G Model

ANIREP-4963; No. of Pages 10 ARTICLE IN PRESS

Animal Reproduction Science xxx (2014) xxxxxx

Contents lists available at ScienceDirect

Animal Reproduction Science

journal homepage: www.elsevier.com/locate/anireprosci

Subdominant hierarchical ovarian follicles are needed

for steroidogenesis and ovulation in laying hens
(Gallus domesticus)
P.L. Rangel a, , A. Rodrguez a , K. Gutirrez a , P.J. Sharp b , C.G. Gutierrez a
a
Universidad Nacional Autnoma de Mxico, Facultad de Medicina Veterinaria y Zootecnia, Av. Universidad 3000,
Col. UNAM, CU. CP 04510, Mexico City, Mexico
b
The Roslin Institute, Royal (Dick) School of Veterinary Studies, University of Edinburgh, Roslin, Midlothian EH25 9PS, UK

a r t i c l e i n f o a b s t r a c t

Article history: Ovarian follicle development in avian species is characterized by a strict hierarchical
Received 23 January 2014 arrangement. The hierarchical follicles secrete progesterone, which induces the LH surge,
Received in revised form 5 April 2014 but the capacity to produce other steroids decreases with development. Our aim was to
Accepted 25 April 2014
evaluate the complementary action of subdominant follicles (F4F6) on ovulation and
Available online xxx
steroidogenesis of the preovulatory follicles (F1F3) in domestic laying hens. The rst
study included four groups: control (C); sham-operated (SO); large hierarchical follicles
Keywords: (LHF) from which F4F6 follicles were extracted; and subdominant hierarchical follicles
LH (SHF) from which F1F3 follicles were extracted. Blood samples were collected every 2 h
StAR from 12 h before estimated ovoposition until 2 h after ovoposition. Egg laying continued
3-HSD at the same rates in C and SO hens, with normal preovulatory surges of oestradiol, testos-
Testosterone terone, progesterone and LH. In contrast, in LHF and SHF groups, ovoposition was blocked;
Progesterone oestradiol concentrations were not affected; but no preovulatory surges of testosterone,
Granulosa
progesterone or LH were seen. Further, the testosterone surge was required for the occur-
rence of progesterone and LH surges. In the second study StAR and steroidogenic enzyme
mRNA expression was evaluated within F1F3 follicles from a LHF group and C-14 and C-8
controls groups, in which follicles were collected 14 h and 8 h before expected ovoposition,
respectively. Extraction of F4F6 follicles caused a signicant reduction in StAR and 3-HSD
expressions within theca, but not in granulosa cells. In conclusion, subdominant hierarchi-
cal follicles (F4F6) are required for the preovulatory release of testosterone, progesterone
and LH, which are highly inter-correlated.
2014 Elsevier B.V. All rights reserved.

1. Introduction have a particular follicular development, with a special

Although avian production for human consumption
is an ancient industry, some reproductive physiological
conditions in birds are poorly understood. Avian species
Corresponding author. Tel.: +52 5556225860; fax: +52 56225935.
E-mail address: eliana@unam.mx (P.L. Rangel).
arrangement of hierarchical and prehierarchical follicles
(Johnson et al., 1993). However, the role of subdominant
follicles within the follicular hierarchical preovulatory fol-
licle growth, maturation and ovulation is not completely
known, although their steroid production is believed to be
complementary in the ovulatory process.
In laying hens the largest ovarian follicles, hierarchi-
cal follicles (F1F7), have sizes between 9 and 35 mm

http://dx.doi.org/10.1016/j.anireprosci.2014.04.011
0378-4320/ 2014 Elsevier B.V. All rights reserved.

Please cite this article in press as: Rangel, P.L., et al., Subdominant hierarchical ovarian follicles are
needed for steroidogenesis and ovulation in laying hens (Gallus domesticus). Anim. Reprod. Sci. (2014),
http://dx.doi.org/10.1016/j.anireprosci.2014.04.011
G Model
ANIREP-4963; No. of Pages 10 ARTICLE IN PRESS
2 P.L. Rangel et al. / Animal Reproduction Science xxx (2014) xxxxxx
in diameter, with the largest follicle ovulating each day
(Gilbert et al., 1983; Johnson, 1996). Further, the patterns
of steroidogenic proles in the maturing ovarian follicle
are well known (Bahr et al., 1983; Porter et al., 1989).
Oestradiol is secreted by the outer theca layer, and its con-
centrations are highest in the smaller yellow yolky follicles
and progressively decrease to low values in the mature F1
preovulatory follicle (Armstrong, 1984; Porter et al., 1989).
Testosterone is mainly released by the inner theca layer in
all the yellow yolky follicles and is lowest in the F1 preovu-
latory mature follicle (Porter et al., 1989; Hernndez-Vrtiz
et al., 1993). Progesterone is produced in the granulosa
layer, with lowest concentrations in the smaller yellow
yolky follicles and highest in the F1 and F2 follicles (Tilly
et al., 1991; Yu et al., 1992).
Steroid hormones produced by the ovary are related to
the ovulatory process in the domestic hen, as ovulation is
preceded by simultaneous surges of progesterone and LH
(Johnson, 1990; Williams and Sharp, 1978; Johnson and
van Tienhoven, 1980), with a positive feedback between
both hormones (Etches and Cunningham, 1976; Imai and
Nalbandov, 1978; Johnson et al., 1985), in which proges-
terone induces the LH peak by stimulating GnRH-I release
(Sterling et al., 1984; Sharp et al., 1989; Fraser and Sharp,
1978). In addition, prior to the progesterone and LH surges,
a preovulatory release of oestradiol occurs (Johnson and
van Tienhoven, 1980; Etches and Cheng, 1981), and is
further preceded by a well-dened testosterone surge
(Williams and Sharp, 1978; Robinson and Etches, 1986;
Robinson et al., 1988).
Oestradiol primes the hypothalamus and enhances
the progesterone stimulation of LH release (Wilson and
Sharp, 1976; Etches, 1990), while testosterone plays a
major role in the ovulatory process, as testosterone immu-
nization or the use of specic testosterone antagonist
blocks ovulation in hens without affecting follicular devel-
opment and blunts the preovulatory surges of progesterone
and LH (Rangel et al., 2005, 2006). Additionally, testos-
terone at physiological or greater concentrations, even
in absence of LH, stimulates granulosa cell progesterone
production in preovulatory and the three largest follicles
in Japanese quails (Sasanami and Mori, 1999) and hens
(Rangel et al., 2006). Further, testosterone increases StAR,
P450scc, and LH receptor mRNA expression in hen granu-
losa cells cultured in vitro (Rangel et al., 2009).
Unlike in mammals, in which the preovulatory follicles
produce all steroids required for ovulation, in avian species
oestradiol and testosterone production is lower in larger
follicles (Johnson, 1990), despite being needed for the ovu-
latory process (Wilson and Sharp, 1976; Etches, 1990;
Rangel et al., 2005, 2006). Therefore, to clarify whether
follicles are complementary, the present study deter-
mined if large hierarchical follicles (2835 mm, F1F3)
need the secretions of the subdominant hierarchical fol-
licles (1025 mm, F4F6) to trigger steroidogenesis and
ovulation of the largest follicle in the laying hen. Two dif-
ferent studies were done. In the rst, we hypothesized
that the removal of subdominant hierarchical follicles, and
hence the absence of their endocrine contribution (E2 and
T), prevents ovulation and preovulatory surges of proges-
terone and LH. In the second study, the hypothesis was that
Please cite this article in press as: Rangel, P.L., et al., Subdominant hierarchical ovarian follicles are
needed for steroidogenesis and ovulation in laying hens (Gallus domesticus). Anim. Reprod. Sci. (2014),
http://dx.doi.org/10.1016/j.anireprosci.2014.04.011
the removal of subdominant hierarchical follicles affects
larger follicles progesterone production by a decreased
mRNA expression of steroidogenic acute regulatory pro-
tein (StAR), P450 cholesterol side-chain cleavage enzyme
(P450scc) and 3-beta-hydroxysteroid dehydrogenase (3-
HSD); and testosterone secretion by a reduction in mRNA
expression of 17-alfa-hydroxylase (17-OH). Further, the
replacement of testosterone, oestradiol or both can restore
gene expression by granulosa and theca cells.
2. Material and methods
2.1. Animals
The Ethics and Animal Welfare Committee of the Facul-
tad de Medicina Veterinaria y Zootecnia, UNAM approved
the animal procedures. Hy-line laying hens (Gallus domes-
ticus) in the middle of their rst laying cycle (40 weeks old)
were used for both studies. Animals were housed in indi-
vidual cages under a 16 h light:8 h dark schedule and had
free access to drinking water and food. Laying was recorded
daily in order to estimate time of ovulation, assuming
that ovulation occurs 1560 min after ovoposition (Etches,
1996).
2.2. Surgical procedure
Animals were anesthetized with halothane (Pollock
et al., 2005) at 4% for induction and 3% for mainte-
nance. Ovarian follicles were removed through a left lateral
celiotomy after lateral and ventral retraction of the proven-
triculus (Bennett and Harrison, 1994). All hens (including
controls) were fasted for 6 h before the rst scheduled
surgery, and food was provided again until the last surgery
was nished (14 h of fasting in total).
2.3. First study: evaluation of the complementarity of
steroid production between hierarchical follicles in laying
hens
Hens were randomly divided into four groups (Fig. 1):
(a) control group (C, n = 6), hens without surgery; (b) sham-
operated group (SO, n = 7) hens anesthetized and subjected
to an exploratory laparotomy, during which counting and
manipulation of the ovarian follicles was performed to
simulate the time taken and manipulation made in the
oophorectomised groups; (c) large hierarchical follicles
group (LHF, n = 6) hens in which the three largest folli-
cles (F1F3) remained and follicles F4F6 were removed;
and (d) subdominant hierarchical follicles group (SHF, n = 8)
hens with the F4F6 largest follicles and excision of the
F1F3 follicles.
After removal of follicles according to the assigned
group (Fig. 1), animals were cannulated in the radial
vein for blood sampling according to our method previ-
ously described (Rangel et al., 2005). All surgeries were
performed 14 h before the estimated time of ovoposi-
tion. Blood samples were taken at 2 h interval, starting
12 h before the estimated laying time and nishing 2 h
after ovoposition. Samples were drawn using 3 mL vacuum
tubes containing sodium heparin. Plasma was separated by
G Model
ANIREP-4963; No. of Pages 10 ARTICLE IN PRESS
P.L. Rangel et al. / Animal Reproduction Science xxx (2014) xxxxxx
Fig. 1. Schematic representation of the rst study, treatments and sample collection. Animal groups: C = control; SO = sham-operated; LHF = large hierar-
chical follicles; and SHF = subdominant hierarchical follicles.
centrifugation at 1500 rpm, and blood cells were resus-
pended in 2.5 mL of sterile saline physiological solu-
tion with 0.5 mg/mL of gentamicine (Bruluart, Tultitlan,
Mexico) and stored at 4 C, until returned to the hens
immediately after the following blood sample was taken.
Catheters were kept patent by ushing with 0.5 mL saline
solution containing 50 UI/mL of heparin (PISA, Guadalajara,
Mexico).
2.3.1. Hormonal assays
Progesterone and testosterone concentrations were
determined by radioimmunoassay (Coat-a-Count, Diag-
nostic Products Corporation, Los Angeles, CA, USA).
Sensitivities of the assays were 0.05 ng and 0.06 ng for
testosterone and progesterone, respectively; the intra-
assay coefcients of variation were 5.1% and 6.54%.
Oestradiol was measured by ELISA (International Immuno-
Diagnostics, CA. USA), with an assay sensitivity of 5.98 pg
and an intra-assay coefcient of variation of 6.21%. LH
was measured by RIA in 60% of samples as previously
described by Sharp et al. (1987) with an assay sensitivity of
0.036 ng/mL and an intra-assay coefcient of variation of
7.6%. All samples were measured in a single assay for each
hormone.
2.4. Second study: evaluation of F4F6 follicular excision
and exogenous testosterone or oestradiol treatment on
steroidogenic enzymes and StAR protein mRNA expression
Hens were randomly assigned to one of the three groups
(Fig. 2): (a) large hierarchical follicles (LHF, n = 20) hens
in which the three largest follicles (F1F3) remain until
slaughter (8 h before next expected ovoposition) and fol-
licles F4F6 were removed at surgery (14 h before next
expected ovoposition); (b) immature follicles (C-14, n = 23),
hens in which follicles F1F3 were extracted by surgery
14 h before next expected ovoposition, and were used to
Please cite this article in press as: Rangel, P.L., et al., Subdominant hierarchical ovarian follicles are
needed for steroidogenesis and ovulation in laying hens (Gallus domesticus). Anim. Reprod. Sci. (2014),
http://dx.doi.org/10.1016/j.anireprosci.2014.04.011
3
compare the effect of time on mRNA expression; and (c)
control (C-8, n = 3) hens that were slaughtered 8 h before
next expected ovoposition, to collect the largest hierar-
chical follicles, which were considered more mature at
that time point, because the proximity to the ovulatory
process. Immediately after surgery, hens from the LHF
group were subdivided and received a single dose of one
of the four steroid treatments: (a) placebo (subgroup P)
hens received 400 l of physiological saline solution (n = 3),
(b) testosterone (subgroup T) animals received 600 ng of
testosterone (Sigma T1500) (n = 6), (c) oestradiol (subgroup
E) animals were treated with 360 ng of 17--estradiol
(Sigma E8875) (n = 6) and (d) testosterone + oestradiol
(subgroup T + E) hens were injected with both testos-
terone and oestradiol at the doses indicated above (n = 5),
to evaluate the effect of steroid replacement. Steroids
were purchased from SigmaAldrich (California), diluted
in physiological saline solution, in a nal volume of 400 l
per hen, and were applied by intramuscular injection. Six
hours after surgery, all animals were slaughtered by cer-
vical dislocation, and remaining hierarchical follicles were
collected to assess follicular StAR protein and steroidogenic
enzyme expression.
2.4.1. mRNA isolation and quantication
Follicles collected, either after surgery or after slaughter,
were immediately processed in the laboratory. Granulosa
and theca cells were isolated from each F1, F2 and F3. We
used 1015 mg of each sample to extract total RNA, with
the UltraClean tissue and an RNA isolation Kit (MoBio). RNA
concentration and purity were calculated using the Ampli-
Quant AQ07 spectro-photometer. A retrotranscription (RT)
was performed in 5 g of total RNA, using Oligo (dT) primer
and RT, as recommended by the manufacturer (SuperScript
First-Strand Kit, Invitrogen). Steroidogenic acute regula-
tory protein (StAR), P450 cholesterol side-chain cleavage
enzyme (P450scc), 3-beta-hydroxysteroid dehydrogenase
G Model
ANIREP-4963; No. of Pages 10 ARTICLE IN PRESS
4 P.L. Rangel et al. / Animal Reproduction Science xxx (2014) xxxxxx

Fig. 2. Schematic representation of the second study treatments and follicle collection. Treatment groups: C-14 = F1F3 control follicles collected 14 h before
expected ovulation; C-8 = F1F3 control follicles collected 8 h before expected ovulation; and LHF = F1F3 follicles collected 6 h after follicular extraction of
the subdominant follicles. Animals in LHF group were further divided into four subgroups that received: P = SSF as a placebo, T = testosterone, E = oestradiol,
and T + E = testosterone plus oestradiol.

(3-HSD), and 17-alfa-hydroxylase (17-OH) cDNA were
quantied by real-time PCR using 8.58 ng of total cDNA and
the primers manufactured by Applied Biosystems, which
are shown in Table 1. Amplication cycles were 50.8 C
for 2 min, 95.8 C for 10 min and then 45 cycles were per-
formed at 95.8 C for 15 s, and 60.8 C for 1 min using
TaqMan Universal PCR Master Mix. The amounts of StAR,
P450scc, 3-HSD, and 17-OH mRNAs expressed in gran-
ulosa or theca cells were estimated from standard cDNA
curves prepared for each gene. Briey, 1 l of each total
cDNA sample was taken and amplied in a PCR reaction
using the same primers as for the real time PCR, at 94 C
for 5 min and then for 40 cycles at 94 C for 15 s and
60 C for 1 min. The amplication products were isolated
by electrophoresis in a 2.5% agarose low-melting point gel
and identied using a transilluminator. The amplication
products were extracted from the gels using the QIAquick
gel extraction Kit (Qiagen), and quantied densitometri-
cally using a spectrophotometer. Total cDNA copies were
calculated as described by Tricarico et al. (2002). The rela-
tionship between quantitative PCR (Ct) values and cDNA
copies in 1 g RNA were determined by regression analy-
ses, which were found to be linear. The number of cDNA
copies for the unknown samples was calculated from the
regression equation. Each standard curve had a range of
1 105 1 1011 copies.
2.5. Statistical analyses
2.5.1. First study
Laying percentage was evaluated by Fischer exact test,
to establish differences between groups. The pretreatment
period considered the 10 days prior to and until the day
after surgery, while the post-treatment period included 5
days starting on the day of the expected ovoposition (two
days after surgery). The acute effect of treatment on ovu-
lation was evaluated on the day after oophorectomy (day
0), approximately 24 h after the expected time for ovulation
(Etches, 1990). Differences in the reinitiation of laying were
estimated by KruskalWallis one-way analysis of variance.
The effect of surgery on ovoposition and on the occur-
rence of steroid and LH surges was evaluated comparing
the control and sham-operated groups. The occurrence of
each hormone surge was analyzed by Chi-square, dening
a surge as an increase of two standard deviations over the
mean concentration of the preceding 4 h.

Table 1
Primers used for the detection of the mRNA by real-time RT-PCR assay. TaqMan gene expression assays: StAR (Gg03338457 g1) and CYP17A1
(Gg03346131 g1).

Target Primer sequence (5 3 ) TaqMan probe (5 3 ) Size (pb) GenBank identication

StAR Data not available ACGGTGGCGGACAACGGAGACAAAG 90 NM 204686.1

For: ACCGTGACTACCGCAACAAG
P450scc-chicken CCTACGGCGTGCTCC 53 NM 001001756
Rev: AGGCCTCCCCTGTCTTGA

3-HSD chicken For: TCAGCAGGGAGGCACTCT

ACTTGCCAAAGCTCC 67 D46763.1
Rev: CCCTTCTAGGATTTTCACCTCAGT

CYP17A1 (17-OH) Data not available GCTGACACCAGCATCGGTGAGTACT 85 NM 001001901.1

Please cite this article in press as: Rangel, P.L., et al., Subdominant hierarchical ovarian follicles are
needed for steroidogenesis and ovulation in laying hens (Gallus domesticus). Anim. Reprod. Sci. (2014),
http://dx.doi.org/10.1016/j.anireprosci.2014.04.011
G Model
ANIREP-4963; No. of Pages 10 ARTICLE IN PRESS
P.L. Rangel et al. / Animal Reproduction Science xxx (2014) xxxxxx 5

Table 2
Presence of hormonal surges in control (C), sham-operated (SO) and hens
from which follicles were removed (large hierarchical follicles, LHF, and
subdominant hierarchical follicles, SHF). Values within the same hormone
that differ are indicated by different letters (P < 0.01).

Group Surge incidence percentage

E2 T P4 LH

C (n = 6) 100a 100a 100a 100a

SO (n = 7) 71a 100a 86a 100a
LHF (n = 6) 67a 17b 33b 33b
SHF (n = 8) 75a 0b 0b 0b

Fig. 3. Laying percentage in hens from control (C, n = 6), sham-operated

(SO, n = 7), large hierarchical follicles (LHF, n = 6) and small hierarchical
follicles (SHF, n = 8) groups, during the pre-treatment period ( = 10 days
including the day of surgery), 2 days after surgery ( = day 0) and the
post-treatment period ( = 5 days including day 0). (*) and (+) indicate
difference vs the control group the day after surgery and during the post-
treatment period respectively (P < 0.001).
Hormonal data were analyzed by ANOVA for repeated
measurements, considering treatment, hen nested within
treatment, time and the interaction between time and
treatment as independent variables. Finally, endocrine
complementation of the follicles was analyzed by Chi-
square to evaluate for independence in the occurrence of
every pair of hormone surges.
2.5.2. Second study
StAR protein and enzyme mRNA expression were evalu-
ated by REML analysis, considering as random variables the
hen, the follicle nested within the hen, and the membrane
nested within the follicle, nested within the hen.
3. Results
3.1. First study: complementarity of steroid production
between hierarchical follicles in laying hens
surgery. Further, in both oophorectomised groups, ovopo-
sition remained lower than in C and SO groups throughout
the post-treatment period (P < 0.001).
Ovoposition continued normally throughout the study
in hens from C and SO groups. In contrast, animals from
the LHF and SHF groups took 3.3 and 3.5 days, respectively,
to restart ovoposition (P < 0.001). Moreover, 3 out of the 8
hens from the SHF group had not resumed laying by day
4, when recording of ovoposition concluded, showing a
greater time to reset for this group.
3.1.2. Effect of oophorectomy on endocrine surges
The frequency of occurrence of hormonal surges
(Table 2) did not differ between C and SO hens (P > 0.05),
further hens showed surges of all studied hormones. Addi-
tionally, oestradiol surge frequency was similar between
all groups (P > 0.05). In contrast, testosterone, progesterone
and LH surge occurrence were signicantly reduced by fol-
licular removal (P < 0.01). In the LHF group two animals
presented testosterone, progesterone or LH surges, how-
ever, they were of lesser magnitude than those of C and SO
groups, and did not stimulate ovulation in the hens.

3.1.1. Effect of oophorectomy on ovoposition 3.1.3. Endocrine complementation

Pretreatment laying percentage (Fig. 3) was similar
(P = 0.68) between groups, with an average of 88%. Ovopo-
sition was not affected by the surgical procedure, as laying
percentage 2 days after surgery was similar between C
and SO groups (100 vs 86, respectively; P = 0.82). In con-
trast, in hens in which follicles were removed (LHF and
SHF groups), ovoposition stopped (P < 0.001) 2 days after
Complementarities of hormone production between
hierarchical follicles showed that surges of testosterone,
progesterone and LH were independent of the oestradiol
surge (P > 0.05). In contrast, surges of progesterone and
LH were dependent on the testosterone surge (P < 0.001).
Finally, the LH surge was highly dependent on the proges-
terone surge (P < 0.001) (Table 3).

Table 3
Matrix of occurrence of the preovulatory hormone surges and their interdependency in ovulation of laying hens.

Hormone Surge Hormone surge dependency

occurrence

Testosterone (%) Progesterone (%) LH (%)

Oestradiol Yes (n = 22) 50 55 59

No (n = 5) 40 40 40
P = 0.686 P = 0.557 P = 0.438

Testosterone Yes (n = 13) 92 100

No (n = 14) 14 14
P < 0.001 P < 0.001

Progesterone Yes (n = 14) 100

No (n = 13) 8
P < 0.001

Please cite this article in press as: Rangel, P.L., et al., Subdominant hierarchical ovarian follicles are
needed for steroidogenesis and ovulation in laying hens (Gallus domesticus). Anim. Reprod. Sci. (2014),
http://dx.doi.org/10.1016/j.anireprosci.2014.04.011
G Model
ANIREP-4963; No. of Pages 10 ARTICLE IN PRESS
6 P.L. Rangel et al. / Animal Reproduction Science xxx (2014) xxxxxx

Fig. 4. Effect of small hierarchical follicle oophorectomy and hormonal treatment on P450scc, StAR and 3-HSD mRNA expression in granulosa (Left panel)
and theca cells (Right panel). Where C-14 = large follicles collected 14 h before the expected ovulation; C-8 = large follicles extracted 8 h before the expected
ovulation and 6 h after oophorectomy without treatment; P = large follicles collected 6 h after oophorectomy of the small follicles, which received SSF as
a placebo, and TX = large follicles collected 6 h after oophorectomy of the small follicles, with a single administration of testosterone, oestradiol or both
hormones immediately after surgery. Values are means of the logarithm of mRNA copies by microgram of cDNA. Expression differs between cell layers.
Differences between groups in the same panel are indicated by different letters (P = 0.04).

3.2. Second study: evaluation of follicular excision and
exogenous testosterone and oestradiol treatments on
steroidogenic enzymes and StAR protein mRNA expression
StAR and all enzyme mRNA expressions were similar for
F1, F2 and F3 follicles (P > 0.05). Therefore, data from these
follicles was pooled for analysis.
Six hours of follicle maturation (groups C-14 vs C-8)
caused a decrease on 3-HSD expressions in granulosa
and theca cells, while no effect was observed on P450scc
and StAR mRNA expression (Fig. 4). When oophorec-
tomy of the small hierarchical follicles was performed,
granulosa cell 3-HSD concentrations remained unal-
tered in this 6 h period (group C-8 vs group P). However,
StAR and 3-HSD mRNA expression decreased in theca
cells (Fig. 4).
No differences were found in mRNA expression of any
steroidogenic enzyme or StAR protein between oophorec-
tomized animals with (T, E and T + E groups) or without
(group P) hormonal administration. Therefore, data from
all hormonal treatment groups were pooled, analyzed and
dened as treatment group (TX) (Figs. 4 and 5).
Expression of mRNA for steroidogenic enzymes and
StAR protein differed between granulosa and theca cells.
P450scc, StAR and 3-HSD were signicantly higher in
granulosa than in theca cells (P = 0.043 for P450scc;
P < 0.001 for StAR and 3-HSD) (Fig. 4). Six hours of fol-
licle maturation (group C-14 vs C-8) caused a decrease on

Please cite this article in press as: Rangel, P.L., et al., Subdominant hierarchical ovarian follicles are
needed for steroidogenesis and ovulation in laying hens (Gallus domesticus). Anim. Reprod. Sci. (2014),
http://dx.doi.org/10.1016/j.anireprosci.2014.04.011
G Model
ANIREP-4963; No. of Pages 10 ARTICLE IN PRESS
P.L. Rangel et al. / Animal Reproduction Science xxx (2014) xxxxxx
Fig. 5. Effect of small hierarchical follicle oophorectomy and hormonal
treatment on 17-OH mRNA expression in theca cells. Where C-14 = large
follicles collected 14 h before the expected ovulation; C-8 = large follicles
extracted 8 h before the expected ovulation and 6 h after oophorectomy
without treatment; P = large follicles collected 6 h after oophorectomy of
the small follicles, which received SSF as a placebo and TX = large follicles
collected 6 h after oophorectomy of the small follicles, which received
testosterone, oestradiol or both hormones. Values are means of logarithm
of number of mRNA copies by microgram of cDNA. Differences between
groups are indicated by different letters (P = 0.04).
17-OH mRNA expression in theca cells, while concentra-
tions remained unaltered when oophorectomy of the small
hierarchical follicles was performed (Fig. 5).
4. Discussion
The present study shows that subdominant hierarchical
follicles are indispensable for the occurrence of the pre-
ovulatory surges of testosterone, progesterone and LH, but
not of oestradiol, in laying hens. Similarly, the testosterone
surge is necessary for progesterone and LH surges to occur.
In addition, subdominant preovulatory follicles affect the
endocrine activity of larger preovulatory follicles.
Higher concentrations of P450scc, StAR and 3-HSD
were found in granulosa cells from the larger follicles.
This was expected, because granulosa cell steroidogenic
capacity increases with steroid production (Porter et al.,
1989; Nitta et al., 1993), and they are the main source
of progesterone production (Huang et al., 1979; Porter
et al., 1989). Similarly, the highest concentrations of these
enzymes were expected in the F1 follicle, since it produces
the preovulatory surge of progesterone (Yu et al., 1992;
Nakamura et al., 1991). However, in our study mRNA con-
centrations for StAR and steroidogenic enzymes did not
differ between the three largest follicles. The absence of
differences may be due to the time of follicle collection
(8 h before expected ovulation), as the preovulatory surge
of progesterone normally occurs 64 h before ovulation
(Johnson and van Tienhoven, 1980) and thus it could have
been missed. Further, it is now known that StAR expression
is regulated by circadian clock genes, involved in the timing
of the preovulatory release of progesterone (Nakao et al.,
2007). Hence, the detailed characterization of steroido-
genic enzyme expression in the follicle as it matures for
ovulation will need to consider the relationship with the
expression of clock genes during the day.
Please cite this article in press as: Rangel, P.L., et al., Subdominant hierarchical ovarian follicles are
needed for steroidogenesis and ovulation in laying hens (Gallus domesticus). Anim. Reprod. Sci. (2014),
http://dx.doi.org/10.1016/j.anireprosci.2014.04.011
7
The high dependence found between testosterone and
progesterone preovulatory surges agrees with our previ-
ous studies (Rangel et al., 2006), which have shown that
blunting the testosterone preovulatory surge, using a spe-
cic testosterone antagonist, acutely blocks ovulation and
the preovulatory progesterone and LH surges in laying
hens (Rangel et al., 2006). Additionally, a local action of
testosterone at the follicular level stimulated progesterone
production by granulosa cells of the largest preovulatory
follicle (F1) in vitro (Rangel et al., 2007). Our present results
suggest that the preovulatory rise of testosterone occurs
by endocrine complementation between hierarchical folli-
cles. As the progesterone and LH preovulatory surges have
a positive feedback (Lage et al., 1975), the dependence
between testosterone and LH surges seen could be indi-
rect, due to the lack of progesterone caused by the absence
of testosterone.
As follicular extraction caused a decrease of testos-
terone and progesterone production in the rst study, we
expected a reduction on StAR protein, P450scc and 3-
HSD expressions in granulosa cells by the same treatment.
Nonetheless, treatment only produced lower expression
of P450scc and 3-HSD within theca cells. These results
suggest that small hierarchical follicles impact larger fol-
licles progesterone production, through their testosterone
production.
It has been previously stated that F2F4 follicles, and
more specically the F3 follicle, are the main sources of
testosterone in the avian ovary (Robinson and Etches,
1986; Johnson and van Tienhoven, 1981; Sechman et al.,
2006). However, a preovulatory increase in testosterone
concentrations was not observed in hens in which small
or large hierarchical follicles were removed (F1F3 and
F4F6 groups). The lack of testosterone surge in hens in
which F4F6 follicles were removed could indicate that
these follicles are responsible for producing testosterone
(Robinson and Etches, 1986). Alternatively, F4F6 follicles
could stimulate F1F3 follicles to produce testosterone and
progesterone. We have previously shown that testosterone
stimulates hen granulosa cell progesterone production
in vitro alone or in combination with LH (Rangel et al.,
2007), and that this stimulatory action of testosterone is
higher when follicles are closer to ovulation (Rangel et al.,
2009). Further, testosterone increased StAR, P450scc and LH
receptor mRNA expression in hen granulosa cells (Rangel
et al., 2009). We now suggest that all hierarchical folli-
cles are needed for the testosterone preovulatory increase
and that the rise in testosterone concentrations is not only
dependent on the F3 follicle.
Seventeen-alfa-hydroxylase is an important enzyme for
testosterone production, and its activity decreases in the
F1 follicle (Nitta et al., 1991). We did not nd differences
in 17-OH mRNA expression between follicle sizes, but we
observed a decrease with time of follicle maturation at the
time when the preovulatory surge of testosterone normally
occurs, which probably caused a depletion of the enzyme.
In addition, this reduction was observed when small hier-
archical follicles were removed and the preovulatory surge
of testosterone did not occur.
The lack of dependence between the oestradiol surge
and ovulation shown in this work is in agreement with the
G Model
ANIREP-4963; No. of Pages 10 ARTICLE IN PRESS
8 P.L. Rangel et al. / Animal Reproduction Science xxx (2014) xxxxxx
study of Lage et al. (1975) in which ovulation in laying
hens occurred independent of the presence of the oestra-
diol preovulatory surge.
The preovulatory oestradiol surge did not depend solely
on subdominant hierarchical follicles (F4F6), as only
61.11% hens from the F4F6 follicle group showed a pre-
ovulatory increase in oestradiol concentration. This could
be related to the results of Armstrong (1984) and Porter
et al. (1989), who found that 50% of aromatase activity
and 85% of oestradiol production is concentrated in ovar-
ian stroma and prehierarchical follicles (Johnson, 1990).
Further, it has been proposed that oestradiol production
decreases proportionally with follicle growth and is null
in the preovulatory follicle (Armstrong, 1984). In addi-
tion, Kawashima et al. (1987) found that oestradiol acts as
an inducer of progesterone receptors at the hypothalamic
level. Taken together, this evidence suggests that oestra-
diol has a longer lasting effect on the hypothalamus for its
ability to respond to progesterone.
In contrast, the surges of testosterone, progesterone and
LH occurred only when subdominant hierarchical follicles
were present, suggesting that secretions of subdominant
follicles are necessary for follicular development and ovu-
lation. Previous studies have demonstrated the secretion of
activin A, inhibin A and IGF-I, with paracrine and autocrine
actions on follicular development and recruitment. For
instance, activin A has a role in keeping hierarchical fol-
licle viability and follicular recruitment (Lovell et al., 1998,
2003), since it increases inhibin A secretion by the F1 fol-
licle and enhances LH and FSH-stimulated secretion of
inhibin A and progesterone (Lovell et al., 2002a). Addi-
tionally, inhibin A has a role in the maintenance of tonic
secretion of FSH (Lovell et al., 2000), and active immu-
nization against inhibin subunit caused an increase in
the number of hierarchical follicles (89.9 mm) and double
ovulations, regulating the entry of follicles to the preovula-
tory hierarchy (Lovell et al., 2001). Finally, IGF-I increases
the stimulatory action of LH and FSH on progesterone and
inhibin A production by preovulatory follicles (Lovell et al.,
2002b), and follicular recruitment from the prehierarchi-
cal follicle pool into the hierarchical category (Hertelendy
et al., 1982). Hence, the absence of subdominant hier-
archical follicles and their secretions could have caused
regression of the large hierarchical follicles and, conse-
quently, the lack of testosterone, progesterone and LH
surges in our study.
The lack of post-treatment egg laying in LHF group sug-
gests that follicular atresia could have occurred in response
to the absence of the subdominant hierarchical follicles.
This is supported by the fact that the average time to
resume egg laying was similar to the reported period for the
rapid follicular growth phase (Johnson, 1990). We suggest
that large hierarchical follicles need the endocrine comple-
mentation of subdominant hierarchical follicles to continue
their development up to ovulation. The follicular regression
that might have occurred in hens with follicle removal may
be compared with induction of moulting in the domestic
chicken, in which hierarchical follicle regression is due to
a reduction in plasma levels of LH and sex steroids (Oguike
et al., 2005), a hormonal environment similar to that found
in oophorectomised hens in this study.
Please cite this article in press as: Rangel, P.L., et al., Subdominant hierarchical ovarian follicles are
needed for steroidogenesis and ovulation in laying hens (Gallus domesticus). Anim. Reprod. Sci. (2014),
http://dx.doi.org/10.1016/j.anireprosci.2014.04.011
We considered the possibility that anaesthesia and
surgical procedures could have a negative effect on fol-
licle development or endocrine secretions, and therefore
included a sham-operated group in the study design. Our
results ruled out any adverse effect of anaesthesia as in
sham-operated hens only one out of eight hens stopped
laying eggs for 4 days while the rest continued laying. The
same could be said for the effect of the food restriction, per-
formed in preparation for the surgical procedure. In laying
hens, food restriction is commonly used to halt egg lay-
ing and induce moulting (Scott et al., 1999; Sgavioli et al.,
2013). In our study, fasting lasted for 14 h, and although
we did not measure food intake, we recorded that all hens
resumed feeding. Hence, the differences in egg laying after
surgery were not affected by fasting as the control and
sham operated hens were subjected to the same fasting
period and did not show the reduction in laying as the
oophorectomised hens.
Finally, treatment with testosterone, oestradiol or both
did not affect expression of any of the mRNA studied. It is
possible that no effect was observed because the time of fol-
licle collection (8 h before ovulation) did not coincide with
the preovulatory surge of progesterone, or that hormonal
doses were ineffective.
5. Conclusions
We conclude that prehierarchical follicles contribute
to the preovulatory increase of oestradiol. In addition,
subdominant hierarchical follicles are necessary to sup-
port large hierarchical follicle development. Finally, we
propose that, for proper production of testosterone, pro-
gesterone and LH, the entire hierarchical follicle range must
be present in the hen ovary, and that the testosterone pre-
ovulatory surge is needed for ovulation.
Conict of interest
None of the authors has any nancial or personal rela-
tionships that could inappropriately inuence or bias the
content of the paper.
Acknowledgements
This work was supported by CONACyT, Mxico, project
number CB-82846 and by the Women Academic Support
Program (PFAMU) of UNAM (grant number PI200906). Dr.
P.J. Sharp thanks Roslin Institute for access to research facil-
ities. Part of this data was presented as a requirement to
obtain a bachelors degree by Gutierrez K.
References
Armstrong, D.G., 1984. Ovarian aromatase activity in the domestic fowl
(Gallus domesticus). J. Endocrinol. 100, 8186.
Bahr, J.M., Wang, S.C., Huang, M.Y., Calvo, F.O., 1983. Steroid concentra-
tions in isolated theca and granulosa layers of preovulatory follicles
during the ovulatory cycle of the domestic hen. Biol. Reprod. 29,
326334.
Bennett, R.A., Harrison, G.J., 1994. Soft tissue surgery. In: Ranson, W.,
Harrison, G.J., Harrison, L.R. (Eds.), Avian Medicine: Principles and
Applications. , 3rd ed. Wingers Publishing, Florida, pp. 10961136.
G Model
ANIREP-4963; No. of Pages 10 ARTICLE IN PRESS
P.L. Rangel et al. / Animal Reproduction Science xxx (2014) xxxxxx
Etches, R.J., 1990. The ovulatory cycle of the hen. Crit. Rev. Poult. Biol. 2,
293313.
Etches, R.J., 1996. Reproduction in Poultry. CAB International, Cambridge,
pp. 318319.
Etches, R.J., Cheng, K.W., 1981. Changes in plasma concentrations of
luteinizing hormone, progesterone, oestradiol and testosterone and
in the binding of follicle stimulating hormone to the theca of follicles
during the ovulation cycle of the hen (Gallus domesticus). J. Endocrinol.
91, 1122.
Etches, R.J., Cunningham, F.J., 1976. The interrelationship between pro-
gesterone and luteinizing hormone during the ovulatory cycle of the
hen (Gallus domesticus). J. Endocrinol. 71, 5158.
Fraser, H.M., Sharp, P.J., 1978. Prevention of positive feedback in the hen by
antibodies to luteinizing hormone releasing hormone. J. Endocrinol.
76, 181182.
Gilbert, A.B., Perry, M.M., Waddington, D., Hardie, M.A., 1983. Role of atre-
sia in establishing the follicular hierarchy in the ovary of the domestic
hen (Gallus domesticus). J. Reprod. Fertil. 69, 221227.
Hernndez-Vrtiz, A., Gonzlez del Pliego, M., Velzquez, P., Pedernera, M.,
1993. Morphological changes in the thecal layer during the maturation
of the preovulatory ovarian of the domestic fowl (Gallus domesticus).
Gen. Comp. Endocr. 92, 8087.
Hertelendy, F., Linter, F., Asem, E.K., Raab, B., 1982. Synergistic effect of
gonadotropin releasing hormone on LH-stimulated progesterone pro-
duction in granulosa cells of the domestic fowl (Gallus domesticus).
Gen. Comp. Endocr. 48, 117122.
Huang, E.S., Kao, K.J., Nalbandov, A.V., 1979. Synthesis of sex steroids by
cellular components of chicken follicles. Biol. Reprod. 20, 454461.
Imai, K., Nalbandov, A.V., 1978. Plasma and follicular steroid levels of lay-
ing hens after the administration of gonadotropins. Biol. Reprod. 19,
779784.
Johnson, A.L., 1996. The avian ovarian hierarchy: a balance between follicle
differentiation and atresia. Poult. Avian Biol. Rev. 7, 99110.
Johnson, A.L., 1990. Steroidogenesis and actions of steroids in the hen
ovary. Crit. Rev. Poult. Biol. 2, 319346.
Johnson, P.A., Shu-Yin, W., Brooks, C., 1993. Characterization of source and
levels of plasma immunoreactive inhibin during the ovulatory cycle
of the domestic hen. Biol. Reprod. 48, 262267.
Johnson, A.L., van Tienhoven, A., 1980. Plasma concentrations of six
steroids and LH during the ovulatory cycle of the hen, Gallus domes-
ticus. Biol. Reprod. 23, 386393.
Johnson, A.L., van Tienhoven, A., 1981. Hypophyseal sensitivity to hor-
mones in the hen. II. Plasma concentration of LH, progesterone, and
testosterone. Biol. Reprod. 25, 153161.
Johnson, P.A., Johnson, A.L., van Tienhoven, A., 1985. Evidence for a positive
feedback interaction between progesterone and luteinizing hormone
in the induction of ovulation in the hen, Gallus domesticus. Gen. Comp.
Endocr. 58, 478485.
Kawashima, M., Kamiyoshi, M., Tanaka, K., 1987. Presence of estrogen
receptors in the hen hypothalamus and pituitary. Endocrinology 120,
582588.
Lage, P.C., van Tienhoven, A., Cunningham, F.J., 1975. Concentration of
estrogens, progesterone and LH during the ovulatory cycle of the lay-
ing chicken (Gallus domesticus). Biol. Reprod. 12, 590598.
Lovell, T.M., Gladwell, R.T., Cunningham, F.J., Groome, N.P., Knight, P.G.,
1998. Differential changes in inhibin a, activin a, and total a sub-
unit levels in granulosa and theca layers of developing preovulatory
follicles in the chicken. Endocrinology 139, 11641171.
Lovell, T.M., Gladwell, R.T., Groome, N.P., Knight, P.G., 2002a. Modulatory
effects of gonadotropin-induced secretion of inhibin A and proges-
terone by granulosa cells from preovulatory (F1F3) chicken follicles.
Reproduction 124, 649657.
Lovell, T.M., Gladwell, R.T., Groome, N.P., Knight, P.G., 2002b. Differential
effect of activin A on basal and gonadotropins and insulin-like growth
factor on the secretion of inhibin A and progesterone by granulosa
cells from chicken preovulatory (F1F3) follicles. Reproduction 123,
291300.
Lovell, T.M., Gladwell, R.T., Groome, N.P., Knight, P.G., 2003. Ovarian follicle
development in the laying hen is accompanied by divergent changes
in inhibin A, inhibin B, activin A and follistatin production in granulosa
and theca layer. J. Endocrinol. 177, 4555.
Lovell, T.M., Knight, P.G., Groome, N.P., Gladwell, R.T., 2001. Changes in
plasma inhibin A during sexual maturation in the female chicken
and the effects of active immunization against inhibin subunit on
reproductive hormone proles and ovarian function. Biol. Reprod. 64,
188196.
Lovell, T.M., Vanmonfort, D., Bruggeman, V., Decuypere, E., Groome,
N.P., Knight, P.G., Gladwell, R.T., 2000. Circulating concentrations of
inhibin-related proteins during the ovulatory cycle of the domestic
Please cite this article in press as: Rangel, P.L., et al., Subdominant hierarchical ovarian follicles are
needed for steroidogenesis and ovulation in laying hens (Gallus domesticus). Anim. Reprod. Sci. (2014),
http://dx.doi.org/10.1016/j.anireprosci.2014.04.011
9
fowl (Gallus domesticus) and after induced cessation of egg laying. J.
Reprod. Fertil. 119, 323328.
Nakamura, T., Funabashi, M., Tanabe, Y., 1991. In vitro studies on steroido-
genesis in the presence of pregnenolone as precursors by the follicular
tissue of the domestic fowl (Gallus domsticus). J. Steroid Biochem. Mol.
Biol. 38, 105110.
Nakao, N., Yasuo, S., Nishimura, A., Yamamura, T., Watanabe, T., Anraku, T.,
Okano, T., Fukada, Y., Sharp, P.J., Ebihara, S., Yoshimura, T., 2007. Circa-
dian clock gene regulation of steroidogenic acute regulatory protein
gene expression in preovulatory ovarian follicles. Endocrinology 148,
30313038.
Nitta, H., Osawa, Y., Bahr, J., 1991. Multiple steroidogenic cell popula-
tions in the thecal layer of preovulatory follicles of the chicken ovary.
Endocrinology 129, 20332040.
Nitta, H., Manson, J.I., Bahr, J.M., 1993. Localization of 3-hydroxysteroid
dehydrogenase in the chicken ovarian follicle shifts from the theca
layer to granulosa layer with follicular maturation. Biol. Reprod. 48,
110116.
Oguike, M.A., Igboeli, G., Ibe, S.N., Ironkwe, M.O., 2005. Physiological and
endocrinological mechanisms associated with ovulatory cycle and
induced-moulting in the domestic chicken a review. World Poult.
Sci. 61, 625632.
Pollock, C., Carpenter, J.W., Antinoff, N., 2005. Birds. In: Carpenter, J.W.
(Ed.), Exotic Animal Formulary. Elsevier Saunders, Saint Louis, MO,
pp. 199212.
Porter, F.E., Hargis, B.M., Silsby, J.L., Halawani, M.E., 1989. Differential
steroid production between theca interna and theca externa cells:
a three-cell model for follicular steroidogenesis in avian species.
Endocrinology 125, 109116.
Rangel, P.L., Lassala, A., Gutirrez, C.G., 2005. Testosterone immunization
blocks the ovulatory process in laying hens without affecting ovarian
follicular development. Anim. Reprod. Sci. 86, 143151.
Rangel, P.L., Rodrguez, A., Gutierrez, C.G., 2007. Testosterone directly
induces progesterone production and interacts with physiological
concentrations of LH to increase granulosa cell progesterone produc-
tion in laying hens (Gallus domesticus). Anim. Reprod. Sci. 102, 5665.
Rangel, P.L., Rodrguez, A., Rojas, S., Sharp, P.J., Gutierrez, C.G., 2009.
Testosterone stimulates progesterone production and STAR, P450
cholesterol side-chain cleavage and LH receptor mRNAs expression in
hen (Gallus domesticus) granulosa cells. Reproduction 138, 961969.
Rangel, P.L., Sharp, P.J., Gutierrez, C.G., 2006. Testosterone antagonist (u-
tamide) blocks ovulation and preovulatory surges of progesterone,
luteinizing hormone and oestradiol in laying hens. Reproduction 131,
11091114.
Robinson, F.E., Etches, R.J., 1986. Ovarian steroidogenesis during follicular
maturation in the domestic fowl (Gallus domesticus). Biol. Reprod. 35,
10961105.
Robinson, F.E., Etches, R.J., Anderson-Langmuir, C.E., Burke, W.H., Cheng,
K.W., Cunningham, F.J., Ishii, S., Sharp, P.J., Talbot, R.T., 1988. Steroido-
genic relationships of gonadotrophins hormones in the ovary of the
hen (Gallus domesticus). Gen. Comp. Endocrinol. 69, 455466.
Sasanami, T., Mori, M., 1999. Effects of oestradiol-17 and testosterone on
progesterone production in the cultured granulosa cells of Japanese
quail. Brit. Poult. Sci. 40, 536540.
Scott, T.A., Silversides, D., Swift, M.L., 1999. Effect of feed form, formula-
tion, and restriction on the performance of laying hens. Can. J. Anim.
Sci. 79, 171178.
Sechman, A., Lakota, P., Wojtysiak, D., Hrabia, A., Mika, M., Lisowski, M.,
Czekalski, R.J., Kapkowska, E., Bednarczyk, M., 2006. Sex steroids level
in blood plasma and ovarian follicles of the chimeric chicken. J. Vet.
Med. A: Physiol. Pathol. Clin. Med. 10, 501508.
Sgavioli, S., Filardi, R.S., Praes, M.F., Domingues, C.H., Pileggi, J., Andrade,
P.C., Boleli, I.C., Junqueira, O.M., 2013. Dietary ber inclusion as an
alternative to Feed Fasting to induce molting in commercial layers.
Rev. Bras. Cienc. Avic. 15, 365370.
Sharp, P.J., Dunn, I.C., Talbot, R.T., 1987. Sex differences in the LH responses
to chicken LHRH-I and II in the domestic fowl. J. Endocrinol. 115,
323331.
Sharp, P.J., Talbot, R.T., Macnamee, M.C., 1989. Evidence for the involve-
ment of dopamine and 5-hydroxytryptamine in the regulation of the
preovulatory release of luteinizing hormone in the domestic hen. Gen.
Comp. Endocr. 76, 205213.
Sterling, R.J., Gasc, J.M., Sharp, P.J., Tuohimaa, P., Baulieu, E.E., 1984.
Absence of nuclear progesterone receptor in LH releasing hormone
neurones in laying hens. J. Endocrinol. 102, R5R7.
Tilly, J.L., Kowalski, K.I., Johnson, A.L., 1991. Cytochrome P450 side-chain
cleavage (P450scc) in the hen ovary. II. P450scc messenger RNA,
immunoreactive protein, and enzyme activity in developing granulosa
cells. Biol. Reprod. 45, 474967.
G Model
ANIREP-4963; No. of Pages 10 ARTICLE IN PRESS
10 P.L. Rangel et al. / Animal Reproduction Science xxx (2014) xxxxxx

Tricarico, A., Pinzani, P., Bianchi, S., Paglierani, M., Distante, V., Pazzaglia,
M., Bustin, S.A., Orlando, C., 2002. Quantitative real-time reverse tran-
scription polymerase chain reaction: normalization to rRNA or single
housekeeping genes is inappropriate for human tissue biopsies. Anal.
Biochem. 309, 293300.
Williams, J.B., Sharp, P.J., 1978. Control of the preovulatory surge of
luteinizing hormone in the hen (Gallus domesticus): the role of pro-
gesterone and androgens. J. Endocrinol. 77, 5765.
Wilson, S.C., Sharp, P.J., 1976. Effects of androgens, oestrogens
and deoxycorticosterone acetate on plasma concentrations
of luteinizing hormone in laying hens. J. Endocrinol. 69, 93
102.
Yu, M.W., Robinson, F.E., Etches, R.J., 1992. Quantication of ovarian
steroidogenesis in the domestic fowl by incubation of intact large
follicles. Poult. Sci. 71, 346351.

Please cite this article in press as: Rangel, P.L., et al., Subdominant hierarchical ovarian follicles are
needed for steroidogenesis and ovulation in laying hens (Gallus domesticus). Anim. Reprod. Sci. (2014),
http://dx.doi.org/10.1016/j.anireprosci.2014.04.011