide practitioners in green BIM implementa-
tion. For instance, through comparing the applied green analyses of
BIM in real-world projects and the various analyses summarized in
Fig. 4, the maturity level of green BIM implementation in the real-world
projects could be preliminarily evaluated. The Green BIM Triangle
taxonomy could also be tailored for dierent types of green buildings in
various countries through specic empirical studies and reviews in the
future. It is important to note that similar to other BIM frameworks such
as those proposed by Chen et al. [143], the Green BIM Triangle tax-
onomy in this study is a grand framework which was not tailored for
specic buildings. Rather, it serves as a foundation in green BIM, and
specic frameworks could be developed based on this foundation. For
instance, based on this taxonomy, future studies could investigate the
potential of BIM in facilitating the Three Star Rating System for green
building certication in China and identify the green analyses of BIM
that are commonly or seldom used in China, thereby formulating tai-
lored frameworks that could guide green BIM development specically
in China. Furthermore, the taxonomy should be regarded as a con-
tinuously updated framework provided that the emerging studies can
be incorporated into thereby enriching the taxonomy. For instance, if a
new BIM plug-in is developed to address the impacts of buildings on
biodiversity, such as bird collision, the aspect of biodiversity may need
to be included in the dimension of green attributes. This expandable
feature ensures the exibility of the taxonomy that can accommodate
both current and future studies for green BIM.
5. Conclusions
With recent developments, BIM has gained increasing importance in
the AEC industry. Using BIM applications to facilitate green built en-
vironment has received growing attention in both academia and the
industry. This study presents a critical review of the nexus between BIM
and green buildings. Based on the review of journal articles and 13
types of BIM applications, this study proposes a Green BIM Triangle
taxonomy to conceptualize the interactions between BIM and green
buildings, and provides insights on the advantages and challenges of
implementing green BIM. Three main facets of green BIM are critically
examined, namely the contributions and applications of BIM in the
lifecycle of green buildings, the various functions of environmental
sustainability analyses provided by BIM programs, and the integration
of green building assessment (GBA) with BIM. The main research
ndings are as follows.
First, the applicability of using BIM in each project phase and the
whole project lifecycle of green buildings was analyzed. It was dis-
covered that while BIM is mainly perceived as a vital tool for the design
stage of green buildings, its potential value for the construction, facility
and operation management phases has been increasingly recognized.
BIM could facilitate data exchange and integration, provide visualized
building performance analyses, and enhance the communication and
collaboration of various stakeholders during the lifecycle of green
buildings. Second, the advantages and challenges of BIM functions for
environmental sustainability analyses of buildings were discussed. 7
major BIM functions for green analyses were identied and critically
reviewed, including energy performance analyses and evaluations,
carbon emission analyses, natural ventilation system analyses, solar
radiation and lighting analyses, water usage analyses, acoustics ana-
lyses and thermal comfort analyses. Third, the potential of applying
Y. Lu et al.
BIM to support the GBA process was explored and reviewed. This study
reveals that green BIM applications could bring various benets for
GBA, such as estimating GBA scores, managing application documents,
and improving the eciency of GBA process.
Even though BIM could add values to green building development,
the empowerment of green BIM is not without challenges. This study
identies 6 major gaps of knowledge that need to be responded by
future studies, including (1) the weak interoperability among various
green BIM applications; (2) lack of supports for the construction and
operation phases of green buildings; (3) lack of industry standards
holistically covering the various application areas of green BIM and
studies on the best practices of green BIM projects; (4) low industrial
acceptance of green BIM applications; (5) low accuracy of BIM-based
prediction models; and (6) the lack of appropriate project delivery
methods. Future research opportunities exist in these areas to further
promote green BIM.
This study provides an important reference for both researchers and
practitioners studying BIM or green buildings. The proposed Green
BIM Triangle taxonomy provides a systematic approach to under-
standing the current body of knowledge on green BIM. Researchers
could use it as a guiding framework to nd research opportunities in
green BIM. Similarly, this study helps practitioners understand the
various functions of BIM software for green buildings. Future research
could respond to the identied gaps of knowledge in this study, thereby
extending and enriching the Green BIM Triangle taxonomy.
Acknowledgement
This study is nancially supported by the National University of
Singapore (Grant Number: R-296-000-151-133) and the National
Natural Science Foundation of China (Grant Numbers: 71390523 and
71471136). The views represented in this article are those of the in-
dividual authors only.
References
[1] P. Teicholz, R. Sacks, K. Liston, BIM Handbook: A Guide to Building Information
Modeling for Owners, Managers, Designers, Engineers, and Contractors, Wiley,
2011.
[2] W. Wu, R.R. Issa, BIM execution planning in green building projects: LEED as a use
case, J. Manag. Eng. 31 (1) (2014) A4014007.
[3] S. Azhar, Building information modeling (BIM): trends, benets, risks, and chal-
lenges for the AEC industry, Leadersh. Manag. Eng. 11 (3) (2011) 241252.
[4] N. Gu, K. London, Understanding and facilitating BIM adoption in the AEC in-
dustry, Autom. Constr. 19 (8) (2010) 988999.
[5] T. Cerovsek, A review and outlook for a Building Information Model(BIM): a
multi-standpoint framework for technological development, Adv. Eng. Inform. 25
(2) (2011) 224244.
[6] R. Volk, J. Stengel, F. Schultmann, Building Information Modeling (BIM) for ex-
isting buildingsliterature review and future needs, Autom. Constr. 38 (2014)
109127.
[7] D. Bryde, M. Broquetas, J.M. Volm, The project benets of building information
modelling (BIM), Int. J. Proj. Manag. 31 (7) (2013) 971980.
[8] Wong, K.-d., and Fan, Q., Building information modelling (BIM) for sustainable
building design, Facilities 31 (3/4) (2013) 138157.
[9] P. Rajendran, T. Seow, K.C. Goh, Application of BIM for managing sustainable
construction, Proceedings International Conference of Technology Management,
Business and Entrepreneurship, Melaka, Malaysia 1819 Dec 2012, 2012.
[11] J.K.W. Wong, J. Zhou, Enhancing environmental sustainability over building life
cycles through green BIM: a review, Autom. Constr. 57 (2015) 156165.
[12] E.A. Fleishman, M.D. Mumford, Evaluating classications of job behavior: a con-
struct validation of the ability requirement scales, Pers. Psychol. 44 (3) (1991)
523575.
[13] J.L. Howard, The Federal Commitment to Green Building: Experiences and
Expectations, Federal Executive, Oce Of The Federal Environmental Executive,
Washington, 2003.
[14] J.F. McLennan, The Philosophy of Sustainable Design: The Future of Architecture,
Ecotone Publishing, 2004.
[15] C.J. Kibert, Sustainable Construction: Green Building Design and Delivery: Green
Building Design and Delivery, John Wiley & Sons, 2012.
[16] BIM forum, BIM tools matrix. http://bimforum.org/wp-content/uploads/2011/
02/BIM_Tools_Matrix.pdf, (2011).
[17] P. Rich, The organizational taxonomy: denition and design, Acad. Manag. Rev.
17 (4) (1992) 758781.
[18] A. Schlueter, F. Thesseling, Building information model based energy/exergy
146
Automation in Construction 83 (2017) 134148
performance assessment in early design stages, Autom. Constr. 18 (2) (2009)
153163.
[19] S. Shrivastava, A. Chini, Using building information modeling to assess the initial
embodied energy of a building, Int. J. Constr. Manag. 12 (1) (2012) 5163.
[20] Autodesk, Autodesk Ecotect Analysis. Sustainable Building Design Software,
(2012).
[21] K.E. Larsen, F. Lattke, S. Ott, S. Winter, Surveying and digital workow in energy
performance retrot projects using prefabricated elements, Autom. Constr. 20 (8)
(2011) 9991011.
[22] A. Watson, Digital buildingschallenges and opportunities, Adv. Eng. Inform. 25
(4) (2011) 573581.
[23] J. Steel, R. Drogemuller, B. Toth, Model interoperability in building information
modelling, Softw. Syst. Model. 11 (1) (2012) 99109.
[24] R. Sacks, M. Radosavljevic, R. Barak, Requirements for building information
modeling based lean production management systems for construction, Autom.
Constr. 19 (5) (2010) 641655.
[25] A. Grilo, R. Jardim-Goncalves, Building information modeling and collaborative
working environments, Autom. Constr. 19 (5) (2010) 521.
[26] S. Azhar, M. Khalfan, T. Maqsood, Building information modeling (BIM): now and
beyond, Australas. J. Constr. Econ. Build. 12 (4) (2012) 15.
[27] C.S. Dossick, G. Ne, Organizational divisions in BIM-enabled commercial con-
struction, J. Constr. Eng. Manag. 136 (4) (2009) 459467.
[28] J. Basbagill, F. Flager, M. Lepech, M. Fischer, Application of life-cycle assessment
to early stage building design for reduced embodied environmental impacts, Build.
Environ. 60 (2013) 8192.
[29] S.-H. Lin, D.J. Gerber, Evolutionary energy performance feedback for design:
multidisciplinary design optimization and performance boundaries for design
decision support, Energ. Buildings 84 (2014) 426441.
[30] A. Jrade, M. Nassiri, Integrating Decision Support System (DSS) and Building
Information Modeling (BIM) to optimize the selection of sustainable building
components, J. Inf. Technol. Constr. 20 (25) (2015) 399420 (2015).
[31] P. Inyim, J. Rivera, Y. Zhu, Integration of building information modeling and
economic and environmental impact analysis to support sustainable building de-
sign, J. Manag. Eng. 31 (1) (2014) A4014002.
[33] K. Hiyama, S. Kato, M. Kubota, J. Zhang, A new method for reusing building in-
formation models of past projects to optimize the default conguration for per-
formance simulations, Energ. Buildings 73 (2014) 8391.
[34] H. Kim, K. Anderson, Energy modeling system using building information mod-
eling open standards, J. Comput. Civ. Eng. 27 (3) (2012) 203211.
[35] J. Schade, T. Olofsson, M. Schreyer, Decision-making in a model-based design
process, Constr. Manag. Econ. 29 (4) (2011) 371382.
[36] A.K. Wong, F.K. Wong, A. Nadeem, Attributes of building information modelling
implementations in various countries, Archit. Eng. Des. Manag. 6 (4) (2010)
288302.
[37] S. Chang, B.-C. Lee, P.-Y. Chen, I.-C. Wu, Visual REQ calculation tool for green
building evaluation in Taiwan, Proceedings of the 28th International Symposium
on Automation and Robotics in Construction, June 29thJuly 2nd, Seoul, Korea,
2013.
[38] D. Knight, B. Addis, Embodied carbon dioxide as a design toola case study,
Proceedings of the Institution of Civil Engineers, Telford, 2011, pp. 171176.
[39] B. Welle, Z. Rogers, M. Fischer, BIM-Centric Daylight Proler for Simulation
(BDP4SIM): a methodology for automated product model decomposition and re-
composition for climate-based daylighting simulation, Build. Environ. 58 (2012)
114134.
[40] M.R. Asl, S. Zarrinmehr, M. Bergin, W. Yan, BPOpt: a framework for BIM-based
performance optimization, Energ. Buildings 108 (2015) 401412.
[41] A.H. Oti, W. Tizani, BIM extension for the sustainability appraisal of conceptual
steel design, Adv. Eng. Inform. 29 (1) (2015) 2846.
[42] Z. Liu, M. Osmani, P. Demian, A.N. Baldwin, The potential use of BIM to aid
construction waste minimalisation, Proceedings of the CIB W78-W102, 2628
October 2011, France, 2011.
[43] A. O'Reilly, Using BIM as a tool for cutting construction waste at source, Constr.
Res. Innov. 3 (1) (2012) 28.
[44] R. Sacks, L. Koskela, B.A. Dave, R. Owen, Interaction of lean and building in-
formation modeling in construction, J. Constr. Eng. Manag. 136 (9) (2010)
968980.
[45] C. Wu, M. Clayton, BIM-based acoustic simulation framework, Proc., 30th CIB
W78 International Conference, 2013.
[46] Y. Ma, A Building Information Modeling Framework for Waste Estimation and
Embodied Carbon Calculation of Buildings, Hong Kong University of Science and
Technology, 2012 (Thesis (M. Phil.), 2012).
[47] P. Rajendran, C.P. Gomez, Implementing BIM for waste minimisation in the con-
struction industry: a literature review, 2nd International Conference on
Management, Malaysia, 2012 (2012).
[48] A. Porwal, K.N. Hewage, Building information modelingbased analysis to mini-
mize waste rate of structural reinforcement, J. Constr. Eng. Manag. 138 (8) (2011)
943954.
[49] D. Mah, J.D. Manrique, H. Yu, M. Al-Hussein, R. Nasseri, House construction CO2
footprint quantication: a BIM approach, Constr. Innov. 11 (2) (2011) 161178.
[50] Y. Jiao, Y. Wang, S. Zhang, Y. Li, B. Yang, L. Yuan, A cloud approach to unied
lifecycle data management in architecture, engineering, construction and facilities
management: integrating BIMs and SNS, Adv. Eng. Inform. 27 (2) (2013) 173188.
[51] R. Sacks, B. Dave, L. Koskela, R. Owen, Analysis framework for the interaction
between lean construction and building information modelling, Proceedings of the
17th Annual Conference of the International Group for Lean Construction, 2009,
pp. 221233.
Y. Lu et al.
[52] A. Mahalingam, A.K. Yadav, J. Varaprasad, Investigating the role of lean practices
in enabling BIM adoption: evidence from two Indian cases, J. Constr. Eng. Manag.
05015006 (2015).
[53] K. Hewage, A. Porwal, Sustainable construction: an information modelling ap-
proach for waste reduction, International Conference on Building Resilience,
Kandalama, Sri Lanka, 2011.
[57] T. Hkkinen, A. Kiviniemi, Sustainable building and BIM, 2008 World Sustainable
Building Conference, Melbourne, Australia, 2008.
[58] H. Bernstein, S. Jones, M. Russo, Green BIM: How Building Information Modeling
is Contributing to Green Design and Construction, McGraw-Hill Construction,
Bedford, MA, 2010.
[59] E. Curry, J. O'Donnell, E. Corry, S. Hasan, M. Keane, S. O'Riain, Linking building
data in the cloud: integrating cross-domain building data using linked data, Adv.
Eng. Inform. 27 (2) (2013) 206219.
[60] X. Yang, S. Ergan, Leveraging BIM to provide automated support for ecient
troubleshooting of HVAC-related problems, J. Comput. Civ. Eng. 30 (2) (2015)
(04015023).
[61] B. Dong, Z. O'Neill, Z. Li, A BIM-enabled information infrastructure for building
energy Fault Detection and Diagnostics, Autom. Constr. 44 (2014) 197211.
[62] A. Akbarnezhad, K.C.G. Ong, L.R. Chandra, Economic and environmental assess-
ment of deconstruction strategies using building information modeling, Autom.
Constr. 37 (2014) 131144.
[63] S. Lagela, L. Daz-Vilario, J. Martnez, J. Armesto, Automatic thermographic
and RGB texture of as-built BIM for energy rehabilitation purposes, Autom. Constr.
31 (2013) 230240.
[64] J.-H. Woo, C. Menassa, Virtual Retrot Model for aging commercial buildings in a
smart grid environment, Energ. Buildings 80 (2014) 424435.
[65] B. Hamidi, T. Bulbul, A. Pearce, W. Thabet, Potential application of BIM in cost-
benet analysis of demolition waste management, Proc., Construction Research
Congress 2014@ Construction in a Global Network, ASCE, 2014, pp. 279288.
[66] J.C. Cheng, L.Y. Ma, A BIM-based system for demolition and renovation waste
estimation and planning, Waste Manag. 33 (6) (2013) 15391551.
[67] P. Bynum, R.R. Issa, S. Olbina, Building information modeling in support of sus-
tainable design and construction, J. Constr. Eng. Manag. 139 (1) (2012) 2434.
[68] EnergyPlus, Getting started with EnergyPlus, Online at http://apps1.eere.energy.
gov/buildings/energyplus, (2007).
[69] D. Rebolj, M. Fischer, D. Endy, T. Moore, A. orgo, Can we grow buildings?
Concepts and requirements for automated nano-to meter-scale building, Adv. Eng.
Inform. 25 (2) (2011) 390398.
[70] Autodesk, Autodesk building performance analysis help. http://help.autodesk.
com/view/BUILDING_PERFORMANCE_ANALYSIS/ENU/?guid=GUID-
43DAB177-3A4F-496C-BECB-2591FD04FC10, (2015).
[71] I. E. Solutions, Introducing IESVE Software, Online at http://www.iesve.com/
software, (2014).
[72] J. Park, J. Park, J. Kim, J. Kim, Building information modelling based energy
performance assessment system: an assessment of the Energy Performance Index
in Korea, Constr. Innov. 12 (3) (2012) 335354.
[73] J.J. Hirsch, Doe 2.3 building energy use and cost analysis program, Online at
http://www.doe2.com, (2014).
[74] Y.K. Cho, Y. Ham, M. Golpavar-Fard, 3D as-is building energy modeling and di-
agnostics: a review of the state-of-the-art, Adv. Eng. Inform. 29 (2) (2015)
184195.
[75] C. Wang, Y. Cho, Automated 3D building envelope recognition from point clouds
for energy analysis, Proc., Construction Research Congress, 2012, pp. 11551164.
[76] C. Wang, Y.K. Cho, Automatic as-is 3d building models creation from unorganized
point clouds, Proc., Construction Research Congress, 2014, pp. 917924.
[77] C. Wang, Y.K. Cho, Automatic 3D thermal zones creation for building energy si-
mulation of existing residential buildings, Proc., Construction Research Congress,
2014, pp. 10141022.
[78] C. Wang, Y.K. Cho, C. Kim, Automatic BIM component extraction from point
clouds of existing buildings for sustainability applications, Autom. Constr. 56
(2015) 113.
[79] S. Lagela, L. Daz-Vilario, J. Armesto, P. Arias, Non-destructive approach for the
generation and thermal characterization of an as-built BIM, Constr. Build. Mater.
51 (2014) 5561.
[80] Y. Ham, M. Golparvar-Fard, Mapping actual thermal properties to building ele-
ments in gbXML-based BIM for reliable building energy performance modeling,
Autom. Constr. 49 (Part B) (2015) 214224.
[81] C.R. Iddon, S.K. Firth, Embodied and operational energy for new-build housing: a
case study of construction methods in the UK, Energ. Buildings 67 (2013)
479488.
[82] S. Liu, X. Meng, C. Tam, Building information modeling based building design
optimization for sustainability, Energ. Buildings 105 (2015) 139153.
[83] H. Wasilowski, C. Reinhart, Modelling an existing building in DesignBuilder/
EnergyPlus: Custom versus default inputs, Proc., Proceedings of Building
Simulation 2009 Conference, Glasgow, Scotland, 2009.
[84] B. Welle, J. Haymaker, Z. Rogers, ThermalOpt: a methodology for automated BIM-
based multidisciplinary thermal simulation for use in optimization environments,
Proc., Building Simulation, Springer, 2011, pp. 293313.
[85] M. Landry, P. Breton, Daylight simulation in 3ds max design 2009advanced
concepts, Autodesk White Paper, 2009.
[86] S. Kota, J.S. Haberl, M.J. Clayton, W. Yan, Building Information Modeling (BIM)-
based daylighting simulation and analysis, Energ. Buildings 81 (2014) 391403.
[87] J.P. Martins, A. Monteiro, LicA: a BIM based automated code-checking application
for water distribution systems, Autom. Constr. 29 (2013) 1223.
[88] M.-H. Construction, The Business Value of BIM in North America: Multi-year
147
Automation in Construction 83 (2017) 134148
Trend Analysis and User Ratings (20072012), McGraw-Hill Construction,
Bedford, MA, 2012.
[89] C. Christensen, G. Koutsouris, ODEON Room Acoustics Software, Version 12, User
Manual, Odeon A/S, Kgs. Lyngby, 2013.
[90] U. Isikdag, J. Underwood, G. Aouad, An investigation into the applicability of
building information models in geospatial environment in support of site selection
and re response management processes, Adv. Eng. Inform. 22 (4) (2008)
504519.
[91] A. Redmond, A. Hore, M. Alshawi, R. West, Exploring how information exchanges
can be enhanced through Cloud BIM, Autom. Constr. 24 (2012) 175183.
[92] W. Wu, R. Issa, Leveraging Cloud-BIM for LEED automation, ITcon 17 (2012)
367384.
[93] W. Wu, R.R. Issa, Application of VDC in LEED projects: framework and im-
plementation strategy, Proc., Proc. CIB W-78 27th International Conference on IT
in Construction, 1519November, Cairo, Egypt, 2010.
[94] W. Wu, Integrating Building Information Modeling and Green Building
Certication: The BIMLEED Application Model Development, University of
Florida, 2010.
[95] S. Azhar, W.A. Carlton, D. Olsen, I. Ahmad, Building information modeling for
sustainable design and LEED rating analysis, Autom. Constr. 20 (2) (2011)
217224.
[96] M.A. Zanni, R. Soetanto, K. Ruikar, Exploring the potential of BIM-integrated
sustainability assessment in AEC, Proceedings of the Sustainable Building and
Construction Conference, Coventry, 2013.
[97] S. Gandhi, J. Jupp, BIM and Australian Green Star Building Certication, Proc.,
Computing in Civil and Building Engineering, ASCE, 2014, pp. 275282.
[98] USGBC, Green Building Facts, US Green Building Council (USGBC), 2008.
[99] Z. Alwan, D. Greenwood, B. Gledson, Rapid LEED evaluation performed with BIM
based sustainability analysis on a virtual construction project, Constr. Innov. 15
(2) (2015) 134150.
[100] P. Sanguinetti, S. Abdelmohsen, J. Lee, J. Lee, H. Sheward, C. Eastman, General
system architecture for BIM: an integrated approach for design and analysis, Adv.
Eng. Inform. 26 (2) (2012) 317333.
[101] P. Geyer, Systems modelling for sustainable building design, Adv. Eng. Inform.
26 (4) (2012) 656668.
[102] J.C. Cheng, M. Das, A BIM-based web service framework for green building en-
ergy simulation and code checking, J. Inf. Technol. Constr. 19 (2014) 150168.
[103] K. Kim, J. Yu, A process to divide curved walls in IFC-BIM into segmented
straight walls for building energy analysis, J. Civ. Eng. Manag. (2015) 113.
[104] A. Cemesova, C.J. Hopfe, R.S. Mcleod, PassivBIM: enhancing interoperability
between BIM and low energy design software, Autom. Constr. 57 (2015) 1732.
[105] D. Ladenhauf, K. Battisti, R. Berndt, E. Eggeling, D.W. Fellner, M. Gratzl-
Michlmair, T. Ullrich, Computational geometry in the context of building in-
formation modeling, Energ. Buildings 115 (2015) 7884.
[106] K.-U. Ahn, Y.-J. Kim, C.-S. Park, I. Kim, K. Lee, BIM interface for full vs. semi-
automated building energy simulation, Energ. Buildings 68 (2014) 671678.
[107] J.B. Kim, W. Jeong, M.J. Clayton, J.S. Haberl, W. Yan, Developing a physical BIM
library for building thermal energy simulation, Autom. Constr. 50 (2015) 1628.
[108] J. Holmstrm, V. Singh, K. Frmling, BIM as infrastructure in a Finnish HVAC
actor network: enabling adoption, reuse, and recombination over a building life
cycle and between projects, J. Manag. Eng. 31 (1) (2014) A4014006.
[109] Y. Arayici, P. Coates, L. Koskela, M. Kagioglou, C. Usher, K. O'reilly, Technology
adoption in the BIM implementation for lean architectural practice, Autom.
Constr. 20 (2) (2011) 189195.
[110] R. Issa, C. Anumba, Computing and information technology (IT) research in civil
engineeringself-fullling or industry transforming? J. Comput. Civ. Eng. 21 (5)
(2007) 301302.
[111] B. Becerik-Gerber, D.J. Gerber, K. Ku, The pace of technological innovation in
architecture, engineering, and construction education: integrating recent trends
into the curricula, J. Inf. Technol. Constr. 16 (2011) 411432.
[112] P.G. Tuohy, G.B. Murphy, Closing the gap in building performance: learning from
BIM benchmark industries, Archit. Sci. Rev. 58 (1) (2015) 4756.
[113] G.R. Newsham, S. Mancini, B.J. Birt, Do LEED-certied buildings save energy?
Yes, but, Energ. Buildings 41 (8) (2009) 897905.
[114] USGBC, Guide to LEED Certication, US Green Building Council (USGBC), 2013.
[115] GSL, The Government Soft Landings Policy September 2012, (2012).
[116] D.C. Kent, B. Becerik-Gerber, Understanding construction industry experience and
attitudes toward integrated project delivery, J. Constr. Eng. Manag. 136 (8) (2010)
815825.
[117] W. Wu, R. Issa, Feasibility of integrating building information modeling and
LEED certication process, Proceedings International Conference on Computing
in Civil and Building Engineering (ICCCBE 2010), Nottingham, UK, 2010 (2010).
[118] W. Wu, R.R. Issa, BIM facilitated web service for LEED automation, Computing in
Civil Engineering (2011), ASCE, 2011(2011).
[119] S. Gandhi, J. Jupp, Green BIM and Green Star certication practices: case studies
in commercial high-rise oce design, 38th AUBEA International Conference,
2013, 2013.
[120] K.L. Kuan, Application of Building Information Modeling on BEAM Plus
Submission in Residential Projects: A Preliminary Investigation, Faculty of
Construction and Environment, The Hong Kong Polytechnic University, 2013
(Doctoral dissertation).
[121] J.K.-W. Wong, K.-L. Kuan, Implementing BEAM Plus for BIM-based sustainability
analysis, Autom. Constr. 44 (2014) 163175.
[123] Y. Lu, V.H. Le, X. Song, Beyond boundaries: a global use of life cycle inventories
for construction materials, J. Clean. Prod. 156 (2017) 876887.
[124] R.D. Chang, V. Soebarto, Z.Y. Zhao, G. Zillante, Facilitating the transition to
Y. Lu et al.
sustainable construction: China's policies, J. Clean. Prod. 131 (2016) 534544.
[125] R. Miettinen, S. Paavola, Beyond the BIM utopia: approaches to the development
and implementation of building information modeling, Autom. Constr. 43 (2014)
8491.
[126] F.H. Abanda, C. Vidalakis, A.H. Oti, J.H. Tah, A critical analysis of Building
Information Modelling systems used in construction projects, Adv. Eng. Softw. 90
(2015) 183201.
[127] M. Kassem, N. Iqbal, G. Kelly, S. Lockley, N. Dawood, Building information
modelling: protocols for collaborative design processes, J. Inf. Technol. Constr. 19
(2014) 126149.
[128] B. Succar, Building information modelling framework: a research and delivery
foundation for industry stakeholders, Autom. Constr. 18 (3) (2009) 357375.
[129] S. Azhar, J. Brown, BIM for sustainability analyses, Int. J. Constr. Educ. Res. 5 (4)
(2009) 276292.
[130] Best Directory, EQUEST, Online at http://www.buildingenergysoftwaretools.com/
software/equest, (2015).
[131] M.V. Shoubi, M.V. Shoubi, A. Bagchi, A.S. Barough, Reducing the operational
energy demand in buildings using building information modeling tools and sus-
tainability approaches, Ain Shams Eng. J. 6 (1) (2015) 4155.
[132] Y. Han, J.E. Taylor, A.L. Pisello, Exploring mutual shading and mutual reection
inter-building eects on building energy performance, Appl. Energy 185 (2015)
11561564.
[133] A.L. Pisello, J.E. Taylor, X. Xu, F. Cotana, Inter-building eect: simulating the
impact of a network of buildings on the accuracy of building energy performance
predictions, Build. Environ. 58 (2012) 3745.
[134] ASHRAE, Standard 55-2013 thermal environmental conditions for human oc-
cupancy, Available at: http://www.techstreet.com/ashrae/standards/ashrae-55-
2013?product_id=1868610, (2013).
[135] P. Fanger, Thermal Comfort: Analysis and Application in Environmental
Engineering, Danish Technical Press, Copenhagen, 1970.
[136] M. Marzouk, A. Abdelaty, Monitoring thermal comfort in subways using building
information modeling, Energ. Buildings 84 (2014) 252257.
[137] IES, Possilpark Health Centre: operational performance review, Available at:
148
Automation in Construction 83 (2017) 134148
http://www.iesve.com/consulting/projects/projectdetail?building=Possilpark-
Health-CentreOperational-Performance-Review&id=5820, (2017).
[138] M. Pazhoohesh, R. Shahmir, C. Zhang, Investigating thermal comfort and occu-
pants position impacts on building sustainability using CFD and BIM, 49th
International Conference of the Architectural Science Association, The
Architectural Science Association and The University of Melbourne, 2015, pp.
257266.
[139] S. Habibi, Smart innovation systems for indoor environmental quality (IEQ), J.
Build. Eng. 8 (2016) 113.
[140] H.Y. Chong, C.Y. Lee, X. Wang, A mixed review of the adoption of Building
Information Modelling (BIM) for sustainability, J. Clean. Prod. 142 (2017)
41144126.
[141] A. Ghaarianhoseini, J. Tookey, A. Ghaarianhoseini, N. Naismith, S. Azhar,
O. Emova, K. Raahemifar, Building Information Modelling (BIM) uptake: clear
benets, understanding its implementation, risks and challenges, Renew. Sust.
Energ. Rev. 75 (2016) 10461053.
[142] Y. Jung, M. Joo, Building information modelling (BIM) framework for practical
implementation, Autom. Constr. 20 (2) (2011) 126133.
[143] K. Chen, W. Lu, Y. Peng, S. Rowlinson, G.Q. Huang, Bridging BIM and building:
from a literature review to an integrated conceptual framework, Int. J. Proj.
Manag. 33 (6) (2015) 14051416.
[144] Q. He, G. Wang, L. Luo, Q. Shi, J. Xie, X. Meng, Mapping the managerial areas of
Building Information Modeling (BIM) using scientometric analysis, Int. J. Proj.
Manag. 35 (4) (2017) 670685.
[145] A. Bradley, H. Li, R. Lark, S. Dunn, BIM for infrastructure: an overall review and
constructor perspective, Autom. Constr. 71 (2016) 139152.
[146] R.D. Chang, J. Zuo, V. Soebarto, Z.Y. Zhao, G. Zillante, X.L. Gan, Discovering the
transition pathways toward sustainability for construction enterprises: im-
portance-performance analysis, J. Constr. Eng. Manag. 143 (6) (2017) 04017013.
[147] K. Kensek, Y. Ding, T. Longcore, Green building and biodiversity: facilitating bird
friendly design with building information models, J. Green Build. 11 (2) (2016)
116130.
 Available online at www.sciencedirect.com
Available online at www.sciencedirect.com
ScienceDirect
ScienceDirect
Energy
Available
Available Procedia
online
online 00 (2017) 000000
atatwww.sciencedirect.com
www.sciencedirect.com
Energy Procedia 00 (2017) 000000 www.elsevier.com/locate/procedia
ScienceDirect
ScienceDirect
www.elsevier.com/locate/procedia

Energy Procedia 119 (2017)000000

00 (2017) 98110
www.elsevier.com/locate/procedia

International Conference on Technologies and Materials for Renewable Energy, Environment and
International Conference on Technologies
Sustainability, and21-24
TMREES17, Materials
Aprilfor Renewable
2017, Energy, Environment and
Beirut Lebanon
Sustainability, TMREES17, 21-24 April 2017, Beirut Lebanon
Towards an environmental approach for the sustainability of
TowardsThean15th environmental
International Symposium approach for Heating
on District the sustainability
and Cooling of
buildings in Algeria
buildings in Algeria
Assessing the feasibility of using the heat demand-outdoor
Hocine Tebboucheaa, Ammar Bouchairb,b, *, Sad Grimescc
temperature function
Hocine Tebbouche for a ,long-term
Ammar Bouchair district
*, Sadheat demand forecast
Grimes
Departement of architecture,Faculty of Sciences and technology, University Mohamed Seddik Benyahia, B.P.98, Ouled Assa, 18000 Jijel,
a,b,c
a,b,c
Departement of architecture,Faculty of hocine-t@univ-jijel.dz;
Algeria; E-mail: Sciences and technology, University Mohamed Seddik
abouchair@univ-jijel.dz; Benyahia, B.P.98, Ouled Assa, 18000 Jijel,
grimess29@gmail.com
a,b,c a a b c c
I. Andri *, A. Pina , P. Ferro , J. Fournier ., B. Lacarrire , O. Le Corre
Algeria; E-mail: hocine-t@univ-jijel.dz; abouchair@univ-jijel.dz; grimess29@gmail.com

a
IN+ Center for Innovation, Technology and Policy Research - Instituto Superior Tcnico, Av. Rovisco Pais 1, 1049-001 Lisbon, Portugal
Abstract
b
Abstract Veolia Recherche & Innovation, 291 Avenue Dreyfous Daniel, 78520 Limay, France
c
Dpartement Systmes
Sustainable architecture (HQE in France, nergtiques
Greenet Buildings
Environnement
in the- IMT
USA,Atlantique, 4 rue Buildings
Sustainable Alfred Kastler, 44300 Nantes,
in Northern France
Europe) is a profound
Sustainable architecture (HQE in France, Green Buildings in the USA, Sustainable Buildings
initiative whose objective is to achieve sustainability of buildings. This concept has spread throughout the worldin Northern Europe) is a and
profound
each
initiative whose toobjective
country worked develop is
itstoapproach
achieve(depending
sustainability
uponof its
buildings.
physical This conceptconditions)
and cultural has spreadtothroughout
minimize the the negative
world and each
impacts
country worked
of buildings on tothedevelop
naturalitsenvironment
approach (depending upon its
and improving thephysical
comfortand andcultural
qualityconditions) to minimize
of life. These the negative
international impacts
initiatives are
Abstract
of buildings on
characterized the natural environment
by multi-criteria and improving
vision, contextuality, the and
flexibility comfort and quality
scalability. of life. should
What strategy These be international
developed forinitiatives are
sustainable
characterized by multi-criteria
buildings in Algeria? This is thevision, contextuality,
fundamental flexibility
question for whichand scalability. What strategy
we try to provide should be
some answers. Ondeveloped
the basis for
of sustainable
a thorough
District heating networks are commonly addressed in the literature as one of the most effective solutions for decreasing the
buildings
study of thein Algeria?
Algerian This is the
context, wefundamental question for of
aim at the presentation which we try to provide
the foundations some answers.
of an approach to theOn the basis ofofa buildings
sustainability thorough
greenhouse gas emissions from the building sector. These systems require high investments which are returned through the heat
study
which ofwould
the Algerian context,
be adjustable to we aim atregions
different the presentation of theand
of the country foundations of an approach
whose peculiarity lies intothe
theconsideration
sustainabilityofof the
buildings
major
sales. Due to the changed climate conditions and building renovation policies, heat demand in the future could decrease,
which
concerns would
of ourbecountry
adjustable
and itsto specificities.
different regions of theforcountry
Including, instanceand whoserisk,
seismic peculiarity lies practices
sociocultural in the consideration of theasmajor
of the population, well
prolonging the investment return period.
concerns of our country
as the diversity and its specificities.
that characterizes Including,
the climatic for instancedata
and geographical seismic
of therisk, sociocultural
entire practices by
national territory, of the population,
following as well
the existing
The main scope of this paper is to assess the feasibility of using the heat demand outdoor temperature function for heat demand
as the diversity
national thatregulations
legislation, characterizes andthe climatic and geographical data of the entire national territory, by following the existing
standards.
forecast. The district of Alvalade, located in Lisbon (Portugal), was used as a case study. The district is consisted of 665
national legislation, regulations and standards.
buildings that vary in both construction period and typology. Three weather scenarios (low, medium, high) and three district
renovation
2017 The
2017 The Authors.
Authors. Published
scenariosPublished by Elsevier
by
were developed Elsevier Ltd. intermediate, deep). To estimate the error, obtained heat demand values were
Ltd.
(shallow,
2017 The under
Peer-review
Peer-review Authors.
under Published by
responsibility of Elsevier
the Ltd.
Euro-Mediterranean Institute for developed
SustainableandDevelopment (EUMISD).
compared with results from a dynamic heat demand model,Institute
responsibility of the Euro-Mediterranean for
previously Sustainable Development
validated by(EUMISD).
the authors.
Peer-review under responsibility of the Euro-Mediterranean Institute for Sustainable Development (EUMISD).
The results showed that when only weather change is considered, the margin of error could be acceptable for some applications
Keywords:sustainability; ecological building, green architecture; quality; environment; Algerie.
(the error in annual demand was lower than 20% for all weather scenarios considered). However, after introducing renovation
Keywords:sustainability; ecological building, green architecture; quality; environment; Algerie.
scenarios, the error value increased up to 59.5% (depending on the weather and renovation scenarios combination considered).
The value of slope coefficient increased on average within the range of 3.8% up to 8% per decade, that corresponds to the
decrease in the number of heating hours of 22-139h during the heating season (depending on the combination of weather and
renovation scenarios considered). On the other hand, function intercept increased for 7.8-12.7% per decade (depending on the
coupled scenarios). The values suggested could be used to modify the function parameters for the scenarios considered, and
improve the accuracy of heat demand estimations.

2017 The Authors. Published by Elsevier Ltd.

* Corresponding
Peer-review author.
under Tel.: +213-345
responsibility 02688;
of the fax: +213-345
Scientific 02688.of The 15th International Symposium on District Heating and
Committee
* E-mail
Corresponding
Cooling. author. Tel.: +213-345 02688; fax: +213-345 02688.
address:abouchair@gmail.com
E-mail address:abouchair@gmail.com
1876-6102 2017demand;
Keywords: Heat The Authors. Published
Forecast; bychange
Climate Elsevier Ltd.
1876-6102 2017 The
Peer-review under Authors. Published
responsibility by Elsevier Ltd. Institute for Sustainable Development (EUMISD).
ofthe Euro-Mediterranean
Peer-review under responsibility ofthe Euro-Mediterranean Institute for Sustainable Development (EUMISD).

1876-6102 2017 The Authors. Published by Elsevier Ltd.

Peer-review under responsibility of the Scientific Committee of The 15th International Symposium on District Heating and Cooling.
1876-6102 2017 The Authors. Published by Elsevier Ltd.
Peer-review under responsibility of the Euro-Mediterranean Institute for Sustainable Development (EUMISD).
10.1016/j.egypro.2017.07.053
 Hocine Tebbouche et al. / Energy Procedia 119 (2017) 98110 99
2 H.Tebbouche, A. Bouchair and S. Grimes/ Energy Procedia00 (2017) 000000

1. Introduction

Unlike bioclimatic architecture that addresses only the energy aspect of the buildings in order to save the
consumption of conventional fossil fuels and promote the use of the so-called renewable energy, sustainable
architecture is an approach that aims to control the different dynamic relations between built space and its external
environment and harmonize the internal space with the social, natural and architectural surroundings. Although
various research topics in bioclimatic architecture have dealt with traditional techniques of adaptation [1-5]. Stephan
et al. [6] has shown that passive houses may not be energy efficient. They can have total energy consumption similar
or more than a new standard building. It was shown that poorly insulated city apartments can use less energy than a
very energy efficient passive house in the suburbs. The house size can significantly reduce the life cycle energy
demand per capita. Current European building energy regulations and certifications do not always result in a lower
overall energy consumption and greenhouse gas emissions. Their policies should adopt wider system boundaries
including embodied, transport energy requirements and other environmental impacts. Scofield [7] criticized the
question of to what extent do LEED-certified buildings save energy studied earlier by Newsham [8]. He wonders
that energy consumption in larger buildings is dominated by plug-loads and operating practices-which are not even
addressed by LEED. Rather than to utilize a non-physical averaging technique that under-weighs large buildings, it
would be better to change the LEED-certification process so that inefficient buildings do not gain LEED-
certification-particularly large inefficient buildings. Blengini [9] has recently conducted a detailed life cycle
analyses study on a low energy house built in northern Italy. He has confirmed that the initial goal of environmental
sustainability is reached, but to a lower degree than initially believed. In comparison to a standard house, while the
winter heat requirements reduced by 10:1, the life cycle energy was only reduced by 2.1:1 and the carbon footprint
by 2.2:1. Perez-Lombard [10] analyses offered data concerning energy depletion in buildings linked to HVAC
systems. They addressed the questions of the availability of the necessary information, the main building types and
the end uses which should be considered in the failure. Comparison using commercial buildings for some countries
(USA, UK, Spain, etc.) is presented. According to them, energy consumption of buildings in developed countries
comprises 2040% of total energy use and is above industry and transport figures in EU and USA. However,
available data is not sufficient and not proportional to its importance. The lack of information makes it difficult to
understand the basic changes that affect energy consumption in this sector. Lausten [11] presents an overview and
analyses current approaches for enhancing energy efficiency in building codes for new buildings. He then outlines
some valuable recommendations related to energy efficiency promotion for new buildings. According to Anderson
et al. [12] the built environment is the dominant source of energy consumption (62%) and greenhouse gas emissions
(55%).Achieving environmental goals, including climate change mitigation, has led to the development of robust
methods to assess the impacts from this sector. These methods focus on either individual buildings or on the urban
scale. Anderson et al. [12] shows that these topics are strongly divided between the scales of analysis: the building
and the urban scale. They think that separation per scale is problematic as it ignores the actual pattern of
construction: new buildings within existing cities. A new approach is therefore needed to link the knowledge gap
between the building and urban scale. Fabbri et al. [13] presented an Energy Retrofit simulation about an Italian case
study: one building typology that is supposed realized in several different periods, having different thermo-physic
parameters. For each period, four energy retrofit actions will be applied, together with the software evaluation of
energy performance. Gillingham et al. [14] reviews literature on several types of energy efficiency policies:
appliance standards, financial incentive programs, information and voluntary programs, and management of
government energy use. They provide an overview of the relevant programs, along with available existing estimates
of energy savings, costs, and cost-effectiveness at a national level. The literature examining these estimates points to
potential issues in determining the energy savings and costs, but recent evidence suggests that techniques for
measuring both have improved. Kaoula and Bouchair [15] showed that it is possible to assess energy performance
and environmental impacts of three hotel buildings having various envelope configurations built in different
climates using a life cycle analysis approach. The assessment was performed using PLEIADES software tools.
Facing the environmental challenges of the early 21st century, the building sector is experiencing a real
environmental revolution for the integration of eco- sustainable principles in the production process of the built
environment. Some attempts were made by [16] to find a policy that addresses all the environmental challenges to
gradually enter the era of multiple energy and sustainable developments, especially in the field of housing through a
100 Hocine Tebbouche et al. / Energy Procedia 119 (2017) 98110
H.Tebbouche, A. Bouchair and S. Grimes / Energy Procedia00 (2017) 000000 3

concept of ecological habitat conducted in Tlemcen city, in Algeria. They found that the achievement of ecological
homes is no more than the choice of ecological means.Combining socio-economic development and environmental
protection, sustainable development, finds its meaning in building sector by the notion of "sustainable architecture",
which is defined as a new practice in the production of healthy, environmentally friendly buildings efficient in terms
of natural resources, economically efficient and offering maximum comfort and safety to their users [17]. This has
led in practice to the implementation of a multitude of approaches to the environmental quality of sustainable
buildings. Following the global energy and climate issues, the first appearance of these efforts goes back to early 90s
of 20th century in Europe and in the USA. The number of labels and certifications resulting has been in constant
development. Most of multiple criteria approaches were initially simple and entirely voluntary. However, the
importance of making these approaches more compatible with the sustainability principles has led to the
development of varied number of standards and normative requirements for certification of sustainable construction
by offering a series of eco-labels and certifications.

2. The existing environmental approaches for sustainable buildings

Recognizing the importance of the environmental quality of their housing stock, many developed countries have
developed in recent years environmental quality measures applied to building sectors. For these, environmental
parameters that take into account their geographical situation and culture were determined and integrated into the
process of design, implementation and management of future construction and evaluation of the quality of existing
ones with a view to a possible improvement in their performance without denaturing them[18, 19]. Dascalaki et al.
[20] presented an overview of the database and its available tools, and the main results from a case study on
Hellenic buildings that reveals relevant characteristics. The Hellenic database included as ample of 250 buildings
from different regions in Greece, with a breakdown that is representative of the national building stock. The main
results focus on the buildings energy performance, thermal envelope characteristics and the exploitation of solar
thermal energy. In Germany and Austria, for example, all stakeholders (designers, builders and occupants) are
involved in an empirical environmental approach. In France, the UK and Scandinavia, the approach is often based
on simple goals grids to quantify. It is based on individual mobilization of every citizen motivated by tax incentives
and very precise regulations. Most of these processes are dynamic and subject to change based on the results of
experimental achievements [21].Many initiatives have been launched in this area since early 1990s. There are now
around the world sixty approaches for sustainable buildings [22, 23]. All these approaches deliver environmental
certification for sustainable buildings today both existing and future buildings. These are: The U.K BREEAM, the
US LEED, the Japanese CASBBE the German DGNB, the Swiss MENERGIE, Green Star in Australia and South
Africa, as well as HQE in France, Estidama for the United Arab Emirates, EDAMA for Jordan and Lebanon
approach ARZ Building Rating System(Fig. 1).

Fig. 1. Logos of some environmental approaches for sustainable buildings.

 Hocine Tebbouche et al. / Energy Procedia 119 (2017) 98110 101
4 H.Tebbouche, A. Bouchair and S. Grimes/ Energy Procedia00 (2017) 000000

All existing approaches at the Mediterranean area, such as HQE in France, Spain VERDE, Lider Portugal and
Protocollo ITACA-Italy, were developed by the of southern European countries. Noting that there is currently a
project called "OPEN HOUSE" initiated by the European Union, which aims to develop and promote a method of
assessing the environmental quality of buildings and a certification that will be common managed by a European
council. This will may complete or replace all existing approaches [24]. However, most of these multi-criteria
approaches were contextual and entirely voluntary. They are now beginning to rely more and more on labelling and
certification systems to integrate the dimension of eco-sustainability in the building sector. These environmental
labels developed according to precise standards are often referred to as the only ones that integrate all objectives of
the construction known as "sustainable" [25].
A significant increase in interest and research in the development of environmental analysis methods of the
buildings is observed in recent years around the world (Fig. 2). Now, owners and designers have a multitude of
choices for the large number and variety of approaches and existing tools. The evaluation can be performed at
different levels, from the simple assessment (or opinion poll) to a complete analysis of the life cycle.

Fig. 2. Creative spaces of certification systems for some buildings sustainability.

3. The criteria and building sustainability assessment indicators

Most approaches try to standardise the sustainability of both existing or future buildings in order to improve their
environmental and energy performances [26].According to the geographical, environmental and sociocultural of
buildings, these initiatives can be outlined as follows:

Those focusing exclusively on energy;

Those with quantified or qualified performance targets;
Those with obligation to use an environmental management system (EMS);
Those which have issues or criteria to be fulfilled;
Those with obligation results [27].

The evaluation criteria which constitutes the system of indicators of the environmental quality evaluation
operations of buildings is not only limited to energy considerations. These include many other crosswise dimensions
of sustainable development, sanitation (eco-materials) and environmental (land, waste, water) as well as economic
(development of eco-construction sector). Based on a global approach, they cover all the technical parameters that
would be improved which revolve around the following main themes:
 H.Tebbouche, A. Bouchair and S. Grimes / Energy Procedia00 (2017) 000000 5
102 Hocine Tebbouche et al. / Energy Procedia 119 (2017) 98110

Insertion of the building in the site;

Water management;
Energy efficiency;
Hygiene and waste management;
Quality of indoor environments, (acoustic comfort, hygrothermal, visual, olfactory and quality of indoor air);
Quality of materials and construction products;
Measures of security and protection against dangerous.

The divergences between the different qualitative sustainable environmental approaches of buildings, relate
primarily to the nature and number of criteria considered by their evaluation systems, and the importance they place
on certain indicators compared to other. These are naturally selected and classified according to the environmental,
climatic and socio-cultural characteristics for each region and the legislative and regulatory context specific to each
country. For example, the major concern of the Japanese system "CASBEE" considered the most complex and most
complete echo-sustainable construction certification system is the use of the land, while the "MINERGIE
Switzerland and "DGNB" German are much more focused on energy performance. However, it is not surprising that
the approach of the United Arab Emirates "Estidama" gives more importance to water management.
It is important to note, that existing environmental approaches to the sustainability of buildings in different
countries do not respond to of sustainable architecture requirements, given the fact that their environmental
assessment systems put much more emphasis on environmental performance, whereas socio-cultural and economic
parameters are given less consideration.

Table 1. Comparison between some key sustainability approaches used for evaluating sustainability.
HQE BREEM LEED
Harmonious relationship between buildings and their Management Site sustainability
immediate environment
Integrated choice of processes and construction products Health and comfort Water management
Building low nuisance Energy Energy and atmosphere
Energy management Transport Materials and resources
Water management Water Quality of interior environment
Waste management activities Materials innovation
Care and Maintenance Waste
Hygrothermal comfort Management of site and ecology
Acoustic comfort Pollution
Visual Comfort
Olfactory comfort
Health conditions of spaces
Air quality
Water quality

Even though for Newsham [8], these approaches seem rather simplistic, exigent, technical and sometimes
obscuring the social and cultural dimensions which remain very subjective assessment. The complexity and the cost
of certification process are often excessive and confusing due to multiple concept meanings used.
Environmental approaches to sustainable buildings offer many advantages. In addition to a guarantee for the
building, they are considered as a support for the promotion of sustainable environmental quality of construction
projects. They provide the design offices, builders, building owners and their companies repositories to optimize
the design of their projects [25].
 Hocine Tebbouche et al. / Energy Procedia 119 (2017) 98110 103
6 H.Tebbouche, A. Bouchair and S. Grimes/ Energy Procedia00 (2017) 000000

4. The Algerian context

Despite the quantitative evolution of the housing stock, many buildings have not been conceived, designed and
built with regard to the specific nature and context of the environment where they are located. The issue of
sustainability and environmental quality of buildings in Algeria remains central for the development of green
buildings. The recent achievements in the construction sector are inadequate with the requirements imposed by the
rapid scientific development and technological knowledge as well as modern information and communication
occurred in different areas such as sustainable building. The imbalanced distribution of the population and the
economic activities across the territory, desertification, irrational use of natural resources, seismic hazards,
degradation of living conditions, the diversity of socio-cultural practices of the population and the climatic and
geographic data throughout the national territory, are the main features which characterize the Algerian context.
To face these major challenges impeding the implementation of the national strategy for the environment and
sustainable development, several actions have been launched at various levels affecting several areas of
development [28].

4.1. Legislative, institutional and regulatory framework

From the beginning of the 21st century Algeria initiated institutional and legal reforms to incorporate the
requirements of sustainable development into national development policy. Thus, the number of laws and legal texts
implementing the 2nd generation for sustainable development has been promulgated. Strategically, several programs
have been developed to ensure better management of this policy within the framework of the National Action Plan
for Environment and Sustainable Development NEAP-DD developed in 2002 including:

National Action Plan for Environment and Sustainable Development;

National Plan of Special Wastes Management;
Improvement Programme for Built Environment;
National Integrated Household Haste Management Program;
National Energy Management Program;
National Programme for Integrated Management of Household and Assimilated Waste.

In terms of institutional strengthening of the integration of sustainable development, it is worth noting the
creation of several specialized agencies including:

National Observatory of the Environment and Sustainable Development;

High Council for Environment and Sustainable Development;
National Waste Agency;
Development Centre of Biological Resources;
National Agency for Integrated Management of Water Resources;
National Agency of Waste [29].

4.2. Physical and territorial environment

Algeria, one of the largest countries of Africa has a vast area of 2,381,741 km. The temperature difference
reaches 25 degrees during the same day and in the same season between its regions. Algeria is a rich country and has
natural and multicultural potential. It has a rate of urbanization of the order of 70%. Twenty two million Algerians
live in cities (63% of the overall population) spread mainly on the North of the country that represents only 4% of
the national territory (Fig. 3).This northern part of the country is characterized, among others, by:

High density (high urbanization), with lack of urbanized land which stops the development of these cities;
An area subject to major natural hazards (floods, earthquakes etc.);
Insufficient renewable energy sources (solar);
104 Hocine Tebbouche et al. / Energy Procedia 119 (2017) 98110
H.Tebbouche, A. Bouchair and S. Grimes / Energy Procedia00 (2017) 000000 7

Fig. 3. Population densities per wilaya Algeria [30].

The rebalancing of the urban framework is among the priority concerns listed by the National Land Planning
Scheme, prepared by the Ministry of Spatial Planning and the Environment in 2008, which consists of:

The stabilization of the growth of large cities in the littoral band;

Stabilization of the increase in medium-sized cities of the Tell strip;
Strengthening of urbanization in the highlands;
Development of urbanization in the south;

It is with this objective that a new set of cities integrating sustainability principles into the process of their design,
implementation and management. Designed to accommodate a large number of housing projects, in addition
to administrative public facilities, educational, cultural and others, the future new towns, are aimed to decongest
existing large urban centers and ensure balanced distribution of the population throughout the country (Fig. 4).

Fig. 4.Geographical location of the new sustainable cities of Algeria [31].

 Hocine Tebbouche et al. / Energy Procedia 119 (2017) 98110 105
8 H.Tebbouche, A. Bouchair and S. Grimes/ Energy Procedia00 (2017) 000000

4.3. Energy management

The building sector, whose energy consumption accounts about 40% of the total energy, is responsible for 20 %
of global emissions of greenhouse gases. As part of a global environmental dimension, energy efficiency in building
sector has been a fundamental worldwide concern since 1970. It aims to fight against waste and exhaustible
conventional fossil resources by reducing greenhouse gas emissions and the development of renewable energy.In
Algeria, energy management is regulated by the laws: 99-09 of 28/07/1999 and 04-09 of 14/ 08/2004 on the
promotion of renewable energy within the framework of sustainable development. They promote the
implementation of measures and other actions for the rational use of energy and reduction of the impact of the
energy system on the environment. As part of the national energy conservation policy, the government has launched
in 2011, the national program for the development of renewable energy and energy efficiency. It is conceded as a
social and economic development pedal. This ambitious program aims to diversify sources of energy, and promotion
of everlasting resources, especially solar, which are expected to produce 22000 megawatts by 2030, including 12000
megawatts for the domestic market which represents 37% of electricity needs. In Algeria, the building sector
(residential and commercial) consumes more than 30% of the total national energy production (Fig. 5).

Fig. 5. Distribution of final energy consumption by sector in Algeria [32].

The agency for the promotion and rationalization of the use of energy launched, in partnership with the Ministry
of Housing and Urban Development, a pilot project called "Eco- pack ". This involves the construction of 600
housing units with high energy performance across three climatic zones in 11 provinces of the country. These are:
50 homes in Algiers, 50 homes in Skikda, 80 in Oran, 80 in Blida, 30 in Tamanrasset, 82 in Mostaganem, 30 in
Bechar, 32 in Laghouat, 80 in Djelfa, 32 in El Oued and 54 in Setif.
The objectives of the project included in the national energy control program (PNME), whose construction works
started in June 2011, are:

The improvement of thermal comfort in homes and reduction of energy consumption for heating and cooling,
Activating the actors of buildings on the issue of energy efficiency ;
Conducting a demonstrative action to show the achievability of the high energy performance projects in Algeria,
Provoking a flow effect of consideration practical aspects of energy management in architectural design [32].
106 Hocine Tebbouche et al. / Energy Procedia 119 (2017) 98110
H.Tebbouche, A. Bouchair and S. Grimes / Energy Procedia00 (2017) 000000 9

This initiative is still very reluctant and insufficient. Algeria has a significant potential green energy, where the
solar exposure time on almost the national territory exceeds 2500 hours per year which can reach 3900 hours per
year. The energy used in buildings remains largely based on fossil and non-renewable conventional energy.

The reality on the ground shows many deficiencies regarding the energy mastering in buildings including:

The absence of technical means and equipment for the rationalization of energy consumption, such as using low-
energy bulbs, or the double glazing which, according to experts, could reduce consumption energy 30%
compared to single glazing thin;
Lack of constructive and architectural design measures which can ensure better control of consumption of
conventional energy resources and reducing the impact of energy fossil on the environment (location and
orientation, size and location of the glass surfaces, volume and depth of local, composition of walls and choice of
materials, insulation and inertia, ...);
Lack of initiatives to promote the use of new and renewable energies, clean and sustainable;
Lack of motivations for the use of renewable energy.

4.4. Water management

The global water need could exceed the supply by 40% by the horizon 2030 according to the report "Measuring
the use of water in a green economy" of the United Nations Environment Programme. As an element vital to our
life, water requires special attention and effective and thoughtful management that relies primarily on the economy
of the so-called safe, clean and unpolluted. According to experts from UNEP, one of the keys to better manage water
today would be to estimate the available resources, prioritize the uses and identify their impacts on ecosystems.
Algeria is not a country with high rainfall; it has always considered the water resources sector as a strategic
sector. Its management is primarily by the law no. 05-12 of 4/08/2005 on water which stresses the importance of
integrating the long term and sustainability in the use and management of this important natural resource. By the
early 2000s important actions were taken by the government through a comprehensive action program to mobilize
new water resources and qualitatively ensure their mastery and their rational management. Currently, the water
resources sector in Algeria, which has grown significantly in recent years, has 72 dams with a capacity of seven
billion cubic meters per year, 9 seawater desalination plants in operation and 165 treatment plants wastewater.
Despite all the efforts, for the development and management of water resources in Algeria, it should be noted that
the consumption and management of water in the building sector is experiencing a multitude of failures including:
Irrational consumption in the absence of measures to limit water waste,
Absence of development strategy for rainwater harvesting techniques;
Damaged network for drinking water distribution which requires urgent therapy works;
Lack of efficient strategy in the supply of drinking water;

Table 2.Drinking water supply indicators evolution between 1999- 2015 [33].
Indicators 1999 2011 2012 2014 1015
Linear network of sanitation and rain water (5Km) 50 000 102 000 105 000 112 000 116 000
Rate of linking (*) 78% 94% 95% 96% 98%
Staffing litter/day/inhabitant 123 170 175 175 180
Water production (billions of m3/year) 1.25 2.9 3.1 3.6 3.6
Frequency of distribution
Daily 45% 73% 75% 75% 75%
1 day of 2 30% 17% 17% 16% 16%
1 day of 3 and plus 25% 10% 10% 9% 9%
The connection national average rate (including rural) reached 96 %. Urban area; the connection rate is around 100 %.
 Hocine Tebbouche et al. / Energy Procedia 119 (2017) 98110 107
10 H.Tebbouche, A. Bouchair and S. Grimes/ Energy Procedia00 (2017) 000000

4.5. Waste management

With very diverse sources: food, chemical and ferrous, plastic and other paper, garbage require special attention
and a very strict management to limit their negative impact on health and the environment. Waste from construction
sites and public works are an important part of the total waste generated annually at the global level, according to
the construction sites, demolition or rehabilitation of structures.
Algeria according to the National Waste Agency, annually produces around 10.5 million tonnes of household
waste including more than 7 million tonnes is municipal waste (14 million of M3). The area of Building and Public
Works generates a significant proportion of total waste. Before these amounts, the challenge of sorting and recovery
of building waste remains crucial to ensure sustainable management. Sixty two (62) % of waste collected annually
in Algeria are organic materials. The remains are of paper and cardboard (9%), plastics (12%), glass (1%), metals
(2%) and others (14%). Waste from construction and demolition are generally disposed in uncontrolled landfills
(Fig. 6).Sixty two (62) % of waste collected annually in Algeria are organic materials. The remains are of paper and
cardboard (9%), plastics (12%), glass (1%), metals (2%) and others (14%). Waste from construction and demolition
are generally disposed in uncontrolled landfills (Fig. 6).

Fig. 6.Ratios of municipal solid waste in Algeria for 2009 [34].

Waste management policy has in recent years, through the Household Waste Management Programme and the
National Plan of Special Wastes Management, enormous progress. In this context, it is planned including: closure
and rehabilitation studies of landfills; the realization of landfills; achieving 300 landfills; the introduction of
recycling and the production of several centres Burial Techniques for special industrial waste. Unfortunately, the
current situation regarding waste management in the construction sector remains totally ineffective. It is
characterized by:

Lack of strategy to reduce the production of harmful of waste;

Lack of clear strategy for waste collection;
Lack of waste sorting;
Failure in the treatment recycling and recovery of waste.
108 Hocine Tebbouche et al. / Energy Procedia 119 (2017) 98110
H.Tebbouche, A. Bouchair and S. Grimes / Energy Procedia00 (2017) 000000 11

4.6. Materials and construction techniques

With the major concern to mop up the increased insufficiency registered since independence in terms of
infrastructure, Algeria has resorted to the use of all kind of prefabricated construction systems, to abusive use of new
materials issued from technology and industry of buildings, up to the almost universal standardization of equipment
projects prototyped to adapt to different sites, neglecting both the geographical, bioclimatic characteristics of
climatic zones and socio-cultural practices of the local population. It is important to note that some materials
harmful to health of customers were widely used by domestic and foreign construction companies in the
construction of some buildings during the eighties in Algeria such as asbestos, lead and oils ASKARELS etc.

5. Discussion and recommendations

Despite all the efforts and resources deployed by the public authority for the application of the concept of
sustainable development in all active sectors, it is noted that building sector is still shortage of sustainable
architecture. The development and implementation of an environmental approach to the promotion of sustainable
buildings, suitable for Algeria, seems to be imperative.
However, the utmost importance should be given to the choice of construction implantation site to ensure good
land management. It is also recommended to strengthen the existing national legislative and regulatory framework,
through implementing legislation and regulations and the establishment of control and monitoring of the application
of these texts. For the integrated choice of construction materials, the return to the use of local materials with high
thermal inertia, healthy, recyclable and environmentally friendly, widely used in vernacular architecture, such as raw
land and natural stone should be strongly encouraged.
In terms of energy, and in order to ensure maximum energy efficiency, the energy strategy to rationalize
consumption is by using energy efficient appliances. It is also suggested to develop he exploitation of solar energy
especially in the southern part of the country where the solar thermal potential, photovoltaic and wind power is the
highest in the country. Citizens should be encouraged by the authorities help to use renewable energy such as the
installation of solar water heaters.
Finally, for better waste management, efficacy techniques should aim in improving the collection, sorting,
transport, treatment, disposal and recovery of waste sites by their reuse and recycling. Particular attention should be
paid to water management to preserve this vital natural resource increasingly scarce in Algeria in particular by:

The awareness of water saving and its valorisation;

The judicious choice of water-saving equipment;
The rainwater collecting;
The treatment and reuse of wastewater.

6. Conclusion

It is well recognized today that the field of standardization of sustainability of constructions through the different
environmental approaches knows a great spread in all countries of the world. Although, these systems tend to be
voluntary and non-compulsory, the fact remains that they are effective in promoting sustainable urban and
architectural production of high environmental quality. They also contribute to improving the quality of the built
environment in general and participate in a mature reflection on the most relevant and the most appropriate approach
to achieve design and build buildings where quality and environment are optimally taken into account. Algeria
cannot under any circumstances be marginalized in this worldwide dynamic. It is imperative to acquire technical,
human and material necessary for the establishment of an appropriate national strategy.
In light of the results of our study, the environmental approach we advocating for sustainable buildings in Algeria
would be a flexible, easily adaptable to different regions according to their physical characteristics, geographic and
climatic and socio-cultural practices that characterize their populations; an approach whose parameter priorities are
adapted with the major concerns of our country such as the rebalancing of the urban structure, energy management,
water and waste management. Remaining within the legal, regulatory and national normative framework, it would
 Hocine Tebbouche et al. / Energy Procedia 119 (2017) 98110 109
12 H.Tebbouche, A. Bouchair and S. Grimes/ Energy Procedia00 (2017) 000000

allow Algeria to develop a national strategy which defines a clear and precise manner of the environmental
requirements for the qualitative evaluation of sustainable buildings analogous to those existing in other countries.

References

1. Bouchair A, Dupagne A. Building Traditions of Mzab Facing the Challenges of Re-shaping of its Built form and Society, Building and
Environment.2003; 38 (11): p.1345-1364.
2. Bouchair A. Decline of Urban Ecosystem of Mzab Valley. Building and Environment. 2004; 36 (6): p.719-732.
3. Bouchair A. Vernacular Architecture: Hot Arid Climate Control. In: Encyclopedia of Energy Engineering and Technology, 2nd ed. Volume
IV, 2342 pages. Taylors & Francis Group, USA; 2015.
4. Bouchair A. Sustainability features of vernacular architecture in Southern Algeria. International conference on vernacular heritage,
sustainability and earthen architecture. VerSus 2014. September 11th to 13th 2014. Valencia, Spain. Proceeding Vernacular architecture:
Towards a sustainable future edited by C. Mileto et al. Universitat politecnica de Valencia, CRC press, Taylor and Francis Group; 2015,
p. 188-193.
5. Bouchair A, Tebbouche H, Hammouni A, Lehtihet MC, and Blibli M. Compact cities as a response to the challenging local environmental
constraints in hot arid lands of Algeria. Energy Procydia. 2013; 42:493502.
6. Stephan, A., Crawford R.H, Myttenaere K. (2013). A comprehensive assessment of the life cycle energy demand of passive houses.
Applied Energy 112 (0): p. 23-34.
7. Scofield JH. Do LEED-certified buildings save energy? Not really ... Energy and Buildings 2009; 41 (12):1386-1390.
8. Newsham GR, Mancini S, Birt BJ. Do LEED-certified buildings save energy? Yes, but ... Energy and Buildings 2009:41 (8):897-905.
9. Blengini GA, Di Carlo T. The changing role of life cycle phases, subsystems and materials in the LCA of low energy buildings. Energy
and Buildings 42 (6): p.869-880.
10. Perez-Lombard L, Ortiz J, Pout C, (2008). A review on buildings energy consumption information. Energy and Buildings 2010:40
(3):394-398. IEA (2015) World energy outlook 2015. Paris: International Energy Agency.
11. Lausten J. Energy efficiency requirements in building codes, energy efficiency policies for new buildings. International energy agency
(IEA). Head of Communication and Information Office. Paris. 2008.
12. Anderson JE, Wulfhorst G, Lang W. Energy analysis of the built environmentA review and outlook. Renewable and Sustainable
Energy Reviews. 2015; (44), p.149158.
13. Fabbri K, Tronchin L, Tarrabusi V. Energy retrofit and economic evaluation priorities applied at an Italian case study. Energy Procedia.
2014; 45: p. 379-384.
14. Gillingham K, Newell R, Palmer K. (2006), Energy efficiency policies: A retrospective examination. Annual Review of Environment and
Resources, 31, p. 161-192.
15. Kaoula D and Bouchair A. Evaluation of environmental impacts of hotel buildings having different envelopes using a life cycle analysis
approach. Indoor and Built environment, 2017; 0 (0) 120.
16. Boukli Hacene M-E-A and Chabane Sari N-Ed. Algerian Strategy in the Context of Sustainable Development: The Case of Green
Building. Journal of Thermal & Environmental Engineering, 2013; 6: 1-6
17. Ragheba A, El-Shimyb H nd, RaghebbGh. Green architecture: a concept of sustainability. Procedia -Social and Behavioral Sciences.
2016; 216:778 787.
18. Elena C, Riascos M, Franklin J, Romero A and Riascos L- A. M. Classification of Assessment Methods for Analyzing Sustainability in
Buildings. Journal of Civil Engineering and Architecture Research. Vol. 2, 2015; 10: 976-984
19. Meir I A, Peeters A, Pearlmutter D, Halasah S, Garb Y. and Davis J-M. An assessment of regional constraints, needs and trends.
Advances in Building Energy Research. 2012; 139
20. Dascalaki EG, Droutsa K, Gaglia AG, Kontoyiannidis S, Balaras CA. Data collection and analysis of the building stock and its energy
performance - An example for Hellenic buildings Energy and Buildings.2010 :42 (8), p. 1231-1237.
21. Gauzin-Mller D. Larchitecture cologique, 29 exemples europens. Paris d. du Moniteur, 290 p. 2001.
22. Gluszak M. (2015). Internationalization, Competiveness and Green Building Certification in Europe (chapter 9). In: P. Stanek & K. Wach
(Eds.). Europeanization Processes from the Mesoeconomic Perspective: Industries and Policies. Krakw: Cracow University of
Economics, p. 173-191.
23. Elmeligy D-A. Rating Systems Awareness for Green Buildings Applications. Journal of Engineering and Science Vol. 3, 2014; 53-64
24. CESBA. Common European Sustainable Building Assessment. Initiative collective pour une approche commune de lvaluation des
btiments durables en Europe. Document dorientation de linitiative CESBA, October 2014 [Online], URL: http://www.fedarene.org/wp-
content/uploads/2014/10/CESBA-Initiative_policy-paper_FR.pdf. (Page consulted on 21 December 2015).
25. Ding GKC. Sustainable construction. The role of environmental assessment tools. Journal of Environmental Management. 2008; 86 (3),
p. 451-464
26. Villot J, Gondran N, Laforest V. Labels de la construction: quelle contribution possible au facteur 4 ? , Dveloppement durable et
territoires. [On line], URL: http://developpementdurable.revues.org/8834. (Page consulted on 10 July 2016). 2011.
27. VAD (Ville et Amnagement Durable). La Qualit environnementale est-elle normalisable ? Le petit guide VAD pour sy retrouver dans
la jungle des Labels, Rfrentiels et Certifications. [On line], URL: http/: www.ville-amenagementdurable.org. (Page consulted on 10 July
2016). 2010.
110 Hocine Tebbouche et al. / Energy Procedia 119 (2017) 98110
H.Tebbouche, A. Bouchair and S. Grimes / Energy Procedia00 (2017) 000000 13

28. CDD-19. 19me session de la Commission du Dveloppement Durable des Nations Unies (CDD-19). Rapport national de lAlgrie.
[Online], URL: https://sustainabledevelopment.un.org/dsd_aofw_ni/ni_pdfs/NationalReports/algeria/full_report.pdf. (Page consulted on
24 September 2016). 2011.
29. Berezowska-Azzag E. Projet Urbain, Guide Mthodologique- Connatre le contexte de dveloppement durable. d. Synergie. 250 P. 2011.
30. ONS (Office National des Statistiques). 2008.
31. Encarta 2010.
32. APRUE. Agence Nationale pour la Promotion et la Rationalisation de l'Utilisation de l'Energie. Consommation nergtique finale de
lAlgrie, Donne et indicateurs. Chiffres cls Anne 2012, (Algrie). [Online]. URL: http://www.aprue.org.dz/indicateurs.html. (Page
consulted on September 2016).
33. MREE. Ministre des Ressources en Eau et de lEnvironnement de la Rpublique algrienne, alimentation en eau potable- Evolution des
indicateurs du Service Public de lEau 1999 2015 , [En ligne], URL : http://mree.gov.dz/wp-content/uploads/2016/03/Indicateurs-AEP-
2015.pdf. (Page consulted on 23 December 2016).
34. Kehila Y, SWEEP-Net, Gourine L. Country Report on the Solid Waste Management in Algeria, the Regional Solid Waste Exchange of
Information and Expertise Network in Mashreq and Maghreb Countries. 2010 Available online: http://www.sweep-
net.org/ckfinder/userfiles/files/country-profiles/RA%20ALGERIE%20ANG.pdf. (Page consulted on 15 December 2016).