J Gen Plant Pathol (2011) 77:239242
DOI 10.1007/s10327-011-0314-1
FUNGAL DISEASES
Characterization of Inago1 and Inago2 retrotransposons
in Magnaporthe oryzae
Edmundo Sanchez Jr. Kozo Asano
Teruo Sone
Received: 4 June 2010 / Accepted: 23 March 2011 / Published online: 26 April 2011
The Phytopathological Society of Japan and Springer 2011
Abstract From the genome of a Japanese field isolate of
the rice blast fungus, Magnaporthe oryzae, we newly
identified Inago1 and Inago2 LTR retrotransposons. Both
elements were found to be Ty3/gypsy-like elements whose
copies were dispersed within the genome of Magnaporthe
spp. isolates infecting rice and other monocot plants.
Southern hybridization patterns of nine re-isolates derived
from conidia of the strain Ina168 produced after a methyl
viologen treatment were not changed, indicating that the
insertion pattern of Inago elements is relatively stable.
Keywords Magnaporthe oryzae  Retrotransposon 
Ty3/gypsy-like elements
The ascomycete fungus Magnaporthe oryzae (Couch) is
the causal agent of the rice blast disease, the most devas-
tating disease of the rice crop. One of the striking features
of the genome of M. oryzae is the abundance of repetitive
sequences such as transposable elements, occupying 7.34%
of the sequence (Dean et al. 2005). Ten elements of class I
retrotransposons and three different elements of class II
DNA transposons, including some elements that have not
yet been described in detail, have been reported (Dean
et al. 2005).
These transposable elements participate as driving forces
of spontaneous mutations, which produce new pathotypes
E. Sanchez Jr.
Graduate School of Agriculture, Hokkaido University,
Kita-9, Nishi-9, Kita-ku, Sapporo 060-8589, Japan
K. Asano  T. Sone (&)
Research Faculty of Agriculture, Hokkaido University,
Kita-9, Nishi-9, Kita-ku, Sapporo 060-8589, Japan
e-mail: sonet@chem.agr.hokudai.ac.jp
and drug resistance, challenging the control of the blast
disease. For example, natural insertions of the DNA trans-
poson Pot3 into host specificity genes AVR-Pita and AVR-
Piz-t resulted in a gain in the range of host-cultivar virulence
(Kang et al. 2001). Insertion of the MINE retrotransposon
into ACE1, the avirulence gene toward Pi33, resulted in the
loss of function of the gene in the virulent parent 2/0/3 (Fudal
et al. 2005).
MAGGY (Farman et al. 1996) is the only retrotranspo-
son whose transposition has been artificially induced in
M. oryzae. The element, when introduced into a wheat-
invading isolate that did not naturally conserve any copies
of MAGGY, was reported to transpose new copies after
regeneration of spheroplasts (Nakayashiki et al. 1999,
2001). It was also revealed that the propagation of
MAGGY is repressed in the wheat isolates genome, as its
copy number per genome reaches a threshold. This copy-
number repression is partially carried out by methylation
and siRNA-dependent gene silencing (Murata et al. 2007).
However, there has been no such report about the trans-
position of retrotransposons under laboratory conditions for
rice-pathogenic strains of M. oryzae. Nishimura et al.
(2000) reported the transposition of MGL, a LINE (long
interspersed element)-like retrotransposon, into the Acr
gene among the progeny from a cross between rice-path-
ogenic strains. This finding suggests that there might be
specific conditions wherein retroelements can be inserted
into the genome and that they may be interesting targets for
phytopathological research to overcome mutations in
pathogens. Identifying novel retroelements and studying
their activities will contribute to the elucidation of the
nature of retrotransposons in M. oryzae rice pathogens.
In the present study, we newly identified retrotrans-
posons Inago1 and Inago2 in shot-gun genome sequence
data of M. oryzae Japanese field isolate 9439009. In
123
240 J Gen Plant Pathol (2011) 77:239242

phylogenetic analyses of pol amino acid sequences of these Nakayashiki et al. 2001). We thus checked for conservation
retroelements and some known elements using the neigh- of Inago1 and Inago2 among various strains of M. oryzae
bor-joining method (Fig. 1a), we showed that these two and M. grisea (Table 1) using Southern hybridization and
elements have high similarity to each other and clustered the probes pING1 and pING2, that we designed for the gag
with MGLR-3 element (Kang 2001). In addition, weak genes of Inago1 and Inago2, respectively (Fig. 2). Double
relationships with MAGGY, Grasshopper (Dobinson et al. digestion by restriction enzymes, which does not cut inside
1993), and REAL (Kaneko et al. 2000) elements, that are the repetitive elements, produced well-separated bands in
Ty3/gypsy retrotransposons, were detected, indicating that the hybridization results. The combination of EcoRI ?
the two elements are also members of the Ty3/gypsy SphI and BamHI ? SphI for use with Inago1 and Inago2,
family of retrotransposons. Pfam conserved domain respectively, resulted in bands that ranging from 1 to
retrieval revealed a zf-CCHC domain at the C-terminal of 10 kbp. More than 20 hybridization bands of both elements
the gag polyprotein, RVT1, rve, and Chromo domains in were found in rice-pathogenic isolates, and variations in the
pol polyprotein of both elements. A zf-H2C2 domain was number of bands in the strains isolated from other plants
retrieved from Inago2 pol polyprotein (Fig. 1b). Inago1 were also detected. For Inago1 detected in pathogens of
and Inago2 sequences did not have significant homology at Eleusine corocana, the number of bands was limited to ca.
the full-length DNA sequence level (56.0%). The sequen- 10 (Fig. 2a), but was less than 20 for Inago2. The mini-
ces of Inago1 and Inago2 were deposited into the DDBJ/ mum number of bands was 4 in pathogens of Digitaria
EMBL GenBank database under accession numbers
AB334124 and AB334125, respectively. Table 1 Magnaporthe field isolates used in this study
Host species-specific conservation has been reported for No. Species Host Isolate Locality
retrotransposons in M. oryzae that have so far been iden-
tified (Dobinson et al. 1993; Eto et al. 2001; Farman et al. 1 M. oryzae Oryza sativa 9439009a Japan
1996; Hamer et al. 1989; Kachroo et al. 1995; Kang 2001; 2 Ina72b Japan
3 Ina168b Japan
c
4 Ken54-04 Japan
0.05
5 Hoku 1b Japan
a Gypsy (Drosophila melanogaster)
6 Guy11d French Guiana
816 Sushi (Takifugu rubripes)
824
marY1 (Tricholoma matsutake) 7 Setaria italica GFSI1-7-2e Japan
1000 MGLR-3
1000 Inago2 8 NRSI2-2-2e Japan
541 Inago1 e
797 MAGGY 9 Panicum miliaceum NNPM1-2-1 Japan
998 Grasshopper 10 STPM4-2-2e Japan
932 REAL (Alternaria alternata)
1000 CfT-1 (Cladosporium fulvum) 11 Elusine coracana Ken15-15-1e Japan
Skippy (Fusarium oxysporum)
921
1000
1000 Pyret 12 SZEC1-1-1e Japan
Cgret (Colletotrichum gloeosporioides)
Tf1 (Schizosaccharomyces pombe) 13 Lolium perenne TP1e Japan
Ty3 (Saccharomyces cerevisiae) e
14 FI5 Japan
1 kb
15 M. grisea Digitaria sanguinalis Dig4-1e Japan
b Inago1 16 NI907e Japan
gag pol 6104 bp a
Gift from Dr. M. Iwano
pING1 b
Gift from Dr. S. Kiyosawa
Inago2
c
gag Gift from Dr. Y. Fujita
pol 5866 bp
d
pING2
Gift from Dr. J. L. Notteghem
e
Gift from Dr. H. Nakayashiki
LTR Zf-CCHC RVT1 Zf-H2C2 rve Chromo

Fig. 1 Structure of Inago1 and Inago2 retrotransposons. a Phyloge-

netic relationship of pol amino acid sequences of the Inago elements
with those of known retrotransposons. Sequence alignment and Table 2 Oligonucleotide primers and probes used in this study
neighbor-joining phylogenetic analysis were performed with the
CLUSTAL X program (Thompson et al. 1997). Bootstrap value for Target Application Name Sequence (50 30 )
1,000 iterations is indicated on each clade. b Schematic illustration of
Inago1 Subcloning Inago1F AGCCCACCGATTCGCC
Inago elements. Open reading frames are indicated with open arrows,
and protein motifs identified with a Pfam search are represented by Inago1R2 CCGAATCCGACGAAGTTGAG
boxes within the arrows. Total length of each element is given on the Inago2 Subcloning Inago2F CTGAAGGACCACCCACCTGC
right. Solid arrows show the LTR sequences. DNA fragments cloned Inago2R2 TTTGGAATTATGGCCACCCC
in the plasmids as hybridization probes are underlined with gray

123
J Gen Plant Pathol (2011) 77:239242 241

a Eco RI-Sph I-digested DNA / Inago1 b Sph I-Bam HI-digested DNA / Inago2

Os Si Pm Ec Lp Ds Os Si Pm Ec Lp Ds
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16

(kbp)
23.1

9.4
6.6

4.3

2.3
2.0

Fig. 2 Conservation of the Inago1 and Inago2 retrotransposons
among various isolates of Magnaporthe spp. Restriction enzyme-
digested chromosomal DNA of each strain was blotted onto a
membrane and hybridized with pING1 for Inago1 (a) or pING2 for
Inago2 (b). Probe DNA fragments were amplified using primers listed
in Table 2 and subcloned into pGEM-T easy (Promega, Madison, WI,
USA). An AlkPhos direct nucleic acids labeling and detection system
(GE Healthcare, Buckinghamshire, UK) was used. Lane numbers
correspond to the strain number in Table 1. Letters above lane
numbers indicate the host of each isolate. Os Oryza sativa, Si Setaria
italica, Pm Panicum miliaceum, Ec Eleusine coracana, Lp Lolium
perenne, Ds Digitaria sanguinalis. Sizes are given in kb

Fig. 3 Changes in Inago1

hybridization patterns of single
conidium re-isolates after
methyl viologen (MV)
treatment. DNA of nine
re-isolates from untreated
culture (untreated) and nine
re-isolates from 10 mM
MV-treated culture were
digested, blotted and hybridized
with pING1. Control lane
(C) contains the DNA extracted
from Ina168 stock culture from
which the rest of the re-isolates
were obtained. Sizes are given
in kb

sanguinalis (Fig. 2b), which have been classified as M.
grisea (Couch and Kohn 2002). Kato et al. (2000), how-
ever, found that Eleusine isolates are ancestors of M. ory-
zae in a study of the pathogenicity, mating ability and
restriction fragment length polymorphisms of Magnapor-
the populations isolated from 85 species of Graminae,
Bambusidae, and Zingiberaceae. These studies and the
results in the present study indicate that the ancestors of
Inago1 and Inago2 were caught in the genome of the
Magnaporthe ancestor at a certain time during evolution
and may have propagated after Magnaporthe diverged into
two species, M. grisea and M. oryzae (Couch and Kohn
2002). The propagation of Inago1 happened independently
in M. grisea (Digitaria pathogens) and in M. oryzae except
for the Eleusine pathogens, whereas the propagation of
Inago2 occurred only in M. oryzae, but the speed of
propagation in M. oryzae was faster in pathogens except for
those of Eleusine.
Stability of Inago1 and Inago2 was then assessed by
Southern hybridization. A piece of the mycelia of strain
Ina168 grown for 3 days in liquid medium (2YEG, 2 g/L
yeast extract and 10 g/L glucose) was placed on an oatmeal
agar (oatmeal 50 g/L, sucrose 20 g/L and agar 35 g/L)
plate and incubated for 10 days at 25C with continuous

123
242
light to enhance the formation of conidia. At the same time,
mycelia in the same liquid culture were exposed to 10 mM
methyl viologen hydrate (MV; Sigma-Aldrich, St. Louis,
MO, USA), which is known to induce oxidative stress,
transcription of MAGGY elements (Ikeda et al. 2001) and
DNA recombinational repair genes (Elegado et al. 2006),
and some of this mycelia was then transferred to an oat-
meal agar plate. Nine conidia were individually transferred
from each oatmeal agar plate onto prune agar slants, and
DNA was extracted from each culture. Extracted DNA of
each re-isolate was used in Southern analysis, under the
same conditions as in Fig. 2 (Fig. 3). Southern hybridiza-
tion did not show any visible insertion of new bands in the
hybridization patterns of the 10 mM MV-treated re-isolates
in comparison with the untreated samples of both Inago1
(Fig. 3) and Inago2 (data not shown). These results indi-
cate that the insertion pattern of both elements was rela-
tively stable.
Quantification of the transcripts of the Inago elements
under liquid culture with or without stresses has so far been
unsuccessful due to high copy numbers in the genome.
Therefore, it was impossible to conclude anything about
the factor responsible for the stability of the insertion
pattern. Further analyses on the expression of both ele-
ments are necessary to elucidate the mechanism underlying
this stability.
Acknowledgments This study was supported in part by Grants-in-
Aid for Regional R&D Proposal-Based Program from Northern
Advancement Center for Science and Technology of Hokkaido,
Japan. We thank Drs. M. Iwano, S. Kiyosawa, J. L. Notteghem and H.
Nakayashiki for the field isolates.
References
Couch BC, Kohn LM (2002) A multilocus gene genealogy concor-
dant with host preference indicates segregation of a new species,
Magnaporthe oryzae, from M. grisea. Mycologia 94:683693
Dean RA, Talbot NJ, Ebbole DJ, Farman ML, Mitchell TK, Orbach
MJ, Thon M, Kulkarni R, Xu JR, Pan H, Read ND, Lee YH,
Carbone I, Brown D, Oh YY, Donofrio N, Jeong JS, Soanes DM,
Djonovic S, Kolomiets E, Rehmeyer C, Li W, Harding M, Kim
S, Lebrun MH, Bohnert H, Coughlan S, Butler J, Calvo S, Ma
LJ, Nicol R, Purcell S, Nusbaum C, Galagan JE, Birren BW
(2005) The genome sequence of the rice blast fungus Magna-
porthe grisea. Nature 434:980986
Dobinson KF, Harris RE, Hamer JE (1993) Grasshopper, a long
terminal repeat (LTR) retroelement in the phytopathogenic
fungus Magnaporthe grisea. Mol Plant Microbe Interact
6:114126
Elegado E, Iwasaki A, Sales M, Ishii C, Tomita F, Sone T (2006)
Oxidative stress induces high transcription of Rhm52 and Rhm54,
novel genes identified as being involved in recombinational repair
in Magnaporthe grisea. J Gen Plant Pathol 72:1619
123
J Gen Plant Pathol (2011) 77:239242
Eto Y, Ikeda K, Chuma I, Kataoka T, Kuroda S, Kikuchi N, Don LD,
Kusaba M, Nakayashiki H, Tosa Y, Mayama S (2001) Compar-
ative analyses of the distribution of various transposable
elements in Pyricularia and their activity during and after the
sexual cycle. Mol Gen Genet 264:565577
Farman ML, Tosa Y, Nitta N, Leong SA (1996) MAGGY, a
retrotransposon in the genome of the rice blast fungus, Magna-
porthe grisea. Mol Gen Genet 251:665674
Fudal I, Bohnert HU, Tharreau D, Lebrun MH (2005) Transposition
of MINE, a composite retrotransposon, in the avirulence gene
ACE1 of the rice blast fungus Magnaporthe grisea. Fungal Genet
Biol 42:761772
Hamer JE, Farrall L, Orbach MJ, Valent B, Chumley FG (1989) Host
species-specific conservation of a family of repeated DNA
sequences in the genome of a fungal plant pathogen. Proc Natl
Acad Sci USA 86:99819985
Ikeda K, Nakayashiki H, Takagi M, Tosa Y, Mayama S (2001) Heat
shock, copper sulfate and oxidative stress activate the retro-
transposon MAGGY resident in the plant pathogenic fungus
Magnaporthe grisea. Mol Genet Genomics 266:318325
Kachroo P, Leong SA, Chattoo BB (1995) Mg-SINE: a short
interspersed nuclear element from the rice blast fungus, Mag-
naporthe grisea. Proc Natl Acad Sci USA 92:1112511129
Kaneko I, Tanaka A, Tsuge T (2000) REAL, an LTR retrotransposon
from the plant pathogenic fungus Alternaria alternata. Mol Gen
Genet 263:625634
Kang S (2001) Organization and distribution pattern of MGLR-3, a
novel retrotransposon in the rice blast fungus Magnaporthe
grisea. Fungal Genet Biol 32:1119
Kang S, Lebrun MH, Farall L, Valent B (2001) Gain of virulence
caused by insertion of a Pot3 transposon in a Magnaporthe
grisea avirulence gene. Mol Plant Microbe Interact 14:671674
Kato H, Yamamoto M, Yamaguchi-Ozaki T, Kadouchi H, Iwamoto
Y, Nakayashiki H, Tosa Y, Mayama S, Mori N (2000)
Pathogenicity, mating ability and DNA restriction fragment
length polymorphisms of Pyricularia populations isolated from
Graminae, Bambusidae, and Zingiberaceae plants. J Gen Plant
Pathol 66:3047
Murata T, Kadotani N, Yamaguchi M, Tosa Y, Mayama S,
Nakayashiki H (2007) siRNA-dependent and -independent
post-transcriptional cosuppression of the LTR-retrotransposon
MAGGY in the phytopathogenic fungus Magnaporthe oryzae.
Nucleic Acids Res 35:59875994
Nakayashiki H, Kiyotomi K, Tosa Y, Mayama S (1999) Transposition
of the retrotransposon MAGGY in heterologous species of
filamentous fungi. Genetics 153:693703
Nakayashiki H, Matsuo H, Chuma I, Ikeda K, Betsuyaku S, Kusaba
M, Tosa Y, Mayama S (2001) Pyret, a Ty3/Gypsy retrotrans-
poson in Magnaporthe grisea contains an extra domain between
the nucleocapsid and protease domains. Nucleic Acids Res
29:41064113
Nishimura M, Hayashi N, Jwa N-S, Lau GW, Hamer JE, Hasebe A
(2000) Insertion of the LINE retrotransposon MGL causes a
conidiophore pattern mutation in Magnaporthe grisea. Mol Plant
Microbe Interact 13:892894
Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG
(1997) The CLUSTAL_X windows interface: Flexible strategies
for multiple sequence alignment aided by quality analysis tools.
Nucleic Acids Res 25:48764882