G Model

JIPH-731; No. of Pages 5 ARTICLE IN PRESS

Journal of Infection and Public Health xxx (2017) xxx–xxx

Contents lists available at ScienceDirect

Journal of Infection and Public Health

journal homepage: http://www.elsevier.com/locate/jiph

Characterization of carbapenemases, ESBLs, and plasmid-mediated

quinolone determinants in carbapenem-insensitive Escherichia coli
and Klebsiella pneumoniae in Riyadh hospitals
Mohamed H. Al-Agamy a,b,∗ , Abduelah Aljallal a , Hesham H. Radwan a , Atef M. Shibl c
a
Department of Pharmaceutics, Microbiology Division, College of Pharmacy, King Saud University, Riyadh, Saudi Arabia
b
Department of Microbiology and Immunology, Faculty of Pharmacy Al-Azhar University, Cairo, Egypt
c
College of Medicine, Alfaisal University, Riyadh, Saudi Arabia

a r t i c l e i n f o a b s t r a c t

Article history: The main objective of this work was to characterize carbapenemases, extended-spectrum ␤-lactamases
Received 1 November 2016 (ESBLs), and plasmid-mediated quinolone resistance (PMQR) among carbapenem-insensitive Klebsiella
Received in revised form 14 February 2017 pneumoniae and Escherichia coli clinical isolates which were isolated from three hospitals in Riyadh.
Accepted 27 March 2017
Thirty-one carbapenem-insensitive isolates (21 K. pneumoniae and 10 E. coli) were recovered from March
2014 to May 2014. Susceptibility testing and phenotypic detection tests were used to characterize the
Keywords:
classes of ␤-lactamases. PCR assays were performed for the detection of the genes encoding ESBL (blaCTX-M ,
OXA-48
blaTEM, blaSHV , and blaOXA-1 ), carbapenemase (blaKPC, blaGES, blaVIM , blaIMP , blaNDM , and blaOXA-48 ), and PMQR
NDM
Carbapenem resistance
(qnrA, qnrB, qnrS, aac(6)-Ib-cr, qepA, oqxA, and oqxB) genes. All carbapenem-insensitive isolates were car-
Saudi Arabia bapenemase producers, with 41.9% and 58.1% being class B carbapenemases class D OXA-48, respectively.
While the prevalence of ESBL producers was 80.6%. The following resistance genes were detected; OXA-
48-like (58.1%), NDM-type (41.9%), CTX-M-1-like (77.4%), CTX-M-9-like (9.6%), TEM-1 (74.2%), OXA-1
(54.8%), SHV-1 (4.4%), qnrS (58.1%), qnrB (3.2%), and aac(6)-Ib-cr (51.6%). The predominant carbapen-
emases in the isolates that had carbapenem MIC ≤ 4 ␮g/ml and MIC ≥ 12 ␮g/ml were blaOXA-48-type and
blaNDM-type respectively. CTX-M-1-like and qnrS were the dominant ESBL and PMQR genes, respectively.
This is the first report in which qnrS was described in the isolates from Saudi Arabia.
© 2017 The Authors. Published by Elsevier Limited on behalf of King Saud Bin Abdulaziz University
for Health Sciences. This is an open access article under the CC BY-NC-ND license (http://
creativecommons.org/licenses/by-nc-nd/4.0/).

Introduction published in Sweden in 2009 and in Turkey in 2003, respectively

Resistance to third-generation cephalosporins is mainly caused
by infections with AmpC ␤-lactamases- and extended-spectrum ␤-
lactamases (ESBL)-producing Enterobacteriaceae. The carbapenem
utilization has been increased after the emergence of resis-
tance to third-generation cephalosporins. However, extensive
use of carbapenems has led to the emergence of carbapenem-
resistant enterobacterial isolates [1]. Carbapenem resistance among
Enterobacteriaceae is principally due to the production of carbapen-
emases. The less frequent mechanisms are the overproduction of
AmpC-mediated ␤-lactamases or ESBLs in organisms with porin
mutations [2–4]. NDM-1 and OXA-48 are the predominant mech-
anisms of carbapenem resistance in Enterobacteriaceae [3]. The
initial reports of the NDM-1 and OXA-48 encoding genes were
[5,6]. In Saudi Arabia, diminutive has been recognized about the
characterization of carbapenemase-producing Enterobacteriaceae
[7–11]. For that reason, 31 carbapenem-insensitive Escherichia coli
and Klebsiella pneumoniae were analyzed over 3 months to eluci-
date the prevalence rate of carbapenemase-producing E. coli and
K. pneumoniae isolated from the clinical specimens of patients
from three different hospitals in Riyadh. Furthermore, we char-
acterized the carbapenemase genotype variants and determined
the ESBL and PMQR genes among carbapenemase-producing iso-
lates.
Material and methods
Bacterial isolates

∗ Corresponding author at: Pharmaceutics Department, College of Pharmacy, King Thirty one Enterobacteriaceae clinical isolates (21 K. pneumoniae
Saud University, P.O. Box 2457, Riyadh 11451, Saudi Arabia. and 10 E. coli) had imipenem MIC ≥ 0.5 ␮g/ml were investigated.
E-mail address: elagamy71@yahoo.com (M.H. Al-Agamy). The strains were isolated over a three-month period, from March

http://dx.doi.org/10.1016/j.jiph.2017.03.010
1876-0341/© 2017 The Authors. Published by Elsevier Limited on behalf of King Saud Bin Abdulaziz University for Health Sciences. This is an open access article under the
CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).

Please cite this article in press as: Al-Agamy MH, et al. Characterization of carbapenemases, ESBLs, and plasmid-mediated quinolone
determinants in carbapenem-insensitive Escherichia coli and Klebsiella pneumoniae in Riyadh hospitals. J Infect Public Health (2017),
http://dx.doi.org/10.1016/j.jiph.2017.03.010
G Model
JIPH-731; No. of Pages 5 ARTICLE IN PRESS
2 M.H. Al-Agamy et al. / Journal of Infection and Public Health xxx (2017) xxx–xxx

Table 1
Primers used in this study.

Gene Primers Sequence Reference

TEM MultiTSO-T for CATTTCCGTGTCGCCCTTATTC Dallenne et al. [15]

MultiTSO-T rev CGTTCATCCATAGTTGCCTGAC
SHV MultiTSO-S for AGCCGCTTGAGCAAATTAAAC
MultiTSO-S rev ATCCCGCAGATAAATCACCAC
OXA-1 MultiTSO-O for GGCACCAGATTCAACTTTCAAG
MultiTSO-O rev GACCCCAAGTTTCCTGTAAGTG
CTX-M group 1 MultiCTXMGp1 for TTAGGAARTGTGCCGCTGYA
MultiCTXMGp1-2 rev CGATATCGTTGGTGGTRCCAT
CTX-M group 2 MultiCTXMGp2 for CGTTAACGGCACGATGAC
MultiCTXMGp1-2 rev CGATATCGTTGGTGGTRCCAT
CTX-M group 9 MultiCTXMGp9 for TCAAGCCTGCCGATCTGGT
MultiCTXMGp9 rev TGATTCTCGCCGCTGAAG
CTX-M group 8/25 CTX-Mg8/25 for AACRCRCAGACGCTCTAC
CTX-Mg8/25 rev TCGAGCCGGAASGTGTYAT

NDM NDM-1-for GGTTTGGCGATCTGGTTTTC Poirel et al. [14]

NDM-1-rev CGGAATGGCTCATCACGATC

IMP MultiIMP for TTGACACTCCATTTACDG Dallenne et al. [15]

MultiIMP rev GATYGAGAATTAAGCCACYCT
VIM MultiVIM for GATGGTGTTTGGTCGCATA
MultiVIM rev CGAATGCGCAGCACCAG
KPC MultiKPC for CATTCAAGGGCTTTCTTGCTGC
MultiKPC rev ACGACGGCATAGTCATTTGC
OXA-48 MultiOXA-48 for GCTTGATCGCCCTCGATT
MultiOXA-48 rev GATTTGCTCCGTGGCCGAAA
GES MultiGES for GES-F AGTCGGCTAGACCGGAAAG
MultiGES rev GES-R TTTGTCCGTGCTCAGGAT

qnrA QnrAm-F AGAGGATTTCTCACGCCAGG Cattoir et al. [16]

QnrAm-R TGCCAGGCACAGATCTTGAC
qnrB QnrBm-F GGMATHGAAATTCGCCACTG
QnrBm-R TTTGCYGYYCGCCAGTCGAA
qnrS QnrSm-F GCAAGTTCATTGAACAGGGT
QnrSm-R TCTAAACCGTCGAGTTCGGCG

aac (6 )-Ib-cr aac (6 )-Ib-cr-F TTGCGATGCTCTATGAGTGGCTA Park et al. [17]
aac (6 )-Ib-cr-R CTCGAATGCCTGGCGTGTTT

qepA qepAF AACTGCTTGAGCCCGTAGAT Kim et al. [18]

qepAR GTCTACGCCATGGACCTCAC

oqxA oqxAF AGTCCATACCAACCTCGTCTCC Ni et al. [19]

oqxAR GCGTGGCTTTGAACTCTGC
oqxB oqxBF CCACCCTTAACTGATCCCTAA
oqxBR CGCCAGCTCATCCTTCAC

through to May 2014, from patients hospitalized in three different
hospitals in Riyadh.
The clinical isolates were identified using Gram staining,
colony morphologies on MacConkey’s agar, and with biochemi-
cal tests using the VITEK 2 system (bioMérieux, Marcy l’Etoile,
France). The strains were stored in glycerol broth cultures at
−70 ◦ C.
Antibiotic susceptibility testing
Minimum inhibitory concentrations (MICs) of piperacillin (PIP),
piperacillin/tazobactam (TZP), cefotaxime (CTX), ceftazidime
(CAZ, ceftazidime/ceftazidime + clavulanic acid (CAZ/CAL),
cefepime (FEP), cefoxitin (FOX), aztreonam (ATM), imipenem
(IMI), IMI/IMI + EDTA (IMI/IMD) meropenem (MRP), ertapenem
(ERT), doripenem (DOR), temocillin (TM), ciprofloxacin (CIP),
gentamicin (GM), amikacin (AK), colistin (COL), tigecycline (TGC),
and fosfomycin (FOS) were determined by an Etest (bioMérieux,
Marcy l’Etoile, France) [12]. Breakpoints of the British Society for
Antimicrobial Chemotherapy (BSAC) were used to detect TM and
COL susceptibility [13]. E. coli ATCC 25922 strains were used as the
control strains.
Phenotypic detection methods for carbapenemase activity
Carbapenemase production was confirmed for isolates with an
MIC of imipenem ≥0.5 ␮g/ml by a modified Hodge test (MHT). The
MHT was conducted according to the CLSI 2014 guidelines [12]. Iso-
lates with cloverleaf images in the inhibition zone were considered
as carbapenemase-producing isolates. Etest IMI/IMD metallo-beta-
lactamase (MBL) strips were used to analyze the production of
MBLs. A ratio of the MICs of IMI to IMD of ≥8 or the presence of
a phantom zone was interpreted as being positive for class B MBL
production. For class A carbapenemases, an IMI disc and an IMI
disc + phenylboronic acid (PBA) was used. The zone of inhibition of
the IMI disc was compared to the zones of inhibition of the IMI + PBA
disc. If an IMI + PBA disc showed a zone difference of ≥4 mm from
the IMI disc, the isolates were recorded as demonstrating class A
carbapenemase activity. If an IMI disc has not been inhibited by
EDTA and/or PBA and showed resistance to the temocillin (TM) disc,
the isolate was recorded as having class D OXA-48 activity.
Phenotypic detection of ESBL
Etest ESBL strips were used to analyze the production of ESBL.
CAZ/CAL ESBL Etest strips were used. The test was considered pos-
itive if a ≥8-fold reduction was observed in the MIC of CAZ/CAL

Please cite this article in press as: Al-Agamy MH, et al. Characterization of carbapenemases, ESBLs, and plasmid-mediated quinolone
determinants in carbapenem-insensitive Escherichia coli and Klebsiella pneumoniae in Riyadh hospitals. J Infect Public Health (2017),
http://dx.doi.org/10.1016/j.jiph.2017.03.010
G Model
JIPH-731; No. of Pages 5 ARTICLE IN PRESS
M.H. Al-Agamy et al. / Journal of Infection and Public Health xxx (2017) xxx–xxx 3

Table 2
Clinical data, minimum inhibitory concentrations (MICs), and resistance profiles of 10 Escherichia coli and 21 Klebsiella pneumoniae clinical isolates producing OXA-48 or
NDM-1. (For interpretation of the references to color in this table legend, the reader is referred to the web version of this article.)

Clinical data E test MIC (mg/L)

Isolate NO Resistance genes

Date of isolation
Hospital Specimen PIP TZP CTX CAZ CAZ/CAL FEP FOX ATM IMI IMI/IMD MRP ERT DOR TM CI GM AK COL TGC FOS
(mm-yyyy)

EC1 A Urine 03/2014 >256 >256 >256 >256 >32/>4 >256 1.5 >256 >32 64/<1 2 6 4 8 >32 0.5 12 <0.016 0.25 1.5 NDM+CTX-M-1+TEM+qnrS+aac(6)-Ib-cr

EC2 A Blood 03/2014 >256 >256 >256 >256 >32/>4 64 16 >256 >32 64/<1 3 6 1.5 4 >32 1.5 32 1.5 0.38 2 NDM+CTX-M-1+CTX-M-9+TEM+qnrS+aac(6)-Ib-cr

EC3 A Urine 04/2014 >256 >256 >256 >256 >32/>4 128 64 >256 1 <4/<1 0.75 0.75 0. 5 128 >32 24 4 1.5 0.125 2 OXA-48+CTX-M-1+TEM+OXA-1+qnrS+aac(6)-Ib-cr

EC4 A Urine 04/2014 >256 >256 >256 >256 >32/>4 >256 2 >256 2 <4/<1 1.5 0.75 1 >256 >32 24 4 1.5 0.125 1.5 OXA-48+CTX-M-1+TEM+OXA-1+qnrS+aac(6)-Ib-cr

EC5 B Urine 04/2014 >256 >256 >256 >256 >32/>4 32 >256 >256 2 <4/<1 0.75 0.5 1 192 >32 8 3 2 0.25 1.5 OXA-48+CTX-M-1+TEM+OXA-1+qnrS+aac(6)-Ib-cr

EC6 B Sputum 04/2014 >256 >256 >256 >256 >32/>4 192 4 >256 1 <4/<1 0.25 0.75 0.38 128 >32 192 6 2 0.25 1.5 OXA-48+CTX-M-1+TEM+OXA-1+qnrS+aac(6)-Ib-cr

EC7 C Urine 04/2014 >256 >256 >256 >256 >32/>4 >256 8 48 12 12/<1 6 12 8 8 >32 256 >256 1 0.25 1.5 NDM+TEM

EC8 C Blood 04/2014 >256 >256 >256 >256 >32/>4 >256 32 64 >32 128/<1 >32 >32 >32 32 >32 192 >256 0.75 0.25 0.75 NDM+TEM

EC9 C Urine 04/2014 >256 >256 >256 >256 >32/>4 24 1 16 >32 48/<1 3 8 2 12 >32 256 >256 1 0.38 1.5 NDM+TEM

EC10 C Urine 05/2014 >256 >256 >256 >256 >32/>4 48 0.5 32 >32 94/<1 24 24 8 48 >32 512 >256 4 0.38 1.5 NDM+TEM

KP1 A Urine 3/2014 >256 >256 >256 >256 >32/>4 >256 >256 >256 >32 48/<1 6 6 8 8 >32 48 8 0.5 0.19 1 NDM+CTX-M-1+CTX-M-9+TEM+qnrS+aac(6)-Ib-cr

KP2 A Blood 3/2014 >256 >256 >256 >256 >32/>4 >256 >256 >256 >32 48/<1 2 6 2 8 >32 1 6 0.38 0.5 4 NDM+CTX-M-1+TEM+OXA-1+qnrS+aac(6)-Ib-cr

KP3 A Urine 3/2014 >256 >256 >256 >256 >32/>4 >256 >256 >256 >32 48/<1 2 6 2 12 >32 16 12 2 0.5 3 NDM+CTX-M-1+TEM+qnrS+aac(6)-Ib-cr

KP4 C Urine 3/2014 >256 >256 >256 >256 >32/>4 >256 >256 >256 >32 128/<1 16 6 24 >256 >32 0.75 12 0.5 0.75 8 NDM+CTX-M-1+OXA-1

KP5 C Urine 3/2014 >256 >256 >256 >256 >32/>4 >256 >256 0.125 >32 64/<1 4 6 1.5 >256 >32 8 >256 0.19 0.75 2 NDM+CTX-M-1+OXA-1

KP6 C Sputum 4/2014 >256 >256 >256 >256 >32/>4 >256 >256 >256 24 24/<1 4 6 4 196 >32 128 16 4 0.5 4 NDM+CTX-M-1+TEM+aac(6)-Ib-cr

KP7 A Urine 4/2014 >256 >256 >256 >256 >32/>4 >256 >256 >256 1 <4/<1 0.25 0.75 0.19 128 >32 32 2 0.5 0.25 0.75 OXA-48+CTX-M-1+TEM+OXA-1+qnrS+aac(6)-Ib-cr

KP8 B Blood 03/2014 >256 >256 >256 >256 >32/>4 >256 >256 >256 2 <4/<1 0.38 1 0.125 192 >32 48 2 0.75 0.125 1 OXA-48+CTX-M-1+TEM+OXA-1+qnrS

KP9 B Urine 03/2014 >256 >256 >256 >256 >32/>4 >256 >256 >256 1 <4/<1 0.25 0.5 0.125 128 >32 32 4 1.5 0.25 1 OXA-48+CTX-M-1+TEM+OXA-1+qnrS+aac(6)-Ib-cr

KP10 B Urine 03/2014 >256 >256 >256 >256 >32/>4 >256 >256 >256 1 <4/<1 0.38 1 0.125 128 >32 24 6 1 0.19 1.5 OXA-48+CTX-M-1+TEM+OXA-1+qnrS+aac(6)-Ib-cr

KP11 C Sputum 04/2014 >256 >256 >256 >256 >32/>4 >256 >256 >256 0.75 <4/<1 0.25 0.5 0.25 >256 >32 24 3 0.5 0.25 1.5 OXA-48+CTX-M-1+TEM+OXA-1+qnrS

KP12 C Blood 04/2014 >256 >256 >256 >256 >32/>4 >256 >256 >256 1 <4/<1 0.5 0.5 0.38 128 >32 32 4 1.5 0.19 1.5 OXA-48+CTX-M-1+OXA-1+qnrS+aac(6)-Ib-cr

KP13 C Urine 04/2014 >256 >256 >256 >256 >32/>4 >256 >256 >256 2 <4/<1 0.38 0.5 1 128 >32 16 3 1.5 0.125 1.5 OXA-48+CTX-M-1+TEM+OXA-1+qnrS

KP14 C Urine 04/2014 >256 >256 >256 >256 >32/>4 >256 >256 >256 1 <4/<1 0.75 0.5 0.38 128 >32 16 2 1 0.125 1 OXA-48+CTX-M-1+TEM+OXA-1+qnrS+aac(6)-Ib-cr

KP15 A Urine 04/2014 >256 >256 >256 >256 >32/>4 >256 >256 >256 1 <4/<1 0.38 0.5 0.75 64 >32 32 4 1 0.125 1 OXA-48+CTX-M-1+TEM+OXA-1+qnrS

KP16 A Blood 05/2014 >256 >256 >256 >256 >32/>4 32 48 128 2 <4/<1 1 2 1 >256 4 16 4 0.5 0.75 3 OXA-48+CTX-M-1+qnrB

KP17 A Urine 05/2014 >256 >256 >256 >256 >32/>4 96 >256 >256 1 <4/<1 0.19 0.5 0.125 >256 0.064 1.5 3 1 0.5 16 OXA-48+CTX-M-1

KP18 B Urine 4/2014 >256 >256 >256 >256 >32/>4 >256 >256 >256 4 4/<1 0.5 2 0.38 192 >32 192 >256 0.5 0.38 1 OXA-48+CTX-M-1+TEM

KP19 A Urine 5/2014 >256 >256 >256 1 0.5/0.125 8 >256 8 >32 48/<1 12 12 12 6 0.047 0.5 96 0.5 0.75 6 NDM +CTX-M-9

KP20 B Sputum 4/2014 >256 >256 8 0.5 0.25/0.125 8 96 0.75 4 <4/<1 6 24 6 64 >32 256 32 1 1 16 OXA-48+ SHV+OXA-1+aac(6)-Ib-cr

KP21 A Blood 5/2014 >256 >256 8 0.5 0.25/0.125 8 16 0.75 2 <4/<1 2 1 2 64 >32 128 64 1.5 0.75 24 OXA-48+ SHV

PIP: piperacillin, TZB: tazobactam, CTX: cefotaxime, CAZ: ceftazidime, CAZ/CAL: ceftazidime/clavulanic acid, FEP: cefepime, FOX: cefoxitin, ATM: aztreonam, IMI/IMD:
imipenem/imipenem + EDTA, MRP: meropenem, ERT: ertapenem, DOR: doripenem, TM: temocillin, CPI: ciprofloxacin, GM: Gentamicin; AK; amikacin, COL: colistin, TGC:
tigecycline, FOS: fosfomycin.
Values highlighted in gray: resistant, values highlighted in yellow: intermediate, and non-highlighted values: sensitive.

compared with the MIC of CAZ alone or if a phantom zone or Results

deformed ellipse was present. Cloxacillin (200 ␮g/ml) was incor-
porated in the agar to inhibit AmpC ˇ-lactamase. Susceptibility and phenotypic results

The whole results are illustrated in Table 2. All 31 carbapenem-

insensitive isolates were shown cloverleaf images in the inhibition
Detection of the antibiotic resistance-encoding genes zones and were considered carbapenemase-producing isolates.
Etest IMI/IMD MBL strips were applied to the 31 carbapenemase-
The released DNA by boiling method was used as template in positive isolates, with 13 (41.9%) giving a positive result. The
polymerase chain reaction (PCR). Techne Flexigene Thermocycler prevalence rate of MBL in the E. coli and K. pneumoniae isolates was
(Techne, Duxford, Cambridge, UK) was used. Positive and negative 60% (n = 6/10) and 33.3% (n = 7/21), respectively. Unlike phenotypic
controls were included in all PCR assays. methods for detection of classes A and B, there were not any isolate
PCR amplification was conducted for seeking the carbapene- showing inhibition by PBA and consequently our isolates were neg-
mase genes (blaKPC, blaGES, blaVIM , blaIMP , blaNDM , and blaOXA-48 ), ative for Class A carbapenemase. The CAZ/CAL ESBL Etest strip was
ESBL genes (blaTEM , blaSHV , blaOXA-1 , blaCTX-M-1 group, blaCTX-M-2 applied to the 31 carbapenemase-positive isolates with 25 (80.6%)
group, blaCTX-M-8 group, blaCTX-M-9 group, and blaCTX-M-25 group) giving a positive result. The ESBL prevalence was 60% (n = 6/10) and
and PMQR genes (qnrA, qnrB, and qnrS, aac(6)-Ib-cr, qepA, and 90.5% (n = 19/21) for E. coli and K. pneumoniae isolates, respectively.
oqxA and oqxB) by using previously described primers (Table 1) All collected E. coli isolates had IMI MIC with range from 1 to
and methodology [13–18] genes. PCR products for aac(6 )-Ib were 128 ␮g/ml. The resistance rates for IMI, ERT, DOR, and MRP were
subjected to digestion with BstF51 (New England Biolabs, USA) to 60%, 60%, and 40%,30%, respectively; all the collection was resistant
discriminate the original gene and its aac(6 )-Ib-cr variant [16]. to PIP, TZP, CTX, CAZ, FEP, ATM, and CIP; and 70%, 50%, 40%, 30%

Please cite this article in press as: Al-Agamy MH, et al. Characterization of carbapenemases, ESBLs, and plasmid-mediated quinolone
determinants in carbapenem-insensitive Escherichia coli and Klebsiella pneumoniae in Riyadh hospitals. J Infect Public Health (2017),
http://dx.doi.org/10.1016/j.jiph.2017.03.010
G Model
JIPH-731; No. of Pages 5 ARTICLE IN PRESS
4 M.H. Al-Agamy et al. / Journal of Infection and Public Health xxx (2017) xxx–xxx
and 10% of the isolates were resistant to GM, TM, AK, FOX, and COL
respectively. The whole collection was sensitive to TGC, and FOS.
All the 21 K. pneumonaie isolates had IMI MIC with range from
0.75 to 128 ␮g/ml. The resistance rates to ERT, IMI, MRP, and DOR
were 47.6%, 42.9%, 42.9%, and 23.8%, respectively; all the isolates
were resistant to PIP, TZP, and CTX; and 95.2% were resistant to
FOX; 85.7% were resistant to CAZ, FEP and CIP; and FEP; 81% were
resistant to ATM and TM; 76.2% and 19% were resistant to GM and
AK, respectively; and 4.8% were resistant to COL. All isolates were
sensitive to TGC, and FOS.
Prevalence of carbapenemases and ESBLs
Among the 21 K. pneumoniae isolates, 7 (33.3%) and 14 (66.7%)
were blaNDM-1 - and blaOXA-48 -positive, respectively. Among the
10 E. coli isolates, 6 (60%) and 4 (40%) were blaNDM-1 - and
blaOXA-48 -positive, respectively. The prevalence of blaCTX-M was
90.5% (n = 19/20) and 60% in K. pneumoniae and E. coli isolates,
respectively. The resistance encoding gene CTX-M-9-like was
detected in two K. pneumoniae isolates either alone or concomi-
tantly with CTX-M-1-like. CTX-M-9-like was detected in one E. coli
isolate and concomitant with CTX-M-1-like.
Prevalence of PMQR
Among the PMQR tested genes, only qnr and aac(6)-Ib-cr were
detected. Six E. coli isolates harbored both qnrS and aac(6)-Ib-cr
genes while 13 K. pneumoniae isolates harbored qnr genes (qnrS,
n = 12, and qnrB, n = 1). Moreover, aac(6)-Ib-cr was detected in 10
K. pneumoniae isolates. Eight of them were associated with qnrS.
Discussion
Until recently, carbapenem was the only remaining option
for treating serious MDR enterobacterial infections. However,
widespread utilization of carbapenems has led to the emergence
of carbapenem-resistant enterobacterial isolates [1], necessitating
alteration to COL, and TGC as last-resort antibiotics [20]. Our results
showed that 15 (48.4%) and two (6.5%) isolates were resistant to IMI
and COL. The emergence of COL resistance was reported previously
in Saudi Arabia [10] and our study documented this finding. The
authors reported that three OXA-48-positive K. pneumoniae iso-
lates were COL resistance [10]. Fortunately, the whole collection is
still sensitive to TGC and FOS.
E. coli, K. pneumoniae, and other Gram-negative bacteria develop
resistance to carbapenems via the production of carbapene-
mases and/or the reduction in outer membrane permeability.
Carbapenemases remain the most clinically important mechanism
of carbapenem resistance. Class A carbapenemase include KPC
and GES, while metallo-beta-lactamases (MBL) include VIM, IMP,
and NDM. The reported class D carbapenemases are OXA-48-like
enzymes [21,22].
We analyzed 31 isolates had IMI MIC ≥ 0.5 ␮g/ml, and deter-
mined the prevalence of carbapenemases among them. The MHT
results showed that the tested isolates were 100% carbapenemase
positive. From the IMI/IMD MBL strip results, 13 (41.9%) out of the
31 isolates that were MBL-positive were inhibited by EDTA. There
was not any isolate was inhibited by PBA and consequently they did
not produce class A carbapenemases. Until now, there is not any
available phenotypic method for detecting class D OXA-48. Latest
studies exhibited that the resistance to TM maybe indicate class
D OXA-48 activity [23]. Fifteen out of 18 OXA-48-positive isolates
showed high levels of resistance to TM (MIC ≥ 128 ␮g/ml), while
the three OXA-48-positive isolates showed high resistance to TM
as well but their MICs were 64 ␮g/ml. Moreover, three out of 13
NDM-type-positive isolates showed high levels of resistance to TM
Please cite this article in press as: Al-Agamy MH, et al. Characterization of carbapenemases, ESBLs, and plasmid-mediated quinolone
determinants in carbapenem-insensitive Escherichia coli and Klebsiella pneumoniae in Riyadh hospitals. J Infect Public Health (2017),
http://dx.doi.org/10.1016/j.jiph.2017.03.010
(MIC ≥ 196 ␮g/ml). Therefore, molecular tests could overcome this
shortcoming of phenotypic detection tests.
K. pneumoniae and E. coli that produce blaOXA-48 and blaNDM-1
are becoming increasingly prevalent and reported in diverse of the
world including the Middle East and Saudi Arabia. We first reported
OXA-48-like genes in E. coli from Riyadh hospitals. OXA-48 and
NDM-type are the dominant carbapenemases in E. coli and K. pneu-
moniae with prevalences of 58% and 42%, respectively. The findings
of several studies are in agreement with our findings [7,9,10].
However, previous study reported that blaNDM-1 was the prevail-
ing carbapenemase gene (46.5%) followed by the blaOXA-48- like
gene (32.5%) [8]. In this study, there was no association between
NDM and OXA-48. Numerous studies based in Saudi Arabia are
in agreement with our study [9,10]. However, other researchers
have confirmed an association between NDM and OXA-48 genes
[8]. Neither blaIMP , blaVIM, blaGES, nor blaKPC were detected in the
carbapenemase-positive isolates. Low levels of carbapenem resis-
tance (MIC ≤ 4 ␮g/ml) were mediated by the OXA-48 like gene
while high levels of carbapenem resistance (MIC ≥ 12 ␮g/ml) were
mediated by NDM-type genes.
Interestingly, the strains that produced the most carbapene-
mases (78.12%; 25/31) carried the CTX-M ESBL genes. We found
that the prevalence of ESBL among carbapenemase-producing K.
pneumoniae strains (90.5%; 9/21) was higher than carbapenemase-
producing E. coli strains. The prevalence of CTX-M-1-like genes
(75%; 24/31) was higher than CTX-M-9-like genes (9.67%; 3/31).
The CTX-M-9-like gene was detected in only one K. pneumoniae
isolate, concomitant with CTX-M-1-like.
Noticeably, all the OXA-48-producing E. coli isolates (n = 4) also
produced ESBL (a CTX-M-1 type) together with OXA-1, TEM, qnrS,
and aac(6)-Ib-cr.
Our results revealed that the qnrS and aac(6)-Ib-cr genes are
the dominant PMQR among E. coli and K. pneumoniae. Our results
showed that qnrS was the most frequently encountered PMQR gene
(61.3; 19/31) followed by the aac(6)-Ib-cr gene (51.6%; 16/31).
Qnr B was detected in only one K. pneumoniae isolate. Notably, all
qnrS-positive E. coli (100%; 6/6) and most qnrS-positive K. pneumo-
niae isolates (61.5%; 8/13) had both aac(6 )-1b-cr and qnr genes.
Neither qnrA, qepA, oqxA nor oqxB genes were detected in the
carbapenemase-positive isolates. Our study was in agreement with
a previous study in Saudi Arabia [24]. The authors reported that the
aac(6 )-1b-cr gene was the most prevalent PMQR followed by qnrB
then qnrA [24]. In the present study, qnrS was the most prevalent,
which was not detected by a previous study [24]. Only one K. pneu-
moniae isolate harbored the qnrB gene but qnrA was not detected
at all.
Conclusions
Despite their high carbapenem and low COL resistance, TGC and
FOS remain 100% susceptible. We documented the high prevalence
of carbapenemase-producing E. coli and K. pneumoniae in Riyadh
hospitals. In addition to any isolate showed reduced susceptibility
to carbapenem must be screened for carbapenemase. The use of
phenotypic methods coupled with molecular genotypic testing for
the detection of carbapenemase-producing isolates is more defini-
tive and useful. To date, OXA-48 and NDM-type are the dominant
carbapenemases circulating in Saudi Arabia. Controlling the spread
and limiting the impact of carbapenemase-producing isolates in
Saudi hospitals will require intensive efforts in both the public and
private healthcare centers.
Funding
No funding sources.
G Model
JIPH-731; No. of Pages 5 ARTICLE IN PRESS
M.H. Al-Agamy et al. / Journal of Infection and Public Health xxx (2017) xxx–xxx
Competing interests
None declared.
Ethical approval
Not required.
Acknowledgments
The authors extend their appreciation to the Deanship of Scien-
tific Research at King Saud University for funding the work through
the research group Project no. RGP-038.
We are grateful to Mr. Muneer Ibraheem Mohammed Hussein
for his technical assistance during the collection of the isolates and
antimicrobial susceptibility testing.
References
[1] Wang X, Chen G, Wu X, Wang L, Cai J, Chan EW, et al. Increased prevalence
of carbapenem resistant Enterobacteriaceae in hospital setting due to cross-
species transmission of the bla NDM-1 element and clonal spread of progenitor
resistant strains. Front Microbiol 2015;6:595.
[2] Demir Y, Zer Y, Karaoglan I. Investigation of VIM, IMP, NDM-1, KPC AND OXA-48
enzymes in Enterobacteriaceae strains. Pak J Pharm Sci 2015;28:1127–33.
[3] Nordmann P, Dortet L, Poirel L. Carbapenem resistance in Enterobacteriaceae:
here is the storm! Trends Mol Med 2012;18:263–72.
[4] Nordmann P, Naas T, Poirel L. Global spread of carbapenemase-producing Enter-
obacteriaceae. Emerg Infect Dis 2011;17:1791–8.
[5] Yong D, Toleman MA, Giske CG, Cho HS, Sundman K, Lee K, et al. Characteri-
zation of a new metallo-␤-lactamase gene, blaNDM-1 , and a novel erythromycin
esterase gene carried on a unique genetic structure in Klebsiella pneumoniae
sequence type 14 from India. Antimicrob Agents Chemother 2009;53:5046–54.
[6] Poirel L, Heritier C, Tolun V, Nordmann P. Emergence of oxacillinase-
mediated resistance to imipenem in Klebsiella pneumoniae. Antimicrob Agents
Chemother 2004;48:15–22.
[7] Memish ZA, Assiri A, Almasri M, Roshdy H, Hathout H, Kaase M, et al. Molecular
characterization of carbapenemase production among gram-negative bacteria
in Saudi Arabia. Microb Drug Resist 2015;21(3):307–14.
[8] Sonnevend Á, Ghazawi AA, Hashmey R, Jamal W, Rotimi VO, Roshdy AM,
et al. Characterization of carbapenem-resistant Enterobacteriaceae with high
rate of autochthonous transmission in the Arabian peninsula. PLoS One
2015;10(6):e0131372.
[9] Al-Agamy MH, Shibl AM, Elkhizzi NA, Meunier D, Turton JF, Livermore DM.
Persistence of Klebsiella pneumoniae clones with OXA-48 or NDM carbapene-
mases causing bacteraemias in a Riyadh hospital. Diagn Microbiol Infect Dis
2013;76(2):214–6.
Please cite this article in press as: Al-Agamy MH, et al. Characterization of carbapenemases, ESBLs, and plasmid-mediated quinolone
determinants in carbapenem-insensitive Escherichia coli and Klebsiella pneumoniae in Riyadh hospitals. J Infect Public Health (2017),
http://dx.doi.org/10.1016/j.jiph.2017.03.010
5
[10] Shibl A, Al-Agamy M, Memish Z, Senok A, Khader SA, Assiri A. The emergence
of OXA-48- and NDM-1-positive Klebsiella pneumoniae in Riyadh, Saudi Arabia.
Int J Infect Dis 2013;17(12):e1130–03.
[11] Zowawi HM, Balkhy HH, Walsh TR, Paterson DL. ␤-Lactamase production in key
gram-negative pathogen isolates from the Arabian Peninsula. Clin Microbiol
Rev 2013;26(3):361–80.
[12] Clinical and Laboratory Standards Institute (CLSI). Performance standards for
antimicrobial susceptibility testing; Twenty-fourth informational supplement
performance standards for antimicrobial susceptibility testing. Document
M100-24. Wayne, PA, USA: Clinical and Laboratory Standards Institute (CLSI);
2014.
[13] British Society on Antimicrobial Chemotherapy (BSAC). Methods for Antimi-
crobial Susceptibility Testing—Version 14. Available from: http://bsac.org.
uk/wp-content/uploads/2012/02/BSAC-Susceptibility-testing-version-14.pdf.
[Last accessed 5 January 2015].
[14] Poirel L, Walsh TR, Cuvillier V, Nordmann P. Multiplex PCR for detection of
acquired carbapenemase genes. Diagn Microbiol Infect Dis 2011;70:119–23.
[15] Dallenne C, Da Costa A, Decreı́ D, Favier C, Arlet G. Development of a set of multi-
plex PCR assays for the detection of genes encoding important beta-lactamases
in Enterobacteriaceae. J Antimicrob Chemother 2010;65:490–5.
[16] Cattoir V, Poirel L, Rotimi V. Multiplex PCR for detection of plasmid mediated
quinolone resistance qnr genes in ESBL-producing enterobacterial isolates. J
Antimicrob Chemother 2007;60:394–7.
[17] Park CH, Robicsek A, Jacoby GA, Sahm D, Hooper DC. Prevalence in the United
States of aac(6 )-Ib-cr encoding a ciprofloxacin-modifying enzyme. Antimicrob
Agents Chemother 2006;50:3953–5.
[18] Kim HB, Park CH, Kim CJ, Kim EC, Jacoby GA, Hooper DC. Prevalence of
plasmid-mediated quinolone resistance determinants over a 9-year period.
Antimicrobial Agents Chemother 2009;53:639–45.
[19] Ni Q, Tian Y, Zhang L, Jiang C, Dong D, Li Z, et al. Prevalence and quinolone
resistance of fecal carriage of extended-spectrum ␤-lactamase-producing
Escherichia coli in 6 communities and 2 physical examination center popula-
tions in Shanghai, China. Diagn Microbiol Infect Dis 2016;86(4):428–33.
[20] Osei Sekyere J, Govinden U, Bester LA, Essack SY. Colistin and tige-
cycline resistance in carbapenemase-producing Gram negative bacteria:
emerging resistance mechanisms and detection methods. J Appl Microbiol
2016;121(3):601–17.
[21] Sonnevend Á, Ghazawi A, Alqahtani M, Shibl A, Jamal W, Hashmey R, et al.
Plasmid-mediated colistin resistance in Escherichia coli from the Arabian Penin-
sula. Int J Infect Dis 2016;50:85–90.
[22] Jeon JH, Lee JH, Lee JJ, Park KS, Karim AM, Lee CR, et al. Structural basis for
carbapenem-hydrolyzing mechanisms of carbapenemases conferring antibi-
otic resistance. Int J Mol Sci 2015;16:9654–92.
[23] Woodford N, Pike R, Meunier D, Loy R, Hill R, Hopkins KL. In vitro activity
of temocillin against multidrug-resistant clinical isolates of Escherichia coli,
Klebsiella spp. and Enterobacter spp, and evaluation of high-level temocillin
resistance as a diagnostic marker for OXA-48 carbapenemase. J Antimicrob
Chemother 2014;69:564–7.
[24] Shibl AM, Al-Agamy MH, Khubnani H, Senok AC, Tawfik AF, Livermore DM.
High prevalence of acquired quinolone-resistance genes among Enterobacte-
riaceae from Saudi Arabia with CTX-M-15 ␤-lactamase. Diagn Microbiol Infect
Dis 2012;73(4):350–3.