Pregnancy Impairs the Innate Immune

Resistance to Salmonella typhimurium

This information is current as
of November 24, 2017.
Leading to Rapid Fatal Infection
Branka Pejcic-Karapetrovic, Komal Gurnani, Marsha S.
Russell, B. Brett Finlay, Subash Sad and Lakshmi Krishnan
J Immunol 2007; 179:6088-6096; ;
doi: 10.4049/jimmunol.179.9.6088
http://www.jimmunol.org/content/179/9/6088

Downloaded from http://www.jimmunol.org/ by guest on November 24, 2017

Why The JI?
Rapid Reviews! 30 days* from submission to initial decision
No Triage! Every submission reviewed by practicing scientists
Speedy Publication! 4 weeks from acceptance to publication
*average

References This article cites 56 articles, 23 of which you can access for free at:
http://www.jimmunol.org/content/179/9/6088.full#ref-list-1
Subscription Information about subscribing to The Journal of Immunology is online at:
http://jimmunol.org/subscription
Permissions Submit copyright permission requests at:
http://www.aai.org/About/Publications/JI/copyright.html
Email Alerts Receive free email-alerts when new articles cite this article. Sign up at:
http://jimmunol.org/alerts

The Journal of Immunology is published twice each month by

The American Association of Immunologists, Inc.,
1451 Rockville Pike, Suite 650, Rockville, MD 20852
Copyright 2007 by The American Association of
Immunologists All rights reserved.
Print ISSN: 0022-1767 Online ISSN: 1550-6606.
 The Journal of Immunology

Pregnancy Impairs the Innate Immune Resistance to

Salmonella typhimurium Leading to Rapid Fatal Infection1

Branka Pejcic-Karapetrovic,2,3 Komal Gurnani,3* Marsha S. Russell,* B. Brett Finlay,

Subash Sad,* and Lakshmi Krishnan4*
Typhoid fever and gastroenteritis caused by Salmonella enterica species are increasing globally. Pregnancy poses a high risk,
but it is unclear how maternal immunity to infection is altered. In mice, susceptible strains die of S. enterica serovar
typhimurium (ST) infection within 7 days whereas resistant mice (1291/SvJ) develop a chronic infection. We found that
virulent ST infection during pregnancy, in normally resistant 1291/SvJ mice, evoked 100% fetal loss and surprisingly
>60% host fatality, with a median survival of 6 days. Splenic bacterial load was 1000-fold higher in pregnant mice. This
correlated to a diminished splenic recruitment/expansion of innate immune cells: dendritic cells, neutrophils, and NK cells.
In particular, the splenic expansion and activation of NK cells postinfection seen in nonpregnant mice was lacking in

Downloaded from http://www.jimmunol.org/ by guest on November 24, 2017

pregnancy. Most notably, pregnant-infected mice had decreased production of serum IL-12 and increased IL-6 levels.
Moreover, uteroplacental tissue of pregnant-infected mice exhibited an 40-fold increase in IL-6 mRNA expression relative
to noninfected placenta, whereas IL-12p40 was not increased. In vivo blocking of IL-6 significantly reduced the splenic
bacterial burden in pregnant mice yet failed to prevent fetal loss. Fetal demise correlated to the rapidity of infection; by 14 h,
ST expanded to >105 in the placenta and had reached the fetus. Therefore, the preferential placental expansion of ST
plausibly altered the inflammatory response toward IL-6 and away from IL-12, reducing the recruitment/activation of
splenic innate immune cells. Thus, highly virulent pathogens may use placental invasion to alter systemic host resistance to
infection. The Journal of Immunology, 2007, 179: 6088 6096.

S almonella enterica serovars are Gram-negative bacteria
that can cause systemic infection and enteritidis. Typhoid
fever in humans caused by S. enterica serovar typhi con-
tributes to 600,000 deaths per year. S. enterica serovar typhi-
murium (ST)5 induces gastroenteritis in humans, as well as live-
stock, and is a major foodborne pathogen in the developed world
(1). The mouse model of ST infection mimics human typhoid,
causing disseminated disease in many peripheral organs including
spleen, liver, and lymph nodes (2). The genetic background of the
mice strongly influences outcome of infection; C57BL/6 mice suc-
cumb within 7 days even to a low dose, whereas 1291/SvJ mice
develop a chronic infection that lasts 60 90 days. Susceptibility of
C57BL6/J mice has been attributed to a mutation in the NRAMP
*National Research CouncilInstitute for Biological Sciences, Ottawa, Ontario, Can-
ada; Department of Biochemistry, Microbiology, and Immunology, University of
Ottawa, Ottawa, Ontario, Canada; and Michael Smith Laboratories, University of
British Columbia, Vancouver, British Columbia, Canada
Received for publication July 30, 2006. Accepted for publication August 18, 2007.
The costs of publication of this article were defrayed in part by the payment of page
charges. This article must therefore be hereby marked advertisement in accordance
with 18 U.S.C. Section 1734 solely to indicate this fact.
1
This work was supported by funds from the Canadian Institutes of Health Research
Institute of Infections and Immunity, Canada.
2
Current address: Assisted Human Reproduction Implementation Office, Health
Canada, Ottawa, Canada.
3
B.P.-K. and K.G. contributed equally to this work.
4
Address correspondence and reprint requests to Dr. Lakshmi Krishnan, National
Research CouncilInstitute for Biological Sciences, 1200 Montreal Road, Building
M-54, Ottawa, Ontario, Canada K1A OR6. E-mail address: Lakshmi.Krishnan@nrc-
cnrc.gc.ca
5
Abbreviations used in this paper: ST, Salmonella enterica serovar typhimurium;
BHI, brain-heart infusion; uNK, uterine NK.
Copyright 2007 by The American Association of Immunologists, Inc. 0022-1767/07/$2.00
gene, whereas 1291/SvJ mice have a normal NRAMP gene
which confers resistance (3).
ST is an intracellular bacterium that resides within the modified
phagosomes of APCs (4). Innate immunity that includes NK cells,
NKT cells, dendritic cells, and neutrophils are all critical in con-
trolling the early primary infection (5). Inflammatory cytokines
produced by innate immune cells including TNF-, IFN-, IL-12,
and IL-18 are also important for curtailment of infection during the
first week before onset of adaptive immunity (5, 6). CD4 T cell
response to ST infection is generally detectable only beyond 7
days of infection (7), whereas CD8 T cell response is substan-
tially delayed until the second week postinfection (8). Overall, ST
appears to have evolved many mechanisms to evade the host im-
mune system and establish chronic infection.
In humans, the high-risk populations for Salmonella infections
include the young, old, pregnant, transplant patients, and HIV-
infected individuals (9, 10). Salmonella serovars also lead to preg-
nancy loss in livestock (11). Despite evidence for increased sus-
ceptibility of the immunocompromised host to many Salmonella
species, the underlying mechanisms remain largely unknown.
Pregnancy confers a transient altered immune status in the mater-
nal host as responses are biased toward type 2 (humoral) and away
from type 1 (inflammatory and cell-mediated) phenotype (12, 13).
This shift in the immune state during pregnancy, while pronounced
at the maternal-fetal interface, may to some extent modulate systemic
immunity. Pregnancy can have deleterious effect on the outcome of
infections such as leishmaniasis, malaria, toxoplasmosis, and listeri-
osis (14 16). Furthermore, autoimmunity such as systemic lupus er-
ythematosus in which the principal pathology is autoantibody produc-
tion tends to flare up during pregnancy, whereas rheumatoid arthritis,
an inflammatory disorder, is ameliorated in the maternal host (17).
However, most infections during pregnancy, while detrimental to the
fetus, do not lead to fatal maternal outcome.

www.jimmunol.org
The Journal of Immunology
The mechanisms of host response to infections during preg-
nancy need to be understood to enable better management of ep-
idemic outbreaks and to reduce the risk of horizontal and vertical
spread of disease. In particular, very little is known about the spe-
cific host-pathogen interactions of intracellular bacteria with an
immunocompromised host. In this study, using the mouse model
of infection, we have defined some of the factors that influenced
ST pathogenesis in pregnant hosts. We show that ST rapidly pro-
liferates in the placenta leading to invasive fetal disease within
14 h. Additionally, pregnant hosts become fatally susceptible to
infection due to defective systemic innate immunity that is plau-
sibly triggered by altered immune responsiveness to ST in the
placental environment.
Materials and Methods
Bacteria
Virulent ST strain SL1344 (18) and the mutant strain ssaR were generated
and maintained as previously described (19). Briefly, bacteria were grown
in liquid culture in brain-heart infusion (BHI) medium (Difco Laborato-
ries). At mid-log phase (OD600 0.8), bacteria were harvested and frozen
at 80C (in 20% glycerol). CFU were determined by performing serial
dilutions in 0.9% NaCl, which were spread on BHI agar plates.
Mice, matings, and infections
1291/SvJ mice, 6 8 wk of age, were purchased from The Jackson Lab-
oratory. Mice were maintained in the animal facility at the Institute for
Biological Sciences (National Research Council Canada, Ottawa, Ontario,
Canada) in accordance with the recommendations of the Canadian Council
on Animal Care. One male and two females were housed per cage over-
night and mating was determined by the presence of a vaginal plug on the
following morning. The day of vaginal plug observation was defined as
pregnancy day 0. For infection, frozen stocks of bacteria were thawed and
diluted in 0.9% NaCl. Mice were inoculated with 1 103 organisms sus-
pended in 200 l of 0.9% NaCl, via the lateral tail vein (i.v.). Infection was
initiated at various stages of pregnancy: middle (days 10 12) and late
(days 14 15), and in nonpregnant age-matched mice. For depletion of IL-6
in vivo, mice were treated with 100 g/100 l (i.p.) of functional grade
anti-mouse IL-6 Ab (clone MP5-20F3; eBioscience) twice (day of initia-
tion of infection and 2 days later).
Assessment of bacterial burden in organs
Mice were euthanized by CO2 asphyxiation and spleen, liver, placentas/
uteroplacental tissue, and fetal liver were aseptically removed. For the
spleen, single-cell suspensions were obtained by squishing the organ be-
tween frosted ends of a glass slide. Liver, placentas (pooled per mouse),
and fetal liver (pooled per mouse) were homogenized using a motorized
homogenizer. In some cases, wherein it was difficult to discern the
placentas of resorbed fetuses, the entire uteroplacental unit was homog-
enized. An aliquot of the cell suspension or homogenate was lysed with
water for 30 s, and then evaluated for the numbers of viable bacteria.
Ten-fold serial dilutions of the tissue homogenates, in 100-l volume of
0.9% NaCl were plated on BHI agar. For assessing bacterial burdens at
early time points after infection, the entire volume of tissue homogenate
was spread onto several plates. Colonies were counted after 24 h of
incubation at 37C.
Assessment of pregnancy outcome
Fetal resorptions were identified by the notably smaller size and necrotic or
hemorrhagic appearance of the fetus and/or placenta when compared with
normal viable fetuses and/or as resorbing necrotic scars in the uterus. The
percentage resorption rate was calculated using the formula R/(R V)
100, where R is the number of resorbing fetuses and V is the number of
viable fetuses per animal.
Flow cytometric analysis of immune cell subsets
Single-cell suspensions of spleens were analyzed for the various immune
cell types based on their surface expression of various markers. For stain-
ing with all Abs, cells were first incubated on ice (106 cells in 100 l of
PBS plus 1% BSA) with anti-mouse CD32/CD16 (FcII/III receptor). Af-
ter 10 min, 35 l of different FITC- or PE-labeled anti-mouse Abs were
added and incubated for an additional 30 min on ice. Abs against the
following cell surface markers were used to identify the various immune
6089
cell types: B220, CD4, CD8, TCR, CD25, F480, MAC-1, CD11c, Gr-1,
NK1.1, DX5, CD94, and Ly49D. All Abs were purchased from BD Bio-
sciences. After 30 min, cells were washed and fixed in 1% formaldehyde
in PBS and acquired on an EPICS XL flow cytometer (Beckman Coulter).
Analysis was done using EXPO software (Beckman Coulter).
Uterine tissue from nonpregnant or placenta from pregnant mice were
cut into small pieces, and treated with 0.5 mg of collagenase type IV
(Worthington Biochemical) for 10 min (37C), and then a single-cell sus-
pension was obtained by squishing the tissue with a plunger over a cell
strainer. Cells were subject to Percoll Plus (GE Healthcare Biosciences)
gradient centrifugation and the lymphocyte interface was collected. Cells
were then stained with anti-DX5 Ab, similar to the staining procedure
outlined for spleen cells.
Assessment of NK cytotoxicity
Cytotoxicity of NK cells in vitro was assessed in a 51Cr-release assay on
YAC-1 target cells. Murine NK-sensitive target cells, YAC-1 (Moloney
murine leukemia virus-induced lymphoma cells) as well as NK-insensitive
cells, P815 (mastocytoma cells, H-2d) were propagated in RPMI 1640 me-
dium additionally supplemented with 8% FBS and 10 g/ml gentamicin
(R8 medium) 37C, 8% C02. Both cell lines were obtained from the Amer-
ican Type Culture Collection (ATCC). For the assay, 5 106 target cells
Downloaded from http://www.jimmunol.org/ by guest on November 24, 2017
were labeled with 50 Ci 51Cr (Amersham Pharmacia Biotech) for 1 h at
37C and washed three times. Effector cells were prepared by tweezing the
spleens between the frosted ends of two sterile glass slides in R8 medium.
Cells were subsequently passed through Falcon 2360 cell strainers (BD
Labware), centrifuged, and resuspended in R8 medium. Various ratios of
effectors and targets were cocultured for 4 h at 37C in 96-well round-
bottom tissue-culture plates (Falcon). The supernatants were collected, and
radioactivity was detected by gamma counting. The percentage of specific
lysis was calculated using the formula: 100 ((experimental cpm spon-
taneous cpm)/(total cpm spontaneous cpm)). The percentage-specific
killing obtained at various E:T ratios was also converted to lytic units,
wherein 1 lytic unit represents the number of effectors yielding 15% spe-
cific lysis of 2.5 104 YAC-1 targets.
Cytokine ELISAs
Blood was obtained by cardiac puncture under anesthesia, before eutha-
nasia of mice, and collected in microtainer serum separator tubes (BD
Biosciences). After the blood was allowed to clot at 4C, the serum was
separated by quick high-speed centrifugation, and stored at 70C. Levels
of serum IL-12, IL-6, IFN- , and IL-10 were assayed by sandwich ELISA.
The following Ab pairs were used: R4-A62 (ATCC HB170) and XMG1.2-
biotin for IFN-; SXC4 and SXC1-biotin for IL-10. IL-6 and IL-12 Ab
pairs were purchased from BD Biosciences. Cytokine standards were pur-
chased from ID Labs. Duplicate standard curves encompassing several
doubling dilutions of the standard were included on each plate. All serum
samples were assayed at the same time to minimize day-to-day error in
cytokine detection. The detection limits for cytokines in the ELISAs were
200 pg/ml IFN-, 200 pg/ml IL-10, 200 pg/ml IL-6, 100 pg/ml IL-12p40.
Assessment of placental cytokine expression by quantitative
RT-PCR
Placentas from individual mice were dissected out, pooled, and snap-frozen
in a dry ice/100% ethanol bath. In the case of ST-infected pregnant mice,
where it was not always possible to discern individual placenta, the whole
uteroplacental unit was snap-frozen. Total RNA was extracted using the
Qiagen RNeasy Mini kit according to the instructions of the manufacturer
along with rapid mechanical lysis. Briefly, the placentas or uteroplacental
units were cut into pieces and lysed in 1 ml of lysis buffer in a MiniBead-
beater 3110BX (BioSpec Products) with glass beads ( 0.5 mm and
0.1 mm; BioSpec Products). Total RNA from homogenates was extracted
and treated with RNase-free DNase I (Roche Applied Science) for 30 min
at 37C. DNase was then removed according to the instructions of the
manufacturer. A total of 25 g of total RNA was taken for cDNA syn-
thesis. cDNA was synthesized using AncT primers (Sigma-Aldrich). RNA
was made linear at 65C for 5 min and cDNA was synthesized in a 40-l
reaction volume containing: 1.5 l of AncT primers (100 pM/l), 8 l 5
first-strand buffer, 4 l of DTT (100 mM), 5 l of dNTP (5 mM), 1 l of
RNase OUT (40 U/l), 2 l of Superscript II (200 U/l) (Invitrogen Life
Technologies), and 15 l of RNA template. Reverse transcription was
performed in a Thermo Cycler 9700 (Applied Biosystems) at 42C for 15
min and 45C for 2 h. Identical samples not treated with Superscript II were
also prepared as controls to measure DNA contamination. The remaining
RNA template was hydrolyzed with 1 M NaOH at 65C for 5 min and
neutralized with 1 M HCl. cDNA was purified using Microcon YM-30
6090 PREGNANCY ALTERS INNATE IMMUNITY TO INFECTION

Table I. Primer sequences used for assay of placental cytokines

Gene Forward Primer (53) Reverse Primer (53)

-actin TGACCGAGCGTGGCTACA TCTCTTTGATGTCACGCACGAT

TGF- AAACGGAAGCGCATCGAA GGGACTGGCGAGCCTTAGTT
IL-10 CAGCCGGGAAGACAATAACTG CCGCAGCTCTAGGAGCATGT
IL-6 CCAGAAACCGCTATGAAGTTCCT CACCAGCATCAGTCCCAAGA
IL-12p40 CCCCCAAAAGCTGTCTTCTG GCAAAGGTGTCATGATGAACTTAGG
IFN- ACAATGAACGCTACACACTGCAT TGGCAGTAACAGCCAGAAACA
IL-18 AAGAAAGCCGCCTCAAACCT TCTGACATGGCAGCCATTGT
TNF- ATCCGCGACGTGGAACTG ACCGCCTGGAGTTCTGGAA

centrifugal filter units (Millipore). The number of amplicons was measured in the spleen (Fig. 2a) and liver (Fig. 2b) on day 3 of infection in
by quantitative real-time PCR using gene-specific primers and quantitative age-matched nonpregnant and pregnant mice. The bacterial counts
PCR SYBR green supermix (ABgene). Primers were designed using were similar in the peripheral organs of both nonpregnant and
Primer Express 2.0. The primer pairs used are listed in Table I. -actin was
used as an internal reference control. Ten-fold dilutions of cDNA were pregnant mice, suggesting that host resistance to infection re-
used as template to generate the standard curve for each primer-template mained intact. However, ssaR infection was deleterious to preg-
set (1, 1/10, 1/100, 1/1000). This standard curve was run together nancy outcome, as colonization of the placenta was observed (Fig.
with triplicate reactions of the uncharacterized samples. PCR was per- 2c). Furthermore, this correlated to 50% fetal resorption rate

Downloaded from http://www.jimmunol.org/ by guest on November 24, 2017

formed in sealed tubes in a 96-well microtiter plate in an ABI Prism 7000
thermocycler (Applied Biosystems). The 25-l reaction consisted of 12.5
(Fig. 2d). Thus, ssaR infection results in less severe systemic bac-
l of quantitative PCR SYBR green supermix, 2.5 l of primer mix (1.5 terial burden in the pregnant host, despite placental colonization
pM/l each), and 10 l of template. Thermal conditions were as follows: and adverse fetal outcome.
activation at 95C for 15 min, followed by 40 cycles of denaturation at
95C for 15 s, annealing at 60C for 1 min, and extension at 72C for 1
min. Fluorescence was measured during the annealing step and plotted
against the amplification cycle. Relative quantitative analysis of the data
was extrapolated from the standard curve. Primer efficiencies were
98 100%.

Statistical analysis
Nonparametric Mann-Whitney or Students t test, as appropriate, and
stated in the figure legends were used to determine the statistical signifi-
cance of the experimental data.

Results
Exacerbation of ST infection in pregnant hosts
Normal C57BL/6J mice succumbed to ST infection (given i.v.)
within 7 days even to a low dose (102), whereas 1291/SvJ mice
resisted infection even with 103 dose of ST (i.v.), and developed a
chronic infection that lasts for 60 days, followed by clearing
(Fig. 1a). In contrast 60% of 1291/SvJ mice infected with ST
in midpregnancy (days 10 12), succumbed to infection within 7
days (Fig. 1b). The median survival in the pregnant group was 6
days. This correlated to a rapid increase in bacterial burden in the
organs of pregnant mice. When ST infection was initiated in mid-
dle or late pregnancy, the bacterial burden in the spleen was pro-
foundly increased (1000-fold) in comparison to the burden
achieved in the spleens of nonpregnant age-matched mice (Fig.
1c). The exacerbation of ST infection observed in pregnant mice FIGURE 1. ST infection in pregnancy. a, Splenic bacterial burden after
ST infection in nonpregnant C57BL/6J mice (infected with 102 i.v.), or
also correlated to substantial bacterial colonization of the placenta.
1291/SvJ mice (infected with 103 i.v.). Mean SD of n 3 mice per
Infection with 103 CFU of ST resulted in 107 bacteria in the
time point is indicated. , C57BL/6 mice were euthanized due to high
uteroplacental units of individual mice within 3 days (Fig. 1d). bacterial burden. b, Nonpregnant or pregnant 1291/SvJ mice were in-
This resulted in a 75% fetal loss (Fig. 1e). Furthermore, infection jected with 103 ST (i.v.). Pregnant mice were infected in midpregnancy
in late pregnancy (days 14 and 15) induced premature labor in (days 10 12). Survival curves are based on a total of 20 mice in each group
many mice (data not shown), again demonstrating the highly det- and are significantly different based on the log-rank test. c, Nonpregnant,
rimental effect of ST infection on pregnancy outcome. midpregnant (days 10 12), or late-pregnant (days 14 15) 1291/SvJ mice
were infected with 103 ST. Bacterial burden in the spleen was determined
Host resistance to nonvirulent ST-ssaR strain is not on day 3 of infection. Each data point represents bacterial burden per total
compromised in pregnancy spleen of individual mice. , Splenic bacterial burden in pregnant mice
was significantly different (p 0.0001) in comparison to nonpregnant
A highly attenuated mutant strain of ST, ssaR, is defective for the
controls by the two-tailed, Mann-Whitney U test. d, Bacterial burden in the
Salmonella pathogenicity island II (SPI-II) type III secretion, and uteroplacental tissue on day 3 of infection in 1291/SvJ mice infected with
is unable to secrete type III effectors proteins, and hence is unable 103 ST. e, Resorptions on day 3 of infection. The mean resorption rate in
to survive or rapidly proliferate within phagocytic cells (20). the various groups is indicated by a horizontal line. Resorptions induced by
1291/SvJ mice were infected with 103 CFU of ssaR in middle infection were significantly higher (p 0.0001) in comparison to healthy
pregnancy (days 10 12) and the bacterial burden was determined controls based on the two-tailed, Mann-Whitney U test.
The Journal of Immunology
FIGURE 2. ST ssaR infection during pregnancy. 1291/SvJ mice were
infected with ST ssaR (103, i.v.) either in the nonpregnant state or in middle
pregnancy. Bacterial burden in the spleen (a) and liver (b) and uteropla-
cental tissue (c) of individual mice was determined on day 3 of infection.
The mean bacterial burden in each group is indicated by a horizontal line.
Bacterial burden in the spleen and liver were not significantly different
among nonpregnant and pregnant animals by the two-tailed, Mann-Whit-
ney U test. d, Percentage fetal resorptions at the time of euthanasia on day
3 of infection compared with noninfected-pregnant controls.
ST-infected pregnant mice exhibit reduced recruitment of innate
immune cell types to the spleen
To address the mechanism(s) responsible for the rapid loss of host
resistance to ST infection during pregnancy, we evaluated the phe-
notype and numbers of the various immune cell types in the spleen
(Figs. 3 and 4). Four groups of mice were included in the study:
naive (nonpregnant), naive pregnant, infected (nonpregnant, age
matched), and infected pregnant. First, in comparison to naive
mice, pregnant mice in the absence of any infection exhibited sig-
nificantly reduced percentages of CD4 and CD8 T cells,
whereas differences in other cell types were marginal and insig-
nificant (Fig. 3). ST infection of nonpregnant 1291/SvJ mice
induced increased percentages of many innate immune cell types
defined by the expression of F480, MAC-1, CD11c, and Gr-1
(macrophages, dendritic cells, and neutrophils). Most striking was
the significant increase in NK1.1 and DX5 cells, indicative of
a rapid onset of NK cell response to infection which was lacking
in infected-pregnant mice. Both subsets of DX5CD94 and
DX5Ly49D were lower in pregnant-infected mice (Fig. 3). The
overall numbers (Fig. 4) of NK cells and their subsets in the spleen
was also markedly decreased in infected-pregnant mice, reiterating
the lack of effective NK response against ST infection during preg-
nancy. Infected-pregnant mice also showed significant reductions
in the percentages of dendritic cells, neutrophils, and TCR T
cells as evident from the decreased splenic expression of CD11c,
Gr-1, and TCR, respectively (Fig. 3). Calculating the overall
numbers of these innate immune cell subsets also supported their
decrease in the spleen (data not shown). Infected-pregnant mice
exhibited lower percentages of MAC-1 cells but differences in
percentages of F480 cells were statistically insignificant com-
pared with infected nonpregnant mice. Thus, whether macrophage
numbers are modulated in infected-pregnant mice is unclear. The
percentages of T and B cells defined by the expression of CD4,
CD8, CD25, and B220 were also lower in infected-pregnant mice
in comparison to nonpregnant controls. However, as T cells
showed a constitutive reduction in pregnant animals even in the
absence of infection, it was deduced that ST did not cause any
further reduction of adaptive immune cell types. Furthermore, ef-
fects of ST infection were studied on day 3 of infection, an early
time point when adaptive immunity may be expected to play little
role. In summary, it appeared that the ability of the host to elicit a
rapid recruitment and activation of systemic innate immune re-
sponse to infection was severely compromised during pregnancy.
6091
Downloaded from http://www.jimmunol.org/ by guest on November 24, 2017
FIGURE 3. Analysis of splenic cell populations in ST infection. Cell
surface expression of the indicated markers was determined for splenic
lymphocytes from four groups of mice: naive nonpregnant, naive pregnant,
infected nonpregnant (on day 3 of ST infection) and infected pregnant
(infected with ST in middle pregnancy and analyzed on day 3 of infection).
Data are shown as percentage of positive cells in the spleen for each
marker. Data are plotted as mean SD of analysis (50,000 events per
sample) done on individual mouse spleen (n 4 5 for the naive groups,
and n 8 10 for the infected groups). Statistical comparisons done be-
tween naive-non pregnant and naive pregnant groups indicated significant
reduction in the expression of CD4 and CD8 during pregnancy. Statistical
analysis done between naive nonpregnant and infected-nonpregnant groups
indicated significant increase in the expression of NK1.1 and DX5 postin-
fection. Statistical analysis done between infected-nonpregnant and infect-
ed-pregnant groups indicated significant reductions in B220, CD4,
CD8, TCR, CD4CD25, MAC-1, CD11c, Gr-1, NK1.1,
DX5, DX5CD94, and DX5Ly49D populations during pregnancy.
, p 0.01; , p 0.001; and , p 0.0001 by Mann-Whitney U test.
ST-infected pregnant mice exhibit reduced splenic NK
cytotoxicity
NK cells are the first line of defense against many infections, and
are capable of mounting a cytotoxic response against infected tar-
get cells. Age-matched nonpregnant and pregnant mice were chal-
lenged with ST, and the ability of splenic effectors to kill NK-
sensitive targets was evaluated on day 3 of infection. Splenic
effectors from infected-nonpregnant mice killed YAC-1 targets ef-
fectively, and exhibited negligible killing on NK-insensitive P815
target cells (Fig. 5a). In contrast, splenic effectors from infected-
pregnant mice exhibited weak killing of YAC-1 target cells (Fig.
5b). Stringently comparing the data based on lytic U/106 spleen
cells, the level of NK cytolytic activity on day 3 of ST infection
was 2 U/106 spleen cells in infected-nonpregnant mice and was
significantly lower, 0.5/106, for infected-pregnant mice ( p
0.003). The weak cytolytic activity was not attributable to kinetics
6092
FIGURE 4. Numbers of splenic NK cells after ST infection. The per-
centages of NK1.1, DX5, DX5CD94, and DX5Ly49D cells ob- age of DX5 cell in the uterine lymphocyte population on day 3 of infec-
tained after analysis of individual spleen samples were converted into num-
bers of each cell population based on the total splenocyte count obtained
for each mouse. The populations of the NK cell subsets are indicated for
the four groups; naive nonpregnant, naive pregnant, infected nonpregnant,
and infected pregnant. For the latter two groups, analysis was done on day
3 of infection, and naive and naive pregnant controls that were age-
matched were included alongside. Mean cell number SD of n 4 10
mice/group is indicated. , NK cell numbers in the infected-pregnant mice
are significantly reduced (p 0.01) in comparison to infected-nonpregnant
group by the two-tailed, Mann-Whitney U test.
of the assay, as NK activity was minimal before day 3 (data not
shown).
ST-infected pregnant mice do not exhibit increased
uteroplacental NK numbers
Uterine NK (uNK) cells constitute a distinct population during
pregnancy and are important for early implantation. It has been
suggested that uNK cells are recruited from splenic lineage cells
(21, 22). Furthermore, uNK cells have been implicated in inflam-
FIGURE 5. Splenic NK cytotoxicity after ST infection. 1291/SvJ
mice were infected with ST (103, i.v.) in the nonpregnant state or in middle
pregnancy. On day 3, splenocytes were obtained from individual mice, and
their ability to kill NK-sensitive YAC-1 target cells, and NK-insensitive
P815 target cells was determined by 51Cr-release assay. Percentage-spe-
cific killing SD at the various E:T ratios are indicated for spleen cells
from infected-nonpregnant (a) and infected-pregnant mice (b).
PREGNANCY ALTERS INNATE IMMUNITY TO INFECTION
FIGURE 6. The percentages of uterine DX5 (NK) cells. The percent-
tion is indicated along with data from age-matched noninfected control
Downloaded from http://www.jimmunol.org/ by guest on November 24, 2017
groups. In the case of nonpregnant animals, the lymphocytes were ex-
tracted from the full uterine tissue. In the case of pregnant groups, lym-
phocytes were extracted from the placentas (for noninfected groups) or
uteroplacental tissue (for infected groups). Data represent Mean SEM
of 100,000 events per sample. The results are representative of three
experiments, each performed with cells pooled from two to four mice
per group. , Percentages of DX5 cells in naive nonpregnant mice
were significantly higher than infected-nonpregnant mice (p 0.05 by
Students t test).
mation-induced pregnancy loss (23). Thus, it is possible that the
reduced splenic NK activity noted in ST-infected pregnant hosts is
a result of redistribution of NK subsets to the uteroplacental en-
vironment. We therefore evaluated the numbers of DX5 NK cells
in the uterus (Fig. 6). In nonpregnant mice, the uNK cells ac-
counted to 25% of the uterine lymphocyte population. This num-
ber did not change significantly in the naive pregnant uterus. How-
ever, there was a clear decrease in the uNK cell numbers of
infected nonpregnant mice suggesting redistribution of NK lineage
cells to other lymphoid organs. In contrast, in pregnant mice, on
day 3 postinfection uNK cell numbers did not show any change in
response to infection (Fig. 6). Furthermore, their numbers re-
mained at levels comparable to naive pregnant mice, even at 24 h
after infection (data not shown).
The data presented thus far support a defective innate cell re-
cruitment/activation in pregnant mice. As NK cells showed the
most significant activation in response to infection in nonpregnant
hosts, we examined in additional detail the differences in NK cell
function and distribution. Although NK cell response was dimin-
ished in the spleen, it appeared that uNK numbers remained stable
in pregnant-infected host. Thus, it was not clear whether NK cells
could be solely responsible for the pathology of pregnancy loss
and/or defective systemic resistance to infection. Indeed, a highly
virulent pathogen such as ST may evoke multiple interactions with
host immune cells at various sites of infection. Thus, in the next
series of experiments, we addressed the role of inflammatory
cytokines.
ST-infected pregnant mice produce dichotomous levels of serum
IL-12 vs IL-6
We measured cytokine levels in the serum of individual mice.
IL-12 production is important for influencing the function of many
cell types including dendritic cells, NK cells, and T cells. In com-
parison to noninfected naive mice, ST infection evoked increased
production of serum IL-12 on day 3. However, this increase in
The Journal of Immunology 6093

FIGURE 7. Serum cytokine levels in response to ST infection. Individ-

ual serum samples were assayed for levels of IL-12 (a) and IL-6 (b). Mean
serum cytokine level in each group is indicated by a horizontal line. The
levels of IL-12 were significantly lower in infected-pregnant mice in com-
parison to infected-nonpregnant mice, whereas IL-6 is significantly higher
in infected-pregnant mice when analyzed by the two-tailed, unpaired Stu-
dent t test (p 0.0001).

Downloaded from http://www.jimmunol.org/ by guest on November 24, 2017

serum IL-12 did not occur in pregnant ST-infected mice (Fig. 7a). FIGURE 8. Placental cytokine expression in healthy and ST-infected
In contrast, serum IL-6 levels (Fig. 7b) were elevated in infected- tissues. Cytokine mRNA expression was determined in uteroplacental tis-
pregnant mice in comparison to infected-nonpregnant or naive sue samples from individual mice. 1291SvJ mice were infected with 103
controls. In contrast, serum levels of IFN- and IL-10 were similar ST between 12 and 14 days of gestation. Placentas (where discernable) or
in both infected-nonpregnant and -pregnant mice on day 3 of ST total uteroplacental tissue were obtained on day 3 of infection. Placenta
infection (data not shown). TNF was not detected in the serum of from healthy age-matched noninfected mice (naive pregnant), were ob-
any of the groups (data not shown). Thus, ST-infected pregnant tained on days 1517 of gestation. Data are presented as relative mRNA
abundance normalized to levels of -actin. Mean SD of expression
mice exhibited a skewed peripheral inflammatory response
levels for n 5 in the naive pregnant and n 8 in the infected group is
characterized by overt production of IL-6 and decreased pro- indicated. , p 0.01 and , p 0.001 by Mann-Whitney U test in
duction of IL-12. comparison to cytokine expression in naive pregnant placenta.
ST infection modulates cytokine expression in the
uteroplacental tissue 9, b and c). Anti-IL6 treatment of nonpregnant mice did not alter
their overall resistance to ST infection. Overall, it appears that the
Maintenance of healthy pregnancy is associated with placental se-
increased production of IL-6 may be one of the mechanisms re-
cretion of anti-inflammatory cytokines IL-10 and TGF- (24, 25).
sponsible for impaired control of ST in the periphery.
As ST infection was causing a dramatic increase in fetal loss, we
sought to ascertain the relative levels of inflammatory (IL-6, IL-18, ST proliferates massively in placental tissue, rapidly
TNF, IL-12p40, and IFN-) and anti-inflammatory cytokines invading the fetus
(IL-10 and TGF-) in the uteroplacental tissue. This was achieved
by performing quantitative RT-PCR on samples from individual Although blocking the IL-6-mediated inflammation in the pregnant
mice and normalizing values to expression levels of -actin. Be- host reduced systemic ST infection, it failed to reduce placental
tween days 15 and 18 of gestation, uteroplacental tissue from ST-
infected mice (day 3 postinfection) showed a significant increase
in the expression of cytokines IL-6 (40-fold increase), TNF-
(8-fold increase), IL-18 (3.5-fold increase), and IL-10 (10-
fold increase) relative to expression levels in the placenta of
healthy noninfected mice (Fig. 8). IFN- expression levels also
showed an increased trend in infected-placental tissue, but lacked
statistical significance. In contrast, the expression levels of IL-
12p40 and TGF- were similar in both healthy and infected utero-
placental tissue. Thus, uteroplacental cytokine expression also
suggested overt production of IL-6 in pregnant hosts.

Blocking IL-6 levels in vivo partially restores the resistance of

pregnant mice to ST infection
Of the various cytokines, IL-6 appeared to be dramatically in-
creased both in the serum and placenta. Thus, we sought to deter-
mine whether this bore any direct consequences to bacterial burden
or fetal loss. We therefore depleted IL-6 in vivo by Ab treatment
during the 3-day window of ST infection in pregnant mice. Fig. 9a
shows that anti-IL6 treatment of pregnant ST-infected mice sig-
nificantly decreased the splenic bacterial burden, relative to un-
treated pregnant-infected mice. Blocking the function of IL-6 in
vivo did not reduce placental bacterial load or resorption rates (Fig.
FIGURE 9. Anti-IL6 Ab treatment of ST-infected pregnant mice.
1291Sv/J mice were infected with 103 ST. CFU on day 3 of infection in
the spleen (a) and placenta (b) are indicated. c, Resorptions per mouse on
day 3 of infection. Data are represented as values for individual mice, with
the horizontal line indicating group means. , Splenic CFU for pregnant
ST-infected mice treated with anti-IL-6 Ab is significantly lower (p
0.0043) in comparison to untreated pregnant-infected mice by the two-
tailed, Mann-Whitney U test.
6094
FIGURE 10. Kinetics of ST growth in placenta vs spleen. Nonpregnant
and pregnant 1291/SvJ mice were infected with 103 ST (i.v). Bacterial
burden in the spleens and placentas of representative mice (n 35/time
point) were determined at 2, 14, 2730, and 72 h later. Mean SEM of
CFU over time in the total organ is indicated. For each time point, indi-
vidual spleens or pooled placenta per mouse was processed and assessed.
For the 72-h time point, in case of pregnant mice, uteroplacental tissue in
lieu of pooled placenta was processed.
infection and fetal resorptions. Therefore, a kinetic study was un-
dertaken to elucidate the rate of infection in various tissues. Fig. 10
demonstrates the bacterial burden in the spleen and placenta at
272 h after infection. After infection with 103 dose, bacteria could
be detected in the spleen and placenta as early as 2 h after infec-
tion, with 200 bacteria detected in the spleen and 50 detected
in the placenta. After 14 30 h, splenic bacterial burden showed very
little increase from the initial 2-h counts and was similar in both
nonpregnant and pregnant hosts. In contrast, the bacterial burden
in the placenta had increased to 105 by 14 h, and 108 by 2730 h.
Differences in the splenic bacterial burden between pregnant and
nonpregnant hosts became evident only at 72 h. These results sug-
gest that although ST may not show a predilection for the placenta
at 2 h, it proliferates profoundly and unabatedly in the placenta.
Indeed, it appears that the bacterial numbers double approximately
every hour in the placenta. Furthermore, the placental infection
appeared to be highly invasive, as colonization of fetal liver oc-
curred by 14 h, and 103104 bacteria were recovered by 24 h
(n 5 mice, fetal livers of litter from each mother were pooled,
homogenized, and plated). By 48 h, we could not clearly discern
the fetus in many animals. Thus, the propensity of ST to proliferate
in the placenta appears to acutely breach the placental barrier.
Discussion
Typhoid fever is a major public health problem in developing
countries, whereas the incidence of nontyphoidal salmonellosis
caused by enteritidis species is on the rise even in the developed
world. Immunocompromised individuals are at high risk for bac-
teremia and systemic spread (26). Complications in pregnancy due
to Salmonella infections include endomyometritis, salpingitis, cho-
rioamnionitis, transplacental infection and septic abortion, neona-
tal septicemia, and meningitis, and there are a few reported cases
of life-threatening septicemia in the mother (9, 27). Abortions due
to Salmonella serovars is also common in live stock, leading to
huge economic losses (11). Thus, there is clinical evidence sup-
porting an ineffective response to Salmonella species during preg-
PREGNANCY ALTERS INNATE IMMUNITY TO INFECTION
nancy. However, to our knowledge, there have been no reports on
the immune mechanisms that modulate pathogenesis of Salmo-
nella infection in pregnant hosts.
Our data implicate a two-way Salmonella-induced immunopa-
thology that adversely affects both the fetus and mother. The first
event of pregnancy loss appears to be triggered by the rapid pro-
liferation of Salmonella in the secluded placental environment.
Two hours after infection, only 5% of the infective dose (50
bacteria) reached the placenta, yet this number grew astoundingly
to 105107 by 14 30 h. In contrast, relatively higher numbers
(200 bacteria) homed to the spleen, but they expanded only mar-
ginally in the first 24 h. This marked contrast in the ability of
Salmonella to proliferate in the spleen vs placenta is suggestive of
a unique escape and/or invasive mechanism in the pregnant host.
Maternal malaria is associated with sequestration of plasmodium-
infected erythrocytes in the placenta (28). Similarly, Listeria
monocytogenes uses actA filament-mediated entry (29) to favor-
ably proliferate in the placenta, despite initial tropism to lymphoid
tissue (30, 31). Whether the rampant placental ST infection is due
Downloaded from http://www.jimmunol.org/ by guest on November 24, 2017
to accumulation of infected cells from other organs or preferential
trophoblast entry needs further study.
Our study adds Salmonella to the list of pathogens such as Tox-
oplasma, Chlamydia, Listeria, and Plasmodium that preferentially
invade the placenta and may cause abortion through local inflam-
mation (15, 16, 31, 32). The placental interface does express TLRs
and can trigger the innate cascade (32, 33) to protect the host.
Indeed, ST infection is also associated with increased placental
expression of IL-6, IL-18, TNF, and IFN-. It is possible that the
interaction of Salmonella LPS with its TLR-4 ligand on the tro-
phoblast triggered the profound local inflammation and trophoblast
apoptosis (33).
The second rather surprising event in Salmonella-induced im-
munopathology is the profound and rapid loss of systemic host
resistance, resulting in the conversion of a normally resistant strain
of mouse to a susceptible one. Overt inflammation can cause sub-
stantial fetal damage (34, 35) and thus it is understandable that
infections that augment inflammation cause pregnancy loss. This
may be an evolutionary advantage to avoid wastage of resources
on a damaged offspring and preserve the mother. However, it ap-
pears that if the pathogen is highly evasive and virulent, such as
Salmonella, the deviation of inflammatory responses during preg-
nancy can also result in catastrophic host outcome. Increase in
splenic bacteria was preceded by heavy placental infection. There-
fore, it is possible that reverse trafficking of ST from placenta to
the spleen occurred. There is precedence for trafficking of bacteria
from placenta to spleen in the case of L. monocytogenes infection
(30), although effective immunity to Listeria in the systemic com-
partment ensues. Contrastingly, despite high ST burden by day 3 in
the spleen of pregnant hosts, recruitment and activation of many
innate immune cell types (NK cells, neutrophils, dendritic cells)
was reduced in comparison to nonpregnant hosts.
One possibility was that pregnancy prevented activation of cell
types such as NK cells as a perturbation in their peripheral num-
bers can lead to spontaneous abortion and pre-eclampsia (3537).
Pregnancy hormones, estrogen, progesterone, and prolactin may
have dampening effects on peripheral NK cells (38). However, in
the absence of infection, we observed no marked difference in the
overall numbers of splenic NK cells in the pregnant and nonpreg-
nant mice. Thus, it is likely that the peripheral expansion/recruit-
ment/activation of NK cells evoked by infection may be inefficient
during pregnancy. The Ly49 receptor family are constituted as
homodimers that bind directly to their MHC class I ligands and
Ly49D is considered to be stimulatory (39). In contrast, CD94 on
NK cells is coexpressed as a heterodimer with NKG2, and the
The Journal of Immunology
resulting receptor may be stimulatory or inhibitory dependent on
the associating NKG2 isoform (39). The decrease of both
NK1.1Ly49D and NK1.1CD94 subsets in infected-pregnant more, IL-6 also has complex differential effects on differentiation
mice suggests lack of stimulatory receptor activation during preg-
nancy, and consequent weak NK cell function, resulting in im-
paired clearance of infected cells. Indeed, we noted that depleting
NK cells (with anti-NK1.1 Ab treatment) increased (1.6-fold) bac-
terial burden in nonpregnant 1291Sv/J mice suggesting a role for
NK cells in facilitating ST clearance (data not shown). However,
the apparent decrease in peripheral NK cells during pregnancy
may be a consequence of their redistribution to the uterus (21).
uNK cells are important for decidualization (22), however, they
express mainly NK inhibitory receptors and have weaker cytolytic
activity (40). Nevertheless, uNK cells have been implicated in trig-
gering inflammation-induced fetal demise later in gestation (23). In
contrast, uNK cells were not increased in ST-infected pregnant
hosts. The rapid advanced pathology evoked by ST may have
masked any early increase in uNK cells. Furthermore, the virulent
nature of ST probably evoked a complex cellular and cytokine
cascade involving multiple events. However, the decrease in uNK
cells pursuant to infection in nonpregnant mice may have aided
NK cell recruitment to other infected compartments. In contrast,
the lack of change in uNK cell numbers in the pregnant-infected
host may indicate their failure to redistribute to systemic tissue. It
is then plausible that resident uNK cells in the pregnant-infected
host responded to local infection and contributed to placental pa-
thology and, by failing to migrate to the spleen, also led to break-
down of systemic resistance.
IL-12 is produced by monocyte lineage cells after recognition of
pathogen-specific molecular patterns. Consistent with the reduced
recruitment of dendritic cells and macrophages, infected-pregnant
mice displayed reduced serum IL-12 amounts. This may be a con-
sequence of the cross-talk between NK cells and dendritic cells
(41), as IFN- produced by NK-cells can stimulate IL-12 produc-
tion. Alternatively, the lack of dendritic cell activation may have
contributed to weaker NK cell response as IL-12 can drive NK cell
expansion and function. IL-12 plays an essential role in Salmonella
pathogenesis: exogenous administration of IL-12 improves sur-
vival times in susceptible mice and anti-IL-12 Ab treatment exac-
erbates infection (42); immunity against oral Salmonella infection
is associated with a rapid increase in IL-12p40 mRNA production
in a Peyers patch (43). In humans, IL-12 deficiency increases
susceptibility to ST infection (44). In contrast IL-12 is highly del-
eterious to pregnancy (45, 46). Interestingly, placental expression
of IL-12p40 was also not increased, despite increased levels of
other inflammatory cytokines. Furthermore, we noted that pregnant
mice were hypersensitive to in vivo administration of IL-12 becoming
acutely ill within a day (data not shown). Thus, it makes sense that
ST-infected pregnant hosts may be down-modulating IL-12 produc-
tion. Regulatory mechanisms may exist during pregnancy to prevent
the deleterious expression of IL-12 in response to infection.
Despite the reduced activation of many innate cell types in the
spleen of pregnant-infected hosts, at the uteroplacental interface,
there was substantial inflammatory response characterized in par-
ticular with the overt up-regulation of IL-6. Indeed, IL-6 was also
elevated in the serum of pregnant ST-infected mice. How such
dichotomous inflammation (reduced systemic innate cell type ac-
tivation and IL-6 increase) is regulated in the ST-infected pregnant
host is unclear. IL-6 is a pleiotropic cytokine with contrasting ef-
fects on varied cell types and is also associated with suppressive
immune effects (47). The function of IL-6 is controlled through
soluble IL-6R trans-signaling (48). Interestingly, IL-6 promotes
neutrophil apoptosis leading to suppression of neutrophil infiltra-
tion and resolution of acute inflammation while steering transition
6095
to acquired immunity (49). Neutrophils are the main source of
early IFN- production critical for activation of NK cells. Further-
and activation of dendritic cells and macrophages (49, 50). Thus,
the overt production of IL-6 may have lead to the deleterious con-
sequence of lack of sufficient recruitment of inflammatory cell
types in the systemic compartments of pregnant ST-infected hosts.
Interestingly, blocking IL-6 activity in vivo restored systemic
host resistance, reiterating the inappropriate presence of this cyto-
kine in pregnant ST-infected mice. A recent study demonstrated
opposing effects of IL-6 and IL-12 on downstream signaling
events, and ST survived in larger numbers in IL-6-treated macro-
phages (51). Thus, the elevated IL-6 levels may have facilitated
unabated growth of ST in pregnant hosts. Nevertheless, while anti-
IL-6 was effective in reducing bacterial burdens in the spleens of
pregnant mice, it failed to do so in the placenta, and consequently
did not prevent fetal demise. Considering the extremely high levels
of placental IL-6 expression, it is possible that anti-IL-6 Ab failed
to provide sufficient neutralization at the fetomaternal interface in
Downloaded from http://www.jimmunol.org/ by guest on November 24, 2017
a timely manner. Indeed, the phenomenal expansion in numbers of
ST from 2 to 14 h (50 to 105 bacteria) implies a doubling time
of 1 h. Thus, the early innate immune response at the placental
interface was not sufficient to curb bacterial replication. It is also
possible that the absence of IL-12 expression by the placenta fa-
vored ST proliferation. Moreover, fetal loss may have been irre-
versible and rapid as placental carnage occurred before the host
using IL-6 neutralization to its benefit.
Pregnancy poses a high risk against other intracellular infections
such as malaria, listeriosis, and tuberculosis (31, 52, 53). However,
despite adverse pregnancy outcome, normally, the host does not
fatally succumb to infection. Indeed, even in areas of endemic
infections, successful pregnancies occur. Moreover, there is no un-
due mortality in women of reproductive age. Thus, the maternal
host is probably capable of effectively combating many infections,
despite altered immune state. This raises the question as to why
ST infection resulted in such dramatic consequences for the host.
Pathogens differ in their virulence, replication rate, intracellular
habitats, and nature of inflammation evoked, and these factors in-
fluence their interaction with the host. For example, Listeria pro-
liferates rapidly but is localized in the cytoplasm allowing the host
innate and adaptive immune response to rapidly control pathogen
replication (54). Alternatively, mycobacteria reside within the
phagosome and can avert host adaptive immunity, but its slow
replication leads to chronic infection (55). In contrast, Salmonella
not only proliferates rapidly, but it remains in a modified phago-
some (4). It is also a highly virulent organism which devotes 4%
of its genome to virulence mechanisms (56). Thus, even in the
fully competent host, adaptive immunity to Salmonella is substan-
tially delayed (8), making it important for innate immunity to con-
trol infection. Consequently, even a slightly deviated and/or de-
layed cytokine/cellular innate response during pregnancy may lead
to catastrophic host outcome. The primary interaction of ST with
the placental interface probably triggered a defective innate immune
cascade leading ultimately to breakdown of systemic resistance. Our
study reiterates the multifaceted cytokine and cellular regulatory net-
work operative in pregnancy that highly virulent pathogens may use
to deregulate host innate responses. The knowledge that some infec-
tions may evoke rapid maternal immunopathology and fatality bears
implications for control of epidemic outbreaks.
Acknowledgments
We gratefully acknowledge the technical assistance provided by Renu
Dudani and Ahmed Zafer. This is National Research Council Publica-
tion Number 42520.
6096
Disclosures
The authors have no financial conflict of interest.
References
1. Jones, B. D., and S. Falkow. 1996. Salmonellosis: host immune responses and
bacterial virulence determinants. Annu. Rev. Immunol. 14: 533561.
2. Santos, R. L., S. Zhang, R. M. Tsolis, R. A. Kingsley, L. G. Adams, and
A. J. Baumler. 2001. Animal models of Salmonella infections: enteritis versus
typhoid fever. Microbes. Infect 3: 13351344.
3. Boyer, E., I. Bergevin, D. Malo, P. Gros, and M. F. Cellier. 2002. Acquisition of
Mn(II) in addition to Fe(II) is required for full virulence of Salmonella enterica
serovar typhimurium. Infect. Immun. 70: 6032 6042.
4. Buchmeier, N. A., and F. Heffron. 1991. Inhibition of macrophage phagosome-
lysosome fusion by Salmonella typhimurium. Infect. Immun. 59: 22322238.
5. Wick, M. J. 2004. Living in the danger zone: innate immunity to Salmonella.
Curr. Opin. Microbiol. 7: 5157.
6. Wick, M. J. 2003. The role of dendritic cells in the immune response to Salmo-
nella. Immunol. Lett. 85: 99 102.
7. Ravindran, R., and S. J. McSorley. 2005. Tracking the dynamics of T-cell acti-
vation in response to Salmonella infection. Immunology 114: 450 458.
8. Luu, R. A., K. Gurnani, R. Dudani, R. Kammara, H. van Faassen, J. C. Sirard,
L. Krishnan, and S. Sad. 2006. Delayed expansion and contraction of CD8 T
Cell response during infection with virulent Salmonella typhimurium. J. Immu-
nol. 177: 1516 1525.
9. van der Klooster, J. M., and H. J. Roelofs. 1997. Management of Salmonella
infections during pregnancy and puerperium. Neth. J. Med. 51: 83 86.
10. Doffinger, R., S. Patel, and D. S. Kumararatne. 2005. Human immunodeficiencies
that predispose to intracellular bacterial infections. Curr. Opin. Rheumatol. 17:
440 446.
11. Cagiola, M., G. Severi, K. Forti, M. Menichelli, P. Papa, A. De Giuseppe, and
P. Pasquali. 2007. Abortion due to Salmonella enterica serovar abortusovis (S.
abortusovis) in ewes is associated to a lack of production of IFN- and can be
prevented by immunization with inactivated S. abortusovis vaccine. Vet. Micro-
biol. 121: 330 337.
12. Chaouat, G. 2003. Innately moving away from the Th1/Th2 paradigm in preg-
nancy. Clin. Exp. Immunol. 131: 393395.
13. Wegmann, T. G., H. Lin, L. Guilbert, and T. R. Mosmann. 1993. Bidirectional
cytokine interactions in the maternal-fetal relationship: is successful pregnancy a
TH2 phenomenon? Immunol. Today 14: 353356.
14. Krishnan, L., L. J. Guilbert, A. S. Russell, T. G. Wegmann, T. R. Mosmann, and
M. Belosevic. 1996. Pregnancy impairs resistance of C57BL/6 mice to Leishma-
nia major infection and causes decreased antigen-specific IFN- response and
increased production of T helper 2 cytokines. J. Immunol. 156: 644 652.
15. Luft, B. J., and J. S. Remington. 1982. Effect of pregnancy on resistance to
Listeria monocytogenes and Toxoplasma gondii infections in mice. Infect. Im-
mun. 38: 1164 1171.
16. Fievet, N., M. Moussa, G. Tami, B. Maubert, M. Cot, P. Deloron, and
G. Chaouat. 2001. Plasmodium falciparum induces a Th1/Th2 disequilibrium,
favoring the Th1-type pathway, in the human placenta. J. Infect. Dis. 183:
1530 1534.
17. Kaaja, R. J., and I. A. Greer. 2005. Manifestations of chronic disease during
pregnancy. J. Am. Med. Assoc. 294: 27512757.
18. Hoiseth, S. K., and B. A. Stocker. 1981. Aromatic-dependent Salmonella typhi-
murium are non-virulent and effective as live vaccines. Nature 291: 238 239.
19. Brumell, J. H., C. M. Rosenberger, G. T. Gotto, S. L. Marcus, and B. B. Finlay.
2001. SifA permits survival and replication of Salmonella typhimurium in murine
macrophages. Cell. Microbiol. 3: 75 84.
20. Pfeifer, C. G., S. L. Marcus, O. Steele-Mortimer, L. A. Knodler, and B. B. Finlay.
1999. Salmonella typhimurium virulence genes are induced upon bacterial inva-
sion into phagocytic and nonphagocytic cells. Infect. Immun. 67: 5690 5698.
21. Chantakru, S., C. Miller, L. E. Roach, W. A. Kuziel, N. Maeda, W. C. Wang,
S. S. Evans, and B. A. Croy. 2002. Contributions from self-renewal and traffick-
ing to the uterine NK cell population of early pregnancy. J. Immunol. 168: 2228.
22. van den, H. M., C. Peralta, S. Bashar, S. Taylor, J. Horrocks, and B. A. Croy.
2005. Trafficking of peripheral blood CD56bright cells to the decidualizing uterus
new tricks for old dogmas? J. Reprod. Immunol. 67: 2134.
23. Murphy, S. P., L. D. Fast, N. N. Hanna, and S. Sharma. 2005. Uterine NK cells
mediate inflammation-induced fetal demise in IL-10-null mice. J. Immunol. 175:
4084 4090.
24. Lin, H., T. R. Mosmann, L. Guilbert, S. Tuntipopipat, and T. G. Wegmann. 1993.
Synthesis of T helper 2-type cytokines at the maternal-fetal interface. J. Immunol.
151: 4562 4573.
25. Chaouat, G., S. Zourbas, S. Ostojic, G. Lappree-Delage, S. Dubanchet, N. Ledee,
and J. Martal. 2002. A brief review of recent data on some cytokine expressions
at the materno-foetal interface which might challenge the classical Th1/Th2 di-
chotomy. J. Reprod. Immunol. 53: 241256.
26. McCabe-Sellers, B. J., and S. E. Beattie. 2004. Food safety: emerging trends in
food borne illness surveillance and prevention. J. Am. Diet. Assoc. 104:
1708 1717.
27. Hedriana, H. L., J. L. Mitchell, and S. B. Williams. 1995. Salmonella typhi
chorioamnionitis in a human immunodeficiency virus-infected pregnant woman.
A case report. J. Reprod. Med. 40: 157159.
28. Rogerson, S. J., L. Hviid, P. E. Duffy, R. F. Leke, and D. W. Taylor. 2007.
Malaria in pregnancy: pathogenesis and immunity. Lancet Infect. Dis. 7:
105117.
PREGNANCY ALTERS INNATE IMMUNITY TO INFECTION
29. Le Monnier, A., N. Autret, O. F. Join-Lambert, F. Jaubert, A. Charbit, P. Berche,
and S. Kayal. 2007. ActA is required for crossing of the fetoplacental barrier by
Listeria monocytogenes. Infect. Immun. 75: 950 957.
30. Bakardjiev, A. I., J. A. Theriot, and D. A. Portnoy. 2006. Listeria monocytogenes
traffics from maternal organs to the placenta and back. PLoS Pathog. 2: e66.
31. Le Monnier, A., O. F. Join-Lambert, F. Jaubert, P. Berche, and S. Kayal. 2006.
Invasion of the placenta during murine listeriosis. Infect. Immun. 74: 663 672.
32. Equils, O., D. Lu, M. Gatter, S. S. Witkin, C. Bertolotto, M. Arditi,
J. A. McGregor, C. F. Simmons, and C. J. Hobel. 2006. Chlamydia heat shock
protein 60 induces trophoblast apoptosis through TLR4. J. Immunol. 177:
12571263.
33. Abrahams, V. M., P. Bole-Aldo, Y. M. Kim, S. L. Straszewski-Chavez,
T. Chaiworapongsa, R. Romero, and G. Mor. 2004. Divergent trophoblast re-
sponses to bacterial products mediated by TLRs. J. Immunol. 173: 4286 4296.
34. Caucheteux, S. M., C. Kanellopoulos-Langevin, and D. M. Ojcius. 2003. At the
innate frontiers between mother and fetus: linking abortion with complement
activation. Immunity 18: 169 172.
35. Borzychowski, A. M., B. A. Croy, W. L. Chan, C. W. Redman, and I. L. Sargent.
2005. Changes in systemic type 1 and type 2 immunity in normal pregnancy and
pre-eclampsia may be mediated by natural killer cells. Eur. J. Immunol. 35:
3054 3063.
36. Lee, H., C. D. Gregory, G. B. Rees, I. V. Scott, and P. R. Golding. 1987. Cy-
totoxic activity and phenotypic analysis of natural killer cells in early normal
human pregnancy. J. Reprod. Immunol. 12: 35 47.
37. Beer, A. E., J. Y. Kwak, and J. E. Ruiz. 1996. Immunophenotypic profiles of
peripheral blood lymphocytes in women with recurrent pregnancy losses and in
Downloaded from http://www.jimmunol.org/ by guest on November 24, 2017
infertile women with multiple failed in vitro fertilization cycles. Am. J. Reprod.
Immunol. 35: 376 382.
38. Dosiou, C., and L. C. Giudice. 2005. Natural killer cells in pregnancy and re-
current pregnancy loss: endocrine and immunologic perspectives. Endocr. Rev.
26: 44 62.
39. Raulet, D. H., R. E. Vance, and C. W. McMahon. 2001. Regulation of the natural
killer cell receptor repertoire. Annu. Rev. Immunol. 19: 291330.
40. Ponte, M., C. Cantoni, R. Biassoni, A. Tradori-Cappai, G. Bentivoglio, C. Vitale,
S. Bertone, A. Moretta, L. Moretta, and M. C. Mingari. 1999. Inhibitory receptors
sensing HLA-G1 molecules in pregnancy: decidua-associated natural killer cells
express LIR-1 and CD94/NKG2A and acquire p49, an HLA-G1-specific receptor.
Proc. Natl. Acad. Sci. USA 96: 5674 5679.
41. Della, C. M., S. Sivori, R. Castriconi, E. Marcenaro, and A. Moretta. 2005.
Pathogen-induced private conversations between natural killer and dendritic
cells. Trends Microbiol. 13: 128 136.
42. Kincy-Cain, T., J. D. Clements, and K. L. Bost. 1996. Endogenous and exoge-
nous interleukin-12 augment the protective immune response in mice orally chal-
lenged with Salmonella dublin. Infect. Immun. 64: 14371440.
43. Bost, K. L., and J. D. Clements. 1995. In vivo induction of interleukin-12 mRNA
expression after oral immunization with Salmonella dublin or the B subunit of
Escherichia coli heat-labile enterotoxin. Infect. Immun. 63: 1076 1083.
44. Altare, F., D. Lammas, P. Revy, E. Jouanguy, R. Doffinger, S. Lamhamedi,
P. Drysdale, D. Scheel-Toellner, J. Girdlestone, P. Darbyshire, et al. 1998. In-
herited interleukin 12 deficiency in a child with bacille Calmette-Guerin and
Salmonella enteritidis disseminated infection. J. Clin. Invest. 102: 20352040.
45. Daniel, Y., M. J. Kupferminc, A. Baram, A. J. Jaffa, G. Fait, I. Wolman, and
J. B. Lessing. 1998. Plasma interleukin-12 is elevated in patients with preeclamp-
sia. Am. J. Reprod. Immunol. 39: 376 380.
46. Zenclussen, A. C., R. Joachim, E. Hagen, C. Peiser, B. F. Klapp, and P. C. Arck.
2002. Heme oxygenase is downregulated in stress-triggered and interleukin-12-
mediated murine abortion. Scand. J. Immunol. 55: 560 569.
47. VanHeyningen, T. K., H. L. Collins, and D. G. Russell. 1997. IL-6 produced by
macrophages infected with Mycobacterium species suppresses T cell responses.
J. Immunol. 158: 330 337.
48. Rose-John, S., J. Scheller, G. Elson, and S. A. Jones. 2006. Interleukin-6 biology
is coordinated by membrane-bound and soluble receptors: role in inflammation
and cancer. J. Leukocyte Biol. 80: 227236.
49. Jones, S. A. 2005. Directing transition from innate to acquired immunity: defining
a role for IL-6. J. Immunol. 175: 34633468.
50. Bleier, J. I., V. G. Pillarisetty, A. B. Shah, and R. P. DeMatteo. 2004. Increased
and long-term generation of dendritic cells with reduced function from IL-6-
deficient bone marrow. J. Immunol. 172: 7408 7416.
51. Bhattacharya, M., N. Ojha, S. Solanki, C. K. Mukhopadhyay, R. Madan, N. Patel,
G. Krishnamurthy, S. Kumar, S. K. Basu, and A. Mukhopadhyay. 2006. IL-6 and
IL-12 specifically regulate the expression of Rab5 and Rab7 via distinct signaling
pathways. EMBO J. 25: 2878 2888.
52. Beeson, J. G., and P. E. Duffy. 2005. The immunology and pathogenesis of
malaria during pregnancy. Curr. Top. Microbiol. Immunol. 297: 187227.
53. Laibl, V. R., and J. S. Sheffield. 2005. Tuberculosis in pregnancy. Clin. Perinatol.
32: 739 747.
54. Brunt, L. M., D. A. Portnoy, and E. R. Unanue. 1990. Presentation of Listeria
monocytogenes to CD8 T cells requires secretion of hemolysin and intracellular
bacterial growth. J. Immunol. 145: 3540 3546.
55. Dudani, R., Y. Chapdelaine, H. H. Faassen, D. K. Smith, H. Shen, L. Krishnan,
and S. Sad. 2002. Multiple mechanisms compensate to enhance tumor-protective
CD8 T cell response in the long-term despite poor CD8 T cell priming ini-
tially: comparison between an acute versus a chronic intracellular bacterium ex-
pressing a model antigen. J. Immunol. 168: 57375745.
56. Bowe, F., C. J. Lipps, R. M. Tsolis, E. Groisman, F. Heffron, and J. G. Kusters.
1998. At least four percent of the Salmonella typhimurium genome is required for
fatal infection of mice. Infect. Immun. 66: 33723377.