Ecological Indicators 84 (2018) 564–572

Contents lists available at ScienceDirect

Ecological Indicators
journal homepage: www.elsevier.com/locate/ecolind

Original Articles

A search for standardized protocols to detect alien invasive crayfish based MARK
on environmental DNA (eDNA): A lab and field evaluation
⁎
Aurora N. Geertsa, , Pieter Boetsb,c, Stef Van den Heedea, Peter Goethalsb,
⁎
Christine Van der heydena,
a
Hogeschool Gent/University College Ghent, Faculty of Science and Technology, Valentin Vaerwyckweg 1, 9000 Ghent, Belgium
b
Ghent University, Faculty of Bioscience Engineering, Coupure links 653, 9000 Ghent, Belgium
c
PCM Provincial Centre of Environmental Research, Godshuizenlaan 95, 9000 Ghent, Belgium

A R T I C L E I N F O A B S T R A C T

Keywords: Environmental DNA (eDNA) techniques are becoming increasingly popular in conservation and invasion
Environmental DNA biology, especially for monitoring and early detection of rare, endangered or invasive species. An exponential
Crayfish increase in varying methods regarding eDNA collection and analysis has been observed, which leads to mixed
Procambarus clarkii success in detection efficiency in studies on aquatic invertebrates. In this study, we tested and compared three
Invasive species
sampling and three DNA extraction methods using the crayfish Procambarus clarkii as model species. Based on
existing and newly developed primers, we were able to identify this species from tissue DNA and filtered eDNA
samples from water of aquaria kept in the laboratory as well as water from natural ponds. The species could be
positively identified in field and laboratory samples, though effectiveness differed greatly. Results in our study
seemed to be highly dependent on primer choice, DNA extraction method, and the type of sample (tissue or
filter). Our results showed that both an adapted phenol:chlorophorm:isoamyl alcohol protocol and a MasterPure
extraction kit provided the most reliable results to detect the species based on tissue and filtered eDNA samples.
The results are promising, but also highlight the necessity for a standardized protocol for each step of the eDNA-
based monitoring process. These protocols will need to be optimized individually for target groups or species.

1. Introduction money consuming. Furthermore, the identification of these organisms

The environmental DNA (eDNA) approach, though relatively new
(Ficetola et al., 2008; but see Venter et al., 2004), has the potential of
becoming an important method to monitor general species distributions
(Bohmann et al., 2014) and to detect rare or invasive alien species at an
early stage (Dougherty et al., 2016; Egan et al., 2013). All organisms
release DNA in the environment, be it dermal cells, mucous cells, in-
testinal cells in faeces, or gametes. Species can then be identified by
DNA extraction and sequencing from these environmental samples, like
water or soil (eDNA).
Using eDNA-based methods for biomonitoring has the advantage
that it generates rapid results, that no specific taxonomical knowledge
is needed, that any biotechnologically trained personnel should be able
to determine the origin of the DNA in the sample, and above all: that
the technique is not invasive (Rees et al., 2014). Normally, assessment
of biological water quality is based on presence/absence of indicator
organisms (e.g. macroinvertebrates). Therefore, invasive, destructive
and capture-based sampling takes place. This sampling is often time and
requires extensive taxonomical knowledge and involves further pre-
paration of the sample (Herder et al., 2013). The use of eDNA techni-
ques can reduce the time and effort normally needed in biomonitoring,
as well as reduce some of the problems inherent to field sampling, such
as the chance of missing species which are present as a result of in-
sufficient sampling effort.
Several eDNA protocols have already been described (Herder et al.,
2013) and the first commercial eDNA-analyses have been performed in
biomonitoring (cfr. Spygen), but until now, a standardized technique or
protocol has not been determined. Even though the knowledge of dif-
ferent techniques and the possible applications are increasing fast, there
are many hurdles that still need to be overcome (Deiner et al., 2015;
Renshaw et al., 2015; Roussel et al., 2015).
Most freshwater eDNA studies have focused on amphibians (Ficetola
et al., 2008; Goldberg et al., 2011) and fish (Takahara et al., 2013;
Takahara et al., 2012; Thomsen et al., 2012b). Detecting these larger
aquatic organisms is relatively “easy” due to the high production of
extracellular DNA. According to Herder et al. (2013), the detection

⁎
Corresponding authors.
E-mail addresses: aurora_geerts@yahoo.com (A.N. Geerts), christine.vanderheyden@hogent.be (C. Van der heyden).

http://dx.doi.org/10.1016/j.ecolind.2017.08.068
Received 13 October 2016; Received in revised form 21 August 2017; Accepted 24 August 2017
1470-160X/ © 2017 Published by Elsevier Ltd.
A.N. Geerts et al.
probability, based on eDNA, can even reach 99–100% for some or-
ganisms. In effect, detecting species based on eDNA has been success-
fully applied for a number of vertebrates such as the African clawed
frog (Xenopus laetis, Secondi et al., 2016), Great crested newt (Triturus
cristatus, Biggs et al., 2015), Bluegill sunfish (Lepomis macrochirus,
Takahara et al., 2013), and European weatherfish (Misgurnus fossilis,
Thomsen et al., 2012a).
The detection of macro-invertebrates through eDNA has yielded
mixed results. Targeting a broad set of macro-invertebrate species,
Mächler et al. (2014) were able to detect 5 out of 6 species in river and
lake systems. Caddisflies, however, could not be detected, which the
authors ascribed to the low amount of DNA released by these animals
through their sand case, which is used as protection (Mächler et al.,
2014). In a study comparing different sampling and extraction methods
for river and lake water, Deiner et al. (2015) concluded that biodi-
versity detection was strongly influenced by the choice of eDNA capture
and extraction protocols. They found that a combination of filtration
(glass fiber filter, 0.7 μm) and phenol:chloroform:isoamyl alcohol ex-
traction resulted in the highest amount of total recovered DNA for lentic
systems, but also established that detection rate was highest for the
combination of filtration and Qiagen DNeasy Blood & Tissue Kit (Deiner
et al., 2015). Goldberg et al. (2013) developed an eDNA test for the
early detection of the invasive New Zealand mudsnail (Potamopyrgus
antipodarum). They showed high sensitivity levels, detecting fairly low
densities of 11–78 individuals/m2 in a large river (Goldberg et al.,
2013). Tréguier et al. (2014) reported a detection efficiency of 59% for
the red swamp crayfish Procambarus clarkii in ponds where crayfish
presence was verified by trapping. They found that the eDNA method
performed better in small and shallow ponds compared to larger bodies
of water, probably due to the higher dilution of DNA in the larger lakes
(Tréguier et al., 2014). In a recent study on the use of eDNA to detect
crayfish, Dougherty et al. (2016) developed a qPCR assay to detect
Orconectes rusticus at low abundances in inland lakes (catch per unit
effort: 0.08, and two lakes where O. rusticus was not collected). Based
on eDNA, O. rusticus could successfully be detected in all lakes where its
presence had been established using classical methods. Later research
done by Larson et al. (2017) showed similar successful results using
qPCR to detect eDNA of O. rusticus and Pacifastacus leniusculus in large
North American lakes. In the study, there were two false negatives out
of eight, for O. rusticus and one out of seven, for P. leniusculus, the
species were not identified using eDNA, only with baited trapping
(Larson et al., 2017).
Despite these positive reports, various studies have used different
protocols for water sampling and for extracting DNA, making it difficult
to apply these techniques in routine monitoring. Therefore, the need to
develop a standard eDNA protocol is urgent (see a synthesis of guide-
lines in Goldberg et al., 2016). A standard protocol is especially re-
levant in light of the recent European regulation (1143/2014) on in-
vasive alien species, which states that each EU member state is
responsible for the follow up and management of a list of 37 alien in-
vasive species. This particularly applies to non-indigenous crayfish such
as Orconectes limosus, O. rusticus, Pacifastacus leniusculus, and Pro-
cambarus clarkii which can have a pronounced destructive effect on
aquatic ecosystems (Gherardi, 2007; Gherardi et al., 2011; Mathers
et al., 2016).
The aim of our study was to test the consistency of eDNA-based
crayfish monitoring techniques. Specifically, we set out to demonstrate
the presence or absence of an invasive crayfish species in Belgium,
Procambarus clarkii, using eDNA. This species was chosen because of its
invasive nature and the potential of the eDNA-technique for fast de-
tection. If specific species can be identified through eDNA monitoring of
water samples, management of the invasive crayfish and protection of
the native species could start sooner (Dougherty et al., 2016), and we
could, therefore, be more effective in controlling the invasion. We
tested three different extraction methods that had proven effective in
previous eDNA studies (adapted phenol:chloroform:isoamyl alcohol or
565
Ecological Indicators 84 (2018) 564–572
“Muyzer”, and CTAB extraction), as well as the MasterPure DNA ex-
traction kit which, to our knowledge, has not been compared to other
methods yet (Dauphin et al., 2010; Deiner et al., 2015; Gabor et al.,
2003; Holzmann et al., 2003; Renshaw et al., 2015). The extraction
methods also differ in time invested: Muyzer and CTAB: 1.5 days,
MasterPure: 0.5 day. Both Muyzer and CTAB make use of hazardous
chemicals, like phenol:chlorophorm:isoamyl alcohol, and cetyl-tri-
methylammonium bromide.
A specific primer pair was designed and one additional primer pair
was retrieved from the literature (Tréguier et al., 2014). The primers
were checked for species-specificity on tissue samples. Primers were
further used on water samples originating from aquaria in which single
crayfish specimens were maintained, as well as from natural ponds in
Flanders, Belgium. Since eDNA techniques have only recently been
employed in monitoring, we want to highlight the variable results and
difficulties we encountered while developing and applying this ap-
proach for the detection of invasive crayfish. Our results clearly show
the high potential of using eDNA, but primarily show the pitfalls and
inconsistencies encountered using this relatively new monitoring
technique, emphasizing that detection (or lack thereof) of this invasive
crayfish based on eDNA alone is not yet error proof.
2. Material and methods
2.1. Crayfish species/Study organism
In this study we focused on Procambarus clarkii, a crayfish species
that can currently be found in lentic and lotic systems in Belgium and
several other European countries (Boets et al., 2016; Boets et al., 2012;
Kouba et al., 2014). Individuals were kept in separate aquaria (H
20 cm × L 33 cm × W 25 cm; 13 l) with biological filters, thus pro-
viding DNA-containing water. Crayfish were fed commercial fish food
every two days. All crayfishes used in the experiments were caught in
the wild (Flanders, Belgium).
Procambarus clarkii Girard (1852, see Fig. 1) was first found in 2008
in Zammel (Boets et al., 2009) and is expanding fast (Boets et al., 2012).
This crayfish species displays dominant behaviour and can outcompete
other native and invasive species. It can also have a negative impact on
resident macroinvertebrate communities in European freshwater eco-
systems (Gherardi, 2007), on amphibians and even on the stability of
dikes (Eldredge and Humphries, 1994; Gherardi, 2006). This crayfish is
used as an indicator of heavy metal contamination in aquatic en-
vironments (Alcorlo et al., 2006; López et al., 2004). Adults of P. clarkii
reach sizes between 5 and 12 cm and are very common in small fish
ponds nearby the river Schelde, close to Hamme-Moerzeke (see ‘2.3
Study area’ and supplementary figure S1 in Supplementary material).
2.2. Trapping method
A Ron Thompson Crayfish trap was used for crayfish sampling in the
field. Nets were placed at variable intervals (fluctuating from 3 m up to
20 m, depending on accessibility), approximately 1 m from the shore.
The traps were left in the water for 2 days and then checked for the
presence of crayfish. Recovered crayfish were kept in the lab in aquaria
or euthanized (frozen) and stored at −20 °C. No difference in trapping
success was seen between traps with and without bait. Therefore, bait
was eventually omitted.
2.3. Study area
Besides water originating from our aquaria, our developed eDNA
technique was applied to field samples: two lentic water bodies. Water
from a pond containing P. clarkii, as well as specimens of P. clarkii, were
collected from a private pond in the Buntjesstraatjen in Moerzeke,
Eastern Flanders (coordinates: 69868, 343285: N 51 4.366, E 4 10.351,
see supplementary figure S2). Water was also collected from the old
A.N. Geerts et al.
ramparts of the city of Dendermonde, at the ‘Forten’, nearby the ‘Nieuw
Kwartier’ in Dendermonde, Eastern Flanders (coordinates: 64308,
338138: N 51 1.539, E 4 5.67, see supplementary figure S1). This lo-
cation does not contain P. clarkii (pers. obs). Physical and chemical
water quality parameters were measured for water from both locations.
Temperature, dissolved oxygen, and air pressure were measured in the
field using a HQ40D probe (Hach®). Nitrite, nitrate, ammonium, pH,
conductivity, and oxidation reduction potential were measured in the
lab with the same HQ40D probe. In order to estimate the chlorine-
content, carbonate hardness, general hardness, nitrite-N, and nitrate-N,
these parameters were measured in the lab with Tetra, 6-in-1
Freshwater test strips.
2.4. eDNA sampling
All eDNA-sampling material, filtering material, scissors, tweezers
and pestles were sterilized with a 0.7% sodium hypochlorite solution
(1/10 of commercially available solution) for at least 30 min. Before
use, these materials were rinsed with sterile distilled water and air
dried.
Water from aquaria was sampled using a 1 l glass bottle which was
completely filled after gentle mixing of the water. Water of field sites
(described above) was sampled to test for the presence of P. clarkii,
known to be present in Moerzeke based on traditional monitoring and
to compare DNA yield of different sampling and extraction methods. A
2 l sample was taken just beneath the water surface, at approximately
1 m off shore (without physically going into the lake) on different dates
between February and May 2016 wearing sterile gloves. Samples were
transported in cool and dark containers to the laboratory where 200 ml
was directly filtered over a nitrocellulose filter (Porafil), 0.45 μm pore
size, 47 mm diameter using a water faucet aspirator vacuum pump
(Dynalon®) and glass filtration system. The filters were individually
Table 1
Polymerase chain reaction (PCR) primer pair sequences, and annealing temperatures used. Amplicon size including primer pair length. The annealing temperature was chosen after
gradient PCR.
Species Primer Primer sequence 5′-3′ Primer design
name
Procambarus clarkii SPY-ProCla- CAGAAGCTAAAGGAGATAA Tréguier et al.
F (2014)
SPY-ProCla- AACTAGGGGTATAGTTGAGAG
R
Rodriv F CCTGTGGTAGAGGTTGGCAG Primer3Plus
Rodriv R CCGTAGCCCCAGAAGACAAT
566
Ecological Indicators 84 (2018) 564–572
Fig. 1. Procambarus clarkii specimen. © Jolien Weytens.
stored in sterile petri dishes at −20 °C.
In addition to direct filtering, 200 ml of water from six field samples
(for each location) was centrifuged at 4 °C, 14000 rpm for 10 min.
Centrifugation has been used in previous eDNA studies, mainly to
concentrate DNA and reduce excess water (Ficetola et al., 2008; Turner
et al., 2015). The pellet was resuspended in 5 ml of sterile distilled
water by vortexing and subsequently filtered over a 0.45 μm filter. All
filters were cut in half and kept in a labelled sterile petri dish at −20 °C.
Identification of P. clarkii was only tested in the Moerzeke site,
where it is present. Samples from the Forten site were extracted and the
DNA concentration was measured to compare extraction and sampling
(field and field pellet) methods and their DNA yield between sites.
2.5. Primer development
Mitochondrial genes were chosen to develop primer pairs for P.
clarkii. These genes have more copies per cell (Mills et al., 2000), and
are thus more likely to be detected in eDNA samples. Mitochondria are
also expected to be resistant to degradation (Turner et al., 2014). The
primer pair “ProCla” was developed by Tréguier et al. (2014) and has
an amplicon size of 96 bp. The RodRiv primer was designed by using
sequence data from GenBank and Primer 3Plus (Table 1), and has an
amplicon size of 109 bp. The short amplicon sizes have been proven
successful when identifying other species (Mahon et al., 2013). The
primers’ specificity was tested in silico through Primer-Blast with the
default settings (NCBI, Zhang et al., 2000) but no other species, except
P. clarkii, were identified. Both primers were also tested on species
specificity through PCR with DNA from other crayfish occurring in
Flanders (Orconectes limosus, and Astacus leptodactylus), and Astacus
astacus (only occurs in Wallonia, Belgium) as well as three-spined
stickleback (Gasterosteus aculeatus) DNA (for previous specificity tests of
ProCla, see Tréguier et al., 2014). For each primer, annealing
Primer origin Amplicon size Annealing
temperature
COI (Tréguier et al., 2014) 96 51 °C
Cytochrome c oxidase subunit III (GenBank: 109 54 °C
JX316743.1)
A.N. Geerts et al.
temperature was tested in a gradient PCR (Applied Biosystems).
2.6. DNA extraction and PCR reaction
Each DNA extraction included an extraction-positive control (P.
clarkii tissue sample) and an extraction-negative control (200 μl ultra-
pure water). DNA concentrations were measured using Qubit broad
range DNA assay (Invitrogen).
2.6.1. Adapted Muyzer protocol (phenol:chloroform:isoamyl alcohol or
PCI)
An adapted Muyzer-protocol with glycogen (Muyzer et al., 1993)
was used (see 1.1 in Supplementary material). Tissue samples consisted
of muscle and other soft tissue. The filtered sample (½ of a 0.45 μm
filter) was cut into smaller pieces into a 1.5 ml Eppendorf tube on ice.
0.5 ml TE-buffer (1X TE, pH 8.0) was added to each tube as well as
0.5 ml PCI or phenol:chloroform:isoamyl alcohol (24:25:1 v/v). The
solution was homogenized by grinding with a sterilized micro-pestle for
30 s, and vortexing for 1 min. All samples were kept on ice between
steps. Samples were centrifuged at 4 °C for 5 min at 13000 rpm. The
supernatant was transferred to a new 1.5 ml Eppendorf tube. Subse-
quently, 0.5 ml PCI (24:25:1 v/v) was added to the supernatant, shaken
and then centrifuged at 4 °C for 5 min at 13000 rpm. The last two steps
were repeated: the supernatant was transferred to a new 1.5 ml tube.
0.5 ml PCI (24:25:1 v/v) was added to the supernatant, shaken and then
centrifuged at 4 °C for 5 min at 13000 rpm. All samples were kept on ice
between steps. The supernatant was transferred to a new 1.5 ml Ep-
pendorf tube. 1 ml of ethanol (100%, −20 °C) was added, as well as
50 μl of sodium acetate (3 M, pH5), and 2 μl of glycogen (20 mg/mL).
Samples were incubated overnight at −20 °C.
Samples were centrifuged at 4 °C for 30 min at 13000 rpm. The
supernatant was removed and 1 ml of 70% ethanol was added to the
pellet. Samples were centrifuged at 4 °C for 5 min at 13000 rpm. The
supernatant was removed and samples were left to air dry for 20 min.
Filter samples were resuspended in 30 μl sterilized MilliQ water, while
DNA extracted from tissues was resuspended in 100 μl sterilized MilliQ
water.
2.6.2. CTAB protocol
This protocol was based on the use of acetyl-trimethylammonium
bromide (CTAB) extraction buffer (see 1.2 in Supplementary material).
The CTAB extraction buffer was heated to 65 °C and 300 μl of the
warm buffer was added to the frozen tissue sample or ½ nitrocellulose
filter. Using a sterilized microcentrifuge pestle, the sample was grinded
and homogenized. An additional 250 μl of warm CTAB buffer was
added (and used to rinse the pestle). The samples were vortexed, and
incubated in a water bath (65 °C) for 60 min. During incubation they
were vortexed twice. Afterwards, the samples were vortexed and RNAse
A was added to a final concentration of 10 μg/mL. The Eppendorf tubes
were inverted and incubated in a water bath (37 °C) for 40 min. After
20 min, the tubes were inverted once. The samples were vortexed and
then centrifuged (Eppendorf) at 13000 rpm for 5 min at room tem-
perature. The supernatant was pipetted to a new sterile 1.5 ml
Eppendorf tube without dislodging the pellet. 500 μl of 24:1 chlor-
oform:isoamyl alcohol (v/v) was added and mixed. The samples were
centrifuged at 13000 rpm for 15 min at room temperature.
The upper aqueous layer was transferred to a new sterile 1.5 ml tube
avoiding debris at the interface. 900 μl of cold (−20 °C) 100% ethanol
was added and mixed. Samples were incubated at −20 °C for 30 min.
Afterwards, the samples were centrifuged at 13000 rpm for 45 min at
4 °C. Ethanol was poured off and the pellet was washed with 1 ml 70%
ethanol. The sample was vortexed until it was resuspended and then
centrifuged at 30000 rpm for 10 min at 4 °C. The supernatant was re-
moved with a sterile pipette. The samples were dried until the pellet
was translucent.
The pellet was resuspended in 100 μl 1X TE Buffer (pH 8.0). Phase
567
Ecological Indicators 84 (2018) 564–572
Lock Gel™ (5 Prime PLG) tubes were prepared by centrifugation at
13000 rpm for 30 s. The sample volume was brought up to 500 μl by
adding 400 μl 1X TE Buffer. 500 μl of PCI (25:24:1) (v/v) was added to
each sample and the sample was transferred to the PLG tube. The tubes
were shaken and centrifuged at 13000 rpm for 5 min at room tem-
perature. The aqueous layer was pipetted to a new 1.5 ml Eppendorf
tube and 50 μl Na-Acetate (3 M) was added. 1000 μl of cold (−20 °C)
100% ethanol was added. The samples were stored overnight in the
freezer (−20 °C).
The samples were spun at 13000 rpm during 45 min at 4 °C. The
pellet was checked and ethanol was gently poured off. 1 ml of 70%
ethanol was added to wash the sample and vortexed to resuspend the
pellet. The samples were centrifuged at 13000 rpm for 15 min at 4 °C.
The ethanol was poured off and the samples dried until the pellet was
transparent. Filter samples were resuspended in 30 μl sterilized MilliQ
water, while DNA extracted from tissues was resuspended in 100 μl
sterilized MilliQ water.
2.6.3. MasterPure DNA purification kit (Epicentre)
The MasterPure extraction follows the manufacturer’s instructions
with some adaptations, as it was optimized for fish at the UGent
Laboratory of Environmental Toxicology and Aquatic Ecology (see 1.3
in Supplementary material).
The frozen tissue or ½ of a nitrocellulose filter sample was put into a
sterile 1.5 ml Eppendorf tube and kept on ice. 600 μl of Tissue and Cell
Lysis Solution and 1 μl of 50 μg/μL proteinase K solution was added to
each sample. Using a sterilized microfuge tube pestle, the sample was
homogenized thoroughly. The lysate was incubated in a warm water
bath (65 °C) for 15 min, vortexing for 2–3 s every 5 min. Samples were
allowed to cool down to 37 °C at room temperature.
Three μL of 5 mg/mL RNAse A solution was added to the cell lysate.
The Eppendorf tubes were inverted 25 times to mix the solution and
then incubated in a warm water bath (37 °C) for 10 min.
Samples were put on ice for 5 min. 200 μl of MPC Protein
Precipitation Agent was added to each sample. To mix the solution,
samples were vortexed for 10 s. Afterwards, samples were centrifuged
at 13000 rpm for 10 min at 4 °C in the microcentrifuge. Precipitated
proteins and tissue particles form a tight pellet. The supernatant was
transferred to a clean sterile 1.5 ml Eppendorf tube; the pellet was
discarded.
Five hundred μL isopropanol was added to the supernatant and the
tube was inverted 30–40 times to mix. The samples were centrifuged at
more than 13000 rpm for 10 min at 4 °C in the microcentrifuge to pellet
the DNA. The isopropanol was removed using a sterile pipette and tip
without stirring the DNA pellet. 500 μl 75% ethanol was added and the
tube was inverted to rinse the pellet without dislodging it. The ethanol
was removed without touching or dislodging the DNA pellet. The last
ethanol rinsing step was repeated and all ethanol was removed with a
sterile pipette. The Eppendorf tubes were left open so the remaining
ethanol could evaporate. Filter samples were resuspended in 30 μl
sterilized MilliQ water, while DNA extracted from tissues was re-
suspended in 100 μl sterilized MilliQ water.
All DNA samples were stored at −20 °C. The integrity and quality of
the DNA was visualized using gel electrophoresis (1% agarose gel)
stained with SYBR safe (Invitrogen, by Thermofisher Scientific).
Visualization occurred with the Safe Imager™ Blue-Light
Transilluminator (ThermoFisher Scientific). A 1 kb SmartLadder
(Eurogentec) was used to confirm the presence of genomic-grade DNA.
The DNA concentration and quality was measured using Qubit broad
range DNA assay (Invitrogen) for 53 Moerzeke samples, divided over
extraction and sampling methods, and 24 Forten samples.
2.7. Polymerase Chain Reaction
All polymerase chain reactions were done using the TaqMan
Environmental master mix (ThermoFisher Scientific) using the adapted
A.N. Geerts et al.
protocol from Thomsen et al. (2012b). 25 μl PCR reactions were pre-
pared using 10 μl TaqMan Environmental master mix, 11 μl sterilized
MilliQ water, 1 μl forward primer (10 μM), 1 μl reverse primer (10 μM)
and 2 μl sample DNA. All PCR amplifications included a PCR-positive
control (sample known to contain target species DNA) and a PCR-ne-
gative control (ultrapure water).
The PCR was performed under the following thermal conditions:
95 °C for 10 min followed by 35 cycles at 95 °C for 15 s, 51 or 54 °C
(depending on the primer, see Table 1) for 60 s, 72 °C for 60 s and a
final extension 72 °C for 60 s.
The PCR products were visualized using gel electrophoresis (2%
agarose gel) stained with SYBR safe (Invitrogen, by Thermofisher
Scientific). Visualization occurred with the Safe Imager™ Blue-Light
Transilluminator (Thermofisher Scientific). A 100 bp SmartLadder
(Eurogentec) was used to confirm the length of the amplified fragments.
In order to compare results of the different eDNA samples (tissue,
filters: aquarium, field and field pellet) and extraction methods
(Muyzer, CTAB and MasterPure), three extractions per method were
performed (except for the field pellet samples which were used in two
extractions instead of three). For each extraction two replicates were
included of each sampling method and a negative control. Since filters
were cut in half, these were randomized over the different extraction
methods. PCR was performed on each replicate extraction. In total 96
samples were extracted: 36 extractions for tissue and aquarium sam-
ples, 36 extractions for field, and 24 extractions for pellet samples (two
locations). There were no PCR replications (see Table 2). Because of the
different treatments and low amount of replicates (n = 6), statistical
analysis was not possible.
When the PCR products were visible as a clear band of the expected
length (96 bp for ProCla and 109 bp for RodRiv), they were considered
positive. Positive identification of a species relies on primers reacting
accurately with the corresponding species-specific DNA strand, which
should be reflected in the length of the amplicons. If the extraction
control or the PCR control were positive, the results of that replicate
extraction were discarded (Goldberg et al., 2016).
Tissue and eDNA samples were amplified using the same PCR pro-
tocol described (50 μl volume) and were subsequently sequenced. One
eDNA sample and four tissue samples (one sample with ProCla and
three with RodRiv, since this primer pair had not been tested before)
were chosen. Amplicons were sequenced using the BigDye® Terminator
v3.1 Cycle Sequencing Kit' (Thermo Fisher Scientific) on ABI 3130XL
(Applied Biosystems, Inc.). Amplicon sequences obtained (see 2 in
Supplementary material) were compared to known sequences
(Procambarus taxid 6726 was selected as the amplicon sequences are
very short) using NCBI BLAST 2.6.1 (Altschul et al., 1997). The ex-
pected 109 bp amplicon of RodRiv aligns perfectly only to P. clarkii
(BLAST 2.6.1: 3e-47 E value, 100% identification), so sequenced frag-
ments of this amplicon are expected to show the same results. To
summarize, the criteria for positive identification of P. clarkii are hereby
defined as: amplicon length should both be as expected for each primer,
sequence of the amplicon should align with known P. clarkii sequences,
and all controls should be negative except for the positive control.
The percentage of successful identifications of target DNA was cal-
culated by dividing the number of positive reactions by the total
Table 2
Percentage of positive species identification for P. clarkii. In parentheses we show the amount of positive reactions divided by the total amount of reactions (minus extractions where
negative controls were positive). Sampling methods include frozen tissue, 200 ml filtered aquarium water, 200 ml filtered field water and 200 ml field water centrifuged and filtered. The
extraction methods include Muyzer, CTAB and MasterPure. The primers used were ProCla (Tréguier et al., 2014) and RodRiv (designed in house).
Origin Muyzer
Procambarus clarkii Primer ProCla
Tissue 100 (4/4)
Aquarium filter 0 (0/4)
Field filter 75 (3/4)
Field pellet filter 50 (2/4)
Ecological Indicators 84 (2018) 564–572
number of reactions for that sampling and extraction method.
2.8. Detection limit
Milli Q water was spiked using DNA extracted from tissue samples.
Two samples were used; the first had a concentration of 50 ng/μl, the
second a concentration of 25 ng/μl. From these samples, dilutions were
made: 1:2, 1:10, 1:20, 1:100 and 1:200. The detection limit was tested
using PCR reactions (see Polymerase Chain Reaction) with both
RodRiv and ProCla primers (see Table 1).
3. Results
The results show that effective identification using environmental
DNA varied with sampling and extraction method, and developed pri-
mers (Table 2 and Fig. 2). All tissue samples yielded positive identifi-
cation, but only when the ProCla primer was used. Pelleted field sam-
ples did not show higher detection efficiencies compared to filtered
field samples. High accuracy in identifying the field samples was ob-
tained when using the RodRiv primer in combination with the Muyzer
protocol. In one replicate extraction (two samples), the extraction
control was positive, which reduced the amount of replicates from six to
four (n = 4).
Measured DNA concentrations (Fig. 2) varied between DNA sam-
pling and extraction protocols. Total DNA concentrations for field filter
samples were higher compared to pelleted field samples, aquarium
filter DNA concentrations were very low compared to the other sample
sources (around 6.0 ng/μl).
3.1. Primers
For the RodRiv primer we found the expected 109 bp amplicons, as
well as other amplicons. In positive reactions, amplicons ranged around
400 bp, and in a few samples around 900–1000 bp. The published
primer ProCla (Tréguier et al., 2014) detected tissue samples reliably,
but seemed to be less successful for the detection of P. clarkii when used
on water samples (Table 2). This primer consistently resulted in am-
plicons of the expected size (96 bp including primers).
When testing specificity, both primers reacted in PCR with tissue
samples from Astacus astacus, but did not react to the other crayfish
species. The resulting amplicons for A. astacus were around 200–300 bp
for both primers.
The ProCla amplicon of 96 bp successfully aligned with P. clarkii
sequences, including the sequence the primers originated from
(KJ645855.1): forward sequence 51 E value, and 100% identification,
reverse sequence 0.002 E value, 100% identification. Full sequences
can be found in Table 2.1 in Supplementary material. The RodRiv
amplicons were also sequenced (see 2.1 in Supplementary material).
When compared to known sequences (BLASTX 2.6.1), one 963 bp am-
plicon (from tissue, see 2.1 in Supplementary material) showed simi-
larity with Pseudomonas sp. (1e-147 E value, and 89% identification),
while an 375 bp amplicon (from eDNA, see 2.2 in Supplementary ma-
terial) showed similarity with Roseobacter sp. (2e-15 E value, and 39%
identification). The 109 bp amplicons from tissue samples successfully
CTAB MasterPure
RodRiv ProCla RodRiv ProCla RodRiv
0 (0/4) 100 (4/4) 0 (0/4) 100 (4/4) 50 (2/4)
75 (3/4) 0 (0/4) 75 (3/4) 25 (1/4) 100 (4/4)
100 (4/4) 0 (0/4) 25 (1/4) 50 (2/4) 25 (1/4)
75 (3/4) 0 (0/4) 25 (1/4) 0 (0/4) 50 (2/4)
568
A.N. Geerts et al.
Fig. 2. Total DNA concentrations (ng/μl) per extraction method (Muyzer, CTAB, and MasterPure) and sample source (Tissue, Filter Aquarium, Filter Field, and Filter Pellet) for two
locations; one where Procambarus clarkii can be found (Moerzeke), and one were the species is absent (Forten).
aligned with P. clarkii sequences, including the sequence the primers
originated from (JX316743.1): forward sequence 2e-04 E value, 100%
identification, reverse sequence 5e-04 E value, 95% identification. We
were not able to sequence the shortest eDNA amplicons (109 bp) for
RodRiv because of low quality. For full amplicon list and BLAST results
see Table 2.1 in Supplementary material.
3.2. Detection limit
Detection limit of P. clarkii differed between primers. The RodRiv
primer did not react with any of the diluted samples. With the ProCla
primer, positive species identification was possible up to a concentra-
tion of 2.5 ng/μl for both diluted tissue samples (sample 50 ng/μl, di-
lution 1:20; sample 25 ng/μl, dilution 1:10). All controls (extracted
MilliQ water and MilliQ added to PCR reaction) were negative and
positive controls (tissue samples) were positive.
4. Discussion
Environmental DNA has mostly been used in research focusing on
(invasive or threatened) amphibian and fish species. In the past years
the scope of research has broadened (mammals: Foote et al., 2012;
reptiles: Piaggio et al., 2014). Studies focusing on large invertebrates,
however, are still rare and show divergent results (see for example
Tréguier et al., 2014). Large invertebrates with exoskeletons or shells
lack the permeable skin that characterizes fish and amphibian species,
influencing their detectability (Goldberg et al., 2013). Though they
might be more difficult to detect using eDNA, a few research groups
have been able to successfully identify several species of macro-in-
vertebrates: mudsnails (Goldberg et al., 2013), several mussel and two
crab species (Mahon et al., 2013), several stonefly species (Elbrecht and
Leese, 2015), and five different macro-invertebrate species (Mächler
et al., 2014).
In this study, we were able to detect P. clarkii in water samples
based on eDNA with variable accuracy. In field and aquarium samples
we achieved an average accuracy of 22% for the ProCla primer, and
61.1% for the RodRiv primer. Our results show that positive identifi-
cation is not straightforward, even for an organism as large as the
freshwater crayfish species used in this study. Results in our study were
highly dependent on primer choice, DNA extraction method, and the
type of sample (tissue or filter), thus supporting the necessity for further
research into standardization and optimization of eDNA protocols.
569
Ecological Indicators 84 (2018) 564–572
Both primers and amplicons were sequenced and compared to
known sequences (BLASTX 2.6.1). As they have both short amplicons,
the fragments resulting from sequencing were also quite short (see
Table 2.1 in Supplementary material). We were able to align the short
sequences to the correct amplicon. These separate alignments (forward
and reverse) were not always perfect, but the combination of both
forward and reverse fragments and the knowledge that the amplicons
align only to P. clarkii (for ProCla see Tréguier et al., 2014) allows us to
conclude that we have correctly identified this species with both pri-
mers in our samples. When the ProCla primer was tested against other
species it reacted with the target species but also with the European
crayfish (A. astacus). This primer was tested against tissue samples from
other crayfish species in a previous study, but no unspecific reactions
were reported (Tréguier et al., 2014). When the larger RodRiv ampli-
cons were compared to known sequences (BLASTX 2.6.1), they showed
similarity with Pseudomonas sp. (1e-147 E value, and 89% identifica-
tion), and with Roseobacter sp. (2e-15 E value, and 39% identification).
The fragments obtained from sequencing the 109 bp amplicon were
larger and thus alignment with P. clarkii sequences was more accurate
(see Table 2.1 in Supplementary material). The RodRiv primer also
reacted positively with A. astacus tissue, which means neither primer is
completely species-specific. Even though the European crayfish is be-
coming less common in its native region because of competitive ex-
clusion and sensitivity to the crayfish plague (Aphanomyces astaci),
further research into specificity of the ProCla and RodRiv primers is
needed since both P. clarkii and A. astacus can co-occur (Gherardi, 2006;
Westman et al., 2002). However, as A. astacus no longer occurs in
Flanders (Belgium) both primers can be used to track the occurrence
and expansion of P. clarkii.
The difference in results for the two primers used further reflects the
need for thorough preliminary tests for each primer. In this case, both
primers were needed to positively identify P. clarkii, since ProCla
mostly reacted with the tissue samples, while RodRiv reacted best with
the field and aquarium samples (see Table 2). Comparing different
primers can be essential for the successful identification of certain
species. A tissue sample is often used as a positive control and was
expected to give consistent positive results. In several other extractions
using environmental TaqMan and when used with the taq-polymerases,
RodRiv previously showed positive results for tissue samples (A.N.
Geerts, unpublished results). One potential explanation for the lack of
positive results for P. clarkii tissue when using the RodRiv primer might
have been the higher amount of DNA which can inhibit primers from
A.N. Geerts et al. Ecological Indicators 84 (2018) 564–572

Table 3 2014). Higher DNA concentrations should result in higher concentra-

Results of measured physical and chemical parameters in Moerzeke and in the Forten,
Belgium.
Parameters Moerzeke Forten
Temperature (°C) 12.2 13.4
Dissolved Oxygen (mg O2/L) 7.7 8.9
Air pressure (mbar) 1012 1011
Nitrite NO2− (mg/L) 0 0
Nitrite Nitrogen NO2− −N (mg/L) 0 0
Ammonium NH4+ (mg/L) out of range 0,325
Nitrate NO3− (mg/L) – –
pH 7.35 7.68
Conductivity (μS/cm) 785 289
Oxydation Reduction Potential (mV) 180 170.3
Chlorine Cl2 (mg/L) 0–0.8 0–0.8
Carbonate hardness (°d) 6 6
General hardness (°d) 16 16
Nitrite NO2− (mg/L) 0 0
Nitrate NO3− (mg/L) 0 0
effectively binding to the right sequence (Matijašić et al., 2010). This,
however, was tested through dilutions when measuring the detection
limit of both primers. Concentrations for the dilutions ranged from
50 ng/μl to 0.125 ng/μl. The results (see 3.2) did not differ from pre-
vious outcomes, showing that the amount of DNA was not the cause for
the lack of reactions. Another potential explanation for the negative
results on P. clarkii tissue might be inhibition (Deiner et al., 2015). The
successful DNA extraction and identification of the P. clarkii tissue
samples was proven by the positive reactions in a PCR with the ProCla
primer. ProCla, however, did not appear to react as efficiently as Ro-
dRiv to the filtered samples. This was unexpected since ProCla showed
positive, albeit limited, results in an eDNA study done by Tréguier et al.
(2014). In their study, P. clarkii was detected in 59% of the 158 ponds it
inhabits, using the ProCla primer with qPCR (Tréguier et al., 2014).
Similar results were found in research by Cai et al. (2017), who also
used ProCla to identify P. clarkii in eDNA samples. The researchers
based their method on Tréguier et al. (2014) and could consistently
identify P. clarkii in field and aquarium samples, with only one false
negative (Cai et al., 2017). Another possible reason for the difference in
detection success between primers might be that the DNA sequence
RodRiv binds to is more abundant or less degraded when compared to
the DNA sequence ProCla binds to. When choosing the right primer(s),
several aspects need to be taken into account aside from primer spe-
cificity, particularly for primers that target small fragments, since eDNA
is usually degraded DNA. Some researchers have suggested, however,
that targeting different regions of the genome can improve organism
detection (Evans et al., 2016). Especially when moving towards an
eDNA metabarcoding approach, using two or more primers might be
essential to effectively assess biodiversity (Creer et al., 2016; Deiner
et al., 2016).
The total DNA concentrations measured after extraction were more
or less similar for the tissue (on average 17.7 ng/μl) and aquarium (on
average 6.0 ng/μl) samples, but differed for field samples when using
different DNA extraction protocols (see Fig. 2). The highest con-
centrations were obtained from the extractions using the MasterPure
protocol, with comparable results with CTAB. In the Forten samples,
CTAB extractions resulted in the highest concentrations, followed by
MasterPure and then Muyzer. For the Moerzeke samples, higher DNA
concentrations did not directly relate to higher identification success.
Identifying P. clarkii from the Moerzeke samples gave the best results
when using the Muyzer protocol, resulting in 75% (ProCla) and 100%
(RodRiv) identification (see Table 2). The Muyzer protocol is the only
one that does not include an RNAse step. This is important in con-
centration and purity measurements but especially in further analyses
(like sequencing). In other eDNA studies, DNA extractions were usually
done using CTAB (Renshaw et al., 2015) or DNeasy kit (Rees et al.,
tions of target DNA, and thus a higher probability of primers binding to
the target sequence. In this regard the difference between extracted
field and pelleted field water samples is extremely relevant: for Moer-
zeke samples the concentration was on average 139.4 ng/μl for field
samples, and 76.2 ng/μl for pelleted field samples; while for the Forten
samples it was 41.3 ng/μl for field samples, and 23.9 ng/μl for pelleted
field samples. In our study pelleted samples did not result in increased
detection of P. clarkii or in similar eDNA concentrations. Rather, by
pelleting field water samples, we lost about half of the available eDNA.
This technique might not be essential for detection, but could be used
for field water samples with high amounts of suspended material. These
samples usually take longer to filter, even with low volumes (200 ml).
Our findings partly reflect previous results by (Deiner et al., 2015),
where pelleted samples resulted in the lowest DNA yield. Other studies
have successfully used centrifugation to concentrate eDNA and identify
target species (Ficetola et al., 2008; Thomsen et al., 2012a).
Extracted DNA concentrations differed between the two sampled
locations (see Fig. 2). The same volume of water was sampled (200 ml),
and both locations showed similar values in physical and chemical
parameters (see Table 3). Only conductivity differed: Moerzeke 785 μS/
cm, and the Forten 289 μS/cm. These results show that, even when the
sampling locations seem similar, there can still be factors, most likely
the amount of algae and bacteria in the water column, that may in-
fluence the extraction process and the amount of DNA that can be ex-
tracted (Barnes and Turner, 2016).
The lack of positive results from eDNA is a bit troubling, since our
target species is a large invertebrate (max length of 12 cm). Life history
or behavioural differences could influence the amount of DNA released
into the environment (Barnes and Turner, 2016; Maruyama et al., 2014;
Takahara et al., 2012). How often individuals moult, how active the
species is (including during feeding and reproduction), will inevitably
influence the concentration and spread of DNA in the water column. P.
clarkii is known to construct burrows (Barbaresi et al., 2004) and is
usually more active at night (Pérez-Bote, 2004). This might mean that
eDNA shed by individuals could be more readily available in the sedi-
ment instead of the water column. The species exhibits high fecundity,
and is capable of reproducing twice a year, though this is mostly ob-
served in warmer regions (GISD, 2016). During the reproductive period
males are more energetic and travel actively, possibly increasing the
amount of eDNA in their aquatic environment. Breeding for P. clarkii
takes place in the fall (from September onwards; GISD, 2016). Our
sampling period, February-May, may have biased our results in the
negative sense. This, however, does not explain the lack of success in
identifying aquarium samples, as the laboratory crayfish were housed
individually under similar climatic conditions. The low detection effi-
ciency for aquarium samples is probably related to the DNA con-
centrations present in these samples (Fig. 2). Extracted aquarium filters
consistently resulted in lower DNA concentrations (on average 6.0 ng/
μl) compared to extracted field or pellet filters (see Fig. 2). Other factors
that could negatively influence the eDNA persistence in our aquaria are
light, constant oxygenation, temperature (20 °C), bacterial activity, and
the general sedentariness of the individual crayfish (Barnes and Turner,
2016). A crucial factor to take into account is the amount of individuals
in the sampled habitat (Thomsen et al., 2012a). If only a few individuals
are present, then their activity will influence the results greatly (Dejean
et al., 2011), but if there are several hundreds of crayfish present in a
small pond the chances of positive identification increase regardless of
how active these individuals are. Unfortunately, the population size of
the crayfish in the Moerbeke sampling site is unknown, but based on the
success of the catch, it is assumed that P. clarkii was abundantly present.
The difference in sampling method also influenced the extraction
and PCR results. As expected, tissue samples yielded 100% positive
results for all extraction methods and in all PCR reactions, except for
the RodRiv primer, which did not react with the tissue samples (see
Table 3). Since aquaria are small controlled closed environments, with

570
A.N. Geerts et al.
a known amount of individuals per volume, we expected to have a high
success rate in identifying species. This, however, was not consistently
reflected in our results, where the average positive identification was
around 83% for the RodRiv primer, but as stated before this is most
likely related to the low eDNA concentrations found in these samples
(see Fig. 2). Positive identification from field samples and pellet sam-
ples was possible for all three extraction methods, though with highly
differing success rates. Centrifugation of field samples did not increase
the chances of positive identification. After comparison of the different
sampling methods, it seems that in order to confidently determine the
presence of the target species in field samples, at least two water
samples per study site would be needed to correct for false negatives.
This reflects the necessity for further optimisation. Further tests with
other types of filters as well as ‘enclosed filters’ should be done (Spens
et al., 2016).
We can conclude that eDNA analysis for detection of the crayfish P.
clarkii has the potential of becoming an efficient and reliable biomo-
nitoring method. Our results show that the species can be detected, but
the efficiency differed greatly not only between sampling techniques
but also between extraction methods. The differences in extracted DNA
concentrations show that even low amounts of DNA can be detected
when the right primer is used. We suggest that future research focuses
on finding optimal primers and assessing the effect of environmental
conditions on the eDNA method. This will be especially relevant in the
current transition to qPCR and metabarcoding (Creer et al., 2016), and
in trying to quantify species abundance, though this quantification
might not be possible for PCR-based methods (Dougherty et al., 2016;
Elbrecht and Leese, 2015). Our results showed that CTAB and Mas-
terPure were both good methods for eDNA extraction of filtered sam-
ples (see Table 2). CTAB is a method that lasts two days (see 1.2 in
Supplementary material), uses hazardous products, requires the pre-
paration of fresh CTAB buffer (this solution can be stored for maximum
three days at 4 °C) and includes many steps, i.e. more chances for
mistakes. The MasterPure kit might be more expensive but can be
performed in half a day without the need for buffer preparation (see 1.3
in Supplementary material) and without the use of toxic reagents. Our
results indicate that the Muyzer method for eDNA extraction for filtered
samples showed the best results, while MasterPure was best for tissue
and aquarium samples. The Muyzer protocol (adapted PCI method) has
been used in other eDNA studies and has shown its efficacy (Deiner
et al., 2015). However, if applied to P. clarkii further optimization
would clearly be needed. MasterPure is easy to use and was the most
time efficient. This time efficiency as well as the reliability of products
used (all included in kit) reduces the chances of mistakes. Further re-
search should be conducted in validating the Muyzer method as the
most efficient DNA extraction protocol for macro-invertebrates, and
comparing it to other methods (like the DNAeasy kit), focussing on
reducing time and costs, while increasing DNA quantity and quality.
Our research shows that filtered field samples of P. clarkii can be
identified almost consistently, suggesting that small water samples of
100 ml (filter of 200 ml, cut in half), combined with an adapted PCI
DNA extraction, and simple PCR reactions (with one or two existing
primers) could be enough to detect this invasive crayfish species in
freshwater ecosystems. For future biomonitoring, we suggest working
with several field replicates to reduce the chances of false negatives.
Our results show that a standard protocol might not be possible for
every eDNA application. However, our findings demonstrate that reli-
able outcomes can be obtained using simple and inexpensive sampling,
extraction methods and PCR. Methods should be optimized for specific
goals, an eDNA protocol for quick species identification (invasive spe-
cies for example) should be more sensitive than a protocol for biodi-
versity monitoring. For any eDNA application, however, optimization
will be necessary. We also propose focussing on identifying efficient
primers for the target species, while taking into account DNA quality
and inhibition of PCR (Thompson et al., 2006). Our results also show
that published primers should still be tested when optimizing new or
571
Ecological Indicators 84 (2018) 564–572
existing protocols. In this regard, our results provide data on which
future eDNA research can build in order to improve DNA-based bio-
monitoring.
Acknowledgements
The research project “MolEcWa”, Aurora Geerts, and Christine Van
der heyden were financed by the Fund for Applied Research of the
University College Ghent.
We acknowledge the city of Dendermonde and Mr. Frans Van
Haevermaet for allowing the collection of crayfishes and water samples
in their territories. We would like to thank Jolien Weytens, Julie
Vandermarliere, Annelien Rigaux, and Andy Vierstraete for their help
in the lab, two anonymous referees, and Prof. Dr. Tom Moens for cri-
tically reading former versions of the manuscript. A kind thanks to Dr.
Verstraete and Dr. Vandenheede for their support.
Appendix A. Supplementary data
Supplementary data associated with this article can be found, in the
online version, at http://dx.doi.org/10.1016/j.ecolind.2017.08.068.
References
Alcorlo, P., Otero, M., Crehuet, M., Baltanás, A., Montes, C., 2006. The use of the red
swamp crayfish (Procambarus clarkii, Girard) as indicator of the bioavailability of
heavy metals in environmental monitoring in the River Guadiamar (SW, Spain). Sci.
Total Environ. 366, 380–390.
Altschul, S.F., Madden, T.L., Schäffer, A.A., Zhang, J., Zhang, Z., Miller, W., Lipman, D.J.,
1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs. Nucleic Acids Res. 25, 3389–3402.
Barbaresi, S., Tricarico, E., Gherardi, F., 2004. Factors inducing the intense burrowing
activity of the red-swamp crayfish, Procambarus clarkii, an invasive species.
Naturwissenschaften 91, 342–345.
Barnes, M.A., Turner, C.R., 2016. The ecology of environmental DNA and implications for
conservation genetics. Conserv. Genet. 17, 1–17.
Biggs, J., Ewald, N., Valentini, A., Gaboriaud, C., Dejean, T., Griffiths, R.A., Foster, J.,
Wilkinson, J.W., Arnell, A., Brotherton, P., Williams, P., Dunn, F., 2015. Using eDNA
to develop a national citizen science-based monitoring programme for the great
crested newt (Triturus cristatus). Biol. Conserv. 183, 19–28.
Boets, P., Lock, K., Cammaerts, R., Plu, D., Goethals, P.L., 2009. Occurrence of the in-
vasive crayfish Procambarus clarkii (Girard, 1852) in Belgium (Crustacea:
Cambaridae). Belgian J. Zool. 139, 173–176.
Boets, P., Lock, K., Adriaens, T., Mouton, A., Mouton, P.L.M., 2012. SHORT NOTES -
Distribution of crayfish (Decapoda, astacoidea) in flanders (Belgium): an update.
Belg. J. Zool. 142, 86–92.
Boets, P., Brosens, D., Lock, K., Adriaens, T., Aelterman, B., Mertens, J., Goethals, P.,
2016. Alien macroinvertebrates in flanders (Belgium). Aquat. Invasions 11 (2),
131–144.
Bohmann, K., Evans, A., Gilbert, M.T.P., Carvalho, G.R., Creer, S., Knapp, M., Yu, D.W., de
Bruyn, M., 2014. Environmental DNA for wildlife biology and biodiversity mon-
itoring. Trends Ecol. Evol. 29, 358–367.
Cai, W., Ma, Z., Yang, C., Wang, L., Wang, W., Zhao, G., Geng, Y., Douglas, W.Y., 2017.
Using eDNA to detect the distribution and density of invasive crayfish in the Honghe-
Hani rice terrace world heritage site. bioRxiv 109074.
Creer, S., Deiner, K., Frey, S., Porazinska, D., Taberlet, P., Thomas, W.K., Potter, C., Bik,
H.M., 2016. The ecologist's field guide to sequence-based identification of biodi-
versity. Methods Ecol. Evol.
Dauphin, L., Stephens, K., Eufinger, S., Bowen, M., 2010. Comparison of five commercial
DNA extraction kits for the recovery of Yersinia pestis DNA from bacterial suspensions
and spiked environmental samples. J. Appl. Microbiol. 108, 163–172.
Deiner, K., Walser, J.-C., Mächler, E., Altermatt, F., 2015. Choice of capture and extrac-
tion methods affect detection of freshwater biodiversity from environmental DNA.
Biol. Conserv. 183, 53–63.
Deiner, K., Fronhofer, E.A., Meachler, E., Walser, J.-C., Altermatt, F., 2016.
Environmental DNA reveals that rivers are conveyer belts of biodiversity information.
bioRxiv 020800.
Dejean, T., Valentini, A., Duparc, A., Pellier-Cuit, S., Pompanon, F., Taberlet, P., Miaud,
C., 2011. Persistence of environmental DNA in freshwater ecosystems. PLoS One 6,
e23398.
Dougherty, M.M., Larson, E.R., Renshaw, M.A., Gantz, C.A., Egan, S.P., Erickson, D.M.,
Lodge, D.M., 2016. Environmental DNA (eDNA) detects the invasive rusty crayfish
Orconectes rusticus at low abundances. J. Appl. Ecol.
Egan, S.P., Barnes, M.A., Hwang, C.T., Mahon, A.R., Feder, J.L., Ruggiero, S.T., Tanner,
C.E., Lodge, D.M., 2013. Rapid invasive species detection by combining environ-
mental DNA with light transmission spectroscopy. Conserv. Lett. 6, 402–409.
Elbrecht, V., Leese, F., 2015. Can DNA-based ecosystem assessments quantify species
abundance? Testing primer bias and biomass—sequence relationships with an
A.N. Geerts et al.
innovative metabarcoding protocol. PLoS One 10, e0130324.
Eldredge, L.G., Humphries, J.D., 1994. Perspectives in aquatic exotic species management
in the Pacific Islands. SPC.
Evans, N.T., Olds, B.P., Renshaw, M.A., Turner, C.R., Li, Y., Jerde, C.L., Mahon, A.R.,
Pfrender, M.E., Lamberti, G.A., Lodge, D.M., 2016. Quantification of mesocosm fish
and amphibian species diversity via environmental DNA metabarcoding. Mol. Ecol.
Resour. 16, 29–41.
Ficetola, G.F., Miaud, C., Pompanon, F., Taberlet, P., 2008. Species detection using en-
vironmental DNA from water samples. Biol. Lett. 4, 423–425.
Foote, A.D., Thomsen, P.F., Sveegaard, S., Wahlberg, M., Kielgast, J., Kyhn, L.A., Salling,
A.B., Galatius, A., Orlando, L., Gilbert, M.T.P., 2012. Investigating the potential use of
environmental DNA (eDNA) for genetic monitoring of marine mammals. PLoS One 7,
e41781.
GISD, 2016. Global Invasive Species Database. Species Profile: Procambarus Clarkii.
(Downloaded from http://www.iucngisd.org/gisd/species.php?sc=608 on 17-06-
2016).
Gabor, E.M., de Vries, E.J., Janssen, D.B., 2003. Efficient recovery of environmental DNA
for expression cloning by indirect extraction methods. FEMS Microbiol. Ecol. 44,
153–163.
Gherardi, F., Aquiloni, L., Diéguez-Uribeondo, J., Tricarico, E., 2011. Managing invasive
crayfish: is there a hope? Aquat. Sci. 73, 185–200.
Gherardi, F., 2006. Crayfish invading Europe: the case study of Procambarus clarkii. Mar.
Freshwater Behav. Physiol. 39, 175–191.
Gherardi, F., 2007. Understanding the Impact of Invasive Crayfish, Biological Invaders in
Inland Waters: Profiles, Distribution, and Threats. Springer, pp. 507–542.
Goldberg, C.S., Pilliod, D.S., Arkle, R.S., Waits, L.P., 2011. Molecular detection of ver-
tebrates in stream water: a demonstration using Rocky Mountain tailed frogs and
Idaho giant salamanders. PLoS One 6, e22746.
Goldberg, C.S., Sepulveda, A., Ray, A., Baumgardt, J., Waits, L.P., 2013. Environmental
DNA as a new method for early detection of New Zealand mudsnails (Potamopyrgus
antipodarum). Freshwater Sci. 32, 792–800.
Goldberg, C.S., Turner, C.R., Deiner, K., Klymus, K.E., Thomsen, P.F., Murphy, M.A.,
Spear, S.F., McKee, A., Oyler-McCance, S.J., Cornman, R.S., Laramie, M.B., Mahon,
A.R., Lance, R.F., Pilliod, D.S., Strickler, K.M., Waits, L.P., Fremier, A.K., Takahara,
T., Herder, J.E., Taberlet, P., 2016. Critical considerations for the application of
environmental DNA methods to detect aquatic species. Methods Ecol. Evol. 7,
1299–1307.
Herder, J., Valentini, A., Bellemain, E., Dejean, T., van Delft, J., Thomsen, P.F., Taberlet,
P., 2013. Environmental DNA–a review of the possible applications for the detection
of (invasive) species. Stichting RAVON, Nijmegen. Report 104.
Holzmann, M., HABURA, A., GILES, H., BOWSER, S.S., Pawlowski, J., 2003. Freshwater
foraminiferans revealed by analysis of environmental DNA samples. J. Eukaryot.
Microbiol. 50, 135–139.
Kouba, A., Petrusek, A., Kozák, P., 2014. Continental-wide distribution of crayfish species
in Europe: update and maps. Knowl. Manage. Aquat. Ecosyst. 413.
López, F.S., García, M.G., Vidal, J.L.M., Aguilera, P., Frenich, A.G., 2004. Assessment of
metal contamination in Donana National Park (Spain) using crayfish (Procambarus
clarkii). Environ. Monit. Assess. 93, 17–29.
Larson, E.R., Renshaw, M.A., Gantz, C.A., Umek, J., Chandra, S., Lodge, D.M., Egan, S.P.,
2017. Environmental DNA (eDNA) detects the invasive crayfishes Orconectes rusticus
and Pacifastacus leniusculus in large lakes of North America. Hydrobiologia 800,
173–185.
Mächler, E., Deiner, K., Steinmann, P., Altermatt, F., 2014. Utility of environmental DNA
for monitoring rare and indicator macroinvertebrate species. Freshwater Sci. 33,
1174–1183.
Mahon, A.R., Jerde, C.L., Galaska, M., Bergner, J.L., Chadderton, W.L., Lodge, D.M.,
Hunter, M.E., Nico, L.G., 2013. Validation of eDNA surveillance sensitivity for de-
tection of Asian carps in controlled and field experiments. PLoS One 8, e58316.
Maruyama, A., Nakamura, K., Yamanaka, H., Kondoh, M., Minamoto, T., 2014. The re-
lease rate of environmental DNA from juvenile and adult fish. PLoS One 9, e114639.
Mathers, K.L., Chadd, R.P., Dunbar, M.J., Extence, C.A., Reeds, J., Rice, S.P., Wood, P.J.,
2016. The long-term effects of invasive signal crayfish (Pacifastacus leniusculus) on
instream macroinvertebrate communities. Sci. Total Environ. 556, 207–218.
572
Ecological Indicators 84 (2018) 564–572
Matijašić, B.B., Obermajer, T., Rogelj, I., 2010. Quantification of Lactobacillus gasseri,
Enterococcus faecium and Bifidobacterium infantis in a probiotic OTC drug by real-time
PCR. Food Control 21, 419–425.
Mills, L.S., Pilgrim, K.L., Schwartz, M.K., McKelvey, K., 2000. Identifying lynx and other
North American felids based on mtDNA analysis. Conserv. Genet. 1, 285–288.
Muyzer, G., De Waal, E.C., Uitterlinden, A.G., 1993. Profiling of complex microbial po-
pulations by denaturing gradient gel electrophoresis analysis of polymerase chain
reaction-amplified genes coding for 16S rRNA. Appl. Environ. Microbiol. 59,
695–700.
Pérez-Bote, J., 2004. Feeding ecology of the exotic red swamp crayfish, Procambarus
clarkii (Girard, 1852) in the Guadiana River (SW Iberian Peninsula). Crustaceana 77,
1375–1387.
Piaggio, A.J., Engeman, R.M., Hopken, M.W., Humphrey, J.S., Keacher, K.L., Bruce, W.E.,
Avery, M.L., 2014. Detecting an elusive invasive species: a diagnostic PCR to detect
Burmese python in Florida waters and an assessment of persistence of environmental
DNA. Mol. Ecol. Resources 14, 374–380.
Rees, H.C., Maddison, B.C., Middleditch, D.J., Patmore, J.R., Gough, K.C., 2014. REVIEW:
The detection of aquatic animal species using environmental DNA- a review of eDNA
as a survey tool in ecology. J. Appl. Ecol. 51, 1450–1459.
Renshaw, M.A., Olds, B.P., Jerde, C.L., McVeigh, M.M., Lodge, D.M., 2015. The room
temperature preservation of filtered environmental DNA samples and assimilation
into a phenol–chloroform–isoamyl alcohol DNA extraction. Mol. Ecol. Resources 15,
168–176.
Roussel, J.M., Paillisson, J.M., Treguier, A., Petit, E., 2015. The downside of eDNA as a
survey tool in water bodies. J. Appl. Ecol. 52, 823–826.
Secondi, J., Dejean, T., Valentini, A., Audebaud, B., Miaud, C., 2016. Detection of a global
aquatic invasive amphibian, Xenopus laevis, using environmental DNA. Amphibia-
Reptilia 37, 131–136.
Spens, J., Evans, A.R., Halfmaerten, D., Knudsen, S.W., Sengupta, M.E., Mak, S.S.,
Sigsgaard, E.E., Hellström, M., 2016. Comparison of capture and storage methods for
aqueous macrobial eDNA using an optimized extraction protocol: advantage of en-
closed filter. Methods Ecol. Evol.
Takahara, T., Minamoto, T., Yamanaka, H., Doi, H., Kawabata, Z.i., 2012. Estimation of
fish biomass using environmental DNA. PLoS One 7, e35868.
Takahara, T., Minamoto, T., Doi, H., 2013. Using environmental DNA to estimate the
distribution of an invasive fish species in ponds. PLoS One 8, e56584.
Thompson, D., Rajal, V., De Batz, S., Wuertz, S., 2006. Detection of Salmonella spp. in
water using magnetic capture hybridization combined with PCR or real-time PCR. J.
Water Health 4, 67–75.
Thomsen, P., Kielgast, J., Iversen, L.L., Wiuf, C., Rasmussen, M., Gilbert, M.T.P., Orlando,
L., Willerslev, E., 2012a. Monitoring endangered freshwater biodiversity using en-
vironmental DNA. Mol. Ecol. 21, 2565–2573.
Thomsen, P.F., Kielgast, J., Iversen, L.L., Møller, P.R., Rasmussen, M., Willerslev, E.,
2012b. Detection of a diverse marine fish fauna using environmental DNA from
seawater samples. PLoS One 7, e41732.
Tréguier, A., Paillisson, J.M., Dejean, T., Valentini, A., Schlaepfer, M.A., Roussel, J.M.,
2014. Environmental DNA surveillance for invertebrate species: advantages and
technical limitations to detect invasive crayfish Procambarus clarkii in freshwater
ponds. J. Appl. Ecol. 51, 871–879.
Turner, C.R., Barnes, M.A., Xu, C.C., Jones, S.E., Jerde, C.L., Lodge, D.M., 2014. Particle
size distribution and optimal capture of aqueous macrobial eDNA. Methods Ecol.
Evol. 5, 676–684.
Turner, C.R., Uy, K.L., Everhart, R.C., 2015. Fish environmental DNA is more con-
centrated in aquatic sediments than surface water. Biol. Conserv. 183, 93–102.
Venter, J.C., Remington, K., Heidelberg, J.F., Halpern, A.L., Rusch, D., Eisen, J.A., Wu, D.,
Paulsen, I., Nelson, K.E., Nelson, W., 2004. Environmental genome shotgun sequen-
cing of the Sargasso Sea. Science 304, 66–74.
Westman, K., Savolainen, R., Julkunen, M., 2002. Replacement of the native crayfish
Astacus astacus by the introduced species Pacifastacus leniusculus in a small, enclosed
Finnish lake: a 30-year study. Ecography 25, 53–73.
Zhang, Z., Schwartz, S., Wagner, L., Miller, W., 2000. A greedy algorithm for aligning
DNA sequences. J. Comput. Biol. 7, 203–214.