See

discussions, stats, and author profiles for this publication at: https://www.researchgate.net/publication/323249504

Notch expressed by osteocytes plays a critical

role in mineralisation

Article in Journal of Molecular Medicine · February 2018

DOI: 10.1007/s00109-018-1625-x

CITATIONS READS

0 57

9 authors, including:

Jin Shao Dung Nguyen

Queensland University of Technology Dartmouth College
5 PUBLICATIONS 35 CITATIONS 20 PUBLICATIONS 44 CITATIONS

SEE PROFILE SEE PROFILE

Rong Huang
Queensland University of Technology
6 PUBLICATIONS 23 CITATIONS

SEE PROFILE

Some of the authors of this publication are also working on these related projects:

Dietary fats and Osteoarthritis View project

OCT4; inflammation; dental pulp cell View project

All content following this page was uploaded by Jin Shao on 23 February 2018.

The user has requested enhancement of the downloaded file.

Journal of Molecular Medicine
https://doi.org/10.1007/s00109-018-1625-x

ORIGINAL ARTICLE

Notch expressed by osteocytes plays a critical role in mineralisation

Jin Shao 1,2 & Yinghong Zhou 1,2 & Jinying Lin 2,3 & Trung Dung Nguyen 4,5 & Rong Huang 1,2 & Yuantong Gu 2,4 &
Thor Friis 1,2 & Ross Crawford 1,2,6 & Yin Xiao 1,2

Received: 20 August 2017 / Revised: 4 January 2018 / Accepted: 5 February 2018

# Springer-Verlag GmbH Germany, part of Springer Nature 2018

Abstract
Notch is actively involved in various life processes including osteogenesis; however, the role of Notch signalling in
the terminal mineralisation of bone is largely unknown. In this study, it was noted that Hey1, a downstream target of
Notch signalling was highly expressed in mature osteocytes compared to osteoblasts, indicating a potential role of
Notch in osteocytes. Using a recently developed thermosensitive cell line (IDG-SW3), we demonstrated that dentin
matrix acidic phosphoprotein 1 (DMP1) expression was inhibited and mineralisation process was significantly altered
when Notch pathway was inactivated via administration of N-[N-(3,5-Difluorophenacetyl)-L-alanyl]-S-phenylglycine
t-butyl ester (DAPT), an inhibitor of Notch. Dysregulation of Notch in osteocyte differentiation can result in
spontaneous deposition of calcium phosphate on collagen fibrils, disturbed transportation of intracellular mineral
vesicles, alteration of mineral crystal structure, decreased bonding force between minerals and organic matrix, and
suppression of dendrite development coupled with decreased expression of E11. In conclusion, the evidence pre-
sented here suggests that Notch plays a critical role in osteocyte differentiation and biomineralisation process.

Key messages
& Notch plays a regulatory role in osteocyte phenotype.
& Notch modulates the mineralisation mediated by
osteocytes.
& Notch activity influences the ultrastructural properties of
bone mineralisation.

Keywords Notch . Mineralisation . Osteocytes . DMP1 . Osteoblasts

Jin Shao and Yinghong Zhou contributed equally to this work.

Electronic supplementary material The online version of this article
(https://doi.org/10.1007/s00109-018-1625-x) contains supplementary
material, which is available to authorized users.

* Yin Xiao 4
School of Chemistry, Physics and Mechanical Engineering, Science
yin.xiao@qut.edu.au and Engineering Faculty, Queensland University of Technology,
Brisbane, QLD 4059, Australia
1
Institute of Health and Biomedical Innovation, Queensland 5
Present address: Department of Aerospace and Mechanical
University of Technology, 60 Musk Avenue, Kelvin Grove, Engineering, College of Engineering, University of Notre Dame,
Brisbane, QLD 4059, Australia Notre Dame, IN 46556, USA
2
The Australia–China Centre for Tissue Engineering and Regenerative 6
The Prince Charles Hospital, Brisbane, QLD 4059, Australia
Medicine (ACCTERM), Queensland University of Technology,
Brisbane, QLD 4059, Australia
3
Department of Implantology, Xiamen Stomatological Research
Institute, Xiamen Stomatological Hospital, Fujian 361000, China

Introduction
Bone is composed of 50 to 70% mineral which provides it
with mechanical rigidity and strength. It is osteocyte that mod-
ulates the mineralisation of organic bone matrix, also called
osteoid, which is secreted by osteoblasts [1, 2]. Osteocyte,
which is derived from osteoblast, composes the most abun-
dant cell type in bone. The definition between osteoblast and
osteocyte is ambiguous as the transition is a successive pro-
cess. Here, we define osteocyte as the cell being embedded or
have been embedded in bone matrix. This expression is more
accurate because as long as the osteoblast stops secreting ma-
trix and is buried by matrix secreted by the adjacent cells, it
simultaneously stops proliferation and generates cell process-
es to begin a new cell fate. Under this definition, even the
mature osteoblasts are still located on the bone surface, al-
though mature osteoblasts are regarded to be buried in bone
matrix at early stage in other literatures.
Recent observations have revealed that an intracellular
amorphous calcium phosphate precursor is transiently secret-
ed by bone cells and deposited within the gap zones inside the
type-I collagen fibril where it transforms into hydroxyapatite
[3–5]. It is well known that dentin matrix acidic phosphopro-
tein 1 (DMP1) secreted by osteocytes plays a crucial role in
mineralisation. Toyosama et al. have provided in situ informa-
tion that DMP1 mRNA can be found mainly in osteocytes but
not in osteoblasts, which agrees with our definition mentioned
above [6]. DMP1 belongs to the SIBLING (small integrin-
binding ligand N-linked glycoproteins) family which com-
poses the majority of non-collagenous proteins in bone. The
highly phosphorylated property of DMP1 makes it possible to
regulate mineral formation and organisation, as well as phos-
phate homeostasis [7–9]. This fact shows that osteoblast and
osteocyte may play strikingly different roles in osteogenesis. It
appears that osteoblasts produce a large amount of phosphate
(Pi) through ALP activity and then osteocytes utilise the phos-
phate to phosphorylate matrix proteins including DMP1 [10].
The phosphate transfer actually provides an explanation of
phosphate resource for mineralised tissues, which also indi-
cates osteocytes actively regulate the mineralisation processes.
DMP1 is expressed by relatively mature osteocytes, however,
osteocytes also express an early marker, E11, also known as
gp38 or podoplanin which is not expressed by osteoblasts [11,
12]. It has been reported that E11 is required for the mainte-
nance of podocyte processes [13] and overexpression of E11
causes cell membrane extensions in keratinocytes [14]. This
data together indicate that E11 regulates the dendrites forma-
tion during the transition from osteoblast to osteocyte. The
dendritic shape is not only the morphological characteristic
of osteocytes, but also plays a role in the mechanosensing,
signals communication and mineral homeostasis [15–19].
The network composed by osteocytes is complex and rem-
iniscent of a neuronal system [20]. A recent research estimated
J Mol Med
the average number of osteocytes in adult human is around 42
billion and those cells form 23 trillion connections via den-
drites [21]. The widely accepted view is that osteocytes com-
municate with each other by direct gap junction and indirect
secreting signalling [22]. In addition to this direct cell-to-cell
contact, osteocytes also deliver some signalling molecules in-
cluding prostaglandin E2 and ATP to communicate with adja-
cent cells [23, 24]. Apart from those well-documented signal
propagation mechanisms, another important type of signalling
pathway bound on the cell membrane is Notch signalling
pathway. Notch signalling pathway in mammals contains
single-pass transmembrane ligands (Jagged 1, 2 and Delta-
like 1, 3 and 4) and four epidermal growth factor (EGF)-like
Notch receptors (Notch 1–4) that display both redundant and
distinct functions [25]. The activation of receptors initiates a
sequence of proteolytic events with the assistance of ADAM
metalloprotease and γ-secretase and eventually releases
Notch intracellular domain (NICD). NICD then translocates
into nucleus and binds to the DNA-binding protein compound
of RBP-jκ and MAML 1–3 [26, 27] to control specific gene
transcription, through transcriptional repressors hairy and en-
hancer of split (Hes1–7) and hairy and enhancer of split relat-
ed with YRPW motif 1 (Hey1, 2 and L) [28, 29].
A live imaging experiment has shown that osteocytes are
not static; actually, they perpetually expand and retract the
dendrites suggesting a hand-shake manner of communication
[30]. The motions of dendrites provide topological basis to
Notch signalling regulation [29, 31, 32]. However, Notch
functions in osteocytes are largely unknown and this study
investigated the role of Notch in the regulation of osteocyte
mineralisation.
Materials and methods
Immunohistochemistry
The study is approved by the Animal Ethics Committee of
Queensland University of Technology. Six femoral samples
from 6-month female Wistar rats were collected and
decalcified in 10% ethylenediaminetetraacetate (EDTA), then
embedded in paraffin. Serial sections of 5-μm-thick were cut
from the paraffin blocks with a microtome for immunohisto-
chemical study [33]. Briefly, after dewaxing and hydration,
slides were heated at 75 °C in pressure cooker for antigen
retrieval. The endogenous peroxidase activity was eliminated
by incubating in 3% H2O2 for 15 min. Non-specific protein
binding was blocked with 10% swine serum for 1 h. Samples
were incubated with primary antibodies against Hes1
(ab71559, Abcam; 1:100) overnight at 4 °C, followed by in-
cubation with a biotinylated swine-anti-mouse, rabbit, goat
secondary antibody (DAKO) for 15 min at room temperature,
and then with streptavidin peroxidase (DAKO) for 15 min.
J Mol Med

Diaminobenzidine (DAB) solution (DAKO) was then added a 21G needle. Single cell suspension was prepared by
for 3 min to visualise the antibody complexes. The samples passing the cell clumps through an 18G needle. The ob-
were counterstained with Mayer’s haematoxylin for 15 s. tained cells were blended and seeded into the tissue cul-
Images of the stained slides were then captured using Axion ture flasks containing DMEM with 100 U/mL of penicil-
software under a light microscope (Carl Zeiss Microimaging) lin, 100 μg/mL of streptomycin and 10% FBS. On day 2,
at various magnifications. half of the medium containing non-adherent cells was
replaced with fresh medium. The remaining attached cells
Immunofluorescence study were bone marrow cells according to the direct plastic
adhesion method which is widely used in isolation of
IDG-SW3 cells (EKC001, Kerafast) and rat bone marrow BMCs [36, 37]. Medium was changed completely on
cells (BMCs) were plated on 8-well chamber slides day 4. Only cells at an early passage (P1–P2) were used
(177,445, Lab-Tek) at a density of 4000 cells per well. in this study. After cells reached 70–80% confluence, me-
The cells were washed three times with ice-cold PBS dium was changed completely with DMEM containing
followed by fixing with 2% paraformaldehyde (PFA) for 100 U/mL of penicillin, 100 μg/mL of streptomycin and
10 min at room temperature. The cells were then incubat- 10% FBS supplemented with 50 μg/mL of ascorbic acid,
ed with 0.2% triton for cell permeabilisation. Non-specific 10 nM of dexamethasone and 8 mM of β-
proteins were blocked with the incubation of 1% BSA in glycerophosphate (1,043,003, D4902 and G9891, Sigma-
PBST for 30 min at room temperature. Actin cytoskeleton Aldrich). Medium was changed every 2–3 days for the
was stained with Alexa Fluor 568 phalloidin (Life duration of the experiment.
Technologies Pty Ltd., Australia) in permeabilised IDG- IDG-SW3 cells were expanded in proliferation conditions
SW3 cells. The primary antibodies, rabbit anti-Hes1 at 33 °C in α-MEM (12,571, Gibco) with 10% FBS, 100 U/
(ab71559, Abcam; 1:100) and mouse anti-E11 (ab10288, mL of penicillin, 50 μg/mL of streptomycin and 50 U/mL of
Abcam; 1:100), in PBS with 1% BSA were applied and IFN-γ (PMC4031, Gibco) on rat tail type 1 collagen (0.2 mg/
incubated at room temperature for 1 h. The samples were mL in 0.2 M acetic acid)-coated plates. To induce differentia-
then incubated with goat anti-mouse Alex Fluor 488 tion towards osteocytes, IDG-SW3 cells were plated at
(A31560, Life Technologies) and goat anti-rabbit Alex 80,000 cells/cm2 in osteogenic differentiation conditions at
Fluor 647 (A21246, Life Technologies) at room tempera- 37 °C with the supplementation of 50 μg/mL of ascorbic acid
ture for 30 min to detect the primary antibodies. The and 4 mM β-glycerophosphate in the absence of IFN-γ.
slides were counterstained with DAPI (D1306, Life Collagen-coated plates were necessary for both proliferation
Technologies) and mounted with ProLong® Gold and differentiation culture [38]. To inhibit Notch signalling
Antifad e Reagent (P10144 , L ife Tec hnologies). pathway, N-[N-(3,5-Difluorophenacetyl)-L-alanyl]-S-
Phalloidin (A12379, Life Technologies) staining was per- phenylglycine t-butyl ester (DAPT) (D5942, Sigma) diluted
formed to detect cytoskeleton changes. The images were
captured using Nikon EclipseTi-S microscope and Leica
SP5 confocal microscope. Cell counting was performed
Table 1 The primers used for RT-qPCR
using Image J software. The DAPT-treated cells and con-
trol group stained with E11 were also used for quantita- Fwd_DMP1 GCATCCTGCTCATGTTCCTTTG
tive analysis of cell dendrites. The procedure and param- Rev_DMP1 GAGCCAAATGACCCTTCCATTC
eters settings were described previously by Ren et al. Fwd_E11 GTCCAGGCGCAAGAACAAAG
[34]. Unpaired Student’s t test was performed to deter- Rev_E11 GGTCACTGTTGACAAACCATCT
mine the statistical significance. Fwd_Hes1 CAGCTGACAAGGAGGACTGA
Rev_Hes1 GTCACCTCGTTCATGCACTC
Cell culture Fwd_Notch1 TGTTGTGCTCCTGAAGAACG
Rev_Notch1 TCCATGTGATCCGTGATGTC
Rat BMCs were isolated and cultured based on protocols Fwd_Rbpj CTCCACCCAAACGACTCACT
from our previously published study [35]. Briefly, six 12- Rev_Rbpj CATCCATCTCGCTTCCATTT
week-old female Wistar rats were sacrificed by CO2 as- Fwd_SOST TTCAGGAATGATGCCACAGA
phyxiation. Femurs and tibias were dissected from sur- Rev_SOST GTCAGGAAGCGGGTGTAGTG
rounding tissues. The epiphyseal growth plates were re- Fwd_MEPE CATGAAGATGCAGGCTGTGT
moved and the marrow was collected by flushing with Rev_MEPE TCCTCTTTGCCTTCATCCAC
Dulbecco’s Modified Eagle Medium (DMEM) (11,885, Fwd_Universal_GAPDH TCAGCAATGCCTCCTGCAC
Gibco), containing 100 U/mL of penicillin, 100 μg/mL Rev_Universal_GAPDH TCTGGGTGGCAGTGATGGC
of streptomycin and 10% fetal bovine serum (FBS) with

in DMSO was added into the culture at concentrations indi-
cated. The same amount of DMSO was applied in control.
siRNA-mediated knockdown of Hes1
IDG-SW3 cells were transfected with mouse siRNA oligonu-
cleotides targeting Hes1 (NM_008235 Sigma-Aldrich) using
J Mol Med
RNAimax (Invitrogen) according to the manufacturer’s in-
structions and previous research [39]. Briefly, IDG-SW3 cells
were seeded on 6-well plates at 1 × 106 cells per well 1 day
before transfection. Fifty nanometer siRNA targeting Hes1
and fluorescent universal negative Control siRNA (Sigma-
Aldrich) were transfected with RNAimax reagent
(Invitrogen) in opti-MEM (Gibco) without serum for 6 h
 J Mol Med
ƒFig. 1 Notch expression in osteocytes. a Immunohistochemistry staining
of Hes1 in rat femur showed positive staining in osteocytes (black arrow)
and negative staining in osteoblasts (black arrowhead) (scale bar 20 μm).
H&E staining image shows that the black arrow indicates the osteocytes
embedded in bone matrix, while the white arrow shows the typical cubic
osteoblasts located on the bone surface (scale bar 50 μm). b
Immunofluorescence staining of Hes1 in rBMCs in osteogenic culture
of 7 and 14 days. The rBMCs cultured in osteogenic conditions for
14 days representing late differentiation stage expressed high level of
Hes1 (scale bar 100 μm). c Bar graph counted Hes1-positive cells ratio
according the immunofluorescence staining results. The number of Hes1-
positive cells significantly increased when rBMCs were osteogenically
differentiated for 14 days in comparison with 7 days. n = 3. *p < 0.05. d
and e Western blots of Hes1 in rBMCs and IDG-SW3 cell line. Hes1
expression at protein level increased during late osteogenic differentiation
of rBMCs and IDG-SW3 cell line. Bar graph represented relative bands
intensity. *p < 0.05, compared with day 7. f RT-qPCR results of IDG-
SW3 cell line in osteogenic culture. Hes1, Notch1 and Rbpj all increased
during differentiation. n = 3 wells per group. *p < 0.05, compared with
day 1. g Luciferase reporter test showed Rbpj activity also increased in
IDG-SW3 cell line. n = 3 wells per group. **p < 0.01, compared with day
1. (one-way ANOVA with Bonferroni post-hoc test)
before cells were washed with PBS and changed to osteogenic
medium. Samples were collected at 1, 3 and 7 days after
transfection.
Western blot
The whole cell lysates were collected by adding 250 μL cell
lysis buffers with protease inhibitor (cOmplete, EDTA-free
04693132001, Roche) and phosphatase inhibitor
(PhosSTOP, 04906845001, Roche) for the Western blotting
detection. A total of 15 μg of proteins from each sample were
separated on SDS-PAGE gels and then transferred onto a ni-
trocellulose membrane (Pall Corporation). After being
blocked in Odyssey blocking buffer for 1 h (P/N 927–
40,000, LI-COR Biosciences), the membranes were incubated
with primary antibodies against Hes1 (1:1000, ab71559,
Abcam), E11 (1:1000, ab10288, Abcam), DMP1(1:1000, a
kind gift from Professor Jerry Feng of the Texas A&M
University College of Dentistry) and α-Tubulin (1:2000,
ab15246, Abcam) overnight at 4 °C. The membranes were
then incubated with anti-mouse/rabbit fluorescence conjugat-
ed secondary antibodies at 1:10,000 dilutions for 1 h at room
temperature. The protein bands were visualised using the
Odyssey Infrared Imaging System (LI-COR Biosciences).
The relative intensity of protein bands was quantified using
Image J software. The experiments were repeated three times
and a representative blot was displayed.
Quantitative reverse transcription polymerase chain
reaction
Total RNA was extracted using TRIzol reagent (15596-018,
Life Technologies) for RT-qPCR detection. Measurement of
RNA yield was performed using NanoDrop 1000
spectrophotometer (Thermo Fisher Scientific).
Complementary DNA was synthesised from 500 ng of total
RNA using DyNAmo™ cDNA Synthesis Kit (F-470L,
Finnzymes, Thermo Scientific) following the manufacturer’s
instructions [40]. RT-qPCR primers (Table 1) were designed
based on cDNA sequences from the NCBI Sequence data-
base. SYBR Green qPCR Master Mix (4,344,463,
Invitrogen) was used for detection and the target mRNA ex-
pressions were assayed on the 7500 fast real-time PCR system
(Applied Biosystems). Experiments were performed in tripli-
cate. The mean cycle threshold (Ct) value of each target gene
was normalised against the Ct value of the house keeping gene
GAPDH.
Rbpj luciferase reporter assay
In order to monitor the Notch signalling activity, a Rbpj lucif-
erase reporter kit (CCS-014L, QIAGEN) was used in IDG-
SW3 cell culture. The Rbpj protein is a direct co-modulator of
Notch signalling; therefore, its activity can represent canonical
Notch signalling. This reporter construct encodes a firefly lu-
ciferase gene under the control of tandem repeats of Rbpj
transcriptional response element; therefore, the Notch signal-
ling can be quantitatively analysed via measurement of lucif-
erase intensity. IDG-SW3 cells were seeded on 96-well plates
and transfected with 0.2 μg of reporter pre-mixed with 1.2 μl
Lipofectamine 2000 (11,668,019, Thermo Fisher) in 25 μl
Opti-MEM (31,985,070, Gibco) according to manufacturer’s
instructions. Luciferase activity was detected by Dual-
Luciferase® Reporter Assay System (E1910, Promega) and
measured using a POLARstar Omega microplate reader
(BMG Labtech). Three independent experiments were per-
formed in triplicate.
Intracellular calcium concentration assay
The calcium concentration of cells was determined by the
calcium detection kit (ab102505, Abcam) following the man-
ufacturer’s instructions. The optical densities (ODs) were test-
ed on a Bio-Rad microplate reader at 575 nm. All the results
were normalised to the (-DPAT) group. Three independent
experiments were performed in triplicate.
Scanning electron microscope
SEM was used to examine the surface structure of IDG-SW3
cells. The previously described critical point drying protocol
was chosen in this study [41, 42]. The cells cultured for
3 weeks were completely rinsed and fixed in 2.5% glutaralde-
hyde at 4 °C for 1 h. Then post-fixation was carried out with
1% osmium tetroxide followed by dehydration through a se-
ries of increasing concentrations of ethanol (50, 70, 90, 100
and 100% vol/vol) for 10 min each. After drying with 100%
J Mol Med
 J Mol Med
ƒFig. 2 Inhibition of Notch disturbed osteocyte marker expression. a
Representative images of Western blots showed IDG-SW3 cell line
expressed DMP1 and E11. The expression of DMP1 and E11 was
inhibited remarkably after Notch signaling was blocked by DAPT appli-
cation. b Relative band intensity was calculated based on Western blotting
results. n = 3, *p < 0.05, **p < 0.01, comparisons between the −DAPT
and +DAPT groups. c RT-qPCR results were consistent with Western
blots. n = 3, *p < 0.05, **p < 0.01, comparisons between the −DAPT
and +DAPT groups. d Live cell fluorescent images showed GFP activity
representing DMP1 expression gradually increased during IDG-SW3 cell
osteogenic differentiation. The increasing concentrations of DAPT added
into the culture system led to a gradual decrease of GFP intensities. There
was nearly no GFP expression when the concentration of DAPT reached
50 μM. The phase images of osteogenic culture at 14 days showed min-
eral nodules formed in normal IDG-SW3 cells, while the mineralisation
was impeded after the application of DAPT (scale bar 50 μm)
hexamethyldisilazane (HMDS), samples were coated with 1–
2 nm gold-palladium and measured under Zeiss Sigma
variable-pressure (VP) field-emission scanning electron mi-
croscope (SEM).
Transmission electron microscope and selected area
electron diffraction
Transmission electron microscope (TEM) generates high res-
olution images of ultra-thin specimen which makes it an ap-
propriate method to observe the combination of mineral crys-
tals and collagen and intracellular ultrastructure like mineral
particles in our project [43]. The fixation and dehydration
process for the TEM was performed similarly to that for
SEM mentioned above. Briefly, mineralised cultures were
fixed in 2.5% glutaraldehyde at 4 °C for 1 h, postfixed in
osmium tetroxide, dehydrated in a graded ethanol series, treat-
ed with acetonitrile and finally infiltrated with a Quetol-based
resin. Embedded samples were polymerised at 60 °C for 24 h,
sectioned (75 nm) using Leica EM UC7 ultramicrotome and
collected on bare 300 mesh copper TEM grids followed by
post-staining with uranyl acetate and lead citrate. TEM obser-
vation was performed using JOEL 1400 at 80 kV. Selected
area electron diffraction (SAED) is useful in distinguishing the
crystal orientation to elucidate the arrangement of mineral,
especially hydroxyapatite (HA) in bone tissue [44]. The sam-
ples for SAED were prepared as described for TEM. The
diffraction pattern of normal bone was set as the standard
control [45].
Atomic force microscopy
To obtain new insights of the mechanical property of the
mineral nodules, the bond between mineral and collagen
were measured using atomic force microscopy (AFM) as
described previously [46]. Briefly, samples were prepared
as the protocol for SEM, images were taken before and
after the AFM testing to calculate the level of mineral
removal. The AFM system Nanosurf FlexAFM
(Nanosurf AG, Switzerland) and the rectangular cantilever
ACLA (AppNano) were used. The cantilever tip has py-
ramidal tip with the front angle of 9°. The cantilever
spring constant was determined to be around 40.46 N/m.
The sensitivity calibration S of the cantilever was per-
formed by indenting a hard surface to measure the slope
of the force-height curve. The lateral detachment force
was determined based on the total compression of the
cantilever, probe geometry and cantilever orientation. In
addition, the detachment forces required to complete high,
medium and low levels of mineral removal which had
been defined as 42, 18 and 8% removal, respectively,
were recorded and statistically analysed.
Statistical analysis
Different statistical methods and comparisons used as in-
dicated in the figures and legends. Briefly, for two-sample
data sets (control vs. experimental condition) unpaired
Student’s t test was performed in this study. For data sets
with more than two conditions or different time points,
two-way ANOVA with Bonferroni post-hoc test was per-
formed. All statistical analyses were conducted with
Prism v6.05. p ≤ 0.05 was set as statistical significance.
Results
Notch target genes are expressed by osteocytes
In order to examine the Notch expression pattern in osteo-
cytes, we chose Hes1, a downstream target of Notch signal-
ling, for immunohistochemistry staining of rat femur. We
found that Hes1 is highly expressed in the osteocytes buried
in bone matrix, while osteoblasts located at the surface of bone
matrix were almost negatively stained. H&E staining was per-
formed to further indicate the location of osteoblasts on the
bone surface and osteocytes embedded in bone matrix
(Fig. 1a). We also used in vitro osteogenic culture of rat bone
marrow cells (rBMCs) to confirm the expression of Hes1.
After 14 days of osteogenic culture, which represented the late
stage of osteogenesis with mineral nodule formation, Hes1
was highly expressed in rBMCs compared with 7-day culture
as shown in immunofluorescent staining (Fig. 1b, c). This
result was consistent with the Western blot of rBMCs in oste-
ogenic culture which showed Hes1 was upregulated after
10 days, representing the late stage of differentiation (Fig.
1d). The IDG-SW3 cells under osteogenic conditions also
showed the same expression pattern of Hes1 (Fig. 1e, f). To
further confirm these findings, we used the Rbpj luciferase
reporter to transfect the IDG-SW3 cells, and a significant in-
crease of Rbpj activities was observed in the late

differentiation stage of osteocytes (Fig. 1g), indicating the
canonical Notch signalling pathway was activated in these
osteocytes.
Inhibition of Notch signalling negatively affects
expression of osteocyte markers
For a decade, DMP1 has been considered as a critical
marker of osteocyte which has an important role in
mineralisation. The IDG-SW3 cells express GFP under
the direction of DMP1 promotor. Moreover, this cell line
maintains proliferation at 33 °C while exits from cell cy-
cle at 37 °C of culture and differentiates to osteocytes.
Those properties make this cell line a powerful tool for
osteocyte research. We blocked Notch signalling in IDG-
SW3 cells by adding gradient concentration of DAPT, a
γ-secretase inhibitor to test whether Notch regulates
DMP1 expression. The cell viability after treatment with
DAPT was not changed and DAPT inhibited Hes1 expres-
sion in a dose-dependent manner (Supplementary Fig. 1A
and B). In normal condition, IDG-SW3 cells expressed
intensive GFP after 14 days of culture in osteogenic dif-
ferentiation medium; however, the intensity of GFP grad-
ually decreased in correlation with the increasing concen-
tration of DAPT. The GFP could not be detected when
IDG-SW3 cells were cultured with 50 μM DAPT
(Fig. 2a). This down-regulation of DMP1 by Notch signal
inhibition, as well as another early osteocyte marker, E11,
which regulates the formation of dendrites, had been con-
firmed at both protein and mRNA levels (Fig. 2b–d). The
transcription of other osteocyte-related genes, SOST and
MEPE, were also reduced after DAPT treatment
(Supplementary Fig. 1C).
To further confirm the changes of osteocyte markers were
attributed to the Notch signalling blockage, siRNA-mediated
knockdown of Hes1 was performed (Supplementary Fig. 2A)
with a demonstrated knockdown of Notch1 (Supplementary
Fig. 2B) in the siHes1 treatment. Consistent with our expec-
tations, the DMP1 (Supplementary Fig. 2C) and E11
(Supplementary Fig. 2D) expressions were down-regulated
after Hes1 transcriptional inhibition by siRNA.
Inhibition of Notch signalling disturbs both
extracellular and intracellular mineralisation
mediated by osteocytes
The general mineralisation levels were examined by von
Kossa staining. After 14-day osteogenic differentiation, a
large number of mineral nodules were formed by IDG-SW3
cells (Fig. 3a), while the number and diameter of the nodules
were significantly reduced in the DAPT group (Fig. 3d). The
ultrastructure of the mineral nodules was further observed
under TEM. In normal mineralisation, plenty of mineral
J Mol Med
particles were closely attached to collagen fibrils (Fig. 3b,
c); in contrast, the mineral particles were randomly deposited
and showed lack of tight contacts to collagen (Fig. 3E, F).
Intracellular mineralisation is a key step for normal
biomineralisation. In this study, it was noted that intracellular
mineral vesicles with appropriate size were observed in the
plasma of IDG-SW3 cells (Fig. 3g, h). However, when cul-
tured with the supplementation of DAPT, the intracellular
mineral particles were much smaller and sparsely distributed
in limited localisation in the plasma (Fig. 3i, j). The calcium
concentration in cells had been determined and the results
showed a decrease of it in Notch-inhibited IDG-SW3 cells
(Fig. 3k).
Notch signalling influences the mechanical properties
of mineralisation
Mechanical property of tissue mineralisation is critical for
bone function. In this study, we tested the bonding force of
the nodules formed by osteocytes using AFM. After a detach-
ment force of 35 μN was applied, there was nearly no nodules
that could be removed in the normal group (Fig. 4a, b).
However, evidently most nodules were removed from cell
culture plates in the DAPT-treated group after the same de-
tachment force was applied (Fig. 4c, d). For quantitative anal-
ysis, three levels of mineral nodule removal were established
according to the percentage of mineral nodules removed as
high (42%), medium (18%) and low (8%), respectively. In all
three removal levels, significantly higher detachment forces
were required to remove mineral nodules in the IDG-SW3
normal mineralisation group, in other words, normal mineral
nodules bound more tightly to collagen (Fig. 4e). In order to
explore the mineral structure that contributes to the changes of
mechanical properties, the crystal structure of the mineral nod-
ules was evaluated using SAED. The nodules formed by IDG-
SW3 cells in normal differentiation condition presented simi-
lar diffraction pattern to that of normal bone, which was
characterised by sharp and distinct diffraction rings, indicating
the crystal structure of normal nodules resembled normal bone
which is well organised (Fig. 4f, h). After Notch was inhibited,
in contrast, the diffraction pattern was less distinct, suggesting
that the arrangement of crystal was impacted due to the lack of
Notch signalling (Fig. 4g).
Inhibition of Notch signalling alters E11 expression
and osteocyte dendrite formation
E11 is an early marker of osteocytes and plays a role in the
development of dendrites, which is a unique morphological
characteristic of osteocytes. To test the expression of E11 and
the cell morphology, we conducted immunofluorescent (IF)
staining of E11 in IDG-SW3 cells. Confocal images con-
firmed that E11 was strongly expressed in cytoplasm as well
J Mol Med

Fig. 3 The structure of

mineralised nodules formed by
IDG-SW3 cells. a and d IDG-
SW3 cells (−DAPT) formed more
mineralised nodules compared
with the group of (+DAPT) as
shown in von Kossa staining. b, c,
d and f TEM images showed
(−DAPT) minerals were pene-
trated into and closely bound to
collagen fibrils as indicated by red
arrow in (c), while (+DAPT)
minerals were deposited on the
surface of collagen as indicated
by red arrow in (f). Scale bar 1 μm
in (b) and 6 μm in (e). g–j TEM
images of IDG-SW3 (−DAPT)
cells showed aggregated minerals
located in cytoplasm (g and h). In
contrast, there were only sparse
and small minerals observed in
(+DAPT) cells (i and j). K
Intracellular calcium concentra-
tion also decreased in (+DAPT)
cells. n = 3, *p < 0.05, normalised
to the (−DAPT) group

as the dendrites of IDG-SW3 cells cultured in differentiation
medium (Fig. 5a), while the expression was obviously
inhibited when DAPT was added (Fig. 5d). The decreased
expression of E11 in the DAPT treatment was not due to the
alteration/damage of cell cytoskeleton (Supplementary
Fig. 3). SEM was utilised to directly observe the cell morphol-
ogy. The normal IDG-SW3 cells presented with multi-
dendritic structure (Fig. 5b, c). In contrast, the Notch-
deficient IDG-SW3 cells were unable to generate enough den-
drites. And it is of note that a lot of spontaneous mineral
deposition was found in this condition (Fig. 5e, f, as
indicated by red arrowhead), which is consistent with the
TEM results mentioned above that mineral could not be de-
livered into the gap zone of collagen without the regulation of
Notch signalling. Quantitative analysis confirmed a signifi-
cant decline of both dendrite length and dendrite number
when Notch signalling was inhibited (Fig. 5g).
Discussion
Bone matrix is deposited by osteoblasts, followed by
osteocyte-mediated mineralisation. As osteoblasts are far
away from the mineral frontline, it is believed that the
 J Mol Med

osteocytes embedded in osteoid have an important role in the boundary between two fluorochromes [9]. Quantitative infor-
mineralisation process [47]. Feng and colleagues have dem- mation has also revealed that 60% of the minerals reside with-
onstrated that the mineralisation started at the proximal sites of in a distance less than 1 μm from the canaliculi and 80% of the
osteocytes, then extended to the distal sites, and there is a clear minerals are located in a distance of 1.4 μm [48]. Even after
 J Mol Med
ƒFig. 4 Mechanical properties and crystal structure of mineralisation were
damaged in the absence of Notch. a–d The microscope images showed
mineral nodules before and after the application of 35-μN detachment
force. The mineral nodules in the (−DAPT) group remained intact after
force application as shown in the red circles in a and b. In the (+DAPT)
group, the minerals were evidently removed as shown in c and d (scale
bar 500 μm). e For quantitative analysis, three levels of mineral removal
were defined as high (42%), medium (18%) and low (8%). The forces
applied to detach minerals to the same removal level were higher in the
(−DAPT) group than in the (+DAPT) group, indicating the bonding force
of minerals were greater in the (−DAPT) group. All the data are shown as
mean ± standard deviation; *p < 0.05 indicated the significant difference
of the applied forces between the (−DAPT) and (+DAPT) groups. f–h
SAED analysis revealed the diffraction patterns of minerals formed by
IDG-SW3 (−DAPT) cells resembled to that of normal bone, which were
distinct and clear, and quite different from the patterns of the (+DAPT)
group. White arrows indicated crystalline standard diffraction planes of
002, 211 and 004, which are characteristics of native bone
apoptosis, due to the non-existence of access for other cell
types, the lacuno-canalicular space is infilled with minerals
and the remnant osteocytes become mineralised by them-
selves, leaving the dead osteocytes as fossil [49]. Taken to-
gether, all the evidence reviewed above indicates it is osteo-
cyte that mediates mineralisation.
Osteoblasts and osteocytes belong to the same lineage and
represent continuous differentiation stages [50]. The
mineralisation process accompanies the transition from oste-
oblasts to osteocytes and fundamental epigenetic changes. As
mentioned earlier, osteoblasts express high ALP but no CK II,
while osteocytes express high CK II but no ALP. The opposite
phenomenon in protein expression reflects that the osteoblasts
and osteocytes exert different but consecutive functions in
osteogenesis. Specifically, osteoblasts provide organic frame
and phosphate, and then osteocytes utilise the phosphate to
mineralise the organic matrix. Those changes in cell functions
are likely controlled by cell signalling pathways including the
Notch signalling pathway.
Notch has been intensively studied in bone modelling and
remodelling [51, 52]. More specifically, Notch maintains bone
marrow mesenchymal progenitor cell pool and regulates oste-
oclastogenesis directly or indirectly through modulating oste-
oblasts [53, 54]. As the major cell type in bone tissue, osteo-
cyte plays a central role in orchestrating bone formation and
resorption. It senses mechanical loading, secrets non-
collagenous protein related to mineralisation and regulates
activities of both osteoblasts and osteoclasts [55]. However,
there are limited studies that focus on Notch’s function in
osteocyte and the existing results are quite controversial. It
has been reported that Notch expression in osteocytes leads
to a reduction of bone resorption and an increase in cancellous
bone mass [56]. Another study by the same group suggests
that inactivation of Notch can also increase cancellous bone
mass [56]. A most recent research has demonstrated that over-
expression of Notch in osteocytes causes osteopetrosis
through upregulating Wnt signalling [57]. The limitations of
those reports might be that they neglected the different Notch
expression levels during osteogenesis. More specifically,
Notch signalling inhibits the osteoblastic progenitor differen-
tiation. It is not surprising, therefore, that osteoblasts express
low level of Notch signalling in physiological conditions [54,
58, 59]. However, the increase of Notch during the transition
from osteoblasts to osteocytes is quite a new topic. It has been
reported that Hey 1, a downstream target of Notch signalling,
is upregulated more than 10-fold during cell differentiation
towards osteocytes [60]. Another recent observation on trans-
genic Notch reporter mice models has shown that Notch is
expressed in osteocytes [61]. Consistent with those observa-
tions, we have also demonstrated that Rbpj, a nuclear effector
for canonical Notch signalling transduction, is increased in
osteocytes. This suggests that Notch plays a role in terminal
differentiation and mineralisation process.
In our present study, we tested the relationship of Notch
pathway and the structure and mechanical properties of min-
eral nodules in details. In order to achieve this aim, TEM,
SAED and AFM were used for observation and analysis in
our study. Those methods illustrate the properties of mineral in
terms of appearance, crystal arrangement and bond strength,
respectively. Ideal bones need both rigidity and resilience to
maintain physiological function. The compromise between
rigidity and resilience can be attributed to the proper ratio of
organic collagen to mineral component, as well as the struc-
ture of mineral crystallite in terms of shape, size and crystal-
linity [62]. The collagen acts as the scaffold and template to
guide mineralisation. Moreover, it also positively promotes
the infiltration of amorphous calcium phosphate [63]. The
major mineral component in bone is hydroxyapatite, which
does not crystallise spontaneously as it depends on specific
extracellular matrix proteins, such as DMP1 produced by os-
teocyte, to form nucleated amorphous calcium phosphate
(ACP) particles. ACP particles then ripen and expand into
larger scale, eventually, form hydroxyapatite [64]. Intensive
studies have focused on the mineral regulatory functions of
non-collagenous proteins, among which DMP1 is the best-
known player in matrix-mediated mineralisation. DMP1 has
binding sites to both calcium phosphate and collagen [65]. It
has been reported that the c-terminal fragment of DMP1 me-
diates osteocyte maturation and mineralisation [64]. In an
in vitro study, DMP1 has been shown to prevent unregulated
calcium phosphate precipitation in solution and promote con-
trolled nucleation of mineral particles by stabilising calcium
phosphate and transferring it to the gap region of collagen
where it would then be deposited and crystallised. This pro-
cess can also be attributed to that phosphorylated DMP1 can
form negatively charged mineral complexes and this property
helps mineral to infiltrate into collagen fibrils carrying a pos-
itive charge [63, 66]. Consistent with this observation, an un-
regulated spontaneous mineral precipitation which is random-
ly deposited without a strong bond to the collagen has been
 J Mol Med

Fig. 5 Cell morphology

investigation. a
Immunofluorescent staining of
E11 (green) and DAPI (blue).
IDG-SW3 (-DAPT) cells pre-
sented with clear dendrite struc-
ture and strong expression of E11.
d No clear dendrite structure was
found in IDG-SW3 (+DAPT)
cells (scale bar 75 μm). b–f SEM
images revealed similar morpho-
logical changes in osteocytes.
Specifically, b and c the normal
IDG-SW3 cells presented with
multi-dendritic structure. The red
arrows indicate the cell bodies,
the yellow arrows indicate the
dendrites. e and f The Notch-
deficient IDG-SW3 cells present-
ed with round cell body and were
lack of dendrites as indicated by
red arrows. Red arrowheads indi-
cate spontaneously deposited
minerals. c and f were enlarged
images of selected areas of (b and
e). Scale bar 10 μm in (b and e),
5 μm in (c and f). g Both length
and number of dendrites were
significantly reduced in the
(+DAPT) group. n = 3,
**p < 0.01, comparisons between
the (−DAPT) and (+DAPT)
groups

found in osteocytes lacking DMP1. Although the relationship
between DMP1 and mineralisation has been well reported, the
specific mechanism involved in this process in vivo is yet
unknown. We have presented solid evidence in this study that
Notch is required for the expression of DMP1, and established
clear relationships between Notch and cellular mineralisation.
An abnormal intracellular mineralisation has also been ob-
served in osteocytes with the blockage of Notch signalling.
Normally, calcium phosphate deposits are located intracellu-
larly, especially in mitochondria with average size of
50~80 nm. However, in Notch-inhibited osteocytes, the glob-
ules are smaller with disordered morphologies [5, 67]. These
J Mol Med
abnormal mineral particles are secreted into the extracellular
matrix delivered by calcium phosphate containing vesicles.
Hence, the intracellular mineralisation is a key step in normal
biomineralisation. The specific mechanism which controls this
process remains unknown [3]. We have provided evidence
which shows that the intracellular mineralisation is disturbed
when Notch signalling is inhibited. It is speculated that Notch
not only affects extracellular mineralisation by inhibiting
DMP1, but also interferes intracellular mineralisation via un-
known mechanisms. Narayanan et al. suggested that non-
phosphorylated DMP1 can active intracellular calcium ion ac-
cumulation [68]. It is possible that DMP1 can regulate both
extracellular and intracellular mineral activities, which may ex-
plain our observations of disordered intracellular mineralisation
in osteocytes with inhibited Notch signalling.
We have also demonstrated that the morphological abnor-
mality in Notch-deficient osteocytes lacking typical dendrites
based on SEM and immunofluorescent observations. The ex-
pression of an early osteocyte marker, E11, which is responsi-
ble for the generation of cell processes, was also inhibited after
Notch blockage. Those results clearly demonstrate that Notch
signalling controls the protrusion of processes during the tran-
sition from osteoblasts to osteocytes. These long and slender
processes not only compose a huge network linking each indi-
vidual osteocyte together, but also play an important role in
mineral and matrix protein delivery, as there appears to be an
abundant distribution of DMP1 along canalicular walls [69].
Further studies are required to explore the mechanism of how
Notch regulates the expression of osteocyte-related genes.
The collagen matrix secreted by osteoblasts and the
minerals infiltrated into collagen under strict direction by
osteocytes are essential to normal mineralised tissues with
physiological function—reaching an equilibrium between
rigidity and resilience. Our study has demonstrated that
Notch signalling promotes highly organised integration of
collagen and mineral through activating DMP1 expression
with the possible involvement of other non-collagenous
proteins. Further research on the relationship between
Notch signalling and mineralisation is warranted in order
to provide new knowledge in this understudied area, and
form a cornerstone for the development of novel ap-
proaches and biomaterials for bone regeneration.
In conclusion, the evidence presented here suggests that
Notch plays a critical role in osteocyte differentiation and
biomineralisation from intracellular mineral package to extra-
cellular mineral deposition.
Acknowledgements This study was supported by the National Health
and Medical Research Council (NHMRC) of Australia Early Career
Fellowship (1105035) to YZ, QUT Tuition Waiver Scholarship to JS,
and Science and Technology Project Grants funded by Xiamen Science
and Technology Bureau (3502Z20161247) to JL, YZ and YX. The au-
thors acknowledge the facilities, and the scientific and technical assis-
tance of Dr. Jamie Riches, Ms. Rachel Hancock and Ms. Ning Liu, of
the Australian Microscopy & Microanalysis Research Facility at the
Central Analytical Research Facility operated by the Institute for Future
Environments at the Queensland University of Technology.
Compliance with ethical standards
The study is approved by the Animal Ethics Committee of Queensland
University of Technology
References
1. Clarke B (2008) Normal bone anatomy and physiology. Clin J Am
Soc Nephrol 3:S131–S139
2. Canalis E, Giustina A, Bilezikian JP (2007) Mechanisms of ana-
bolic therapies for osteoporosis. N Engl J Med 357:905–916
3. Boonrungsiman S, Gentleman E, Carzaniga R, Evans ND,
McComb DW, Porter AE, Stevens MM (2012) The role of intra-
cellular calcium phosphate in osteoblast-mediated bone apatite for-
mation. Proc Natl Acad Sci 109:14170–14175
4. Mahamid J, Sharir A, Addadi L, Weiner S (2008) Amorphous cal-
cium phosphate is a major component of the forming fin bones of
zebrafish: indications for an amorphous precursor phase. Proc Natl
Acad Sci 105:12748–12753
5. Mahamid J, Sharir A, Gur D, Zelzer E, Addadi L, Weiner S (2011)
Bone mineralization proceeds through intracellular calcium phos-
phate loaded vesicles: a cryo-electron microscopy study. J Struct
Biol 174:527–535
6. Toyosawa S, Shintani S, Fujiwara T, Ooshima T, Sato A, Ijuhin N,
Komori T (2001) Dentin matrix protein 1 is predominantly
expressed in chicken and rat osteocytes but not in osteoblasts. J
Bone Miner Res 16:2017–2026
7. Deshpande AS, Fang P-A, Zhang X, Jayaraman T, Sfeir C, Beniash
E (2011) Primary structure and phosphorylation of dentin matrix
protein 1 (DMP1) and dentin phosphophoryn (DPP) uniquely de-
termine their role in biomineralization. Biomacromolecules 12:
2933–2945
8. Feng JQ, Ward LM, Liu S, Lu Y, Xie Y, Yuan B, Yu X, Rauch F,
Davis SI, Zhang S, Rios H, Drezner MK, Quarles LD, Bonewald
LF, White KE (2006) Loss of DMP1 causes rickets and osteoma-
lacia and identifies a role for osteocytes in mineral metabolism. Nat
Genet 38:1310–1315
9. Lu Y, Yuan B, Qin C, Cao Z, Xie Y, Dallas SL, McKee MD,
Drezner MK, Bonewald LF, Feng JQ (2011) The biological func-
tion of DMP-1 in osteocyte maturation is mediated by its 57-kDa C-
terminal fragment. J Bone Miner Res 26:331–340
10. Orimo H (2010) The mechanism of mineralization and the role of
alkaline phosphatase in health and disease. Journal of Nippon
Medical School=Nippon Ika Daigaku zasshi 77:4–12
11. Zhang K, Barragan-Adjemian C, Ye L, Kotha S, Dallas M, Lu Y,
Zhao S, Harris M, Harris SE, Feng JQ, Bonewald LF (2006) E11/
gp38 selective expression in osteocytes: regulation by mechanical
strain and role in dendrite elongation. Mol Cell Biol 26:4539–4552
12. Schulze E, Witt M, Kasper M, Lowik CW, Funk RH (1999)
Immunohistochemical investigations on the differentiation marker
protein E11 in rat calvaria, calvaria cell culture and the osteoblastic
cell line ROS 17/2.8. Histochem Cell Biol 111:61–69
13. Matsui K, Breiteneder-Geleff S, Kerjaschki D (1998) Epitope-
specific antibodies to the 43-kD glomerular membrane protein
podoplanin cause proteinuria and rapid flattening of podocytes.
Journal of the American Society of Nephrology: JASN 9:2013–2026
14. Scholl FG, Gamallo C, Vilaro S, Quintanilla M (1999)
Identification of PA2.26 antigen as a novel cell-surface mucin-type

glycoprotein that induces plasma membrane extensions and in-
creased motility in keratinocytes. J Cell Sci 112(Pt 24):4601–4613
15. Burra S, Nicolella DP, Francis WL, Freitas CJ, Mueschke NJ, Poole
K, Jiang JX (2010) Dendritic processes of osteocytes are
mechanotransducers that induce the opening of hemichannels.
Proc Natl Acad Sci 107:13648–13653
16. Piemontese M, Onal M, Xiong J, Han L, Thostenson JD, Almeida
M, O’Brien CA (2016) Low bone mass and changes in the osteo-
cyte network in mice lacking autophagy in the osteoblast lineage.
Sci Rep 6:24262 http://dharmasastra.live.cf.private.springer.com/
articles/srep24262#supplementary-information
17. Thompson WR, Uzer G, Brobst KE, Xie Z, Sen B, Yen SS, Styner
M, Rubin J (2015) Osteocyte specific responses to soluble and
mechanical stimuli in a stem cell derived culture model. Sci Rep
5:11049 http://dharmasastra.live.cf.private.springer.com/articles/
srep11049#supplementary-information
18. Hesse B, Varga P, Langer M, Pacureanu A, Schrof S, Mannicke N,
Suhonen H, Maurer P, Cloetens P, Peyrin F et al (2015) Canalicular
network morphology is the major determinant of the spatial distri-
bution of mass density in human bone tissue: evidence by means of
synchrotron radiation phase-contrast nano-CT. J Bone and Mineral
Res:Off J Am Soc Bone Mineral Res 30:346–356
19. Nango N, Kubota S, Hasegawa T, Yashiro W, Momose A, Matsuo
K (2016) Osteocyte-directed bone demineralization along canalic-
uli. Bone 84:279–288
20. Turner CH, Robling AG, Duncan RL, Burr DB (2002) Do bone
cells behave like a neuronal network? Calcif Tissue Int 70:435–442
21. Buenzli PR, Sims NA (2015) Quantifying the osteocyte network in
the human skeleton. Bone 75:144–150
22. Schaffler MB, Cheung WY, Majeska R, Kennedy O (2014)
Osteocytes: master orchestrators of bone. Calcif Tissue Int 94:5–24
23. Genetos DC, Kephart CJ, Zhang Y, Yellowley CE, Donahue HJ
(2007) Oscillating fluid flow activation of gap junction hemichan-
nels induces atp release from MLO-Y4 osteocytes. J Cell Physiol
212:207–214
24. Cherian PP, Siller-Jackson AJ, Gu S, Wang X, Bonewald LF,
Sprague E, Jiang JX (2005) Mechanical strain opens connexin 43
hemichannels in osteocytes: a novel mechanism for the release of
prostaglandin. Mol Biol Cell 16:3100–3106
25. Andersson ER, Sandberg R, Lendahl U (2011) Notch signaling:
simplicity in design, versatility in function. Development 138:
3593–3612
26. Nam Y, Sliz P, Song L, Aster JC, Blacklow SC (2006) Structural
basis for cooperativity in recruitment of MAML coactivators to
Notch transcription complexes. Cell 124:973–983
27. Wilson JJ, Kovall RA (2006) Crystal structure of the CSL-Notch-
mastermind ternary complex bound to DNA. Cell 124:985–996
28. Kopan R, Ilagan MXG (2009) The canonical Notch signaling path-
way: unfolding the activation mechanism. Cell 137:216–233
29. Bray SJ (2016) Notch signalling in context. Nat Rev Mol Cell Biol.
advance online publication 17:722–735
30. Veno PND, Sivakumar P, Kalajzic I, Rowe D, Harris SE, Bonewald
L, Dallas SL (2006) Live imaging of osteocytes within their lacunae
reveals cell body and dendrite motions. J Bone Miner Res 21
31. Sprinzak D, Lakhanpal A, LeBon L, Santat LA, Fontes ME,
Anderson GA, Garcia-Ojalvo J, Elowitz MB (2010) Cis-
interactions between Notch and Delta generate mutually exclusive
signalling states. Nature 465:86–90 http://www.nature.com/nature/
journal/v465/n7294/suppinfo/nature08959_S1.html
32. Rios AC, Serralbo O, Salgado D, Marcelle C (2011) Neural crest regu-
lates myogenesis through the transient activation of NOTCH. Nature
473:532–535 http://www.nature.com/nature/journal/v473/n7348/abs/
10.1038-nature09970-unlocked.html#supplementary-information
33. Zhou Y, Fan W, Prasadam I, Crawford R, Xiao Y (2015)
Implantation of osteogenic differentiated donor mesenchymal stem
J Mol Med
cells causes recruitment of host cells. J Tissue Eng Regen Med 9:
118–126
34. Ren Y, Lin S, Jing Y, Dechow PC, Feng JQ (2014) A novel way to
statistically analyze morphologic changes in Dmp1-null osteocytes.
Connect Tissue Res 55:129–133
35. Shi M, Zhou Y, Shao J, Chen Z, Song B, Chang J, Wu C, Xiao Y
(2015) Stimulation of osteogenesis and angiogenesis of hBMSCs
by delivering Si ions and functional drug from mesoporous silica
nanospheres. Acta Biomater 21:178–189
36. Kalajzic I, Kalajzic Z, Kaliterna M, Gronowicz G, Clark SH,
Lichtler AC, Rowe D (2002) Use of type I collagen green fluores-
cent protein transgenes to identify subpopulations of cells at differ-
ent stages of the osteoblast lineage. J Bone Miner Res 17:15–25
37. Li X, Liu P, Liu W, Maye P, Zhang J, Zhang Y, Hurley M, Guo C,
Boskey A, Sun L, Harris SE, Rowe DW, Ke HZ, Wu D (2005)
Dkk2 has a role in terminal osteoblast differentiation and mineral-
ized matrix formation. Nat Genet 37:945–952 http://www.nature.
com/ng/journal/v37/n9/suppinfo/ng1614_S1.html
38. Woo SM, Rosser J, Dusevich V, Kalajzic I, Bonewald LF (2011)
Cell line IDG-SW3 replicates osteoblast-to-late-osteocyte differen-
tiation in vitro and accelerates bone formation in vivo. J Bone Miner
Res 26:2634–2646
39. Shih Y-RV, Hwang Y, Phadke A, Kang H, Hwang NS, Caro EJ,
Nguyen S, Siu M, Theodorakis EA, Gianneschi NC, Vecchio KS,
Chien S, Lee OK, Varghese S (2014) Calcium phosphate-bearing
matrices induce osteogenic differentiation of stem cells through
adenosine signaling. Proc Natl Acad Sci 111:990–995
40. Li S, Shao J, Zhou Y, Friis T, Yao J, Shi B, Xiao Y (2016) The
impact of Wnt signalling and hypoxia on osteogenic and
cementogenic differentiation in human periodontal ligament cells.
Mol Med Rep 14:4975–4982
41. Moran P, Coats B (2012) Biological sample preparation for SEM
imaging of porcine retina. Microscopy Today 20:28–31
42. Fischer ER, Hansen BT, Nair V, Hoyt FH, Dorward DW (2012)
Scanning electron microscopy. Curr Protoc Microbiol Chapter 2:
Unit2B.2. DOI https://doi.org/10.1002/9780471729259.
mc02b02s25
43. Keene DR, Tufa SF (2010) Transmission electron microscopy of
cartilage and bone. Methods Cell Biol 96:443–473
44. Williams DB, Carter CB (2009) Diffraction from crystals transmis-
sion electron microscopy: a textbook for materials science. Springer
US, Boston, pp 257–269
45. Zuo Q, Lu S, Du Z, Friis T, Yao J, Crawford R, Prasadam I, Xiao Y
(2016) Characterization of nano-structural and nano-mechanical
properties o f osteoarthritic subchond ral bon e. BMC
Musculoskelet Disord 17:367
46. Nguyen TD, Gu Y (2016) Investigation of cell-substrate adhesion
properties of living chondrocyte by measuring adhesive shear force
and detachment using AFM and inverse FEA. Sci Rep 6:38059
https://www.nature.com/articles/srep38059#supplementary-
information
47. Mikuni-Takagaki Y, Kakai Y, Satoyoshi M, Kawano E, Suzuki Y,
Kawase T, Saito S (1995) Matrix mineralization and the differenti-
ation of osteocyte-like cells in culture. Journal of bone and mineral
research: the official journal of the American Society for Bone and
Mineral Research 10:231–242
48. Kerschnitzki M, Kollmannsberger P, Burghammer M, Duda GN,
Weinkamer R, Wagermaier W, Fratzl P (2013) Architecture of the
osteocyte network correlates with bone material quality. Journal of
bone and mineral research: the official journal of the American
Society for Bone and Mineral Research 28:1837–1845
49. Bell LS, Kayser M, Jones C (2008) The mineralized osteocyte: a
living fossil. Am J Phys Anthropol 137:449–456
50. Bonewald LF (2011) The amazing osteocyte. J Bone Miner Res 26:
229–238
J Mol Med
51. Zanotti S, Canalis E (2010) Notch and the skeleton. Mol Cell Biol
30:886–896
52. Zanotti S, Canalis E (2011) Notch regulation of bone development and
remodeling and related skeletal disorders. Calcif Tissue Int 90:69–75
53. Engin F, Yao Z, Yang T, Zhou G, Bertin T, Jiang MM, Chen Y, Wang
L, Zheng H, Sutton RE, Boyce BF, Lee B (2008) Dimorphic effects
of Notch signaling in bone homeostasis. Nat Med 14:299–305
54. Hilton MJ, Tu X, Wu X, Bai S, Zhao H, Kobayashi T, Kronenberg
HM, Teitelbaum SL, Ross FP, Kopan R, Long F (2008) Notch
signaling maintains bone marrow mesenchymal progenitors by sup-
pressing osteoblast differentiation. Nat Med 14:306–314
55. Dallas SL, Prideaux M, Bonewald LF (2013) The osteocyte: an
endocrine cell…and more. Endocr Rev 34:658–690
56. Canalis E, Parker K, Feng JQ, Zanotti S (2013) Osteoblast lineage-
specific effects of Notch activation in the skeleton. Endocrinology
154:623–634
57. Canalis E, Bridgewater D, Schilling L, Zanotti S (2016) Canonical
Notch activation in osteocytes causes osteopetrosis. Am J Physiol
Endocrinol Metab 310:E171–E182
58. Zanotti S, Smerdel-Ramoya A, Stadmeyer L, Durant D, Radtke F,
Canalis E (2008) Notch inhibits osteoblast differentiation and
causes osteopenia. Endocrinology 149:3890–3899
59. Deregowski V, Gazzerro E, Priest L, Rydziel S, Canalis E (2006)
Notch 1 overexpression inhibits osteoblastogenesis by suppressing
Wnt/β-catenin but not bone morphogenetic protein signaling. J
Biol Chem 281:6203–6210
60. John HCS, Bishop KA, Meyer MB, Benkusky NA, Leng N,
Kendziorski C, Bonewald LF, Pike JW (2014) The osteoblast to
osteocyte transition: epigenetic changes and response to the vitamin
D3 hormone. Mol Endocrinol 28:1150–1165
61. Liu P, Ping Y, Ma M, Zhang D, Liu C, Zaidi S, Gao S, Ji Y, Lou F, Yu
F, Lu P, Stachnik A, Bai M, Wei C, Zhang L, Wang K, Chen R, New
MI, Rowe DW, Yuen T, Sun L, Zaidi M (2016) Anabolic actions of
Notch on mature bone. Proc Natl Acad Sci 113:E2152–E2161
62. Addison WN, Nelea V, Chicatun F, Chien YC, Tran-Khanh N,
Buschmann MD, Nazhat SN, Kaartinen MT, Vali H, Tecklenburg
MM, Franceschi RT, McKee MD (2015) Extracellular matrix
View publication stats
mineralization in murine MC3T3-E1 osteoblast cultures: an ultra-
structural, compositional and comparative analysis with mouse
bone. Bone 71:244–256
63. Nudelman F, Pieterse K, George A, Bomans PHH, Friedrich H,
Brylka LJ, Hilbers PAJ, de With G, Sommerdijk NAJM (2010)
The role of collagen in bone apatite formation in the presence of
hydroxyapatite nucleation inhibitors. Nat Mater 9:1004–1009
http://www.nature.com/nmat/journal/v9/n12/abs/nmat2875.html#
supplementary-information
64. He G, Dahl T, Veis A, George A (2003) Nucleation of apatite
crystals in vitro by self-assembled dentin matrix protein 1. Nat
Mater 2:552–558 http://www.nature.com/nmat/journal/v2/n8/
suppinfo/nmat945_S1.html
65. He G, George A (2004) Dentin matrix protein 1 immobilized on
type I collagen fibrils facilitates apatite deposition in vitro. J Biol
Chem 279:11649–11656
66. He G, Gajjeraman S, Schultz D, Cookson D, Qin C, Butler WT,
Hao J, George A (2005) Spatially and temporally controlled bio-
mineralization is facilitated by interaction between self-assembled
dentin matrix protein 1 and calcium phosphate nuclei in solution.
Biochemistry 44:16140–16148
67. Dey A, Bomans PHH, Müller FA, Will J, Frederik PM, de With G,
Sommerdijk NAJM (2010) The role of prenucleation clusters in
surface-induced calcium phosphate crystallization. Nat Mater 9:
1010–1014 http://www.nature.com/nmat/journal/v9/n12/abs/
nmat2900.html#supplementary-information
68. Narayanan K, Ramachandran A, Hao J, He G, Park KW, Cho M,
George A (2003) Dual functional roles of dentin matrix protein 1:
implications in biomineralization and gene transcription by activa-
tion of intracellular Ca2+ store. J Biol Chem 278:17500–17508
69. Harris SE, Gluhak-Heinrich J, Harris MA, Yang W, Bonewald LF,
Riha D, Rowe PSN, Robling AG, Turner CH, Feng JQ, McKee M,
Nicollela D (2007) DMP1 and MEPE expression are elevated in
osteocytes after mechanical loading in vivo: theoretical role in con-
trolling mineral quality in the perilacunar matrix. J Musculoskelet
Neuronal Interact 7:313–315