Am J Physiol Endocrinol Metab 288: E1110 –E1119, 2005.
First published January 11, 2005; doi:10.1152/ajpendo.00464.2004.
Impact of resistance loading on myostatin expression and cell cycle regulation
in young and older men and women
Jeong-su Kim,1,2 James M. Cross,3 and Marcas M. Bamman1,2
1
Department of Physiology and Biophysics, The University of Alabama at Birmingham;
2
Geriatric Research, Education, and Clinical Center, Veterans Affairs Medical Center;
and 3Department of Surgery, The University of Alabama at Birmingham, Birmingham, Alabama
Submitted 1 October 2004; accepted in final form 5 January 2005
Kim, Jeong-su, James M. Cross, and Marcas M. Bamman.
Impact of resistance loading on myostatin expression and cell cycle
regulation in young and older men and women. Am J Physiol Endo-
crinol Metab 288: E1110 –E1119, 2005. First published January 11,
2005; doi:10.1152/ajpendo.00464.2004.—Myostatin inhibits myo-
blast proliferation and differentiation in developing muscle. Mounting
evidence suggests that myostatin also plays a limiting role in growth/
repair/regeneration of differentiated adult muscle by inhibiting satel-
lite cell activation. We tested the hypothesis that myostatin mRNA
expression would decrease after resistance loading (RL) with a
blunted response in older (O) females (F) who have shown minimal
hypertrophy [vs. males (M)] after long-term RL. As myostatin is
thought to modulate cell cycle activity, we also studied the response
of gene transcripts key to stimulation (cyclin B1 and D1) and inhibi-
tion (p21cip and p27kip) of the cell cycle, along with the muscle-
specific load-sensitive mitogen mechano-growth factor (MGF).
Twenty young (Y; 20 –35 yr, 10 YF, 10 YM) and 18 O (60 –75 yr, 9
OF, 9 OM) consented to vastus lateralis biopsy before and 24 h after
a bout of RL (3 sets ⫻ 8 –12 repetitions to volitional fatigue of squat,
leg press, knee extension). Gene expression levels were determined by
relative RT-PCR with 18S as an internal standard and analyzed by
age ⫻ gender ⫻ load repeated-measures ANOVA. A load effect was
found for four transcripts (P ⬍ 0.005) including myostatin, cyclin D1,
p27kip, and MGF as mRNA levels decreased for myostatin (⫺44%)
and p27kip (⫺16%) and increased for cyclin D1 (34%) and MGF
(49%). For myostatin, age ⫻ load and gender ⫻ load interactions
(P ⬍ 0.05) were driven by a lack of change in OF, while marked
declines were noted in YM (⫺56%), YF (⫺48%), and OM (⫺40%).
Higher cyclin D1 levels in OF led to a main age effect (36%, O ⬎ Y)
and an age ⫻ gender interaction (66%, OF ⬎ YF vs. 10%, OM ⬎
YM; P ⬍ 0.05). An age ⫻ gender ⫻ load interaction (P ⬍ 0.05) for
cyclin D1 resulted from a 48% increase in OF. Post hoc testing within
groups revealed a significant increase in MGF after RL in YM only
(91%, P ⬍ 0.05). Higher levels of cyclin B1 in O (27%, O ⬎ Y) led
to a main age effect (P ⬍ 0.05). An age ⫻ load interaction for cyclin
B1 (P ⬍ 0.05) was driven by a 26% increase in Y with no change in
O after RL. No age or gender differences, or load-mediated changes,
were detected in levels of p21cip mRNA expression. These data
clearly demonstrate that RL downregulates myostatin expression and
alters genes key to cell cycle progression. However, failure to reduce
myostatin expression may play a role in limiting RL-induced hyper-
trophy in OF.
sarcopenia; mechano-growth factor; p27kip; aging; resistance exercise
SARCOPENIA (From the Greek sarx for flesh and penia for loss)
refers to the gradual loss of skeletal muscle mass and strength
during the aging process. The resultant decline in functional
Address for reprint requests and other correspondence: M. M. Bamman,
UAB Dept. of Physiology and Biophysics, Muscle Research Laboratory,
GRECC/11G, Veterans Affairs Medical Center, 1530 3rd Ave. South, Bir-
mingham, AL 35294-0001 (E-mail: mbamman@uab.edu).
E1110
Downloaded from www.physiology.org/journal/ajpendo by ${individualUser.givenNames} ${individualUser.surname} (177.075.077.231) on May 8, 2018.
Copyright © 2005 American Physiological Society. All rights reserved.
capacity contributes to falls, fractures, and impaired mobility in
older individuals (reviewed in Ref. 23). In differentiated adult
skeletal muscle, chronic resistance loading (RL) is known to
partially attenuate these sarcopenic phenomena by inducing
increases in the size and strength of muscle. Although the
mechanisms leading to RL-mediated hypertrophy are not fully
understood, the process appears to require activation of nor-
mally quiescent myoblast precursor (i.e., satellite) cells (1).
Satellite cell activity is modulated by a host of endocrine and
autocrine/paracrine factors, some of which are responsive to
mechanical load, including mechano-growth factor [MGF ⫽
IGF-IEc, muscle-specific insulin-like growth factor-I (IGF-I)
isoform]. We and others previously found a blunted myofiber
hypertrophic response in older women compared with older
men during long-term resistance training (reviewed in Ref. 16),
suggesting that load-mediated satellite cell activity may differ
by gender. Clearly, the muscles of young men acutely respond
to mechanical load with upregulated expression of mRNAs
thought to be important in the hypertrophic process (5, 14, 28,
41, 42). We suspect that a blunted response of stimulating
factors and/or a failure to downregulate inhibitory factors may
occur in older women.
First characterized in 1997 (25), myostatin, or growth and
differentiation factor-8 (GDF-8), is a member of the transform-
ing growth factor-␤ superfamily that is known to play an
essential role in the regulation of skeletal muscle mass. Myo-
statin mutation leads to massive hypertrophy and/or hyperpla-
sia in developing animals, as evidenced by knockout experi-
ments in mice (25) and by the well-known “double-muscling”
phenotype seen in myostatin-null cattle (26). Additionally,
myostatin mutation has been recently identified in a young
child with overt muscle hypertrophy (32). Myostatin impairs
muscle growth by inhibiting myoblast proliferation (36, 37) as
well as differentiation (21, 30) in developing muscle. Addi-
tionally, myostatin has been shown to inhibit satellite cell
activation (24), which would presumably limit growth of
terminally differentiated adult myofibers. Myostatin may there-
fore play a key role in the inhibition of hypertrophic processes
(17). Although the mechanisms are not fully understood, it
most likely acts by modulating key regulators of the cell cycle
such as cyclins (e.g., cyclins B1 and D1) and cyclin-dependent
kinase inhibitors (e.g., p21cip and p27kip). For example, myo-
statin inhibition of satellite cell activation appears to be specific
to negative regulation of G1-S progression (24), which we
suggest may point to a potential interaction between myostatin
The costs of publication of this article were defrayed in part by the payment
of page charges. The article must therefore be hereby marked “advertisement”
in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
http://www.ajpendo.org
 MYOSTATIN MRNA EXPRESSION AFTER LOADING
and p27kip. Levels of myostatin mRNA expression have been
found to be reduced after long-term resistance training (31) and
elevated by disuse (29), with the magnitude of elevation
significantly related to the magnitude of disuse myofiber atro-
phy. These findings suggest myostatin expression is tightly
coupled to mechanical load.
The aims of the present study were to test the hypotheses
that 1) acute RL using a regimen known to induce myofiber
hypertrophy when performed 2–3 days/wk for several weeks (3
sets ⫻ 8 –12 repetitions to volitional fatigue of squat, leg press,
and knee extension) would suppress myostatin mRNA expres-
sion and elevate MGF mRNA expression in vastus lateralis
samples and 2) the RL-mediated myostatin and/or MGF re-
sponses would be blunted in older women compared with both
age-matched men and younger men and women. We studied
additional transcripts involved in cell cycle progression (cyc-
lins B1 and D1) and inhibition (p21cip and p27kip) to gain a
better understanding of the influence RL exerts onto mitogenic
processes. Expression levels of gene transcripts were deter-
mined by relative RT-PCR using 18S ribosomal RNA as an
internal standard.
METHODS
Subjects. Thirty-eight adults were recruited from the Birmingham,
Alabama metropolitan area into two age groups. Age ranges were
60 –75 yr for the older group (9 males, OM; 9 females, OF) and 20 –35
yr for the younger group (10 males, YM; 10 females, YF). All subjects
completed a detailed health history appraisal and all older subjects
passed a comprehensive physical exam conducted by a geriatrician
and a diagnostic stress test monitored by a cardiologist. Subjects were
free of any musculoskeletal or other disorders that might have affected
their ability to complete resistance training and testing for the study.
Subjects were not obese (BMI ⬍30) and none of the subjects had leg
resistance training experience within the past 5 yr. Of the older
postmenopausal women, four of nine women were on estrogen re-
placement therapy; however, this has been shown not to influence
single myofiber function (40) nor resistance training adaptation (10).
None of the subjects was being treated with exogenous testosterone or
other pharmacological interventions known to influence muscle mass.
The study was approved by the Institutional Review Boards of both
the University of Alabama at Birmingham (UAB) and the Birming-
ham Veterans Affairs Medical Center. Written informed consent was
obtained before participation in the research.
RL stimulus. We have described the RL stimulus in detail previ-
ously (4). Briefly, after a preexercise vastus lateralis muscle biopsy,
subjects attended five successive visits to the laboratory on alternate
days. The sequential sessions consisted of an introduction/familiar-
ization to the 3 movements (squat, leg press, knee extension), a second
familiarization session including practice one-repetition maximum
(1RM) strength tests, 1RM assessment followed by 1 set ⫻ 8 –12
repetitions of each exercise performed at 70% of 1RM, 2 sets ⫻ 8 –12
repetitions to volitional fatigue, and, during the fifth session, 3 sets ⫻
8 –12 repetitions to volitional fatigue. All sets were separated by 90-s
rest intervals. We designed this progressive protocol to prepare
subjects for the full loading bout performed during the fifth exposure
to the resistance exercises. As our objective was to study the effects
of loading per se and not the effects of acute myofiber damage/
inflammation, the progressive nature of this protocol was aimed at
protecting subjects, at least in large part, from the acute inflammatory
response that typically follows unaccustomed resistance exercise.
Body composition. Thigh lean mass (TLM), total body lean mass,
and body fat percentage were determined by dual-energy X-ray
absorptiometry (DEXA) using a Lunar Prodigy (model 8743; GE
Lunar, Madison, WI). Analyses were conducted according to manu-
AJP-Endocrinol Metab • VOL
Downloaded from www.physiology.org/journal/ajpendo by ${individualUser.givenNames} ${individualUser.surname} (177.075.077.231) on May 8, 2018.
Copyright © 2005 American Physiological Society. All rights reserved.
E1111
facturer’s instructions using enCORE 2002 software (version
6.10.029). DEXA scans were performed on all but one young male
(thus n ⫽ 37 for DEXA analyses). For age and gender comparisons,
1RM strength results were adjusted for TLM to yield estimates of
specific strength.
Tissue collection. Muscle samples were collected in the Pittman
General Clinical Research Center at UAB. Muscle tissue was removed
under local anesthetic (1% Lidocaine) from vastus lateralis muscle by
percutaneous needle biopsy using a 5-mm Bergstrom biopsy needle
under suction as previously described (9). To avoid any residual
effects of the initial biopsy taken from the left leg, the postexercise
biopsy was taken from the right leg 24 h after the first full bilateral
loading bout (4 progressive bouts preceded this one). Samples were
quickly blotted with gauze, dissected free of visible connective and
adipose tissues, weighed, and snap-frozen in liquid nitrogen. All
samples were stored at ⫺80°C.
Total RNA isolation. Frozen muscle samples (average ⫽ 35 mg)
were homogenized, and total RNA was extracted using the TRI
Reagent (Molecular Research Center, Cincinnati, OH) according to
the company’s protocol, which is based on the method by Chomczyn-
ski and Sacchi (7). Extracted RNA was precipitated from the aqueous
phase with isopropanol and, after two ethanol washes, dried and
suspended in nuclease-free water (Promega, Madison, WI) at a ratio
of 0.8 ␮l/mg muscle. RNA concentration was determined with a
fluorometer (TD-700, Turner Designs, Sunnyvale, CA) using the
RiboGreen RNA Quantitation Kit (Molecular Probes, Eugene, OR)
according to the manufacturer’s protocol. RNA concentration of each
sample was determined by linear regression using ribosomal RNA
standards from the RiboGreen RNA Quantitation Kit and expressed as
total RNA per milligram of muscle. RNA samples were stored at
⫺80°C for the subsequent analyses of specific mRNAs by relative
RT-PCR procedures.
RT. One microgram of RNA was reverse transcribed in a total
volume of 20 ␮l using SuperScript II Reverse Transcriptase (Invitro-
gen, GIBCO-BRL, Carlsbad, CA) with a mix of oligo(dT) (100
ng/reaction) and random primers (200 ng/reaction), according to the
method described by Bickel et al. (5). After the RT reaction, mixtures
were incubated at 45°C for 50 min, they were heated at 90°C for 5 min
to discontinue the reaction and then stored at ⫺80°C for subsequent
PCR analyses.
PCR. A relative RT-PCR method was applied in the present study
using 18S ribosomal RNA as an internal standard (Invitrogen) to
determine relative expression levels of mRNAs for myostatin, MGF,
cyclin B1, cyclin D1, p21cip, and p27kip. The primer sequences for the
specific target mRNAs are shown in Table 1. Primers were designed
using the Primer Select computer program (DNAStar, Madison, WI)
and prepared by Invitrogen (GIBCO). In preliminary experiments, we
confirmed that each target mRNA primer set was compatible with the
alternate 18S primers.
For each PCR reaction, 18S (with a 324-bp product) was coampli-
fied with each target cDNA (mRNA) to express each mRNA as a ratio
of target mRNA/18S. The 18S primers were mixed with competimers
to ensure that 18S and each target mRNA coamplified in the linear
range. The ratio of this primer-competimer mixture was optimized in
preliminary experiments and ranged from 1:25 to 1:120 depending on
the abundance of the target mRNA. A representative linearity test for
the validation of PCR cycle number is shown in Fig. 1. In this
myostatin linearity test, 36 was chosen as the optimum number of
cycles, as 18S and myostatin levels deviated from linearity past 38 and
40 cycles, respectively (not shown).
The conditions of both RT and PCR reactions were standardized by
using the same premixed reagents for all 76 samples to be compared.
Based on the number of PCR reactions, a PCR premix was prepared
with 2 mM MgCl2, PCR buffer (GIBCO) 0.2 mM 2-deoxynucleotide
5⬘-triphosphate, 1 ␮M specific primer set, 0.5 ␮M 18S primer-
competimer mix, and 0.75 unit of Biolase DNA Taq polymerase
(GIBCO) in 25 ␮l of total volume. For each PCR, 1 ␮l of RT product
288 • JUNE 2005 • www.ajpendo.org
E1112 MYOSTATIN MRNA EXPRESSION AFTER LOADING

Table 1. Sequences of the specific sets of primers used

Target mRNA PCR Primer Sequence 5⬘ 3 3⬘ Product Size, bp GenBank Accession No.

Myostatin 5⬘ sense: CTACAACGGAAACAATCATTACCA 243 NM_005259

3⬘ antisense: GTTTCAGAGATCGGATTCCAGTAT
MGF 5⬘ sense: ACCAACAAGAACACGAAGTC 282 U40870
3⬘ antisense: CAAGGTGCAAATCACTCCTA
Cyclin B1 5⬘ sense: TCTGGATAATGGTGAATGGACA 222 NM 031966
3⬘ antisense: GCCTTGGCTAAATCTTGAACTA
Cyclin D1 5⬘ sense: GACCCCGCACGATTTCAT 269 NM 001758
3⬘ antisense: GGAGGCAGTCTGGGTCACAC
p21cip 5⬘ sense: GCAGCGGAACAAGGAGTCAG 233 L25610
3⬘ antisense: CGCCGCCTGAGCAAAGTAAA
p27kip 5⬘ sense: GCGCAGGAGAGCCAGGAT 232 NM 004064
3⬘ antisense: TTGGGGAACCGTCTGAAACA
MGF, mechano-growth factor.

(cDNA) was added into 24 ␮l of premix and topped with 50 ␮l of
mineral oil (Sigma, St. Louis, MO). PCR was carried out in a DNA
Engine (PTC-200) Peltier Thermal Cycler (MJ Research, Waltham,
MA) with an initial denaturing step of 3 min at 96°C, followed by
specific cycles (31–38 cycles depending on the results of linearity
tests for each target mRNA and 18S) of 1 min at 96°C, 45 s at specific
annealing temperatures (52–58°C depending on primers), 45 s at
75°C, and a final step of 3 min at 72°C. Immediately following PCR,
25 ␮l of PCR product (22 ␮l of the reaction mixture diluted with 3 ␮l
of loading buffer) were separated by electrophoresis (100-V constant)
in a 2% agarose gel for 1.5 or 2 h [depending on the band separation
between 18S (324 bp) and specific target genes due to the size of each
mRNA product]. To eliminate age group, gender, or RL bias, each
20-well gel contained pre-post paired samples for subjects within each
group (i.e., YM, YF, OM, OF) with the different subject groups
loaded in random order on each gel. Gels were run with molecular
mass markers (100 bp Hyper Ladder IV; Genesee Scientific, San
Diego, CA) to confirm the expected size of each mRNA. Ethidium
bromide (0.1 ␮g/ml) was premixed in the 2% agarose gel, and images
were captured under UV in a Bio-Rad ChemiDoc imaging system
(Hercules, CA). Band densitometry was performed using Bio-Rad
Quantity One software. Parameters for image development were
consistent across all gels using predefined saturation criteria for the
CCD camera. For each gel, total exposure time was determined by the
first point of saturation on the image. This standardization, combined
with equal distribution of the four age/gender groups across all gels,
enabled us to accurately test for age, gender, and RL effects.
Statistical analysis. Data are reported as means ⫾ SE. Between-
group differences in preexercise descriptive variables were tested
using age ⫻ gender ANOVA. All variables measured before and after
loading were analyzed using age ⫻ gender ⫻ load repeated-measures
ANOVA. For each ANOVA model with a significant main or inter-
action effect, Tukey HSD tests were performed post hoc to localize
the effect(s). Zero-order correlations were tested between levels of
lean body mass (LM) or TLM and resting levels, as well as load-
mediated changes, for each transcript studied. Correlations were also
tested between load-mediated changes in mRNA levels for myostatin,
MGF, cyclin B1, cyclin D1, p21cip, and p27kip mRNA. For each
correlation, we tested for the presence of outliers by residual analysis
using a standard residual ⬎2.5 SD. If one or more outliers were
identified, these subjects were excluded and the correlation was
retested. Results are summarized with the appropriate sample size for
each correlation after removing outliers (if any). Statistical signifi-
cance was accepted at P ⬍ 0.05 for all tests.

RESULTS

Descriptive characteristics of the subjects are shown in

Table 2. The four age/gender groups are defined as YF (young
females), YM (young males), OF (older females), and OM
(older males) on all figures and throughout the remaining text.
It is necessary to note that this study sample overlapped with
our previous investigation of the effects of acute RL on protein
expression (4); however, due to methodological limitations
such as tissue availability, the present investigation includes
several individuals not previously studied. Within each age
group, males and females were of similar age. Typical gender
differences in height and weight were found, as main gender
effects (P ⬍ 0.0001) confirmed that men were taller and
weighed more than women. A lower body fat percentage was
found in young compared with older adults (P ⬍ 0.01). Young
subjects had more total LM (P ⬍ 0.05) and TLM (P ⬍ 0.001)
than their older counterparts, with the effect most notable in
Fig. 1. Validation of PCR cycle number. Representative linearity tests for the men. The age differences in both total body LM and TLM were
coamplification of 18S and myostatin mRNA products as a function of PCR not driven by height, as height was not different between
cycle number. Regression analyses show that amplification of each product
was highly linear across this range of 32–38 cycles. The order of PCR cycles
young and older subjects within gender. Adjusting TLM for
on the image corresponds with the order of PCR products in the scatter plots total body LM revealed significantly higher levels of relative
below. TLM for both YF (P ⬍ 0.001) and YM (P ⬍ 0.01) compared
AJP-Endocrinol Metab • VOL 288 • JUNE 2005 • www.ajpendo.org
Downloaded from www.physiology.org/journal/ajpendo by ${individualUser.givenNames} ${individualUser.surname} (177.075.077.231) on May 8, 2018.
Copyright © 2005 American Physiological Society. All rights reserved.
 MYOSTATIN MRNA EXPRESSION AFTER LOADING E1113
Table 2. Descriptive characteristics of each group
Young Females Young Males Older Females Older Males
(n ⫽ 10) (n ⫽ 10) (n ⫽ 9) (n ⫽ 9)

Age, yr 27.9⫾1.4 28.2⫾1.2 64.3⫾1.0 65.1⫾1.7

Height, cm† 162.4⫾2.4 178.6⫾3.1 160.1⫾2.1 177.0⫾2.5
Weight, kg† 63.0⫾3.2 79.5⫾4.1 63.1⫾3.2 83.2⫾2.5
%Body fat*† 34.2⫾1.7 20.3⫾3.2 38.8⫾1.8 30.7⫾1.9
Total body LM, kg*† 38.9⫾0.9 59.5⫾2.1 36.7⫾1.8 55.1⫾1.5
Thigh LM, g*† 9,354⫾305 14,949⫾580 7,964⫾471 12,697⫾470
Relative thigh LM*†, %total body LM 24.0⫾0.4 25.1⫾0.4 21.7⫾0.5 23.0⫾0.3
Specific strength measurements, 1RM (kg)/thigh LM (kg)
Knee extension* 3.85⫾0.19 4.00⫾0.17 3.59⫾0.12 3.13⫾0.22
Leg press 9.46⫾0.39 10.02⫾0.46 9.25⫾0.37 8.86⫾0.26
Squat 6.08⫾0.29 6.46⫾0.47 6.27⫾0.26 5.51⫾0.25
Values are means ⫾ SE. LM, lean mass; 1RM, one-repetition maximum strength. *Main age effect, P ⬍ 0.05. †Main gender effect, P ⬍ 0.05.

with their older, within-gender counterparts. We previously
interpreted age differences in this relative TLM index as an
indication that atrophy with aging occurs more rapidly in the
weight-bearing lower limb musculature than in the remaining
LM compartment (4, 27). The similar estimates of specific
strength (Table 2) among the groups indicate that all subjects
exercised at the same relative loading intensity as a constant
percentage of 1RM was used to set initial resistances. Lower
knee extension-specific strength found in older subjects (P ⬍
0.05) may, however, be indicative of age differences in quad-
riceps muscle quality.
The concentration of total RNA increased 13% after loading,
from 0.24 ⫾ 0.01 to 0.27 ⫾ 0.01 ␮g/mg muscle (P ⬍ 0.05). As
the bulk of total muscle RNA is ribosomal, this could be
considered as a marker of enhanced potential for protein
synthesis (5). The results of specific transcript expression
analyses are shown in Figs. 2– 4. A main load effect (P ⬍
0.005) was found for four transcripts including myostatin,
MGF, cyclin D1, and p27kip. We found a significant load-
mediated decline in the levels of myostatin mRNA expression
(⫺44%, P ⬍ 0.00001) at the 24-h timepoint (Fig. 2A). In
addition, age ⫻ load (P ⬍ 0.01) and gender ⫻ load (P ⬍ 0.05)
interactions were found for myostatin mRNA, apparently
driven by a lack of change in OF (P ⫽ 0.69). Levels of
myostatin mRNA were markedly decreased in the other groups
[OM (⫺40%), YM (⫺56%), and YF (⫺48%), P ⬍ 0.01] after
acute RL. By contrast, MGF mRNA expression increased
markedly (⫹49%, P ⬍ 0.001) after acute RL (Fig. 2B).
Although no interactions were detected for MGF, the increase
with load was clearly driven by YM (91%) as post hoc tests
revealed no other within-group increases.
Results of general cell cycle regulators are shown in Figs. 3
and 4. We assessed mRNA levels of cyclins key to initiation
(cyclin D1) and progression through the G2-M boundary (cy-
clin B1). Results revealed a significant increase in cyclin D1
mRNA levels (34%, P ⬍ 0.001) after RL (Fig. 3A). Higher
cyclin D1 levels in OF led to a main age effect (36%, O ⬎ Y;
P ⬍ 0.01) and an age ⫻ gender interaction (66%, OF ⬎ YF vs.
10%, OM ⬎ YM; P ⬍ 0.05). An age ⫻ gender ⫻ load
interaction (P ⬍ 0.05) for cyclin D1 resulted from a marked
48% increase in OF after RL. Higher levels of cyclin B1
mRNA expression (Fig. 3B) in older adults (27%, O ⬎ Y)
resulted in a main age effect (P ⬍ 0.05). An age ⫻ load
interaction for cyclin B1 (P ⬍ 0.05) resulted from a 26%
AJP-Endocrinol Metab • VOL
Downloaded from www.physiology.org/journal/ajpendo by ${individualUser.givenNames} ${individualUser.surname} (177.075.077.231) on May 8, 2018.
Copyright © 2005 American Physiological Society. All rights reserved.
increase in younger adults with no significant change in older
adults after RL.
The results of two key cell cycle inhibitors are shown in Fig.
4. p27kip has been shown to arrest cultured satellite cells in G1
and has been implicated in the progression of sarcopenia (35).
A main load effect revealed a modest but statistically signifi-
cant reduction in p27kip mRNA (⫺16%, P ⬍ 0.01) after RL
(Fig. 4A). With this reduction, postloading levels of p27kip
expression in OF reached approximately the basal level seen in
the other three age-gender groups. No significant age, gender,
or loading effects were detected for p21cip mRNA expression
(Fig. 4B).
Correlational analyses revealed some noteworthy associa-
tions. Using residual analysis to detect outliers as described in
METHODS led to the removal of no more than one outlier from
any given correlation. For all subjects, the relative concentra-
tion of myostatin mRNA in resting VL muscles was positively
related to LM (r ⫽ 0.45, P ⬍ 0.01, n ⫽ 37) and TLM (r ⫽
0.49, P ⬍ 0.01, n ⫽ 37; Fig. 5A). Furthermore, the magnitude
of reduction in myostatin mRNA correlated with LM (r ⫽
⫺0.42, P ⬍ 0.05, n ⫽ 36) and TLM (r ⫽ ⫺0.47, P ⬍ 0.01, n ⫽
36). Interestingly, these findings appeared to have been mainly
driven by males. In men, resting myostatin levels were posi-
tively related to LM (r ⫽ 0.68, P ⬍ 0.005, n ⫽ 18) and TLM
(r ⫽ 0.63, P ⬍ 0.01, n ⫽ 18; Fig. 5B), and there was a negative
relationship between load-induced reduction in myostatin
mRNA and muscle mass (TLM) (r ⫽ ⫺0.80, P ⬍ 0.01, n ⫽
17; Fig. 6A).
The findings of a positive association between resting myo-
statin mRNA levels and muscle mass suggest a novel paradox
whereby individuals with an apparently advantageous potential
for muscle growth and/or maintenance also express high levels
of perhaps the single most potent “anti-growth” factor. This
may, however, “prime” the muscle for growth, as load-induced
reductions in myostatin mRNA were greatest in subjects with
higher muscle mass. In support of this concept, we also found
TLM in males was inversely related to the magnitude of
load-induced change in p27kip mRNA expression (r ⫽ ⫺0.52,
P ⬍ 0.05, n ⫽ 18) and positively related to load-induced
increases in cyclin D1 mRNA levels (r ⫽ 0.47, P ⬍ 0.05, n ⫽
18). Furthermore, load-mediated changes in myostatin and
p27kip mRNA levels were positively related in men (r ⫽ 0.59,
P ⬍ 0.01, n ⫽ 19; Fig. 6B) but not in women (r ⫽ 0.03, P ⬎
0.05, n ⫽ 19). This finding in males was primarily driven by
288 • JUNE 2005 • www.ajpendo.org
E1114 MYOSTATIN MRNA EXPRESSION AFTER LOADING

(r ⫽ 0.60, P ⬍ 0.01, n ⫽ 37). As cyclin D1 has been used

extensively as a general marker of cell cycle activity, and MGF
is a muscle-specific, load-sensitive mitogen, this relationship is
suggestive of a load-induced increase in mitogenic activity
within a population of myogenic cells. Partitioning by age or
gender revealed significant relationships in young subjects
(r ⫽ 0.80, P ⬍ 0.01, n ⫽ 19) and in males (r ⫽ 0.54, P ⬍
0.05, n ⫽ 19).

Fig. 2. Relative RT-PCR results for myostatin (A) and mechano-growth factor
(MGF; B) mRNA expression using 18S ribosomal RNA as an internal
standard. A and B: image above the histogram displays an example of pre- and
postloading mRNA expression levels for an individual subject within each
group (young males, YM; young females, YF; older males, OM; and older
females, OF) run on the same gel. The order of samples on the image
corresponds with the order of bars in the histogram below. A: levels of
myostatin mRNA expression significantly dropped by 44% 24 h after acute
resistance loading. Age ⫻ load (P ⬍ 0.01) and gender ⫻ load interactions
(P ⬍ 0.05) were driven by a lack of change in OF (P ⫽ 0.69), while marked
declines (P ⬍ 0.01) were noted in YM (⫺56%), YF (⫺48%), and OM
(⫺40%). B: levels of MGF mRNA expression increased markedly (49%, P ⬍ Fig. 3. Relative RT-PCR results for cyclin D1 (A) and cyclin B1 (B) mRNA
0.001) 24 h after acute resistance loading. Although no interactions were expression using 18S ribosomal RNA as an internal standard. A and B: image
detected for MGF, the increase with load was clearly driven by YM (91%) as post above the histogram displays an example of pre- and postloading mRNA
hoc tests revealed no other within-group increases. Values are means ⫾ SE. expression levels for an individual subject within each group (YM, YF, OM,
and OF) run on the same gel. The order of samples on the image corresponds
with the order of bars in the histogram below. A: significant increase in cyclin
D1 mRNA levels (34%, P ⬍ 0.001) was found 24 h after acute resistance
YM (r ⫽ 0.69, P ⬍ 0.05, n ⫽ 10). On the basis of these loading. Higher cyclin D1 levels in OF led to a main age effect (36%, O ⬎ Y)
relationships, we speculate that not only are myostatin and and an age ⫻ gender interaction (66%, OF ⬎ YF vs. 10%, OM ⬎ YM; P ⬍
p27kip related, the efficacy of load-mediated myogenesis may 0.05). An age ⫻ gender ⫻ load interaction (P ⬍ 0.05) for cyclin D1 resulted
be determined by the degree to which both transcripts are from a 48% increase in OF. B: main age effect (P ⬍ 0.05) was primarily driven
by higher levels of cyclin B1 mRNA expression in older adults (27%, O ⬎ Y).
synchronously downregulated. There was also an age ⫻ load interaction for cyclin B1 mRNA expression (P ⬍
For all subjects, there was a positive correlation between 0.05) as a load-induced increase was found in young subjects only. Values are
load-mediated increases in MGF and cyclin D1 mRNA levels means ⫾ SE.

AJP-Endocrinol Metab • VOL 288 • JUNE 2005 • www.ajpendo.org

Downloaded from www.physiology.org/journal/ajpendo by ${individualUser.givenNames} ${individualUser.surname} (177.075.077.231) on May 8, 2018.
Copyright © 2005 American Physiological Society. All rights reserved.
 MYOSTATIN MRNA EXPRESSION AFTER LOADING E1115
DISCUSSION

To our knowledge, this study is the first to demonstrate the

effects of age, gender, and acute RL on the mRNA levels of
myostatin and a host of other key modulators of cell cycle
progression and withdrawal. The results of the present study
clearly demonstrate that acute RL markedly downregulates
myostatin mRNA expression with a concomitant increase in
MGF mRNA. Others have reported decreased myostatin pro-
tein levels in response to loading in rodents (19). RL also
increased levels of gene expression for cyclin D1 (all subjects)
and cyclin B1 (young subjects only). Although there were no
changes in p21cip expression levels, load-mediated downregu-

Fig. 5. Positive correlations between thigh muscle mass and myostatin mRNA
expression in untrained, resting muscle for all subjects (A) and men only (B).
Thigh muscle mass was measured by dual-energy X-ray absorptiometry (sum
of lean mass compartments in both thighs). Levels of myostatin mRNA were
determined relative to 18S ribosomal RNA by RT-PCR. The significant
relationship (A) was strengthened when women were excluded (B).

lation of p27kip gene expression was observed. These com-

bined data suggest that, by some as yet unknown mechanism,
mechanical load facilitates cell cycle progression by attenuat-
ing inhibitory factors and elevating stimulatory factors. Fur-
thermore, the positive relationships between magnitudes of
change in general and muscle-specific cell cycle promoters and
inhibitors suggest that at least some enhanced cell cycle activ-
ity occurred in mitotically active myogenic cells such as
satellite muscle cells. Based on the assumption that satellite
cell activation is a requisite step in the hypertrophy process,
these alterations may provide some valuable insight regarding
Fig. 4. Relative RT-PCR results for p27kip (A) and p21cip (B) mRNA expres-
sion using 18S ribosomal RNA as an internal standard. A and B: image above load-mediated mechanisms of myofiber hypertrophy.
the histogram displays an example of pre- and postloading mRNA expression The capacity of young men for resistance training-induced
levels for an individual subject within each group (YM, YF, OM, and OF) run myofiber hypertrophy is well known. Additionally, much of the
on the same gel. The order of samples on the image corresponds with the order recent work demonstrating acute load-mediated increases in
of bars in the histogram below. A: levels of p27kip mRNA decreased
(⫺16%, P ⬍ 0.01) 24 h after acute resistance loading. B: levels of p21cip proteins and/or mRNAs thought to be important for long-term
mRNA were not significantly changed 24 h after resistance loading. Values growth/regeneration has been conducted in young men (14, 28,
are means ⫾ SE. 41, 42). Our unique model enabled us to assess potential
AJP-Endocrinol Metab • VOL 288 • JUNE 2005 • www.ajpendo.org
Downloaded from www.physiology.org/journal/ajpendo by ${individualUser.givenNames} ${individualUser.surname} (177.075.077.231) on May 8, 2018.
Copyright © 2005 American Physiological Society. All rights reserved.
E1116 MYOSTATIN MRNA EXPRESSION AFTER LOADING
Fig. 6. A: inverse relationship in men between untrained, resting thigh muscle
mass and the magnitude of load-mediated reduction in myostatin mRNA
expression. The correlation suggests that subjects with higher muscle mass
were more responsive to acute mechanical load (i.e., greater reduction in
myostatin mRNA). B: positive relationship between load-mediated changes
(chg) in mRNA levels of p27kip and myostatin found in men only, indicating
that greater declines in myostatin mRNA levels were associated with declines
in p27kip mRNA expression.
influences of age and/or gender on key transcriptional activities
following loading. The overall trend of these data is that young
men responded most positively to the loading program, dem-
onstrating robust and consistent changes in factors thought to
promote (MGF, cyclin D1, cyclin B1) and inhibit (myostatin,
p27kip) the processes of growth and regeneration. The other
age/gender groups showed some, but not all, of these favorable
responses, with the least responsive group appearing to be
older women.
Although these data provide important insight regarding age
and gender influences on load-mediated gene expression, two
limitations are notable. First, our postloading analysis was
limited to one timepoint (24 h). Additional postloading biop-
sies both earlier and later than 24 h may have revealed
additional age and/or gender differences. With serial biopsies
ranging from 0 to 48 h postloading, Psilander et al. (28) clearly
AJP-Endocrinol Metab • VOL
Downloaded from www.physiology.org/journal/ajpendo by ${individualUser.givenNames} ${individualUser.surname} (177.075.077.231) on May 8, 2018.
Copyright © 2005 American Physiological Society. All rights reserved.
demonstrated (in young men) that temporal postloading re-
sponses vary among transcripts. Second, our analyses were
limited to mRNAs. Although our work is certainly not unique
in this regard (5, 28), coupled analysis of both mRNA and its
protein product is certainly a strength. However, we previously
showed using the same model that 24 h after loading is
probably too early to detect a host of changes at the protein
level (4). A protocol with multiple postloading biopsies would
have addressed both of these limitations but was simply not
feasible.
Myostatin and general cell cycle inhibitors. We found no
significant age differences in resting levels of myostatin
mRNA, a finding that has been shown previously in men (39).
One important finding was that, in response to the same
relative loading stimulus, older women had an impaired ability
to downregulate myostatin expression. Older men, however,
showed a load-induced reduction in myostatin similar in mag-
nitude to both younger men and women. We recently reported
that older females showed a blunted myofiber hypertrophic
response along with a blunted strength gain after 26 wk of
progressive resistance training compared with older males (3).
If myostatin downregulation is key to the promotion of hyper-
trophic processes, an attenuated acute response to loading in
older women may contribute to an impaired long-term growth
adaptation. Interestingly, older women have also been shown
to be more susceptible to detraining following resistance train-
ing compared with young men, young women, and older men
(18). A study of polymorphic variation in a cohort of older
women showed that myostatin polymorphic variants were
related to differences in strength levels in older women (34).
This group further demonstrated that women with a less com-
mon myostatin allele exhibited a 68% larger increase in muscle
volume in response to strength training (17), suggesting this
allele resulted in either lower amounts of myostatin protein or
an alternate protein product with reduced efficacy as a negative
regulator.
Reductions in myostatin mRNA have been shown previ-
ously following 9 wk of resistance training (31). On the basis
of our finding of markedly reduced myostatin mRNA levels
following acute RL, we suggest the bulk of the reduction found
after 9 wk of training may have occurred very early in the
training program (e.g., first 1–3 exercise bouts). In contrast to
our findings and to those of Roth et al. (31), Willoughby (41)
recently reported increased levels of myostatin protein and
mRNA after both 6 and 12 wk of resistance training. One
major difference in protocol design, however, was the collec-
tion of 6- and 12-wk biopsies only 15 min after an exercise
bout (compared to 24 h in the current study).
As increased mechanical load has been shown to reduce
myostatin, one might expect increased myostatin levels during
states of reduced loading. Findings in both humans (29) and
rodents (20) support this concept. Significantly elevated myo-
statin mRNA levels were observed in the vastus lateralis
muscle of 12 patients with chronic disuse atrophy of type II
myofibers (29). Furthermore, muscle atrophy during space-
flight has been shown to be associated with increased myosta-
tin mRNA and protein levels (20).
Striking from the present study was the finding that thigh
muscle mass in healthy sedentary adults, irrespective of age or
gender, was positively related to resting levels of muscle
myostatin mRNA. At odds with this finding are reports that
288 • JUNE 2005 • www.ajpendo.org
 MYOSTATIN MRNA EXPRESSION AFTER LOADING
serum levels of a “myostatin-immunoreactive protein” are
higher in older adults and inversely related to muscle mass (44)
and lean mass in frail elderly women (33) and to lean mass in
HIV-positive men suffering from cachexia (11). However, the
sequence of the 26-kDa “immunoreactive protein” has not been
confirmed, and whether this protein is in fact myostatin in any
form has been questioned (45). Our findings of a positive
association between resting myostatin mRNA levels and mus-
cle mass were revealed in a fairly large subject cohort. Al-
though further study is certainly needed (including protein-
level analyses), we consider this result combined with the
finding that load-induced reductions in myostatin mRNA were
greatest in subjects with higher muscle mass as a possible
indicator of hypertrophic potential. It is also possible that the
positive relationship seen between resting myostatin mRNA
and thigh muscle mass was, in part, driven by myofiber type
distribution. Previous studies in rodents have indicated prefer-
ential expression of myostatin in type II plantaris muscle (38)
and a positive relationship between myostatin mRNA expres-
sion and MHCIIb abundance (6). Whether myostatin is more
abundant in type II muscle among humans is unknown. If so,
it is certainly possible that subjects with greater thigh muscle
mass in our study also possessed a greater type II myofiber area
distribution. In an ongoing study of over 40 young and older
participants similar in age to the current subjects, we have
found that the type II atrophy associated with sarcopenia is
most notable in type IIx myofibers (M. Bamman, J.S. Kim, and
D. Kasek, unpublished observations).
The cell cycle is regulated by a number of cyclin-dependent
kinase inhibitors including the INK4 family and the CIP/KIP
family (p21cip, p27kip, p57kip). p27kip is typically considered an
inhibitor of cell cycle initiation (G1) (22), while p21cip inhibits
the cell cycle at multiple control points, including progression
through the G2-M boundary. In the present study, a load-
induced reduction was found for p27kip mRNA levels as
indicated by an overall main effect of loading. The mean data
in Fig. 4A show that all groups except OM contributed to this
effect. We reported a similar load-mediated reduction in p27kip
protein concentration in women using the same acute loading
model (4). Spangenburg et al. (35) previously suggested that
p27kip may be a molecular mediator in the progression of
age-related sarcopenia based on the findings that p27kip expres-
sion is higher in older satellite cells, and p27kip overexpression
arrests cultured satellite cells in G1 despite the overexpression
of IGF-I, a potent mitogen.
Lin et al. (22) previously demonstrated the inhibitory influ-
ence of p27kip on myogenic cells and its association with
myostatin in developing muscle, as p27kip knockout mice
showed markedly increased gastrocnemius muscle mass and a
reduction in myostatin mRNA levels. This finding suggests
that p27kip deficiency-induced muscle hypertrophy may be
partially mediated by decreased myostatin. We report herein
that not only were p27kip and myostatin mRNA levels reduced
by mechanical load, the magnitudes by which these transcripts
declined were positively related in men and especially in young
men. If, in fact, p27kip and myostatin work in concert, our
findings may provide some basis for a greater load-induced
hypertrophic potential in young men vs. older women, as no
coordinated decline in the two transcripts was seen in older
women nor in all women combined.
AJP-Endocrinol Metab • VOL
Downloaded from www.physiology.org/journal/ajpendo by ${individualUser.givenNames} ${individualUser.surname} (177.075.077.231) on May 8, 2018.
Copyright © 2005 American Physiological Society. All rights reserved.
E1117
The importance of p27kip in the inhibition of cell growth has
been demonstrated by Coats et al. (8), suggesting that the
activity of cdk2, which is involved in progression throughout
the entire cell cycle from G1 to M, is mainly inhibited by p27kip
and to a lesser degree by p21cip. Levels of p21cip mRNA did
not change in our model. By contrast, p21cip mRNA levels
have been shown to increase markedly in response to mechan-
ical load in rodents (2, 12) and in humans (5). These investi-
gators considered an increase in p21cip as indicative of en-
hanced differentiation. In the work by Bickel et al. (5), muscle
biopsies were collected 24 h after the second of two bouts of
electrically evoked isometric contractions. The timing between
stimulus and biopsy was identical to our model but the con-
traction paradigm differed substantially. We do not know
whether this difference is responsible for the markedly differ-
ent results in p21cip expression between the two studies;
however, it is noteworthy that results of both total RNA
concentration and cyclin D1 mRNA levels also differed, as
total RNA concentration (␮g RNA/mg muscle) increased 13%
and cyclin D1 mRNA increased 34% after our dynamic RL
regimen but did not change significantly in the isometric
contraction model of Bickel et al.
The cdk inhibitors (p21cip, p27kip) we studied are often
viewed as general markers of differentiation but, in addition to
promoting withdrawal of actively proliferating cells, they spe-
cifically inhibit cell cycle initiation and/or progression. In a
quiescent cell type such as satellite cells, our impression is that
these cdk inhibitors may be responsible for inhibiting entry into
the cell cycle (arresting in G1). Thus in the early response
phase following loading, we speculate a suppression of cdk
inhibitors might be advantageous by facilitating entrance into
the cell cycle. Beyond an initial phase of proliferative activity
(e.g., the first 24 h), an increase in cdk inhibitors may be
advantageous to promote withdrawal (i.e., differentiation) of
some cells as proliferation continues. The expression of p21cip
mRNA has been shown to increase markedly within 12 h after
the onset of compensatory overload (via synergist ablation) in
rats (2). The compensatory overload model induces a much
greater loading stimulus than our resistance exercise regimen,
thus making it difficult to compare the two time courses.
MGF and general cell cycle promoters. In differentiated
adult skeletal myofibers, RL-mediated myofiber hypertrophy
involves increased muscle protein synthesis and activation of
satellite cells. MGF is a load-sensitive autocrine/paracrine
growth factor that likely works in concert with IGF-I to
promote both of these processes (13, 15, 43). We found a
marked increase in MGF mRNA expression (⫹49%) after
acute RL; however, post hoc tests revealed a within-groups
increase in young men only (91%). Others have also reported
induction of MGF mRNA after acute RL in young men (5, 14,
28). Hameed et al. (14) found this acute response in young men
only, as no change in MGF mRNA was noted in elderly men.
In a separate study, however, this group found a substantial rise
in MGF mRNA after 5 wk of resistance training in elderly men
(13). The young men in the present study not only experienced
the largest elevation in MGF but also the greatest reduction in
myostatin mRNA, suggesting the muscles of young men were
most responsive to the loading stimulus.
As markers of general proliferative activity, we examined
cyclin D1 as integral to cell cycle initiation and cyclin B1 as an
index of late cell cycle activity (i.e., progression through the
288 • JUNE 2005 • www.ajpendo.org
E1118 MYOSTATIN MRNA EXPRESSION AFTER LOADING
G2-M boundary). Our data indicate that acute RL induced an
overall increase in levels of cyclin D1 gene expression while
only young subjects increased cyclin B1 mRNA levels. Others
found increases in cyclin D1 mRNA levels after acute loading
in rodents (12). Certainly these changes in cyclin expression
cannot be uniquely attributable to satellite cell activation, as
these general cell cycle markers may also point toward upregu-
lation of mitotic activity in non-muscle cells (e.g., fibroblasts)
that would seem necessary for growth/repair/regeneration of
supporting tissues within the muscle. However, by assessing
both cyclins D1 and B1, our data may provide some important
insight into the overall growth/regenerative capacity of young
and older men and women in response to acute loading. Based
solely on cycle D1 mRNA levels (Fig. 3A), one might hypoth-
esize that older women would have the greatest mitotic poten-
tial; however, by also studying late cell cycle activity (cyclin
B1; Fig. 3B), younger men emerge as the group with the
greatest combined response. In support of this, we noted
positive relationships between increases in cyclin D1 and MGF
only in young subjects and in men.
If we accept these molecular markers as representative of
some key processes in the regulation of muscle mass, our
combined findings may provide some molecular basis for
disparate hypertrophic adaptations to long-term resistance
training among gender- and age-specific populations. Based on
the aforementioned assumption, we have drawn the following
conclusions from these data. First, in resting and otherwise
healthy muscle not induced to hypertrophy and not exposed to
acutely atrophic conditions, the concentration of myostatin
mRNA was positively related to muscle mass. This novel
“paradox” may lead to a greater potential to reduce myostatin
(among those with higher muscle mass) when a hypertrophic
stimulus is imposed, as the magnitude of load-mediated reduc-
tion in myostatin was inversely related to muscle mass and this
relationship was strengthened when only men were included.
Second, as additional evidence for a link between resting
muscle mass and mitogenic potential, load-mediated increases
in cyclin D1 and decreases in p27kip mRNAs were related to
TLM in men only. Third, concurrent reduction in myostatin
and p27kip, as seen in young men, may be optimal as a
permissive signal for the induction of myogenesis. Fourth, the
greatest load-driven increase in MGF mRNA was found in
young men, and the magnitudes of increase in MGF and cyclin
D1 mRNAs were correlated in all subjects, suggesting coordi-
nated mitogenic signaling between the two.
Overall, our findings suggest that high- to moderate-intensity
RL serves as a natural inhibitor of myostatin gene transcrip-
tion. Myostatin may act in concert with p27kip and reductions
in these cell cycle inhibitors are coincident with enhancements
in cell cycle progression (cyclins D1 and B1) and myogenic
potential (MGF). Although these load-mediated myofiber hy-
pertrophic signals appear to be optimal in young males, older
women show impaired capacity to reduce myostatin and en-
hance MGF gene expression levels in response to the same
relative loading stimulus. These acute molecular responses
may underlie age and gender differences in the capacity for
load-mediated hypertrophy. Thus an important next step would
be the evaluation of these responses during long-term resis-
tance training to determine whether indeed these acute events
are predictive of satellite cell activation and myofiber hyper-
trophy.
AJP-Endocrinol Metab • VOL
Downloaded from www.physiology.org/journal/ajpendo by ${individualUser.givenNames} ${individualUser.surname} (177.075.077.231) on May 8, 2018.
Copyright © 2005 American Physiological Society. All rights reserved.
ACKNOWLEDGMENTS
We are indebted to the research subjects for invaluable contributions to this
work. We thank S. C. Tuggle and S. Hall for administering the resistance
loading bouts and strength tests, and V. Hill for the efforts in subject
recruitment. Finally, we sincerely thank Drs. F. Haddad and G. Adams for
technical expertise and open communication during development of the PCR
protocols.
GRANTS
Funding for this work was provided by National Institute on Aging Grant
R01-AG-17896 (M. M. Bamman) and General Clinical Research Center Grant
M01-RR-00032.
REFERENCES
1. Adams GR, Caiozzo VJ, Haddad F, and Baldwin KM. Cellular and
molecular responses to increased skeletal muscle loading after irradiation.
Am J Physiol Cell Physiol 283: C1182–C1195, 2002.
2. Adams GR, Haddad F, and Baldwin KM. Time course of changes in
markers of myogenesis in overloaded rat skeletal muscles. J Appl Physiol
87: 1705–1712, 1999.
3. Bamman MM, Hill VJ, Adams GR, Haddad F, Wetzstein CJ, Gower
BA, Ahmed A, and Hunter GR. Gender differences in resistance-
training-induced myofiber hypertrophy among older adults. J Gerontol A
Biol Sci Med Sci 58: 108 –116, 2003.
4. Bamman MM, Ragan RC, Kim JS, Cross JM, Hill VJ, Tuggle SC, and
Allman RM. Myogenic protein expression before and after resistance
loading in 26- and 64-yr-old men and women. J Appl Physiol 97:
1329 –1337, 2004.
5. Bickel CS, Slade JM, Haddad F, Adams GR, and Dudley GA. Acute
molecular responses of skeletal muscle to resistance exercise in able-
bodied and spinal cord-injured subjects. J Appl Physiol 94: 2255–2262,
2003.
6. Carlson CJ, Booth FW, and Gordon SE. Skeletal muscle myostatin
mRNA expression is fiber-type specific and increases during hindlimb
unloading. Am J Physiol Regul Integr Comp Physiol 277: R601–R606,
1999.
7. Chomczynski P and Sacchi N. Single-step method of RNA isolation by
acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Bio-
chem 162: 156 –159, 1987.
8. Coats S, Whyte P, Fero ML, Lacy S, Chung G, Randel E, Firpo E, and
Roberts JM. A new pathway for mitogen-dependent cdk2 regulation
uncovered in p27(Kip1)-deficient cells. Curr Biol 9: 163–173, 1999.
9. Evans W, Phinney S, and Young V. Suction applied to a muscle biopsy
maximizes sample size. Med Sci Sports Exerc 14: 101–102, 1982.
10. Figueroa A, Going SB, Milliken LA, Blew RM, Sharp S, Teixeira PJ,
and Lohman TG. Effects of exercise training and hormone replacement
therapy on lean and fat mass in postmenopausal women. J Gerontol A Biol
Sci Med Sci 58: 266 –270, 2003.
11. Gonzalez-Cadavid NF, Taylor WE, Yarasheski K, Sinha-Hikim I, Ma
K, Ezzat S, Shen R, Lalani R, Asa S, Mamita M, Nair G, Arver S, and
Bhasin S. Organization of the human myostatin gene and expression in
healthy men and HIV-infected men with muscle wasting. Proc Natl Acad
Sci USA 95: 14938 –14943, 1998.
12. Haddad F and Adams GR. Selected contribution: acute cellular and
molecular responses to resistance exercise. J Appl Physiol 93: 394 – 403,
2002.
13. Hameed M, Lange KH, Andersen JL, Schjerling P, Kjaer M, Har-
ridge SD, and Goldspink G. The effect of recombinant human growth
hormone and resistance training on IGF-I mRNA expression in the
muscles of elderly men. J Physiol 555: 231–240, 2004.
14. Hameed M, Orrell RW, Cobbold M, Goldspink G, and Harridge SD.
Expression of IGF-I splice variants in young and old human skeletal
muscle after high-resistance exercise. J Physiol 547: 247–254, 2003.
15. Hill M and Goldspink G. Expression and splicing of the insulin-like
growth factor gene in rodent muscle is associated with muscle satellite
(stem) cell activation following local tissue damage. J Physiol 549:
409 – 418, 2003.
16. Hunter GR, McCarthy JP, and Bamman MM. Effects of resistance
training on older adults. Sports Med 34: 329 –348, 2004.
17. Ivey FM, Roth SM, Ferrell RE, Tracy BL, Lemmer JT, Hurlbut DE,
Martel GF, Siegel EL, Fozard JL, Jeffrey Metter E, Fleg JL, and
Hurley BF. Effects of age, gender, and myostatin genotype on the
288 • JUNE 2005 • www.ajpendo.org
 MYOSTATIN MRNA EXPRESSION AFTER LOADING
hypertrophic response to heavy resistance strength training. J Gerontol A
Biol Sci Med Sci 55: M641–M648, 2000.
18. Ivey FM, Tracy BL, Lemmer JT, NessAiver M, Metter EJ, Fozard JL,
and Hurley BF. Effects of strength training and detraining on muscle
quality: age and gender comparisons. J Gerontol A Biol Sci Med Sci 55:
B152–B157; discussion B158 –B159, 2000.
19. Kawada S, Tachi C, and Ishii N. Content and localization of myostatin
in mouse skeletal muscles during aging, mechanical unloading and reload-
ing. J Muscle Res Cell Motil 22: 627– 633, 2001.
20. Lalani R, Bhasin S, Byhower F, Tarnuzzer R, Grant M, Shen R, Asa
S, Ezzat S, and Gonzalez-Cadavid NF. Myostatin and insulin-like
growth factor-I and -II expression in the muscle of rats exposed to the
microgravity environment of the NeuroLab space shuttle flight. J Endo-
crinol 167: 417– 428, 2000.
21. Langley B, Thomas M, Bishop A, Sharma M, Gilmour S, and Kam-
badur R. Myostatin inhibits myoblast differentiation by downregulating
MyoD expression. J Biol Chem 277: 49831– 49840, 2002.
22. Lin J, Della-Fera MA, Li C, Page K, Ho Choi Y, Hartzell DL, and
Baile CA. P27 knockout mice: reduced myostatin in muscle and altered
adipogenesis. Biochem Biophys Res Commun 300: 938 –942, 2003.
23. Marcell TJ. Sarcopenia: causes, consequences, and preventions. J Ger-
ontol A Biol Sci Med Sci 58: M911–M916, 2003.
24. McCroskery S, Thomas M, Maxwell L, Sharma M, and Kambadur R.
Myostatin negatively regulates satellite cell activation and self-renewal.
J Cell Biol 162: 1135–1147, 2003.
25. McPherron AC, Lawler AM, and Lee SJ. Regulation of skeletal muscle
mass in mice by a new TGF-␤ superfamily member. Nature 387: 83–90,
1997.
26. McPherron AC and Lee SJ. Double muscling in cattle due to mutations
in the myostatin gene. Proc Natl Acad Sci USA 94: 12457–12461, 1997.
27. Petrella JK, Kim JS, Tuggle SC, Hall SR, and Bamman MM. Age
differences in knee extension power, contractile velocity, and fatigability.
J Appl Physiol 98: 211–220, 2005.
28. Psilander N, Damsgaard R, and Pilegaard H. Resistance exercise alters
MRF and IGF-I mRNA content in human skeletal muscle. J Appl Physiol
95: 1038 –1044, 2003.
29. Reardon KA, Davis J, Kapsa RM, Choong P, and Byrne E. Myostatin,
insulin-like growth factor-1, and leukemia inhibitory factor mRNAs are
upregulated in chronic human disuse muscle atrophy. Muscle Nerve 24:
893– 899, 2001.
30. Rios R, Carneiro I, Arce VM, and Devesa J. Myostatin is an inhibitor
of myogenic differentiation. Am J Physiol Cell Physiol 282: C993–C999,
2002.
31. Roth SM, Martel GF, Ferrell RE, Metter EJ, Hurley BF, and Rogers
MA. Myostatin gene expression is reduced in humans with heavy-resis-
tance strength training: a brief communication. Exp Biol Med (Maywood)
228: 706 –709, 2003.
AJP-Endocrinol Metab • VOL
Downloaded from www.physiology.org/journal/ajpendo by ${individualUser.givenNames} ${individualUser.surname} (177.075.077.231) on May 8, 2018.
Copyright © 2005 American Physiological Society. All rights reserved.
E1119
32. Schuelke M, Wagner KR, Stolz LE, Hubner C, Riebel T, Komen W,
Braun T, Tobin JF, and Lee SJ. Myostatin mutation associated with
gross muscle hypertrophy in a child. N Engl J Med 350: 2682–2688, 2004.
33. Schulte JN and Yarasheski KE. Effects of resistance training on the rate
of muscle protein synthesis in frail elderly people. Int J Sport Nutr Exerc
Metab 11, Suppl: S111–S118, 2001.
34. Seibert MJ, Xue QL, Fried LP, and Walston JD. Polymorphic variation
in the human myostatin (GDF-8) gene and association with strength
measures in the Women’s Health and Aging Study II cohort. J Am Geriatr
Soc 49: 1093–1096, 2001.
35. Spangenburg EE, Chakravarthy MV, and Booth FW. p27Kip1: a key
regulator of skeletal muscle satellite cell proliferation. Clin Orthop Relat
Res 403: S221–S227, 2002.
36. Taylor WE, Bhasin S, Artaza J, Byhower F, Azam M, Willard DH Jr,
Kull FC Jr, and Gonzalez-Cadavid N. Myostatin inhibits cell prolifer-
ation and protein synthesis in C2C12 muscle cells. Am J Physiol Endo-
crinol Metab 280: E221–E228, 2001.
37. Thomas M, Langley B, Berry C, Sharma M, Kirk S, Bass J, and
Kambadur R. Myostatin, a negative regulator of muscle growth, func-
tions by inhibiting myoblast proliferation. J Biol Chem 275: 40235–
40243, 2000.
38. Wehling M, Cai B, and Tidball JG. Modulation of myostatin expression
during modified muscle use. FASEB J 14: 103–110, 2000.
39. Welle S, Bhatt K, Shah B, and Thornton C. Insulin-like growth factor-1
and myostatin mRNA expression in muscle: comparison between 62–77
and 21–31 yr old men. Exp Gerontol 37: 833– 839, 2002.
40. Widrick JJ, Maddalozzo GF, Lewis D, Valentine BA, Garner DP,
Stelzer JE, Shoepe TC, and Snow CM. Morphological and functional
characteristics of skeletal muscle fibers from hormone-replaced and non-
replaced postmenopausal women. J Gerontol A Biol Sci Med Sci 58: 3–10,
2003.
41. Willoughby DS. Effects of heavy resistance training on myostatin mRNA
and protein expression. Med Sci Sports Exerc 36: 574 –582, 2004.
42. Willoughby DS and Nelson MJ. Myosin heavy-chain mRNA expression
after a single session of heavy-resistance exercise. Med Sci Sports Exerc
34: 1262–1269, 2002.
43. Yang SY and Goldspink G. Different roles of the IGF-I Ec peptide
(MGF) and mature IGF-I in myoblast proliferation and differentiation.
FEBS Lett 522: 156 –160, 2002.
44. Yarasheski KE, Bhasin S, Sinha-Hikim I, Pak-Loduca J, and Gonza-
lez-Cadavid NF. Serum myostatin-immunoreactive protein is increased in
60 –92 year old women and men with muscle wasting. J Nutr Health Aging
6: 343–348, 2002.
45. Zimmers TA, Davies MV, Koniaris LG, Haynes P, Esquela AF,
Tomkinson KN, McPherron AC, Wolfman NM, and Lee SJ. Induction
of cachexia in mice by systemically administered myostatin. Science 296:
1486 –1488, 2002.
288 • JUNE 2005 • www.ajpendo.org