Kaohsiung Journal of Medical Sciences (2016) 32, 501e506

Available online at www.sciencedirect.com

ScienceDirect

journal homepage: http://www.kjms-online.com

Original article

Detection of Haemophilus influenzae type b,

Streptococcus agalactiae, Streptococcus
pneumoniae and Neisseria meningitidis
in CSF specimens of children suspicious
of Meningitis in Ahvaz, Iran
Mansour Amin, Mozhgan Ghaderpanah, Tahereh Navidifar*

Health Research Institute, Infectious and Tropical Diseases Research Center, Ahvaz
Jundishapur University of Medical Sciences, Ahvaz, Iran

Received 9 May 2016; accepted 19 August 2016

Available online 30 September 2016

KEYWORDS Abstract Meningitis is a life-threatening infection associated with a high mortality and
Bacterial meningitis; morbidity worldwide. Neisseria meningitidis, Haemophilus influenzae, and Streptococcus
Haemophilus pneumoniae are the most prevalent infectious agents that cause bacterial meningitis (BM).
influenzae; The objective of this study was to determine the frequencies of these three bacteria using bac-
Neisseria terial cultures and polymerase chain reaction (PCR). In our cross-sectional study, cerebrospinal
meningitidis; fluid (CSF) specimens were obtained from 196 patients who were suspected of having BM and
Streptococcus referred to the pediatric ward of Abuzar Hospital (Ahvaz, Iran). The samples were monitored
agalactiae; by gram stain, cultures, and the PCR method. The patients’ age mean was 23
0.56 months.
Streptococcus The 196 patients comprised 92 (46.9%) boys and 104 (53.06%) girls. Based on bacterial cultures,
pneumoniae just three isolates of H. influenzae were detected. However, PCR detected this bacterium in
eight patients. Streptococcus pneumoniae was detected in five (2.5%) patients by the amplifi-
cation of the lytA gene and in one (0.5%) patient by ply. In this study, no N. meningitidis isolate
was in the CSF samples, based on the bacterial culture or PCR results. Streptococcus agalactiae
was detected only in one patient, based on PCR. In conclusion, in the present study, the PCR
method was more sensitive and rapid than culture for detecting the infectious agents in BM.
For this reason, this diagnosis method is recommended for BM.
Copyright ª 2016, Kaohsiung Medical University. Published by Elsevier Taiwan LLC. This is an
open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/
by-nc-nd/4.0/).

Conflicts of interest: All authors declare no conflicts of interest.

* Corresponding author. Health Research Institute, Infectious and Tropical Diseases Research Center, Ahvaz Jundishapur University of
Medical Sciences, Golestan Street, Ahvaz, Iran.
E-mail address: roya_67@ymail.com (T. Navidifar).

http://dx.doi.org/10.1016/j.kjms.2016.08.009
1607-551X/Copyright ª 2016, Kaohsiung Medical University. Published by Elsevier Taiwan LLC. This is an open access article under the
CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).
502
Introduction
Bacterial meningitis (BM) in infants and children usually de-
velops after the colonized bacteria in the nasopharynx area
are disseminated through the blood stream. After bacter-
emia develops, the microorganisms penetrate the blood-
brain barrier and reach the subarachnoid space [1]. Bacterial
meningitis is a medical emergency and a life-threatening
condition in infants and children [2,3]. The most common
manifestation of BM in childhood is insidious with nonspecific
symptoms that progress over 2e5 days before meningitis is
diagnosable. A delay in the diagnosis and treatment of BM
could lead to irreversible brain damage; therefore, the
diagnosis and early treatment of the causative agents are
vital [4,5]. To minimize adverse outcomes, the early clinical
suspicion and implementing appropriate antimicrobial
therapy are essential [6,7]. Bacterial meningitis causes
125,000 deaths annually in infants and young children.
Furthermore, 96% of these deaths occur in developing
countries. Up to 50% of these children die and 25e50% of the
survivors have subsequent neurological complications such
as epilepsy, mental retardation, or sensory neural deafness
[8,9]. The most common etiologic agents of acute BM are
Haemophilus influenzae type b (Hib), Streptococcus pneu-
moniae, and Neisseria meningitidis. These three bacteria
have accounted for 90 percent cases of BM in the infants and
children under 4 weeks of ages [10].
The distribution of BM among infants and children in Iran
is at variable frequencies of 2.9e64.5% [11,12]. In Iran, the
statistical records show that, after Hib, S. pneumoniae is
the most common cause of BM in children under 5 years old
[10]. The relatively recent introduction of Hib vaccine in
the routine immunization programs of children has
remarkably reduced Hib meningitis in Iran and other
developing countries [13]. Group B streptococcus (GBS) is
also a cause of infection during the first weeks of life, [i.e.,
late onset GBS disease (7 days to 3 months old)], and may
involve community or nosocomial acquisition [14]. Cere-
brospinal fluid (CSF) is the most appropriate sample for a
diagnosis of BM; therefore, lumbar puncture is the gold
standard method and should be performed for all suspected
cases of meningitis, unless contraindicated [15]. Moreover,
the detection rates of bacteria in the CSF samples may be
as high as 90 percent, while in blood samples about 50
percent positive results are observed by each method [16].
Various diagnostic assays exist for diagnosing BM such as
CSF examination (e.g., gram staining, CSF cell count and
differential cell count, and the concentration of protein
and glucose), bacterial culture, latex agglutination, PCR,
loop-mediated isothermal amplification method, micro-
array, immune chromatography, and fluorescence in situ
hybridization [2]. In developing countries, the standard
methods for the laboratory diagnosis of BM are gram
staining of the CSF and bacterial culture [7]. However,
these approaches may have some limitations with regard to
the relatively low rapidity and sensitivity [17].
A CSF culture is the reference method for a diagnosis of
BM, and it is especially essential for determining antimi-
crobial susceptibility [8]. The main limitations of a bacte-
rial culture are that it requires at least 2 days to allow the
bacteria to grow and it has a low sensitivity. However,
M. Amin et al.
bacterial culture sensitivity can be improved by the
centrifugation of a larger volume of sample.
Polymerase chain reaction has an important role in the
identification of bacteria in BM and may be recommended if
gram staining and the cultural identification of the samples
have failed; however, PCR is not a diagnostic routine test
[18]. The main advantages of PCR versus bacterial culture
are it does not require a viable bacteria and it has a high
sensitivity [6].
On the other hand, a clear hallmark of BM is the influx of
activated leukocytes, particularly granulocytes, into the
CSF. The persistence of granulocytes in this region rather
than clearance of the infectious agents contributes to the
extensive neuronal damage [19].
To our knowledge, there has not been any adequate
research on the detection of Hib, S. agalactiae, Strepto-
coccus pneumonia and Neisseria meningitidis in CSF spec-
imens of children in Ahvaz, Iran who are suspected of
having BM. For this reason, we investigated the frequencies
of these four bacteria in CSF specimens using bacterial
cultures and the PCR technique.
Materials and methods
Study design
This study was conducted from September 2014 to March
2015 from samples collected at a children’s hospital, Abu-
zar Hospital, in Ahvaz, Iran. The study was approved by the
Research Ethics Committee of Ahvaz Jundishapur University
of Medical Sciences (Ahvaz, Iran). Informed consent forms
were completed by the patients’ relatives for the patient’s
to be included in the study. In this study, a pediatrician
performed 196 lumbar punctures on infants and children
under 5 years old who were suspected of having BM. For
sampling, the children suspected of having meningitis were
defined as those presenting with one or more clinical
symptoms of meningitis such as nausea, vomiting, irrita-
bility, fever, headache, neck stiffness, a bulging fontanel,
abnormal reflex seizures, coma, and lack of alertness [19].
The specimens were transported to the laboratory of the
university on ice bags. Three milliliters of CSF was collected
in three sterile tubes. The first tube was used for analyzing
the cell count and the protein and glucose concentrations;
the second tube was centrifuged and its sedimentation was
used for the bacterial culture test and the preparation of a
direct smear; and the third tube was used for DNA extrac-
tion and PCR.
The assay of biochemical factors
A laboratory technician at Abuzar Hospital (Ahvaz, Iran)
measured the concentrations of glucose and protein and
the CSF cell count and differential cell count. The data
were collected.
The bacterial isolation by bacterial culture
One milliliter of CSF was centrifuged at 3000 g for 20 mi-
nutes. Its sediment was inoculated onto Blood Agar (Merck,
Bacterial meningitis in Ahvaz, Iran 503

Germany) and Chocolate agar. A direct smear was also culture in 14 (7.14%) of the 196 patients. The amplification
established for gram staining. The plates were incubated at results of these bacteria are shown in Figures 1 and 2. The
37 C for 48e72 hours. Bacteria colonies were identified by diagnosis of BM was detected by the bacterial culture of
colony morphology, optochin sensitivity, catalase and oxi- the CSF in 3 (1.5%) of 196 patients and by PCR in 14 (7.14%)
dase tests, and their requirement for X and/or V factors. patients. The frequency of Hib was 4.08% (eight patients).
Furthermore, Hib was detected in three patients by bac-
The bacterial identification by PCR terial culture and PCR, but this bacterium was recognized
in the five remaining patients only by PCR. Streptococcus
pneumoniae was detected in five (2.5%) patients by
A volume of 200 mL CSF was placed in a 1.5-mL microtube.
amplification of the lytA gene and in one (0.5%) patient by
Deoxyribonucleic acid (DNA) was extracted using the High
ply. Furthermore, in total, S. pneumoniae was recognized
Pure PCR Template Preparation Kit (Roche Diagnosis, Man-
only by amplifications of ply and lytA genes. In this study,
nheim, Germany) in accordance with the manufacturer’s
no N. meningitidis isolate was detected in the CSF sam-
procedure. The primer sets used to identify Neisseria
ples, based on bacterial culture or PCR. Streptococcus
meningitidis, S. pneumoniae, Hib, and GBS, and the gene
agalactiae was detected by PCR in only one patient. In our
targets are listed in Table 1. A multiplex PCR to 50 mL vol-
study, gram staining for 13 patients was positive: four
umes was prepared as follows: 25ml 2x master mix (Ampli-
smears contained gram-negative coccobacilli and nine
qon, Odense, Denmark), 0.6 pmol/mL of each primer and
100 ng of the DNA sample. Amplification was performed in a
thermal cycler (Eppendorf, Hamburg, Germany) and cor-
responded to one cycle at 95 C for 2 minutes, 30 cycles at
95 C for 30 seconds, 59.8 C for 30 seconds, 72 C for
90 seconds, and a final extension cycle at 72 C for 5 mi-
nutes. The PCR products were visualized on 1% and 2%
agarose gels stained with ethidium bromide. The standard
strains used in our study were Hib ATCC 10211, N. menin-
gitidis ATCC 35561, S. agalactiae ATCC 12386, and S.
pneumoniae ATCC 33400.

Statistical analysis

The sensitivity, specificity, negative predictive value (NPV),

and positive predictive value (PPV) were calculated for the
PCR technique, and compared to culture as the gold stan-
dard test. Statistical tests were performed by SPSS version
16.00 (SPSS Statistics, Inc., Chicago, IL, USA).

Figure 1. The amplification results on two agarose gel. Lane

Results
In this cross-sectional study, CSF samples were obtained
from 196 infants and children under 5 years old wo were
suspected of having BM. Their age mean was
2.1
0.25 years and the boy:girl ratio was 1.13:1. Bac-
terial meningitis was confirmed by PCR or/and bacterial
1, the ladder of 50 base pairs (cinnagene_Iran); Lane 2, the
negative control (i.e., water); Lane 3, the positive controls,
which include Haemophilus influenzae type b ATCC 10211,
Neisseria meningitidis ATCC 35561, and Streptocuccus pneu-
moniae ATCC 33400; Lanes 4e9, 11, and 12 H. influenzae type
b (bex) isolates from CSF. Lane 10, a clinical sample of S.
pneumoniae (ply).

Table 1 The primer sets used in our study.

Gene microorganism Primer 50 to 30 Amplicon size Reference
cspB S. agalactiae F- TCTAGCCCCTCAAGCTCCTG 798 bp *
R- TGATCGGCTGTTTTGACCCTAA
ctrA N. meningitidis F-GCTGCGGTAGGTGGTTCAA 110 bp 20
R-TTGTCGCGGATTTGCAACTA
ply S. pneumoniae F-TGCAGAGCGTCCTTTGGTCTAT 80 bp 21
R-CTCTTACTCGTGGTTTCCAACTTGA
lytA S. pneumoniae F- CATGGCGCCTTCTTTAGCGTCTA 546 bp 21
R- GAGTTCATGACGGACTACCGCCT
bex H. influenzae type b F- TATCACACAAATAGCGGTTGG 181 bp 21
R- GGCCAAGAGATACTCATAGAACGTT
* This study.
504 M. Amin et al.

low glucose level, but there was no evidence of bacterial

detection in their smears or PCR/culture examinations.

Discussion

Despite a deep understanding about the pathogenesis of

Figure 2. The amplification results on one agarose gel. Lane
1, ladder of 100 base pairs (cinnagene_Iran); Lanes 2e6, clin-
ical samples of Streptococcus pneumoniae (lytA); and Lane 7, a
clinical sample of Streptococcus agalactiae.
smears contained gram-positive cocci. Table 2 shows the
detection pattern of these bacteria in our clinical samples,
based on gram staining, bacterial culture, and PCR.
Moreover, four of the nine patients with gram-positive
cocci smears did not have a positive result in their bac-
terial culture or PCR. The rates of sensitivity and speci-
ficity of PCR were 100% and 94.3%, respectively, compared
to culture. In addition, the NPV and PPV for PCR were 100%
and 21.4%, respectively, compared to culture. In our study,
20 patients had high cell counts, a high protein level, and a
BM-causing pathogens and despite the availability of anti-
biotics and the vaccination against these bacteria, BM re-
mains a leading cause of the morbidity and mortality in the
world [7]. BM can affect anyone, but babies and young
children are most at risk, with about half of all reported
cases occurring in the under five years [22]. In our study,
the frequency of the most common causes of BM in children
such as N. meningitidis, Hib, S. pneumoniae, and GBS in the
CSF specimens, based on the culture and PCR method, was
7.14% (14 patients). The prevalence of BM among infants
and children in other regions of Iran was variable. For
example, the prevalence was 6.8% in Tabriz [8] and 2.9% in
Tehran [11]. The different rates in our study were reported
in different countries such as Turkey (44.4%) [9], Papua New
Guinea (19.9%) [23], Nepal (7.2%) [7], and Brazil (17.7%) [6].
In our study, only 1.5% cases were confirmed as BM by the
CSF culture. By contrast, BM was recognized by PCR in
7.14% cases. This finding is more likely associated to the
patient’s use of antibiotics before the lumbar puncture. For
this reason, using nonculture techniques such as PCR or
antigen detection is necessary to detect these infectious
agents [9]. Meningitis by Hib primarily affects the infants
and children under 3 years old [5]. In our study, Hib was
detected in eight patients (three patients by both bacterial
culture and PCR and five patients by only PCR). However,
according to a study by Ghotaslou et al. [18], the preva-
lence of Hib in Tabriz is very low (2 of 277 cases).

Table 2 The pattern of detected bacteria in CSF samples based on smear, bacterial culture, and PCR.
Age Bacteria PCR Culture Smear Protein CSF/serum Lymphocytes/mm3 PMN
(mo.) mg/dL glucose ratio Cell/mm3
1 13 H. influenzae þ þ Gram-negative coccobacilli 81 0.19 960 840
2 16 H. influenzae þ þ Gram-negative coccobacilli 65 0.3 132 168
3 2 H. influenzae þ þ Gram-negative coccobacilli 72 0.16 48 72
4 8 H. influenzae þ  negative 85 0.4 60 40
5 8 H. influenzae þ  Gram-negative coccobacilli 96 0.87 1375 1125
6 25 H. influenzae þ  negative 50 0.56 205 815
7 8 H. influenzae þ  negative 300 1.4 144 36
8 9 Unknown   Gram-positive cocci 209 0.08 2 90
9 6 Unknown   Gram-positive cocci 321 0.34 10 256
10 5 S. pneumoniae   Gram-positive cocci 85 0.35 2 10
11 6 S. pneumoniae   Gram-positive cocci 66 0.48 3 45
12 2 S. pneumoniae þ  Gram-positive cocci 145 0.43 205 325
13 13 Unknown   Gram-positive cocci 115 0.41 8 92
14 42 Unknown   Gram-positive cocci 301 0.53 10 30
15 14 S. pneumoniae   Gram-positive cocci 148 0.39 14 250
16 12 S. pneumoniae   Gram-positive cocci 125 0.18 5 26
17 <1 H. influenzae þ  negative 210 0.13 10 90
18 2.5 S. agalactiae þ negative 145 0.25 25 145
CSF Z cerebrospinal fluid; H. influenzae Z Haemophilus influenzae; PCR Z polymerase chain reaction; PMN Z polymorphonuclear
leukocytes; S. agalactiae Z Streptococcus agalactiae; S. pneumoniae Z Streptococcus pneumoniae.
In bacterial meningitis, the white blood count is >100 cells/mL (>90% PMN), CSF/serum glucose ratio is under 0.4, and the protein level is
>50 mg/dL.
Bacterial meningitis in Ahvaz, Iran
The introduction of the Hib vaccine has always elimi-
nated invasive Hib diseases such as BM in most countries
where Hib vaccination has been routinely implemented
[24]. As a result of the routine use of Hib vaccine in infants
in the UK, the incidence of invasive Hib disease had fallen
from 22.9/100,000 in 1990 to 0.65/100,000 in 1998 [25]. In
Iran, the Hib vaccination schedule has been initiated since
December 2014; however, at the time of collecting samples
in our study, Hib vaccination had not been implemented.
For this reason, in our study, Hib was recognized as the
most common cause of BM among the infants and children.
To our knowledge, after the introduction of Hib vaccine in
Iran, no study has been conducted on the prevalence of Hib
among infants and children. The frequency of Hib in CSF
samples of the children in a large and long-term trial in
Turkey was 18.8% [9]. Moreover, Hib vaccination has been
performed since 2006 in Turkey, but the frequency of Hib
was greater than in our study. This finding may be because
their study had a larger population and longer study period,
compared to our study.
In most countries, S. pneumoniae is the major cause of
childhood BM, particularly in countries where Hib diseases
have been eliminated by vaccination [10]. In some Euro-
pean and sub-Saharan African countries, S. pneumoniae is
the second most reported cause of the septic meningitis,
after meningococcal cases [9]. In our study, S. pneumo-
niae was detected in five patients by lytA primers and
only one patient by ply primers. Similar to our study re-
sults, the frequency of this bacterium in CSF samples of
children suspected of having BM in other regions of Iran
was reported, and was 1.8% (5 of 277) in Tabriz [18] and
22.5% (7 of 31) in Tehran [12]. The ongoing development
of the pneumococcal vaccine for routine immunization
schedules in most countries has remarkably reduced the
frequency of invasive diseases caused by vaccine sero-
types [26]. However, no pneumococcal vaccine program
has been implemented in Iran. Because S. pneumoniae is
a main cause of BM among infants and children in other
regions of Iran, it seems that pneumococcal vaccination is
essential.
In our study, no N. meningitidis isolate was detected,
based on bacterial culture and PCR. In contrast to our re-
sults, N. meningitidis was detected among infants and
children in other regions of Iran (three cases in Tabriz [8]
and three cases in Tehran [12]). On the other hand, N.
meningitis was the most common cause of BM among
Turkish children in their first five years of life, especially in
infants aged zero through six months under five years old
[9]. In Iran, there is no national immunization program
against N. meningitis, but vaccination only has been rec-
ommended for some high-risk groups such as military pop-
ulation and pilgrims who travel annually to the Hajj in Saudi
Arabia. According to a wide and long-term study by
Mehrabi-Tavana et al. [27], the incidence rate of N. men-
ingitis was 1.22 in a nonmilitary individuals who were
mostly younger than 18 years old. This bacterium was not
detected during our study; the implementation of a na-
tional vaccination program is nevertheless essential.
On June 14, 2012, the United States Food and Drug
Administration (FDA, USA) licensed the Hib-Men CY-TT
vaccine for the prevention of invasive Hib and serogroups C
and Y meningococcal disease in children aged 6 weeks to
505
18 months. Infants with complement component de-
ficiencies, functional or anatomical asplenia, and sickle cell
disease have an increased risk of contracting meningo-
coccal diseases, compared to healthy infants [28]. In our
study, only one (0.5%) S. agalactiae isolate was detected by
PCR. In a study in India, 27 of 972 (2.7%) infants (aged
1 month to 2 years) were diagnosed with GBS meningitis
based on amplification of the scpB gene [14]. Cho et al. [29]
reported GBS as the most common bacteria responsible of
BM for 99 (24.6%) patients. Among these 99 patients, only
eight patients presented within 6 days after birth and the
remaining patients presented between 7 days and
5 months.
In our study, 20 patients had the clinical manifestations
of meningitis, an elevated number of polymorphonuclear
leukocytes (PMNs), a high protein level, and low glucose
level in their CSF samples. However, no evidence of the
bacterial detection was detected in their smears, PCR, or
bacterial culture. The number of PMNs in the CSF was high.
This result is likely owing to infection by other BM-causing
bacteria such as Escherichia coli and other gram-negative
enteric bacilli such as species of Klebsiella and Entero-
bacter [1]. Moreover, in our study, the smear examination
of four patients with gram-positive cocci showed no evi-
dence of these four bacteria, based on the bacterial culture
or PCR. It appears that other gram-positive cocci rather
than S. pneumoniae caused BM in these patients. Staphy-
lococcus species and other gram-positive cocci may cause
BM among infants and children. In our study, the rates of
sensitivity, specificity, and NPV by PCR were high,
compared to culture. The NPV was 100%, which gives a high
confidence that the PCR-negative results were true. How-
ever, the PPV was low (21.4%); thus, these data indicated
that many of the positive results from this procedure were
false positives. Therefore, it will be necessary to follow up
any positive result with a more reliable test to obtain a
more accurate assessment. Similar to our study, Yahia et al.
[30] reported high rates (100%) for sensitivity and NPV;
however, unlike in our study, the specificity and PPV were
low (49% and 13.3%, respectively). Two limitations of our
study were the lack of the availability to an antigen
detection kit for diagnosis of these bacteria and the lack of
knowledge about the patients’ previous use of antibiotic
medication.
Conclusion
The laboratory confirmation of the etiology of the acute BM
for optimal treatment of patients is essential; therefore,
the frequencies of the most common infectious agents
causing BM were examined by cultures and PCR in this
study. The frequencies of N. meningitidis, H. influenzae, S.
agalactiae, and S. pneumoniae comprised three cases,
based on the bacterial culture, and 14 cases, based on PCR.
Based on the bacterial culture, only three cases of H.
influenzae were isolated; however, based on the PCR
technique, eight cases of H. influenzae, one case of S.
agalactiae, and five cases of S. pneumonia were detected.
According to this study’s results, the routine use of PCR as a
sensitive and rapid technique for the detection of these
bacteria is suggested in all hospitals.
506
Acknowledgments
This work is a part of the M.Sc. thesis of Mozhgan Gha-
derpanah. It has been approved by the Department of
Microbiology of Ahvaz Jundishapur University of Medical
Sciences (Ahvaz. Iran). The authors thank the Health
Research Institute, Infectious and Tropical Diseases
Research Center, Jundishapur University of Medical Sci-
ences (Ahvaz, Iran) for their financial support (grant no.,
92133).
References
[1] Sáez-Llorens X, McCracken Jr GH. Bacterial meningitis in
children. Lancet 2003;361:2139e48.
[2] Kim KS. Acute bacterial meningitis in infants and children.
Lancet Infect Dis 2010;10:32e42.
[3] Adriani KS, Brouwer MC, van de Beek D. Risk factors for
community-acquired bacterial meningitis in adults. Neth J
Med 2015;73:53e60.
[4] Cornelis AS, Hachimi-Idrissi S. The use of dexamethasone in
bacterial meningitis in children and adults: a retrospective
analysis. ISRN Pediatr 2011;2011:380283.
[5] Khan M, A Khan KM, Pardhan K, Ahmed Memon A. Identifica-
tion of etiological agents by LPA and PCR in childhood men-
ingitis. Pak J Med Sci 2013;29:1162e6.
[6] Wu HM, Cordeiro SM, Harcourt BH, Carvalho M, Azevedo J,
Oliveira TQ, et al. Accuracy of real-time PCR, Gram stain and
culture for Streptococcus pneumoniae, Neisseria meningitidis
and Haemophilus influenza meningitis diagnosis. BMC Infect
Dis 2013;13:26.
[7] Shrestha RG, Tandukar S, Ansari S, Subedi A, Shrestha A,
Poudel R, et al. Bacterial meningitis in children under 15 years
of age in Nepal. BMC Pediatr 2015;15:94.
[8] Fuller DG, Duke T, Shann F, Curtis N. Antibiotic treatment for
bacterial meningitis in children in developing countries. Ann
Trop Paediatr 2003;23:233e53.
[9] Ceyhan M, Gürler N, Ozsurekci Y, Keser M, Aycan AE, Gurbuz V,
et al. Meningitis caused by Neisseria meningitidis, Hemophi-
lus influenzae type B and Streptococcus pneumoniae during
2005e2012 in Turkey. A multicenter prospective surveillance
study. Hum Vaccin Immunother 2014;10:2706e12.
[10] Ghotaslou R, Yeganeh-Sefidan F, Salahi-Eshlaqi B, Ebra-
himzadeh-Leylabadlo H. Etiology of acute bacterial meningitis
in Iran: a systematic review. Acta Med Iran 2015;53:454e61.
[11] Rezaeizadeh G, Pourakbari B, Ashtiani MH, Asgari F,
Mahmoudi S, Mamishi S. Antimicrobial susceptibility of bac-
teria isolated from cerebrospinal fluids in an Iranian referral
pediatric center, 1998e2008. Maedica (Buchar) 2012;7:131e7.
[12] Mahmoudi S, Zandi H, Pourakbari B, Ashtiani MT, Mamishi S.
Acute bacterial meningitis among children admitted into an
Iranian referral children’s hospital. Jpn J Infect Dis 2013;66:
503e6.
[13] Dominguez SR, Daum RS. Toward global Haemophilus influ-
enzae type b immunization. Clin Infect Dis 2003;37:1600e2.
M. Amin et al.
[14] Dwivedi S, Das BK, Aneja S, Sharma S, Chaturvedi MK, Kahn G,
et al. Group B streptococcal meningitis in infants beyond the
neonatal period. Indian J Pediatr 2014;81:4e8.
[15] Thomas V, Ahmed R, Qasim S. Cerebrospinal fluid analysis in
childhood bacterial meningitis. Oman Med J 2008;23:32e3.
[16] Hoffman O, Weber RJ. Pathophysiology and treatment of
bacterial meningitis. Ther Adv Neurol Disord 2009;2:1e7.
[17] Dunbar SA, Eason RA, Musher DM, Clarridge 3rd JE. Micro-
scopic examination and broth culture of cerebrospinal fluid in
diagnosis of meningitis. J Clin Microbiol 1998;36:1617e20.
[18] Ghotaslou R, Farajnia S, Yeganeh F, Abdoli-Oskouei S, Ahan-
garzadeh Rezaee M, Barzegar M. Detection of acute childhood
meningitis by PCR, culture and agglutination tests in Tabriz,
Iran. Acta Med Iran 2012;50:192e6.
[19] Hoffmann O, Braun JS, Becker D, Halle A, Freyer D, Dagand E,
et al. TLR2 mediates neuroinflammation and neuronal dam-
age. J Immunol 2007;178:6476e81.
[20] Donovan C, Blewitt J. Signs, symptoms and management of
bacterial meningitis. Paediatr Nurs 2010;22:30e5.
[21] Tzanakaki G, Tsopanomichalou M, Kesanopoulos K,
Matzourani R, Sioumala M, Tabaki A, et al. Simultaneous
single-tube PCR assay for the detection of Neisseria menin-
gitidis, Haemophilus influenzae type b and Streptococcus
pneumoniae. Clin Microbiol Infect 2005;11:386e90.
[22] Liu EY, Chang FY, Chang JC, Fung CP. Differences in virulence
of pneumolysin and autolysin mutants constructed by inser-
tion duplication mutagenesis and in-frame deletion in Strep-
tococcus pneumoniae. BMC Biotechnol 2014;14:16.
[23] Greenhill AR, Phuanukoonnon S, Michael A, Yoannes M,
Orami T, Smith H, et al. Streptococcus pneumoniae and
Haemophilus influenzae in paediatric meningitis patients at
Goroka General Hospital, Papua New Guinea: serotype dis-
tribution and antimicrobial susceptibility in the pre-vaccine
era. BMC Infect Dis 2015;15:485.
[24] Kelly DF, Moxon ER, Pollard AJ. Haemophilus influenzae type b
conjugate vaccines. Immunology 2004;113:163e74.
[25] McVernon J, Andrews N, Slack MP, Ramsay ME. Risk of vaccine
failure after Haemophilus influenzae type b (Hib) combination
vaccines with acellular pertussis. Lancet 2003;361:1521e3.
[26] Wei BP, Robins-Browne RM, Shepherd RK, Azzopardi K,
Clark GM, O’Leary SJ. Assessment of the protective effect of
pneumococcal vaccination in preventing meningitis after
cochlear implantation. Arch Otolaryngol Head Neck Surg 2007;
133:987e94.
[27] Mehrabi-Tavana A, Ataee RA. Meningococcal meningitis con-
trol in Iran: five year comparative study 2000e2004. The Med
Sci 2009;9:51e4.
[28] Centers for Disease Control and Prevention (CDC). Infant
meningococcal vaccination: Advisory Committee on Immuni-
zation Practices (ACIP) recommendations and rationale.
MMWR Morb Mortal Wkly Rep 2013;25(62):52e4.
[29] Cho HK, Lee H, Kang JH, Kim KN, Kim DS, Kim YK, et al. The
causative organisms of bacterial meningitis in Korean children
in 1996e2005. J Korean Med Sci 2010;25:895e9.
[30] Yahya MA, Balach O. Comparison of multiplex PCR, gram stain,
and culture for diagnosis of acute bacterial meningitis. Int J
Pharm Pharm Sci 2014;6:425e9.