Appl Microbiol Biotechnol (1995) 43:65-69
M. Z. A. Bhuiyan • K. Ueda • Y. Inouye
M. Sugiyama
Molecular cloning and expression in Escherichia coli
of bleomycin-resistance gene
from a methicillin-resistant Staphylococcus aureus
and its association with IS431 mec
Received: 18 April 1994/Received last revision: 1 July 1994/Accepted: 26 July 1994
Abstract A gene that confers bleomycin resistance was
cloned from the chromosomal DNA of methicillin-re-
sistant Staphylococcus aureus (MRSA) B-26 into the
plasmid pUC18. It is of chromosomal origin rather
than plasmid and exists in the chromosome making
a cluster with the kanamycin-resistance gene. We found
that the nucleotide sequence of the Neomycin-resist-
ance gene from the chromosome of MRSA B-26 is
identical to that from a staphylococcal plasmid,
pUBll0. The partial sequence of IS431mec was also
found upstream from the DNA fragment containing
the bleomycin- and kanamycin-resistance genes.
Introduction
Bleomycin, an aminoglycopeptide, is one of the impor-
tant antineoplastic antibiotics isolated from Streptomy-
ces verticillus (Umezawa 1975). The mode of action of
bleomycin has been studied extensively and it was
proved that the drug causes cell death as a result of
multiple strand scissions by direct interaction with the
tumour cell DNA. Detailed studies have elucidated the
mechanism of Neomycin-induced double-strand
breaks in bacterial and viral DNA (Haidle and Lloyd
1979).
A transposon Tn5, originally identified as a compon-
ent of an R factor from Klebsiella (Berg et al. 1975),
M. Z. A. Bhuiyan • K. Ueda
Department of Paediatrics,
Hiroshima University School of Medicine,
Kasumi 1-2-3, Minami-ku, Hiroshima 734, Japan
Y. Inouye . M. Sugiyama ( ~ )
Institute of Pharmaceutical Sciences,
Hiroshima University School of Medicine, Kasumi 1-2-3,
Minami-ku, Hiroshima 734, Japan.
Fax: 81-82-257-5284
© Springer-Verlag 1995
carries a Neomycin-resistance determinant (Genilloud
et al. 1984; Mazodier et al. 1985). Sugiyama et al. have
cloned two Neomycin-resistance genes, designated
blmA and blmB, from Neomycin-producing S. verticil-
lus and demonstrated that they encode bleomycin-
binding protein and Neomycin acetyltransferase
respectively (Sugiyama et al. 1994). In addition, a strain
harbouring the staphylococcal plasmid p U B l l 0
(Jalanko et al. 1981) was resistant to bleomycin (Semon
et al. 1987). Although the bleomycin-resistance genes
encoded in pUB110 and Tn5 have been sequenced, the
biochemical mechanism of resistance has not yet been
elucidated (Mazodier et al. 1985; Semon et al. 1987).
Almost all strains of methicillin-resistant Staphyl-
ococcus aureus (MRSA), isolated in Hiroshima Univer-
sity Hospital from October 1990 to April 1992, were
resistant to Neomycin, which was not used as an anti-
bacterial agent. From our observation that the
Neomycin-resistance properties did not disappear,
even when the MRSA cells were treated with ethidium
bromide as a plasmid-curing agent (Bouanchaud et al.
1969), these strains were thought to be resistant to the
drug as a result of the presence of the gene in the
chromosome rather than in the plasmid.
In the present study we cloned a gene that confers
Neomycin resistance from the chromosomal DNA of
a MRSA strain isolated from Hiroshima University
Hospital, Japan, and the possibility of the bleomycin-
resistance determinant as a transposable element in
MRSA strains is discussed.
Materials and methods
Bacterial strains and plasmids
Methicillin-resistant Staphylococcus aureus (MRSA) B-26 was used
to clone a gene encoding a chromosomal Neomycin-resistance
determinant. Escherichia coli TG1 and E. coli DH5c~ were used as
hosts for cloning and sequencing experiments. Plasmids pUC18,
pUCll8 and pUCll9 were used as vectors. E. coli TB1 was used as
66
a host for expression vector pMALc-2 (Maina et al. 1988) obtained
from New England BioLabs Inc. (Beverly, Mass., USA). E. coli
harbouring the pUC-based plasmids and pMALc-2 were cultivated
in LB broth containing 100 gg/ml ampicillin at 37°C overnight.
MRSA B-26 was cultivated in TSB broth (Difco laboratories, De-
troit, Mich., USA) containing 100 gg/ml bleomycin A2 sulphate at
37°C overnight.
Preparation of chromosomal DNA
The chromosomal DNA from MRSA B-26 was isolated according
to the method of Davis et al. (1980) after cell lysis using lysozyme and
achromopeptidase.
Shotgun cloning of the bleomycin-resistance gene
The chromosomal DNA was partially digested with several different
restriction enzymes, either singly or in combination, and ligated to
pUC18 digested with the same enzyme. The chimeric plasmid was
introduced into E. coli cells by electroporation using the Transpor-
ator (BTX Electro Cell Manipulator, San Diego, Calif., USA), ac-
cording to the manufacturer's instructions. LB agar containing am-
picillin (100 ~tg/ml) and Neomycin A2 sulphate (100 gg/ml) was used
to screen bleomycin-resistant transformants.
Oligonucleotides and polymerase chain reaction
To amplify the structural gene for bleomycin resistance from MRSA
B-26 by the polymerase chain reaction (PCR), two primers having
EcoRI and BamHI sites at the 5'- and 3'-adjacent regions respect-
ively, designated primer I(5'-ATGCGAATTCATGTTACAG-
TCTATCCCGGC-3') and primer 2 (5'-ATAAGGATCCTTAG-
CTTTTTATTTGTTGAA-3'), were designed on the basis of the
nucleotide sequence of the Neomycin-resistance gene from pUB110
(Semon et al. 1987) and synthesized using a Cyclone Plus DNA
synthesizer (MilliGen Bioresearch, Bedford, Mass., USA) by Bio-
Synthesis Inc. (Lewisville, Tex., USA). A 1.6-kb BamHI-BglI! frag-
ment containing the bleomycin-resistance gene from MRSA B-26
was used as a template for the PCR. PCR amplification was per-
formed according to the method described previously (Innis et al.
1990).
Subcloning of the PCR-amplified gene
The structural gene for bleomycin resistance, amplified by the PCR
method, was inserted into an expression vector pMALc-2 and intro-
duced into E. coli TB1. The structural gene is expected to be
expressed under the control of the tac promoter in pMALc-2
(Maina et al. 1988).
DNA sequencing
Some DNA fragments were subcloned into pUC118 and pUC119.
The plasmids were isolated by the alkaline extraction procedure of
Birnboim and Doly (1979), and purified by the Magic Minipreps
DNA purification system (Promega Corp., Madison, Wis., USA),
according to the manufacturer's instructions. DNA was sequenced
by the dideoxy-DNA chain-termination method (Sanger et al. 1977)
using the A.L.F. DNA sequencer (Pharmacia LKB Biotechnology,
Uppsala, Sweden). The sequence data were analysed for open-read-
ing frame and amino acid sequence homologies with the GENETYX
programme (Software Development, Tokyo, Japan).
Reagents used
Restriction enzymes were purchased from New England Biolabs Inc.
and Toyobo Co. Ltd. (Osaka, Japan). A ligation kit containing T4
DNA ligase was obtained from Gibco BRL (Gaithersburg, Md.,
USA). A PCR-amplification kit containing Taq polymerase and
dNTP was purchased from Takara Shuzo Co. Ltd. (Kyoto, Japan).
Results
Cloning and expression of the Neomycin-resistance
gene in E. coli
Preliminary experiments confirmed that no plasmid
DNA was present in MRSA B-26. To clone a gene for
Neomycin resistance from MRSA B-26, we partially
digested the chromosomal DNA with several different
restriction enzymes, either singly or in combination,
ligated the fragments to pUC18 cleaved with the same
enzyme, and introduced the products into E. coli TG1.
Only when the chromosomal DNA was digested with
HindIII, were three clones resistant to bleomycin
obtained. The plasmids isolated from these clones all
contained the same 5.1 x 103-base (5.1-kb) insert of
Staphylococcus DNA in the same direction. A partial
restriction map of the plasmid, designated pl 8KBA1, is
shown in Fig. 1. E. coli harbouring the plasmid was
resistant even to 1000 gg/ml bleomycin.
Clustering with the kanamycin-resistance gene
E. coli harbouring p18KBA1 was also resistant to
100 gg/ml kanamycin. To localize both the Neomycin-
and kanamycin-resistance genes the deletion deriva-
tives ofpl8KBA1 were constructed; the plasmid, desig-
nated pl8KBA2, was obtained by double digestion of
pl8KBA1 with HindIII and BamHI and subsequent
ligation (Fig. 1). E. coli TG1, harbouring the 2.6-kb
BamHI-HindIII insert, contained in the p 18KBA2 plas-
mid, was also resistant to both antibiotics.
The pl8KBA3 plasmid, which contained the 1.6-kb
BglII-BamHI segment from the cloned 5.1-kb HindIII-
HindIII DNA fragment, was also constructed. E. coli
harbouring pl8KBA3 was resistant to bleomycin, but
not to kanamycin. E. coli harbouring plasmid
pl8KBA4, in which the 2.6-kb BamHI-HindIII seg-
ment was deleted from the 5.1-kb HindIII-HindIII
DNA fragment, no longer expressed both bleomycin
and kanamycin resistance. Thus the Neomycin-resist-
ance gene was cloned together with the kanamycin-
resistance gene in a clustered fashion.
Ubukata et al. (1989) have also described
a kanamycin-resistance gene, located on the chromo-
some of a MRSA strain. In the present study we dem-
onstrated that the bleomycin-resistance gene is clus-
tered with the kanamycin-resistance gene and located
 67

Fig. 1 Restriction-map
similarity between p 18KBA 1 (a)
Hind III Hind III BamHI Hind III
and p U B l l 0 (b). The thick EcoR I
amH I
black bar indicates insertion
fragment from methicillin- pl 8KBA1
resistant S. aureus B-26 strain,
and the line indicates the
plasmid pUC18. The thick white
bar indicates the deleted Hind III
fragment. The dotted line
indicates the extent of the pl 8KBA2
BamH I
] ~ gl II Bgl II
I
Pvu ][ 8amH I
Ill
BamHI
I
sequence determined, p U B l l 0
(Jalanko et al. 1981) was
linearized at the EcoRI site. In
pl8KBA1, an extra BglII site is Hind III
Bgl II Bgl II Pvu II BamH I BamHI
present, which is within the BamH I
insertion sequence IS431mec, as pl 8KBA3 ] I I I
shown in Fig. 2

1 ;[ 1 ;]

a lkb

kan r ble r

EcoRl Bgl II Pvull BamHI Xbal EcoRI

pUB 110 I I I i I I
I I
b 1 Kb

downstream from the gene for kanamycin resistance as
a p U B l l 0 plasmid (Jalanko et al. 1981; Semon et al.
1987), and there is a major restriction-enzyme site sim-
ilarity in both (Fig. 1). We amplified the structural gene
(399 base pairs, bp; data not shown) for bleomycin
resistance from MRSA B-26 by the PCR method, using
two oligonucleotide primers, which were synthesized
o n the basis of the nucleotide sequence of the
bleomycin-resistance gene from p U B l l 0 (Semon et al.
1987). The nucleotide sequence of the bleomycin-resist-
ance gene from MRSA B-26 was identical to that from
p U B l l 0 (data not shown). In addition, we confirmed
that the structural gene for bleomycin resistance from
MRSA was expressed under the control of the tac
promoter on expression vector pMALc-2 (Maina et al.
1988) in E. coll.
To elucidate the phenomenon of how bleomycin-
and kanamycin-resistance genes have been evolu-
tionarily integrated into the chromosomal DNA from
MRSA, we also sequenced about 300 bp from both the
right and left ends of the cloned 5.1-kb HindIII-HindIII
DNA fragment. We compared the nucleotide sequences
of both the regions with those of several insertion
sequences from Staphylococcus aureus to discover
whether there is any insertion-sequence (IS)-like ele-
ment near the Neomycin- and kanamycin-resistance
gene. We thus ought to find out why the nucleotide
sequence of the bleomycin-resistance gene of MRSA
B-26 is identical to that of pUBll0, also having a sim-
ilar alignment with the kanamycin-resistance gene; this
led us to investigate how these two genes from pUB110
transferred to the chromosomal DNA of MRSA B-26.
As shown in Fig. 2, a region with complete homology
to IS431rnec (Barberis-Maino et al. 1990) was found
downstream from the left HindIII site of the cloned
5.1-kb DNA fragment. The sequence ACTTTG-
CAACAGAACCG is identical to an inverted repeat,
designated IR-r in IS431mec, which is a methicillin-
resistance-associated insertion-sequence-like element.
But another inverted repeat, designated IR-1, in
IS431mec was not found in our cloned gene: IR-1 is
shown to be located 759 bases upstream from the IR-r
motif (Barberis-Maino et al. 1990). Upstream from the
right HindlII site of the fragment, however, no signifi-
cant homology with IS431mec was found.
Discussion
Insertion sequences can reside on both plasmids and
chromosomes and provide regions of DNA sequence
68

Fig. 2 Comparison of the H in dllI

partial nucleotide sequences of
the segment containing the a AAGCTTTTAA
HindIII-BgIII site (a) in the
cloned 5.1-kb DNA fragment of b A A G C T T T T A A 720
Staphylococcus DNA with
those of IS431mec (b). The
nucleotide sequence of ACTTAAACCTGACTGTCATTGTACATCGAAATATCTGAATAACCTCATTGAGCAAGATCA
IS431mec is numbered
according to the system ACTTAAACCTGACTGTCATTGTACATCGAAATATCTGAATAACCTCATTGAGCAAGATCA 780
described by Barberis-Maino et
al. (1990). * Identical
nucleotides in the compared
sequences, - - the IR-r CCGTCATATTAAAGTAAGAAAGACAAGGTATCAAAGTATCAATACAGCAAAGAATACTTT
************************************************************
sequence
CCGTCATATTAAAGTAAGAAAGACAAGGTATCAAAGTATCAATACAGCAAAGAATACTTT 840

Bgln
A~KAGGTATTGAATGTATTTACGCTCTATATAAA/~Gd~CCG~2AGGTCTCCTTCAGATCT
AAAAGGTATTGAATGTATTTACGCTCTATATAAAAAGAACCGCAGGTCT-CTTCAGATCT 099

ACGGATTTTCGCCATGCCACGAAATTAGCATCATGCTAGCAAGTTAAGCGAACACTGACA

ACGGATTTTCGCCATGCCACGAAATTAGCATCATGCTAGCAAGTTAAGCGAACACTGACA 959

TGATAAATTAGTGGTTAGCTATATTTTTTTACTTTGCAACAGAACCG

TGATAAATTAGTGGTTAGCTATATTTTTTTACTTTGCAACAGAACCG 1006

for recombination (Broda 1979; Cohen 1976; Iida et al.
1983). In addition, plasmids also can act as vectors for
transposable DNA elements or transposons (Kleckner
1981).
The frequent presence of I S 4 3 1 on chromosomal and
plasmid DNA of staphylococci in various copy num-
bers and locations points to the mobile character of this
element. I S 4 3 1 is also present in the mercury-resistance
determinant, m e r of S. a u r e u s (Barberis-Maino et al.
1987). The methicillin-resistance determinant m e c in S.
a u r e u s is thought to be transposable (Trees and Ian-
dolo 1987) and has a chromosomal location (Kuhl et al.
1978). There is indirect evidence that both m e t and m e c
determinants transpose (Trees and Iandolo 1987;
Shalita et al. 1980; Witte et al. 1986; Lyon and Skurray
1987). However, direct evidence for the mobility of
1S431 is not available yet. Judging from the observation
of above researchers and our findings in S. a u r e u s B-26,
we hypothesize that this bleomycin-resistance gene was
originally present in plasmid p U B l l 0 clustered with
a kanamycin-resistance gene, which was later integ-
rated into the chromosome of MRSA, with the medi-
ation of I S 4 3 1 m e c , like the mercury- and tetracycline-
resistance genes (Skinner et al. 1988; Barberis-Maino
et al. 1987). Studies are in progress in our laboratory to
determine the structure and function of a protein
encoded by the bleomycin-resistance gene in MRSA.
Further detailed studies are also needed of how the
bleomycin- and kanamycin-resistance genes from
p U B l l 0 transferred to the chromosome in MRSA.
AcknowledgementsWe are grateful to Professor T. Yokoyama,
Hiroshima University Hospital for gifts of MRSA strains. We thank
Mr. H. Yaju, Pharmacia Biotech K.K., Tokyo, for his skilful analysis
of nucleotide sequencing. We thank Nippon Kayaku Co. Ltd. for the
gift of bleomycin A2 sulphate. We wish to thank the Research Centre
for Molecular Medicine, Hiroshima University School of Medicine,
for the use of their facilities.
References
Barberis-Maino L, Berger-Bachi B, Weber H, Beck WD, Kayser FH
(1987) IS431, a staphylococcal insertion sequence-like element
related to IS26 from Proteus vulgaris. Gene 59:107-113
Barberis-Maino L, Ryffel C, Kayser FH, Berger-Bachi B (1990)
Complete nucleotide sequence of IS431mec in Staphylococcus
aureus. Nucleic Acids Res 18:5548
Berg DE, Davies J, Allet B, Rochaix J-D (1975) Transposition of
factor R genes to bacteriophage 2. Proc. Natl Acad Sci USA
72:3628 3632.
Birnboim HC, Doly J (1979) A rapid alkaline extraction procedure
for screening recombinant plasmid. Nucleic Acids Res
7:1513 1523
Bouanchaud HH, Scavizzi MR, Chabbert YA (1969) Elimination by
ethidium bromide of antibiotic resistance in enterobacteria and
staphylococci. J Gen Microbiol 54:417-425
Broda P (1979) Plasmids. Freeman, San Francisco, pp 23-51
Cohen SN (1976) Transposable genetic elements and plasmid evolu-
tion. Nature 263:731-738

Davis RW, Botstein D, Roth JR (1980) Advanced bacterial genetics.
A manual for genetic engineering. Cold Spring Harbor Laborat-
ory, Cold Spring Harbor, New York
Genilloud O, Garrido MC, Morreno F (1984) The transposon Tn5
carries a bleomycin-resistance determinant. Gene 32:225-233
Haidle CW, Lloyd RS (1979) In: Hahn FE (ed) Bleomycin in anti-
biotics, vol V, part II. Springer, Berlin Heidelberg New York, pp
124-151
Iida S, Meyer J, Arber W (1983) Prokaryotic IS dements. In: Shapiro
JA (ed) Mobile genetic elements. Academic Press, New York, pp
159-221
Innis MA, Gelfand DH, Sninsky JJ, White TJ (1990) PCR protocols:
a guide to methods and applications. Academic Press, San Diego,
Calif
Jalanko A, Palva I, Soederlund H (1981) Restriction maps of plas-
mids pUB110 and pBD9. Gene 14:325 328
Kleckner N (1981) Transposable elements in Prokaryotes. Rev Gen-
et 15:341 404
Kuhl SA, Patee PA, Baldwin JN (1978) Chromosomal map location
of the methicillin resistance determinant in Staphylococcus aure-
us. J Bacteriol 135:460-465.
Lyon BR, Skurray R (1987) Antimicrobial resistance of Staphylococ-
cus aureus: genetic basis. Microbiol Rev 51:88-134
Maina CV, Riggs PD, Grandea III AG, Slatko BE, Moran LS,
Tagliamonte JA, McReynolds LA, Guan CD (1988) An Es-
cherichia coli vector to express and purify foreign proteins by
fusion to and separation from maltose-binding protein. Gene
74:365-373
Mazodier P, Cossart P, Giraud E, Gasser F (1985) Completion of
the nucleotide sequence of the central region of Tn5 confirms the
presence of three resistance gene. Nucleic Acids Res 13:195-205
69
Sanger F, Nivcklen S, Coulson AR (1977) DNA sequencing with
chain-terminating inhibitors. Proc Natl Acad Sci USA
74:5463-5467
Semon D, Movva NR, Smith TF, Alama ME, Davies J (1987)
Plasmid-determined bleomycin resistance in Staphylococcus
aureus. Plasmid 17:46-53
Shalita Z, Murphy E, Novick RP (1980) Penicillinase plasmids of
Staphylococcus aureus: structural and evolutionary relationships.
Plasmid 3:291.-311
Skinner S, Inglis B, Matthews PR, Stewart PR (1988) Mercury and
tetracycline resistance genes and flanking repeats associated with
methicillin resistance on the chromosome of Staphylococcus
aureus. Mol Microbiol 2:289-297
Sugiyama M, Thompson CJ, Kumagai T, Suzuki K, Deblaere R,
Villarroel R, Davies J (1994) Characterisation by molecular clon-
ing of two genes from Streptomyces verticillus encoding resistance
to bleomycin. Gene 151:11-16
Trees DL, Iandolo JJ (1987) Isolation of a transposon (Tn4291) that
codes for resistance to methicillin in Staphylococcus aureus. Abstr
Annu Meet Am Soc Microbiol 87:56
Ubukata K, Nonoguchi R, Matsuhashi M, Song MD, Konno
M (1989) Restriction maps of the regions coding for methicillin
and tobramycin resistances on chromosomal DNA in methicil-
lin-resistant staphylococci. Antimicrob Agents Chemother
33:1624 1626
Umezawa H (1975) Bleomycin. In: Corcoran JW and Hahn FE (eds)
Antibiotics, vol III. Springer, Berlin Heidelberg New York, pp
21-33
Witte W, Green L, Misra TK, Silver S (1986) Resistance to mercury
and to cadmium in chromosomally resistant Staphylococcus
aureus. Antimicrob Agents Chemother 29:663-669