Infection, Genetics and Evolution 10 (2010) 238–245

Contents lists available at ScienceDirect

Infection, Genetics and Evolution

journal homepage: www.elsevier.com/locate/meegid

Phylogeny of Leishmania species based on the heat-shock protein 70 gene§

Jorge Fraga a, Ana Margarita Montalvo a, Simonne De Doncker b, Jean-Claude Dujardin b,
Gert Van der Auwera b,*
a
Parasitology Department, Institute of Tropical Medicine Pedro Kouri, La Havana, Cuba
b
Department of Parasitology, Institute of Tropical Medicine Antwerp, Nationalestraat 155, 2000 Antwerp, Belgium

A R T I C L E I N F O A B S T R A C T

Article history: The 70 kDa heat-shock protein (HSP70) is conserved across prokaryotes and eukaryotes, and the protein
Received 24 July 2009 as well as its encoding gene have been applied in phylogenetic studies of different parasites. In spite of
Received in revised form 4 November 2009 the frequent use of New World Leishmania species identification on the basis of restriction fragment
Accepted 6 November 2009
length polymorphisms (RFLP) in the hsp70 gene, it was never sequenced extensively for studying
Available online 11 November 2009
evolutionary relationships. To fill this void we determined the nucleotide sequence of an 1380 bp
fragment of the coding region commonly used in RFLP analysis, from 43 isolates and strains of different
Keywords:
geographic origins. Combination with previously determined sequences amounted to a phylogenetic
Leishmania
analysis including 52 hsp70 sequences representing 17 species commonly causing leishmaniasis both in
Sauroleishmania
Phylogeny the New and Old World. The genus Leishmania formed a monophyletic group with three distinct
HSP70 subgenera L. (Leishmania), L. (Viannia), and L. (Sauroleishmania). The obtained phylogeny supports the
following eight species: L. (L.) donovani, L. (L.) major, L. (L.) tropica, L. (L.) mexicana, L. (V.) lainsoni, L. (V.)
naiffi, L. (V.) guyanensis and L. (V.) braziliensis, in some of which subspecies can be recognized: L. (L.)
donovani infantum, L. (V.) guyanensis panamensis, and L. (V.) braziliensis peruviana. The currently
recognized L. (L.) aethiopica, L. (L.) garnhami, and L. (L.) amazonensis did not form monophyletic clusters.
These findings are discussed in relation to results from other genes and proteins, which have to be
integrated in order to build a genetically supported taxonomy for the entire genus.
ß 2009 Elsevier B.V. All rights reserved.

1. Introduction
The leishmaniases are a complex of diseases caused by
kinetoplastid flagellates of the genus Leishmania, and which
include visceral leishmaniasis (VL) as well as several forms of
cutaneous leishmaniasis (CL). Three hundred and fifty million
people in 88 countries are at risk. The global yearly incidence is 0.5
million cases of VL and 1.5 million of CL, while 12 million people
worldwide are affected by the disease (WHO, 2000; Desjeux,
2001). The genus Leishmania comprises some 30 species of
morphologically similar kinetoplastid protozoa, among which 20
species are responsible for human disease. In order to design
reliable diagnostic tools, it is crucial to agree on a clear definition of
the taxa to be identified (Bañuls et al., 2002).
The classification of Leishmania was initially based on
ecobiological criteria such as vector, geographical distribution,
tropism, antigenic properties and clinical manifestation (Pratt and
David, 1981; Lainson and Shaw, 1987). The two subgenera (L.)
§
Note: Nucleotide sequence data reported in this paper are available in the
GenBank, EMBL and DDBJ databases under the accession numbers EU599088–
EU599094, FN395018–FN395033, FN395035–FN395053, and FN395055–FN395056.
* Corresponding author. Tel.: +32 3 2476586; fax: +32 3 2476359.
E-mail address: gvdauwera@itg.be (s.$. Van der Auwera).
Leishmania and (L.) Viannia are separated on the basis of their
location in the vector’s intestine (Lainson and Shaw, 1987), and the
species within the subgenera were generally established using
multi-locus enzyme electrophoresis (MLEE, Rioux et al., 1990), as
to date the gold standard. The validity of the taxonomic
classification scheme has been questioned several times, and
the debate centers on the species status of L. (V.) panamensis, L. (V.)
peruviana, L. (L.) infantum, L. (L.) chagasi, L. (L.) archibaldi, L. (L.)
garnhami, L. (L.) pifanoi and L. (V.) lainsoni (Bañuls et al., 2007). Also
the taxonomic position and phylogenetic relationship of lizard-
infecting Leishmania remains uncertain, as a number of lizard-
infecting parasites previously classified as Leishmania but appar-
ently undergoing peripylarian development in sandflies, have been
placed into the genus Sauroleishmania (Lainson and Shaw, 1987). It
is therefore needed to agree on a practical taxonomic classification
scheme based on reliable and consensual concepts.
As with most other single-celled organisms, morphological
characters provide few clues for understanding evolutionary
relationships within the genus Leishmania, and by extension the
entire Trypanosomatidae family to which it belongs. The advent of
molecular sequence data provided a large extent of additional
information for phylogenetic analyses, but in spite of this evolution-
ary relationships remain poorly resolved (Hughes and Piontkivska,
2003). Several molecular markers have been used: the internal

1567-1348/$ – see front matter ß 2009 Elsevier B.V. All rights reserved.
doi:10.1016/j.meegid.2009.11.007
 J. Fraga et al. / Infection, Genetics and Evolution 10 (2010) 238–245 239

Table 1 (Continued )
transcribed spacer (ITS) 1 and 2 of the ribosomal DNA array (Cupolillo
et al., 1995; Dávila and Momen, 2000; Berzunza-Cruz et al., 2002; Speciesa Strain nameb Country Accession
numberc
Orlando et al., 2002; Kuhls et al., 2005; Spanakos et al., 2008; Sukmee
et al., 2008; Villinski et al., 2008), a repetitive DNA sequence (Piarroux MHOM/ET/83/169-83 Ethiopia FN395020
et al., 1995), the gene for the catalytic polypeptide from DNA MHOM/ET/72/L100 Ethiopia FN395021

polymerase a (polA, Croan et al., 1997), the gene encoding the largest L. tropica MHOM/IN/79/DD7 India FN395025
subunit of RNA polymerase II (rpoIILS, Croan and Ellis, 1996; Croan et MHOM/KE/81/NLB_030B Kenya FN395026
al., 1997), the cytochrome oxidase II gene (Ibrahim and Barker, 2001), L. major UQ_8 Sudan FN395022
the glycoprotein 63 gene (gp63, Mauricio et al., 2007), cysteine MHOM/IL/67/LRC-L137 Israel FN395023
protease B genes (cpb, Hide et al., 2007), the mini-exon (Sukmee et al., Githure Kenya FN395024
MHOM/IL/80/Friedlin* Israel XM_001684512
2008), 7SL RNA (Zelazny et al., 2005), and the cytochrome B gene
(cytB, Luyo-Acero et al., 2004; Asato et al., 2009). Most of these studies L. donovani MHOM/SD/68/1S Sudan FN395027
include only species of either the New or Old World, or isolates and MHOM/IN/00/Devi India FN395028
MHOM/SD/82/Gilani Sudan FN395029
strains from one particular geographic region. Some authors have
MHOM/ET/67/HU3* Ethiopia X52314
investigated phylogenetic relationships within the entire genus
using polA, rpoIILS, ITS-1 and 2, cytB, 7SL RNA and the mini-exon L. archibaldi MHOM/SD/97LEM3463 Sudan FN395030
(Croan and Ellis, 1996; Croan et al., 1997; Dávila and Momen, 2000; L. infantum MHOM/MT/85/Buck Malta FN395031
Berzunza-Cruz et al., 2002; Luyo-Acero et al., 2004; Zelazny et al., MHOM/PT/00/IMT260 Portugal FN395032
2005; Spanakos et al., 2008; Sukmee et al., 2008; Villinski et al., 2008; MHOM/MA/67/ITM-AP263 Malta FN395033
MCAN/ES/98/LLM-877* Spain XM_001470287
Asato et al., 2009).
Knowing the evolutionary history of the Leishmania genus not L. chagasi MCAN/BR/06/Maike Brazil FN395035
only helps to build a reliable and objective taxonomic classification MHOM/BR/07/WC Brazil FN395036
MHOM/BR/07/ARL Brazil FN395037
system, but also allows extrapolation of parasite-linked biological
features to closely related strains. Unraveling the phylogenetic L. mexicana MNYC/BZ/62/M379 Belize EU599091
patterns that underlie the origin of contemporary taxa requires the MHOM/PE/02/LH2312 Peru FN395038

study of independent genes that display different evolutionary L. amazonensis MHOM/BR/73/M2269 Brazil EU599090
constraints (Phillipe, 1998), as the history of a gene might be MHOM/BR/77/LTB0016/C1S1* Brazil L14604
different from that of the species in which it resides. Genes coding MHOM/BR/77/LTB0016/C1S1* Brazil L14605

for proteins such as EF-1 (elongation factor 1), HSP70 (heat-shock L. garnhami MHOM/VE/76/JAP78 Venezuela EU599092
protein 70), and GAPDH (glyceraldehyde-3-phosphate dehydroge- L. braziliensis MHOM/BO/–/CUM 180 Bolivia FN395039
nase) are all suitable candidates for the study of molecular MHOM/PE/02/LH2182 Peru FN395040
systematics of kinetoplastids (Momen and Cupolillo, 2000). MHOM/BO/94/CUM 29 Bolivia FN395041
Heat-shock proteins (HSPs) play an important role in folding, MHOM/PE/91/LC2177 Peru FN395042
MHOM/PE/91/LC2177 clone 2 Peru EU599088
assembly, intracellular localization, secretion, regulation, stabiliza-
MHOM/BR/06/ICA Brazil FN395043
tion and degradation of other proteins (Young et al., 2004). One class, MHOM/BR/75/M2903* Brazil M87878
the 70 kDa heat-shock proteins (HSP70), are highly conserved across MHOM/BR/75/M2904* Brazil XM_001566275
prokaryotes and eukaryotes both in sequence and function, and have
L. peruviana MHOM/PE/03/LH2864 Peru FN395044
great importance as molecular chaperones, protein folding, and MHOM/PE/03/LH2439 Peru FN395045
transport (Hartl and Hayer-Hartl, 2002). Genes encoding cytoplasmic MHOM/PE/90/LC468 Peru FN395046
HSP70s were among the first kinetoplastid genes to be cloned and MHOM/PE/90/LCA08 clone 2 Peru EU599089
characterized because of their conserved nature (Folgueira and L. lainsoni MHOM/BO/95/CUM71 Bolivia FN395047
Requena, 2007). The protein as well as its encoding gene have been MHOM/PE/91/LC1581 Peru FN395048
widely used for phylogenetic studies of different parasites, such as MHOM/PE/02/LH2344 Peru FN395049
MHOM/PE/03/LC2525 Peru FN395050
Cryptosporidium spp. (Sulaiman et al., 2000; Langkjaer et al., 2007),
Babesia spp. (Yamasaki et al., 2002, 2007), Giardia spp. (Arisue et al., L. guyanensis MHOM/PE/02/LH2372 Peru FN395051
2002b), Entamoeba spp. (Arisue et al., 2002b), Microsporidium spp. MHOM/GF/85/LEM 699 French FN395052
Guiana
(Arisue et al., 2002b) and Blastocystis hominis (Arisue et al., 2002a),
MHOM/BR/07/029-ZAV Brazil FN395053
illustrating the use for this type of analysis. In this study we MHOM/BR/75/M4177 Brazil EU599093
investigate the phylogenetic relationships within the entire Leish-
L. panamensis MHOM/PA/71/LS94 Panama EU599094
mania genus using partial coding sequences of the hsp70 gene, and we
MCHO/PA/00/M4039 Panama FN395055
discuss the implications for species definitions.
L. naiffi MDSA/BR/78/M5210 Brazil FN395056

2. Materials and methods L. tarentolae TarII* Unknown AY423868

Trypanosoma TINF/BR/63/CL Brener* Brazil XM_812645

2.1. PCR amplification of hsp70 cruzi

Trypanosoma rangeli MHOM/HOND/–/H14* Honduras EF108422

A PCR product of 1422 bp was amplified from the strains listed
a
in Table 1 using primers HSP70sen and HSP70ant (Fig. 1, Table 2) Species currently recognized in the literature, based upon MLEE as well as
biological and epidemiological features (Rioux et al., 1990; WHO, 1990; Bañuls et
al., 2007; references throughout the text).
b
Table 1 Wherever available the full WHO code of the strain is provided. Some sequences
Sequences included in this study. were derived from a parasite clone, as indicated with the code. Sequences from strains
indicated with * were retrieved from GenBank, the remaining ones were determined
Speciesa Strain nameb Country Accession in this study.
c
numberc Accessions starting with XM are derived from a contemporary annotation of full
genome sequences, and are GenBank specific. From L. amazonensis strain MHOM/
L. aethiopica MHOM/ET/89/Gere Ethiopia FN395018
BR/77/LTB0016/C1S1 two sequences were found in GenBank.
NLB 107-08 Kenya FN395019
240 J. Fraga et al. / Infection, Genetics and Evolution 10 (2010) 238–245
Fig. 1. Schematic overview of the HSP70 coding region from L. major strain Friedlin (GenBank accession XM_001684512), drawn to scale. PCR primer annealing sites are
indicated by the hatched boxes, with the names (Table 2) and 50 –30 orientation shown on top, and the annealing positions relative to the ATG start codon at the bottom. The
grey shaded area denotes the amplified fragment, and the variable positions, i.e. alignment positions in which at least two different nucleotides are present in the Leishmania
genus sequences of Table 1, are indicated in black.
from Garcia et al. (2004). The reaction mix (50 mL) contained 1
standard PCR buffer including 1.5 mM MgCl2, 1 Q-buffer, 200 mM
of each deoxynucleoside triphosphate, 0.5 U HotStarTaq Plus DNA
polymerase (Qiagen, Hilden, Germany), 0.4 mM of each primer, and
around 10 ng of genomic DNA isolated from parasite culture. The
thermal cycling parameters of the assay were: initial denaturation
at 95 8C for 5 min; followed by 35 cycles consisting of 94 8C for 40 s
– 61 8C for 1 min – 72 8C for 2 min; and a final extension step of
8 min at 72 8C. Amplicons were analyzed on a 2% agarose gel, and
sequenced directly without molecular cloning.
2.2. DNA sequencing
Eight primers (Table 2) were used for sequencing both strands
of the entire amplicon, except for circa 40 terminal nucleotides
which were sequenced on one strand only. Sequences were
generated using the dideoxy nucleotide chemistry with the ABI
PRISM1 BigDyeTM Terminator cycle sequencing kit (PerkinElmer,
Foster City, CA, USA), and analyzed on an ABI 3730 automated
sequencer (PerkinElmer). For phylogenetic analysis only the region
between the primers was used, i.e. 1380 out of the 1422
nucleotides.
2.3. Phylogenetic analysis
The obtained sequences were aligned with previously pub-
lished sequences as listed in Table 1, using the software package
MEGA (Molecular Evolutionary Genetic Analysis Version 4, Tamura
et al., 2007, www.megasoftware.net). As no length variation is
present between the sequences, the alignment was straight-
forward and no alignment algorithm was needed. The same
software was used to build phylogenetic trees with both distance
and character-based methods, and to analyze synonymous versus
non-synonymous nucleotide substitutions. The number of synon-
ymous differences per synonymous site, and the number of non-
synonymous differences per non-synonymous site was averaged
over all Leishmania sequence pairs, using the Nei–Gojobori method
(Nei and Gojobori, 1986) and ignoring the 10 positions in the
alignment containing ambiguous nucleotides. Distances from
nucleotide sequences were estimated with the Kimura-2 parame-
ter model (Kimura, 1980), and trees were built with the Neighbor-
Joining (Saitou and Nei, 1987), Minimum Evolution (Rzhetsky and
Nei, 1992), and Maximum Parsimony (Eck and Dayhoff, 1966;
Fitch, 1971) methods. Distances from predicted amino acid
Table 2
Primers used for hsp70 gene sequencing and PCR.
Primer Sequence (50 ! 30 ) Nucleotide positiona
HSP70sen GACGGTGCCTGCCTACTTCAA 435–455
HSP70-F335 CACGCTGTCGTCCGCGACG 825–843
HSP70-R429 AACAGGTCGCCGCACAGCTCC 938–918
HSP70-2F CTGAACAAGAGCATCAACCC 1084–1103
HSP70-2R CTTGATCAGCGCCGTCATCAC 1254–1234
HSP70-F893 GTTCGACCTGTCCGGCATCC 1383–1402
HSP70-R1005 GTGATCTGGTTGCGCTTGCC 1514–1495
HSP70ant CCGCCCATGCTCTGGTACATC 1856–1836
a
The annealing position of the primers is given relative to GenBank accession
XM_001684512 (L. major strain Friedlin).
sequences were determined with the p-distance model. As
outgroup, the two Trypanosoma species found most closely related
to the Leishmania genus in our analysis were used. The support of
monophyletic groups was assessed by the bootstrap method
(Felsenstein, 1985) with 2000 replicates. Additionally, sequence
groupings were detected by the analysis of phylogenetic networks
inferred from uncorrected p-distances with the Neighbor-Net
method in SplitsTree4 (Huson, 1998; Huson and Bryant, 2006).
Such networks can depict alternative evolutionary paths sup-
ported by the data set, and as such do not enforce a single
bifurcating dendrogram.
3. Results
We sequenced 1380 bp of the hsp70 genes from 16 Leishmania
species from the New and Old World. Table 1 lists the accession
numbers of the 44 newly determined sequences from different
geographic origins that were analyzed, as well as those of 10
sequences retrieved from GenBank and included in the alignment,
amounting to 52 strains representing 17 Leishmania and 2
Trypanosoma species. Analysis of the 3 full genome sequences
from L. infantum, L. major, and L. braziliensis at www.genedb.org
(results not shown) revealed complementarity of our PCR primers
only to subfamily HSP70 in Folgueira and Requena (2007). There
were no sequence ambiguities in 38 out of the 44 sequences, and in
total 10 nucleotides could not be determined unambiguously in
the remaining 6 sequences (Fig. 2). In addition, sequences from
four L. major, two L. tropica, and one L. amazonensis isolates were
unreadable, probably because different equally sized amplicons
were obtained. Hence, these were not included in this study.
The hsp70 PCR gene fragment of Leishmania spp. is GC rich
(63.6–65.4%), with a similarity among Leishmania sequences
between 94.1 and 99.8%. The location of the variable positions is
indicated in Fig. 1. The nucleotide sequence variation is sufficient
to discriminate parasite species: 148 nucleotide positions (11%)
are polymorphic and 111 positions (8%) are parsimony informa-
tive, meaning that at least two different nucleotides are present,
each found in at least two sequences. The deduced amino acid
sequences (459 amino acids) revealed substitutions at 43 positions
(9%), of which 39 sites (8%) are parsimony informative. The number
of synonymous substitutions per synonymous site is 6.3%, the
number of non-synonymous substitutions per non-synonymous
site is 1.9%. The average dissimilarity between the Leishmania and
Trypanosoma species is 13.4%, which is twice as high as the highest
intra-Leishmania values.
The Neighbor-Joining tree in Fig. 2 shows that the subgenera L.
(Leishmania) and L. (Viannia) each form a distinct monophyletic
clade, with L. (Sauroleishmania) branching off in between as an
independent taxon. Within the L. (Leishmania) subgenus, the tree
shows a distinction between species of the Old and New World.
Only five groups can be reliably recognized within the New World:
the L. mexicana complex, L. lainsoni, L. naiffi, the L. guyanensis
complex, and the L. braziliensis complex. In the Old World, hsp70
identifies L. major, the L. donovani complex, and a mixed group of L.
aethiopica with L. tropica. All these clusters were also observed in
Minimum Evolution and Maximum Parsimony phylogenies (not
shown), indicating that the derived groups are robust and not
dependent of the choice of evolutionary models underlying the
 J. Fraga et al. / Infection, Genetics and Evolution 10 (2010) 238–245 241

Fig. 2. Neighbor-Joining phylogeny of the hsp70 sequences listed in Table 1, based on an alignment of 1380 nucleotides. Distances were estimated using the Kimura-2
parameter model, thereby excluding all 10 sites with ambiguous nucleotides. Bootstrap support of the branches was inferred from 2000 replicates, and is given in percentages
at the internodes when exceeding 70%. The tree is drawn to the scale at the bottom, expressed as distance per nucleotide. Supported monophyletic species and (sub)genera are
depicted at the right, irrespective of the species classification presented in Table 1, but reflecting the observations from Section 4. Old World clusters are indicated by a dot on
the branch leading to the cluster, while a square is used for New World groups. The tree was rooted with the two Trypanosoma sequences found most related to Leishmania
hsp70. Numbers between brackets following the strain names indicate the amount of ambiguous nucleotides in the sequence.

various tree-building algorithms. Trees based upon amino acid
sequences did not conflict the nucleotide-based phylogenies, even
though they showed a lower resolutive power.
Fig. 3 displays a phylogenetic network obtained from the same
sequences as in Fig. 2, except for the Trypanosoma and L. tarentolae
isolates, which were excluded. The groups that could be reliably
identified using conventional phylogenetic analysis are also
recovered from the network. L. infantum, L. panamensis, and L.
peruviana are found as separate subgroups within the L. donovani,
L. guyanensis and L. braziliensis complexes respectively, as was also
the case in Fig. 2 except for L. peruviana. The species L. tropica, L.
aethiopica, L. mexicana, L. amazonensis, and L. garnhami cannot be
distinguished as separate entities.
4. Discussion
For the first time we employed hsp70 sequences in a
phylogenetic study of Leishmania species, which contrary to other
parasites was not yet done. The degree of conservation of the
analyzed 1380 bp region of the coding sequence is suited for
analysis at the species, intra- and supra-species level. Our study
includes 50 strains from different geographic origins, representing
242 J. Fraga et al. / Infection, Genetics and Evolution 10 (2010) 238–245

Fig. 3. Phylogenetic network of the Leishmania sequences of Table 1 and Fig. 2, excluding the Trypanosoma outgroup and L. tarentolae. It was constructed with the NeighborNet
algorithm (Bryant and Moulton, 2004), excluding all conserved sites. Uncorrected p-distances from nucleotides were used, representing the fraction of differences between
each pair of sequences. Each of the four panels (A)–(D) is drawn to the scale indicated, expressed as dissimilarity per nucleotide counted over variable sites (Fig. 1) in the hsp70
alignment. Sequence positions in the network are indicated by dots and squares. (A) Complete network with representation of the three groups shown in more detail in the
remaining panels. (B) L. (Viannia) subgenus sequences separate into four species. Squares are used to indicate subspecies. (C) Old World sequences of the L. (Leishmania)
subgenus separate into three species. Within L. tropica, the two squares (tro) denote the currently recognized L. tropica sequences, the dots (aet) represent L. aethiopica (Table
1). Within L. donovani, squares represent L. donovani infantum. (D) New World sequences of the L. (Leishmania) subgenus. The species L. garnhami, L. mexicana, and L.
amazonensis as listed in Table 1 are indicated by gar, mex, and ama, respectively.

17 species among which the most common causative agents of
leishmaniasis in the New and Old World. Hardly any sequence
ambiguity was observed, and our PCR primers only matched to
identical hsp70 copies in three published genomes, indicating that
the sequence data obtained are from orthologous genes. The fact
that synonymous substitutions are favored over non-synonymous
substitutions (6.3 versus 1.9%, respectively) indicates a strong
selection pressure on this gene.
In our analysis, Leishmania hsp70 sequences were clearly
distinct from the two most closely related Trypanosoma sequences
recovered from GenBank, thereby strongly supporting lizard (L.
tarentolae) and mammalian Leishmania as a monophyletic group.
This agrees with other studies based on isoenzyme data and gene
sequences from ITS rDNA, polA, rpoIILS, 7SL RNA and cytB (Thomaz-
Soccol et al., 1993; Croan et al., 1997; Dávila and Momen, 2000;
Orlando et al., 2002; Luyo-Acero et al., 2004; Zelazny et al., 2005),
and supports the classification of lizard Leishmania as subgenus L.
(Sauroleishmania) proposed by Saf’janova (1982) on the basis of
biological criteria, rather than as a separate genus (WHO, 1990;
Bañuls et al., 2007). Equally so, our analysis is in agreement with
the division of mammalian species from Lainson and Shaw (1987)
in the peripylarian L. (Viannia) and suprapylarian L. (Leishmania)
subgenera, both of which form distinct monophyletic clusters.
While L. (Viannia) is restricted to neotropical regions, L. (Leishman-
ia) occurs both in the New (neotropical and southern neoarctic)
and Old (palearctic, African and Oriental) World (Kerr, 2000). This
geographical dichotomy is reflected by the separation of the New
(L. mexicana complex) and Old World groups within the L.
(Leishmania) subgenus (Fig. 2), also found with sequences from
polA and rpoIILS (Croan et al., 1997), ITS rDNA (Dávila and Momen,
2000), 7SL RNA (Zelazny et al., 2005), and cytB (Luyo-Acero et al.,
2004; Asato et al., 2009).
The fact that the Old World species separate from the common
ancestor of L. (Leishmania) after the divergence between the two
mammalian subgenera is congruent with the idea of a New World
origin of the genus as also found by others (Noyes et al., 1997;
Croan et al., 1997; Noyes, 1998; Stevens et al., 2001; Lukeš et al.,
2007). In such scenario, L. (Leishmania) and L. (Viannia) evolved
from their common ancestor in the New World, after which L.
(Leishmania) strains found their way to the Old World. However,
this theory puts L. tarentolae in an illogical position, as an Old
World species branching from within New World taxa, being closer
to L. (Leishmania) than L. (Viannia) as deduced from hsp70 (Fig. 2)
and other genes (polA and RNA polymerase II, Croan et al., 1997; ITS
 J. Fraga et al. / Infection, Genetics and Evolution 10 (2010) 238–245
rRNA, Orlando et al., 2002; 7SL RNA, Zelazny et al., 2005; cytB,
Luyo-Acero et al., 2004). Several hypotheses could explain this
inconsistency (Croan et al., 1997; Noyes, 1998): (1) either L.
(Sauroleishmania) evolved in the New World and migrated to the
Old World independently of L. (Leishmania); or (2) the common
ancestor of both subgenera migrated to the Old World, whereby
the L. mexicana ancestor migrated back after the split of L.
(Sauroleishmania). Of course, we cannot exclude the possibility that
the hsp70 sequences of the three subgenera would evolve at a
markedly different speed in view of the different vector and host
environments in which they reside, in which case the relative
position of the root and the three subgenera could be erroneously
inferred. Comparison with information from additional genetic
markers and L. (Sauroleishmania) species is needed to resolve these
issues.
As shown in Fig. 2, hsp70 groups the analyzed mammalian
Leishmania sequences into eight monophyletic clusters, each
highly supported by bootstrap values of 95% and more. These
clusters correspond to either species as listed in Table 1, or more
often so-called species complexes. Some of these species
complexes comprise distinct sub-clusters as depicted in Fig. 3,
corresponding to MLEE-defined species. Each of the eight groups is
discussed in detail below, together with an alternative view on
species definitions based on hsp70.
(1) L. (L.) donovani complex: This cluster comprises all strains
causing visceral leishmaniasis, the most devastating clinical
manifestation of the disease, and is also found on the basis of a
repetitive DNA sequence (Piarroux et al., 1995), polA and
rpoIILS (Croan et al., 1997), ITS rDNA (Dávila and Momen, 2000;
Berzunza-Cruz et al., 2002; Kuhls et al., 2005), cytB (Luyo-Acero
et al., 2004; Asato et al., 2009), and gp63 (Mauricio et al., 2007).
Sequences in this group have been assigned to four species
based on MLEE and differences in vectors, reservoirs and
pathology (Lainson and Shaw, 1987; Rioux et al., 1990;
Thomaz-Soccol et al., 1993): L. donovani, L. archibaldi,
L. infantum, and L. chagasi (Table 1). From Fig. 3 it is clear
that L. infantum and L. chagasi cannot be distinguished from one
another, and comprise a subgroup of the L. donovani cluster.
This agrees with microsatellite, RFLP, RAPD and DNA sequence
analysis, on the basis of which L. chagasi has been found
identical to L. infantum, and it is consistent with the recent
introduction of L. infantum in the New World (Rioux et al.,
1990; Cupolillo et al., 1994; Maurı́cio et al., 2000; Lukeš et al.,
2007). L. archibaldi as valid taxon has been questioned, because
markers either do not distinguish it from L. donovani, or are
unreliable: e.g. glutamate oxaloacetate transaminase, rDNA
ITS, the mini-exon, cpb, isocitrate dehydrogenase, malic
enzyme, mannose phosphate isomerase, glucose-6-phosphate
dehydrogenase, fumarate hydratase and gp63 (Lewin et al.,
2002; Jamjoom et al., 2004; Mauricio et al., 2004; Kuhls et al.,
2005; Quispe-Tintaya et al., 2005; Lukeš et al., 2007; Mauricio
et al., 2007; Zemanová et al., 2007). Also on the basis of hsp70
sequences the species could not be identified. Taken together,
on the basis of these data we recommend to recognize L.
donovani as the sole species of the L. donovani complex, with
only L. donovani infantum as a subspecies. As such, L. infantum
would cease to exist as a separate species entity.
(2) L. (L.) tropica complex: Based on hsp70, L. tropica cannot be
distinguished from L. aethiopica, and both species comprise a
single cluster. This was also seen in studies using gp63, cytB, 7SL
RNA and ITS rDNA genes (Dávila and Momen, 2000; Berzunza-
Cruz et al., 2002; Luyo-Acero et al., 2004; Zelazny et al., 2005;
Mauricio et al., 2007; Asato et al., 2009). As neither group is
monophyletic, they cannot be given the status of subspecies. As
such, L. tropica would be the only recognized species.
243
(3) L. (L.) major: Lainson and Shaw (1987) included L. major within
the L. tropica complex. However, hsp70 clearly identifies it as a
monophyletic cluster separate from L. tropica, as also observed
using MLEE (Rioux et al., 1990; Thomaz-Soccol et al., 1993), a
repetitive DNA sequence (Piarroux et al., 1995), cytB (Luyo-
Acero et al., 2004), 7SL RNA (Zelazny et al., 2005), and the ITS
region (Dávila and Momen, 2000; Berzunza-Cruz et al., 2002).
Our results support the status of L. major as independent
species as proposed by WHO (1990) and Bañuls et al. (2007).
(4) L. (L.) mexicana complex: Three species are grouped in the L.
mexicana complex, i.e. L. amazonensis, L. mexicana and L.
garnhami. The group is well defined as a whole, distinct from
the three Old World L. (Leishmania) groups described above
(Figs. 2 and 3). Similar results were obtained from different
gene sequences: the mini-exon (Fernandes et al., 1994), polA
and rpoIILS (Croan et al., 1997), 7SLRNA (Zelazny et al., 2005),
ITS rDNA (Dávila and Momen, 2000), and cytB (Luyo-Acero
et al., 2004; Asato et al., 2009). Even though ITS rDNA
sequences were able to resolve the complex (Dávila and
Momen, 2000; Berzunza-Cruz et al., 2002), in our analysis none
of the three species can be distinguished as a monophyletic
clade. As such no subspecies can be defined based on hsp70, and
L. mexicana would be the single recognized species.
(5) L. (V.) naiffi: This species is one of the four groups recognized in
the L. (Viannia) subgenus, which agrees with earlier observa-
tions (Thomaz-Soccol et al., 1993; WHO, 1990; Bañuls et al.,
2007). It was described in 1989 and the diversity in comparison
with other members of the L. (Viannia) subgenus has
determined its position at the complex level (Thomaz-Soccol
et al., 1993; Cupolillo et al., 1994, 1995), as also observed in
Figs. 2 and 3. Few studies have analyzed the phylogenetic
status of this species, using ITS rDNA and mini-exon genes, and
in all cases only one isolate was analyzed, with similar results
(Cupolillo et al., 1995; Spanakos et al., 2008; Sukmee et al.,
2008; Villinski et al., 2008). As only one isolate of this species is
present in our analysis, we cannot investigate its monophyletic
status.
(6) L. (V.) braziliensis complex: This group is made up of the two
species L. braziliensis and L. peruviana. Some authors have
suggested that L. peruviana may simply be a variant of L.
braziliensis and not a valid species (Grimaldi et al., 1987), which
is supported by the very high similarity found in biochemical
and molecular analyses (Arana et al., 1990; Dujardin et al.,
1995). Nevertheless, Bañuls et al. (1999) showed that L.
peruviana corresponds to a discrete typing unit distinct from
other L. braziliensis strains analyzed, using MLEE and RAPD
data. This latter view is supported by our data, as can be seen in
Fig. 3, displaying L. peruviana as a subgroup within the L.
braziliensis population. As such, hsp70 sequences suggest the
species status of L. braziliensis for all the strains belonging to the
complex, with L. braziliensis peruviana as the single subspecies.
(7) L. (V.) guyanensis complex: As found previously with isoenzyme
comparisons (Rioux et al., 1990; Thomaz-Soccol et al., 1993;
Cupolillo et al., 1994), restriction patterns of the ITS rDNA
region (Cupolillo et al., 1995), and phylogenetic analysis from
ITS rDNA and cytB (Dávila and Momen, 2000; Luyo-Acero et al.,
2004), L. guyanensis and L. panamensis form a monophyletic
complex (Fig. 2). Within this complex both species form
monophyletic sub-clusters, confirming results from a broad
range of isoenzyme and RAPD markers (Bañuls et al., 2002), and
ITS rDNA phylogeny (Berzunza-Cruz et al., 2002; Spanakos
et al., 2008; Villinski et al., 2008) showing a clear separation.
However, only one or two isolates per species were tested in
these studies, and in our study the monophyly of L. guyanensis
excluding L. panamensis is not supported (bootstrap value
below 70% in Fig. 2). And even though the bootstrap support for
244 J. Fraga et al. / Infection, Genetics and Evolution 10 (2010) 238–245
a monophyletic L. panamensis clade generally is slightly less
than 90% (e.g. 88% in Fig. 2), also network analysis (Fig. 3)
identifies the two L. panamensis strains as a well-defined
subgroup. In conclusion, hsp70 data suggest to identify all
species in the complex as L. guyanensis, with as subspecies L.
guyanensis panamensis.
(8) L. (V.) lainsoni: This species presents the most distinct biological
(morphology, growth in axenic culture medium), biochemical
(enzymatic electrophoresis profile), and molecular biological
characteristics of the L. (Viannia) subgenus, although data from
biochemical and molecular techniques are still not conclusive
with respect to its taxonomic position within L. (Viannia) (Corrêa
et al., 2005). Our hsp70 phylogenetic trees show L. lainsoni as the
most divergent species among the L. (Viannia) subgenus (Fig. 2),
albeit without bootstrap support (less than 70%). Similar results
were described by Fernandes et al. (1994), who performed
phylogenetic analysis using the mini-exon gene. Our data
identify L. lainsoni is a separate species inside the L. (Viannia)
subgenus as was described earlier (Silveira et al., 1987; Cupolillo
et al., 1994; WHO, 1990; Bañuls et al., 2007).
In the above paragraphs we describe the evolution of
Leishmania parasites as it presents itself from hsp70 sequence
data, and discuss the implications of this analysis for the
taxonomic framework of these protozoa, starting from the
assumption that each taxonomic entity should be monophyletic
in nature. As such we propose to abandon the concept of species
complexes, as none of them seems to be composed of separate
monophyletic entities. Because the complexes themselves do seem
monophyletic, only these could instead merit the species status.
Our intention is not to impose a revised classification scheme
based only upon this gene, as grouping of any sequence set into
unequivocally defined clusters depends upon the degree of
conservation of the genetic tool at hand. As hsp70 is quite
conserved in nature, it cannot be expected to uncover the fine
population structure within each of the eight groups, as can be
achieved with methods such as multi-locus microsatellite typing,
multi-locus sequence typing, and often MLEE. In addition,
phylogenies are prone to sampling bias, even though we tried to
overcome this problem by selecting strains of diverse geographic
origins. As such, every classification scheme is arbitrary, even more
so as the degree of variation defining a taxonomic level is applied
differently in various organisms, e.g. bacteria, algae, fungi, animals,
and plants. Whether Leishmania taxonomy actually requires
revision of the recognized species on the basis of new insights,
such as presented in this paper, is a matter of debate. Nevertheless,
the current classification must not be used without proper
awareness of its shortcomings, in order to prevent adverse
misinterpretations based on inconsistent species definitions.
With this study we want to actively contribute to the discussion
on a general taxonomic consensus framework for Leishmania,
arising from different data sets, and one that is easily applicable
from a clinical and epidemiological point of view to the benefit of
patients and people at risk. As restriction fragment length
polymorphisms (RFLP) of the here analyzed hsp70 PCR amplicon
is already applied for species typing in the New World (Garcia et al.,
2004, 2005, 2007a,b; Perez et al., 2007), and its use can be further
extended to the Old World, a consensus classification scheme
should at least take results from this target into consideration. As
such, the RFLP technology can be further improved based upon the
sequence information provided by our study, and it could serve as a
standardized tool for species identification of the entire Leishmania
genus, applicable in most reference laboratory settings. In the
future we will build further upon the currently described data set
to gain more insight into the fascinating spectrum of contemporary
Leishmania parasites.
Acknowledgements
The authors would like to thank all colleagues and institutes
who kindly donated the Leishmania reference strains or DNA,
among whom J. Arévalo (Instituto de Medicina Tropical Alexander
von Humboldt, Lima, Peru); L. Garcı́a (Centro Universitario de
Medicina Tropical, Cochabamba, Bolivia); E. Cupolillo (Instituto
Oswaldo Cruz, Rio de Janeiro, Brazil); G. Schönian (Institut für
Mikrobiologie und Hygiene, Berlin, Germany); I. Mauricio and D.
Evans (London School of Hygiene and Tropical Medicine, London,
UK); P. Desjeux (Instituto Boliviano de Biologia de Altura, La Paz,
Bolivia); J.-P. Dedet and J.A. Rioux (Centre National de Référence
des Leishmania, Montpellier, France); J.J. Shaw (University of São
Paulo, São Paulo, Brazil); G. Schoone and A. El Harith (Royal
Tropical Institute, Amsterdam, The Netherlands); and the Leishe-
pinet consortium (EU contract INCO-CT2005-015407). Ilse Maes
(ITM, Antwerp) is acknowledged for her help with the PCRs,
sequencing, and DNA collection. This work has been funded by the
third framework program of the Belgian Development Cooperation
with ITM-A.
References
Arana, M., Evans, D.A., Zolessi, A., Cuentas, A.L., Arévalo, J., 1990. Biochemical
characterization of Leishmania (Viannia) braziliensis and Leishmania (Viannia)
peruviana by isoenzyme electrophoresis. Trans. R. Soc. Trop. Med. Hyg. 84, 526–
529.
Arisue, N., Hashimoto, T., Yoshikawa, H., Nakamura, Y., Nakamura, G., Nakamura, F.,
Yano, T.A., Hasegawa, M., 2002a. Phylogenetic position of Blastocystis hominis
and of stramenopiles inferred from multiple molecular sequence data. J. Eukar-
yot. Microbiol. 49, 42–43.
Arisue, N., Sánchez, L.B., Weiss, L.M., Müller, M., Hashimoto, T., 2002b. Mitochon-
drial-type hsp70 genes of the amitochondriate protists, Giardia intestinalis,
Entamoeba histolytica and two microsporidians. Parasitol. Int. 51, 9–16.
Asato, Y., Oshiro, M., Myint, C.K., Yamamoto, Y., Kato, H., Marco, J.D., Mimori, T.,
Gomez, E.A., Hashiguchi, Y., Uezato, H., 2009. Phylogenetic analysis of the genus
Leishmania by cytochrome b gene sequencing. Exp. Parasitol. 121, 352–361.
Bañuls, A.L., Hide, M., Prugnolle, F., 2007. Leishmania and the leishmaniases: a
parasite genetic update and advances in taxonomy, epidemiology and patho-
genicity in humans. Adv. Parasitol. 64, 1–109.
Bañuls, A.L., Hide, M., Tibayrenc, M., 1999. Molecular epidemiology and evolution-
ary genetics of Leishmania parasites. Int. J. Parasitol. 29, 1137–1147.
Bañuls, A.L., Hide, M., Tibayrenc, M., 2002. Evolutionary genetics and molecular
diagnosis of Leishmania species. Trans. R. Soc. Trop. Med. Hyg. 96, S9–13.
Berzunza-Cruz, M., Cabrera, N., Crippa-Rossi, M., Sosa-Cabrera, T., Pérez-Montfort,
R., Becker, I., 2002. Polymorphism analysis of the internal transcribed spacer
and small subunit of ribosomal RNA genes of Leishmania mexicana. Parasitol.
Res. 88, 918–925.
Bryant, D., Moulton, V., 2004. Neighbor-Net: an agglomerative method for the
construction of phylogenetic networks. Mol. Biol. Evol. 21, 255–265.
Corrêa, J.R., Brazil, R.P., Soares, M.J., 2005. Leishmania (Viannia) lainsoni (Kineto-
plastida: Trypanosomatidae), a divergent Leishmania of the Viannia subgenus –
a mini review. Mem. Inst. Oswaldo Cruz 100, 587–592.
Croan, D., Ellis, J., 1996. Phylogenetic relationships between Leishmania, Viannia and
Sauroleishmania inferred from comparison of a variable domain within the RNA
polymerase II largest subunit gene. Mol. Biochem. Parasitol. 79, 97–102.
Croan, D.G., Morrison, D.A., Ellis, J.T., 1997. Evolution of the genus Leishmania
revealed by comparison of DNA and RNA polymerase gene sequences. Mol.
Biochem. Parasitol. 89, 149–159.
Cupolillo, E., Grimaldi Jr., G., Momen, H., 1994. A general classification of New World
Leishmania using numerical zymotaxonomy. Am. J. Trop. Med. Hyg. 50, 296–311.
Cupolillo, E., Grimaldi, G., Momen, H., Beverley, S.M., 1995. Intergenic region typing
(IRT): a rapid molecular approach to the characterization and evolution of
Leishmania. Mol. Biochem. Parasitol. 73, 145–155.
Dávila, A.M., Momen, H., 2000. Internal-transcribed-spacer (ITS) sequences used to
explore phylogenetic relationships within Leishmania. Ann. Trop. Med. Para-
sitol. 94, 651–654.
Desjeux, P., 2001. Worldwide increasing risk factors for leishmaniasis. Med. Micro-
biol. Immunol. 190, 77–79.
Dujardin, J.C., Bañuls, A.L., Llanos-Cuentas, A., Alvarez, E., DeDoncker, S., Jacquet, D.,
Le Ray, D., Arévalo, J., Tibayrenc, M., 1995. Putative Leishmania hybrids in the
Eastern Andean valley of Huanuco, Peru. Acta Trop. 59, 293–307.
Eck, R.V., Dayhoff, M.O., 1966. Atlas of Protein Sequence and Structure. National
Biomedical Research Foundation, Silver Springs, MD.
Felsenstein, J., 1985. Confidence limits on phylogenies: an approach using the
bootstrap. Evolution 39, 783–791.
Fernandes, O., Murthy, V.K., Kurath, U., Degrave, W.M., Campbell, D.A., 1994. Mini-
exon gene variation in human pathogenic Leishmania species. Mol. Biochem.
Parasitol. 66, 261–271.
 J. Fraga et al. / Infection, Genetics and Evolution 10 (2010) 238–245
Fitch, W.M., 1971. Towards defining the course of evolution: minimum change for a
specific tree topology. System. Zool. 20, 406–416.
Folgueira, C., Requena, J.M., 2007. A postgenomic view of the heat shock proteins in
kinetoplastids. FEMS Microbiol. Rev. 31, 359–377.
Garcia, A.L., Kindt, A., Quispe-Tintaya, K.W., Bermudez, H., Llanos, A., Arévalo, J.,
Bañuls, A.L., De Doncker, S., Le Ray, D., Dujardin, J.C., 2005. American tegumen-
tary leishmaniasis: antigen-gene polymorphism, taxonomy and clinical pleo-
morphism. Infect. Genet. Evol. 5, 109–116.
Garcia, A.L., Parrado, R., De Doncker, S., Bermudez, H., Dujardin, J.C., 2007a. Ameri-
can tegumentary leishmaniasis: direct species identification of Leishmania in
non-invasive clinical samples. Trans. R. Soc. Trop. Med. Hyg. 101, 368–371.
Garcia, A.L., Tellez, T., Parrado, R., Rojas, E., Bermudez, H., Dujardin, J.C., 2007b.
Epidemiological monitoring of American tegumentary leishmaniasis: molecu-
lar characterization of a peridomestic transmission cycle in the Amazonian
lowlands of Bolivia. Trans. R. Soc. Trop. Med. Hyg. 101, 1208–1213.
Garcia, L., Kindt, A., Bermudez, H., Llanos-Cuentas, A., De Doncker, S., Arévalo, J.,
Wilber Quispe-Tintaya, K., Dujardin, J.C., 2004. Culture-independent species
typing of neotropical Leishmania for clinical validation of a PCR-based assay
targeting heat shock protein 70 genes. J. Clin. Microbiol. 42, 2294–2297.
Grimaldi Jr., G., David, J.R., McMahon-Pratt, D., 1987. Identification and distribution
of New World Leishmania species characterized by serodeme analysis using
monoclonal antibodies. Am. J. Trop. Med. Hyg. 36, 270–287 (Erratum in: Am. J.
Trop. Med. Hyg. 37, 414).
Hartl, F.U., Hayer-Hartl, M., 2002. Molecular chaperones in the cytosol: from
nascent chain to folded protein. Science 295, 1852–1858.
Hide, M., Bras-Gonçalves, R., Bañuls, A.L., 2007. Specific cpb copies within the
Leishmania donovani complex: evolutionary interpretations and potential clini-
cal implications in humans. Parasitology 134, 379–389.
Hughes, A.L., Piontkivska, H., 2003. Phylogeny of Trypanosomatidae and Bodonidae
(Kinetoplastida) based on 18S rRNA: evidence for paraphyly of Trypanosoma
and six other genera. Mol. Biol. Evol. 20, 644–652.
Huson, D.H., 1998. SplitsTree: analyzing and visualizing evolutionary data. Bioin-
formatics 14, 68–73.
Huson, D.H., Bryant, D., 2006. Application of phylogenetic networks in evolutionary
studies. Mol. Biol. Evol. 23, 254–267.
Ibrahim, M.E., Barker, D.C., 2001. The origin and evolution of the Leishmania
donovani complex as inferred from a mitochondrial cytochrome oxidase II gene
sequence. Infect. Genet. Evol. 1, 61–68.
Jamjoom, M.B., Ashford, R.W., Bates, P.A., Chance, M.L., Kemp, S.J., Watts, P.C., Noyes,
H.A., 2004. Leishmania donovani is the only cause of visceral leishmaniasis in
East Africa; previous descriptions of L. infantum and ‘‘L. archibaldi’’ from this
region are a consequence of convergent evolution in the isoenzyme data.
Parasitology 129, 399–409.
Kerr, S.F., 2000. Palaearctic origin of Leishmania. Mem. Inst. Oswaldo Cruz 95, 75–80.
Kimura, M., 1980. A simple method for estimating evolutionary rate of base
substitutions through comparative studies of nucleotide sequences. J. Mol.
Evol. 16, 111–120.
Kuhls, K., Mauricio, I.L., Pratlong, F., Presber, W., Schönian, G., 2005. Analysis of
ribosomal DNA internal transcribed spacer sequences of the Leishmania dono-
vani complex. Microbes. Infect. 7, 1224–1234.
Lainson, R., Shaw, J.J., 1987. Evolution, classification and geographical distribution.
In: Peters, W., Killick-Kendrick, R. (Eds.), The Leishmaniases in Biology and
Medicine. Academic Press, London, pp. 1–120.
Langkjaer, R.B., Vigre, H., Enemark, H.L., Maddox-Hyttel, C., 2007. Molecular and
phylogenetic characterization of Cryptosporidium and Giardia from pigs and
cattle in Denmark. Parasitology 134, 339–350.
Lewin, S., Schönian, G., El Tai, N., Oskam, L., Bastien, P., Presber, W., 2002. Strain
typing in Leishmania donovani by using sequence-confirmed amplified region
analysis. Int. J. Parasitol. 32, 1267–1276.
Lukeš, J., Mauricio, I.L., Schönian, G., Dujardin, J.C., Soteriadou, K., Debet, J.P., Kuhls,
K., Quispe-Tintaya, K.W., Jirků, M., Chocholová, E., Haralambous, C., Pratlong, F.,
Obornı́k, M., Horák, A., Ayala, F.J., Miles, M.A., 2007. Evolutionary and geograph-
ical history of the Leishmania donovani complex with a revision of current
taxonomy. Proc. Natl. Acad. Sci. 104, 9375–9380.
Luyo-Acero, G.E., Uezato, H., Oshiro, M., Takei, K., Kariya, K., Katakura, K., Gomez-
Landires, E., Hashiguchi, Y., Nonaka, S., 2004. Sequence variation of the cyto-
chrome b gene of various human infecting members of the genus Leishmania
and their phylogeny. Parasitology 128, 483–491.
Mauricio, I.L., Gaunt, M.W., Stothard, J.R., Miles, M.A., 2007. Glycoprotein 63 (gp63)
genes show gene conversion and reveal the evolution of Old World Leishmania.
Int. J. Parasitol. 37, 565–576.
Mauricio, I.L., Stothard, J.R., Miles, M.A., 2004. Leishmania donovani complex:
genotyping with the ribosomal internal transcribed spacer and the mini-exon.
Parasitology 128, 263–267.
Maurı́cio, I.L., Stothard, J.R., Miles, M.A., 2000. The strange case of Leishmania
chagasi. Parasitol. Today 16, 188–189.
Momen, H., Cupolillo, E., 2000. Speculation on the origin and evolution of the genus
Leishmania. Mem. Inst. Oswaldo Cruz 95, 583–588.
Nei, M., Gojobori, T., 1986. Simple methods for estimating the numbers of synony-
mous and nonsynonymous nucleotide substitutions. Mol. Biol. Evol. 3, 418–
426.
245
Noyes, H., 1998. Implications of a Neotropical origin of the genus Leishmania. Mem.
Inst. Oswaldo Cruz 93, 657–661.
Noyes, H.A., Arana, B.A., Chance, M.L., Maingon, R., 1997. The Leishmania hertigi
(Kinetoplastida; Trypanosomatidae) complex and the lizard Leishmania: their
classification and evidence for a neotropical origin of the Leishmania-Endotry-
panum clade. J. Eukaryot. Microbiol. 44, 511–517.
Orlando, T.C., Rubio, M.A., Sturm, N.R., Campbell, D.A., Floeter-Winter, L.M., 2002.
Intergenic and external transcribed spacers of ribosomal RNA genes in lizard-
infecting Leishmania: molecular structure and phylogenetic relationship to
mammal-infecting Leishmania in the subgenus Leishmania (Leishmania).
Mem. Inst. Oswaldo Cruz 97, 695–701.
Perez, J.E., Veland, N., Espinosa, D., Torres, K., Ogusuku, E., Llanos-Cuentas, A.,
Gamboa, D., Arévalo, J., 2007. Isolation and molecular identification of Leish-
mania (Viannia) peruviana from naturally infected Lutzomyia peruensis (Diptera:
Psychodidae) in the Peruvian Andes. Mem. Inst. Oswaldo Cruz 102, 655–
658.
Phillipe, H., 1998. Molecular phylogenetic in kinetoplats. In: Coomb, G.H., Vick-
erman, K., Sleigh, M.A., Warren, A. (Eds.), Evolutionary Relationships among
Protozoa. Systematics Association, London, pp. 195–212.
Piarroux, R., Fontes, M., Perasso, R., Gambarelli, F., Joblet, C., Dumon, H., Quilici, M.,
1995. Phylogenetic relationships between Old World Leishmania strains
revealed by analysis of a repetitive DNA sequence. Mol. Biochem. Parasitol.
73, 249–252.
Pratt, D.M., David, J.R., 1981. Monoclonal antibodies that distinguish between New
World species of Leishmania. Nature 291, 581–583.
Quispe-Tintaya, K.W., Laurent, T., Decuypere, S., Hide, M., Bañuls, A.L., De Doncker,
S., Rijal, S., Cañavate, C., Campino, L., Dujardin, J.C., 2005. Fluorogenic assay for
molecular typing of the Leishmania donovani complex: taxonomic and clinical
applications. J. Infect. Dis. 192, 685–692.
Rioux, J.A., Lanotte, G., Serres, E., Pratlong, F., Bastien, P., Perieres, J., 1990. Taxonomy
of Leishmania. Use of isoenzymes. Suggestion for a new classification. Ann.
Parasitol. Hum. Comp. 65, 111–125.
Rzhetsky, A., Nei, M., 1992. A simple method for estimating and testing minimum
evolution trees. Mol. Biol. Evol. 9, 945–967.
Saf’janova, V.M., 1982. The problem of the taxonomy with Leishmania. Ser. Proto-
zool. Soc. Acad. Scir. Leningr. 7, 5–109.
Saitou, N., Nei, M., 1987. The neighbor-joining method: a new method for recon-
structing phylogenetic trees. Mol. Biol. Evol. 4, 406–425.
Silveira, F.T., Shaw, J.J., Braga, R.R., Ishikawa, E., 1987. Dermal leishmaniasis in the
Amazon region of Brazil: Leishmania (Viannia) lainsoni sp.n., a new parasite from
the State of Pará Mem. Inst. Oswaldo Cruz 82, 289–291.
Spanakos, G., Piperaki, E.T., Menounos, P.G., Tegos, N., Flemetakis, A., Vakalis, N.C.,
2008. Detection and species identification of Old World Leishmania in clinical
samples using a PCR-based method. Trans. R. Soc. Trop. Med. Hyg. 102, 46–53.
Stevens, J.R., Noyes, H.A., Schofield, C.J., Gibson, W., 2001. The molecular evolution
of Trypanosomatidae. Adv. Parasitol. 48, 1–56.
Sukmee, T., Sriripattanapipong, S., Mungthin, M., Worapong, J., Rangsin, R., Samung,
Y., Kongkaew, W., Bumrungsana, K., Chanachai, K., Apiwathanasorn, C., Rujir-
ojindakul, P., Wattanasri, S., Ungchusak, K., Leelayoova, S., 2008. A suspected
new species of Leishmania, the causative agent of visceral leishmaniasis in a Thai
patient. Int. J. Parasitol. 38, 617–622.
Sulaiman, I.M., Morgan, U.M., Thompson, R.C., Lal, A.A., Xiao, L., 2000. Phylogenetic
relationships of Cryptosporidium parasites based on the 70-kilodalton heat
shock protein (HSP70) gene. Appl. Environ. Microbiol. 66, 2385–2391.
Tamura, K., Dudley, J., Nei, M., Kumar, S., 2007. MEGA4: Molecular Evolutionary
Genetics Analysis (MEGA) software version 4.0. Mol. Biol. Evol. 24, 1596–1599.
Thomaz-Soccol, V., Lanotte, G., Rioux, J.A., Pratlong, F., Martini-Dumas, A., Serres, E.,
1993. Monophyletic origin of the genus Leishmania Ross, 1903. Ann. Parasitol.
Hum. Comp. 68, 107–108.
Villinski, J.T., Klena, J.D., Abbassy, M., Hoel, D.F., Puplampu, N., Mechta, S., Boakye, D.,
Raczniak, G., 2008. Evidence for a new species of Leishmania associated with
focal disease outbreak in Ghana. Diagnost. Microbiol. Infect. Dis. 60, 323–327.
WHO, 2000. The Leishmaniases and Leishmania/HIV Co-infections. WHO fact sheet
116World Health Organization, Geneva.
WHO, 1990. Control of leishmaniasis. Report of a WHO Expert Committee. Technical
Report Series No. 793. World Health Organization, Geneva, Switzerland.
Yamasaki, M., Inokuma, H., Sugimoto, C., Shaw, S.E., Aktas, M., Yabsley, M.J., Yamato,
O., Maede, Y., 2007. Comparison and phylogenetic analysis of the heat shock
protein 70 gene of Babesia parasites from dogs. Vet. Parasitol. 145, 217–227.
Yamasaki, M., Tajima, M., Lee, K.W., Jeong, J.R., Yamato, O., Maede, Y., 2002.
Molecular cloning and phylogenetic analysis of Babesia gibsoni heat shock
protein 70. Vet. Parasitol. 11, 123–129.
Young, J.C., Agashe, V.R., Siegers, K., Hartl, F.U., 2004. Pathways of chaperone-
mediated protein folding in the cytosol. Nat. Rev. Mol. Cell. Biol. 5, 781–791.
Zelazny, A.M., Fedorko, D.P., Li, L., Neva, F.A., Fisher, S.H., 2005. Evaluation of 7SL
RNA gene sequences for the identification of Leishmania spp. Am. J. Trop. Med.
Hyg. 72, 415–420.
Zemanová, E., Jirků, M., Mauricio, I.L., Horák, A., Miles, M.A., Lukeš, J., 2007. The
Leishmania donovani complex: genotypes of five metabolic enzymes (ICD, ME,
MPI, G6PDH, and FH), new targets for multilocus sequence typing. Int. J.
Parasitol. 37, 149–160.