c Indian Academy of Sciences

ONLINE RESOURCES

Isolation and characterization of fteen polymorphic microsatellite loci

for the citrus mealybug, Planococcus citri (Hemiptera: Pseudococcidae),
and cross-amplication in two other mealybug species

RENATA F. MARTINS1 , VERA ZINA2 , ELSA BORGES DA SILVA2 , MARIA TERESA REBELO3 ,
ELISABETE FIGUEIREDO4 , ZVI MENDEL5 , OCTVIO S. PAULO1 ,
JOS CARLOS FRANCO2 and SOFIA G. SEABRA1

1
Computational Biology and Population Genomics Group, Centro de Biologia Ambiental, Departamento de Biologia
Animal, Faculdade de Cincias da Universidade de Lisboa, 1749-016 Lisboa, Portugal
2
Centro de Estudos Florestais, Instituto Superior de Agronomia, 1349-017 Lisboa, Portugal
3
Centro de Estudos do Ambiente e do Mar (CESAM), Departamento de Biologia Animal, Faculdade de Cincias da
Universidade de Lisboa, 1749-016 Lisboa, Portugal
4
Centro de Engenharia dos Biossistemas, Instituto Superior de Agronomia, 1349-017 Lisboa, Portugal
5
Department of Entomology, Agricultural Research Organization, The Volcani Center, P.O. Box 6, Bet Dagan 50250, Israel

[Martins R. F., Zina V., Silva E. B., Rebelo M. T., Figueiredo E., Mendel Z., Paulo O. S., Franco J. C. and Seabra S. G. 2012 Isolation and
characterization of fteen polymorphic microsatellite loci for the citrus mealybug, Planococcus citri (Hemiptera: Pseudococcidae), and cross-
amplication in two other mealybug species. J. Genet. 91, e75e78. Online only: http://www.ias.ac.in/jgenet/OnlineResources/91/e75.pdf]

Introduction Hypervariable molecular markers, namely microsatellites,

The citrus mealybug, Planococcus citri (Risso) is a cos-
mopolitan and polyphagous insect pest mainly of subtrop-
ical fruit trees under Mediterranean climate conditions and
ornamental plants in interior landscapes in cooler zones
(Ben-Dov 1994; Franco et al. 2004). The cryptic behaviour
of mealybug, its typical waxy body cover, and clumped spa-
tial distribution pattern render the use of many insecticides
ineffective. Therefore, there is a need to develop more effec-
tive, species-specic and environmentally safe approaches to
control this pest. Pheromone-based control tactics, such as
male attraction annihilation (mass trapping or lure and kill) or
mating disruption, have been suggested as good alternatives
(Franco et al. 2009). However, the success of pheromone-
based control methods depends on knowledge of mating
system of insect pests (Boake et al. 1996). In this respect,
elucidating the existence of polyandry in a target species is a
critical issue. Recently, behavioural experiments showed that
mealybug females can mate several times, both on the same
day and on days after the initial mating (Waterworth et al.
2011; Silva et al. 2012). Nevertheless, further studies are
needed to conrm mealybug polyandry, aiming to elucidate
if the progeny of multiple-mated mealybug females actually
originate from more than one father.
For correspondence. E-mail: sgseabra@fc.ul.pt.
Keywords. microsatellite; next-generation sequencing; polyandry; Coccoidea; scale insects; Planococcus.
are useful tools in establishing parentage in analysis of
mating systems and have been used in a wide range of
organisms, including insect pests, such as Ceratitis capi-
tata (Wiedemann) and Bactrocera oleae (Rossi) (Bonizzoni
et al. 2002; Augustinos et al. 2008). Until recently, devel-
opment of even a small number of microsatellites was a
time-consuming and expensive technique, but taking advan-
tage of the next-generation sequencing technologies it is
now possible to develop a large set of these markers in a
very short period of time (Abdelkrim et al. 2009; Allentoft
et al. 2009; Gilles et al. 2011). Here, we describe the devel-
opment and characterization of 15 polymorphic microsatel-
lites for P. citri, by applying next-generation sequencing of
enriched genomic libraries, which will be used to inves-
tigate the polyandry hypothesis on mealybug species. We
also tested cross-amplication in two other economically
important cosmopolitan mealybug pests, the vine mealybug,
P. cus (Signoret), and the citrophilus mealybug, Pseudococ-
cus calceolariae (Maskell) (Ben-Dov 1994; Zada et al. 2008;
El-Sayed et al. 2010).
Materials and methods
For the microsatellite development, we pooled DNA from
10 individuals sampled from ve Portuguese populations,

Journal of Genetics Vol. 91, Online Resources e75

 Renata F. Martins et al.
extracted with E.Z.N.A. R
Tissue DNA Isolation kit
(Omega, Norcross, USA) following manufacturers pro-
tocol. High molecular weight and nal concentration
were veried in a 0.5% agarose gel, stained with
20,000 Red SafeTM Nucleic Acid Staining Solution
(iNtRON Biotechnology, Kyungki-do, Korea) and conrmed
with NanoDropTM 1000 Spectrophotometer v3.7 (Thermo
Scientic, Wathlam, USA).
Isolation of microsatellites was carried out by GenoScreen
(Lille, France) (http://www.genoscreen.fr/) using 454 GS-
FLX R
technology (Roche, Branford, USA). After genomic
DNA fragmentation, DNA libraries highly enriched with
microsatellites were prepared using the probes with the
repetitions TG, TC, AAC, AAG, AGG, ACG, ACAT and
ACTC. Sequencing was performed in a quarter of a run on
a Titanium R
plate, generating about 40 million basepair of
data, each read with an average length of 220.49 bp. A total
of 19,265 good-quality sequences were obtained, of which
4156 contained microsatellite motifs. Primer pairs were val-
idated bioinformatically for 504 of these and 24 pairs were
selected for PCR amplication in seven samples of P. citri.
Validation of correct amplication was performed in a 2%
agarose gel and all primer pairs were amplied in most sam-
ples. From these, 16 (showing a clear band in all individuals)
were selected for polymorphism testing in our laboratory and
only one was revealed to be monomorphic, leaving a nal set
of 15 polymorphic markers.
Individuals from eight different populations, ve from
Portugal (Silves, Mafra, Agualva, Tavira and Camarate) and
three from Israel (Shilat, Iron and Yotveta), were sampled
alive and kept under controlled laboratory conditions for the
experimental crosses. For the genetic variability and poly-
morphism test, two individuals from each population were
used, in a total of 16 individuals, which were kept in abso-
lute ethanol at 4 C. For the paternity tests, virgin females
were chosen from two Portuguese populations (Silves and
Agualve) to mate with a unique male and the progeny result-
ing from these crosses was also sampled, in a total of seven
crosses and two individuals from the F1 progeny (one male
and one female). Additionally, six individuals of P. cus,
sampled from Italy (Sicily), Spain (Murcia) and Portugal
(Tavira), and two individuals of P. calceolariae, sampled
from a Portuguese population (Loul) were included. DNA
extraction was performed with E.Z.N.A. R
Tissue DNA Iso-
lation kit (Omega, Norcross, USA) following manufacturers
protocol.
Amplication of microsatellite loci was performed using
the M13-tailed primer protocol for uorescence labelling of
PCR fragments (Schuelke 2000). Each of the forward pri-
mers were 5 tailed with the M13 (uni-43) tail sequence 5-
AGGGTTTTCCCAGTCACGACGTT-3 (Venkatesan et al.
2007) which hybridize with a uorescence labelled M13
(uni-43) primer. Polymerase chain reactions (PCR) pro-
ceeded in a nal volume of 10 L, with 0.5 L of
DNA (1070 ng/mL), 0.025 U of GoTaq DNA polymerase
(Promega, Madison, USA), 1 Colorless GoTaq Flexi
Journal of Genetics Vol. 91, Online Resources
Buffer, 0.2 mM of dNTPs, 2 mM of MgCl2 , 0.1 M of the
forward primer, containing the 5 tail sequence, 0.25 M of
the reverse primer and 0.25 M of each 5 uorescent primer
(labelled with HEX or FAM), according to the following pro-
tocol: an initial denaturation step at 94 C for 5 min, followed
by 10 cycles for tail binding of 94 C for 30 s, 60 C for 1 min,
72 C for 1 min. Primer annealing followed in 25 cycles of
94 C for 30 s, 55 C for 1 min and 72 C for 30 s with a
nal extension step of 72 C for 10 min. PCR products were
checked to conrm correctly sized products on 0.5% agarose
gels, stained with Red Safe.
Microsatellites were genotyped in an ABI PRISM 310
Genetic Analyser (Applied Biosystems, Carlsbad, USA) with
GeneScan Rox Size Standard (Applied Biosystems, Carls-
bad, USA) as internal size standard. Microsatellite loci were
scored using GeneMapper v4 (Applied Biosystems, Carls-
bad, USA). Numbers of alleles, expected and observed het-
erozygosities and FIS were obtained with GENETIX v4.05.2
(Belkhir et al. 19962004) and deviations from Hardy
Weinberg equilibrium (HWE) were tested in GENEPOP
4.1.2 (Rousset 2008).
Results and discussion
In a total of 16 individuals of P. citri genotyped for primer
testing, 15 polymorphic loci showed variable number of alle-
les, ranging from 2 to 7 with a mean of 3.1 (table 1). Expected
and observed heterozygosity for each locus ranged from
0.1172 to 0.8027 and from 0.1210 to 0.8286, respectively. FIS
values were signicantly deviated from HWE for 11 of the
15 microsatellite loci, probably due to data structuring, since
individuals from two signicantly distant geographic areas
were used. When testing HWE within samples from each
of the two regions, only Portugal showed relatively low and
nonsignicant FIS values and Israel showed generally high
and, in some loci, signicant FIS values (table 1). Even with
a smaller sample size from Israel than from Portugal, most
loci (13 out of 15) had higher or equal number of alleles in
Israel than in Portugal. The heterozygote decits found may
also be due to inbreeding in the populations studied.
For the experimental crosses, eight loci (Pci-6, Pci-7, Pci-
9, Pci-14, Pci-16, Pci.17, Pci-20, and Pci-24) were chosen as
they were polymorphic in the Portuguese populations. From
these, four were polymorphic within each cross, being able
to distinguish between female and male progenitor and thus
perceiving male contribution to the progeny.
Cross-amplication on P. cus and P. calceolariae was
tested and we were able to correctly amplify eight loci (Pci-2,
Pci-6, Pci-8, Pci-16, Pci-17, Pci-20, Pci-22 and Pci-24) and
three loci (Pci-6, Pci-8 and Pci-16), in each species respec-
tively (table 2), with the same PCR conditions as described
above.
The microsatellite isolation method used here was found
to be more rapid, efcient and less expensive than traditional
cloning methods. Overall, these microsatellite markers show
e76
 Table 1. Characterization of 15 polymorphic microsatellite loci in the citrus mealybug, Planococcus citri.

Geographical location
GenBank Size Portugal Israel
accession Repeat range Total
Locus number Primer sequence (53) motif (bp) Na Na Ho He FIS Na Ho He FIS

Pci-1 JQ812723 F: GGAGTTTCATCATCGCGTTC (TGG)8 106121 2 1 2 0.3333 0.5455 0.4667

R: GCCAATGAAGCTGACCTAGA
Pci-2 JQ812724 F: TCAATTCGCGAGGAATTAGG (GGA)11 100124 2 1 2 0.5000 0.5303 0.0686
R: CGAGTGCAAACAACCGGTAA
Pci-6 JQ812725 F: AGGTGGAGGTACCAATGTATGTG (TCG)9 141177 4 2 0.3000 0.3947 0.2667 4 0.3333 0.6667 0.4667*
R: CAGCAAACAAGGAGAAAACTACG
Pci-7 JQ812726 F: GCCGTACGAAACCTTGTTTG (AAG)8 158164 3 3 0.5714 0.6044 0.0317 2 0.2000 0.2000
R: TCGGTCTCTTGGTACTTGGTC
Pci-8 JQ812727 F: CAGATTGCTTATCATCCATCCA (ATTG)8 162170 2 1 2 0.0000 0.4848 1.2000*
R: CGACGACCTCTGCAAAGTATG
Pci-9 JQ812728 F: AGCTGAGTTACCTACGCGAGA (CAGG)7 162170 2 2 0.1000 0.1000 2 0.1667 0.5303 0.8229
R: CGGCACACTTCGATACCTTT
Pci-10 JQ812729 F: AAGCTGAGGTTGGACCAGAA (TGT)9 176179 2 1 2 0.3333 0.3030 0.1200
R: TCGTATTTATGTGCCGCATC
Pci-12 JQ812730 F: GCAGCTCCAGCAAAATTACC (GAC)10 190196 3 1 3 0.0000 0.6667 1.2000**
R: ATCGTATTCGCATCGCCTC
Pci-14 JQ812731 F: AACGGAAGATGAAGATGATGC (GAA)9 187231 5 3 0.6000 0.6842 0.0764 3 0.3333 0.5455 0.5125
R: CCTGCAGATGTCATTGGTGA
Pci-16 JQ812732 F: GTTTTCGATCTCCTCGATACG (ACG)9 197233 7 4 0.6842 0.6500 0.0388 4 0.667 0.8030 0.2222

Journal of Genetics Vol. 91, Online Resources

R: ATTTCAGCATCGTTTACGCC
Pci-17 JQ812733 F: ACTGAATAGATGTGGCTCTGTGA (GTT)9 211223 4 3 0.2000 0.1947 0.0031 3 0.3333 0.5455 0.5125
R: TCAATATCGCAAGTCCATGA
Isolation of microsatellite loci in Planococcus citri

Pci-20 JQ812734 F: CGAACGCTAAGCGGGTATAA (AGG)8 253256 2 2 0.1000 0.1000 2 0.0000 0.4848 1.2000*
R: CGCGCTCACTTTAGTGGTTT
Pci-21 JQ812735 F: GCAGGATTAAATTGCCTCCA (CGT)7 314344 3 1 3 0.0000 0.3030 1.2000
R: CGACAACGAGAGCTTAACAGG
Pci-22 JQ812736 F: CCGGCATTACTCATTCAAGT (ACA)8 316319 2 1 2 0.0000 0.3030 1.2000
R: TGGATGTTTGCTCAGTACTTCTGT
Pci-24 JQ812737 F: GCTCATTGCAGTACCAAGTACG (GTC)8 190196 3 3 0.4000 0.4684 0.1159 1
R: GAGATCACGTGTAATGCATCG

Na , number of alleles; Ho , observed heterozygosity; He , expected heterozygosity. *P value < 0.05; **P value < 0.01.

e77
 Renata F. Martins et al.

Table 2. Allele size range and number of alleles (Na ) for the Interactions, CNRS UMR 5000, Universit de Montpellier II,
microsatellite loci amplied in Planococcus cus and Pseudococcus Montpellier, France.
calceolariae. Ben-Dov Y. 1994 A systematic catalogue of the mealybugs of the
world (Insecta: Homoptera: Coccoidea: Pseudoccocidae and
Planococcus Pseudococcus Putoidae) with data on their geographical distribution, host
cus calceolariae plants, biology and economic importance. Intercept, Andover,
UK.
Locus Na Size range (bp) Na Size range (bp) Boake C. R. B., Shelly T. E. and Kaneshiro K. Y. 1996 Sexual
selection in relation to pest-management strategies. Annu. Rev.
Pci-2 1 112 Entomol. 41, 211229.
Pci-6 1 159 2 159177 Bonizzoni M., Katsoyannos B. I., Marguerie R., Guglielmino C. R.,
Pci-8 3 146170 1 170 Gasperi G., Malacrida A. and Chapman T. 2002 Microsatellite
Pci-16 3 206218 2 206215 analysis reveals remating by wild Mediterranean fruit y females,
Pci-17 1 214 Ceratitis capitata. Mol. Ecol. 11, 19151921.
Pci-20 1 262 El-Sayed A., Unelius C. R., Twidle A., Mitchell V., Manning
Pci-22 2 310313 L., Cole L. et al. 2010 Chrysanthemyl 2-acetoxy-3-methyl-
Pci-24 2 193196 betanoate: the sex pheromone of the citrophilous mealybug,
Pseudococcus calceolariae. Tetrahedron Lett. 51, 10751078.
Franco J. C., Suma P., Silva E. B., Blumberg D. and Mendel
Z. 2004 Management strategies of mealybug pests of citrus in
Mediterranean countries. Phytoparasitica 32, 507522.
suitable resolution for our aims in following studies and in Franco J. C., Zada A. and Mendel Z. 2009 Novel approaches for the
the near future should be able to give us insight into the management of mealybug pests. In Biorational control of arthro-
genetic variability, gene ow and mating system of the citrus pod pests: application and resistance management (ed. I. Ishaaya
and A. R. Horowitz), pp. 233278. Springer, Berlin, Germany.
mealybug. Gilles A., Meglcz E., Pech N., Ferreira S., Malausa T. and Martin J.
2011 Accuracy and quality assessment of 454 GS-FLX Titanium
pyrosequencing. BMC Genomics 12, 245.
Acknowledgements
Rousset F. 2008 Genepop 007: a complete reimplementation of the
Genepop software for Windows and Linux. Mol. Ecol. Res. 8,
This work was funded by Fundao para a Cincia e a Tecnologia,
103106.
Portugal (project PTDC/AGR-AAM/099560/2008).
Schuelke M. 2000 An economic method for the uorescent labeling
of PCR fragments. Nat. Biotechnol. 18, 233234.
Silva E. B., Branco M., Mendel Z. and Franco J. C. 2012 Mat-
References ing behavior and performance in the two cosmopolitan mealy-
bug species Planococcus citri and Pseudococcus calceolar-
Abdelkrim J., Robertson B., Stanton J. L. and Gemmell N. 2009 iae (Hemiptera: Pseudococcidae). J. Insect Behav. (in press;
Fast, cost-effective development of species-specic microsatel- doi:10.1007/s10905-012-9344-6).
lite markers by genomic sequencing. BioTechniques 46, 185192. Venkatesan M., Hauer M. C. and Rasgon J. L. 2007 Using uores-
Allentoft M., Schuster S., Holdaway R., Hale M., McLay E., cently labeled M13-tailed primers to isolate 45 novel microsatel-
Oskam C. et al. 2009 Identication of microsatellites from an lite loci from the arboviral vector Culex tarsalis. Med. Vet.
extinct moa species using high-throughput (454) sequence data. Entomol. 21, 204208.
BioTechniques 46, 195200. Waterworth R. A., Wright I. M. and Millar J. G. 2011 Reproductive
Augustinos A., Stratikopoulos E., Drosopoulou E., Kakani E. and biology o the three cosmopolitan mealybug (Hemiptera: Pseu-
Mavragani-Tsipidou P. 2008 Isolation and characterization of dococcidae) species, Pseudococcus longispinus, Pseudococcus
microsatellite markers from the olive y, Bactrocera oleae, and viburni, and Planococcus cus. Ann. Entomol. Soc. Am. 104,
their cross-species amplication in the Tephritidae family. BMC 249260.
Genomics 9, 618. Zada A., Dunkelblum E., Assael F., Franco J. C., Silva E. B., Pro-
Belkhir K., Borsa P., Chikhi L., Raufaste N. and Bonhomme F. tasov A. and Mendel Z. 2008 Attraction of Planococcus cus
19962004 GENETIX 4.05, logiciel sous Windows TM pour males to racemic and chiral pheromone baits: ight activity and
la gntique des populations. Laboratoire Gnome, Populations, bait longevity. J. Appl. Entomol. 132, 480489.

Received 14 February 2012, accepted 18 April 2012

Published on the Web: 13 July 2012

Journal of Genetics Vol. 91, Online Resources e78