Professional Documents
Culture Documents
Sponsored by
US Department of Energy' s Oftice of Fuels Development
and the Oftice of Industrial Technologies
Oak Ridge National Laboratory
National Renewable Energy Laboratory
Applied CarboChemicals
BBI International
Cargill, Inc.
Cargill Dow LLC
CIFAR- University of California, Davis
Corn Refiners Association
Diversa
E.l. DuPont de Nemours and Company, Inc.
Idaho National Engineering and Environmental Laboratory
Iogen Corporation
Katzen International, Inc.
Natural Resources Canada
Novozymes NS
Pacific Northwest National Laboratory
Tate and Lyle PLC
Tembec, Inc.
Tennessee V alley Authority Public Power Institute
Editors
Brian H. Davison and James W. Lee
Oak Ridge National Laboratory
Mark Finkelstein and James D. McMillan
National Renewable Energy Laboratory
BRIAN H. DAVISON
Oak Ridge National Laboratory
MARK FINKELSTEIN
National Renewable Energy Laboratory
Session Chairpersons
Session 1: Feedstock Production, Genetic Modification,
and Processing
Chairs: Sharon Shoemaker, University of California, Davis, CA
Lynn Wright, Oak Ridge National Laboratory, Oak Ridge, TN
Session 2: Microbial Catalysis and Metabolic Engineering
Chairs: Nancy Ro, Purdue University, West Lafayette, IN
Francisco Roberto, Idaho National Engineering
and Environmental Laboratory, Idaho Falls, ID
Session 3: Bioprocessing Research
Chairs: Mark Eiteman, University of Georgia, Athens, GA
Amit Vasavada, Diversa Corporation, San Diego, CA
Session 4: Genetics and Genomics in Bioenergy and Bioproducts
Chairs: Thomas W. Jeffries, USDA Forest Products Laboratory,
Madison, WI
James McLaren, Inverizon International, Inc.,
Chesterfield, MO
Session 5: Industrial Bio-Based Product Development
Organizing Committee
Brian Davison, Conference Chair, Oak Ridge National Laboratory,
Oak Ridge, TN
Mark Finkelstein, Conference Co-Chair, National Renewable Energy
Laboratory, Golden, CO
Bill Apel, Idaho National Engineering and Environmental Labora-
tory, Idaho Falls, ID
Doug Cameron, Cargill, Minneapolis, MN
Tom Jeffries, USDA Forest Service, Madison, WI
James Lee, Oak Ridge National Laboratory, Oak Ridge, TN
Lee Lynd, Dartmouth College, Hanover, NH
Jim McMillan, National Renewable Energy Laboratory, Golden, CO
Dale Monceaux, Katzen International, Inc., Cincinnati, OH
vi Introduction
Mark Paster, US Department of Energy, Washington, DC
Jack Saddler, University of British Columbia, Vancouver, British
Columbia, Canada
Valerie Sarisky-Reed, US Department of Energy, Washington, DC
Sharon Shoemaker, University of California, Davis, CA
David Short, E. l. DuPont de Nemours & Co., Newark, DE
Jeff Tolan, Iogen Corporation, Ontario, Canada
Nancy Watlington, Oak Ridge National Laboratory, Oak Ridge, TN
Liz Willson, National Renewable Energy Laboratory, Golden, CO
Charles Wyman, Dartmouth College, Hanover, NH
Guido Zacchi, Lund University, Lund, Sweden
Gisella Zanin, State University of Maringa, Maringa, PR, Brazil
Acknowledgments
The continued success of the Symposium is due to the many partici-
pants, organizers, and sponsors, but is also a success and pleasure due to
the diligent and creative staff. In particular, Nancy Watlington of ORNL,
the conference secretary and Liz Willson of NREL, the assistant conference
secretary, provided advice, persistence, and unfailing good humor.
Dr. John Barton also contributed greatly to the website design and imple-
mentation. Other ORNL staff included: Norma Cardwell, Angie Fincher,
Tony McBee, Norm Kurtz, Sandie Jones, and Sadie Drescher.
Oak Ridge National Laboratory is operated for the US Department of
Energy by UT-Battelle, LLC under contract DE-ACOS-000R2272S.
The National Renewable Energy Laboratory is operated for the US
Department of Energy by Midwest Research Institute, Battelle, and Bechtel
under contract DE-AC36-99GOI0337.
The submitted manuscript has been authored by a contractor of the
US Government under contract DE-ACOS-OOOR2272S. Accordingly, the
US Government retains a nonexclusive, royalty-free license to publish or
reproduce the published form of this contribution, or allow others to do
so, for US Government purposes.
This symposium has been held annually since 1978. We are pleased to
have the proceedings of the Twenty-Fourth Symposium currently pub-
lished in this special issue to continue the tradition of providing a record of
the contributions made.
The Twenty-Fifth Symposium will be May 4-7, 2003 in Breckenridge,
Colorado. For more information on the 24th and 25th Symposia, visit the
following Websites: http://www.ct.ornl.gov /symposium and http:/ /
nrel.gov /biotech_symposium. We encourage comments or discussions
relevant to the format or content of the meetings.
Applied Biochemistry and Biotechnology Vols. 105-108/ Spring 2003
CONTENTS
Introduction
Brian H. Davison and Mark Finkelstein ................................................ iii
Introduction to Session 1
Sharon P. Shoemaker and Lynn L. Wright ............................................... 3
Rapid Biomass Analysis: New Tools for Compositional Analysis of Corn
Stover Feedstocks and Process Intermediates from Ethanol Production
Bonnie R. Hames, * Steven R. Thomas, Amie D. Sluiter,
Christine J. Roth, and David W. Templeton ....................................... 5
Xylem-Specific and Tension Stress-Responsive Expression
of Cellulose Synthase Genes from Aspen Trees
Chandrashekhar P. Joshi * ........................................................................ 17
Microbial Pretreatment of Biomass: Potential for Reducing Severity
of Thermochemical Biomass Pretreatment
Fred A. Keller, Jenny E. Hamilton, and Quang A. Nguyen* ................ 27
Physical Separation of Straw Stem Components to Reduce Silica
J. Richard Hess, *David N. Thompson, Reed L. Hoskinson,
Peter G. Shaw, and Duane R. Grant ................................................... 43
Application of a Depolymerization Model for Predicting
Thermochemical Hydrolysis of Hemicellulose
Todd Lloyd and Charles E. Wyman* ....................................................... 53
Dilute-Sulfuric Acid Pretreatment of Corn Stover
in Pilot-Scale Reactor: Investigation of Yields, Kinetics,
and Enzymatic Digestibilities of Solids
Daniel J. Schell, * Jody Farmer, Millie Newman,
and James D. McMillan ......................................................................... 69
Hydrothermal Pretreatment Conditions to Enhance
Ethanol Production from Poplar Biomass
Maria Jose Negro, Paloma Manzanares, Ignacio Ballesteros,
Jose Miguel Oliva, Araceli Cabanas, and Mercedes Ballesteros* ..... 87
Estimation of Temperature Transients
for Biomass Pretreatment in Tubular Batch Reactors
and Impact on Xylan Hydrolysis Kinetics
Suzanne L. Stuhler and Charles E. Wyman* ........................................ 101
*For papers with multiple authorship, the asterisk identifies the author to whom corre-
spondence and reprint requests should be addressed.
ix
x Contents
Effect of Sulfuric and Phosphoric Acid Pretreatments
on Enzymatic Hydrolysis of Corn Stover
Byung-Hwan Um, M. Nazmul Karim, * and Linda L. Henk .............. 115
Introduction to Session 2
Nancy W. Y. Ho and Francisco F. Roberto ............................................ 245
Saccharification of Marine Microalgae
Using Marine Bacteria for Ethanol Production
Mitsufumi Matsumoto, * Hiroko Yokouchi, Nobukazu Suzuki,
Hiroshi Ohata, and Tadashi Matsunaga .......................................... 247
D-Xylose Transport by Candida succiphila
and Kluyveromyces marxianus
Boris U. Stambuk, * Mary Ann Franden,
Arjun Singh, and Min Zhang .............................................................. 255
Molecular Characterization of a Gene
for Aldose Reductase (CbXYL1) from Candida boidinii
and Its Expression in Saccharomyces cerevisiae
Min Hyung Kang, Haiying Ni,
and Thomas W. Jeffries* ...................................................................... 265
Changing Flux of Xylose Metabolites by Altering Expression
of Xylose Reductase and Xylitol Dehydrogenase
in Recombinant Saccharomyces cerevisiae
Yong-Su lin and Thomas W. Jeffries* .................................................... 277
Effect of Media on Spore Yield and Thermal Resistance
of Bacillus stearothermophilus
Thereza Christina Vessoni Penna, *
Irene A. Machoshvili, and Marina Ishii ........................................... 287
Cassava Flour Wastewater as a Substrate
for Biosurfactant Production
Marcia Nitschke* and Glaucia M. Pastore ......................................... 295
A New Oxygen Sensitivity and Its Potential Application
in Photosynthetic H2 Production
James W. Lee* and Elias Greenbaum .................................................... 303
Introduction to Session 3
Mark A. Eiteman and Amit Vasavada .................................................. 317
Optimization of S02-Catalyzed Steam Pretreatment
of Com Fiber for Ethanol Production
Renata Bura, Rodney J. Bothast, Shawn D. Mansfield,
and John N. Saddler, * .......................................................................... 319
xii Contents
A Comprehensive Kinetic Model for Dilute-Acid
Hydrolysis of Cellulose
Qian Xiang, Jun Seok Kim, and Y. Y. Lee* ........................................... 337
Effect of Agitation on Removal of Acetic Acid
from Pretreated Hydrolysate by Activated Carbon
Sarah A. Priddy and Thomas R. Hanley* ............................................. 353
Introduction to Session 4
James S. McLaren and Thomas W. Jeffries ........................................... 631
Introduction to Session 6
Joel R. Cherry and Robert DiCosimo ..................................................... 675
Contents xv
Partial Purification and Kinetic Characterization
of Acid Phosphatase from Garlic Seedling
Begiim Yenigiin* and Yiiksel Giivenilir ................................................. 677
Automated Filter Paper Assay
for Determination of Cellulase Activity
Stephen R. Decker, * William S. Adney, Edward Jennings,
Todd B. Vinzant, and Michael E. Himmel ....................................... 689
Adsorption of Components of Enzymatic Synthesis
of Ampicillin on Different Hydrophobic Resins
Marcelo F. Vieira, Marlei Barboza,
and Raquel de Lima C. Giordano* .................................................... 705
Xylanase Production by Trichoderma reesei Rut C-30 on Rice Straw
Alejandro Colina, Betzabe Sulbaran-de-Ferrer,
Cateryna Aiello, and Alexis Ferrer* .................................................. 715
A Different Method of Measuring and Detecting Mono-
and Dioxygenase Activities:
Key Enzymes in Hydrocarbon Biodegradation
Roberto Zazueta-Sandoval, * Vanesa Zazueta Novoa,
Hortencia Silva Jimenez, and Roberto Cabrera Ortiz ................... 725
Xylanase Production by Penicillium canescens
IO-IOc in Solid-State Fermentation
Yasser Bakri, Philippe Jacques, * and Philippe Thonart .................... 737
Protease Production by Streptomyces sp. Isolated
from Brazilian Cerrado Soil: Optimization of Culture
Medium Employing Statistical Experimental Design
Luciana A. I. de Azeredo, Leda R. Castilho, Selma G. F. Leite,
Rosalie R. R. Coelho, and Denise M. G. Freire* .............................. 749
Synthesis of Monocaprin Catalyzed by Lipase
Marco A. M. Da Silva, Vitoria C. Medeiros,
Marta A. P. Langone, and Denise M. G. Freire* ............................. 757
Effect of Dose of Xylanase on Bleachability
of Sugarcane Bagasse Ethanol/Water Pulps
Denise S. Ruzene and Adilson R. Gon~alves* ..................................... 769
CelF of Orpinomyces PC-2 has an Intron
and Encodes a Cellulase (CeIF) Containing
a Carbohydrate-Binding Module
Huizhong Chen, Xin-Liang Li, * David L. Blum,
Eduardo A. Ximenes, and Lars G. Ljungdahl .................................. 775
xvi Contents
Partition Behavior and Partial Purification of Hexokinase
in Aqueous Two-Phase Polyethylene Glycol/Citrate Systems
George G. G. Oliveira, Daniel P. Silva, Ines Concei~iio Roberto,
Michele Vitolo, and Adalberto Pessoa Jr. * ....................................... 787
Introduction to Session 7
Michael Cockrem and Cesar C. Santana ............................................... 827
Feedstock Production,
Genetic Modification, and Processing
Abstract
New, rapid, and inexpensive methods that monitor the chemical compo-
sition of corn stover and corn stover-derived samples are a key element to
enabling the commercialization of processes that convert stover to fuels and
chemicals. These new techniques combine near infrared (NIR) spectroscopy
and projection to latent structures (PLS) multivariate analysis to allow the
compositional analysis of hundreds of samples in 1 d at a cost of about $10
each. The new NIRjPLS rapid analysis methods can also be used to support
a variety of research projects that would have been too costly to pursue by
traditional methods.
Index Entry: Corn stover; near infrared spectroscopy; projection to latent
structures; feedstock; multivariate analysis.
Introduction
Robust analytical methods are needed to support and enable biomass
conversion processes because of the heterogeneity that is an inherent prop-
erty of biomass. The chemical composition of a biomass feedstock varies as
a function of many factors including plant genetics, growth environment,
harvesting method, and storage. Many biomass feedstocks are residues of
another process, which introduces the varying efficiency in the original
process as an additional source of compositional variance. All of these
sources of compositional variance are difficult to control; however, the
composition of a given feedstock can be measured in real time and that
information can be used to adjust process conditions for optimal conver-
sion. The rapid, inexpensive compositional analysis methods described
here are examples of new tools that will be needed for the commercializa-
tion of processes that convert biomass into fuels and valuable chemicals.
*Author to whom all correspondence and reprint requests should be addressed.
Process Product
and the validation of the PLS algorithm, and the development of quality
assurance/ quality control procedures including guidelines for appropri-
ate application of the new methods.
Calibration Samples
The first step in developing a new method is the gathering of appro-
priate calibration samples. A minimum of 30 unique samples is needed for
preliminary methods, and calibration sets for robust methods usually con-
tain 100-300 well-characterized samples. Collecting and characterizing a
good calibration set costs about $300,000, which is by far the most expen-
sive and time-consuming step in method development.
Calibration samples should have compositions similar to the samples
to be analyzed. If possible, the calibration set should include samples that
represent all known sources of compositional variance for that material.
Another feature that is essential to a good calibration set is independent
variance of the different constituents. Calibration sets should be checked
for strong correlations among major constituents. Since the composition of
plants is determined by physiology and plant viability, biomass feedstock
samples with independently varying constituents are sometimes difficult
to find. Several calibration samples can often be made from one feedstock
by manually adding or removing specific plant tissues such as leaves or
nodes. The extremes of a corn stover calibration set can be found within a
single plant, in the various plant tissue types. For example, no whole corn
stover feedstock will have as much protein as a sample consisting only of
leaves. A research environment is ideal for the generation and collection of
process calibration samples since reaction parameters are often skewed
for experimental purposes. Larger-scale processes run at steady state, so
development of a rapid analysis method to support these processes should
begin during the reactor shake-down phase. Hundreds of samples may
need to be evaluated to identify 30 unique samples for a preliminary cali-
bration. The preliminary method can then be used to identify the best
samples for expanding and improving the calibration set.
Applied Biochemistry and Biotechnology Vol. 105-108,2003
8 Hames et al.
~ whole stover
0.9
-leaves
0.8
-leaf sheaths
0.7
-pith
-I>- internode
0.3
0.2
0.1
o~----------~----------~------------~----------~~
400 900 1400 1900 2400
wavelength (nm)
Multivariate Analysis
Multivariate analysis connects the compositional data with the spec-
troscopic data. The PLS (sometimes called partial least squares) method
regresses the matrix of compositional information against NIR spectral
data collected from 400 to 2500 nm. In simplified terms, PLS analysis solves
hundreds of equations in thousands of variables to obtain a linear equation
Table 1
Calibration Ranges and SEs of Cross Validation for NIR/PLS
Method for Compositional Analysis of Corn Stover Feedstocks
Min Max SECV
Constituent (% drywt) (% dry wt) (% drywt)a
40
35
~ 30
d.
IE
z 25. :091uoa n
.!' :Oxylan
lII:
!: 20 i61ignin
i- prolsin
!ucetyl ,
15 :0 8TI!.~.i.~n..l
o 5 16 20 25 30 35 40 50
wt"!. bv wet chemistry
Fig. 3. Comparison of corn stover feedstock composition as determined by wet
chemical and NIR/PLS methods.
114
.. acetyl
80
• lignin
• minor sugars
40
cXylan
20 • gtucan
o
Colorado, 2000 lIinols, 2000 Iowa. 2000A Iowa, ZOOIA 10_ 20018
Fig. 4. Comparison of theoretical ethanol yields and composition of bulk corn stover
feedstocks.
Table 2
Calibration Ranges (% dry wt) and Standard Errors
of Cross Validation (SECV, % dry wt) for a NIRjPLS Method for
the Compositional Analysis of Pretreated Corn Stover Solids
Constituent Range (% dry wt) SECV (% dry wt)a
Gluean 39.6-68.9 1.549
Xylan 1.0-23.2 1.458
Lignin 22.1-33.5 1.506
Protein 1.1-4.9 0.479
Ash 0.5-16.6 1.467
·5E of cross validation.
Conclusion
For biomass analysis, rapid techniques based on NIR/PLS can pro-
vide significant savings in time and money with no loss of precision or
accuracy relative to the calibration methods. Spectroscopy-based compo-
sitional analysis methods are applicable to a wide variety of biomass and
biomass-derived materials. NREL is uniquely situated for the develop-
ment of these methods for several reasons. First, years of experience in
method development for biomass analysis and experience with a wide
variety of biomass types provide the necessary data quality. Second, the
availability at NREL of unique biomass samples produced in a research
environment enhances calibration range and depth. These new rapid meth-
ods for biomass analysis can support and improve research and develop-
ment by providing levels of information that would have been too costly to
pursue using traditional wet chemistry-based compositional analysis
methods. The development of rapid analysis methods for the composi-
tional analysis of biomass and biomass-derived materials is a key element
in enabling the commercialization of processes that produce fuels and
chemicals from biomass.
Acknowledgments
This work was funded by the US Department of Energy: Office of
Biomass Programs and the NREL Biomass program.
Applied Biochemistry and Biotechnology Vol. 105-108, 2003
Rapid Biomass Analysis 15
stovint3.eqa calibrat
l
&J
'"
~ o Ash
"0
01)
U " Protein
1J
~ o Lignin
Ul
;:[
"- DGlucan
'"
:!
lIXylan
o 10 20 30 40 50 60 70
Wet cherristry values (%)
~ 60 _ Xlyan
2: _ Ash
'j'" _ Lignin
D GIu:;an
40
2 3 4 5 6
sample
References
1. Milne, T. A., Chum, H. L., Agblevor, F., and Johnson, D. K., (1992), Biomass Bioenergy
2 (1-6), 341-366
2. DiFoggio, R. (1995), Appl. Spectrosc. 49(1), 67-75.
3. Grohmann, K., Torget, R., and Himmel, M. (1989), FY1988 Annual Report, Document
ID 1191, BIC no. B00463, Solar Energy Research Institute, Golden, CO, pp. Bl3-B32
CHANDRASHEKHAR P. JOSHt
Plant Biotechnology Research Center,
School of Forestry and Wood Products,
Michigan Technological University, 1400 Townsend Drive,
Houghton, M149931, E-mail: cpjoshi@mtu.edu
Abstract
Genetic improvement of cellulose biosynthesis in woody trees is one of the
major goals of tree biotechnology research. Yet, progress in this field has been
slow owing to (1) unavailability of key genes from tree genomes, (2) the inability
to isolate active and intact cellulose synthase complexes and, (3) the limited
understanding of the mechanistic processes involved in the wood cellulose
development. Here I report on the recent advances in molecular genetics of
cellulose synthases (CesA) from aspen trees. Two different types of cellulose
synthases appear to be involved in cellulose deposition in primary and second-
ary walls in aspen xylem. The three distinct secondary CesAs from aspen-
PtrCesA1, PtrCesA2, and PtrCesA3-appear to be aspenhomologs of Arabidopsis
secondary CesAs AtCesA8, AtCesA7, and AtCesA4, respectively, based on their
high identity I similarity (>80%). These aspen CesA proteins share the trans-
membrane domain (TMD) structure that is typical of all known "true" CesA
proteins: two TMDs toward the N-terminal and six TMDs toward the C-termi-
nal. The putative catalytic domain is present between TMDs 2 and 3. All signa-
ture motifs of processive glycosyltransferases are also present in this catalytic
domain. In a phylogenetic tree based on various predicted CesA proteins from
Arabidopsis and aspen, aspen CesAs fall into families similar to those seen with
Arabidopsis CesAs, suggesting their functional similarity. The coordinate
expression of three aspen secondary CesAs in xylem and phloem fibers, along
with their simultaneous tension stress-responsive upregulation, suggests that
these three CesAs may playa pivotal role in biosynthesis of better-quality cel-
lulose in secondary cell walls of plants. These results are likely to have a direct
impact on genetic manipulation of trees in the future.
D D D QVLRW
Acknowledgments
I wish to thank Dr. Vincent Chiang and Dr. Glenn Mroz for their con-
stant support and encouragement for my laboratory's work in cellulose
biosynthesis. I am specifically grateful to Dr. Luguang Wu for his initial
contribution to aspen CesA gene cloning. I also wish to thank Dr. Priit
Pechter, Dr. Xiaoe Liang; and my graduate students Rajesh Chavli, Anita
Samuga, and Udaya Kalluri for their assistance in preparing the manu-
script and sharing their unpublished data. This work was partially sup-
References
1. Delmer, D. P. (1999), Annu. Rev. Plant Physiol. Plant Mol. BioI. 50,245-276.
2. Brown, R. M., Jr., Saxena, I.M. and Kudlicka, K (1996), Trends Plant Sci. 1, 149-156.
3. Delmer, D. P. and Amor, Y. (1995), Plant Cell 7, 987-1000
4. Haigler, C. (1985), in Cellulose Chemistry and Applications, Nevell, T. P. and Zoronian,
S. H., eds., Ellis Horwood, Chichester, UK, pp. 30-83.
5. Timell, T. E. (1986), Compression Wood in Gymnosperms. Springer-Verlag, Berlin,
Germany.
6. Kimura, S., Laosinchai, W., Hoh, T., Cui, X., Linder c.R., and Brown, R.M. (1999),
Plant Cell 11, 2075-2085.
7. Haigler, C. and Blanton, R. L. (1996), Proc. Natl. Acad. Sci. USA 93, 12,082-12,085.
B. Saxena, I. M., Lin, F. c., Brown, R. M. (1990), Plant Mol. BioI. 15,673--683.
9. Saxena, I. M., Brown, R. M., Fevre, M., Geremia, R. A, and Henrissat, B. (1995), J.
Bacteriol. 177,1419-1424.
10. Pear, J. R., Kawagoe, Y., Schreckengost, W. E., Delmer, D. P., and Stalker, D. M. (1996)
Proc. Natl. Acad. Sci. USA 93, 12,637-12,642.
11. Richmond, T. A (2000), Genome BioI. 1(4), Rev. 3001.1-3001.6.
12. Taylor, N. G., Scheible W.-R., Cutler, S., Somerville, C. R., and Turner, S. R. (1999),
Plant Cell 11, 769-779.
13. Holland, N., Holland, D., Helen~aris, T., Dhugga, K, Xoconostle-Cazares, B., and
Delmer, D. P. (2000), Plant Physiol. 123, 1313-1323.
14. Taylor, N. G., Laurie, S., and Turner, S. R. (2000), Plant Cell 12,2529-2540.
15. Joshi, C. P. (2003), in Molecular Genetics and Biotechnology ofForest Trees, Kumar, S. and
Fladung, M., eds., Howarth, Howarth, NY.
16. Dadswell, H. E. and Wardrop, AB. (1955), Holzforschung 9, 97-103.
17. Norberg, P. H. and Meier, H. (1966), Holzforschung 20, 174-178.
lB. Timell, T. E. (1969), Svensk Papperstidning 72,173-181.
19. Wu, L., Joshi, C. P., and Chiang, V. L. (2000), Plant J22, 495-502.
20. Kawagoe, Y. and Delmer, D. P. (1997) in Genetic Engineering, vol. 19, Setlow,J. K, ed.,
Plenum, New York, NY, pp 63-87.
21. Fagard, M., Desnos, T., Desprez, T., Goubet, F., Refregier, G., Mouille, G., McCann,
M., Rayon, c., Vernhettes, S., and Hofte, H. (2000), Plant Cell 12, 2409-2424.
22. Arioli, T., Peng, L., Betzner, A S., Burn, J., Wittke, W., Herth, W., et al. (1998), Science
279, 717-720.
Abstract
Typical pretreatment requires high-energy (stearn and electricity) and
corrosion-resistant, high-pressure reactors. A review of the literature sug-
gests that fungal pretreatment could potentially lower the severity require-
ments of acid, temperature and time. These reductions in severity are also
expected to result in less biomass degradation and consequently lower
inhibitor concentrations compared to conventional thermochemical pre-
treatment. Furthermore, potential advantages of fungal pretreatment
of agricultural residues, such as corn stover, are suggested by its effective-
ness in improving the cellulose digestibility of many types of forage fiber
and agricultural wastes. Our preliminary tests show a three- to five-fold
improvement in enzymatic cellulose digestibility of corn stover after pre-
treatment with Cyathus stercoreus; and a ten- to IOO-fold reduction in shear
force needed to obtain the same shear rate of 3.2 to 7 rev / s, respectively,
after pretreatment with Phanerochaete chrysosporium.
Index Entries: Microbial pretreatment; fungal pretreatment; corn stover;
enzymatic hydrolysis.
Introduction
In many enzyme-based biomass conversion processes to ethanol or
other chemicals, a thermochemical pretreatment step is required to disrupt
the lignocellulosic structure of biomass, and partially solubilize polysaccha-
rides (1,2). Pretreatment improves the susceptibility of holocellulosic
polysaccharides to enzymatic hydrolysis. Thermochemical pretreatment
has been identified as a unit operation that is the second highest (after feed-
stock) cost component in enzyme-based conversion of com stover to ethanol
(3). The cost centers are steam, chemicals, and expensive corrosion-resistant
well as by electrical refining energy consumed. The inoculum for the coarse
pulp was the mycelium of potato dextrose broth-grown fungi fragmented
in water for 30 s in a sterile Waring blender, or the whole broth culture. It
was found that whole broth, or adding additional glucose to the blended
mycelium inoculum, provided no added benefit. The moisture content rec-
ommended for each pulp is 75% beech, 89% spruce, and 86% pine.
Sawada et al. (9-11) investigated the effects of fungal pretreatment
and steam explosion pretreatment on enzymatic saccharification of beech
wood meal. Their work indicates that fungal pretreatment followed by less
severe steaming maximizes enzymatic saccharification. The investigators
suggested that the lignin network covering the holocellulose (cellulose and
hemicellulose) is broken down by successive fungal pretreatment and
steam explosion pretreatments, which together maximize subsequent
enzymatic saccharification of beech wood meal. P. chrysosporium (ATCC
34541) was incubated without agitation at 37°C with 5.0 g of meal (unspeci-
fied dryness), 15 mL of Kirk's broth (2.0 g of glucose, 0.02 g of ammonium
tartrate, 0.02 g of yeast extract, 5.0 mL of 0.4 M phthalate buffer pH 4.5,
Applied Biochemistry and Biotechnology Vol. 705-708,2003
Microbial Pretreatment of Biomass 29
1.0 mL of Kirk's salt solution, and 100 mL water) in 300-mL Erlenmeyer
flasks. The type of closure on the flasks was unspecified. One gram of
fungal pretreated biomass was then subjected to steam explosion at 170-
230°C for 0-30 min.
The maximum saccharification of beech wood meal (9.5%) occurred at
28 d of fungal pretreatment and became less thereafter, possibly, Sawada
et al. (9-11) explained, because degraded lignin combined with or coated
the remaining holocellulose. Fungal pretreatment combined with steam
explosion improved saccharification, compared to steam explosion alone
by 20-100 % of the polysaccharide in the wood. However, 17 % of the
holocellulose degraded during fungal pretreatment, and there was an
unspecified holocellulose loss during steam explosion at optimum 215°C
for 6.5 min.
did not wet the fungus and was reblended. The mixture was vortexed to
mix well, and 1.5 mL was serologically pipeted into cryovials, and frozen
at -70 DC. Freeze preservation was evaluated; all cultures survived freez-
ing and thawing, and grew well when plated on PDA. The cork borers
were kept from corroding by washing and draining them quickly and
rapidly drying in a lOODC oven. Sterilize fast at 121 DC and dry.
Preparation of Stover
Coarsely milled corn stover was washed to remove dirt, drained, and
air-dried to about 30% moisture. It was then well mixed (coned and quar-
tered), portioned, and frozen. To obtain homogeneous material, approx
2 kg of frozen, coarsely milled corn stover was mixed with crushed dry ice
(using 1 part crushed dry ice to 1 part biomass); the mixture was then milled
in a laboratory Wiley mill through a 2-mm mesh. The milled stover was
stored unsealed in plastic bags in a freezer. When all the dry ice had sub-
limed (when it was observed that the bag was not expanding), the bags
were sealed and kept frozen until needed.
Preparation and Inoculation of Corn Stover Biomass
Mycelial cultures were grown on PDA agar. Approximately 1 in. 2 of
a fresh agar culture was minced and suspended in 5 mL media at pH 6 (see
Table 1, ref. 15) and then homogenized using a sterile glass rod until
uniformly dispersed in the buffer. Large quantities were prepared in a
small, sterilized Waring blender. Mycelial culture homogenates were
used promptly. Spore suspensions could be kept for up to 1 wk in a refrig-
erator (4 C).
D
Cl
-~
$0
N
Cl
8
Microbial Pretreatment of Biomass 35
determined by plotting a graph of laminar flow rates of the fluid vs force
on the fluid. This can be done for the Stormer viscometer by plotting revo-
lutions per second vs weight applied, for at least four weights. For a true
viscous substance, the plot is a straight line through the origin. Other
graphic forms represent various types of "plastics." If a straight line is not
produced, viscosities need to be determined at more than one force
(weight). Known amounts of distilled deionized water may be added to
low-moisture biomass, in both samples and controls, to reduce the TS to the
range for measurement of viscosity with the Stormer.
Bostwick Consistometer
The Consistometer (CSC Scientific, Fairfax, VA) is used to determine
the consistency of viscous materials such as jellies and sauces by measuring
the distance that the material flows under its own weight in a given time
intervaL This may not work for a slurry if the solids dewater. It can be
calibrated against known standards.
These protein values are expected from the literature since Phanero-
chaete is known to be a prolific enzyme producer. Cyathus produced no net
protein relative to the control. The lowest moisture level they dropped to
before water was added back during the 29 d was about 77%. The fungi
appeared to be present when viewed under the microscope. No bacterial
contamination was observed in any of the flasks.
The flask weight loss discussed earlier contains CO2 loss from fungal
activity on corn stover. As shown in Table 2, the 29-d incubation with
Cyathus caused an 8.3% dry-wt loss, and Phanerochaete caused a weight loss
of almost 20%. However, the stover controls lost an average of 5.6%. This
is an expected weight loss owing to water-soluble extractives dissolved out
of the stover during the 29-d incubation. Compared to the controls, the net
weight loss owing to the Cyathus was only 2.7%, and about 14.5% for
Phanerochaete. Shorter incubation time and selection of the appropriate
fungal species should reduce the dry weight loss. Furthermore, one would
also want to know what component(s) make up the weight loss since loss
of carbohydrates results in lower ethanol yield and lignin loss could mean
less boiler fuel.
However, the problem here, which will need to be solved before accu-
rate work can be done in the future, is that we are not able to detect moisture
loss simply by weighing the flasks, unless we know the DM loss, and fungal
cell mass gain. Studies in the literature solved this problem by controlling
the humidity so that there is no significant moisture loss. We could estimate
the DM loss from CO2 emission. That is possible, but difficult to do in small
shake flasks while they are being aerated. One could use a mass spec if one
obtained a uniform and high enough air flow rate. Or, one could attempt
to trap the CO2, The DM loss could at best only be estimated unless one
knows the solubilization rate of each: hemicellulose, cellulose and lignin,
and cell mass gain.
At small scale, studies in the literature use an environmentally con-
trolled incubator, or they make them by enclosing the flasks in a closed
chamber, or even plastic bags, while sparging the flasks by pumping water-
saturated air through tubing to each flask. At large scale, the biomass is
stacked in piles over tarpaulin-lined depressions. Drainage is pumped out
and sprayed over the piles, at frequent intervals, occasionally adding
makeup water, or the piles are covered with tarpaulins.
100 I!!'!"I
60 --
40 -
20 ~
~
\"
~
o
o 100 200 300 400 500 600 700
Force (g)
Fig. 1. Viscosity measurements of 10% (w /w) corn stover slurry using Thomas-
Stormer viscometer.
10.-------------------------------------~
9 +-----------.
8+-------------------------------~~--------_4
7 ---------------------~~-------------I
6
5
4
3
~ Untreated Control
2
No flow _ _ Phanerochaete
1 +--------;:-,-,,-1----
~ pretrea
ted
O+---~--~~~~--~===r==~==~
o 100 200 300 400 500 600 700
Shear Stress (g)
Biomass
Feedstock
Fungal
Inoculum Air
Lignin Residues
Water
Leachate
Conclusion
Based on the preliminary results, there is not a clear correlation
between digestibility improvement and viscosity reduction. However,
we believe that these impressive fungal pretreatment improvements
should translate into significant reduction in size-reduction (e.g., milling)
energy requirements or the severity of steam pretreatment needed to
solubilize corn stover polysaccharides. Recommendations for further
work include fine tuning the fungal pretreatment conditions and time
needed to result in significant reduction in viscosity and improvement
in cellulase digestibility at small scale, with minimal carbohydrate loss;
scaling up of the fungal pretreatment to 5-gal pails or 55-gal drum to
generate sufficient material for evaluation of the impact on thermochemi-
cal pretreatment severities required to achieve high hemicellulose solu-
bilization and cellulose digestibility; optimizing a symbiotic fungal
pretreatment using two or more fungi; and since the key requirement for
the small-scale work is a controlled, constant-humidity incubator, main-
taining constant humidity while providing mixing, controlled tempera-
ture, and airflow for the aerobic fungi.
References
1. Hsu, T. A, (1996), in Handbook on Bioethanol-Production and Utilization, Wyman, C.
E., ed., Taylor & Francis, Washington, DC, pp. 179-212.
2. Zerbe, J.I. And Baker, A J. (1987), in Energy from Biomass and Waste X, Klass, D. L., ed.,
Elsevier, London, UK, pp. 927-947.
3. (2002), NREL Enzyme Sugar-Ethanol Platform Project, National Renewable
Energy Laboratory, Golden, CO; (Website: http://www.ott.doe.gov /biofuels/
esp _background.html.)
4. Eriksson, K E. and Vallander, L. (1982), Svensk Papperstidning 6, R33-R38.
5. Messner, K and Srebotnik, E. (1994), FEMS Microbiol. Rev. 13,351-364.
6. Akhtar, M., Attridge, M. c., Blanchette, R. A, Meyers, G. c., Wall, M. B., Sykes, M.
S., et al. (1992), Proceedings ofthe 5th International Conference on Biotechnology in the Pulp
and Paper Industry, Kuwahara, M. and Shimada, M., eds., Uni Publishers, Tokyo,
Japan, pp. 3-8.
7. Akhtar, M., Attridge, M. c., Meyers, G. c., Kirk, T. K, and Blanchette, R. A (1992),
TAPPI J. 75(2),105-108.
B. Kashino, Y., Nishida, T., Yoshimasa, Y., Fujita, K, Kondo, R., and Sakai, K (1993),
TAPPI J. 76(12), 167-17l.
9. Sawada, T., Nakamura, Y., Kobayashi, F., Kuwahara, M., and Watanabe, T. (1995),
Biotechnol. Bioeng. 48(2), 719-724.
10. Sawada, T., Kuwahara, M., Nakamura, Y., and Suda, H. (1987), Int. Chern. Eng. 27,
686-693.
Abstract
In this paper, we describe ongoing efforts to solve challenges to using
straw for bioenergy and bioproducts. Among these, silica in straw forms a
low-melting eutectic with potassium, causing slag deposits, and chlorides
cause corrosion beneath the deposits. Straw consists principally of stems,
leaves, sheaths, nodes, awns, and chaff. Leaves and sheaths are higher in
silica, while chaff, leaves, and nodes are the primary sources of fines. Our
approach to reducing silica is to selectively harvest the straw stems using an
in-field physical separation, leaving the remaining components in the field
to build soil organic matter and contribute soil nutrients.
Introduction
Agricultural crop residues are a valuable renewable resource from
which to produce biobased products. In 1999, American farmers harvested
53,909,000 acres of wheat (1). The straw from this acreage of wheat repre-
sents greater than 100 million t annually. Currently, some of the straw is
harvested (baled) for use as livestock bedding or low-grade animal feed.
However, these low-grade uses provide only a minimal return. Nationally
only about 3.2% of the economic return on wheat is from straw (1). Produc-
ers, including the National Association of Wheat Growers and the Idaho
Wheat Commission, have long recognized the potential economic and
environmental benefits of producing bioenergy and bioproducts from
excess wheat straw.
*Author to whom all correspondence and reprint requests should be addressed.
Internodal
Fig. 1. Simplified anatomic structure of a wheat plant ready for harvest, which
needs to be fractionated into the grain (food), stem (bioenergy), and remaining residue
(returned to field).
the double-sided tape and on the disks and counted under the same con-
ditions as the straw ash. Calibration curves were prepared and used to
adjust the values from the internal quantitative program on the EDS sys-
tem for matrix effects. Wet methods and wavelength-dispersive spec-
trometry were used to verify the results.
Partitioning of Wheat Straw Biomass
Using Plot-Harvesting Equipment
The first phase of research on the mechanical separation was con-
ducted to determine whether the higher-value wheat straw components
(the stems) could be mechanically separated from the rest of the material
using preexisting plot-harvesting equipment. Several small bales of wheat
straw were threshed and separated at the University of Idaho experiment
station in Aberdeen, using their small plot-harvesting equipment. The
equipment used for the tests is shown in Fig. 2 and included a stationary
tined-cylinder thresher (on the left in the foreground) and a small plot
combine harvester (on the right in the background). Each machine was
initially tested separately, while adjusting airflow and cylinder speeds to
separate the straw stems from the remaining fractions. In addition to sepa-
rate testing, the machines were also tested in sequence to determine the
more effective equipment configuration for separating the stem fraction
from the rest of the straw.
Applied Biochemistry and Biotechnology Vol. 105-108, 2003
Selective Harvest of Straw Stems 47
Table 1
Compositions of Whole Straw
of Several Wheat Varieties Utilized in this Study
Westbred 936 Boundary Stephens
Component (wt %) (wt %) (wt %)
Gluean 40.6 40.4 39.3
Xylan 25.2 25.8 25.1
Galactan 0.4 0.4 0.4
Mannan 2.5 3.2 2.7
Arabinan ND' ND' ND'
Lignina 14.5 18.1 17.8
Ash 9.0 4.1 5.4
% Reeoveryb 92.2 92.0 90.7
aLignin with extractives.
bDifference from 100% owing to unknown uronic acid content and to
recovery errors in the procedure.
eND, none detected.
Table 2
Compositions of the Straw Ash
from the Several Wheat Varieties Used in this Study
Westbred 936 Boundary Stephens
Component (wt %) (wt %) (wt %)
Total Ash 9.0 4.1 5.4
~
Fines Nodes Sheath Heads Stems Baled
Straw
c
o
U
~
.t:.
U
as
CII
.E
aI
~
en
~O%~~--~~~~_ _~. . . .
Fines Nodes Sheath Heads Stems Baled
Straw
Fig. 5. Cylinder and concave tines of the tined-cylinder thresher, visible through the
open cover.
Fig. 6. Nodes separated from the stems using the tined-cylinder thresher.
Neither the stationary tined-cylinder thresher nor the small plot com-
bine harvester machine alone adequately separated the stems from the
other material. Using the plot harvesting equipment, the most effective
method for separation of the bulk of the stem fraction from the nodes
(without optimization for stem yield) was to first pass the straw through
the tined-cylinder thresher. The aggressive threshing action of the tines
(see Fig. 5) broke the stems near the nodes, and the more dense nodes
exited through the airflow separation and out the grain discharge. Sepa-
rated nodes are shown in Fig. 6. Each fragment in Fig. 6 also contained a
residual stem segment on either side as a result of the stem breaking at a
small distance from the node. Although this reduced stem yield, the
purpose of these tests was to test in-field methods for separating the
Applied Biochemistry and Biotechnology Vol. 705-70B, 2003
50 Hess et al.
c:
o
~
r.
Ii!QI 1
c:
~ 1
in
i O.O'lb" ' - -
Baled Straw Separated Stems
Fig. 7. Silica reduction achieved for Westbred 936 using the plot-harvesting equipment.
Conclusions
Mechanical separations of wheat straw stems using plot-harvesting
equipment were as good as perfect fractionation of stems by hand. These
results indicate that existing harvesting equipment can be modified to do
this fractionation if proper adjustments are made to the equipment set-
tings. Mechanical separation of the stems reduced the ash content of the
harvested fraction by 21 % and the silica content by 44%.
Acknowledgments
We thank the University of Idaho Aberdeen Research and Extension
Center for assistance with the in-field fractionation. Dr. Judi Steciak (Uni-
versity of Idaho) played a large role in obtaining support and will be
involved in future tasks on this project. This project is administered by the
Idaho Department of Water Resources Energy Division. This work is sup-
ported in part by the US Department of Energy, Assistant Secretary for
Energy Efficiency and Renewable Energy (EE) under DOE Idaho Opera-
tions Office Contract DE-AC07-99ID13727. Additional support for this
work, both in kind and financial, is provided by the Idaho Wheat Com-
mission, Grant 4-D Farms, and Energy Products of Idaho, Inc.
References
1. USDA NASS (2001), US Department of Agriculture, National Agricultural Statistics
Service; (Website: http://www.usda.gov /nass/).
2. National Research Council (NRC) (1999), Biobased Industrial Products: Priorities for
Research and Commercialization, National Academy Press, Washington, DC.
3. Saeman, J. F., Bubl, J. L., and Harris, E. E. (1945), Ind. Eng. Chern. 17,35-37.
4. Thompson, D. N., Chen, H. -c., and Grethlein, H. E. (1992), Bioresour. Technol. 39,
155-163.
5. Shodson, M. J. and Sangster, A. G. (1989), Can. J. Bot. 67,281-287.
Abstract
Literature data were collected and analyzed to guide selection of conditions
for pretreatment by dilute acid and water-only hemicellulose hydrolysis, and
the severity parameter was used to relate performance of different studies on
a consistent basis and define attractive operating conditions. Experiments were
then run to confirm performance with com stover. Although substantially
better hemicellulose sugar yields are observed when acid is added, costs would
be reduced and processing operations simplified if less acid could be used
while maintaining good yields, and understanding the relationship between
operating conditions and yields would be invaluable to realizing this goal.
However, existing models seldom include the oligomeric intermediates preva-
lent at lower acid levels, and the few studies that include such species do not
account for the distribution of chain lengths during reaction. Therefore, the
polymeric nature of hemicellulose was integrated into a kinetic model often
used to describe the decomposition of synthetic polymers with the assumption
that hemicellulose linkages are randomly broken during hydrolysis. Predic-
tions of monomer yields were generally consistent with our pretreatment data,
data reported in the literature, and predictions of other models, but the model
tended to overpredict oligomer yields. These differences need to be resolved
by gathering additional data and improving the model.
Index Entries: Hemicellulose; hydrolysis; kinetic model; dilute acid;
depolymerization.
Introduction
Ethanol made from cellulosic biomass has the potential to displace a
significant fraction of petroleum in the United States, reducing the depen-
dence on foreign imports and improving the environment. Biologic process-
*Author to whom all correspondence and reprint requests should be addressed.
for 2, 6,and 18 min. Four tests were performed at 190°C, one each at 7,14,
22, and 74 min. Two tests were performed at 170°C, one each at 27 and 87
min. One test was performed at 150°C for 107 min.
When a run was completed, the discharge valve on the bottom of the
steam gun was opened, and the contents were blown into a 300-L flash
vessel to rapidly bring the temperature to below 100°C and quench the
reaction. Next, the contents were removed, placed in double plastic bags
for storage at 4°C, and shipped in a cooler to Dartmouth College for analy-
sis. After arriving at Dartmouth, the pretreated biomass was pressed to
obtain about 100 mL of liquid hydrolysate, the remaining material
was slurried with tap water in a 19-L poly bucket, the supernatant was
decanted, and fresh water was added. This procedure was repeated until
the pH of the supernatant reached 6.0. Then the solids were filtered and
weighed, and their moisture content was determined before rebagging
and refrigerating them.
Tube Reactor Batch Tests
Batch tube reactors were assembled from 12.5-mm OD Hastelloy (C276)
tubing with a 0.8255-mm wall thickness cut into 10-cm lengths. About 6 g
of the acid-soaked corn stover described earlier was loaded into each reactor
tube using a small spatula and a specially designed plastic funnel and tamped
lightly with a glass rod. The tubes were capped with inexpensive 304 stain-
less steel end caps protected from the acid by inserting machined Teflon
plugs into the tube ends based on the kind suggestion of Professor Y. Y. Lee
of Auburn University. The tubes were immersed in a 22.8 cm id x 35 cm deep
4-kW model SBL-2D fluidized sand bath (Techne, Princeton, NJ) controlled
at the target temperature, held for a specified amount of time, removed from
the sand bath, and immediately immersed into a room temperature water
bath to quench the reaction. Reaction time was determined as the moment of
immersion into the heated sand bath until the moment of quenching. After
cooling, the contents of the tubes were removed and filtered with 100 mL of
deionized water through a medium-porosity fritted glass filter crucible, and
the solids were dried in a vacuum oven at 45°C.
Runs were made at the following temperatures and times: 180°C for
1,2,5,10,20, and 40 min; 160°C for 5,10,20,40, and 80 min; and 140°C for
5, 10,20,40,80, and 120 min. Temperature transients to be expected using
batch tubes during heat-up were analyzed using the method developed by
Stuhler and Wyman (18). This showed that at 160°C it could be expected
that the center-line temperature of a O.5-in. ID tube would be 153°C (.95!1
T + To) after approx 90 s. This simulation suggests that the longer run times
at lower temperatures would not be affected significantly although tran-
sient effects could be greater at 180°C.
Analyses
Dried solids and filtered hydrolysates were analyzed for their mono-
meric sugar content according to NREL LAP-002 (19) and LAP-013 (20)
/' - -
Monomers ko Oligomers kd Degradation
/,ks
Hemicellulose (slow)
Depolymerization Model
Most kinetic models for hemicellulose hydrolysis do not consider
the presence of oligomers in the reaction sequence at all, and the few that
include such species lump them into one or two compounds that ignore
the range of chain lengths expected as hemicellulose decomposes from
larger chains to smaller ones. However, kinetic models have been devised
to describe the distribution of chain lengths that occur in the decomposi-
tion of plastics (27) and size reduction operations in the grinding of min-
eral ores (28) based on both continuous (29,30) and discrete (31-33)
product distributions. Furthermore, Agarwal et al. (34) applied discrete
depolymerization kinetics to predict hemicellulose and cellulose degra-
dation in alkaline pulping. The discrete depolymerization approach of
Simha (32) was applied here to capture the range of chain lengths that are
expected during pretreatment by hemicellulose hydrolysis.
Consider the breaking of one bond of a polymer composed of n mono-
mer units to form two new molecules:
N n -Nj+Nn _ j (6)
Subsequently, these products can degrade further as follows:
N n _ j - Nk + N n _ j_k (7)
Nj-Nj+N j_i (8)
If we assume that all the bonds linking monomer units have the same
probability of being broken, then the rate of change in concentration of any
j-mer can be expressed by the following differential equation:
dN. n
-dJ =2k h ~ N j -k h (j-1)N j (9)
t j=j+l
Integrating Eq. 10 based on the initial condition that at time t =0, N n=Nno,
we obtain the following result:
Nn=N~exp(-kh[n-1]t) (11)
To solve for the concentration of the (n-1)-mer, Eq. 11 is substituted into
Eq. 9 to give
dN _
n1 0
--cit = 2kh N n exp (- kh [n -1] t) - kh (n - 2)N n_1 (12)
80
...CII 5-mer
E 60
0
c:
0
:l!
1/1
1\1 40
-;l!.
0
..--~ ......
, .....
20 ..... , 2-mer
f ~: . . . . ".,3-mer " ..................
J~ -mer '.'-. . ..... - - -
o ~------",~~:~'~-~-~~~~~"~-~-~-~~~~-----~-T--------~-~-F-~-~--~~
Fig. 1. Distribution curves for depolymerization of a hypothetica15-mer containing
5 monomer units assuming random scission and arbitrary rate constant.
(5
a.. D
40
E 0
:J
E t.
.~ <>
~ 20 • 0
00
0~ 01:;.0
0
• 0-
I:;. 0
0
Log Ro
100
• Garrote et al. Total
D Garrote Ollgomers
• Rubio et al. Total
80 . This Work Total
CD
I/)
c + This Work Oligomer
x>-
iii
..;::::;
60 • •
•
D
s::::
0-·
$
c
a.. •
E
40
• +
+ •
•
:::J
D 4'
E
.
.~
~
•
0
~ 20
•
:.!!
0 ~ D
D
•
0
2.5 3 3.5 4 4.5 5 5.5
Log Ro
about 90% and occurred at a log modified severity parameter of about 3.8.
However, xylooligomers represented a much lower fraction of the total
solubilized sugars than for the water-only case, with only about 20% of the
total being oligomers at the optimum yield point.
••
Q)
II) & Tucker et at Total
0
>. 80 • Tucker et al. Oligom
><
~ • - This Work Total
x This Work Oli omer
E 80 • • & _
.to
Q)
0
a.. •
•
E
::s 40
E
·x 0
as
~
20 0 0
~
0 x x
..
0
II
II X X
0 II X
0 II II
Log Mo
Next, model curves based on Eqs. 11,14, and 17 were fitto our steam
gun data in Fig. 5 and to literature data as shown in Fig. 6 for Garrote
et al.' s (5) data for water-only hydrolysis of corncobs. The kinetic constant
for monomer degradation was calculated from the Arrhenius expression
reported by Converse et al. (35). Then, the hydrolysis constant was deter-
mined to minimize the sum of the squares of the differences between
monomer data and model predictions. Use of the monomer for predicting
xylan partitioning is somewhat arbitrary but was chosen because it could
be fit well with an arbitrary hydrolysis rate constant. In addition, oligo-
mers with nine or more monomer units were arbitrarily assumed to
remain in the residual solids, and those of length 2 through 8 as well
as monomers were assumed to be all in the liquid phase. If the cutoff
between soluble and insoluble oligomers is decreased, the oligomer curve
moves closer to the data but never reaches it even at a cutoff degree of
polymerization (DP) of 2. A cutoff above DP-8 tends to increase the diver-
gence between data and model, but only slowly, as the contribution from
higher-chain oligomers diminishes rapidly with increasing DP.
As shown in Figs. 5 and 6, the data and predictions agree reasonably
well initially, but xylooligomers are overestimated and residual xylan
underestimated at later times. This divergence could be explained, at least
in part, by an accelerated decomposition of xylose, but only analysis could
confirm or deny this. Unfortunately, no analyses of degradation products
were available, and the decomposition kinetics of Converse et al. (35) were
used unmodified.
'J.
~ 60
iii
50
kh=.017 min-1
40 kcF.042 min- 1
E
::::I
E
'51! 30 •
i
~ 20
10 .---- .. -' .
0
. -- .. ~-
0 10 20 30 40 50 60 70 80 90 100
Time, min
.
\
.' ....,' . •
>< \
-, Model Residual Xylan
a;
:;::::
c 60 '
.. ..
CP , '
0 '. ,
Il. ,!" , • ".
E 40
::::I
E
';(
.
,
: '~ ,
\\"
C'II
"", ...,
::i 20
0~
! " '.
•
.•
0
0 50 100 150 200 250 300 350
Time, min
Fig. 6. Comparison of data and depolymerization model predictions for water-only
hydrolysis of corncobs.
Com Stover
140°C .. - . • • • • • • • • • • • • • • • • 0.
,,'
80
1% H2SO4 •
GI
III
~.
, •
0
>. .' '. •
>< ,
!
\
...
!i 60
\
•
•
S or nomer
,
..
0
• "
• '- . ""-. -__ 0._ . - .- .. - 0.- _._. __ .__ ..
0 5 10 15 20 25 30 35 40 45
Time, min
Conclusions
The highest yields of total solubilized corn stover xylose in our steam
gun, water-only hydrolysis was 53% at a log severity parameter near 4.0,
consistent with results reported in the literature. With H 2S04 addition, the
modified severity parameter was found to provide a useful means for com-
paring data from different studies, and the highest yield of solubilized hemi-
cellulose, using our batch tube apparatus, was measured to be 89% at a log
modified severity of 3.8, again consistent with literature values. Oligomeric
xylan comprised about 80% of the total soluble monomers and oligomers at
the maximum total yield point without acid present but contributed only
about 20% of the total sugars in solution when 1% H 2S04 was added.
II)
\
I 140°C •
I/)
0
80 I
I '" •
>-
><
I
I
--
I
:!
I
I •
60
c:: ,.
II;'" • Chen Monomers
II)
, • Chen Oligomers
0
11.
~
I
.'1
. • kh=0.08
kd=0.0022 .. Chen Residual Xylan
_ Model Monomers
E
•
40
:::J ! \1 ...... Model Oligomers
E . ___ Model Residual Xylan
.. ..
1
";C
cu
:E 20
\
\ .
'"
~
0 '"
0
0 10 20 30 40 50
Time, min
reflect their history during hydrolysis and are not affected by heat transfer
or other effects that could influence the profiles. It will also be valuable to
determine the range of oligomer sizes that are released into solution to
determine whether the definition of soluble and insoluble chain lengths we
arbitrarily assigned is reasonable.
Acknowledgments
We gratefully acknowledge support from the USDA Initiative for
Future Agricultural and Food Systems Program through contract no.
00-52104-9663. We also appreciate interactions with our partners in that
project: Y. Y. Lee from Auburn University; Bruce Dale from Michigan State
University; Rick Elander and Robert Torget from the NREL, Michael
Ladisch from Purdue University; and Mark Holtzapple from Texas A&M
University; and the students involved in this work. We are also indebted
to the NREL supported through the Department of Energy's Biofuels Pro-
gram for making its steam gun apparatus available for performing water-
only tests. In particular, we wish to thank Rick Elander for coordinating
the test work and Mel Tucker for performing these experiments. We also
received guidance from Quang Nguyen and Kyung Kim on using the
steam gun equipment and in analytical methods, respectively. Small batch
reactor experiments were performed at Thayer School of Engineering
using equipment purchased by Thayer School of Engineering.
References
1. Wyman, C. E. (1999), Annu. Rev. Energy Environ. 24, 189-226.
2. Wooley, R., Ruth, M., Glassner, D., and Sheehan, J. (1999), Biotechnol. Prog. 15,794-803.
3. Lynd, L. R., Elander, R. T., Wyman, C. E. (1996), Appl. Biochem. Biotechnol. 57/58,
741-76l.
4. Hsu, T. (1996), in Handbook on Bioethanol: Production and Utilization, Wyman, C.E., ed.,
Taylor & Francis, Washington, DC, pp. 183-187.
5. Garrote, G., Dominguez, H., and Parajo, J. C. (2001), Process Biochem. 36,571-578.
6. Rubio, M., Tortosa, J. F., Quesada, J., and Gomez, D. (1998), Biomass Bioenergy 15(6),
483-49l.
7. Carrion, J., Rubio, M., Gomez, D, Miiiana, A, and Soler, A, (1989), in Proceedings
of the 5th International Conference on Biomass for Industry, Grassi, G., Gosse, G., and
Dos Santos, G., eds., Lisbon, Portugal, Elsevier Applied Science, London, England,
UK, pp. 2.45-2.49.
8. Lamptey, J., Robinson, C. W., and Moo-Young, M., (1985), Biotechnol. Lett. 7(7),531-534.
9. Tortosa, J. F., Rubio, M., and Gomez, D. (1995), Afinidad LII457, 181-188.
10. Schultz, T. P., Templeton, M. c., Biermann, C. J., and McGinnis, G. D. (1984), J. Agric.
Food Chern. 32(5),1166-1172.
11. Esteghlaliart, A, Hashimoto, A G., Fenske, J. J., and Penner, M. H. (1997), Bioresour.
Tech. 59, 129-136.
12. Bhandari, N., MacDonald, D. G., and Bakhshi, N. N. (1984), Biotechnol. Bioeng. 26,
320-327.
13. Torget,R, Walter,P., Himmel,M., and Grohmann, K. (1991),Appl. Biochem. Biotechnol.
28/29, 75-86.
14. Lee, Y. Y., Chen, R, and Iyer, P. (1994), Annual Report for NREL Subcontract no.
XAW-3-13441-01, National Renewable Energy Labortory, Golden, co.
Abstract
Corn stover is a domestic feedstock that has potential to produce signifi-
cant quantities of fuel ethanol and other bioenergy and biobased products.
However, comprehensive yield and carbon mass balance information and
validated kinetic models for dilute-sulfuric acid (H 2S04 ) pretreatment of
corn stover have not been available. This has hindered the estimation of
process economics and also limited the ability to perform technoeconomic
modeling to guide research. To better characterize pretreatment and assess
its kinetics, we pretreated corn stover in a continuous 1 tf d reactor. Corn
stover was pretreated at 20% (w fw) solids concentration over a range of
conditions encompassing residence times 6f 3-12 min, temperatures of 165-
195°C, and H 2S04 concentrations of 0.5-1.4% (w /w). Xylanconversion yield
and carbon mass balance data were collected at each run condition. Perfor-
mance results were used to estimate kinetic model parameters assuming
biphasic hemicellulose hydrolysis and a hydrolysis mechanism incorpo-
rating formation of intermediate xylo-oligomers. In addition, some of the
pretreated solids were tested in a simultaneous saccharification and fer-
mentation (SSF) process to measure the reactivity of their cellulose compo-
nent to enzymatic digestion by cellulase enzymes. Monomeric xylose yields
of 69-71% and total xylose yields (monomers and oligomers) of 70-77%
were achieved with performance level depending on pretreatment sever-
ity. Cellulose conversion yields in SSF of 80-87% were obtained for some of
the most digestible pretreated solids.
Index Entries: Pretreatment; dilute-sulfuric acid; enzymatic conversion;
corn stover; xylan conversion; kinetics; pilot scale.
Pretreatment System
Dilute-H2S04 pretreatments were conducted in a continuous pilot-
scale reactor operating at a feed rate of approx 32 kg (dry basis)/h. The
process flow diagram of the pretreatment system is shown in Fig. 1 and
Schell et a1. (9) describe in more detail the pilot plant and the data acquisi-
tion and control system. Biomass is conveyed to the pretreatment system
from a feed hopper via a weigh belt and belt conveyor. The continuous
pretreatment system consists of acid supply tanks; a biomass mixer; a high-
temperature, high-pressure reactor system; and a flash tank. The pretreat-
ment reactor system is a vertical pulp digester supplied by Sunds
Defibrator, (now Metso Paper USA, Norcross, GA) and includes the reactor
and material feed (plug feeder) and discharge (reciprocating popet valves)
systems. The reactor is steam heated and can operate at temperatures of
150-200°C, and residence times of 3-20 min can be achieved by controlling
feedstock level in the reactor. A gamma-ray level sensor measures the level
of biomass in the pretreatment reactor. The acid delivery system consists of
Applied Biochemistry and Biotechnology Vol. 105-108, 2003
72 Schell et al.
Sulfuric Acid
Water - - - ,
Pump
VeDtStte~s +-~------~~+-~
Pretreated CorD
Stover Slurry
c "Averages and SDs for runs I, 2, 5, 6,9, and 11 all were targeted for the same run conditions.
bPretreatment reactor operated at zero level in a mode that achieves a short but unknown residence time estimated at 45-75 s.
-Y'~
c
- cCorn stover preimpregnated with acid before pretreatment; actual acid concentration in the pretreatment reactor was not controlled but
~
targeted to achieve an acid concentration equivalent to 1.2% (w /w).
c
'"
c....,
76 Schell et al.
tent (14). Protein content was calculated as 6.25 times the nitrogen content,
which was measured using a Perkin-Elmer Series 2400 CHNS/O Elemental
Analyzer (Norwalk, CT).
Concentrations of soluble components in the hydrolysate liquors
(monomeric and oligomeric sugars, acetic acid, 5-hydroxymethanol fur-
fural, and furfural) were measured using techniques previously reported
(9). Total xylose is defined as the sum of monomeric and oligomeric
xylose. Measurements of hydrolysate liquor pH were made the following
day with the liquor at ambient temperature (approx 25°C). The amount of
insoluble solids in the hydrolysate was measured using a technique (pro-
cedure A) reported by NREL (15).
Enzymatic Digestibility
Enzymatic digestibility or cellulose conversion was determined by
hydrolyzing the cellulose contained in washed pretreated solids using a
simultaneous saccharification and fermentation (SSF) process. The washed
solids were produced by the aforementioned procedure for measuring in-
soluble solids. SSF was conducted in a laboratory-shaking incubator (150
rpm) at a working volume of 100 mL in 250-mL baffled flasks with water
traps. The washed solids were loaded to a level of 6% (w Iw) cellulose (cel-
lulose measured as discussed above) and Iogen (Ottawa, Canada) cellulase
enzyme (lot no. BRC 191095) was added to a level of 15 filter paper units
(FPU)/g of cellulose. The medium consisted of yeast extract (1% [w/v]),
peptone (2% [w Iv]), and citrate buffer (0.05 M). The initial pH was adjusted
to 5.2 using NaOH, and then the culture was inoculated with the yeast, Sac-
charomyces cerevisiae DsA, to achieve an initial optical density (at 600 nm) of
0.5. The flask was maintained at 320C for 7 days and sampled daily. Ethanol
concentration was measured by high-performance liquid chromatography
using a Bio-rad (Richmond, CA) HPX-87H column operating at 65°C with a
0.01 N H 2S04 solution mobile phase and a refractive index detector. Ethanol
yield was calculated based on the theoretical ethanol concentration from
cellulose after subtracting the ethanol added from the inoculum. The theo-
retical ethanol yield number is assumed to be a conservative estimate of
cellulose conversion but is also a number that represents realistic conversion
results, since the SSF test is done at conditions roughly similar to those that
might be encountered in an actual process (i.e., 6% cellulose concentration,
32°C, and a low enzyme loading of 15 FPU I g of cellulose).
Xylan Conversion Yields and Mass Balance Calculations
Calculation of xylan conversion yields (i.e., monomeric xylose, oligo-
meric xylose, furfural, and unconverted xylan) and carbon mass balances
followed a previously reported methodology (16) and relies on accurate
measurements of flow rates and component concentrations in the inlet and
outlet streams. We measured flow rates for corn stover (weigh belt), acid,
and water to the pug mill mixer (Magnetic flowmeter and Coriolis mass
flowmeter, respectively), and the pretreatment-reactor vent stream
The kinetic rate parameters, ki' were modeled using Eq. I, which
applies the Arrhenius relationship and general acid-base catalysis:
ki=(k~ + k7[H+] + k~H[OH-]) exp( ~~i) (1)
Since all pretreatments were conducted at very low pH «2.25), the
hydroxyl ion term was ignored and rewriting the hydrogen concentrations
in terms of the pH gives
k i=(k~ + k7[ lO-pH)) exp( ~~i) (2)
Using pH is more appropriate than using the effective acid concentra-
tion (i.e., acid concentration after neutralization by ash), which could effec-
tively be zero if there is insufficient acid.
The model contains 13 parameters (4 each of kt, kr, Ei , and the fraction
of fast-reacting xylan) that must be determined. A genetic algorithm
(Evolver, an Excel add-in from Palisade, Newfield, NY) adjusted the 13
parameters to minimize an error term (E):
E = X + 0 + Xl (3)
in which X, 0, and Xl are the sum of the square of the errors between the
measured yield and the predicted yield for monomeric and oligomeric
xylose, and unconverted xylan, respectively. When the measured total
xylose concentration was less than the measured monomeric xylose con-
centration, probably owing to measurement error, the value for oligomeric
xylose yield was set to zero; this occurred in runs 9, 36, and 38.
Applied Biochemistry and Biotechnology Vol. 105-108, 2003
78 Schell et al.
Results
Table 1 summarizes run conditions and key results from each of the
41 runs. It presents the pretreatment run conditions (temperature, time,
and acid concentration), the final pH of the hydrolysate liquors, the com-
bined severity factor (CSF), cellulose conversion determined by SSF test-
ing, and xylan conversion results. The CSF is defined as (17,18)
r-1001) - pH
CSF = 10glO(t x exp r 14.75 (4)
70
o
o
60
o o o '"
o
--
~ 50
l!
CD o
'"
'"
'"
>= 40
!
~30
20
I ",Monomeric I
10 o Total
O+-----~----~----~----~----~----._----._--~
Fig. 2. Monomeric and total xylose yields of pretreated com stover as function of CSF.
Xylan Conversion
Figure 2 presents monomeric and total xylose yields as a function of
the CSF. The results show peaks in monomeric xylose yield at CSF ( 1.6-1. 7
and total xylose yield at CSF ( 1.4-1.5, with both yields reaching highs of 70
to 71%. At lower severities, total xylose yields were much greater than
monomeric xylose yields, but the two values were nearly equal above a CSF
of 1.6. In addition, above a CSF of 1.7, both monomeric and total xylose
yields declined, presumably because the harsher pretreatment conditions
at these higher severities degraded more of the xylose to furfural and other
degradation products.
The fractionation of xylan into monomeric and oligomeric xylose,
furfural, and unconverted xylan, as well as the overall xylan mass balance
is shown in bar chart form in Fig. 3, which plots run numbers in order of
increasing pretreatment severity. In addition to the trends just discussed,
Fig. 3 shows the predicted trend of increasing furfural and decreasing
xylan with increasing pretreatment severity. The top of the bar shows the
overall mass balance closure for xylan, which is usually in the range of 90-
100%, except at the higher pretreatment severities, where mass balance
begins to drop below 90%. We believe that other unmeasured degradation
products are being produced under these conditions that are not included
in the mass balance calculation.
Applied Biochemistry and Biotechnology Vol. 105-108,2003
80 Schell et al.
120
100
......
'ii
u 80 -
;:
f
-
0
CD
.c 60
e
~
'ij
:; 40
20
0
~~~~~~~~~~~N~~~~~~~-N~~~C~~~~~c~~~~gM~
Run.
Monomeric Xylose • Oligomeric Xylose .Xylan 0 Fur1ural I
Fig. 3. Yields of monomeric and oligomer xylose, furfural, and unconverted xylan
plotted by run number in order of increasing severity. The height of each bar repre-
sents the total xylan mass balance closure.
95
90
A
-
--
~ 85
c
0 A
A
A A
A
... 80
A
ii A A
~
6 75
0
:
0 70 A
:2 A
"i
0 65
60
55
1.0 1.1 1.2 1.3 1.4 1.5 1.6 1.7 1.8 1.9 2.0 2.1
Combined Severity Factor
80 ~------------------------------------------~
70
•
&
• • .. .
• ..
• Monomeric Xylose
• Oligomeric Xylose
.. Unconverted Xylan
10 20 30 40 50 60 70 80
experimental Yield <%)
Cellulose Conversion
Figure 4 shows cellulose conversion or enzymatic digestibility of the
pretreated solids plotted against the CSF. In general, there appears to be a
trend of increasing cellulose digestibility with increasing pretreatment
severity, particularly at CSFs <1.6. At CSFs >1.6, digestibilities >80% were
routinely obtained, and the highest value obtained was 87%. The typical
composition (dry basis) of well-pretreated corn stover was 55-60% cellu-
lose, 3-7% residual xylan, and 27-31 % lignin.
Pretreatment Kinetics
Kinetic parameters were estimated using data from runs 1-38 and are
shown in Table 2. The ability of the kinetic model to fit the xylan hydrolysis
data is presented in Fig. 5, which shows that the model predicts xylan
hydrolysis performance across the data set fairly well. The best fit esti-
mated value of the fast-reacting xylan fraction was 0.72, slightly higher
than previous estimates (7, 8).
Applied Biochemistry and Biotechnology Vol. 705-708, 2003
82 Schell et al.
90~------~----------------------------~--------~
85
--
<ft 80
:; 75
'i
>= 70
~ 65
~60
§ 55
~II 50
:::& 45
1+-------- Experimental data range
40
35+-------4--------r-------r-------.----~~------~
Fig. 6. Predicted maximum monomeric and total xylose yields as function of tem-
perature and pH when maximizing based on monomeric xylose yield.
The kinetic model was used to predict both maximum monomeric and
total xylose yields as a function of temperature and pH (at 1.0, 1.5, and 2.0)
by adjusting residence time (i.e., calculating the residence time that maxi-
mizes xylose yield at a fixed temperature and pH). The results using mono-
meric xylose yield as the criterion to maximize are shown in Fig. 6. The
vertical dotted lines at temperatures of 165 and 183°C show the range inves-
tigated in the experiments, thus demonstrating that the graph
includes some extrapolation beyond the range within which the model para-
meters were estimated. The graph highlights several interesting results.
First, maximum yields increase with increasing temperature and decreas-
ing pH. Second, maximum total xylose yields are always greater than
monomeric xylose yields, but the differences become small (0.5-2.0 percent-
age points) at low pH and high temperature. Third, the model predicts that
the time required to achieve maximum xylose yield is always shorter for
total xylose yield than for monomeric xylose yield (not shown).
Figure 7 presents the maximum monomeric and total xylose yields
when either maximum monomeric xylose or maximum total xylose is
used as the maximization criterion. The results are presented as a func-
tion of temperature at pHs of 1.0 and 2.0. For clarity, the lines of mono-
meric and total xylose yield when monomeric xylose is the maximization
criterion are not shown at pH 1.0, since these lines lie very close to (almost
on top of) the lines based on maximizing total xylose yield. Figure 7 high-
lights the following results: At pH 1.0, the maximum yields are similar
regardless of which criterion is used to maximize yield. At pH 2.0, maxi-
mizing on total xylose yield gives higher overall total xylose yields than
Applied Biochemistry and Biotechnology Vol. 105-108,2003
Dilute-H2S04 Pretreatment of Corn Stover 83
90~------~---------------------------r---------.
85
l80
'tI 75
! 70
R65
~60
§ 55
~1\ 50
:245
40 .--~------- Experimental data range
~~------~-------.--------'-------~--~~-r------~
160 165 170 175 180 185 190
Temperatura (Oe)
Maximizing monomeric xylose yield MaxImizing total xyiose yield
------- Totel xylose - - 0 Total xyiose
_ _ Monomeric xylose _ Monomeric xylose
Fig. 7. Predicted maximum monomeric and total xylose yields as function of tem-
perature and pH when maximizing based on either monomeric or total xylose yield.
Discussion
Our highest xylose yields obtained with corn stover (70-77%) are sig-
nificantly lower than the best results reported by Esteghlalian et a1. (7) and
Chen et a1. (8) (85-90%). However, our results were obtained at pilot scale
using significantly higher solids concentrations (20% compared with 10%).
Besides the obvious differences in dilute-acid pretreatment reactor systems
(small-scale batch agitated systems compared with a continuous unagitated
pilot-scale system), the higher solids concentration also produces higher
sugar concentrations in the hydrolysate that may be affecting yields
because the reaction rates (k3 and k4 ) depend on xylose concentration. We
believe one or both of these factors contribute to the differences observed
between our results and those previously reported.
Performance variability and scatter in the data are apparent from the
results presented in Figs. 2-5 and the previous discussion of reproducibil-
ity. Several factors possibly contribute to this variability, including uncer-
tainties in the residence time calibration, temperature nonuniformities
within the reactor, changes in feedstock acid-neutralizing capacity that
affect the final measured acid concentration, as well as normal measure-
Applied Biochemistry and Biotechnology Vol. 105-108, 2003
84 Schell et al.
ment and control errors associated with operating continuous pilot-scale
equipment. The high degree of scatter in the performance results reflects a
combination of these factors. Kinetic modeling was used to develop an
overall representation of performance trends.
The most important predictions from the kinetic modeling are that
low pHs are required to achieve the highest xylose yields and that yields
improve at higher temperatures (although shorter residence times are
required). Esteghlalian et a1. (7) reported similar kinetic behavior, although
other investigators have reported that temperature has little effect on maxi-
mum xylose yields (8,19). Differences in reactor systems, solids concentra-
tions, and accounting for acid neutralization, as well as measurement
uncertainties may explain some of the discrepancies. The highest total
xylose yield, 77% achieved in run 40, was obtained using a higher tempera-
ture (190°C). However, this was only a single run and additional work is
needed to confirm this finding. Although, it is outside the scope of this
article, we are also seeing significant corn stover compositional variabil-
ity, which may also be affecting both pretreatment and enzymatic hy-
drolysis kinetics (unpublished results).
Demonstrating effective pretreatment technology at pilot scale using
economically attractive conditions is required to move lignocellulosic con-
version technology toward commercialization. The work reported here, in
which performance data were obtained with component mass balance clo-
sures near 100%, represents an initial effort to generate accurate and reliable
pilot-scale performance data that can be used to more rigorously analyze
process economics than have been performed in the past (20). Future work
will examine the impact that compositional variability of corn stover has on
performance and will apply measurement uncertainty analysis (21) to assess
the accuracy of pretreatment yield and mass balance results.
Acknowledgments
We gratefully acknowledge the technical assistance of Bob Lyons
and Bryan Rohrback with pilot plant operation, Raymond Ruiz, David
Templeton, Amie Sluiter, and Bonnie Hames with chemical analysis of
process samples, and David Templeton with procurement of the corn
stover. The Biochemical Conversion Element of the Office of Fuels Devel-
opment of the US Department of Energy funded this work.
References
1. Lugar, R. and Woolsey, R. (1999), Foreign Affairs 78,88-102.
2. Lynd, L., Cushman, J., Nichols, R., and Wyman, C. (1991), Science 251,1318-1323.
3. Hsu, T. (1996), in Handbook on Bioethanol: Production and Utilization, Wyman, c., ed.,
Taylor & Francis, Washington, DC, pp. 179-212.
4. Chang, V. and Holtzapple, M. (2000), Appl. Biochem. Biotechnol. 84-86,5-37.
5. Knappert, D., Grethlein, H., and Converse, A. (1980), Biotechnol. Bioeng. 22,1449-1463.
6. Torget, R., Walter, P., Himmel,M., and Grohmann,K. (1991),Appl. Biochem. Biotechnol.
28/29, 75-86.
Abstract
Pretreatment has been recognized as a key step in enzyme-based conver-
sion processes of lignocellulose biomass to ethanol. The aim of this study is to
evaluate two hydrothermal pretreatments (steam explosion and liquid hot
water) to enhance ethanol production from poplar (Populus nigra) biomass by
a simultaneous saccharification and fermentation (SSF) process. The compo-
sition of liquid and solid fractions obtained after pretreatment, enzymatic
digestibility, and ethanol production of poplar biomass pretreated at differ-
ent experimental conditions was analyzed. The best results were obtained in
steam explosion pretreatment at 210°C and 4 min, taking into account cellu-
lose recovery above 95%, enzymatic hydrolysis yield of about 60%, SSF yield
of 60% of theoretical, and 41 % xylose recovery in the liquid fraction. Large
particles can be used for poplar biomass in both pretreatments, since no sig-
nificant effect of particle size on enzymatic hydrolysis and SSF was obtained.
Index Entries: Poplar; ethanol; pretreatment; steam explosion; liquid hot
water.
Introduction
Lignocellulose biomass represents a vast resource that could be trans-
formed into fuel ethanol and can be produced from crops specifically
grown to yield biomass for energy purposes. Among the fast growing
species cultivated in short cycles for biomass production, Populus nigra,
used in the present work as feedstock, is considered a promising energy
crop for central and south Europe owing to its high yield and drought-
resistant features (1).
*Author to whom all correspondence and reprint requests should be addressed.
Analytical Methods
The carbohydrate content of the liquid fraction after both pretreat-
ments was determined by performing a mild acid hydrolysis (3%[v Iv]
H 2S04,120°C, and 30 min) and measuring xylose, arabinose, galactose
and mannose concentration by high-performance liquid chromatogra-
phy (HPLC) in a 1081B Hewlett Packard (HP) liquid chromatograph with
refractive index detector. The following HPLC conditions were used: an
Results
Steam Explosion and Liquid Hot Water Pretreatments
Poplar biomass milled to different particle sizes (2-5 and 12-15 mm)
was subjected to two hydrothermal pretreatments: liquid hot water at 180,
210,220,230, and 240°C; and steam explosion at 190 and 210°C and 4- and
8-min residence time. The goal of our study was to evaluate pretreatment
conditions (particle size, time, and temperature) on hemicellulose recovery
in the liquid fraction, cellulose recovery in the solid fraction, cellulose sus-
ceptibility to enzymatic hydrolysis, and SSF yield of cellulose to ethanol.
The chemical compositions of solid and liquid fractions after liquid
hot water and steam explosion pretreatments are given in Tables 1 and 2,
respectively. Data represent the averages of duplicate pretreatments.
Solid recovery (expressed as solids remaining after pretreatment
divided by 100 g of dry raw material) was affected by pretreatment condi-
tions. Solid recoveries ranged from 88.7 to 60%, and 66 to 59% for liquid hot
water and steam explosion pretreatments, respectively. For liquid hot
water, higher solubilization was obtained at harsher conditions, and no
significant dependence of chip size over the range studied was observed.
A similar pattern of solid recovery decreasing at increasing steaming tem-
peratures was found for steam explosion treatment, again showing little
effect of particle sizes.
Cellulose contents (gl 100 g of pretreated material) in the washed solid
fractions for both pretreatments and all conditions assayed increased in
relation to untreated material (39.5% cellulose). After pretreatment, cellu-
lose content ranged from 41 to 58% and from 56 to 59% for liquid hot water
and steam explosion pretreatment, respectively. The maximum cellulose
content in solid fraction for LWH pretreatment (57.5%) was obtained at
220°C and large particle size (12-15mm).
Applied Biochemistry and Biotechnology Vol. 105-108,2003
)..
~
ib'
Q..
o·tJ:l Table 1
n
:;,- Chemical Composition of Solid and Liquid Fraction
(1)
3 After Liquid Hot Water Poplar Pretreatment
in'
q-
'<: 180°C 210°C 220°C 230°C 240°C
:J
'"
Q..
Particle sizes (mm) 2-5 12-15 2-5 12-15 2-5 12-15 2-5 12-15 2-5 12-15
o·tJ:l
fD
9- Solid recovery (g/100 g dry wt) (%) 88.7 88.2 69.5 70.7 64.5 64.5 64.5 63.4 60.1 60.0
:J
0
Solid fraction (%, [w/w])
~
'<: Ash 1.2 0.9 1.0 1.1 0.8 1.1 1.3 0.9 1.6 0.8
Cellulose 42.2 40.7 52.7 51.8 54.0 57.5 53.3 55.9 52.1 57.4
Hemicellulose 17.8 14.7 7.6 7.2 3.5 3.2 0.8 1.0 0.3 0.6
1.0 Lignin 25.1 28.4 34.3 30.5 37.3 32.1 38.8 36.6 40.8 36.4
I'-.)
Cl
Cl
""
W
94 Negro et al.
A 100~--~~----------------------------------~
80
40 -+--WfIi3---i'&IFI--
2·5 mm 12·15 mm 2-5 mm12·15 mm 2-5 mm12·15 mm 2-5 mm 12·15 mm 2-5 mm 12·15 mm
180·C 210·C 220·C 230·C 240·C
Pretreatment conditions
B Yield
100.-~~~,,--~~--~--------------~-----,
80
60
40
20
Fig.l. Total sugar recovery yield at different pretreatment conditions. (A) Liquid hot
water; (B) steam explosion. Yield is expressed as sugars in the solid or liquid fraction
divided by potential sugars in the raw material. Glucose recovery in solid ( ~ ) and
liquid ( D ) fractions and hemicellulose-derived sugars recovery in solid ( § ) and
( • ) liquid fractions.
Discussion
We assessed the effectiveness of liquid hot water and steam explo-
sion pretreatment of poplar at two different particle sizes, under several
temperature and time conditions, by measuring hemicellulose and cellu-
lose recovery, fiber susceptibility to cellulase attack, and SSF performance.
Applied Biochemistry and Biotechnology Vol. 705-108, 2003
Poplar Pretreatment 97
A Yield %
100
80
60
40
20
o ~'----r--~----r---~--'----r--~----r---~~
2·5 mm 12·15 mm 2-5 mm 12·15 mm 2·5 mm 12·15 mm 2-5 mm 12·15 mm 2·5 mm 12·15 mm
180 ·C 210·C 220 ·C 230 ·C 24O ·C
Pretreatment conditions
B Yield %
100
80
60
40
20
0
2-5mm 12'l~mm Hmm 12-15mm Hmm 12·15mm Hmm 12·15mm 2-5mm 12·15mm
4 min. 8ml n . 4mln . 8 min. 4mln .
210·C 220·C
Pretreatment conditions
Fig. 2. Enzymatic hydrolysis yield ( IR ) and SSF yield ( • ) after (A) Liquid hot
wa ter and (B) steam exp losion at different pretrea tmen t condi tions. Hydrolysis yield
is expressed as glucose obtained in the enzymatic hydrolysis/potential glucose. SSF
yield is expressed as percentage of theoretical yield.
References
1. El Bassam, N. (1996), in Renewable Energy: Potential Energy Crops for Europe and the
Mediterranean Region, FAa, Rome, Italy, Rev. Technical Series 46,142-156.
2. Sun, Y. and Cheng, J. (2002), Bioresour. Technol. 83, 1-11.
3. McMillan, J. D. (1994), in Enzymatic Conversion ofBiomass for Fuels Production, Himmel,
M. E., Baker, J. 0., and Overend, R. P., eds., American Chemical Society, Washington,
DC, pp. 292-324.
4. Heitz, M., Capek-Menard, E., Koeberle, P.G., Gagne, J., and Chornet, E. (1991),
Bioresour. Technol. 35,23-32.
5. Mes-Hartree, M. and Saddler, J. N. (1983), Biotechnol. Lett. 5,531-536.
6. Ando, S., Arai, I., Kiyoto, K., and Hanai, S. (1986), J. Ferment. Technol. 64,567-570.
7. Duff, S. J. B. and Murray, W. D. (1996), Bioresour. Technol. 55, 1-33.
8. Wright, J. D. (1998), Chem. Eng. Prog. 84, 62-74.
9. Van Walsum, G. P., Allen, S. G., Spenser, M. J., Laser, M. S., Antal, M. J., and Lynd,
L.R. (1996), Appl. Biochem. Biotechnol. 57-58,157-170.
10. Weil, J., Sarikaya, A, Rau, S. 1., Goetz, J., Ladisch, C. M., Brewer, M., Hendrickson,
R., and Ladisch, M. R. (1997), Appl. Biochem. Biotechnol. 68,21-40.
11. Weil,J. P.,Sarikaya,A, Rau,S. L.,Goetz,J., Ladish,M., Brewer,M., and Hendrickson,
R. (1998), Appl. Biochem. Biotechnol. 73, 1-17.
12. Mok, W. S.-L. and Antal, M. J. (1992), Ind. Eng. Chem. Res. 31, 1157-1161.
13. Laser, M., Schulman D., Allen, S. G., Lichwa J., Antal, M. J., and Lynd, 1. R. (2002),
Bioresour. Technol. 81, 33-44.
14. Allen, S. G., Schulman D., Lichwa, J., and Antal, M.J. (2001), Ind. Eng. Chem. Res. 40,
2934-2941.
15. Ulbricht, R. J., Northum, S.J., and Thomas,J.A (1984),Fund.Appl. Toxicol. 4,843-853.
16. Carrasco, J. E., Martinez, J. M., Negro, M. J., Manero, J., Mazon, P., Saez, F., and
Martin, C. (1989), in Biomass for Energy and Industry, 5th Conference, vol. 2, Grassi, G.,
Gosse, G., and Dos Santos, G., eds., Elsevier, Essex, England, UK, pp. 38-44.
17. Ballesteros, I, Oliva, J. M., Navarro, A A, Gonzalez, A, Carrasco, J., and Ballesteros,
M. (2000), Appl. Biochem. Biotechnol. 84-86,97-110.
18. Ballesteros, I., Oliva, J. M., Negro, M. J., Manzanares, P., and Ballesteros, M. (2002),
Appl. Biochem. Biotechnol. 98-100, 717-732
19. Ballesteros, I., Ballesteros, M., Cabanas, A, Carrasco, J., Martin, c., Negro, M. J., Saez,
F., and Saez, R. (1991), Appl. Biochem. Biotechnol. 28-29,307-315.
20. Ruiz, R. and Ehrman, T. (1996), NREL Chemical Analysis and Testing Laboratory
Analytical Procedure, No. 002., National Renewable Energy Laboratory, Golden, co.
21. Templeton, D. and Ehrman, T. (1995), NREL Chemical Analysis and Testing Labo-
ratory Analytical Procedure, No. 003., National Renewable Energy Laboratory,
Golden,CO.
22. Weil, J., Brewer, M., Hendrickson, R., Sarikaya, A, and Ladish, M. (1998), Appl.
Biochem. Biotechnol. 70-72,99-111.
23. Belkacemi, K.; Abatzoglou, N., Overed, R. P., and Chornet, E. (1991), Ind. Eng. Chem.
Res. 30,2416-2425.
Abstract
A combined heat transfer jkinetic model was developed to quantify tem-
perature variations in small tubular batch reactors and estimate the effect
of deviations from isothermal operation on the kinetics of biomass pretreat-
ment. Assuming that heat transfer was dominated by conduction in the
radial direction, a classic parabolic time-dependent partial differential
equation was applied to describe the temperature in the system and
dedimensionalized to provide a single solution for application to all situa-
tions. A dimensionless expression for the reaction kinetics for xylan
hydrolysis was then developed, and a single parameter expressed as the
dimensionless ratio of the first-order rate constant times the tube radius
squared divided by the thermal diffusivity was found to control the reaction
rate. Three different characterizations of the deviation between the concen-
tration profile predicted for isothermal xylan hydrolysis and that based on
the transient temperature were directly related to this dimensionless rate
constant parameter for both catalyzed and uncatalyzed hydrolysis kinetics.
These results were then used to project the relationship between deviations
in yield from isothermal results and the tube radius and reaction time.
Index Entries: Reactor design; heat transfer; kinetics; hydrolysis; pre-
treatment.
Introduction
The use of small-volume tubular batch reactors to study the hydrolysis
kinetics of hemicellulose is common in the literature because of the relative
simplicity and ease of use of this type of reactor system. The reactors can be
easily filled with the desired substrate, sealed, and submerged in a constant-
aT = a. (a 2T + 1 aT) (1)
at ar2 r ar
Applied Biochemistry and Biotechnology Vol. 105-708, 2003
Transients in Hydrolysis Kinetics 103
in which Tis the temperature, t is the time, a is the thermal diffusivity, and
r is the radial position. The thermal diffusivity, a, is given by Eq. 2:
a = -'L (2)
pCp
in which Ti is the initial reactor temperature, Tfis the desired reaction tem-
perature, and R is the reactor radius. These three equations were substi-
tuted back into Eq. 1 to obtain the dimensionless heat transfer equation:
aT" aZT" 1 aT"
-=--+-- (6)
at" ar"Z r" ar"
This equation was solved numerically in an Excel spreadsheet using
an explicit finite-difference method with 10 radial increments across the
tube radius, as presented in Fig. 1. Figure 1 shows that the tube contents
near the wall heat up very rapidly while the contents near the center take
much longer to reach the desired reaction temperature. Because this equa-
tion is dimensionless, its solution is applicable to any combination of tubu-
lar reactor size (radius), tube contents (thermal diffusivity), initial reactor
temperature, and desired reaction temperature.
A dimensionless approach was also applied to describe xylanhydroly-
sis based on the following first-order model for solids decomposition:
~~ = -kX (7)
in which X is the hemicellulosic xylan in solid form and k is the reaction rate
constant. We then introduced the dimensionless time, f, as previously
defined and the dimensionless xylan remaining in solid form, X:
x" = X (8)
Xo
e 1.0 I---=:::::::::~~
=
eG)
a.
O.S
E
!!
II) 0.6
II)
CD
C
~ 0.4
c
CD
E
~ 0.2
~
0 .0 .-..L....._ _ _ _~.__-~---___,_--.,_-
0.0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 O.S
t' (dimensionless time)
Fig. 1. Dimensionless temperature profile for tubular batch reactors showing tem-
perature vs time for 10 radial intervals.
in which Xo is the initial amount of xylan in the substrate. Now the dimen-
sionless kinetic expression can be written as
(9)
(10)
(15)
0.8
0.6
«
x
0.4
0.2
0
0.0 0.5 1.0 1.5 2.0 2.5 3.0 3.5 4.0
t"
(18)
in which
* (*
X trans to + iM *) an d X iso
* (to• + iM .)
are, respectively, the numeric values of the predicted amounts of xylan
remaining for transient and isothermal operation evaluated at a specific
time. Clearly, the magnitude of this error is dependent on the number of
time steps that it is evaluated over, so for the purposes of this article a
constant number of time steps was used.
% Area Difference
%AD was based on the difference between the xylan curves for the
transient and isothermal reactions divided by the integral for isothermal
behavior to give a relative deviation:
* • . .)
(!c t. Xtransdt _ !ct' Xisodt
%AD = 100 0 0
rt' • •
Jo Xisodt
(19)
Table 1
Experimental Conditions and Parameters for Kinetic Models
Garrote et al. (9) Chen et al. (4)
% Instantaneous Difference
%ID was derived by subtracting the predicted amount of xylan left for
isothermal operation from the predicted value for transient operation at a
specified dimensionless time and dividing by the predicted quantity of
xylan for isothermal reaction according to the following expression:
(20)
Results
To determine whether the dimensionless rate constant,~, can be cor-
related with a quantitative measure of deviation, the model was applied
with two published kinetic models. Table 1 presents the kinetic parameters
and experimental conditions that were used for the two sets.
The Excel model was run multiple times for both kinetic models by
varying the reaction temperature, acid concentration (for the acid-cata-
lyzed model), and initial temperature (20 or 100°C) within the reported
range of experimental conditions. The value of ~ along with the three
quantitative measures of deviation were calculated for each trial. Figures
3 and 4 show the deviation parameters SSE and %AD defined at 100%
yield (Le., f at which X:o and X;rans are equal to zero) plotted vs ~ for both
catalyzed and uncatalyzed models for two different initial temperatures:
20 and 100°C. The scales for these figures are different for catalyzed and
uncatalyzed models because the ~ values calculated within the experi-
mental ranges in Table 1 are higher for the uncatalyzed model. From Figs.
3 and 4, one can see that for small values of ~, there is a positive linear
relationship between both deviation quantities and ~. For larger values of
60
T =20·C
50 ~' 1
/
V+
40
w
II)
II)
./
V Vi) = 100·C
V ""
30
V
20 / ./
V"
10 ~ ~
0 ~
0.0 0.5 1.0 1.5 2.0 2.5 3.0 3.5 4.0 4.5 5.0
Beta
B 40
35
30 ......-- ~
T
..),.
=20·C"
L+
25
w
~ 20
V
---
15 /
V
---
10 ~Ti=100·C
5 /
o ~~
0.0 0.5 1.0 1.5 2.0 2.5 3.0
Beta
Fig. 3. SSE vs dimensionless rate constant, ~, for (A) uncatalyzed and (B) acid-
catalyzed kinetic models and initial temperatures of 20 and 100°C.
~, this relationship becomes less and less linear. The linear relationship
between %AD and ~ (Fig. 4) holds over a wider range of ~ than the linear
relationship between the SSE and ~ (Fig. 3). For both Figs. 3 and 4, a
comparison of uncatalyzed plots (Figs. 3A and 4A) and catalyzed plots
(Figs. 3B and 4B) shows that there is greater scatter for the catalyzed plots.
This is owing to the additional parameter of acid-concentration that was
included and varied in the acid-catalyzed model to obtain the data points.
The regression lines plotted in Fig. 4 for Ti = 20°C are very similar for
the uncatalyzed and acid-catalyzed models and are given by, respectively:
%ADuncat = 37.5 x ~ (21)
A 180
160 /'
V"
140 ./
120 T=20·C "" /"
Q 100 .Lt~
~ 80 f Tj' =100·C
60 / /'"
40 ~/
20 !~ ~
0 ~
0.0 0.5 1.0 1.5 2.0 2.5 3.0 3.5 4.0 4.5 5.0
Seta
B 100
90
80 ./
70 T=20·C"
'~
80
Q
50 L
~ ./ TI=100·~"""'-
40
V ........ ~
30
/ ,........ rr
20
10 .J" ,....- ........... fo"""
0 ~
0.0 0.5 1.0 1.5 2.0 2.5 3.0
Seta
Fig. 4. %AD vs dimensionless rate constant, 13, for (A) uncatalyzed and (B) acid-
catalyzed kinetic models and initial temperatures of 20 and 100°C.
These two equations can then be used to produce a set of design curves
for each kinetic model. For example, for uncatalyzed kinetics, an expres-
sion for the reaction temperature as a function of tube radius can be written
at any %AD if the thermal diffusivity and kinetic constants are held con-
stant. Figure 5 shows the design curves at 5,10,20,50, and 100% error for
both Ti = 20°C and Ti = 100°C assuming Garrote kinetics as presented in
Table 1 and a = 0.0016 cm2 / s.
A similar plot can be prepared for the acid-catalyzed kinetics using
Eq. 22; however, the initial temperature and the acid concentration must
be specified for each design curve. Figure 6 shows the design curves at 5,
10,20,50, and 100% area difference for an initial temperature of 20°C and
an acid concentration of 0.5 wt%. To demonstrate the effect of varying the
260 TT-------------------------------------,
240
0-
~ 220
E
::I
~D- 200
E
{!!. 180
c:
o
tiIII 160
GI
ex:
14° 1~~~~~~~~~~::::~~~~~~~~
120
0.00 0.25 0.50 0.75 1.00 1.25 1.50 1.75 2.00
Tube Inner Radius (In)
Fig. 5. %AD as function of tube inner radius and reaction temperature for
uncatalyzed model and initial temperatures of 20°C (thick solid lines) and 100°C (thin
solid lines).
acid concentration and initial temperature on the design curve for acid-
catalyzed kinetics for an error of 5%, the plot in Fig. 7 was generated.
Instead of calculating the %AD over the entire time profile (until X
-+ 0) as presented in Figs. 5-7, a different plot was generated by calculat-
ing the %AD at a specified xylan yield (defined as 100% - X) and plotting
vs ~. This plot for uncatalyzed kinetics and two different initial tempera-
tures is presented in Fig. 8.
A third type of plot can be prepared that only considers the error
between the isothermal and transient profiles at an instantaneous time by
using the %ID and plotting the same parameters shown in Fig. 8. Figure 9
shows this plot for the uncatalyzed model.
Discussion
The dimensionless rate constant that was developed in the present
work is directly related to the tube radius squared and the kinetic rate
constant assuming first-order kinetics for xylan hydrolysis and inversely
related to the thermal diffusivity of the contents of the tube. Therefore, it
can be viewed as a ratio of the reaction rate (k) to the rate of heat conduction
(R2 / a for a tube), and the larger the value of ~, the larger the expected
deviation from isothermal operation. This dimensionless group was used
to determine the relative effect of variation of the variables that comprise
it (radius, kinetic constants, reaction temperature, and thermal diffusivity
of tube contents). However, to establish the validity of this dimensionless
270
250
•
230 \
\
~210 ,.\
! 1\
:J 190
f H\
"-.....
8. 170 ,\ ..........
E
-
\',,,- .......
~ 150
........
-
" .....
c: ..... --....
'"" "-
-- ---
..........
.~
~ 130
:--
"- ...........
--
u ............
I'll
~ 110 ............. ~
f- -
20
- 5001. ~ 100% ,
90 - - 5%-:;
10% ==
70
50
0.00 0.25 0.50 0.75 1.00 1.25 1.50 1.75 2.00
Tube Inner Radius (In)
Fig. 6. %AD as function of tube inner radius and reaction temperature for catalyzed
model, initial temperature of 20°C, and 0.5 wt% acid concentration.
,
,
190
_ 170
U
!...
f 150
.,
:J
f \ ' l\
8. 130 \ I\.'\
E \
"
"' "'"-
o
~
c: 110
[\. i'....
r--..... '-...
-
o ~
&
~
90
.......
......
r--..... r-- __ __
5%. T =100', C::0.5
......-
.............
Fig. 7. %AD as function of tube inner radius and reaction temperature for catalyzed
model, initial temperature of 20 and 100°C, and 0.5 and 2.0 wt% acid concentration
with each line representing the limit for an error of 5%.
100
80
40
20
0.0 0.5 1.0 1.5 2.0 2.5 3.0 3.5 4.0 4.5 5.0
B
Fig. 8. Percentage xylan yield as function of %AD and ~ for uncatalyzed model and
initial temperatures of 20°C (thick solid lines) and 100°C (thin solid lines).
700
650
600
8 550
!500
~ 450
Q400
eo
1 350
.&300
j 250
.I 200
'It 150
100
50
0
0.0 0.5 1.0 1.5 2.0 2.5 3.0 3.5 4.0 4.5
B
Fig. 9. Percentage xylan yield as a function of %ID and ~ for uncatalyzed model and
initial temperature of 20°C.
Conclusions
The results of this analysis indicate that it is very important to validate
the assumption of isothermal operation for both acid-catalyzed and
uncatalyzed hydrolysis in batch reactor tubes. A dimensionless rate con-
stant consisting of the ratio of the reaction rate to the heat conduction rate
was shown to be useful as a tool to quantitatively determine the range of
experimental conditions in which the isothermal assumption is reasonable
and those in which this assumption is questionable. Increasing factors that
speed up the reaction rate, such as reaction temperature and acid concen-
tration, were shown to increase the dimensionless rate constant and lead to
larger errors, while increasing factors that speed up the heat conduction
rate, such as thermal diffusivity or smaller reactor tubes, were shown to
decrease the dimensionless rate constant and the resulting error.
Acknowledgments
This research was made possible through the support of the USDA
National Research Initiative Competitive Grants Program (contract 2001-
35504-10041) and the Thayer School of Engineering at Dartmouth College.
References
1. Montane, D., Salvado, J., Farriol, X., and Chornet, E. (1993), Biomass Bioeng. 4-6,
427-437.
2. Torget, R W., Kim, J. 5., and Lee, Y. Y. (2000), Ind. Eng. Chem. Res. 39,2817-2825.
3. Baugh, K. D. and McCarty, P. L. (1988), Biotechnol. Bioeng. 31,50-61.
4. Chen, R, Lee, Y. Y., and Torget, R (1996), Appl. Biochem. Biotechnol. 57/58,133-146.
5. Tillman, L. M., Abaseed, A. E., Lee, Y. Y., and Torget, R (1989), Appl. Biochem.
Biotechnol. 20/21, 107-117.
6. Jacobsen, S.E. (2000), MS thesis, Thayer School of Engineering, Dartmouth College,
Hanover, NH.
7. Jacobsen, S. E. and Wyman, C. E. (2001), Appl. Biochem. Biotechnol. 91-93,377-386.
8. Bird, R. B., Stewart, W. E., and Lightfoot, E. N. (1960), Transport Phenomena, John
Wiley, New York, NY.
9. Garrote, G., Dominguez, H., and Parajo, J. C. (2001), Process Biochem. 36,571-578.
Abstract
The pretreatment of com stover with H 2S04 and H 3P04 was investigated.
Pretreatments were carried out from 30 to 120 min in a batch reactor at 121°C,
with acid concentrations ranging from 0 to 2% (w Iv) at a solid concentration
of 5% (w I v). Pretreated com stover was washed with distilled water until the
filtrate was adjusted to pH 7.0, followed by surfactant swelling of the cellu-
losic fraction in a 0-10% (w Iv) solution of Tween-80 at room temperature for
12 h. The dilute acid treatment proved to be a very effective method in terms
of hemicellulose recovery and cellulose digestibility. Hemicellulose recov-
ery was 62-90%, and enzymatic digestibility of the cellulose that remained
in the solid was >80% with 2% (w Iv) acid. In all cases studied, the perfor-
mance of H 2S04 pretreatment (hemicellulose recovery and cellulose digest-
ibility) was significantly better than obtained with H 3P04 • Enzymatic
hydrolysis was more effective using surfactant than without it, producing
10-20% more sugar. Furthermore, digestibility was investigated as a func-
tion of hemicellulose removaL It was found that digestibility was more di-
rectly related to hemicellulose removal than to delignification.
Introduction
The United States and other industrialized countries of the world are
dependent on imported oil. Oil imports continue to increase, threatening
the strategic security of these countries (1). For instance, according to a June
23,2001 article in Time magazine,the United States imports almost 60% of
Table 2
Sugar Recoveries in Pretreated Corn Stover Liquors·
Acid conc. (w Iv) Gluca (%)bn Xmg (%)b
Untreated
No Acid (water) 3.2 12.4
0.5% H 2SO4 6.0 71.3
1.0% H 2S04 6.4 74.8
2.0% H 2S04 6.2 89.5
0.5% H 3P04 4.5 30.2
1.O%H3P04 5.0 48.8
2.0%H3P04 5.7 58.1
"Enzymatic hydrolysis conditions were as follows: 1% (w Iv)
solid concentration; 40 FPU of cellulase/ g of cellulose for 96 h
at SO°c.
bAll sugar contents are based on the original oven-dried
untreated biomass and expressed as glucan, xylan, mannan,
and galactan equivalents.
Table 3
Cellulose Digestibility of Pretreated Corn Stover Solids
Acid conc. (w Iv) Digestibility at 72 h (%)
Untreated 10.8
No Acid (water) 24.8
0.5% H 2S04 55.4
1.0% H 2S04 58.7
2.0% H 2S04 75.6
0.5% H 3P04 42.1
1.0% H 3P04 45.8
2.0%H3P04 56.0
H 2 S04 Pretreatment
Moderate temperature was investigated at low acid concentrations,
which would result in savings in catalyst and acid neutralization costs, as
well as material costs of constructing the reactor. This method would also
reduce the problems and costs associated with handling the gypsum formed
during the neutralization (14).
H 2S04 effectively solubilized the hemicellulosic portion of the com
stover and increased the digestibility of the cellulose that remained in the
solid residues. As shown in Table I, the relative percentage of glucan was
near 62%, and the xylose remaining was approx 1%. Thus, about 90% of the
xylose was recovered with 2 % (w Iv) H 2S04 treated for 120 min (Table 2).
When the H 2S04 concentration and residence time were increased from 0.5
to 2% (w Iv) and from 30 to 120 min respectively, hemicellulose recovery
(=[hemicellulose amount recovered in liquid phase] I [initial hemicellulose
content]) was increased by 30%. However, delignification was only 22%
with 2% (w Iv) acid concentration and a residence time of 120 min.
H 3 P04 Pretreatment
Compared with H 2S04 treatment, H 3P04 treatment had considerably
lower hemicellulose degradation. Compositions of hydrolysate liquors from
various pretreatments are given in Table 2. In addition, both acid pretreat-
ments had approx the same effect on the lignin content of the com stover. At
121°C and 120 min, the hemicellulose recovery increased from 30 to 48%, and
finally to 58% at 0.5, I, and 2% acid concentrations, respectively.
The difference of both acid-treated com stovers seems to be as much
a function of reaction time as acid concentration. At moderate tempera-
tures, H 3P04 pretreatment resulted in a lower digestibility and hemicellu-
lose conversion (20 and 30%, respectively), which suggests that H 3P04 as a
reagent for pretreatment is not very effective. Under relatively low tem-
peratures (121°C) and under similar conditions, the results showed that
H 2S04 treatment is a better method compared with H 3P04 treatment.
70
60
~
~
i:c 50
~
is 40
Ql
Ql
en
0
:2 30
Qi
()
~
0
20
10
0
0 25 50 75 100
Incubation Time (Hours)
-+- Untreated -II- No Acid (water) -I:r-1 % Sulfuric Acid -9-1 % Phosphoric Acid
80
70
160
~
;g
III
50
(])
Cl
i:5
3l 40
0
2
Qj
() 30
0~
20
10
0
0 25 50 75 100
Incubation Time (Hours)
-+- Untreated ....-- No Acid (water) -ir- 2 % Sulfuric Acid -e- 2 % Phosphoric Acid
Fig. 2. Cellulose digestibility from enzymatic hydrolysis of corn stover pretreated
for 120 min at 2% (w Iv) acid concentration.
are compared with those of the H 3P04 treatment, it is found that initial
digestibility was affected somewhat by the extent of hemicellulose removal,
resulting in increased initial rate. From Fig. 2 it is also apparent that the
percentage of digestibility (at 96 h, and 2% [w Iv] concentration) is approx
25% higher for the H 2S04 than for the H 3P04 pretreatment process.
Effect of Surfactant on Enzymatic Hydrolysis
Figure 3 shows the effect of different concentrations of Tween-80 on
the enzymatic hydrolysis yield of 2% (w Iv) acid-pretreated corn stover.
Tween-80 clearly aided the enzymatic hydrolysis of the pretreated corn
stover; the average rate and extent of conversion with Tween-80-treated
samples were higher than for Tween-free samples. At the loading level of
0-10% (w Iv) solution of Tween-80, the total sugar yield increased up to
a maximum of 15% when compared to results obtained in the absence of
the additive in the 96-h period. It was observed that the addition of Tween-
00+------------------------------------------;
80
I>.
:t:
70
60
£u;
CD
01
is
50
CD
Ul
:2 40
0
CD
()
30
*
20
10
0
0 25 50 75 100
Incubation lime (Hours)
80
A
./.4.
70
III
~
:is
~ 50
Q)
Cl
•
./ // •
is
5l 40
~/
o
"S
CD /./
o 30
/.Y
~
o
20
. /'~
'
10
o
o 25 50 75 100
% Xylan Removed (w/w)
Conclusion
Recovery of xylose using H 2S04 pretreatment of corn stover was 10-
30% greater in comparison with that obtained with H 3P04 pretreatment
under similar comditions. There was a linear relationship between cellu-
lose digestibility and percentage of xylan removed from the solid. An
increase in H 2S04 concentration (1-2% [w/v]) in the pretreatment step
increased cellulose digestibility by approx 25%. This research also con-
firms the previous results in the literature that Tween-SO is an effective
surfactant aid, which increases cellulose digestibility. The addition of
Acknowledgments
We wish to acknowledge Colorado State University Experiment
Station, which partially funded this research. We wish to acknowledge
Dr. James Linden for his valuable comments and Dr. Thomas R. Hanley
for providing travel support for attending the symposium.
References
1. Parajo, J. c., Alonoso, J. L., and Santos, V. (1996), J. Wood Chem. Technol. 16(1),61-78.
2. Wyman, C. E. (1996), Handbook on Bioethanol: Production and Utilization, Taylor &
Francis, Washington, DC.
3. Fan, L. T., Gharpuray, M. M., and Lee, Y. H. (1987), Cellulose Hydrolysis, Springer-
Verlag, Berlin, Germany.
4. Schell, D. L Walter, P. J., and Johnson, D. K. (1992), Appl. Biochem. Biotechnol. 23/35,
659-663.
5. Philippidis, G. P., Smith, T. K., and Wyman, C. E. (1993), Biotechnol. Bioeng. 41,846-853.
6. Kim, S. B., Um, B. H., and Park, S. C. (2001), Appl. Biochem. Biotechnol. 91/93,81-94.
7. Kaar, W. E. and Holtzapple, M. T. (1998), Biotechnol. Bioeng. 59,419-427.
8. Castanon, M. and Wilke, C. R. (1981), Biotechnol. Bioeng. 23, 1365-1372.
9. Knappert, D., Grethlein, H., and Converse, A (1980), Biotechnol. Bioeng. 22, 1449-1463.
10. (1996), NREL Chemical Analysis and Testing Standard Procedure, No. 001-005,009,
National Renewable Energy Laboratory, Golden, CO.
11. Um, B. H. (2002), MS thesis, Colorado State University, Fort Collins, CO.
12. Himmel,M. E., Baker,J. 0., and Overend, R. P. (1994),Enzymatic Conversion of Biomass
for Fuel Production, American Chemical Society, Washington, DC.
13. Hernandez-Soto, A (2002), Inhibitory Effects of Acetic Acid and Furfural on Ethanol
Fermentation by Zymomonas mobilis C25. MS report, Department of Chemical Engi-
neering, Colorado State University, Fort Collins, CO.
14. Tengborg, c., Stenberg, K., Gable, M., Zacchi, G., Larsson, S., Palmqvist, E., and
Hahn-Hagerdal, B. (1998), Appl. Biochem. Biotechnol. 70/72,3-15.
15. Ramos, L. P., Breuil, c., and Saddler, J. N. (1992), Appl. Biochem. Biotechnol. 34/35,
27-47.
16. Mooney, C. A, Mansfield, S. D., Touhy, M. G., and Saddler, J. N. (1998), Bioresour.
Technol. 64, 113-119.
Abstract
Fuel ethanol can be produced from softwood through hydrolysis in an
enzymatic process. Prior to enzymatic hydrolysis of the softwood, pretreat-
ment is necessary. In this study, two-step steam pretreatment employing
dilute H 2S04 impregnation in the first step and S02 impregnation in the
second step, to improve the overall sugar and ethanol yield, was investi-
gated. The first pretreatment step was performed under conditions of low
severity (I80°C, 10 min, 0.5% H 2S04) to optimize the amount of hydrolyzed
hemicellulose. In the second step, the washed solid material from the first
pretreatment step was impregnated with S02 and pretreated under condi-
tions of higher severity to make the cellulose more accessible to enzymatic
attack, as well as to hydrolyze a portion of the cellulose. A wide range of
conditions was used in the second step to determine the most favorable
combination. The temperatures investigated were between 190 and 230°C,
the residence times were 2, 5, and 10 min; and the S02 concentration was
3%. The effect of pretreatment was assessed by both enzymatic hydrolysis
of the solids and by simultaneous saccharification and fermentation (SSF)
of the whole slurry, after the second pretreatment step. For each set of
pretreatment conditions, the liquid fraction was also fermented to deter-
mine any inhibitory effects. Ethanol yield using the SSF configuration
reached 66% of the theoretical value for pretreatment conditions in the
second step of 210°C and 5 min. The sugar yield using the separate hydroly-
sis and fermentation configuration reached 71% for pretreatment condi-
tions of 220°C and 5 min.
Index Entries: Enzymatic hydrolysis; softwood; simultaneous saccharifi-
cation and fermentation; separate hydrolysis and fermentation.
T- Trefl]
Log Ro =log(t· exp [ 14.75 (1)
Raw Material
Fresh spruce, Picea abies, free from bark, was used. Sawdust was sup-
plied by local sawmills. The composition was determined according to the
Hagglund (13) method and is presented in Table 1. The raw material used
for impregnation with H 2S04 in the first step had a dry matter (DM) content
of 55.5%.
Pretreatment
First Pretreatment Step
The first steam pretreatment step was optimized and performed at the
Mid Sweden University, OrnskOldsvik, in a 250-L batch reactor located in
Rundvik, Sweden (14). The reactor is a Masonite gun with direct steam
injection. The heat-up time is 30 s. The sawdust was impregnated with
dilute H 2S04 (0.5% [w /w] based on the water content of the wood) and
pretreated at 180°C for 10 min. The reaction was quenched by blowing the
Applied Biochemistry and Biotechnology Vol. 105-108,2003
130 Soderstrom et al.
Raw material - spruce
Pretreatment
step 1
Fermentation
T=3Q2C
pH =5.5
yeast: 10 gOM/I Liquid
glucose to 50 fil
Pretreatment
step 2
Table 1
Composition of Raw Material and Material
After First Pretreatment Step
Raw material First-step material
Composition (% ofDM) (% ofDM)
Table 2
Experimental Design of Second Pretreatment Step
Experiment Tempature (0C) Time (min) Log (Ro)
1 190 2 2.95
2 190 5 3.35
3 190 10 3.65
4 200 2 3.25
5 200 5 3.64
6 200 10 3.94
7 210 2 3.54
8 210 5 3.94
9 210 10 4.24
10 220 2 3.83
11 220 5 4.23
12 225 5 4.38
13 230 5 4.53
37%, was reimpregnated with gaseous S02' The material was placed in
plastic bags for a 20-min impregnation at room temperature to reach a
concentration of 3% S02 ([w /w], based on the water content of the wood).
The impregnated material was steam pretreated in the second pretreat-
ment step at various temperatures (190, 200, 210, 220, 225, and 230°C) and
residence times (2, 5, and 10 min) (see Table 2). A portion of the pretreated
material was separated by filtration into a solid residue and a liquid for
evaluation with separate enzymatic hydrolysis and fermentation, and some
was kept intact for evaluation with SSF. The liquid was analyzed with
respect to soluble sugars and to their degradation products. The amount of
insoluble solids in the pretreated material was determined.
In two cases, excessive washing was performed on the material from
the first step to try to improve the S02 absorption in the impregnation prior
to the second pretreatment step. Two pretreatment experiments, nos. 8 and
11, which resulted in the highest overall yields in SSF and SHF, respec-
I
E 0.10 n
~ D
0 0
" 0.08
!'
t
D
0.06
S
.--
'II
~ 0.04 0
'D
• ••
0.02
0.00
2.5 3.0
o
• •-
D
• I
3.5
Severity Factor (Log Ro)
4.0
•• •
4.5 5.0
Fig. 2. Yield of monomeric glucose and mannose in liquid after second pretreatment
step as function of severity of that step.
collected. Further studies in which this stream is considered are thus nec-
essary. Losses arising from handling were determined by thoroughly wash-
ing the equipment with water and measuring the amount of solid material
not recovered in the pretreated slurry. The average loss of solid material in
the second pretreatment step was estimated to be 2.4% of the original dry
material by weight.
The liquid after the second pretreatment step contained several
byproducts. At low severity the concentrations of acetic acid, HMF, and
furfural were very low, <0.5 giL. The HMF concentration reached a maxi-
mum of 3 giL for pretreatment at high severity. The furfural concentration
never exceeded 0.75 giL, which was expected, since almost all the pentoses
were recovered as monomeric sugars in the liquid from the first pretreat-
ment step (Fig. 3). Several other substances were detected as unidentified
peaks in the chromatograms but were not quantified. These substances
might be derived from the degradation of sugar and lignin.
All fermentation experiments on the liquid derived from the second
pretreatment step showed good fermentability and no apparent inhibitory
effects. The productivity for the first4h was6 gofethanol/ (L·h), which was
the same as in the reference solution.
Washed Material
Excessive washing of the material from the first step with water prior
to reimpregnation resulted in a higher uptake (the desired 3%) of S02.
However, SSF and enzymatic hydrolysis of this material did not result in
an increase in overall yields compared with the moderately washed mate-
rial exhibiting less S02 absorption.
Applied Biochemistry and Biotechnology Vol. 105-10B, 2003
136 Soderstrom et al.
3.5
DHMF
3.0 - & Furfural L.J
~ 2.5
0
...
~ 20 0
.E
c
R
~ 1.5 L.J
~ 0
8 1.0
•
-•
~
0.5
0
•
-- --
*j
0.0
2.5 3.0
!~
-- 3.5 4.0 - ...
4.5 5.0
Severity Factor (Log Rol
Enzymatic Hydrolysis
For enzymatic hydrolysis to be successful, the cellulose fibers must be
accessible to the enzymes. More severe pretreatment results in a material
that is more accessible to enzymatic attack. If the material is treated under
very severe conditions, much of the cellulose will be hydrolyzed during the
second pretreatment step without the use of enzymes. When treated at very
severe conditions, the sugars are degraded during pretreatment to form
inhibiting substances, which also cause a loss of substrate.
The sugar yields during the enzymatic hydrolysis step ranged from
12 to 20 g of sugar/100 g of dry raw material, depending on the pretreat-
ment conditions. Figure 4 shows the glucose yield in the various steps.
The highest yield in the enzymatic hydrolysis step, 19 g of glucose/100 g
of dry raw material, was obtained for a severity of Log Ro = 3.94, corre-
sponding to pretreatment conditions of 200°C and 10 min. For pretreat-
ment at a severity above 4 the amount of glucan that was hydrolyzed
in the enzymatic hydrolysis was smaller. This is an effect of the higher
hydrolysis yield and increased degradation during the second pretreat-
ment step, which leaves less material for enzymatic hydrolysis.
0.35
• Filtrate step 1
0.30 c FlItrate step 2
• Enzymatic hydrolysis
o Overall 0 0
I'i 025 0
E 0 o§
~
..
~ 0.20
0 • 0 ••
•
) 0.15
~
1St
!!
31 0.10
~
0 05
0.00
2.50 3 .00 3.50 4.00 4.50 500
Severity FlIClo, (Log Ro)
Fig. 4. Yield of glucose formed in each step as function of severity factor of pre-
treatment.
at high severity, inhibitors may form, which affect the fermentation and
inhibit the yeast.
The yield of ethanol in SSP of the slurry from the second pretreat-
ment step was calculated assuming that no lignin degradation occurred
in the pretreatment. The highest yield of ethanol reached in SSP was 71 %
and was obtained following pretreatment at 230°C for 5 min. However,
the highest overall ethanol yield (Le., including both pretreatment steps
and SSP) was 66%.
Overall Yields
The formation of glucose and mannose occurred in different steps of
the process. Mannose was mainly formed during the first pretreatment
step, with a yield of 88% of the theoretical value. In the second step, 2-8%
of the theoretical amount of mannan was obtained, depending on the pre-
treatment conditions. Thus, the total yield of mannose was 90-96% of the
theoretical.
Glucose was mainly obtained in the second pretreatment step and
during enzymatic hydrolysis. Amaximumof21%ofthetheoreticalamount
of glucose was obtained in the second pretreatment step for pretreatment
conditions of 220°C and 5 min. Considering enzymatic hydrolysis, the high-
est yield of glucose was 37%, obtained after pretreatment at 200°C for 10
min. However, the maximum yield following the second pretreatment step
and enzymatic hydrolysis only reached 49%. In this case, pretreatment was
performed at 220°C for 2 min.
Applied Biochemistry and Biotechnology Vol. 105-108, 2003
138 Soderstrom et al.
0.7
••
0
•
• -
~
•
0.6 A
0
0.5 • 0 •o •0 A
•
j
11 0.4 • v
• 0
0
! 0 0
~
_ 0.3
..,
~
0.2
0.1
l <> Overall EtOH yield with SSF I
• Overall EtOH yield with SHF
0.0
2.5 3.0 3.5 4.0 4.5 5.0
Severity Factor (log Ro)
Fig. 5. Overall yields of ethanol following SSF and SHF as function of severity factor
of pretreatment. In SHF the fermentation yield after enzymatic hydrolysis is assumed
to be 90%.
The overall yield of fermentable sugars (Le., following the two pre-
treatment steps and the enzymatic hydrolysis step) was about 70% for a
range of pretreatment conditions with a severity factor of about 4 (see Fig. 4).
The maximum yield of fermentable sugars (0.46 g/ g dry raw material or
71 %) was obtained following second-step pretreatment conditions of 220°C
and 5 min.
The maximum yield of sugars obtained in our study is lower than in
previous studies in which either two-step steam pretreatment with S02
impregnation in both steps (80%) (9) or H 2S04 impregnation in both steps
(77%) (10) was utilized. The same raw material and evaluation methods
were used as in the present study. Nguyen et aL (6) obtained an overall
sugar yield of 82% using two-step steam pretreatment followed by enzy-
matic hydrolysis. However, the cellulase activity used in the present study
was very much lower, 15 FPU / g of DM (25 FPU / g of cellulose), compared
with the 60 FPU/g of cellulose used by Nguyen et aL (6).
Figure 5 shows a comparison of SSF and SHF, in which a yield of 90%
in the fermentation after enzymatic hydrolysis was assumed, which was
the yield reached in the fermentation tests. When the material was steam
pretreated in two steps followed by either SHF or SSF approximately the
same ethanol yield resulted. The highest overall ethanol yield using SSF
was 66%, reached at a severity factor of Log Ro = 3.94 (210°C, 5 min). For
SHF the highest overall ethanol yield was 67% and was obtained for a
severity factor of Log Ro = 4.23 (220°C, 5 min).
Conclusion
Two-step steam pretreatment of softwood with impregnation by
dilute H 2S04 in the first step and S02 in the second step resulted in lower
sugar yields after enzymatic hydrolysis than did procedures incorporating
impregnation with either S02 or H 2S04 in both steps. The ethanol yield after
SSF was about the same as when H 2S04 was used in both steps, however,
when S02 was used in both steps, the yield was higher. The highest overall
ethanol yield reached with the SSF configuration was 66% of the theoretical
(210°C, 5 min), whereas the highest overall sugar yield with the SHF con-
figuration was 71 % (220°C, 5 min).
This is contrary to what was expected based on previous results from
one-step pretreatment with either H 2S04 or S02 (11). Judging from those
results, a first step using H 2S04 followed by a second step with S02 was
thought to be superior. However, the results from our study show that it is
not possible to predict the optimal conditions for two-step steam pretreat-
ment based on a one-step pretreatment procedure. The combination of
H 2S04 in the first step followed by S02 in the second step is thus not a better
alternative than utilization of H 2S04 or 502in both steps.
Acknowledgments
We are grateful to Dr. Robert Eklund at the Mid Sweden University,
brnskoldsvik, for providing the raw material and performing the first
pretreatment step. We also gratefully acknowledge the Swedish National
Energy Administration for financial support.
References
1. von Sivers, M. and Zacchi, G. (1996), Bioresour. Technol. 56(2/3), 131-140
2. Boussaid, A., Robinson, J., Cai, Y., Gregg, D. J., and Saddler, J. N. (1999), Biotechnol.
Bioeng. 64(3),284-289
Abstract
The filtrate from steam-pretreated poplar was analyzed to identify degra-
dation compounds. The effect of selected compounds on growth and
ethanolic fermentation of the thermotolerant yeast strain Kluyveromyces
marxianus CECT 10875 was tested. Several fermentations on glucose
medium, containing individual inhibitory compounds found in the hydroly-
sate, were carried out. The degree of inhibition on yeast strain growth and
ethanolic fermentation was determined. At concentrations found in the
prehy-drolysate, none of the individual compounds significantly affected
the fermentation. For all tested compounds, growth was inhibited to a lesser
extent than ethanol production. Lower concentrations of catechol (0.96 giL)
and 4-hydroxybenzaldehyde (1.02 giL) were required to produce the 50%
reduction in cell mass in comparison to other tested compounds.
Index Entries: Ethanol production; Kluyveromyces marxianus; poplar bio-
mass; inhibitors; fermentation.
Introduction
Conversion of lignocellulosic biomass into ethanol as an alternative to
conventional petroleum transportation fuels is currently under extensive
investigation (1,2). The simultaneous saccharification and fermentation (SSF)
process has been suggested as one of the most promising systems because the
continuous removal of the sugars by the microorganism reduces the end-
"Author to whom all correspondence and reprint requests should be addressed.
Applied Biochemistry and Biotechnology 141 Vol. 705-708,2003
142 Oliva et al.
product inhibition of the enzyme complex. Over the past 10 years, our labo-
ratory has selected a thermotolerant strain of Kluyveromyces marxianus
capable of ethanol fermentation of glucose from cellulose in an SSF process
at 42°C with a good ethanol yield (3).
Steam explosion has been proposed as an efficient pretreatment of
lignocellulosic materials and has the advantage of being able to be devel-
oped on a commercial scale (4,5). During steam explosion pretreatment,
some degradation products are formed that may be potential inhibitors
during fermentation of the sugar fraction. After pretreatment, these inhibi-
tors are in the aqueous portion of the pretreatment hydrolysate slurry. In
an environmentally sustainable lignocellulose-to-ethanol process, this
aqueous fraction should be used as fermentation broth to minimize fresh
water requirements and decrease the amount of water waste produced.
Several researchers have investigated the nature of the inhibitors present
in dilute-acid hydrolysates and steam explosion-pretreated biomass (6-9).
Nevertheless, not only does the concentration of the final inhibiting com-
pounds vary greatly with the pretreatment conditions and the raw material
used, but also their effects depend on the nature of the microorganism, as
well as pH and temperature conditions of the fermentation broth.
In the present study, the filtrate from steam-exploded poplar was ana-
lyzed to identify degradation compounds. The effect of selected compounds
on ethanol fermentation of the thermotolerantyeast strain K. marxianus CECT
10875 was tested.
Materials and Methods
Chemicals
All chemicals were obtained from Sigma (St. Louis, MO), except for
4-hydroxy-3,5-dimethylbenzyl alcohol (syringyl alcohol), which was
obtained from Lancaster Synthesis (Morecambe, England).
Preparation of Poplar Hemicellulose Hydrolysate
One hundred grams of poplar biomass was subjected to pretreatment
in a steam explosion pilot unit at 210°C and 4 min, operated by batches and
equipped with a 2-L reaction vessel. The plant description and working
methodology were described previously (10). The pretreated material was
suction filtered, and the filtrate was collected (approx 1 L) and analyzed.
Microorganism and Fermentation Conditions
K. marxianus CECT 10875, a thermotolerant strain obtained in our labo-
ratory, was used in fermentation experiments. Active cultures for inocula-
tion were prepared by growing the organism overnight on a rotary shaker
at 150 rpm and 42°C in a growth medium (initial pH 5.5) containing: 5 giL
of yeast extract, 2 giL of NH4Cl, 1 giL of KH2P04, 3 giL of MgS047H20, and
30 giL of glucose.
Experiments were carried out in 100-mL Erlenmeyer flasks each con-
taining 25 mL of the growth medium under nonsterile conditions and agi-
tated at 150 rpm. Flasks were inoculated at 4% (v Iv).
Results
Identification of Degradation Compounds in Hydrolysate
The hydrolysate from steam explosion pretreatment of poplar at 210°C
and 4 min residence time was analyzed. Table 1 shows the quantitative
determination of degradation compounds identified. Results are expressed
as milligrams of the compound per liter of filtrate.
Applied Biochemistry and Biotechnology Vol. 105-108,2003
144 Oliva et al.
Table 1
Degradation Products Composition of Liquid Fraction
Obtained After Steam Explosion Pretreatment of Poplar
Compound Concentration (mg/L)a
Acetic acid 2100
Formic acid 430
Levulinic acid NQ
Furfural 490
5-HMF 80
4-Hydroxybenzaldehyde NQ
4-Hydroxybenzoic acid 100
Catechol 30
Guaiacol NQ
Syringaldehyde 50
Syringic acid NQ
Vanillin 14
Vanillic acid NQ
aNQ, not quantified.
Acetic acid (2100 mg/L) and furfural (490 mg/L), from hemicellulose
degradation of hardwood poplar, were the main compounds present in
the hydrolysate. 4-Hydroxybenzoic acid (100 mg/L) and syringaldehyde
(50 mg/L) constituted a large fraction of the lignin-derived compounds in
the hydrolysate.
Effects of Degradation Compounds on Growth and Fermentation
The inhibitory effect of various concentrations of toxic compounds on
growth and ethanol fermentation of K. marxianus CECT 10875 was investi-
gated. Cultures of yeast strain were grown in a glucose-containing medium
and supplemented with varying initial concentrations of degradation com-
pounds identified in the hydrolysate. Dose-response curves for ethanol
production and growth at 24 h were determined for all compounds. Results
of growth and ethanol concentration were expressed as percentage of the
control (one hundred percent of the control growth and ethanol production
is equivalent to 3.4 ± 0.1 giL and 12.3 ± 0.5 giL, respectively). Results for
acetic acid, furfural, 4-hydroxybenzaldehyde, 4-hydroxybenzoic acid, and
catechol are shown in Fig. 1. Experiments using formic and levulinic acids
showed results similar to acetic acid assays, results obtained using 5-HMF
were similar to 5-furfural, and those using syringaldehyde were similar to
4-hydroxybenzaldehyde (data not presented).
In all cultures, growth inhibition was more intensive than ethanol pro-
duction. Dose-response curves for growth in cultures supplemented with
4-hydroxybenzaldehyde and furfural exhibited a sigmoidal pattern, while
catechol followed almost a linear pattern. No total inhibition of both ethanol
Applied Biochemistry and Biotechnology Vol. 105-108,2003
Degradation Compounds from Sf on Fermentation 145
•• GROIIVTH
l00'l'=::~ __
O+-~~~~~-r~~~~~
0.00 025 0.50 0.75 1.00 1.25 1.50 1.75 123 4
4-HV0R0XYBENZALDEHYCE ~) 4-HYDROXYBfNZOICAClD~
GROWTH • GROWIlI
100. ETJ-WolOL 100 - - - ' - - t_ _ _ _ ETHANOL
• "!
l75 ~
i~
15
f2
~~
~
~
I~ ~
II::
25
0.0 0.5 1.0 1.5 20 2!> 3.0 0.0 2.5 1.5 10.0
F~FURAI.·(Wlj ACEllC ACID (Wlj
100 • GROIIVTH
l75
I~
I~
f2
100 c:=JpH 4
~pH5.5
75
~
d
~ 5.0
;
~
25
Ac Hb v Fe Le Sy
0.8 0.8
.. 0.6
0,4
B
l,a
1;6
:::J'
~
~1,2 1,2
~w 1),8 .....
o
:z
8 iM :0,4
b 2 4 68101214162224
T1ME(h}
Fig. 3. Assimilation profiles for K. marxianus CECT 10875 of (A) 1 giL and (B) 2 giL
of different aldehydes obtained in hydrolysate after steam explosion pretreatment of
poplar. (_) Furfural; (e) 5-Hydroxymethylfurfural; (A) Vanillin; (T) Syringaldehyde;
(.) 4-Hydroxybenzaldehyde.
Fig. 4. (opposite page) Conversion of aldehydes and ethanol production during glu-
cose fermentation by K. marxianus CECT 10875. (A) Furfural, (B) Vanillin, (e)
Syringaldehyde, and (D) 4-Hydroxybenzaldehyde.
2.0 12 1.0
/ 12
10 -110
0.& 10'
1.5
II ~
i
./]. i
& g
i 0.8 . s3'
u !
4 •
~
:-
11 ~O.5
0
v,
I
/ 2
r:I
0
,Ccl
- 0.0
c 0 I I ,
:; 25 ~
0 lQ lJlIE (h)15 20 o 5 W ft
~ ~1:
20 25
1":] ·,L
_ _ Elhanol TIME (h)
0
""0 _ _.Symgaldehyde -+- SyiInmI aIcohcil --"'hydfOllY~i(Ie~ 4-hyd~ 1IICOh«-+- Ethanol
...,
150 Oliva et al.
Ethanol production in the presence of 2 giL of vanillin (Fig. 4B) and
syringaldehyde (Fig. 4C) followed a similar pattern. These compounds
were metabolized completely by the microorganism after 16 h of fermen-
tation. As observed with furfural, the reduction of toxic aldehydes to their
corresponding alcohols was necessary for ethanol production to proceed.
Final ethanol concentrations close to 12 giL were obtained in both experi-
ments after 24 h of fermentation.
The results of Fig. 4D show that K. marxianus had the ability to reduce
1 giL of 4-hydroxybenzaldehyde after a lag period of 8 h. The reduction
rate was significantly slower in comparison to the other aldehydes tested,
so the microorganism needed an incubation period of 24 h to metabolize all
the 4-hydroxybenzaldehyde. At this time only 0.76 giL of 4-hydroxybenzyl
alcohol was obtained. A final ethanol concentration of 12 giL was achieved
after 30 h of fermentation.
Discussion
Degradation Compounds in Hydrolysate
All compounds found in the liquid fraction obtained from steam
explosion pretreatment of poplar biomass have been previously identified
in other hardwood hydrolysates (6-9). Acetic acid from hydrolysis 0 fhemi-
cellulose and furfural from degradation of xylose were obtained as a con-
sequence of the high xylan content in hard wood. Vanillin, which is formed
by degradation of guaiacylpropane units of lignin and syringaldehyde,
which are formed in turn by the degradation of syringyl propane units, has
been reported in hydrolysates from other hardwoods such as poplar (6,7)
and red oak (8). 4-Hydroxybenzoic acid constitutes a large fraction of lig-
nin-derived compounds in hydrolysates from the hardwoods poplar (7)
and willow (9).
Effect of Degradation Compounds on Growth and Fermentation
The effect of toxic compounds generated in the pretreatment of ligno-
cellulosic biomass has been examined in different microorganisms such as
prokaryotes (11-15), xylose-fermenting yeasts (16,17), and Saccharomyces
cerevisiae (17-23). However, no studies of the inhibitory effect on growth
and ethanol production of these compounds have been reported for the
thermotolerant yeast K. marxianus.
To interpret the results in the literature, it should be kept in mind that
the solubility of these compounds is limited. Thus, when a high concentra-
tion of a compound is tested, it is possible that, in fact, the microorganism
is exposed to a lower concentration (24).
At the concentrations tested, growth inhibition was observed for all
compounds examined. Cell growth was generally more influenced than
ethanol production for all conditions assayed.
Results from dose-response curves of the different compounds tested
showed that catechol and 4-hydroxybenzoic acid inhibit the growth of the
Applied Biochemistry and Biotechnology Vol. 705-708,2003
Degradation Compounds from Sf on Fermentation 151
yeast strain in a near linear pattern, indicating that the inhibition of growth
is closely related to the initial concentration of these molecules. However,
aldehydes exhibited a sigmoidal inhibition with a shoulder at low concen-
trations. Bacteria and yeasts have been shown to metabolize furans (20-22),
and aromatic aldehydes (15,17-19), although enzymes involved in the
metabolic pathways remain unknown in most cases. In our study the
assimilation of furfural, HMF, vanillin, syringaldehyde, and 4-hydroxy-
benzaldehyde by K. marxianus was demonstrated. The strain exhibited
higher assimilation rates for all aldehydes compared to what has been
reported for other glucose-fermenting microorganisms such as Klebsiella
pneumoniae (15), Saccharomyces cerevisiae, and Zymomonas mobilis (17).
According to Delgenes et al. (17), S. cerevisiae exhibited a lag assimilation
period of 24 and 30 h at an initial concentration of 2 giL of furfural and
vanillin, respectively. K marxianus, however, required only 8 and 16 h,
respectively, to completely assimilate these compounds.
The reduction of furfural to furfuryl alcohol at the beginning of fer-
mentation has been observed by other investigators (21,24), and is gener-
ally believed to be catalyzed by NADH-dependent alcohol dehydrogenase
(16). Furfural is a strong inhibitor of ethanol fermentation of K. marxianus.
A total conversion of furfural to the corresponding alcohol is needed to
start ethanol production. The conversion of furfural to furfuryl alcohol and
furonic acid has been reported for a number of yeasts such as S. cerevisiae
(20-22),Pichia (16), Turolopsis, and Rhodotorula (25). We have found furfuryl
alcohol as the only metabolite from furfural assimilation.
Likewise, vanillin and syringaldehyde were metabolized by
K. marxianus in the fermentation process and totally converted into their
corresponding alcohols. In experiments with 4-hydroxybenzaldehyde,
however, although all the aldehyde was assimilated by the tested strain, it
was only partially transformed to 4-hydroxybenzyl alcohol (76%), and an
unidentified compound was detected by HPLC analysis.
4-Hydroxybenzaldehyde was the most toxic aromatic aldehyde for
K. marxianus. At low concentration (1 giL), the yeast exhibited a lag period
of 8 h, but after prolonged incubation (24 h), this compound was completely
reduced. However, at a higher concentration (2 giL), only 25% of the initial
4-hydroxybenzaldehyde was metabolized after 24 h of incubation.
The conversion of vanillin (15,19) and syringaldehyde (15) to their
corresponding alcohols by microorganisms has been previously observed.
By contrast, Nishikawa et al. (15) found that microbial metabolism of van-
illin and syringaldehyde led to the production of other compounds. In the
metabolism of vanillin, besides vanillyl alcohol, veratrole and several uni-
dentified self-condensation products were detected. Analogously, in the
metabolism of syringaldehyde a multitude of minor products, none domi-
nating, was observed.
Several potential mechanisms for the toxicity of aldehydes have been
suggested (11), including damage from chemical reactivity, direct inhibi-
tion of glycolysis and fermentation, and plasma membrane damage.
Conclusion
Growth and alcoholic fermentation of glucose by K. marxianus CECT
10875 was significantly affected by the presence of biomass decomposition
products. The results showed that growth is more affected than ethanol
production. The degree of inhibition caused by the toxic compounds greatly
depended on the nature and concentration of inhibitor. At inhibitor con-
centrations found in the hydrolysate of steam-exploded poplar biomass, no
single inhibitor completely inhibited growth or fermentation.
4-H ydroxybenzaldehyde and catechol were the most powerful inhibi-
tors of growth and ethanol production. Many of the aldehydes were me-
tabolized by the microorganism to their corresponding alcohols, which
resulted in the removal of the toxic compounds and partial recovery of both
growth and ethanol production.
K. marxianus CECT 10875, a strain selected for resistance to tempera-
ture, exhibited resistance to aromatic compounds and HMF. The yeast
strain showed higher aldehyde assimilation rates in comparison with other
fermentation microorganisms.
References
1. Lynd, L.R.,Wyman, C.E. and Gerngross, T.V. (1999), Biotech. Prog. 15,777-793
2. Sun, Y. and Chen, J. (2002), Bioresour. Technol. 83,1-11.
Enzymatic Hydrolysis
of Ammonia-Treated Rice Straw
Abstract
Rice straw pretreated with liquid anhydrous ammonia was hydrolyzed
with cellulase, cellobiase, and hemicellulase. Ammonia-processing condi-
tions were 1.5 g of NH3/ g of dry matter, 85°C, and several sample moisture
contents. There were four ammonia addition time (min)-processing time
(min) combinations. Sugars produced were analyzed as reducing sugars
(dinitrosalicylic acid method) and by high-performance liquid chromato-
graphy. Monomeric sugars increased from 11 % in the nontreated rice straw
to 61% of theoretical in treated rice straw (79.2% conversion as reducing
sugars). Production of monosaccharides was greater at higher moisture
content and was processing time dependent. Glucose was the monosaccha-
ride produced in greater amounts, 56.0%, followed by xylose, arabinose,
and fructose, with 35.8, 6.6, and 1.4%, respectively.
Index Entries: Sugars; rice straw; ammonia treatment.
Introduction
Rice straw is one of the most abundant agricultural wastes in Califor-
nia and Central Venezuela, accounting for more than 1.5 and 0.9 million
t/yr, respectively (1,2). Brazil, Colombia, Peru, Mexico, and Argentina
also have considerable amounts of rice straw. Recently, rice has been
considered one of the four top crop priorities in Venezuela, which will
make the quantity of straw increase.
Ammonia Processing
A laboratory-scale batch ammonia reactor unit consisting of a 4-L reac-
tor with appropriate support equipment was used for the treatment of rice
straw. A 15% moisture (wet weight basis [wwb]) rice straw was hammer
milled to nominally l-in. length and kept under refrigeration until used.
Water (adjusted to experimental level) and liquid anhydrous ammonia were
added to 80-g samples (dry matter [DM]), and the temperature was rapidly
raised to 85°C. After the treatment time, pressure was suddenly released
and the treated samples were collected and allowed to air-dry overnight.
Moisture contents are expressed in wet weight basis.
Ammonia treatment conditions were as follows: 15,35, and 60% mois-
ture content; 1.5 g of NH3/ g of DM; and four ammonia delivery time-dwell
time combinations (1-0,4-0,4-5, and 4-20). Delivery time refers to the time
the required amount of ammonia takes to get into the reactor chamber.
Dwell time refers to the time allowed after the ammonia gets in the reactor
until decompression occurs, when ammonia is removed from the chamber.
Treatments and analyses were carried out in duplicate. Untreated rice straw
was used as a control for all experiments. The experimental conditions are
presented in Table l.
Fiber Fractionation Analysis
Neutral detergent fiber (NDF), acid detergent fiber, and acid deter-
gent lignin were determined in triplicate to estimate cellulose, hemicellu-
lose, and lignin by standard fiber analysis. Solubles were calculated as the
fraction solubilized by the NDF solution and includes sugars, oligosaccha-
rides, pectin, protein, and some minerals (7).
Enzymatic Hydrolysis
Enzymatic hydrolysis was performed with unwashed pretreated
solids using cellulase (Spezyme CP; Genencor, Rochester, NY), cellobiase
(Novozym 188; Novo N ordisk, Franklinton, NC), and hemicellulase (Biofeed
Plus CT; Novo Nordisk), at a solids loading of 5% (w Iv), in 500-mL Erlenm-
eyer flasks containing 100 mL of 0.05 M citrate buffer (pH 4.8) placed at 50°C
at 100 rpm for 48 h in an incubator shaker (Innova 4300; New Brunswick
Scientific, Edison, NJ). Sodium azide was added for preservation (0.15%).
The first experiment was set with enzyme dosages of 2 and 5 IU I g of DM
using the ammonia-treated sample with the lowest NDF to determine the
best dosage and hydrolysis time. Sugar production was measured as reduc-
ing sugars during 72 h with the dinitrosalicylic acid (DNS) method (8).
25
:E
0
0~
20
ai'
en
.Q 15
:3
Qj
u 10
·E
Q)
::I: 5
O+-------------,-----------,-------------l
20 30 40 50
Solubles, % DM
250~----------------------------------------~
200
ui~
a;O 150
::1 __
0l0l
!/)CD
Ol!/)
.~ 8
(,,):3
:3-
'O0l 100
CDOl
a::E
-+-21U/g
50
_51U/g
0
0 20 40 60 80
Time, h
376.2 for glucose, 164.6 for xylose, 35.5 for galactose, and 42.4 for arabinose,
making up a total of 618.7 mg/ g of DM.
Table 2 presents the results of the sugar yields after enzymatic
hydrolysis for all the unwashed treated samples and the untreated sample.
Reducing sugars were always higher than individual sugars determined
by HPLC, which indicates that there are dimers as well as oligomers.
Table 2
Reducing (DNS) and Individual Sugars (HPLC)
from Enzymatic Hydrolysis of Untreated and Ammonia-Treated Rice Straw
Sugars (mg/ g DM)
HPLC·
Total DNS reducing
Sampleb G X Gal A F sugars sugars
Untreated 66.3 <0.4 2.8 <0.3 <0.4 69.1 82.4
4-20-15 90.4 63.1 <0.5 6.2 8.8 168.5 220.5
4-20-35 173.8 162.8 32.5 <0.3 8.5 377.6 482.8
4-06-35 152.5 138.9 <0.5 26.5 7.6 325.5 406.8
4-20-60 148.3 141.8 <0.5 27.5 7.1 324.7 450.5
4-00-35 126.0 68.5 1.7 14.2 6.9 217.3 231.7
1-05-60 177.4 102.4 <0.5 18.7 7.7 306.2 387.0
4-05-60 207.8 133.0 <0.5 24.4 5.9 371.1 489.8
1-00-60 150.0 39.9 <0.5 9.7 6.4 206.0 268.6
4-00-60 148.0 77.1 <0.5 16.7 7.9 249.7 302.3
aG, glucose; X, xylose; Gal, galactose; A, arabinose; F, fructose.
bNumbers refer to ammonia delivery time (min), dwell time (min), and moisture content
(%, wwb).
The difference rose to 25% for high sugar conversion treatments. The rela-
tionship between both determinations is linear as shown in Fig. 3. Total
reducing sugars increased from 82.4 mg/ g of DM (13.3% conversion) in the
untreated sample to 482.8 of mg/ g DM in one treated sample (78.0% con-
version), corresponding to a factor of 5.86, which shows the great efficiency
of the treatment. Similarly, a factor of 5.46 for total individual sugars was
found in the same treatment. Such treatment (4-20-35), which corresponds
to a delivery time of 4 min and a dwell time of 20 min for a 35% rice straw
moisture, was similar in sugar yield to a treatment (4-05-60) with the same
delivery time and a shorter dwell time (5 min) but with a higher rice straw
moisture (60%).
Complex interactions have been detected in several ammonia-treated
materials; generally, the severity of the treatment increases as moisture
content of the material increases-in other words, it appears that ammonia
needs water to be effective (3). In addition, since the dissolution is exother-
mal, biomass reaches a higher temperature than the reactor temperature,
therefore increasing the severity. The fact that the sugar yield obtained in
a treatment (1-05-60) with the same loading of ammonia, dwell time, rice
straw moisture content but with a shorter ammonia delivery time (1 min)
was 17.5% smaller (371.1 vs 306.2 mg/g of DM) appears to indicate that
time is needed for ammonia to dissolve and to make contact with the
material. Sugar production is linearly related to hemicellulose content
(reduced by solubilization) by the treatment, as Fig. 4 indicates, which
suggests that it can be used to predict sugar conversions from ammonia-
treated materials.
~ 450
c 400
CI
-a, 350
E
~ 300
~
:::l
250
III
.2 200
"-
CD
E 150
0
c: 100
0
E
S 50 •
~ 0
10 15 20 25 30
Hemicellulose, %DM
Conclusion
Enzymatic hydrolysis of ammonia-treated rice straw produced readily
available material as monosaccharides useful for several purposes. The
sugar yield values that we obtained are among the greatest values found in
the literature. Sugar and glucose yields were moisture and dwell-time
250
200
~ ]50
E::;;:
::EQ
Q/
;;:
100
Fig. 5. Effect of ammonia dwell time on sugars yield from rice straw (35% moisture)
for ammonia delivery time of 4 min. Unt, untreated; G, glucose, X, xylose; Gal, galac-
tose; A, arabinose; F, fructose.
250
200
~
E:=
::gQ
]50
Q/
;;
100
so
Fig. 6. Effect of ammonia dwell time on sugars yield from rice straw (60% moisture)
for ammonia delivery time of 4 min. Unt, untreated; G, glucose, X, xylose; Gal, galac-
tose; A, arabinose; F, fructose.
Acknowledgments
We gratefully acknowledge financial support from the Technological
Park of the University of Zulia (Maracaibo, Venezuela), Fonacit (Caracas,
Venezuela), and Fundacite-Zulia (Maracaibo, Venezuela.
References
1. Via senko, E. Y., Ding, H., Labavitch, J. M., and Shoemaker, S. P. (1997), Bioresour.
Technol. 59, 109-119.
2. MPC (2000), Ministerio de Producci6n y Comercio, Venezuela.
3. Ferrer, A., Byers, F. M., Sulbanin-de-Ferrer, B., Dale, B, E., and Aiello, C. (2000), Appl.
Biochem. Biotechnol. 84/86, 163-179.
4. Ferrer, A., Byers, F. M., Sulbaran-de-Ferrer, B., Dale, B, E., and Aiello, C. (2002), Appl.
Biochem. Biotechnol. 98-100, 123-134.
5. Ferrer, A., Byers, F. M., Sulbaran-de-Ferrer, B., Dale, B, E., and Aiello, C. (2002), Appl.
Biochem. Biotechnol. 98-100, 135-146.
6. Sulbaran-de-Ferrer, B., Ferrer, A., Byers, F. M., Dale, B, E., and Aristigueta, M. (1997),
Arch. Latinam. Prod. Anim. 5(Suppl. 1), 112-114.
7. Goering H. K. and Van Soest P. J. (1970), ARS-USDA, Handbook No. 379, The Agri-
cultural Research Service (ARS), Washington, DC.
8. Miller, G. L. (1959), Anal. Chem. 31,426-468.
9. Ehrman T. (1992), NREL Chemical Analysis and Testing Standards Procedure,
No. 002, National Renewable Energy Laboratory, Golden, CO.
10. Dale, B. E., Henk, L. L., and Shiang, M. (1985), Dev. Ind. Microbiol. 26,223-233.
11. Kaur, P. P., Arneja, J. S., and Singh, J. (1998), Bioresour. Technol. 66,267-269.
Abstract
Com stover is emerging as a viable feedstock for producing bioethanol
from renewable resources. Dilute-acid pretreatment of com stover can solubi-
lize a significant portion of the hemicellulosic component and enhance the
enzymatic digestibility of the remaining cellulose for fermentation into etha-
noL In this study, dilute H 2SO4 pretreatment of com stover was performed
in a steam explosion reactor at160°C, 180°C, and 190°C, approx 1 wt % H 2S04,
and 70-s to 840-s residence times. The combined severity (Log10 [Rol-pH), an
expression relating pH, temperature, and residence time of pretreatment,
ranged from 1.8 to 2.4. Soluble xylose yields varied from 63 to 77% of theo-
retical from pretreatments of com stover at 160 and 180°C. However, yields
>90% of theoretical were found with dilute-acid pretreatments at 190°C. A
narrower range of higher combined severities was required for pretreatment
to obtain high soluble xylose yields when the moisture content of the acid-
impregnated feedstock was increased from 55 to 63 wt%. Simultaneous sac-
charification and fermentation (SSF) of washed solids from com stover
pretreated at 190°C, using an enzyme loading of 15 filter paper units (FPU) /
g of cellulose, gave ethanol yields in excess of 85%. Similar SSF ethanol yields
were found using washed solid residues from 160 and 180°C pretreatments
at similar combined severities but required a higher enzyme loading of
approx 25 FPU / g of cellulose.
Index Entries: Pretreatment; dilute-acid; acid hydrolysis; com stover;
enzymatic hydrolysis.
Introduction
Enzymatic utilization of the cellulose in lignocellulosic feedstocks
requires effective pretreatment to make the recalcitrant cellulose more
accessible to cellulase enzymes (1-8). Dilute-acid pretreatment can
improve enzyme accessibility to cellulose in pretreated lignocellulosic
feedstocks and solubilize a significant portion of the hemicellulosic com-
ponent under pretreatmenttemperatures ranging from 140 to 180°C (9,10).
In general, higher pretreatment temperatures and shorter reactor resi-
dence times result in higher soluble xylose recovery yields and enzymatic
cellulose digestibility (11).
A preliminary series of pretreatment experiments based on the litera-
ture was carried out using a 4-L steam explosion reactor at 160 and 180°C,
1% H 2S04, and 2 to 14-min reactor residence times. These conditions estab-
lished baseline total soluble xylose recovery yield for this reactor and could
be readily scaled up to the National Renewable Energy Laboratory's
(NREL's) Pilot Development Unit (PDU) vertical Sunds Hydrolyzer
(12,13). However, the maximum total xylose yield obtained in this series
of experiments was 77% of theoretical value, well below our goal of >85%.
In an attempt to increase soluble xylose recovery yield, the temperature
range was increased to 190°C with 1.0-1.1% (w/w) H 2S04 , and 70-s to
4-min reactor residence time. The combined severity factor (Log lO [RaJ -
pH) (14,15) for these higher temperature pretreatment conditions was in
the 1.9-2.2 range. These higher-temperature conditions were based on
modeling results reported in the literature, which suggest that 90% of the
corn stover xylan can be solubilized in 1 min, using H 2S04 concentrations
>0.9% (w /w) and pretreatment temperatures >190°C (9). In addition, the
effects of dewatering methods and moisture content of input corn stover
on pretreatment xylose yields were also investigated (16).
An important goal of pretreatment is to increase the enzymatic digest-
ibility of cellulose remaining in pretreated biomass residues. Higher-tem-
perature dilute-acid pretreatment has been shown to increase cellulose
digestibility of pretreated residues (8). The present study compares the
digestibility of cellulose remaining in corn stover residues pretreated at
160,180, and 190°C using a simultaneous saccharification and fermentation
(SSF) assay (17). The SSF assay was chosen over the standard enzymatic
saccharification assay because of the lower enzyme loading, reaction tem-
peratures, and removal of enzymatic end-product inhibition.
--
iii
u
;;
95
.160"C.I997.prcsscd
...0
Q)
90
+180°C,l997,prcsscd
X U§)OC,l998,airdricd
Q)
.c 85
e l90"C.l997.airdried
I-
--
.t. I9O"C.I 998.prcsscd
0~
80
~
Q)
>
0
75
u
Q)
II: 70
Q)
I/)
0 65
>.
><
Q) 60
:a;:,
"0 55
en
50
1.8 1.9 2 2.1 2.2 2.3 2.4 2.5
Combined Severity (LoQ,o(Ro)-pH)
Fig. 1. Total soluble xylose yields from pretreatment experiments using acid-
impregnated corn stover at various temperatures, combined severities, harvest years,
and dewatering methods after acid soaking. (.) Pretreatment at 160°C using 1997
feedstock pressed to approx 50 wt% solids; ( • ) pretreatment at 180°C using 1997
feedstock pressed to approx 50 wt%; ( x ) pretreatment at 180°C using 1998 feedstock
partially air-dried to 47wt%; ( • ) pretreatments at 190°C using 1997 feedstock par-
tially air-dried to 46-wt%; (A) pretreatments at 190°C using 1998 feedstock pressed
to approx 47 wt% solids.
the two sets of experiments performed at 180 and 190°C, in which the
soluble xylose yields are comparable between pressed and partially air-
dried acid-impregnated feedstocks.
The effects of increased moisture in the acid-impregnated feedstock
on soluble xylose yields for pretreatments at 190°C are shown in Fig. 2. As
the solids content of the acid-impregnated feedstock decreased, the soluble
xylose yields at lower severities decreased. The effect is similar to decreas-
ing the pretreatment temperature to 180°C. However, as the severity of
pretreatment was increased, the soluble xylose yield increased above 90%
theoretical, then rapidly dropped off as the conditions became more
severe. The peak (combined severity approx 2.13) is rather abrupt, and the
optimal condition would be difficult to maintain in a large-scale pretreat-
ment reactor where a few seconds' change in either direction for residence
time would significantly alter yield. The much broader maximum associ-
ated with the drier, higher-solids-content acid-impregnated feedstock
would allow a large-scale pretreatment reactor to maintain conditions
necessary for maximum yield even though process conditions varied
somewhat during operation. The higher acid loading associated with
Applied Biochemistry and Biotechnology Vol. 105-108, 2003
Dilute-Acid Steam Explosion of Corn Stover 171
100.-------------------------------------------------~
--
iii 95
.
u
;:;
CD
0 90
CD
.c
.... 85
tf.
.....
3l
.! 80
>
•
CD
75
.2
>-
>< 70
.!!!
.Q
:::s
'0 65
en
60
60 70 80 90 100 110 120 130 140 150 160
Pretreatment Time (8)
100
--
(ij
0
90
80
~~-----------------.------ ~~
...
~
Qj
0
Qj 70
~
~
;,.!! 60
l?....
"C
Qj 50
:;:
'0 40
C
C'II
~ 30
W __ I .2m,n.25FPl..g ~ 16O'C. m,n.25FPl g
L&.. 20
en
en
10
0
0 20 40 60 80 100 120 140 160 180
Time (h)
The effects of enzyme loading on initial rates and final extent of reac-
tion for converting cellulose to ethanol from corn stover pretreated at 160°C
are shown in Fig. 4. Pretreatment of corn stover was carried out in a 4-L
steam explosion reactor at 160°C for 14 min, with 1.07% H 2S04 , The SSF
assays were carried out with S. cerevisiae DsA yeast with enzyme loadings
of approx 5,15, and 25 FPU / g of cellulose. Solids were loaded to give final
cellulose content of 6 wt% based on NIR analysis of the 160°C pretreated
residue.
Figure 5 shows the effects of enzyme loading on ethanol yields in SSF
fermentations at 32°C for an exhaustively washed residue resulting from
pretreatment of corn stover at 190°C. The cellulose loading was adjusted to
give 6 wt% based on wet chemical analysis of the residue. Ethanol yield is
based on the total expected from the amount of cellulose loaded into each
fermentation flask.
The preceding results show that >90% soluble xylose recovery yield
and >90% SSF cellulose digestibility can be obtained from corn stover using
dilute-acid steam explosion pretreatment at 1% H 2S04 (before steam addi-
tion), 190°, and short residence times (90-11 0 s). Lowering the pretrea tment
temperature to 160 or 180°C, and increasing the residence times to obtain
a combined severity factor similar to 190° pretreatments, resulted in lower
xylose recovery yield and lower cellulose digestibility.
There are several possible causes for the lower yields at lower pre-
treatment temperatures. First, high temperature and short residence times
-
'ii
u
:;:
90
e0 80
Q) 70
or.
-
~
#. 60
'tJ
a; 50
>= 40
'0
..
c
as 30
or. _5FPU/g
W 20
LL. ___ 15FPU/g
en
en 10 --.- 25 FPU/ g
0
0 50 100 150 200
Time (h)
Fig. 4. Effects of enzyme loading on initial rates and final extent of reaction for
converting cellulose to ethanol. Pretreatment of corn stover was carried out in a 4-L
steam explosion reactor at 160°C for 14 min with 1.07% H 2S04 •
100
.-.. 90
iij
U 80
:;...
0 70
GI
J::.
I-
60
.....
~
0
"C 50
Gi
:; 40
0c
- 30
CIS
J::.
W
u.. 20
U)
U)
10
0
0 20 40 60 80 100 120 140 160 180
Time (h)
Fig. 5. Effects of enzyme loading on initial rates and final extent of reaction of
converting cellulose to ethanol. Pretreatment of corn stover was carried out in a 4-L
steam explosion reactor at 190°C for 90 s with 1.06% H 2S04 •
Conclusion
Acid-catalyzed steam explosion pretreatment of corn stover (preim-
pregnated with 1% H 2S04) produced digestible residues and solubilized
significant amounts of the hemicellulosic fraction. Soluble xylose yields
varied from 63 to 77% of theoretical from pretreatments of corn stover at
160 and 180°C. However, soluble xylose yields >90% of theoretical were
found with dilute-acid pretreatments at 190°C.
The effect of starting total solids content in the range studied (37-47%)
did not have a significant impact on peak xylose yield at 190°C; however,
the peak xylose yield shifted to longer residence times, from about 90 to
about 130 s. The longer residence time is presumably required because of
greater heat capacity and slower heat transfer throughout the wetter bio-
mass. The higher-solids feedstocks had a broader range of pretreatment
reactor residence time for achieving maximum xylose yields and thus are
more desirable from a process control viewpoint.
SSF of washed solids from corn stover pretreated at 190°C, using an
enzyme loading of 15 FPU / g of cellulose, gave ethanol yields in excess of
85%. Similar SSF ethanol yields were found using washed solid residues
from 160 and 180°C pretreatments at similar combined severities but
required a higher enzyme loading of approx 25 FPU / g of cellulose.
Acknowledgment
This work was funded by the US Department of Energy, Office of
Fuels Development.
References
1. Grohmann, K, Himmel, M., Rivard, c., Tucker, M., Baker, J., Torget, R., and Graboski,
M. (1984), Biotechnol. Bioeng. Symp. 14, 139-157.
2. Lin, K W., Ladisch, M. R., Voloch, M., Patterson, J. A., and Noller, C. H. (1985),
Biotechnol. Bioeng. 27,1427-1433.
3. Weimer, P. J., Chou, Y. C. T., Weston, W. M., and Chase, D. B. (1986), Biotechnol.
Bioeng. Symp. 17,5-18.
4. Rolz, c., de Arriola, M. c., Valladares, J., and de Cabrera, S. (1987), Process Biochem.
22,17-23.
5. Torget, R., Werdene, P., Himmel, M., and Grohmann, K, (1990), Appl. Biochem.
Biotechnol. 24125, 115-126.
Abstract
Oligomer solubility could potentially play an important role in control-
ling the rates and yields in the thermochemical hydrolysis of hemicellulose
as a pretreatment for subsequent enzymatic conversion of cellulose. How-
ever, limited data or models are available to describe the aqueous solubility
of sugar monomers and oligomers. In this work, we measured the solubili-
ties of sugars common to many biomass feedstocks in the temperature
range of 2S-30°C. Then we reviewed solubility models for sugars from the
open literature. Finally, we applied models to test their ability to describe
this and other data reported in the literature. It was found that the solubil-
ity of sugar monomers was not well described by the ideal solubility law
or other more complex models. However, with an empirical adjustment to
the enthalpy of fusion, the ideal solubility law was able to approximately
predict the solubility of cello-oligomers. Based on these results, solubilities
for low molecular weight xylo-oligomers are predicted to investigate
their possible importance in pretreatment and define further experimental
measurements needed to improve our understanding of sugar and oligo-
mer solubility.
Index Entries: Hydrolysis; oligomers; pretreatment; solubility; sugars.
Introduction
Lignocellulosic biomass has the potential to become a valuable raw
material for the production of fuels and chemicals provided efficient and
economical means are developed to convert them into marketable prod-
ucts. Biological processing offers a particularly promising path to realize
such costs, and impressive improvements have been made (1). However,
further reductions in the cost of pretreatment and biological conversion of
Models
Ideal Solubility Model
The simplest method for predicting the solubility of carbohydrates is
to use the ideal solubility law, the thermodynamic derivation of which is
relatively straightforward (16). For a component to be ideal, no solvent can
appear in the solid phase(B) and the activity coefficient must be unity (17).
This implies that the solute does not form a hydrate at the given tempera-
ture, that the affinity between solute molecules is approximately the same
as the affinity between solute and solvent molecules, and that the solute
and solvent have similar molecular volumes (16). With these assumptions,
dissolution is thermodynamically equivalent to melting the solute, and the
change in free energy of dissolution (6.G dis ) is equated to the change in free
energy on melting (6.Gf ) at the dissolution temperature. By assuming that
there is no change in entropy, 6.Gf is equal to the change in enthalpy on
melting (6.Hf ) (16). The resulting expression is as follows:
-b.Hf(Tm-T) b.Cp(Tm-T) p
In(X )=---- + - - - -b.C
-In(Tm)
- (1)
R TmT R T R T
Equation 1 is the first form of the ideal solubility law, in which X is the
mole fraction of solute in solution at saturation, T is the absolute tempera-
ture, Tm is the melting point of the solute, R is the ideal gas constant, and 6.Cp
is the heat capacity difference of the solute between pure solid and a
subcooled liquid at the dissolution temperature. However, because the
solute is thermodynamically stable only as a solid at the dissolution tem-
perature, 6.Cp is difficult, and in some cases impossible, to determine. Thus,
in the two most common forms of the ideal solubility law, an assumption
about 6.Cp is necessary. The first assumption is that it can be set to zero,
leading to (16)
(2)
In(X) = - b.HfIn
RTm
(TTm ) (3)
values for only monomers and a few dimers. Thus, it is necessary to esti-
mate these values for oligomers. The enthalpy of fusion at the melting
point temperature can be estimated by the entropy of fusion from the
relationl::.Hf =Tml::.Sf. Walden (18) observed that l::.Sfisabout 13cal/(K·mol)
(54 J/(K·mol) for a large number of organic compounds. However, the
values for l::.Hfcalculated using Walden's value for l::.Sfare much less than
the experimental values reported in the literature, for the monomers and
dimers for which the fusion enthalpies are tabulated. Thus, l::.Sfs were cal-
culated from the experimentall::.Hfs (see Table 1) and found to vary quite
widely. However, note that the values do not vary appreciably between
monomer and dimer.
With this in mind, values of l::.Sf that should not depend on chain
length were bracketed between 60 and 100 J / (K-mol) and used in the ideal
solubility law. For both the cello-oligomers and the xylo-oligomers, a mini-
mum and maximum solubility was calculated using these two values for
the fusion entropies, and these predictions were compared to experimental
values available in the literature.
UNIQUAC/UNIFAC
Activities are often applied instead of concentrations to compensate
for deviations from ideality in the liquid phase. Several methods have
been devised to predict the activity that incorporate a combinatorial term
(also called an athermal term), y f, that accounts for entropic effects arising
from differences in size between solute and solvent molecules, and/ or a
residual term, Yf, that accounts for energetic interactions such as Coulom-
bic forces and hydrogen bonding that are very temperature dependent
(18). UNIQUACand UNIFACaretwosuchmodels. They differinthe way
in which the residual term is calculated (19). Both methods treat the dif-
ferential heat capacity as a linear function of temperature. UNIQUAC
requires between five and six parameters for each component aside from
water, and UNIFAC requires more parameters, depending on the num-
ber of functional groups.
Peres and Macedo (8) applied UNIQUAC to determine a wide variety
of thermodynamic parameters for binary systems of D-glucose, D-fructose,
and sucrose in water. The same group later compared the UNIQUAC pre-
dictions with those obtained from the Flory-Huggins and entropic free-
volume models (9-11). Gabas and Laguerie (12) applied UNIFAC to
describe the solid-liquid-phase equilibria of the ternary system xylose, man-
nose, and water. Likewise, Abed et al. (13) used UNIFAC to describe the
phase equilibria at saturation of mixtures of water, sucrose, and glucose
along with water, sucrose, and fructose. Catte et al. (14), and Spiliotis and
Tassios (15) each created their own UNIFAC models using data from the
literature. None of these groups examined the solubility of a binary, sugar
monomer, or oligomer/water system over a wide temperature range,
although many of them included data from other researchers.
Other Models
The Flory-Huggins model has been applied to predict sugar solubili-
ties in some circumstances. It contains only a combinatorial term in the
activity coefficent, assuming that deviations from ideality can be accounted
for completely by the entropy of mixing, and requires knowledge of the
molar volume of solution (20). It is often applied to polymer solutions. The
entropic free-volume model is a refinement of the Flory-Huggins model in
which van der Waals volumes are used instead of molar volumes (10).
Table 2
Experimental Solubilities as Measured iln Mole Fractions"
Mole Fraction at Saturation
0.1
c O.OB
o
~
,"
U:0.06 Ideal Solubility Law Eqn. 3 ,. ,.,.
~
~,,/ .,'
o
...--" ,.,
-------
-,,-' ,----"1'
:::E 0 .04
0.02 --
_ ' ' _ ' • - •• Ideal Solubility Law Eqn. 2
O+----.----.----.-----.----.----.----.---~
20 25 30 35 40 45 50 55 60
Temperature ee)
0.06.---------------=0
8
0.05
c 0.04
o
~
U: 0.03
OJ
,.,. "
'0 Ideal Solubility Law Eqn. 3 ,., ,.
~ ...... "
" ....
::E 0.02
_......
0.01 f- - - - - -
f- • - - •. - • •
-= .. - - - ''1' '
Ideal Solubility Law Eqn. 2
o +---------,--------,---------,--------4
20 30 40 50 60
Temperature ee)
0.3
UNIQUAe
c
0.25
Taylor Experimental Fit
c 0.2
0
ti<tI
U:0.15
~
0
-----..-----":.....---
.... .....-- . .., ..
:::E 0.1 Ideal Solubility Law Eqn. 3 _
0.05
------ -...-.
•• _ •• - •• - ••
--- .. ~
Ideal Solubility Law Eqn. 2
0
20 30 40 50 60
Temperature ee)
.- . - . . ·r
c:
... 1
....!I
\
0 0.2 Ideal SokbiUty Law Eqn. 3 .... .......
'tl
!!! ....,.,
....
.......
•
......';
•
I
IL
.m 0.15 ... .' I
0
:E
_... .".."",. .."". ........ .. " !Ii
0.1
-
.. •• - II
0.05
•• - , - Solaity Low E," 2 I
0
20 30 40 50 60
Tel1ll8rature eC)
0.25 .------------------;E~
0.2
c:
~0.15
~
.m
-
~ 0.1 Ideal Solubilty Law Eqn. 3 ......... ..
~--- .....
_....... . .. """"
0.05 _-- _ •• ""f
-_ ...... -- . - - . ..--. ....... - I
I- • - - •• Ideal Solubility Law Eqn. 2
0+----~---~---_r---_1
20 30 40 50 60
Temperature eC)
0.01
0.005
0
20 30 40 50 60
Temperature ("C)
1.0E+00 , . - - - - - - - - - - - - - - - - - - - - ,
1.0E-05 +------,-----,-------,------;
20 30 40 50 60
Tel11l8rature ("C)
oligo (as xy[ose) mass fraction = oligo mass fraction X (150 X DP/MW) (5)
MW is the molecular weight of the oligomer and DP is the degree of
polymerization of the oligomer. Figure 4 shows that all of the xylo-oligo-
mers except for the trimer are predicted to have much greater solubilities
than the corresponding cello-oligomer. At room temperature, the solu-
bilities range from between 0.02 and 0.001 for xylobiose to 0.005 to 0.0001
for xylohexaose, corresponding to a range of mass percentages of about
1-20% for both species. This implies that, although they are much less
soluble than the xylose monomer, they are at least moderately soluble at
room temperature. When these predictions are extrapolated to 150°C, the
predicted solubilities are very high. The minimum predicted solubilities
of xylopentaose and xylohexaose at 120°C approach the experimental
solubility of the most soluble monomer, mannose, at room temperature
on the basis of mass fraction.
The next step was to compare these numbers with numbers expected
in an uncatalyzed batch hydrolysis to estimate how solubility might in-
fluence hydrolysis. For example, for biomass containing 25% xylan (on a
dry basis) in a batch system with 20% solids, the maximum oligomer mass
percentage in the liquor would be 6.25% (expressed as xylan equivalents)
at a yield of 100%. Converted to xylose equivalents, this maximum oligo-
mer mass percentage is 7.1 %. Figure 4 shows that at 120°C, the predicted
minimum mass percentages for xylobiose to xylohexaose are all >55% (as
xylose equivalents). Thus, for all oligomers with a degree of polymeriza-
tion <6, the maximum expected oligomer concentration would be much
less than the solubility of anyone of the oligomeric components, and for
temperatures exceeding 120°C, the solubility of any xylo-oligomer of
chain length <6 is not expected to be a limiting factor in batch hydrolysis.
However, higher molecular weight oligomers could still be a factor, but
their solubility could not be predicted because their melting points are
not known.
Conclusion
This work examined the solubilities of several monomers and oligo-
mers expected in biomass hydrolysis. The monomers were very soluble in
the temperature range of 20-30°C, with a mass fraction ranging from 28.22%
for galactose at 20°C to 77.75% for mannose at 25°C. The order of solubilities
0.1 X6 (min.)
0.0
20 40 60 80 100 120 140
Temperature ("C)
1.0 1----------~i=iiiI"'l"""""J
WO.9 X2 (max.) _~~
..m X3 (max.)
~0.8
·s X4 (max.)
'[0.7
CD
~0.6
>.
~O.S
c:
o
UO.4
~
IL
U) 0.3
:a
::E 0.2
0.1 +---.---.!:::......;~:....-__,_--___.__--__r_--...,......:=..J
B
20 40 60 80 100 120 140
Temperature ("C)
from most to least soluble is mannose, xylose, glucose, arabinose and galac-
tose. All of the solubilities were strongly temperature dependent, increasing
in solubility by at least 10% in a SoC increment. The data developed were in
close agreement with the values reported by most other researchers.
Neither Eq. 2 nor Eq. 3 of the ideal solubility law predicted the experi-
mental solubilities closely, although both equations predicted the correct
order of solubilities. UNIQUAC did closely predict some of the experi-
mental values reported in the literature. UNIQUAC was simulated using
the parameters reported by Peres and Macedo (8) and are presented in
Table 3. Not enough information was available to estimate the solubilities
of the other sugars using UNIQUAC, UNIFAC, Flory-Huggins, or the
Entropic Free-Volume models.
Table 3
UNIQUAC Parameters (9)
Glucose fixed parameters
To (reference temperature) 298.15 K
Tm (melting point temperature) 425.15 K
6.H (fusion enthalpy) 32432J mol
6.A (constant term for linear temperature dependent 6.C ) 139.5766 J/mol
6.B (slope term for linear temperature dependent 6.Cp ) p oJ/(mol·K)
Size parameters (dimensionless) Glucose Water
Q; (surface area parameter) 8.1528 0.92
R; (volume parameter) 7.92 1.4
a;j (slope term for linear temperature dependent interaction) Glucose Water
Glucose 0 -0.069
Water 0.277 0
Acknowledgments
We wish to thank the Thayer School of Engineering, Dartmouth Col-
lege for the use of its facilities. This work was funded by The National
Science Foundation Division of Bioengineering and Environmental Sys-
tems through contract BES-9985351.
References
1. Lynd, L. R., Wyman, C. E., and Gerngross, T. U. (1999), Biotechnol. Prog. 15,777-793.
2. Saeman, J. F. (1945), Ind. Eng. Chem. 37,42-52.
3. Jackson, R. F., Silsbee, C. G., and Profitt, M. J. (1922), Sci. Papers Bur. Stand. 20,588.
4. Taylor, J. B. (1957), Trans. Faraday Soc. 55, 1198-1203.
5. Young, F. E. (1957), ,. Phys. Chern. 61,616-619.
6. Gabas, N., Carillon, T., and Hiquily, N. (1988), ,. Chern. Eng. Data 33, 128-130.
7. Jacobsen, S. E. (2001), MS Thesis, Dartmouth College, Hanover, NH.
8. Peres, A. M. and Macedo, E. (1996), Fluid Phase Equilibria 123, 71-95.
9. Peres, A. M. and Macedo, E. (1997), Fluid Phase Equilibria 139,47-74.
10. Peres, A. M. and Macedo, E. (1997), Carbohydr. Res. 303,135-151.
11. Macedo, E. A. and Peres, A. M. (2001), Ind. Eng. Chern. Res. 40,4633-4640.
12. Gabas, N. and Laguerie, C. (1993), J. Cryst. Growth 128, 1245-1249.
13. Abed, Y., Gabas, N., Delia, M.L., and Bounahmidi, T. (1992), Fluid Phase Equilibria 73,
175-184.
14. Catte, M., Dussap, c., and Gros, J. (1995), Fluid Phase Equilibria 105, 1-25.
15. Spiliotis, N. and Tassios, D. (2000), Fluid Phase Equilibria 173, 39-55.
16. Neau, S. H., Bhandarkar, S. V., and Hellmuth, E. W. (1997), Pharm. Res. 14,601-605.
Abstract
The influence of the pressure in the ethanol/water pulping of sugarcane
bagasse was studied using argon pressure varying from 0.5 to 1.5 MPa. The
reaction volume and activation volume were studied. For the reaction vol-
ume, temperature and time were constant and pressure was varied, and for
the activation volume, temperature was constant and pressure and time were
varied. The degradation of cellulose was not promoted by the pressure with
positive reaction volume (4100 cm3 / mol). On the other hand, degradation of
xylan (polyoses) and lignin was strongly favored by the pressure and reac-
tion volume ranged from -1000 to -3000 cm3 / mol.
Introduction
Organosolv is a pulping process that uses organic solvents, and it has
been proposed as an alternative for chemical pulp production (1). An etha-
nol/ water mixture is one of the most promising organosolv delignification
process options because it combines high delignification rates with favor-
able conditions for organic solvent recovery, low cost, and abundance of
ethanol in countries where sugarcane is economically important (2).
We studied the influence of pressure of an inert gas (argon) in the
pulping of sugarcane bagasse. The effect of pressure can be evaluated by
the reaction volume ( V) and activation volume ( vt).
In any reaction
reactants (R) - transition state m- products (P)
Reaction volume, V, is given by V =V p - V R and activation volume,
V*, is defined by V* = v+ - V R •
v
V' > 0 (pre ure di favor)
o
o 6. V < 0 (pressure favor)
reaction coordinate
In k) = - L1 V+
( aapT RT
(2)
Hydrolysis of Pulp
One gram of dry pulp was treated with 10 mL of 72% H 2S04 with
stirring at 45°C for 7 min for the hydrolysis and solubilization of carbohy-
drates. The reaction was interrupted by adding 50 mL of distilled water,
and the mixture was then transferred to a 500-mL Erlenmeyer flask and the
volume completed to 275 mL with distilled water. The flask was auto-
claved for 30 min at 1.05 bar for the complete hydrolysis of carbohydrate
oligomers. The mixture was filtered and the hydrolysate completed to 500
mL with distilled water. A 40-mL sample of the hydrolysate was diluted
to 50 mL, and the pH was adjusted to 2.0 with 2 mol/L of NaOH. After
filtration in a Sep-Pak CIS cartridge to remove aromatic compounds (com-
ing from lignin derivatives), the hydrolysate was analyzed in an Aminex
HPX-87H column (300 x 7.8 mm) (Bio-Rad, Hercules, CA) at 45°C by using
a Shimadzu chromatograph and refraction index detector.
Applied Biochemistry and Biotechnology Vol. 705-108,2003
198 Gonc;alves and Ruzene
The mobile phase was 0.005 mol/L of H 2S04 at 0.6 mL/min. Sugar
concentrations reported as xylan and glucan with respect to the amount of
pulp were determined using calibration curves of pure compounds (10).
The dark solid obtained in the filtration after hydrolysis was oven-dried
and weighed. The obtained mass corresponded to the residual lignin in the
pulp and was reported as a percentage with respect to the pulp weight on
a dry basis. Mass balance is defined as the sum of the percentage of xylan,
glucan, and lignin present in the pulp, with respect to the pulp weight on
a dry basis. These values were also normalized to 100% and expressed in
centesimal form for calculations using Eqs. 3-5.
Results and Discussion
Reaction Volume and Activation Volume
Results for ethanol/water pulping of sugarcane bagasse as a function
of different argon pressures and reaction times are presented in Table 1. A
decrease was observed in the yield when the reaction time increased from
1 to 3 h and the pressure increased from 0.5 to 1.5 MPa. This was also
observed in the results of the viscosity, decreasing 20% when the reaction
time increased from 1 to 3 h and decreasing about 30% when the pressure
increased. Values of kappa number in 1 h decreased with an increase in the
pressure; for the 2-h reaction-time data, kappa number increased with an
increase in pressure, and at 3 h (excluding kappa number at 1.0 MPa),
kappa number also increased with an increase in pressure. Residual lignin
(RsL) follows kappa number, with an average relationship of RsL = 0.2 x
kappa. Viscosity to kappa ratio is a measure of the compromise between
carbohydrate preservation (high viscosity) and delignification (low kappa
number). Increasing pressure favored delignification but carbohydrates
were degraded to some extent.
The chemical composition of the organosolv pulps expressed as
glucan, xylan, and residual lignin is also given in Table 1. Xylan degrada-
tion occurred with an increase in the pressure and reaction time. This deg-
radation was also assessed by the xylan/ glue an content ratio.
The values of glucan, xylan, residual lignin, and total yield were used
for the determination of constants used in calculating the reaction volume
and activation volume.
Calculation of Reaction Volume
Initially, the following equilibrium situation was considered for each
individual component:
component in the pulp ~ component in solution
The total volume of the system was constant (closed vessel) and mass
values were used to determine equilibrium constants:
(K = concentrationcomponent in solution/ concentratio~omponent in pulp)'
Calculations of the reaction volume were made using concentrations of
glucan, xylan, residual lignin, as well as pulp yield.
Applied Biochemistry and Biotechnology Vol. 105-108,2003
),.
:g
i5'
Q..
OJ
o·
n
::,-
til
:3
in' Table 1
q-
'<: Ethanol/Water Pulping of Sugarcane Bagasse
::,
'"Q.. as Function of Argon Pressure and Reaction Time and Composition of Pulps
OJ (% in Dry Basis with Respect to Pulp WeighW
o·
iii
n::,- Mass
::,
Total Viscosity/ Residual Xylan/
0 Time Pressure yield Kappa Viscosity kappa lignin Glucan Xylan glucan Balance
~
'<: (h) (MPa) (%)b number (cP) ratio (%) (%) (%) ratio (%)
1 0.5 51.5 52.7 9.3 0.18 12.0 71.2 9.0 0.13 92.1
2 0.5 49.0 38.7 7.5 0.19 9.3 75.1 7.3 0.10 91.7
<..0
<..0 3 0.5 48.5 43.0 7.6 0.18 8.5 46.3 4.7 0.10 59.5
1 1.0 48.2 50.4 5.4 0.11 9.8 64.7 4.4 0.07 78.9
2 1.0 44.7 45.7 5.3 0.12 10.0 64.1 4.1 0.06 78.2
3 1.0 43.4 37.4 4.7 0.12 8.8 78.1 4.3 0.06 91.1
1 1.5 47.0 43.5 6.5 0.15 9.0 76.1 6.0 0.08 90.9
2 1.5 46.0 48.9 5.4 0.11 10.3 77.0 4.9 0.06 92.2
3 1.5 44.0 50.1 4.8 0.10 9.4 78.1 4.3 0.06 91.8
-Composition of original sugarcane bagasse: 43.7% glucan, 24.4% xylan, 28.0% lignin.
bTotal yield = (pulp weight/bagasse weight) x 100%.
~
~
Cl
,00
N
Cl
::2
)..
"0 Table 2
"0
~
Equilibrium Constants (K) for Glucan, Xylan, Residual Lignin, and Total Yield (Yt total) and Corrected Values
c...
OJ Equilibrium constants Corrected equilibrium constants
0'
~
" Time Pressure K K K K K K K
III
3 (h) (MPa) (glue an) (xylan) (residual lignin) (Yt total) (glucan) (xylan) (residual lignin)
in'
q-
'<: 1 0.5 0.2912 4.0957 3.6983 0.9418 0.1892 3.6932 3.3272
'":Jc... 1 1.0 0.5182 10.137 5.1470 1.0747 0.1979 7.7868 3.8499
OJ
0' 1 1.5 0.3237 7.3754 5.8642 1.1277 0.2033 6.6132 5.2396
~ 2 0.5 0.2866 5.6029 5.3717 1.0408 0.1798 5.0549 4.8428
~
":J 2 1.0 0.6524 11.887 5.4957 1.2371 0.2922 9.0779 4.0796
0
~ 2 1.5 0.3367 9.4785 5.1283 1.1739 0.2324 8.6612 4.6503
'<: 3 0.5 1.1084 9.3613 6.0432 1.0619 0.2545 5.165 3.1907
3 1.0 0.3968 11.656 6.6026 1.3042 0.2725 10.53 5.9259
N
3 1.5 0.3778 11.483 3.0202 1.2727 0.2648 10.46 5.4446
0
0
Table 3
Slopes of Straight Line In K = (- V /RD x p and Linear Correlations (r 2) and Corrected Values at Different Reaction Timesa
Linear correlations Corrected linear correlations
Residual Glucan + Yt Residual Glucan +
Glucan Xylan lignin xylan total Glucan Xylan lignin xylan
1 h, slope 0.1059 0.5888 0.461 0.1556 0.1802 0.0717 0.5826 0.4541 0.1427
1 h, r2 0.0298 0.4092 0.9409 0.1138 0.9325 0.9798 0.5519 0.9592 0.6778
~ 2 h, slope 0.1611 0.5257 -0.046 0.1539 0.1203 0.2567 0.5385 -0.041 0.1860
2 h, r2 0.341 0.464 0.4324 0.0705 0.4613 0.2793 0.685 0.0512 0.3921
a
-~ 3 h, slope -1.076 0.2043 -0.004 -0.6690 0.1811 0.0396 0.7056 0.5344 0.1195
,00
N
3 h, r2 0.7842 0.6955 0.0013 0.7812 0.6506 0.3334 0.7429 0.6336 0.6654
a
8 "Bold numbers (significant correlations) were used to calculate the results of the reaction volume and corrected reaction volume.
Effect of Pressure in EthanollWater Pulping 201
Table 4
Calculated and Corrected Reaction Volumes
Reaction volume Corrected reaction volume
(cm3 /mol) (cm3 /mol)
Time Residual Yt Residual
(h) Glucan Xylan lignin total Glucan Xylan lignin
1 -1757 -687 -273 -1730
2 -2052
3 4102 -779 -690 -2689 -2036
-~
~
N
g
W
Effect of Pressure in EthanollWater Pulping 203
Table 6
Calculated Activation Volume
Activation Residual Yt
volume Glucan Xylan lignin total
9549 2193 4912 -360
of sugarcane bagasse with acetone (-1533 cm3 / mol) (7). This fact explains
the decrease in kappa number and viscosity shown in Table 1.
Calculation of Activation Volume
For the calculation of activation volume, the same conditions used in
the calculation of reaction volume were initially considered. A first-order
kinetics was assumed and the rate constant was determined by Eq. 5.
Ln(pjxYt)=-kjxt (5)
in which ki is the rate constant for component i, Pi is the content of the
component i in the pulp (%), Ytis the pulp total yield (centesimalform), and
t is the time (h).
As already mentioned, the obtained values after the application of
Eq. 5 were corrected by the mass balance (Pi x Yt divided by the balance
in the centesimal form). The values of k obtained with the linear correla-
tions are given in Table 5 (original and corrected).
The values of activation volume were calculated using Eq. 2 and the
results of Table 5 (shown in bold, significant correlations).
The value of the activation volume was higher for glucan than for
xylan and lignin (Table 6), showing that degradation of the glucan was
disfavored by pressure. The use of pressure favored first the degradation
of the xylan followed by the lignin; glucan was degraded last.
The final yield was low owing to the delignification and degradation
of the xylans that causes the decrease in viscosity.
The easy degradation of the xylans can be explained by their ramified
and amorphous structure. The cellulose has a linear structure with crystal-
line and amorphous parts, being more difficult to intumesce (to increase
the volume) during the reaction. In an aqueous reaction, xylans tend to
swell more easily than the glucan and xylans tends to degrade, also pro-
moting dissolution of the lignin.
Conclusion
Reaction and activation volume can be calculated for complex systems
such as lignocellulose conversion by using appropriate equations, analyses,
and considerations. For the ethanol/water pulping of sugarcane bagasse,
pressure disfavored the degradation of cellulose and favored lignin disso-
lution. These facts are positive for the system, with kappa reduction. On the
Applied Biochemistry and Biotechnology Vol. 105-708,2003
204 Gom;alves and Ruzene
other hand, xylans were easily degraded by the pressure, decreasing the
viscosity of the obtained pulps. The use of pressure for the conversion in
terms of yield was disfavored, and favored with respect to delignification.
Acknowledgments
We acknowledge financial support from Funda<;ao de Amparo a
Pesquisa do Estado de Sao Paulo and Conselho Nacional do Desenvolvi-
mento Cientlfico e Tecnol6gico.
References
1. Gilarranz, M. A, Oliet, M., Rodrigues, F., and Tijero, J. (1998), Canadian J. Chern. Eng.
76(2), 253-260.
2. Aziz, S. and Sarkanen, K. (1989), TAPPI J. 72, 169-175.
3. Ruzene, D. S. (2001), MS thesis, Faenquil/Debiq, Lorena, Brazil.
4. Stochel, G. and Eldik, R. (1999), Coord. Chern. Rev. 187,329-332,.
5. Asano, T. and Noble, W. J. (1978), Chern. Rev. 78,407-489,.
6. Gonc;alves, A R. and Schuchardt, U. (1999), Appl. Biochern. Biotechnol. 77-79,127-132.
7. Benar, P. and Schuchardt, U. F. (1989), in Brazilian Symposium on the Chemistry of
Lignins and Other Wood Components, vol. 1, Sao Carlos, Brazil, pp. 186-192.
8. TAPPI (1985), TAPPI Standard Methods, T 236 cm-85, Technical Association of Pulp
and Paper Industry, TAPPI, Norcross, GA
9. TAPPI (1982), TAPPI Standard Methods, T 230 om-82, Technical Association of Pulp
and Paper Industry, TAPPI, Norcross, GA
10. ASTM (1956) Standard Test Methods for Lignin in Wood, ASTM Method D 271-48,
American Society for Testing Materials, Philadelphia, PA
Abstract
Silica and alkali metals in wheat straw limit its use for bioenergy and
gasification. Slag deposits occur via the eutectic melting of Si02 with K20,
trapping chlorides at surfaces and causing corrosion. A minimum melting
point of 950°C is desirable, corresponding to an Si02:K20 weight ratio of
about 3:1. Mild chemical treatments were used to reduce Si, K, and Cl, while
varying temperature, concentration, % solids, and time. Dilute acid was more
effective at removing K and Cl, while dilute alkali was more effective for Si.
Reduction of minerals in this manner may prove economical for increasing
utilization of the straw for combustion or gasification.
Index Entries: Bioenergy; combustion; gasification; fluidized bed; silica;
potassium; chloride; slagging.
Introduction
Agricultural crop residues are a valuable renewable resource from
which to produce biobased products. In 1999, American farmers harvested
53,909,000 acres of wheat (1). The straw from this acreage of wheat repre-
sents more than 100,000,000 tons annually. Currently, some of the straw is
harvested (baled) for use as livestock bedding or low-grade animal feed.
However, these low-value uses provide only a minimal return. Nationally,
only about 3.2% of the economic return on wheat is from straw (1). Produc-
ers have long recognized the potential economic and environmental ben-
efits in producing bioenergy and bioproducts from excess wheat straw
Mineral analysis by ICP (9) was done to validate EDS results (> 1 wt%
K and Ca, <1 wt% P, K, S, Mg, Fe) and quantify trace elements «0.1 wt%),
particularly the composition of straw micronutrients in the ash, such as Cu,
Zn, Mn, and B. Straw samples and standard reference material! calibration
standards used for the EDS analyses were shipped to Western Labs (Parma,
removal was offset by the removal of organic matter, and the concentration
in the washed stems remained the same. Alkaline washing dissolved up to
20% of the Si02 and slightly lowered the final Si02 concentration in the
straw. However, the Si02 /K20 ratio was lowered because a less-than-pro-
portional amount of K was removed.
The effect of wash solution and temperature on loss of heating value
is shown in Fig. 3. For these calculations, all components of the organic
matter were assumed to be of equal heating value per unit weight. In gen-
3.0
-"
~
2.0 N0
1.0 N
0
Fig. 1. Si02 /K20 ratio after acid, alkali, or water washing of straw stems at various
temperatures. DI, distilled water.
80
60 5
N
40 -
20 "Q
o
0.2 wt%Acld
0.1 wt"fo Alkali
01 Water
Fig. 2. Si02 /KCl ratio after acid, alkali, or water washing of straw stems at various
temperatures. DI, distilled water.
12
10 ';ft.
8 OJ
.....
6 c::
-
4 r
o
III
2
Fig. 3. Loss of heating value as function of acid, alkali, and water washing of straw
stems at various temperatures. DI, distilled water.
100
- 80
-
iU
o • Cellulose
I- 60 ~ Hemicellulose
o o Lignin/Extractives
?fl. 40 E:;1 Ash
• Other organics
20 on Weight loss
o
None 25 37 50
Temperature (OC)
Fig. 4. Mass balances with increasing temperature for unwashed and washed straw
stems using distilled water at 4% solids for 4 h.
100
80
60 • Cellulose
r.a Hemicellulose
o Lignin/Extractives
40 ~ Ash
• Other organics
20 lID Weight loss
o
None 25 37 50
Temperature (OC)
Fig. 5. Mass balances with increasing temperature for unwashed and washed straw
stems using 0.1 wt% NaOH at 4% solids for 4 h.
100
80
so
-
t-
o
~
60
40
•
riI
o
fJ Ash
Cellulose
Hemicellulose
Lignin/Extractives
• Other organics
20 an Weight loss
o
None 25 37 50
Temperature (OC)
Fig. 6. Mass balances with increasing temperature for unwashed and washed straw
stems using 0.2 wt% H 2S04 at 4% solids for 4 h.
or pH was not high enough to effect significant lignin removaL In the alkali
washes, there were only small losses of hemicellulose and cellulose, while
the overall ash removal was similar at all temperatures tested. Again,
inspection of Fig. 2 shows higher removal of KCl at higher temperatures.
Figure 6 shows the mass balances for the 0.2 wt% acid washes. There were
increased losses of organic matter with increased temperature, with greater
hemicellulose losses occurring in the 25 to 37°C step than in the 37 to 50°C
step. Cellulose removal mirrored the hemicellulose removal with increas-
ing temperature, while higher losses of other organics" occurred in the 37
II
to 50°C step. Ash removal also increased with increasing temperature, and
there were no significant losses of lignin.
The effects of additional parameters, including % solids, acid concen-
tration, and the use of whole straw vs straw stems, on the organic compo-
100
-
80
-
iii • Cellulose
o 60
I- 12 Hemicellulose
o o ligninfExtractives
';Ie 40 &:I Ash
Other organics
20 lID Weight loss
o
None 2 4 16 16
%-Solids (wt%)
Fig. 7. Mass balances with increasing % solids for unwashed and washed straw
stems using distilled water at 25° for 4 or 24 h.
nent mass balances are shown for selected experiments in Figs. 7-9. The
values of 5i02 /K20, 5i02 /KC1, and the percentages of the ash represented
by 5i02, K20, and KCl are given in Table 2 for these experiments. Figure 7
compares a 24-h, 15 wt% solids wash and a 4-h, 16 wt% solids wash of straw
stems. Note that distilled water is a slightly more aggressive solvent than
tap water because it has been demineralized; thus, the distilled water
washes indicate the maximum removals possible using water. Equilibrium
was reached by 4 h in all washes. The effect of % solids (solids loading) in
the distilled water washes is also shown in Fig. 7. Increasing the % solids
resulted in decreased removal of both organic matter and minerals. This
occurred whether the straw remained submerged in the bulk liquid or was
only partly submerged (15% solids). This indicates that the process is solu-
bility limited as long as the straw is submerged and may become liquid-
solid contact limited at solids loadings as high as 15% solids.
It was also observed that the differences between mineral removal at
low and elevated temperatures (37 and 50°C; not shown) were not as great
at higher mass loadings, since solubility limits the amount of material that
can be dissolved, rather than the more aggressive solvent characteristics
secured at the higher temperature. Washing with water removed 11.1 % of
the mass of straw in a 4% fully submerged suspension, while only 6.8%
mass was removed in a 15% partially submerged suspension. The ash con-
centration of unwashed straw was reduced to 4.6% in the 4% solids water
wash, but to only 6.7% in the 15% solids wash. A continuous wash that
lowers the effective "loading" even further would overcome the solubility
limitations and may result in higher mineral losses than experienced in
these batch experiments. However, acidic or alkaline washing in a continu-
ous process may present some difficulty in removing the residual wash
fluid from the straw if residual 504 or Na is not desirable. In the specific case
ofNa, this would definitely not be desirable, since both Na and K contribute
to the eutectic composition and lower the ash fusion temperature. The straw
stems absorbed about 3.7 times their weight of water, and chopped whole
straw absorbed 4.2 times its weight. Thus, residual 504 or Na might be
difficult to remove efficiently without significant further water washes.
Mass balances for washing of straw stems at 25°C with dilute acid at
various acid concentrations are shown in Fig. 8, while Fig. 9 shows the same
for whole straw at 50°C. Higher acid concentrations were required to reach
the same SiOz/KzO ratios for whole straw as reached for stems at 50°C (not
shown). Still, Si02 /K20 ratios obtained with whole straw approached the
minimum acceptable level of 3.0. However, the whole straw contains larger
amounts of silica (separated from the stem fraction in the selective harvest),
and therefore has greater slagging potential. Both the mineral and organic
content removed increased with higher acid concentrations. The highest K
removal without excessive loss of organic matter was achieved at 50°C with
0.2 wt% H 2S04 in a 4% straw suspension (see Fig. 2). The SiOz/K20 ratio
100
--....
80
(ij
• Cellulose
o 60 ~ Hemicellulose
o
o Lignin/Extractives
~ 40
&1 Ash
o • Other organics
IDl Weight loss
20
o
None 0.0 0.2 0.4 1.0
Acid (wt%)
Fig. 8. Mass balances with increasing acid concentration for unwashed and washed
straw stems using dilute H 2S04 at 25° for 4 h, at 4 % solids.
100
--
ca
o
I-
o
80
60 •
rA
o
Cellulose
Hemicellulose
LigninlExtractives
eft. 40 &1 Ash
• Other organics
20 IDl Weight loss
o
None 0.0 0.2 0.4 1.0
Acid (wt%)
Fig. 9. Mass balances with increasing acid concentration for unwashed and washed
of whole chopped straw using dilute H 2S04 at 50° for 24 h at 10% solids.
achieved in this run was approached with whole straw (Si02 /K20 of 2.8) at
10% solids, which was not achievable with stems alone at 10% solids. This
may be because the whole straw starts at a higher Si02 /K20 ratio than
stems alone, since the mechanical stem separation concentrated the alkali
metals relative to the silica in the stems. In any event, lowering the solids
content would probably produce washed straw with an Si02 /K20 ratio
above the desired minimum of 3.0.
Generally, cellulose and hemicellulose concentrations were not sig-
nificantly affected by dilute-acid washes with acid concentrations up to
0.4%. However, Fig. 8 shows significant loss of hemicellulose in a 1% H 2S04
wash. A 5 % H 2S04 wash (not shown) resulted in complete loss of both
cellulose and hemicellulose. In these experiments, the mass balances indi-
Acknowledgments
We thank the University of Idaho, Aberdeen Research and Extension
Center, for use of their plot-harvesting equipment for the mechanical sepa-
rations. We also thank Dr. Judi Steciak at the University of Idaho and Dr.
Robert Carrington at INEEL for useful discussions on biomass slagging
and combustion. Finally, we thank Tracy Houghton at INEEL, who per-
formed the quantitative saccharification analyses. This work was supported
by the US Department of Energy through the INEEL Laboratory Directed
Research and Development Program under DOE Idaho Operations Office
Contract DE-AC07-99IDI3727.
References
1. USDA NASS. (2001), United States Department of Agriculture, National Agricul-
tural Statistics Service (Website: http://www.usda.gov /nass/).
2. Stultz, S. C. and Kitto, J. B., eds. (1992), Steam: Its Generation and Use, 40th ed., Babcock
& Wilcox, Barberton, OH.
3. Jenkins, B. M., Baxter, L. L., Miles, T. R Jr., and Miles, T. R (1999), Fuel 78, 17-46.
4. Seggiani, M. (1999), Fuel 78, 1121-1125.
5. Weast, R c., Astle, M. J., and Beyer, W. H., eds. (1983), CRC Handbook of Chemistry and
Physics, 64th ed., CRC, Boca Raton, FL, p. B-135.
6. Steciak, J., (2001) personal communication (unpublished data), Department of
Mechanical Engineering, The University of Idaho, Boise, ID.
7. Hess, J. R, Thompson, D. N., Hoskinson, R L., Shaw, P. G., and Grant, D. R (2003),
Appl. Biochem. Biotechnol. 105-108, 43-52.
8. ASTM E1508. (1998), Standard Guide to Quantitative Analysis by Energy Dispersive Spec-
troscopy, American Society for Testing and Materials, Philadelphia, PA.
9. Gavlak, R G., Horneck, D. A., and Miller, R O. (1994), Plant, Soil, and Water Reference
Methods for the Western Region, Western Region Extension Publication 125, University
of Alaska Cooperative Extension Service, Fairbanks, AK.
10. (1994), Plant, Soil, and Water Reference Methods for the Western Region, Far West Fertil-
izer and Agrichemical Association.
11. Saeman, J. F., Bubl, J. L. and Harris, E. E. (1945), Ind. Eng. Chern. 17(1),35-37.
Abstract
Cotton gin residue (CGR) collected from five cotton gins was fractionated
and characterized for summative composition. The major fractions of the
CGR varied widely between cotton gins and consisted of clean lint (5-12%),
hulls (16-48%), seeds (6-24%), motes (16-24%), and leaves (14-30%). The
summative composition varied within and between cotton gins and con-
sisted of ash (7.9-14.6%), acid-insoluble material (18-26%), xylan (4-15%),
and cellulose (20-38%). Overlimed steam-exploded cotton gin waste was
readily fermented to ethanol by Escherichia coli K011. Ethanol yields were
feedstock and severity dependent and ranged from 58 to 92.5% of the theo-
retical yields. The highest ethanol yield was 191 L (50 gal)/t, and the lowest
was 120 L (32 gal)/t.
Index entries: Cotton gin waste; steam explosion; characterization;
summative composition.
Introduction
Raw cotton processing generates cotton gin residue (CGR), which is
composed of immature bolls, cottonseed, hulls, sticks, leaves, and dirt.
This material could potentially be used for ethanol production. The major
advantages of this feedstock over other lignocellulosics include high cot-
ton cellulose content and concentration of large volumes of this material
at cotton-ginning plants. Further, conversion of this feedstock to ethanol
could reduce particulate emission, reduce fire hazards from spontaneous
combustion of CGRs, and also create jobs in rural America.
However, because CGR is an agroindustrial byproduct, its chemical
composition varies considerably because of several factors including sea-
son, harvesting, and processing protocols. Several studies have been con-
ducted on CGRs (1-6), some of which showed that the fuel value of the
"Author to whom all correspondence and reprint requests should be addressed.
Determination of Extractives
The ethanol extractives content of the CGR was determined using
ASTM standard method E 1690-95(10). TheCGRsamples,10gof-20mesh,
were weighed into dry cellulose extraction thimbles and extracted for 8 h
with 350 mL of 95% ethanol in a Soxhlet extraction apparatus. After extrac-
tion, the samples were cooled to room temperature and the residual solids
were vacuum filtered using a Buchner funnel. The filtrate was added to the
ethanol extract and vacuum evaporated to dryness on a Buchii rotary evapo-
rator at 40°C and 84 kPa. The final product was dried overnight in a vacuum
oven, weighed, and the extractives content calculated on an oven-dry bio-
mass basis.
water. About 2 kg of each sample was weighed and loaded into a 25-L batch
steam explosion gun. Saturated steam was admitted into the chamber, and
the biomass temperature was raised to 237°C (this usually took 20 ± 5 s). The
run times for the severities 3.5 and 4.5 were 20 and 200 s, respectively. The
steam explosion chamber was washed with water between runs to recover
any residual fiber trapped in the unit. All samples were bagged and stored
in a cold room until the time of analysis or hydrolysis and fermentation.
Franklin 10.4 19.7 7.1 0.4 5.6 19.5 30.3 5.0 98.0
Emporia 5.3 35.6 7.1 0.4 12.7 16.1 21.3 0.6 99.1
Windsor 9.0 16.8 3.6 0.2 6.9 23.9 34.6 1.6 96.6
Suffolk 12.5 15.9 5.4 0.3 24.0 18.6 18.5 2.2 97.4
Wakefield 7.1 48.1 6.1 0.4 7.7 15.6 13.9 0.6 99.5
tions and sealed. The initial pH of the fermentation broth was 6.0. Fermen-
tation was carried out at 35°C and 120 rpm for 72 h. There was no pH control
during fermentation and no antibiotic was added to the fermentation broth.
Samples (1.5 mL) of the culture broth were withdrawn at 24-h intervals and
centrifuged at 11,000g for 10 min. The supernatants were collected and ana-
lyzed by gas chromatography for ethanol and sugar contents.
NonCarbohydrate Components
The extractives, acid-insoluble material, and ash contents of the
samples from the five cotton gins are presented in Tables 2-6. Within each
plant, there was no significant difference between the compositions of the
fresh discharge materials on different days. However, the composition of
the old discharge materials from all the gins was significantly different
(p < 0.05) from those of the fresh discharge samples.
The ash contents of the old discharge feedstocks were 15-70% higher
than those for the fresh discharge samples. The wide range of ash compo-
sition may be due to the differences in the microbial degradation of the old
discharge samples from different plants or the method used to move the
piles from the point of discharge. After the initial discharge of the CGR, the
material was moved away from the discharge area with a bulldozer and
compacted. It is plausible that this operation introduced more dirt into the
CGR, which could account for the increased ash content for all old dis-
charge materials.
Microbial degradation could have contributed to the increased ash
content of the old discharge feedstocks. It has been reported (15) that the
Applied Biochemistry and Biotechnology Vol. 105-108,2003
Composition and Ethanol Production of CGR 225
Table 3
Summative Composition of Cotton Gin Waste from Franklin, VA
(moisture-free whole-biomass basis)
Fresh Fresh Fresh Old
Component discharge discharge discharge discharge
(%) 10-21-00 10-22-00 11-25-00 10-210D-OO
Table 4
Summative Composition of Cotton Gin Waste from Windsor, VA
(moisture-free whole-biomass basis)
Fresh Fresh Fresh Old
Component discharge discharge discharge discharge
(%) 10-21-00 10-22-00 11-25-00 10-210D-00
Arabinan 1.75 ± 0.39 1.40 ± 0.38 1.32 ± 0.39 1.26 ± 0.50
Xylan 5.41 ± 0.50 6.20 ± 1.45 4.45 ± 1.14 5.23 ± 1.61
Mannan 1.01 ± 0.23 0.92 ± 0.17 1.01 ± 0.04 0.81 ± 0.22
Galactan 1.57 ± 0.12 1.51 ± 0.14 1.79 ± 0.41 1.28 ± 0.15
Gluean 26.95 ± 1.11 30.50 ± 1.55 29.05 ± 0.82 32.65 ± 1.59
Total carbohydrates 36.69 40.53 37.62 41.23
Extractives 8.2 ± 0.5 7.2 ± 0.3 13.9 ± 1.1 6.4 ± 1.8
Acid-insoluble residue 22.4 ± 0.2 25.2 ± 1.6 21.6 ± 1.1 20.6 ± 0.7
Ash 10.4 ± 0.2 9.9 ± 0.1 8.4 ± 0.7 12.3 ± 0.9
Grand total 77.69 82.83 81.52 80.53
Table 6
Summative Composition of Cotton Gin Waste from Wakefield, VA
(moisture-free whole biomass basis)
Component Fresh discharge Fresh discharge Old discharge
('Yo) 11-25-00 10-26-00 11-2500-00
The most surprising data were the high acid-insoluble material con-
tent of the samples (Tables 2-6). The fraction of cotton gin waste that was
insoluble in 72% H 2S04 was comparable with that found in woody biom-
ass (16,17). The acid-insoluble material from woody biomass is normally
classified as lignin. However, it would be erroneous to classify the mate-
rial from the CGR as lignin. Since CGR is a complex mixture of organic and
inorganic materials, there could be other acid-insoluble material apart
from lignin. A probable source of nonlignin acid-insoluble material is the
cottonseed. A typical cottonseed is composed of 32% hull, 23% protein,
gins had higher cotton lint content than others (Table 1). Consequently, this
could have influenced the glucan content.
Hydrolysis and Fermentation of Steam-Exploded CGR
When some samples of steam-exploded CGR were enzymatically
hydrolyzed and fermented without overliming there was no cell growth
and no ethanol was produced. However, when the steam-exploded sub-
strate was overlimed and hydrolyzed, the E. coli KOll grew very rapidly
and fermented the substrate to ethanol.
Ethanol yields were determined as a percentage of the theoretical yield.
The ethanol yield reported here is a combination of the fermentation of
xylose and glucose by E. coli KOl1. Although other minor sugars were
present in the steam-exploded substrates, it is not known that E. coli KOll
can ferment these sugars into ethanol.
Ethanol yield was a function of both steam explosion severity and the
source of feedstock (Table 7). At the higher severity (4.5), ethanol yields
were very low and similar for all samples from all the cotton gin plants.
The low yields at the high severity were attributed to inhibitory com-
pounds produced during the steam explosion. Although overliming of
lignocellulosic hydrolysates reduces enzyme and microbial inhibitors, it
does not necessarily restore cell conversion efficiency. It has been reported
(J. D. McMillan, personal communication, 2001; [211) that although cells
may grow in overlimed lignocellulosic hydrolysates, the product yield
may be reduced considerably. In the case of the CGR, the samples that
were steam exploded at a severity parameter of 4.5 and overlimed with
calcium hydroxide supported cell growth, but the ethanol yields were
very low. Ethanol yields were reduced from 92.5 to 21.7% for the Suffolk
gin CGR. Clearly, the choice of severity for CGR treatment is very impor-
tant for CGR fermentation and ethanol production.
The highest ethanol yield was achieved for samples treated at a sever-
ity 3.5 and overlimed with calcium hydroxide. It can be seen that the etha-
nol yields were considerably higher for all feedstocks at this severity com-
pared to the samples at a severity of 4.5 (Table 7). Interestingly, ethanol
yield was different for feedstocks from different cotton gins. This result is
of practical significance because product yield and therefore profitability
could be considerably affected by the source of feedstock.
Ethanol yield was highest (92.5%) for the feedstock from the Suffolk,
or equivalent to 191 Lit of CGR, while that from the Wakefield cotton gin
was the lowest (58%), or equivalent to120 Lit of CGR. Ethanol yield for
most feedstocks was better than those estimated by Beck and Clements (3)
for an acid hydrolysis process.
Conclusion
Production of ethanol from cotton gin waste appeared to be influenced
by several factors including feedstock origin, steam explosion severity,
sample heterogeneity, feedstock composition, and other unknown factors.
To optimize ethanol yield from this resource, some or all of these factors
have to be addressed. Feedstock composition appeared to vary consider-
ably even for samples taken within a ginning season. These feedstocks need
to be analyzed over a few years to establish an average compositional data
on which to base the expected ethanol yield for practical applications.
High steam explosion severities tended to create more inhibitory com-
pounds and these resulted in low ethanol yields. It appears that a severity
of 3.5 is adequate for ethanol production at a reasonable yield. Although
the process was not optimized, the highest ethanol yield for these feed-
stocks was 191 L (50 gal) I t, considerably higher than the 142.8 L (37.8 gal) I
t estimated by Beck and Clements (3) for an acid hydrolysis process.
Acknowledgments
We thank Eric Johnson and Robert Wright, Virginia Polytechnic Insti-
tute and State University, respectively, for assisting in the data collection and
steam explosion. We acknowledge L. O. Ingram, University of Florida, for
providing samples of E. coli KOl1. G. Virgil, Genencor, supplied Spezyme
CP enzyme for the hydrolysis. New York Enzyme Development supplied the
Econase enzyme for the hydrolysis. We also acknowledge MidAtlantic Cot-
ton Gin, Emporia, VA; Commonwealth Gins, Franklin, VA, and Windsor
VA; Suffolk County Gin, Suffolk, VA; and Wakefield Gin, Wakefield, VA for
the collect cotton gin waste. The US DOE through the Southern States Energy
Board and the Southeastern Regional Biomass Energy Program (contract no.
SSEB-SERBEP-2000-VA2-001) funded this project.
References
1. Jeoh, T. and Agblevor, F. A. (2001), Biomass Bioenergy 21,109-120.
2. Jeoh, T. (1999), MS thesis, Virginia Polytechnic Institute and State University,
Blacksburg, VA.
Abstract
The impetus for this paper is Canada's commitment under the United
Nations Framework Convention on Climate Change to reduce national
greenhouse gas emissions as well as reducing our dependency on fossil fuels.
Wood-based ethanol offers an excellent opportunity for greenhouse gas
mitigation due to market potential, an ability to offset significant emissions
from the transportation sector, a reduction of emissions from CO2-intensive
waste-management systems, and carbon sequestration in afforested planta-
tions. While there are technological and economic barriers to overcome, using
wood-biomass as a source of ethanol can be an economically viable tool for
reducing greenhouse gas levels in the atmosphere. This paper examines the
costs and mitigation potential of the production of ethanol from biomass
supplied from industrial wood waste as well as from trees harvested from
afforested land.
Index Entries: Ethanol; greenhouse gas; afforestation; wood waste; economics.
Introduction
Wood-ethanol's contributions to mitigating climate change include its
use as a substitute for fossil fuels and as an octane-boosting gasoline addi-
tive. Also, the wood -biomass to be used as feedstock for ethanol production
can itself be useful in reducing net emissions of greenhouse gases: affores-
tation increases the size of the terrestrial carbon sink and the use of indus-'
trial wood waste replaces other carbon-dioxide-intensive management
methods such as landfill and incineration. Clearly, the production of etha-
nol from wood-biomass merits serious consideration.
The impetus for this paper comes from two related issues: (1) climate
change and the international commitment to its mitigation and (2) the impor-
tance of the reduction of our dependency on fossil fuels for energy. Reducing
ethanol industry not only reduced greenhouse gas emissions, but also an
increase in economic activity, particularly in rural areas. To the consumer,
the debate over the future availability of fossil fuels is not as much of an issue
as the effects of sudden, large jumps in oil and gas prices. Buffering the
demand for gasoline through the addition of ethanol in the transportation
fuel market will reduce the sensitivity of prices at the pump.
As a "no-regrets" option, the production of ethanol from afforestation
and wood waste is economically viable; through both the forestry sector's
carbon sink enhancement and the transportation and energy sectors' emis-
sions reduction, ethanol production can help to mitigate climate change.
Acknowledgments
This paper is based on research that was funded by the Sustainable
Forestry Management Network. The views expressed in this paper are
not necessarily those of the Government of Canada or the Canadian For-
est Service.
References
1. Apps, M. J., Kurz, W. A., Beukema, S. J., and Bhatti, J. S. (1999), Environmental Science
& Policy 2(1), 25-41
2. van Kooten, G. C. and Hauer, G. (2001), Canadian Public Policy 27(3),267-279.
3. Wright, L. L., Cushman, J. H., and Martin, S. A. (1996), in Forests and Global Climate
Change, vol II, Sampson, R.N., and Hair, D., eds., Chapter 8.
4. vanKooten, G. c., Stennes, B., Krcmar-Nozic, E., and van Gorkom, R. (1999), Canadian
Journal of Forestry Research 29(11), 1669-1678.
5. Lashof, D. and Hare, B. (1999), Environmental Science and Policy 2,101-109.
6. McCloy, B. W. and O'Connor, D. V. (1999), Wood-Ethanol Opportunities and Barriers.
Prepared for the Forest Sector Table, National Climate Change Process.
7. van Kooten, G. c., Krcmar-Nozic, E., Stennes, B., and van Gorkom, R. (1999), The
Forestry Chronicle 76(1),165-172.
8. Stennes, B. (2000), Carbon Uptake Strategies in the Western Boreal Forest Region ofCanada:
Economic Considerations. PhD thesis. Department of Forest Resource Management,
University of British Columbia, Vancouver, Canada.
9. Suchanek, P., Shaikh, S. L., and van Kooten, G. C. (2001), Carbon Incentive Mechanisms
and Land-Use Implications for Canadian Agriculture. Sustainable Forest Management
Network Working Paper 2001 (see ref. 6).
10. Graham, P. J., (2001), An Economic Analysis of Fossil Fuel Substitution for Climate
Change Mitigation, MF thesis. Faculty of Forestry, University of British Columbia,
Vancouver, Canada.
11. Canadian Forest Service (CFS) (1999), Canada's Wood Residues: a Profile of Current
Surplus and Regional Concentrations, Draft report prepared for National Climate
Change Process, Forest Sector Table. Canadian Forest Service, Industry, Economics
and Programs branch.
12. Bronson Consulting Group (1999), Demand for Wood Residue for Non Energy Products.
Report prepared for National Climate Change Process, Forest Sector Table.
13. Skog, K. E., Marcin, T. c., and Heath, L. S. (1996), in Forests and Global Climate Change,
vol II, Sampson, R.N., and Hair, D., eds., Chapter 12, pp. 209-215.
14. Rinebolt, D. C. (1996), in Forests and Global Climate Change, vol II, Sampson, R.N., and
Hair, D., eds., Chapter 6, pp. 117-129.
15. Sheehan, J. (1998), The role of bioethanol in global climate change, in Proceedings of the
1998 National Conference on Ethanol Policy and Marketing, Albuquerque, New Mexico.
Microbial Catalysis
and Metabolic Engineering
NANCY W. Y. Hol AND FRANCISCO F. ROBERT02
1Laboratory
of Renewable Resources Engineering,
Purdue University, West Lafayette, IN; and
21daho National Engineering and Environmental Laboratory, Idaho Fall, 10
Abstract
The saccharification of marine microalgae using amylase from marine
bacteria in saline conditions was investigated. An amylase-producing bacte-
rium, Pseudoalterimonas undina NKMB 0074 was isolated and identified. The
green micro alga NKG 120701 was determined to have the highest concentra-
tion of intracellular carbohydrate and was found from our algal culture
stocks. P. un dina NKMB 0074 was inoculated into suspensions containing
NKG 120701 cells and increasingly reduced suspended sugars with incuba-
tion time. Terrestrial amylase and glucoamylase were inactive in saline sus-
pension. Therefore, marine amylase is necessary in saline conditions for
successful saccharification of marine microalgae.
Index Entries: Saccharification; marine algae; marine bacteria; amylase;
ethanol; biomass.
Introduction
Marine micro algae living in marine environments have been studied
for biologic production of useful material such as fatty acids (1,2), bioactive
compounds (3-5), hydrogen (6,7), and polysaccharides (8) for three
decades (9). Marine microalgae can produce these materials using only
solar conversion and CO2 (10-12).
Results
Glucose Production from Starch by Marine Bacteria
The bacteria of 191 strains were isolated from the marine environ-
ment. The isolated strain NKMB 0074 showed the highest glucose concen-
tration (Table 1). Most of the tested strains had little glucose concentration.
The glucose concentration of NKMB 0074 after 24 h of incubation was
0.59 giL and reached 1.85 giL after 48 h.
Using 165 rDNA sequence analysis, NKMB0074 was determined to
be in the Pseudoalteronomas genus with 99% homology. The species was
determined by 165 rDNA phylogenic analysis and was identified as
Pseudoalteronomas undina.
Amylase Activity of Marine Bacteria
Amylase activity of P. undina NKBG 0074 was defined in artificial
seawater. After 1 dayofincubation, amylase activity was 51.18 ±4.35 U Img
of protein (Table 2). The a-amylase of Porcine pancreas and glucoamylase of
Rhizopus sp. were used for comparative study. The two enzymes were found
to be inactive in artificial seawater. Marine amylolytic enzymes were pre-
served in saline conditions and could therefore be used for saccharification
of marine algae.
3000 ~
2.0 §
'""'
0
ID 2500 §
ID 'p
Cl 1.5 <:<j
2- 2000 tl
5
-5 ~
~ 1.0 1500 0
0 u
0 1000
11)
'"0
u
0.5 ::l
500 6
0.0 0
0 10 20 30 40 50 60
Time (h)
Fig. 1. Time course of growth of P. undina NKB 0074 and glucose concentration in
medium. ( 0 )Growth; ( <> ) glucose concentration.
3000 125
'""'
----
'a.
~ 2500 8
E 100
=
'-' bI)
0 2000 3
'i 75 =
0
i§ 'p
11) 1500 <:<j
.t:;
~
0 50 =~
0=
u
11) 1000
'"0
u
u
::l 25 .5
500 B
6
0
£
10 20 30 40 50
Time (h)
96
67
43
30
20
Discussion
The utilization of renewable resources for energy and chemicals is
expected to increase in the near future. Ethanol can be produced by micro-
bial fermentation from renewable plant sources. Carbohydrates contain-
ing starch and polysaccharides, and lignocellulosic materials containing
cellulose, hemicellulose, and lignin, are the most abundant renewable
organic resources. Much attention has therefore been focused on geneti-
cally engineering strains that can efficiently utilize carbohydrates and
lignocellulosic materials and convert them into useful compounds such as
ethanol (25).
Green alga
NKG 040502 419.7 ± 73.5 41.9
NKG 040502 419.7 ± 73.5 41.9
NKG 042501 425.6 ± 58.0 42.5
NKG 041304 429.7 ± 45.2 42.9
NKG041102 453.2 ± 37.2 45.2
NKG042905b 451.8 ± 103.1 45.1
NKG 121701 531.3 ± 27.0 53.1
NKG 132301 442.9 ± 76.1 44.2
Others: 68 strains >40 >40
Total strains = 76
Table 4
Bioconversion to Reduced Sugars of Marine Microalgae Using Several Amylase
Reduced sugars concentration (mg/mL)a
Enyme 1d 2d
Amylase of P. un dina NKMB 0074 0.90 ± 0.28 2.82 ± 0.62
Amylase of P. pancreas c ND ND
Glucoamylase of Rhizopus sp.c ND ND
aND, not determined
bAlive cells of P. undina NKMB 0074 were inoculated at a concentration of 0.14 g/10 mL.
cEach enzyme was used at a concentration of 1 mg of protein/mL.
References
1. Burgess, J. G., Iwamoto, K., Miura, Y., TaKano, H., and Matsunaga, T. (1993), Appl.
Microbiol. Biotechnol. 39,456-459.
2. Miura, Y., Sode, K., Nakamura, N., Matsunaga, N., and Matsunaga, T. (1993), FEMS
Microbiol. Lett. 107,163-168.
3. Wachi, Y., Burgess, J. G., Takahashi, J., Nakamura, N., and Matsunaga, T. (1995), J.
Biotechnol. 2, 210-213.
4. Wake, H., Akasaka, A., Umetsu, H., Ozeki, Y., Shimomura, K., and Matsunaga, T.
(1992), Plant Cell Rep. 11, 62-65.
5. Miura, Y., Sode, K., Nakamura, N., and Matsunaga, T. (1993), J. Mar. Biotechnol. 1,
134-146.
6. Kumazawa, S. and Mitsui A. (1981), Int. J. Hydrogen Energy 6, 339-348.
7. Nandi, R and Sengupta S. (1998), Crit. Rev. Microbiol. 24,61-84.
8. Sudo, H., Burgess, J. G., Takemasa, H., Nakamura, N., and Matsunaga, T. (1995),
Curro Microbiol. 30,219-222.
9. Mitsui, A. (1975), in Proceedings of the 3rd Ineternational Ocean Development Conference.
10. Borowitzka, 1.J. and Borowitzka M.A. (1989), in Industrial Production: Method and
Economics. Cresswell, R c., Rees, T. A. V., and Shah, N., eds., Elsevier Applied Sci-
ence, London, UK, pp. 294-316.
11. Borowitzka, M. A. (1992), J. Appl. Phycol. 4, 267-279.
12. Patterson, G. M. 1. (1996), J. Sci. Ind. Res. 55, 669-684.
13. Mielenz, J. R (2001), Curro Opin. Microbiol. 4,324-329.
14. Razmovski, Rand Pejin D. (1996), Folia Microbiol. 41, 201-207.
15. Joachimsthal, E. and Rogers P. (2000), Appl. Biochem. Biotechnol. 84/86, 343-356.
16. Krishhan, M., Blanco, M., Shattuck, C. K., Nghiem, N. P., and Davison, B. H. (2000),
Appl. Biochem. Biotechnol. 84/86, 525-54l.
17. Lawford, H. and Rousseau, J. (2000), Appl. Biochem. Biotechnol. 84/86,277-293.
18. Sandhu, D. and Joshi V. (1994), Indian J. Exp. Bioi. 32,873-876.
19. Montesinos, T. and Navarro, J.-M. (2000), Enzyme Microbiol. Technol. 27, 362-370.
20. Abouzied, M. M. and Reddy, A. C. (1986), Appl. Environ. Microbiol. 52,1055-1059.
21. Fumihisa, K., Sawada, T., Nakamura, Y., Ohnaga, M., Godliving, M., and Ushiyama,
T. (1998), Appl. Biochem. Biotechnol. 69,177-189.
22. Rippka, R, Deruelles, J., Watherbury, J. B., Herdman, M., and Stanier, R Y. (1979), J.
Gen. Microbiol. 111, 1-6l.
23. Miller, G. 1.(1959), Anal. Chem. 31,426-428.
24. Lowry, 0., Rosebrough, N. J., and Randall, R J. (1951), J. Bioi. Chem. 193,265-275.
25. Aristos, A. and Merja, P. (2000), Curro Opin. Biotechnol. 11,187-198.
26. Matsunaga, T. and Izumida, H. (1984), Biotechnol. Bioeng. Symp. 14,407-418.
27. Matsumoto, M., Yoshida, E., Takeyama, H., and Matsunaga, T.(2000), Appl. Biochem.
Biotech. 84/86,51-57.
Abstract
The kinetics and regulation of D-xylose uptake were investigated in the
efficient pentose fermentor Candida succiphila, and in Kluyveromyces
marxianus, which assimilate but do not ferment pentose sugars. Active high-
affinity (Km - 3.8 roM; V max - 15 nmol![mg·min]) and putative facilitated
diffusion low-affinity (Km -140 roM; V max -130 nmol![mg·min]) transport
activities were found in C. succiphila grown, respectively, on xylose or glu-
cose. K. marxianus showed facilitated diffusion low-affinity (Km - 103 roM;
V max - 190 nmol! [mg· min]) transport activity when grown on xylose under
microaerobic conditions, and both a low-affinity and an active high-affin-
ity (Km - 0.2 roM; V max -10 nmol! [mg·min]) transport activity when grown
on xylose under fully aerobic conditions.
Index Entries: D-Xylose, transport kinetics, fermentation, Candida succiphila,
Kluyveromyces marxianus.
Introduction
A substantial fraction (up to 25%) of the monosaccharides in lignocel-
lulose hydrolysates consists of the pentose sugars D-xylose (5-20%) and
L-arabinose (1-5%). Xylose is second only to glucose in natural abundance,
and although this sugar can be fermented by some species of bacteria, yeast,
and filamentous fungi, the ethanol yields are low. Thus, there has been a
great emphasis in the last two decades on developing an efficient organism
for xylose fermentation through metabolic engineering (1-3). Although some
bacteria (Zymomonas mobilis and Escherichia coli) seem to be the best-perform-
ing biocatalysts for xylose fermentation, the preferred organism for indus-
*Author to whom all correspondence and reprint requests should be addressed.
Applied Biochemistry and Biotechnology 255 Vol. 105-108,2003
256 Stambuk et al.
trial ethanol fermentation processes is the yeast Saccharomyces cerevisiae. Since
wild-type strains of S. cerevisiae do not utilize D-xylose, several laboratories
have attempted to engineer S. cerevisiae for xylose fermentation (4,5). Results
with such genetically engineered yeasts have been encouraging, although
the xylose utilization rates and ethanol productivities are still low compared
to glucose fermentation by this yeast (5).
The first metabolic step in the fermentation of sugars by yeasts is the
uptake through the plasma membrane, and several reports have shown
that transport is the rate-limiting step for fermentation (6-8). Recently,
Eliasson et al. (9) have concluded from studies with chemos tat cultures that
xylose transport limits the xylose flux and metabolism by recombinant
S. cerevisiae cells. Xylose is taken up in S. cerevisiae cells by the glucose
transporters (10-12), which mediate the uptake of xylose by facilitated dif-
fusion with very low affinity (Km > 100 mM). Thus, the transport step would
pose a limitation on the flux, at least at low substrate concentrations. The
specificity of the transporters is also of concern, since glucose inhibits
xylose uptake when these two sugars are present in the fermentation
medium (13,14). Additionally, it is worth noting that xylose reductase (XR),
the first enzyme in the xylose-utilizing pathway, has a low affinity toward
xylose (Km > 50-100 mM), which means that high intracellular concentra-
tions of xylose are necessary for efficient utilization (15,16). Thus, the prop-
erties of the S. cerevisiae transporter(s) suggest the need for the improvement
of this metabolic step by genetic engineering (5,17).
Although hexose transport by yeast has been extensively investigated,
little attention has been given to pentose uptake, including the mechanisms
and the regulation of the transport activity. Here we report studies on the
kinetics and regulation of xylose transport activity in two species of yeast,
Candida succiphila and Kluyveromyces marxianus. C. succiphila is one of the few
yeasts capable of fermenting both D-xylose and L-arabinose (18). Although it
has been reported that some K marxianus strains ferment xylose (19), the
K marxianus (formerly Kfragilis) strain used in the present study assimilates
but does not ferment this sugar.
Materials and Methods
Yeast Strains and Growth Conditions
C. succiphila (NRRL Y-11998) and K marxianus (ATCC 52486) cells
were grown at 30°C in YEP medium (1 % Difco yeast extract, 2% Difco
Bacto Peptone) to which the 2-5% carbon source was added and the pH
adjusted to 5.0. Microaerobic conditions employed 50 mL of medium in
a 125-mL unbaffled Erlenmeyer flask shaken at 100 rpm. Aerobic condi-
tions employed 50 mL of broth in 250-mL baffled Erlenmeyer flasks
shaken at 220 rpm.
Analytical Methods
Growth was followed by turbidity measurements at 600 nm. One
absorbance unit corresponds to approx 0.25 mg (dry wt) of C. succiphila
Transport Assays
Cells were harvested in mid-growth phase, centrifuged, washed
twice with cold distilled water, and suspended in water to a cellular den-
sity of about 60 g (dry cell mass) /L. The uptake of D-(1-14C)xylose (55 mCi/
mmol; American Radiolabeled Chemicals) was measured as previously
described (10,21). As a modification, assays were performed with 50 mM
succinate-Tris buffer, pH 5.0, and the uptake was measured during 30-s
periods. Appropriate experiments had shown that uptake of labeled
xylose was linear for at least 1 min. Transport activity is expressed as
nanomoles of xylose transported per milligram (dry cell mass) per minute.
Kinetic parameters were determined as described elsewhere (22,23) using
0.05-900 mM final substrate concentrations.
For assays in which the effect of inhibitors was evaluated, cell suspen-
sions were incubated with the indicated concentration of the inhibitors for
15 min prior to the assay, and 10 mM labeled xylose was used as substrate,
except for K. marxianus cells grown under aerobic conditions in which the
substrate concentration was 1 mM (see Subheading liD-Xylose Transport by
K. marxianus" and Table 2). The following compounds were dissolved in
ethanol: diethylstilbestrol, 2,4-dinitrophenol (DNP), carbonyl-cyanide-m-
chlorophenylhydrazine (CCCP), and dicyc1ohexyl-carbodiimide (DCCD).
Ethanol did not inhibit the transport activity at the concentration used in
the assays «2% [v Iv]). To determine the inhibitory effect of a sugar on the
transport of xylose, an excess of the test sugar was added to the labeled
xylose. All determinations were done at least in duplicate, which did not
differ by more than 15%.
Results
Growth on D-Xylose
C. succiphila and K. marxianus differed in their mode of xylose utiliza-
tion during growth on this carbon source under microaerobic conditions.
C. succiphila showed low rates of growth and xylose consumption but fer-
mented this sugar during growth producing Significant amounts of ethanol
and xylitol (Fig. 1). By comparison, K. marxianus grew and assimilated
xylose faster, but almost no ethanol and only low quantities of xylitol were
observed in the growth medium (Fig. 1), indicating that this yeast diverts
almost all carbon and energy from xylose metabolism into cell growth. Both
30 A B 100
"0
-
c:
(II
.s::
Ec:
10
-
0
Q)
.... 20 ..0···· .. ······0
0
0_ .... </'
0··· .s::
0_
-~
O·
~
~C)
>..-
x
cD <;) 1 C)
III
10 Qi
°
>..
><
()
0.1
0
0 30 60 90 120 0 30 60
Time (h)
strains produced low amounts of acetate «0.8 giL) at the end of the fer-
mentations and consumed all these products from the medium after the
sugar was exhausted. When grown under aerobic conditions, both yeasts
grew faster than under microaerobic conditions, and higher cellular den-
sities were obtained at the end of the incubations (data not shown). No
ethanol was produced by C. succiphila during aerobic growth on xylose.
D-Xy/ose Transport by C. succiphila
Kinetic analysis showed that xylose-grown cells took up xylose by a
single low-capacity (Vrnax = 15 nmol/[mg·min]) and high-affinity (Km =
3.8 mM) transport system (Fig. 2). The low capacity of this transporter may
explain the low sugar consumption rates observed when these cells are
growing on xylose (Fig. 1). This transport system is an active transporter
since the rate of xylose uptake in xylose-grown cells was significantly inhib-
ited in the presence of protonophores (NaN3, DNP, and eeep) and the H+-
adenosine triphosphatase (ATPase) inhibitors diethylstilbestrol and DeeD
(Table 1), indicating that the eletrochemical H+ gradient across the plasma
membrane is required for uptake of the sugar. Sugar competition studies
indicated that a general monosaccharide transporter probably mediates this
high-affinity system, since both an excess of either hexoses (glucose and
galactose) or pentoses (L-arabinose) significantly inhibited the rate of xylose
uptake (Table 1). Furthermore, control experiments using unlabeled xylose,
under the same conditions of excess sugar as those used for glucose inhibi-
tion, showed that this sugar competed as well as glucose for the uptake of
labeled xylose, indicating that this transport activity may have the same
150
'c:
·e
'~ 100
(5
E
S
::::.
50
o 1 234
Table 1
Effect of Inhibitors on Rate of Xylose Transport by C. succiphila
Relative xylose transport (%)a
Concentration Xylose-grown Glucose-grown
Inhibitor (mM) cells cells
None 100 b 100e
NaN 3 10 5 107
DNP 2.5 2 86
CCCP 2.5 2 62
Diethylstilbestrol 5 31 68
DCCD 5 9 107
Glucose 250 2 2
Galactose 500 3 24
Arabinose 600 11 56
a Determined with 10 mM labeled xylose.
b Rate of xylose transport was 9.0 nmol/(mg·min).
e Rate of xylose transport was 8.5 nmol/(mg·min).
Discussion
It is well known that efficient conversion of xylose to ethanol by most
xylose-fermenting yeasts requires a limited amount of oxygen (24-26). The
explanation for this finding appears to lie in the specificity of the cofactor
required for XRactivity, with XR enzymes utilizing either NADPH orNADH
as cofactor permitting more efficient fermentation of xylose under limited
oxygen availability (27). However, xylose transport into the cell may also
limit fermentation of this sugar, as is the case with Pichia stipitis grown under
different conditions (28-30). Eadie-Hofstee plots of xylose uptake by several
150
•
I~
50
D··.·.
~t
••
O~~J---~--~--~~····-····-····~·~~
h ••••••
o 10 20 30 40
Table 2
Effect of Inhibitors on Rate of Xylose Transport
by Xylose-Grown K. marxianus Cells
Relative xylose transport (%)
Concentration Aerobic Microaerobic
Inhibitor (mM) conditions conditions
concentration.
Not determined.
C
Acknowledgments
We thank Dr. C. Kurtzman (National Center for Agricultural Utiliza-
tion Research, USDA, Peoria, IL) for providing yeast strains. This work was
funded by the Biochemical Conversion Element of the Office of Fuels
Development of the US Department of Energy.
References
1. Bothast, R. J., Nichols, N. N., and Dien, B. S. (1999), Biotechnol. Prog. 15,867-875.
2. Aristidou, A. and Penttila, M. (2000), Curro Opin. Biotechnol. 11,187-198.
3. Zaldivar, J., Nielsen, J., and Olsson, L. (2001), Appl. Microbiol. Biotechnol. 56, 17-34.
Abstract
Candida boidinii produces significant amounts of xylitol from xylose, and
assays of crude homogenates for aldose (xylose) reductase (XYLlp) have
been reported to show relatively high activity with NADH as a cofactor even
though XYLlp purified from this yeast does not have such activity. A gene
coding for XYLlp from C. boidinii (CbXYLl) was isolated by amplifying the
central region using primers to conserved domains and by genome walking.
CbXYLl has an open reading frame of 966 bp encoding 321 amino acids. The
C. boidinii XYLlp is highly similar to other known yeast aldose reductases
and is most closely related to the NAD(P)H-linked XYLlp of Kluyveromyces
lactis. Cell homogenates from C. boidinii and recombinant Saccharomyces
cerevisiae were tested for XYLlp activity to confirm the previously reported
high ratio of NADH:NADPH linked activity. C. boidinii grown under fully
aerobic conditions showed an NADH:NADPH activity ratio of 0.76, which
was similar to that observed with the XYLlp from Pichia stipitis XYLl, but
which is much lower than what was previously reported. Cells grown under
low aeration showed an NADH:NADPH activity ratio of 2.13. Recombinant
S. cerevisiae expressing CbXYLl showed only NADH-linked activity in cell
homogenates. Southern hybridization did not reveal additional bands. These
results imply that a second, unrelated gene for XYLl p is present in C. boidinii.
Results
Cloning ofCbXYL 1
We successfully amplified a DNA fragment of approx 400 bp from
genomic DNA of C. boidinii using degenerate primers designed against con-
served regions GYRLFD and EHHPYLQ found in xylose (aldose) reduc-
tases (18-22) (Fig. I), and the amplicon sequence was identified as a partial
gene for CbXYLl (data not shown). Gene-specific primers were designed
from this fragment. The 5'-upstream, ORF and 3'-downstream sequences for
CbXYLl were obtained by genome walking and deposited into GeneBank
(accession no. AF451326). This sequence consists of 387 bp 5'-upstream, an
ORF of 966 bp that encode putative 321 amino acids with a calculated mo-
lecular weight of 36 kDa, and 52 bp 3'-downstream. The calculated molecu-
lar weight is in good agreement with the protein size of 36 kDa mentioned
in a previous review (29). Sequence analysis showed a TATAAA and three
CAAT boxes located -54, and -120, -159 and -201, respectively, in the
5'-upstream region. As shown in Fig. 2, a phylogenetic analysis showed that
the CbXYL1p is significantly different from three Candida XYL1 proteins
and fromP. stipitis XYL1p, and it is most closely related to the XRof K.lactis
and S. cerevisiae, with which it shows 63 and 62 % identity and 78 and 76%
similarity, respectively. IPKS, which is the coenzyme-binding motif, was
highly conserved in the C. boidinii protein in other yeast aldose (xylose)
reductases, and in mammalian aldo-keto reductase family enzymes (30).
Southern blot analysis was performed with the CbXYLl ORF as a
molecular probe to determine whether other related sequences were
present in the C. boidinii genome. As shown in Fig. 3A, only a single band
Fig. 1 Alignment of amino acid sequences between CbXYLlp and known XRs or
ARs. Amino acid sequences were aligned by using FASTA (see Website: http:/ /
www.ncbi.nlm.nih.gov). Highly conserved sequences in bold were used to design
degenerate primers .
. - - - - - - Candida tropicalis
. - - - - - - - Pichia stipitis
, . - - - - Candida tenuis
'----\
' - - - - Candida shehatae
, - - - - - - - - - Candida guilliermondii
. - - - - - - - - - - - - Pachyso/en tannophilus
, - - - - - - - - - - Candida boidinii
, . - - - - - - - - Kluyveromyces lactis
'------I
' - - - - - - - - - - Saccharomyces cerevisiae
0.1
Fig. 2. Phylogenetic tree of XRs or ARs found in yeasts. Amino acid sequences were
identified by BLAST, and the resulting protein sequences were then aligned. A phy-
logenetic tree was generated from the aligned regions after excluding sequences cre-
ating gaps.
A 1 2 3 B
F1
>10k~
5~ Amp'
Pcbxyl1
2.5kb
Fig. 3. Genomic Southern blot analysis of CbXYLl and construction map for expres-
sion in S. cerevisiae. (A) Genomic DNA from C. boindinii was digested with Msc I, Pst
I, and Xba I. After running on an agarose gel, DNA was transferred onto a nylon
membrane, hybridized with probe DNA that was synthesized by random primer ex-
tension. The signal was then developed according to a protocol given by Roche. Ar-
rows indicate the approx size of hybridized DNA fragments. (B) Construction map of
pRS424-CbXYLl for expression in S. cerevisiae. TheCbXYLl gene was constructed under
the control of its own promoter. PRS424-CbXYLl was introduced into S. cerevisiae
L2612 (Mata, trp-, ura-, leu-) (12). Pcbxyll and CbXYLl indicate promoter and coding
region, respectively.
Table 1
Specific Activity of CbXYLlp Expressed in S. cerevisiae"
NADH (U/mg) NADPH (U/mg)
Control CbXYLlp Control CbXYLlp
D-Arabinose 0.009 0.010 0.009 0.017
L- Arabinose 0.019 0.032 0.020 0.494
D- Galactose 0.006 0.006 0.012 0.094
D- Glucose 0.008 0.008 0.008 0.047
D- Ribose 0.007 0.007 0.015 0.159
D- Xylose 0.009 0.016 0.020. 0.417
(Fig. 3B). After selection for growth on YSD medium, the transformant was
confirmed by PCR amplification (data not shown) and named S4u. To iden-
tify CbXYLlp enzyme activity, S4u was cultured on YS-2% glucose and
2% xylose medium. After culturing for 2 days, xylitol production was ana-
lyzed by HPLC. The transformant produced significant (5.8 g) xylitol from
20 g of xylose whereas the wild-type strain produced only trace amounts
(0.71 g). Glucose was not detected because it was consumed completely for
cell growth within 2 d. This experiment demonstrated that CbXYLl could
be expressed under control of its own promoter in S. cerevisiae.
~
:-
~-.
c
~
"->
§
Aldose Reductase from Candida boidinii 273
To investigate the relative affinities of CbXYL1p for NADPH and
NADH and the substrate specificity, an enzyme assay of the CbXYL1p
was performed with several carbohydrates: D-arabinose, L-arabinose,
D-galactose, D-glucose, D-ribose, and D-xylose. As shown in Table 1,
CbXYL1p had higher activity with S-carbon than with 6-carbon sugars,
and it also had much higher affinity for NADPH than for NADH. The
results were in good agreement with a previous report on the activity of
the same enzyme purified from C. boidinii (31). CbXYL1p showed even
higher activity for L-arabinose than D-xylose, thereby demonstrating that
the cloned gene coded for an NADPH-linked AR.
Discussion
The XYL1 gene coding for XYL1 p was isolated from C. boidinii through
PCR ~mplification and by genome walking. The CbXYLl clone was identi-
fied as XYL1 p by comparing its implied protein sequence with other aldose
(xylose) reductases. The catalytic tetrad of XYL1p, Tyr48/ Asp43/Lys77 /
His110 (32-34) is completely conserved as TyrSO / Asp4S /Lys79 /Hisl12 in
CbXYLlp. According to these reports (32-34), TyrSO is proposed to be the
proton donor of the aldehyde reaction by CbXYL1p. The residue pair
Asp4S/Lys79 is expected to interact with the hydroxy group of TyrSO.
Hisl12 may facilitate proton donation by TyrSO. Therefore, CbXYL1p has
the conserved amino acids for AR function. Jez et al. (32) have reviewed the
cofactor-binding domain and residues. These consensus sequence and
amino acids were well conserved in CbXYL1p.
When this gene was expressed in S. cerevisiae under its native promoter,
xylitol accumulation was observed in the medium. This result showed that
the CbXYLl promoter is recognized in S. cerevisiae. When the cell homoge-
nate from recombinant S. cerevisiae S4a. was used for enzyme assay AR activ-
ity was detected, but no AR activity was detected in homogenates from the
nonrecombinant parent. XR from P. stipitis can be expressed in S. cerevisiae
with its native promoter (19,35). Other aldose (xylose) reductases were also
successfully expressed in E. coli (18,19) or Pichia pastoris (21).
CbXYL1p could reduce several aldose sugars when it was expressed
in S. cerevisiae. It showed higher activity for S-carbon than 6-carbon sug-
Acknowledgments
Y.-S. Jin and J. Laplaza provided helpful comments and discussion.
We acknowledge financial support from the National Renewable Energy
Laboratory under subcontract no. ZCG-9-29009-01 and from Iogen.
References
1. Aristidou, A. and Penttila, M. (2000), Curro Opin. Biotechnol. 11,187-198.
2. Maleszka, R. and Schneider, H. (1982), Can. ]. Microbiol. 28(3),360-363.
Abstract
We changed the fluxes of xylose metabolites in recombinant
Saccharomyces cerevisiae by manipulating expression of Pichia stipitis genes
(XYLl and XYL2) coding for xylose reductase (XR) and xylitol dehydroge-
nase (XDH), respectively. XYLl copy number was kept constant by inte-
grating it into the chromosome. Copy numbers of XYL2 were varied either
by integrating XYL2 into the chromosome or by transforming cells with
XYL2 in a multicopy vector. Genes in all three constructs were under con-
trol of the strong constitutive glyceraldehyde-3-phosphate dehydrogenase
promoter. Enzymatic activity of XR and XDH in the recombinant strains
increased with the copy number of XYLl and XYL2. XR activity was not
detected in the parent but was present at a nearly constant level in all of the
transformants. XDH activity increased 12-fold when XYL2 was on a
multicopy vector compared with when it was present in an integrated single
copy. Product formation during xylose fermentation was affected by XDH
activity and by aeration in recombinant S. cerevisiae. Higher XDH activity
and more aeration resulted in less xylitol and more xylulose accumulation
during xylose fermentation. Secretion of xylulose by strains with multicopy
XYL2 and elevated XDH supports the hypothesis that D-xylulokinase limits
metabolic flux in recombinant S. cerevisiae.
Introduction
Xylose-fermentation in lignocellulose hydrolysate is indispensable
for economic conversion of biomass to fuels and chemicals (1). Saccharomy-
ces cerevisiae is widely used for the industrial fermentation of glucose to
ethanol because it has the capacity for high specific ethanol production
rates (2,3) and will tolerate high ethanol concentrations (4). However,
native strains of S. cerevisiae do not use xylose as a carbon source for growth
(5-7). In contrast to S. cerevisiae, other yeasts use xylose very well. One of
the best xylose-fermenting yeasts, Pichia stipitis, has been studied exten-
sively for the regulatory and physiologic properties that enable it to fer-
ment xylose (8), and it has served as the source of genes for engineering
xylose metabolism in S. cerevisiae. The XYLl and XYL2 genes coding for
xylose reductase (XR) and xylitol dehydrogenase (XDH) from P. stipitis
have been expressed in S. cerevisiae (9-12). The resulting transformants can
grow on xylose aerobically but only produce significant amounts of etha-
nolin low yield under oxygen-limited conditions (13). This results in xylitol
accumulation in the medium as a byproduct, which is a major obstacle in
obtaining high ethanol production from xylose. XR from P. stipitis has a
high affinity for NADPH even though it can use NADH as a cofactor (14).
However, P. stipitis XDH only uses NAD+ as a cofactor (15). This difference
results in cofactor imbalance in the cytosol during xylose metabolism.
Bruinenberg et aL (16) hypothesized that xylitol accumulates during
the metabolism of xylose because yeasts cannot oxidize NADH to NAD+
efficiently through respiration under oxygen-limited conditions, and
because the cytosolic NAD+ /NADH ratio is unfavorable to the XDH reac-
tion. Walfridsson et al. (11) reported that the ratio of XR and XDH activity
is important in reducing xylitol formation in the fermentation of glucose/
xylose mixtures. They found that a strain with a lower ratio (0.06) of XR/
XDH activity accumulated less xylitol and produced more ethanol than a
strain with a higher ratio (17.5). However, they also obtained very low
xylose consumption rates and did not report the effect of aeration (11). This
prompted us to investigate whether or not increasing XDH activity can
reduce xylitol accumulation during metabolism of xylose alone under aero-
bic and oxygen-limited conditions. To alter XDH activity, we introduced
the XYL2 gene into the XYLl integrated S. cerevisiae either by integration
into chromosome or by expression from a multicopy plasmid. To deter-
mine whether we could further alter the ratio of reduced and oxidized
intermediate metabolites formed by the engineered cells, we also studied
the effect of aeration.
A B
40 8 40 8
35 7~ 35 7~
'0 '0
~ 30 6 [;l ~ 30 6 [;l
.... 0;9
'0 25 - .:l
:>.., 25 5r.l
~ 0: ~,., 11
.., "~ .., 20 4 ..
1,.,
~ 20 ~
4
."
0:
15 3 ] ,., .."
0:
!i
15 3 .!
~ ~ ~
:J
10 ~10
~
5
1l
~
5 ~j 1l
U OU
0 0
0 30 60 90 120 150 180 30 60 90 120 150 180
Tbne (bour) Time (hour)
A B
16
120 168
11me (hour)
Fig. 2. Comparison of (A) xylulose and (8) xylitol production during xylose fermen-
tation by recombinant S. cerevisiae. Strains and culture conditions: (a) FPL-YS1020 in
an Erlenmeyer flask at 200 rpm; (b) FPL-YSI020 in a baffled flask at 200 rpm; (c) FPL-
YS1022 in an Erlenmeyer flask at 200 rpm; (d) FPL-YSI022 in a baffled flask at 200 rpm.
Metabolic Flux Distributions in FPL- YSI 020 and FPL- YSI 022 Strains
Metabolic fluxes of the xylose assimilation steps were calculated from
the xylose consumption rates, and the xylitol and xylulose accumulation
rates (Table 3), during xylose fermentation by two of the recombinant
S. cerevisiae strains (FPL-YSI020 and FPL-YS1022). As shown in Fig. 3, alter-
ing levels of XDH activity significantly altered metabolic flux distributions
in xylose assimilation. Higher XDH activity in FPL-YSI022 decreased
xylitol accumulation 20% and increased xylulose accumulation 54% com-
Applied Biochemistry and Biotechnology Vol. 105-108,2003
284 Jin and Jeffries
Table 3
Specific Rates During Xylose Fermentation by Recombinant S. cerevisiae
Specific rate (mM [g cell h]-I) "
A Xylose
B Xylose
24.9 13.7
15.4±0.61 75. 1 12.6 ± 0.61 86 •3
46.2± 13.5 76.9 ± 2.2
17.6
11.0 ± 1.7
X I I
Y U ose
19.1
17.0 ± 1.7
XYIUIose
157.5
35.7 ± 15.19 167.2
59.9 ± 0.4
Xylulose-5-phosphate Xylulose-5-phosphate
pared with FPL-YSI020. Although there was more than a 12-fold increase
in XDH activity in FPL-YSI022 compared with FPL-YSI020, the change in
metabolic flux was not proportional to the increase in enzymatic activity.
This clearly shows that not only enzyme activities but also physiologic
states of cell are responsible for the control of metabolic flux in the xylose
assimilation pathway.
Conclusion
During xylose fermentation by recombinant S. cerevisiae expressing
XYLl and XYL2 from P. stipitis, metabolic flux partitioning from xylitol
Applied Biochemistry and Biotechnology Vol. 105-108,2003
Xylose Metabolite Flux in Saccharomyces 285
Acknowledgments
We thank Prof. Jin-Ho Seo at Seoul National University for kindly
providing the S. cerevisiae L2612 and plasmids pY2XR and pY2XDH. We
also thank Prof. Culbertson at UW-Madison for generous access to his
strains and plasmids.
References
1. Hinman, N. D., Wright, J. D., Hoagland, W., and Wyman, C. E. (1989), Appl. Biochem.
Biotech. 20/21,391-401.
2. Maiorella, B. 1., Blanch, H. W., and Wilke, C. R. (1984), Biotechnol. Bioeng. 26, 1003-1025.
3. Jeffries, T. W. (1985), Trends Biotechnol. 3,208-212.
4. Casey, G. P. and Ingledew, W. M. M. (1986), Crit. Rev. Microbiol. 13,219-280.
5. Chiang, L.-c., Gong, c.-S., Chem, L.-F., and Tsao,G. T. (1981),Appl. Environ. Microbiol.
42,284-289.
6. Senac, T. and Hahn-Hagerdal, B. (1990), Appl. Envinron. Microbiol. 56, 120-126.
7. Wang, P. P. and Schneider, H. (1980), Can. J. Microbiol. 26, 1165-1168.
B. Jeffries, T. W. and Shi, N. Q. (1999), Adv. Biochem. Eng. Biotechnol. 65, 117-161.
9. Kotter, P., Amore, R., Hollenberg, C. P., and Ciriacy, M. (1990), Curro Genet. 18,493-500.
10. Tantirungkij, M., Nakashima, N., Seki, T., and Yoshida, T. (1993), J. Ferment. Bioeng.
75,83-88.
11. Walfridsson, M., Anderlund, M., Bao, X., and Hahn-Hagerdal, B. (1997), Appl.
Microbiol. Biotechnol. 48, 218-224.
12. Jin, Y. S., Lee, T. H., Choi, Y. D., Ryu, Y. W., and Seo, J. H. (2000), J. Microbiol. Biotechnol.
10, 564-567.
13. Tantirungkij, M., Izuishi, T., Seki, T., and Yoshida, T. (1994),Appl. Microbiol. Biotechnol.
41,8-12.
14. Verduyn, c., Van Kleef, R., Frank, J., Schreuder, H., Van Dijken, J. P., and Scheffers,
W. A (1985), Biochem. J. 226,669-677.
15. Rizzi, M., Harwart, K., Erlemann, P., Buithanh, N. A., and Dellweg, H. (1989),
J. Ferment. Bioeng. 67, 20-24.
16. Bruinenberg, P. M., de Bot, P. H. M., van Dijken,J. P., and Scheffers, W. A (1983), Eur.
J. Appl. Microbiol. Biotechnol. 18,287-292.
17. Cho, K. M., Yoo, Y. J., and Kang, H. S. (1999), Enzyme Microb. Technol. 25,23-30.
lB. Lu, P., Davis, B. P., Hendrick, J., and Jeffries, T. W. (1998), Appl. Microbiol. Biotechnol.
49,141-146.
19. Cooper, C. M., Fernstrom, G. A, and Miller, S. A (1944), Ind. Eng. Chem. 36,504-509.
20. Sikorski, R. S. and Hieter, P. (1989), Genetics 122, 19-27.
21. Rose, M. D., Winston, F., and Hieter, P. (1990), Methods in Yeast Genetics: A Laboratory
Course Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New
York, NY.
22. Lachke, A and Jeffries, T. W. (1986), Enzyme Microb. Technol. 8,353-359.
23. Ho, N. W. Y., Chen, Z. D., and Brainard, A P. (1998), Appl. Environ. Microbiol. 64,
1852-1859.
24. Walfridsson, M., Hallborn, J., Penttila, M., Keranen, S., and Hahn-Hagerdal, B. (1995),
Appl. Environ. Microbiol. 61,4184-4190.
Abstract
The interference of eight components in the yield of sporulation and ther-
mal resistance to moist heat (121°C) of Bacillus stearothermophilus spores sus-
pended in 0.02 M calcium acetate solution and inoculated on paper strips
previously treated with calcium acetate/calcium hydroxide was studied.
The spore yield of 1.0 x 108 / mL was developed at 62°C in 17 media containing
different concentrations of D-glucose, sodium chloride, L-glutamic acid, yeast
extract, peptone, manganese sulfate, potassium phosphate, and ammonium
phosphate. The combined effects of yeast extract, peptone, and glucose con-
tributed positively to the spore yield and to the stability of the thermal resis-
tance of both spores in suspension and on strips.
Index Entries: Bacillus stearothermophilus; thermoresistance; sporulation;
bioindicator.
Introduction
The length of the exponential growth phase determines the final cell
population of Bacillus stearothermophilus. Symmetrical cell division depends
on favorable exogenous conditions such as temperature, humidity, nutri-
ents, and aeration. The sporulation of B. stearothermophilus is characterized
by a multiphase, morphologic synchronized process that occurs at the onset
of the stationary phase (1). During the maturation of the spore, thermo-
resistance characteristics develop. Although the complex morphologic
changes that occur during sporulation result from regulated changes in
gene expression, the thermal resistance of mature spores can be manipu-
lated in vitro (2-4). Spores in suspension, when treated with sodium, potas-
sium, magnesium, and manganese cations, are more resistant than spores
*Author to whom all correspondence and reprint requests should be addressed.
,§5
-~
to."
a
8
Media and Spore Yield ofB. sterothermophilus 289
in the hydrogenionic form. The hydrogen form of the spores can be con-
verted in a calcium-resistant form by treatment with calcium acetate (CaAc)
at alkaline pH (2). Acid conditions of the heating menstruum may cause
partial demineralization of the spores (3). On the other hand, the mineral-
ization provides a reduction in the content of water in the protoplast of the
spore, provoking an increase in thermal resistance (4). When inoculated on
strips previously treated with 0.02 M CaAc, the B. stearothermophilus ATCC
7953 spores displayed greater stability (5).
Mineralization of the cortex depends either on the supply of the sporu-
lation medium or on the suspension of harvested spores (6). Thermal resis-
tance is associated with the peptidoglycan present in the spore cortex. At
low pH, the acid protonates the peptidoglycan, decreasing thermal resis-
tance and the viability of spores. Therefore, the pH of the culture medium
influences spore yields, which at pH 8.7 were higher than those obtained in
media at pH values between 7.0 and 5.5 (6).
Spores of B. stearothermophilus are mainly used as a bioindicator (BI) to
monitor and ensure the reproducibility of moist heat processes (7,8).
Bioindicator's are commercially available in suspension form, for impreg-
nation in the load unit; inoculated on paper carriers; or in a self-contained
ampoule where spores are suspended in a recovery medium. Strips
of paper, which are inexpensive and small, are easily placed in strategic
positions in order to verify the homogeneity of the sterilant distribution in
the chamber and in the unit of the load.
The purpose of the present study was to evaluate the interference of
eight components in the yield of sporulation and thermal resistance to
moist heat (121°C) of B. stearothermophilus spores in a suspension of 0.02 M
CaAc and on strips previously treated with CaAcl calcium hydroxide
(Ca[OH]2) (pH 11.0) (9). The principal goal was to verify which component,
individually or in association, showed the greatest influence on viability
and thermal resistance.
Thermal Treatments
Thermal treatments at 121°C were performed through the serum bottle
technique apparatus (5,9). The homogenized spore suspensions (5 mL) were
transferred into 20-mL glass serum bottles (Wheaton SB205A; 60 x 25 mm).
Ten B. stearothermophilus spore strips, previously humidified by instanta-
neous contact with sterile distilled water, were transferred to 20-mL serum
bottles and placed between 10 Durham tubes (30 x 3 mm). The distance
between neighboring parallel tubes was 4.0 ± 0.5 mm, and each Durham
tube was filled with water to two thirds its total capacity. The bottles were
closed with a sterile flange rubber stopper and then sealed with an alumi-
num seal.
Air was removed (5 min) by suction (General Electric vacuum pump,
1725 rpm, 1/6 Hp), with a 22-gage stainless steel needle (30 x 7 mm) through
the rubber stopper of the sealed bottles. A thermocouple sensor end, inside
a 316 stainless steel needle (1.5 x 100 mm), was placed in the geometric
center of the bottles, using the hole through the rubber stopper left by the
pump needle. Triplicate sets of bottles were heated in a thermostatically
controlled oil (Dow Coming® silicone 200/220 CS, P = 0.948 g/cm3) bath
(OTB-7A, Haven Automation) at different time intervals at 121.0 ± O.l°C
and were cooled and held in an ice-water bath. The experimentally deter-
mined lag correction of 7 min was used. The thermocouples, type J
(2x32AWG), overwrapped with Teflon, were equilibrated at 121.0 ± O.l°C
and attached to multipoint recording equipment (lOPE therm 400-CE 12;
recording rate: 30 s). Survivors on the strips were quantified for spore
viability and expressed by decimal logarithms of the average colony-form-
ing units per strip, from at least 10 plates for each time heating condition
and system used.
in suspension were developed in media 3, 5, 12, 16, and 17, with Dl21 c 0
values equal to 2.66, 2.71, 2.84, 2.76, and 2.86 min, respectively, and for the
spores on strips from the media 15 and 16, respectively, with D12l"c values
equal to 2.69 and 3.46 min. Glucose was present at the minimum concentra-
tion, with the exception of media 15 and 17. Yeast extract was present at the
maximum concentration in media 3, 15, 16, and 17; peptone was incorpo-
rated at the maximum concentration in media 5,12,16, and 17. Both com-
ponents were simultaneously incorporated at their respective maximum
concentrations in media 16 and 17, where the presence of glucose at the
maximum concentration in media 17 interfered only slightly in the
thermoresistance of the spores on the strip. Medium 16 showed the best
conditions for maturing the spores, providing the nutrients required to
confer maximum thermal stability to spores developed over a period of 6
d at 62°C, with saturated humidity.
Peptone at a maximum concentration is an excellent source of mineral
salts and amino acids at concentrations required for the formation of
mature spores and the maintenance of thermal resistance. Glucose is a
source of carbon that supplies the energy required for the logarithmic phase
of development before the stationary growth phase is reached and then
forms the spores. Yeast is an excellent source of B complex vitamins essen-
tial for growth and sporulation.
The components peptone and yeast at maximum concentrations and
glucose at minimum concentration provided good viability, about 1 x 108
spores/mL, with a D value at 121°C> 1.5 min for both BIs (the spores in
suspension and on strips), matching international standards.
Acknowledgments
This study was made possible by financial support provided by Bra-
zilian Committees for Scientific Technology Research (Conselho Nacional
de Desenvolvimento Cientifico e Tecnol6gico and Funda~ao de Amparo a
Pesquisa do Estado de Sao Paulo).
References
1. Foster, S. J. (1994), J. Appl. Bacteriol. Symp. Suppl. 76,255-39S.
2. Reich, R R, Whitbourne, J. E., and McDaniel, A W. (1979), J. Parenter. Drug Assoc. 33,
228-234.
3. Marquis, R E. , Sin, J., Shin, and S. Y. (1994), J. Bacteriol. 76, (Suppl.) 405-48S.
4. Beaman, T. C. and Gerhardt, P. (1986), Appl. Environ. Microbiol. 52,1242-1246.
5. Vessoni Penna, T. c., Machoshvili, 1. A, and Taqueda, M. H. S. (1996), J. Pharm. Sci.
Technol. 50,1-11.
6. Vessoni Penna, T. c., Machoshvili, 1. A, and Taqueda, M. E. S. (1998), J. Parenter. Sci.
Technol., 52, 198-208.
7. United States Ph.armacopeia, 23rd and 24th eds. (1995 and 2000), United States
Pharmacopeial Convention, Rockville, MD.
8. Graham, C. S. and Boris, C. A. (1993), In Sterilization Technology: A Practical Guide for
Manufacturers and Users of Health Care Products, Morrissey, R F. and Phillips, G. B.
eds., Van Nostrand, Reinhold, NY, pp. 36-69.
9. Vessoni Penna, T. c., Machoshvili, 1. A, Taqueda, M. E. S., and Ishii, M. (2000), J.
Parenter. Sci. Technol., 54, 398-412.
Abstract
Five cassava flour wastewater (manipueira) preparations were tested as
culture media for biosurfactant production by a wild-type Bacillus sp. isolate.
No-solids (F), no-solids diluted (F /2), natural (I), natural diluted (II2), and
decanted (IPS) were the tested manipueira media. The microorganism was
able to grow and to produce biosurfactant on all manipueira preparations.
The media whose solids were removed (F and F /2) showed better results
than preparations with the presence of solids (I, II2, and IPS). No-solids
medium (F) showed a surface tension of 26,59 mN / m and reciprocal of criti-
cal micelle concentration of over 100 and was selected as a potential substrate
for biosurfactant production.
Introduction
Surface-active molecules produced by microorganisms, also called
biosurfactants, are of great interest as substitutes for chemically derived
surfactants mainly because of their low toxicity and biodegradability 0,2).
Biosurfactants find applications in the cosmetic, pharmaceutical, and food
industries as emulsifiers, humectants, dispersants, and detergents (3,4).
Moreover, they are ecologically safe and suited for environmental applica-
tions such as bioremediation, dispersion of oil spills, and waste treatment
(5,6). Although interest in biosurfactants is increasing, these compounds
are not competitive with synthetic surfactants owing to high production
costs (7). The use of alternative substrates (substitutes for conventional
media), usually renewable resources, could be explored since substrates
account for 50% of final product costs (8).
Preparation of Substrate
Manipueira from the manufacture of cassava flour was collected at Sao
Paulo State and stored at -18°C until needed. The composition of manipueira
waste utilized is given in Table 1. Five different media were prepared from
the original waste and autoc1aved at 121°C for 15 min:
1. Natural manipueira medium (I) with the presence of insoluble solids
(6.2% [w Iv] total solids) was dispersed and distributed in Erlenm-
eyer flasks. The initial pH was 5.9.
2. Naturally diluted manipueira (1/2) was natural manipueira diluted 1:2
with distilled water (3.8% [w Iv] total solids). The initial pH was 5.8.
3. Decanted manipueira (IPS) was natural manipueira waste maintained
for 1 h at room temperature to permit the decantation of solids. The
upper liquid was gently removed and distributed in flasks (2.3%
[w Iv] total solids). The initial pH was 5.8.
4. No solids manipueira (F) was prepared by heating the waste to boil-
ing point to remove all the solids. After cooling, the substrate was
centrifuged at SOOOg for 20 min in a centrifuge (model J2-21;
Beckman). The supernatant was distributed in flasks. The initial pH
was 5.S.
5. No solids diluted manipueira (F 12) was no solids manipueira diluted
1:2 with distilled water. The initial pH was 5.9.
Results
The data obtained during cultivation of Bacillus sp. LB5a in tested
cassava wastewater media are presented in Table 2. The microorganism
was able to grow and produce biosurfactant in all tested media. Growth
patterns were similar; after 24 h cells reached stationary phase. Total car-
100
80
':"t)
::!E 60
t)
40
20 112 _IPS-o-I
0
0 20 40 60 80 100
time(h)
bohydrates consumption was about 80% for all media tested, with most of
the carbohydrates (>50%) being consumed during the first 24 h of fermen-
tation. No-solids media (F and F /2), which had a lower carbohydrate con-
tent, demonstrated the lowest surface tension results, whereas the high
carbohydrate content of media I and IPS did not significantly increase cell
growth or surface tension. No-solids media showed a surface tension of
26.57 mN /m after 24 h, while on solid-content media (I, IPS, and 1/2) the
lowest surface tension attained was 27.5 mN/m after 72 h (IPS).
CMD-l and CMD-2 data were helpful as an indirect indication of
surfactant concentration on culture media (19). The results obtained from
medium F after 72 h showed a CMD-l of 26.92 mN / m and a CMD-2 of 32.06
mN/m, whereas for F/2, although the surface tension was similar, the
values of27.43mN/m (CMD-l) and 35.82 mN/m (CMD-2) suggested that
surface activity was higher on F medium. In fact, the crude biosurfactant
concentration obtained on manipueira F corroborates this statement.
More than 55% of crude biosurfactant was produced during the first
24 h of cultivation, and surface tension reached minimum levels in approx
48 h. After 48 h, biosurfactant production was considerably reduced and
even a decrease in biosurfactant concentration was observed for media I
and F. The decrease in surface activity also occurred at minor rates and
could be observed by CMD data.
The CMC-l obtained for the tested media is shown in Fig. l.
Manipueira media with solids contents reached approximately the same
Applied Biochemistry and Biotechnology Vol. 105-708,2003
300 Nitschke and Pastore
values of CMC-l after 96 h while no-solids media showed the highest
values. Time course evaluation indicated that F medium had the highest
surface activity and at approx 15 h, the CMC-l was about 80, reaching 105
after 72 h. After 96 h, a CMC-l of 114 was attained; therefore, culture broth
should be diluted 114 times to reach 0.87% (v Iv) CMC.
Discussion
The carbohydrates present in manipueira were consumed, and the
levels of iron and manganese, important factors for biosurfactant produc-
tion by Bacillus (20,21), suggested thatthe manipueira medium is a suitable
substrate for supporting cell growth and biosurfactant accumulation by
Bacillus sp. LB5a.
Biosurfactant production by Bacillus sp. LB5a on manipueira media
seemed to be growth associated because the bulk of product accumula-
tion (>55%) occurs during the first 24 h when cell growth reached the
maximum level.
The CMC-l is a direct indication of surface activity in the broth; the
higher the CMC-1 the greater the surface activity. This is, therefore, a more
important measurement than the actual quantity of surfactant if the sur-
factant characteristics vary from cultural conditions. From CMC-l data it
is clear that medium F showed the highest surface activity of all the tested
media, and although medium F12 also showed good results, the dilution
of manipueira F waste was not necessary.
The results suggest that the presence of solids in manipueira waste is
inversely related to broth surface tension. Thompson et al (13), using a
Bacilllus subtilis strain, also observed that a high-solids potato process efflu-
ent showed lower biosurfactant production than a low-solids effluent. Few
differences in media appear to influence the characteristics of the surface-
active compounds produced, as reflected by the different CMC-l curves.
The composition of culture medium was previously described as one of
critical importance for determining product yield and biosurfactant prop-
erties (10).
The medium F prepared from manipueira offers promise as a substrate
for biosurfactant production by the isolate Bacillus sp. LB5a. The tested
solids contents media demonstrated high surface tension and low CMC-1
values and are not recommended for biosurfactant production.
Conclusion
This initial study indicates that manipueira could be used as an alter-
native substrate for biosurfactant production and the no-solids medium
preparation (F) presented the highest potential as a culture medium. The
utilization of cassava flour wastewater could reduce environmental prob-
lems for processing industries while decreasing the estimated cost of
biosurfactant production.
Applied Biochemistry and Biotechnology Vol. 705-108, 2003
Manipueira in Biosurfactant Production 301
Acknowledgments
We wish to thank Plaza S.A for the cassava flour wastewater dona-
tion and Comissao de Aperfei<;oamento de Pessoal de Ensino Superior
(CAPES) and Funda<;ao de Amparo aPesquisa do Estado de Sao Paulo for
financial support.
References
1. Banat, I. M., Makkar, R. S., and Cameotra, S. S. (2000), Appl. Microbiol. Biotechnol. 53,
495-508.
2. Banat, I. M. (2000), Biofutur 198, 44-47.
3. Desai, J. D. and Banat, I. M. (1997), Microbiol. Mol. Rev. 61,47- 64.
4. Rosenberg, E. and Ron, E. Z. (1999), Appl. Microbiol. Biotechnol. 52, 154-162.
5. Banat, I. M. (1995), Bioresour. Technol. 51, 1-12.
6. Banat, I. M. (1995), Acta Biotechnol. 15,251-267.
7. Cameotra, S. S. and Makkar, R. S. (1998), Appl. Microbiol. Biotechnol. 50,520-529.
B. Makkar, R. S. and Cameotra, S. S. (1999), J. Surf Oet. 2,237-241
9. Mercade, M. E. and Manresa, M. A. (1994), JAOCS 71, 61-64.
10. Sheppard, J. D. and Mulligan, C. (1987), Appl. Microbiol. Biotechnol. 27, 110-116.
11. Mercede, M. E., Manresa, M. A., Robert, M., Epsuny, M. J., Andres, c., and Guinea,
J. (1993), Bioresour. Technol. 43, 1-6.
12. Koch, A. K., Reiser, J., and Kappeli, O. (1988), Biotechnology 6, 1335-1339.
13. Thompson, D. N., Fox, S. L., and Bala, G. A. (2000), Appl. Biochem. Biotechnol. 84186,
917-929.
14. Fox, S. L. and Bala, G. A. (2000), Bioresour. Technol. 75,235-240.
15. Cereda, C. P. (1994), Industrializariio da mandioca no Brasil, Pauliceia, Sao Paulo, Brazil.
16. Nitschke, M., Ferraz, c., and Pastore, G. M. (2001), in Proceedings of XXI Congresso
Brasileiro de Microbiologia, Sociedade Brasileira de Microbiologia (SBM), Foz do
Igua<;:u, Brazil, pp. 311-312.
17. Daniels, L., Hanson, R. S., and Phillips, J. A. (1994), in Methods for General and Molecu-
lar Bacteriology, Gerhardt, P., Murray, R. G. E., Wood, W. A., and Krieg, N.R., eds.,
American Society for Microbiology, Washington, DC, pp. 518-519.
lB. Gerson, D. F. and Zajic, J. E. (1979), Process Biochem. 14,20-29.
19. Makkar, R. S. and Cameotra, S. S. (1997), JAOCS 74, 887-889.
20. Cooper, D. G., Macdonald, C. R., Duff, S. J. B., and Kosaric, N. (1981), Appl. Environ.
Microbiol. 42,408-412.
21. Sheppard, J. D. and Cooper, D. G. (1991), Appl. Microbiol. Biotechnol. 35,72-76.
Abstract
We have discovered a new competitive pathway for O 2sensitivity in algal
H2 production that is distinct from the O 2 sensitivity of hydrogenase per se.
This O 2sensitivity is apparently linked to the photosynthetic H2 production
pathway that is coupled to proton translocation across the thylakoid mem-
brane. Addition of the proton uncoupler carbonyl cyanide-p-trifluoro-
methoxy-phenylhydrazone eliminates this mode of O 2 inhibition on H2
photoevolution. This newly discovered inhibition is most likely owing to
background O 2that apparently serves as a terminal electron acceptor in com-
petition with the H2 production pathway for photosynthetically generated
electrons from water splitting. This 02-sensitive H2 production electron trans-
port pathway was inhibited by 3[3,4-dichlorophenyl]1,1-dimethylurea. Our
experiments demonstrated that this new pathway is more sensitive to O 2
than the traditionally known O 2sensitivity of hydrogenase. This discovery
provides new insight into the mechanism of O 2inactivation of hydrogenase
and may contribute to the development of a more-efficient and robust system
for photosynthetic H2 production.
Index Entries: Oxygen sensitivity; H2 production; photosynthetic H2 pro-
duction; H2 production pathways; hydrogenase.
Introduction
Algal photosynthetic hydrogen (H2) production by light-activated
water splitting is a potentially clean energy resource. However, compared
to our knowledge of the pathway of atmospheric CO2 reduction, and in
spite of the potential importance of the hydrogen-producing reaction, rela-
tively little is known concerning the mechanistic pathway of electron flow
in hydrogen-producing algae. In green algae, such as Chlamydomonas
reinhardtii, photoevolution of H2 and O2occurs in the same cell, where the
photosynthetically produced O 2can inhibit the production of H2 (1). There-
fore, the application of green algae for H2 production must address the
problem of O 2sensitivity. Historically, this 02-sensitive phenomenon was
generally interpreted as the direct O 2inhibition of hydrogenase activity (2).
We report here that the classic interpretation of O 2 sensitivity should be
revised. In recent experiments characterizing O 2tolerance in H 2-producing
wild-type C. reinhardtii, we observed a new O 2 sensitivity that is clearly
distinct from that of classic O2inhibition of hydrogenase. The O 2sensitivity
indicates that there is a competitive electron transport pathway that can
redirect electrons from the hydrogenase-catalyzed H2 production pathway
to O 2. That is to say, suppression of H2 evolution in the presence oflow-Ievel
background concentrations of O 2is owing to the drain of reducing equiva-
lents away from the hydrogenase pathway and toward the reduction of O 2.
Our experiments demonstrated that the competitive pathway mechanism
is more sensitive to O 2than the classic O2sensitivity of hydrogenase and can
be suppressed by proton uncoupler carbonyl cyanide-p-trifluoro-methoxy-
phenylhydrazone (FCCP).
I I I I
15 -J 01000%0, -
.....,
l- 1.
s:::. I,
:c
'I
I.
I,
() ,,, I'
- ,,
I ::'\ -
~ 10 'I
I;
"N I'
Ii
:r::
~ ..
II i1
:i
i
_
::t 5 - \ I -
i I
i\ \
--
\
\.""........- ....._........ ...... ...........
o-
,
I I I I
95 100 105 110 115 120
Time (hr)
B 12 12 ~
r10 10 I
~8 8 .5
C
I 6
4
6
4
~
2 2
0 0
20 22 24 26 28 30 32 34
11me (h)
100
!
!c 80
~ 60
J
~
.c 40
0..
'I,N
....0 20
'#.
thylakoid membrane. The addition of the proton uncoupler FCCP can elimi-
nate this mode of O2inhibition on H2 photoevolution. This O2inhibition on
H2 production is most likely owing to the competitive uptake of reducing
equivalents by background O2, with the H2 production pathway for photo-
synthetically generated electrons from water splitting. The 02-sensitive H2
production pathway can be inhibited by DCMU. Our experiments demon-
strated that the competitive pathway is more sensitive to O 2than the classic
O2sensitivity of hydrogenase. These findings redefine the meaning of" oxy-
gen tolerance" in algal H2 production. As discussed, this O2 sensitivity
apparently represents a new pathway in the photosynthetic H2 production
that is coupled with proton translocation across the thylakoid membrane.
As illustrated in Fig. SA, the site for the reduction of O2 could be at the
RuBisco enzyme, which can serve as an RuDP (also known as RuBP) car-
boxylase and/ or an RuDP oxygenase in the Calvin cycle. Under conditions
for H2 photoevolution in which CO2 is not present and ATP is abundant
owing to associated photophosphorylation, the Calvin cycle enzymes are
fully activated and RuBisco could act as a strong oxygenase. This hypoth-
esis can explain how FCCP mitigates O2 inhibition of H2 photoevolution,
since operation of the Calvin cycle requires formation of ATP using the
proton gradient across the thylakoid membrane. Another possible site for
O2interaction could be at Fd, which, according to the classic Mehler reac-
tion, can serve as an electron donor to O2, Additional experimental studies
with different chemical inhibitors and genetic mutants are under way to
elucidate this 02-sensitive H2 production electron transport pathway.
A 111
• , I
18
, l5OO0 ppm 02 - - H2 Production
J; 16 "" 18
:c -%LED
oat 14 ~- 14
E
~ 12 · ~ 12
i- 10 b
J!
· i- 10'i
c
I. 8 ·
0
c - .s!8
0
ts 6 · t- 6~
:::J
'#.
l
r-
4 4
N
J: 2· t- 2
0·
\. 0
• , I
188 188 190 192 194 196 198 200 202
Time (h)
B
.....
1.0
It I I - - H2 Production
1.0
fi 0.8 · t- O.Bb
........
!
5000 ppm °2 Wi
c
!c
~c
o
0.4 -0.4 w0
~"
:g
\
..J
-02 '#.
:::J
e 0.2
'tJ
Q.
N
J:
0.0 · '-- 0.0
186 188
•
190 192 194 196
I
198 200
I I
202
Time (h)
Fig. 4 (A) The introduction of 5000 ppm of O2 dramatically inhibits H2 production,
but the hydrogenase remains active. (B) Expanded vertical scale of (A), showing clear
peak of H2 photoevolution after 10 h of continued presence of 5000 ppm of 02'
3;:;;. H,t /
°2,
I
" :t ~...cot:..."'" 'C'Oln . etc
2H" I
~ ..n(>,'l ___ RuBiSQO
OJ "'~~....,,. I
:J ~';;
Q.. .., ~I c~=::;r .
OJ .... .21 RuDP
o· CAlVIN
(ii ~I CYCLE
g. &1
:J
o jl
a% .cl
'<:
~I
1
w
,
o
LHC
~
:-
Fig. 5. (A) The newly discovered O 2 sensitivity is likely owing to the background O 2 (at about WOO-ppm levels) acting as a terminal sink, in
~ competition with the Fd/hydrogenase H2 production pathway, for photosynthetically generated electrons. Illustrated by the blue-dotted
a
,Co arrows is a speculated mechanism of how the background O 2 might interact with the photosynthetic H2 production pathway at the point(s) of
a RuBisco and/or Fd.
'"
::;; (Continued)
:g B
~ 02 ~H2
' DARK
Q..
\:Xl
o· H3C H (CHzO)" . etc.
9- Hzf • ell:. •,
3tn· ~
, /
~ Co, ~ ~ _,-r >~
:;,
'" CALVIN "
Q..
\:Xl y~_ ~' : CYClE,'
o· '\ I
~ DNA NAOP'
I HAD ,'. ' ~ ... --
:;,- PH +H" ...
:;,
o Hydroget*e Prornoler
'._n~
_ r I
,- '
,,
~ If
w LHC
H+
Fig. 5. (Continued) (B) Development of efficient algal H2 production system by construction and transformation of vector that contains
hydrogenase promoter and a piece of synthetic DNA for the polypeptide proton channel. The transformed alga could grow normally using
~ ambient air CO2 under aerobic conditions without the polypeptide proton channel, which could be expressed only with the induction of the
~ hydrogenase under anaerobic conditions when its function is needed for enhanced H2 production. This diagram illustrates a predicted mecha-
a nism of how photosynthetic H2 production could be enhanced through the action of the proposed polypeptide proton channel by dissipation
,00
of the static proton gradient across the thylakoid membrane so that the photosynthetic electron transport from PSII water splitting to the Fdj
~
8v" hydrogenase H2 production pathway can become more efficient, and by inactivation of the Calvin cycle so that both the background O 2 and CO2
could be prevented from acting as a competitive terminal electron sink.
312 Lee and Greenbaum
Acknowledgments
We thank C. A. Sanders, B. Forbes, and B. Kusiak for culture media
preparation; B. Mathis and A. Jones for secretarial support; M. K. Savage for
editorial assistance; and C. D. King and V. W. Purdue for technical illustra-
tions. We also thank Drs. M. Seibert and M. L. Ghirardi for their 02-tolerant
mutants and informative discussions. This research was supported by the
US Department of Energy Hydrogen Program, the DOE Office of Science
Young Scientist Award (to J. W. Lee), and the Office of Basic Energy Sci-
ences. Oak Ridge National Laboratory is managed by UT-Battelle, LLC, for
the US Department of Energy under contract DE-ACOS-000R2272S.
References
1. Greenbaum, E. and Lee, J. W. (1998) in BioHydrogen, Zaborsky, O. R., ed., Plenum
Press, New York, NY, pp. 235-24l.
2. Ghirardi, M. L., Togasaki, R. K., and Seibert, M. (1997) Appl. Biochem. Biotechnol., 63-65,
141-15l.
3. Lee, J. W., Blankinship, S. L., and Greenbaum, E. (1995), Appl. Biochem. Biotechnol.,
51/52,379-385.
4. Samuilov, V. D., Barsky, E. L., and Kitashov, A. V. (1995) in Photosynthesis: from Light
to Biosphere, vol. II, Mathis, P., ed., Kluwer Academic Publishers, The Netherlands,
pp.267-270.
5. Lee, J. W. and Greenbaum, E. (1997), Fuels and Chemicals from Biomass, ACS Sympo-
sium Series 666, Saha, B. C. and Woodward, J., eds., American Chemical Society,
Washington, DC, pp. 209-222.
Bioprocessing Research
Abstract
A batch reactor was employed to steam explode corn fiber at various
degrees of severity to evaluate the potential of using this feedstock as part of
an enzymatically mediated cellulose-to-ethanol process. Severity was con-
trolled by altering temperature (150-230°C), residence time (1-9 min), and
S02concentration(O-6% [w /w] dry matter). The effects of varying the differ-
ent parameters were assessed by response surface modeling. The results
indicated that maximum sugar yields (hemicellulose-derived water soluble,
and cellulose-derived following enzymatic hydrolysis) were recovered from
corn fiber pretreated at 190°C for 5 minutes after exposure to 3% S02' Sequen-
tial S02-catalyzed steam explosion and enzymatic hydrolysis resulted in a
conversion efficiency of 81% of the combined original hemicellulose and
cellulose in the corn fiber to monomeric sugars. An additional posthydrolysis
step performed on water soluble hemicellulose stream increased the concen-
tration of sugars available for fermentation by 10%, resulting in the high
conversion efficiency of 91 %. Saccharomyces cerevisiae was able to ferment the
resultant corn fiber hydrolysates, perhydrolysate, and liquid fraction from
the posthydrolysis steps to 89,94, and 85% of theoretical ethanol conversion,
respectively. It was apparent that all of the parameters investigated during
the steam explosion pretreatment had a significant effect on sugar recovery,
inhibitory formation, enzymatic conversion efficiency, and fermentation
capacity of the yeast.
1 Com fibre 1
1
Pretreatment
Temperature (150-230°C), Time
(1-9 min), SO:z (0-6%)
1
...--__--11 Filtration ll--__--.
I
Prehydrolyste
1 1 Soli1ds
Post-hydrolysis Fermentation
3% H2SO4, 1 hours, 120°C S.cerevisiae (6WL), time 4 hours,
pH adjusted by O.5M NaOH to 6
Sugar analysis
Fermentation
S.cerevisiae (6WL), time 24
hours, pH a4justed by O.5M
1 Analysis of sugar, ethanol, HMF and fufurals
NaOHto6
1 2.06 170 1 3 97
2 2.17 150 5 3 85
3 2.76 170 5 0 89
4 2.76 170 5 6 92
5 3.02 170 9 3 89
6 3.35 190 5 3 87"
7 3.35 190 5 3 91-
8 3.35 190 5 3 86"
9 3.58 210 2.2 1 89
10 3.58 210 2.2 5 86
11 4.13 210 7.8 1 79
12 4.13 210 7.8 5 81
13 4.53 230 5 3 74
14 4.35 190 5 0 91
15 3.35 190 5 6 86
•Average shot yield: 88 ± 2.6 %.
oven-dried com fiber, was measured by weighing the com fiber before and
after S02 addition. The samples were then loaded, in 50-g batches, into a
preheated 2-L Stake Tech II batch reactor (Stake Tech-Norvall, Ontario,
Canada) and exploded at different severities (temperature ranging from 150-
230°C; time from 1.5 to 5 min; 502 concentration from 0 to 6% weight/oven-
dried weight of fiber) (Table 1). The severity of the steam explosion
pretreatment was represented by the severity factor as defined by Overend
and Chornet (6). This severity factor (Ro) combines the effects of time and
temperature, as follows:
(1)
in which t is the residence time (min), Tr is the reaction temperature (0C),
and Tb is a reference temperature (100°C).
Following steam explosion, the concentration of sugars in the water
soluble fraction was quantified by high-performance liquid chromatogra-
phy (HPLC), while the water-insoluble fraction (water-washed) was col-
lected and adjusted to2% (w /w) dry matter content and subsequently used
for enzymatic hydrolysis. Shot yields (%) were determined by dividing the
dry weight of the steam-exploded sample by the dry weight of the
nonpretreated sample (300 g) (Table 1).
Characterization of Substrate
The chemical composition of the original starting material and the
steam-exploded solids was determined using a modified Klason lignin
method derived from the TAPPI Standard method T222 om-98 (7). Briefly,
0.2 g of sample was incubated at 20°C with 3 mL of 72% H 2SO4 for 2 h with
mixing every 10 min. The reaction was then diluted with 112 mL of deionized
water (final acid concentration of 4% H 2S04) and transferred to a serum
bottle. The solution was subjected to autoclaving at 121°C for 1 h and filtered
through a medium coarseness sintered-glass filter for gravimetric determi-
nation of acid-insoluble lignin. Each experiment was run in triplicate. The
concentration of sugars in both the filtrate and the stream pretreatment
hydolyzate, as well as inhibitors such as 5-hydroxymethylfurfurals (HMFs),
were determined by HPLC analysis. The HPLC system (Dionex DX-500;
Dionex, Sunnyvale, CA) was equipped with an ion-exchange PAl (Dionex)
column, a pulsed amperometric detector with a gold electrode, and a Spectra
AS 3500 autoinjector (Spectra-Physics, Oroville, CA). Prior to injection,
samples were filtered through 0.45-mm HV filters (Millipore, Bedford, MA)
and a volume of 20 ilL was loaded. The column was equilibrated with 250
mM NaOH and eluted with deionized water at a flow rate of 1.0 mL/min.
Ethanol and furfural concentration were determined using a Hewlett-
Packard 5890 gas chromatograph equipped with a 6890 autoinjector, and a
flame ionization detector. Components were separated using a 30-m
Stabilwax-DA column supplemented with a 5-m deactivated guard col-
umn (Restek).
Posthydrolysis
Duplicate samples containing 27 mL of the water soluble fraction were
posthydrolyzed after adding concentrated H 2S04 to achieve a final concen-
tration of 3% acid. Posthydrolysis was performed by heating the solution
at 121°C for 1 h in an autoclave. A batch of sugar standards was also auto-
claved under the same conditions, to estimate any hydrolysis loss. Sugar
concentrations were detected by HPLC as described previously.
Enzymes
A complete Trichoderma reesei cellulase (Celluclast®, Novo Nordisk,
Franklinton, NC) was used in combination with a commercial ~-glucosi
d~se (Novozym 188®, Novo Nordisk) for cellulose degradation, while
gluco-amylase (200 V /mL) and a-amylase (300 V /mL) (Sigma, St. Louis,
MO) were used to ensure complete hydrolysis of the starch. The Celluclast
preparation contained 49 mg of protein/mL as measured by the Bio-Rad
protein assay (Bio-Rad, Hercules, CA) and had the following hydrolytic
activities: 80 filter paper units (FPV)/mL (filter paper activity), 52 IV /mL
of carboxymethylcellulase (CMCase),226 IV /mL of xylanase, and 50 IV /
mL of ~-glucosidase. The protein content and activities of Novozym 188
were as follows: 44 mg/ mL, 792 cellobiose units (CBV) / mL, 5 FPV / mL,
Enzymatic Hydrolysis
Water-washed pretreated solids obtained during steam explosion
were hydrolyzed at a 2% (w Iv) solid concentration in 50 mM sodium
acetate buffer (pH 4.8) at 45°C with continuous agitation (200 rpm) for
72 h. Each flask was inoculated with enzyme based on the amount of FPU
of cellulase and CBU (Novozyme 188) added at a CBU:FPU ratio of 4:1,
with excess glucoamylase and a-amylase as described by Grohmann and
Bothast (2). Aliquots of 200 ilL were aseptically removed at different reac-
tion intervals and boiled for 5 min to inactivate the enzymes. The sugar
concentration was then determined by HPLC. Each experiment was run in
duplicate. The fermentability of sugars obtained after enzymatic hydroly-
sis (liquid fraction) was tested using Saccharomyces cerevisiae.
Fermentation Microorganisms
A spent sulfite liquor-adapted strain of S. cerevisiae was generously
provided by Tembec (Quebec, Canada), and used for all fermentations. The
yeast was maintained at 4°C on YPD medium (2% glucose, 1% yeast extract,
2% peptone, and 1.8% agar). For each fermentation, S. cerevisiae was
pregrown in 500 mL of YP medium (1% glucose, 1% yeast extract, and 1%
peptone) at 30°C for 3 d, and then harvested after 24 h, and resuspended in
fresh YP medium. After extensive washing, the inoculum cell concentra-
tion was adjusted with sterile deionized water to provide the final cell
concentration of 6 giL (oven-dried cell weight).
Fermentation of Corn Fiber Hydrolysate
Fermentation of liquid sugar fractions (prehydrolysate, post-hydro-
lyzed prehydrolysate, and liquid fraction obtained during enzymatic
hydrolysis) was conducted in 50-mL beakers by preadjusting liquid broth
to pH 6.0 with 0.5 M sodium hydroxide and supplementation with 0.125
mL of 2 M (NH4hP04• Each 50-mL beaker contained 20 mL of the water
soluble sugar source and 1 mL of S. cerevisiae inoculum (6 giL of oven-dried
cell weight). The fermentation vessels were maintained at 30°C with
continuous agitation (200 rpm). Sugars, ethanol, HMF, and furfurals were
determined periodically from the aliquot culture samples during the course
of the fermentation. The relative ethanol yield, YEtOw'Y:tbHl was defined as
the ratio of the ethanol yield of the filtrate and the reference fermentation.
Each experiment was run in duplicate.
Response Surface Methodology
A response surface methodology was used to study the effects of tem-
perature, time, and S02 concentration on hemicellulose recovery, enzy-
matic digestibility, and fermentability of corn fiber after steam explosion
Table 4
Yield of Hemicellulose-Derived Sugars (Excluding Glucose)
in Prehydrolysate After Steam Explosion (Monomers)
and Steam Explosion and Posthydrolysis (Oligomers and Total Sugars)
Expressed as GI100 g of Hemicellulose in Original Corn Fiber
Treatment Monomers (%) Oligomers (%) Total sugars (%)
170°C, 1 min, 3% 6.1 10.4 16.5
150°C, 5 min, 3% 5.7 7.1 12.8
170°C, 5 min, 0% 10.9 18.6 29.5
170°C, 5 min, 6% 18.5 24.5 43.0
170°C, 9 min, 3% 23.8 31.0 54.8
190°C, 5 min, 3% 26.5% ± 1.0 23.8% ± 1.6 50.3% ± 0.8
210°C, 2.2 min, 1% 21.5 19.2 40.8
210°C, 2.2 min, 5% 27.6 6.3 33.9
210°C, 7.8 min, 1% 22.5 12.5 35.0
210°C, 7.8 min, 5% 24.1 5.9 30.0
230°C, 5 min, 3% 23.0 4.1 27.1
190°C, 5 min, 0% 15.4 30.6 46.0
190°C, 5 min, 6% 27.8 19.2 46.9
Sugar 1
n1Covery(%1
Sugar
recovery (%1
Sugar
recovery (%1
-
Temperawre reI
nme(mln)
Sugar
recovsry ( ..)
Tempel1lture ("C)
Sugar
recovery (..)
Fig. 3. Response surface for monomeric sugar recovery after pretreatment and
enzymatic hydrolysis regarding (A) temperature and time, and (B) temperature and
502 concentration.
Table 6
Relative Ethanol Yield for Liquid Fraction Obtained After Pretreatment
(Prehydrolysate) (6 h), Enzymatic Hydrolysis (2 h), Posthydrolysis (24 h),
and Concentration of HMF and Furfurals in Prehydrolysate (Original Sugar %)
Enzymatic
Prehydrolysate hydrolysis Posthydrolysis
HMF Furfurals YEtOH/yref
EtOH
Y
EtOH
/yref
EtOH
Y
EtOH
/yref
EtOH
Treatment (%) (%) (%) (%) (%)
170°C, 1 min, 3% 0.01 0.57 79 85 80
150°C, 5 min, 3% 0.01 0.18 85 100 83
170°C, 5 min, 0% 0.03 0.34 79 83 81
170°C, 5 min, 6% 0.07 0.87 82 81 89
170°C, 9 min, 3% 0.12 1.10 85 100 83
190°C, 5 min, 3% 0.24 ± 0.01 1.17 ± 0.07 94 ± 1 89 ± 1 85 ± 4
210°C, 2.2 min, 1% 0.29 0.97 79 81 86
210°C, 2.2 min, 5% 0.45 1.03 81 87 84
210°C, 7.8 min, 1% 1.07 1.05 66 92 84
210°C, 7.8 min, 5% 1.47 1.38 69 95 82
230°C, 5 min, 3% 1.73 1.93 69 96 81
190°C, 5 min, 0% 0.23 1.01 91 86 80
190°C, 5 min, 6% 0.26 1.20 95 89 89
Ethanol
yield (""J
Tempenlture rCJ ~ ~
.
B
Ethanol
yield (""J
Fig. 4. Response surface for relative ethanol yield for liquid fraction obtained after
pretreatment respect to (A) temperature and time, and (B) temperature and 502
concentration.
pretreatment severity (Table 6). Relative ethanol yields were high, ranging
from 81 to 100%, and 80 to 89% for sugars obtained after enzymatic
hydrolysis and posthydrolysis, respectively. The relatively high ethanol
yields obtained during 2 h of fermentation of the liquid fraction collected
after enzymatic hydrolysis were comparable with the results obtained by
Allen et al. (4). After simultaneous saccharification and fermentation of
pretreated corn fiber by hot water and steam explosion, 86 and 90% conver-
sion of glucan to ethanol by S. cerevisiae was observed, respectively.
Conclusion
Each of the parameters investigated during steam pretreatment by
response surface modeling (temperature, time, and S02 concentration)
had an effect on the hemicellulose monomer recovery, its subsequent
fermentability, and enzymatic hydrolysis. Although the wide range of
pretreatment conditions investigated precluded an exact determination
of optimal conditions, the predicted optimal pretreatment conditions
were in agreement with the optimum conditions observed for maximum
sugar yield obtained after pretreatment and enzymatic hydrolysis, and
fermentability of the monomeric sugars. The results show that there is a
need for S02 impregnation of com fiber prior to steam explosion.
A two-stage treatment for com fiber processing, comprising S02-cata-
lyzed steam explosion and hydrolysis by a mixture of cellulolytic and
amylolytic enzymes, proved to be a very effective method for converting
the available polysaccharides in the residue to monomeric sugars, as evi-
denced by the 81 % conversion observed without the need for a detoxifica-
tion step. Maximum sugar yields (soluble and following enzymatic
hydrolysis) were recovered from com fiber pretreated at 190°C for 5 min
with 3% S02. Posthydrolysis of the aqueous solution from S02-catalyzed
steam explosion effectively depolymerized the soluble oligomeric hemicel-
lulose and increased the concentration of carbohydrates in a fermentable
form by 10% at optimum pretreatment conditions. Subsequently,
S. cerevisiae was able to convert the resultant com fiber hydrolysates,
prehydrolysate and liquid fraction from posthydrolysis to ethanol effi-
ciently, respectively yielding 89, 94, and 85% of theoretical conversion.
Acknowledements
We thank Dr. A. Boussaid and D. J. Gregg for assistance in the steam
explosion experiments.
References
1. Anderson, R. A. and Watson, S. A. (1982), in Handbook of Processing and Utilization in
Agriculture, vol. 2, Wolff, I. A. ed., CRC, Boca Rat~n, FL, pp. 31-61.
2. Grohmann, K. and Bothast, R. J. (1996), Process Biochem. 32,405-415.
3. Moniruzzaman, M., Dale, B. E., Hespell, R. B., and Bothast, R. J. (1997), Appl. Biochem.
Biotechnol. 67, 113-126.
Abstract
Acid-catalyzed hydrolysis is controlled not only by temperature and acid
concentration but also by the physical state of the cellulose. Under low tem-
perature and acid condition the cellulose structure stays in stable crystalline
form. Therefore, the prevailing reaction mode is endwise hydrolysis. Glu-
cose then becomes the main sugar product. However, when temperature
and/ or acid concentration is raised to a certain level, the cellulose structure
becomes unstable by breakage of hydrogen bonding, the primary force that
holds the cellulose chains. Once the crystalline structure of the cellulose is
disrupted, acid molecules can penetrate into the inner layers of the cellulose
chains. In support of this hypothesis, we have experimentally verified that a
substantial amount of oligomers is formed as reaction intermediates under
extremely low-acid and high-temperature conditions. We also found that the
breakage of hydrogen bonds occurs rather abruptly in response to tempera-
ture. One such condition is 210°C, 0.07% H 2S04 • Glucose, once it is formed in
the hydrolysate, interacts with acid-soluble lignin, forming a lignin-carbo-
hydrate complex. This occurs concurrently with other reactions involving
glucose such as decomposition and reversion. On the basis of these findings,
a comprehensive kinetic model is proposed. This model is in full compliance
with our recent experimental data obtained under a broad range of reaction
conditions.
Introduction
The origin of the organized kinetic study of cellulose hydrolysis dates
back to that of the work of Saeman (1). This kinetic model describes dilute-
*Author to whom all correspondence and reprint requests should be addressed.
Easily hydrolyzed
celluose Anhydrosugars
~ /11/
Glucose ~ Degradation products
Resistant cellulose
/I ~t
Dissacharides ~
" t
Glucosides
Modified cellulose
insoluble oligomers
Soluble
Oligo saccharides
Analytical Methods
Solid samples from experiments were analyzed for glucan content
according to the NREL analysis procedures (13). Oligomeric sugars in the
hydrolysate liquor were converted into monomers using 4% (w /w) H 2S04
hydrolysis at 120°C for 60 min. Sugars and other compounds were deter-
mined by an high-performance liquid chromatography (HPLC) using a
Bio-Rad Aminex HPX-87P column. Oligomer samples were also analyzed
by HPLC using a Bio-Rad Aminex HPX-42A column.
8 r---------------------~==~~~~~==~--~
_____ Raw Glueo •• wi %
Raw C.llublolt wi %
.2(ii 1
Total Clueo •• wi %
Clueo.. Oflgomtr wi %
"3
E
:::I
6
U
U
'c:" 5
'e
-
It>
~ 4
c:
.2
'5 3
Etil
oc: 2
'"
U
::J
(5 1
o 5 10 15 20 25 30 35 40 45 50 55 60 65 10 75 80 85
Time (min)
lignin was removed. Using this substrate, the glucose yield was improved
to 61.3%. The substrate was also pretreated with 10% aqueous ammonia to
remove 85% lignin. When this substrate was applied, the yield was further
improved to 76.5%. The level of glucose yield observed in our work and its
dependency on pretreatment and reactor type cannot be explained by
existing hydrolysis kinetic theory.
Presence of Oligomers in Hydrolysate
Figure 1 shows the hydrolysis profile for a-cellulose in a BSFT reactor
at 205°C and 0.07% H 2S04 , The observed yield of total soluble sugars
(glucose, cellobiose, and oligomers) is 80.6%. The yield is substantially
higher than those observed in our previous experiments using batch
reactors and percolation reactors. One notable feature of this run is the
presence of oligomers that were not observed in our previous experi-
ments. We believe this is owing to the unique characteristics of the BSFT
reactor and the quick quenching of the hydrolysates, which prevented
further reactions of intermediates. A sample HPLC chromatogram is
shown in Fig. 2. Glucose and cellobiose contents were obtained from
HPLC chromatograms of raw hydrolysate samples. The same liquid
samples were put through a secondary hydrolysis that was carried out
with 4% H 2S04 at 121°C for 1 h. The glucose yield was calculated from the
total glucose value after secondary hydrolysis. The yields of this magni-
,I Glucose
/'
Cellobiose J
t
J
I
Fig. 2. Evidence of oligomer presence in HPLC chromatogram.
I
./
~
•
I
. •..
o
•-
•
,
I
.......01'---:._ _ _ _ _ .1. -
r-------,
H+
I r, . .t ,
Glu
... .
GIU-GIU" Glu-GIU;Glu
.ol i ... ,
H+
1
a-Ce1Iu1ose
0.1 +------.--.-------.--.------.--.------.--.-------.-'------1
o 10 20 30 40 50 60 70 ~ 00 100
Time (min)
Fig. 5. Comparison of hydrolysis rates of starch, and treated and untreated cellulose
(120°C, 4% H 2S04),
~
Cl
c
'2
...
'(ij
E ,. 1.:-........'. -.
"
a:
1iu
estimated treadllne for
:::I
a hydrolysis at 225 °c
'0 20 ,5
Time (min)
jump of reaction rate is observed between 210 and 225°C. The actual mea-
sured rate constant at 225°C is 0.137, which is 2.3 times larger than the value
extrapolated by Arrhenius equation based on the data at lS0-200°C.
We have also observed similar behavior with hydrolysis of a-cellulose
in that a discontinuity of reaction behavior occurred at a certain tempera-
ture (15). This was owing to a temperature-induced disruption of cellulose
physical structure. On devastation of cellulose supramolecular structure,
catalytic hydrolysis becomes much more rapid since the catalytic group can
gain much easier access to cellulose without having to penetrate into the
crystalline barrier. Furthermore, the hydrolysis products, including glu-
cose and oligomers, are readily released into liquid owing to weakened
hydrogen bonding. This finding partly explains why the cellulose hydroly-
sis rate is drastically improved and high glucose yields are obtained under
high-temperature and extremely low-acid conditions.
For the sake of discussion, we introduce a reaction index applicable for
the hydrogen bonds, called the instability index (10)' It is an index similar
to the severity factor in that it involves two parameters: temperature and
acid concentration. The ionic strength of the solution may also be included
into the definition of the instability index. The exact mathematical expres-
sion of 10 is yet to be determined. It is an entity that increases when acid
concentration and/ or temperature increases.
Zone or Un tabl
H-Bonds
Tran itiona!
Zon of Stable Zone
H-Bonds
~ 0.8
0.7
Time (min)
ICrystuJlin2 Celbdose I
Surface Long
" ChtUn OligOntel'$
Surface Glucose I
Short ChtUn Oligomel'$
Glucosides
r-------- . .
________
I
IL
LOlqUl°d JI II
II
_______________________________________ J
on ASL will lead to the condensation reaction between ASL and glucose as
follows:
ASL + Glucose - ASL - Glucose
However, we have yet to positively identify the lignin-carbohydrate
complex in the hydrolysates. Further investigation on this topic is currently
under way in our laboratory.
Proposed Hydrolysis Kinetic Model
On the basis of our experimental findings, we propose a comprehen-
sive kinetic model as described in Fig. 9. This model accounts for factors
pertaining to the heterogeneous nature of the reaction, the hydrogen-bond-
ing theory, and posthydrolysis reaction, specifically glucose-ASL interac-
tion. In the solid phase during the hydrolysis process, the strength of
hydrogen bonds controls the release of either glucose or oligomers to the
liquid. Oligomers are released at high 10 conditions, whereas glucose is
released at low instability conditions. Within the high 10 reaction zone,
oligomers are released into the liquid and further hydrolyzed to glucose in
the acidic liquid medium. In the liquid phase, glucose takes an additional
pathway owing to interaction with ASL at high-temperature conditions.
This occurs concurrently with other reactions involving glucose such as
decomposition and reversion.
Conclusion
The conventional kinetic model of two sequential reactions is inad-
equate as a general model since it does not account for the heterogeneous
nature of the reaction. The heterogeneity of the reaction creates physical
resistances that are far greater than the reaction resistance. The primary
factor controlling the physical resistance is the state of the hydrogen bond-
ing in cellulose molecular structure.
The state of hydrogen bonding affects the kinetic behavior. If the
hydrolysis reaction is carried out under a condition that severely disrupts
hydrogen bonding (high 10 condition), glucose and its oligomers are
formed. Since oligomers are more stable than monomer against decompo-
sition, adoption of such a reaction condition may increase sugar yield.
Quick quenching of the reactor effluent is an efficient way to raise the
glucose yield, especially in the high 10 zone. Glucose-lignin recondensation
occurs during acid hydrolysis of cellulose and is an important factor caus-
ing loss of sugar.
A comprehensive kinetic model is proposed implementing additional
factors into the conventional model: a parallel oligomer pathway, associa-
tion of glucose/oligomers with cellulose through hydrogen bonding, and
interaction of glucose with ASL. The proposed kinetic model provides valid
explanations for our recent laboratory data that contradict the conven-
tional acid hydrolysis model.
Acknowledgments
We wish to thank Rebert Torget of NREL and Par O. Pettersson of Mid
Sweden University for their technical insights and helpful suggestions, and
Dr. Raymond Ruiz of NREL for his contribution to the oligomer analysis by
HPLC. This research was sponsored by the US Department of Energy
through financial agreement DE-FC36-01GOII072, and by NREL through
subcontract ACO-1-31003-01.
References
1. Saeman, J. F. (1945), Ind. Eng. Chem. 37,43-52.
2. Springer, E. L. (1966), Tappi 49,102-106.
3. Daruwalla, E. H. and Shet, R. T. (1962), Text. Res. J. 32, 942-954.
4. Nelson, M. L. (1960), J. Polym. Sci. 43,351-371.
5. Philipp, B., Jacopian, V., Loth, F., Hirte, W., and Schulz, G. (1979), in Hydrolysis of
Cellulose: Mechanisms of Enzymatic and Acid Catalysis, Advances in Chemistry Series,
vol. 181, Brown, R. D., Jr. and Jurasek, L., eds., American Chemical Society, Washing-
ton, DC, pp. 127-143.
6. Millett, M. A., Effland, M. J., and Caulfield, D. F. (1979), in Hydrolysis of Cellulose:
Mechanisms of Enzymatic and Acid Catalysis, Advances in Chemistry Series, vol. 181,
Brown, R. D., Jr. and Jurasek, L., eds., American Chemical Society, Washington, DC,
pp.71-89.
7. Conner, A. H., Wood, B. F., Hill, C. G., and Harris, J. F. (1986), in Cellulose: Structure,
Modification and Hydrolysis, Young, R. A. and Rowell, R. M., eds.,J. Wiley & Sons, New
York, NY, pp. 281-296.
Abstract
The effect of agitation on the adsorption of acetic acid by activated carbon
was tested utilizing an external mass transfer-diffusion model. Simulated
pretreated biomass was contacted with activated carbon under prescribed
conditions of temperature and agitation. Adsorption isotherm studies are
presented as well as batch kinetic rate studies. Use of these data enabled the
determination of isotherm constants, an external mass transfer coefficient,
and an effective diffusivity for each agitation rate studied. The external film
coefficient results ranged from 33.62 !-lm/ s to a complete absence of external
mass transfer resistance, and the diffusivity results ranged from 0.8625 to
10.70 !-lm2 / s. The optimum combination of no external film resistance, and
highest diffusivity, 10.70 !-lm2/s, occurred at 250 rpm and 25°C. The results
of these models and the experimental parameters suggested an efficacious
method and conditions for the removal of this undesirable chemical.
Index Entries: Adsorption; activated carbon; external mass transfer; effec-
tive diffusivity; detoxification.
Introduction
Biomass sources such as softwoods and corn stover have been touted
as viable solutions for the production of fuel ethanol. However, because
these sources do not contain significant quantities of sugar in their natural
state, they must be treated in a manner in which the lignocellulosic material
is reduced to fermentable sugars. This is accomplished by any number of
pretreatment processes such as dilute-acid hydrolysis (1). During the pre-
treatment of most biomass systems, several components resultant from
sugar and lignin degradation processes may be formed, including furfural,
hydroxymethylfurfural, and acetic acid. The quantity of the individual
chemicals can vary with biomass source and may range from parts per
*Author to whom all correspondence and reprint requests should be addressed.
Flange----t;=~~====1.t=====:::=~
IDcm
I4cm
Model
To describe the adsorption rate data, a mathematical model must be
developed. This model incorporates a method for determining the two
major factors affecting adsorption: external mass transfer and diffusivity.
These two factors play an important role in the design and scale-up of
adsorption equipment.
To supply information for the model, data are collected at predeter-
mined time intervals during the kinetic portion of experimentation as pre-
viously described. The initial fraction of the plot obtained is then interpreted
using a four-step mechanism. In this mechanism, only the initial data, <10
min, are used owing to the presence of a linear isotherm during this time
period. The four-step mechanism is as follows: (1) mass transfer of solute
through bulk solution, (2) mass transfer from bulk solute to particle sur-
face, (3) intraparticle diffusion, and (4) adsorption on an interior site. If a
solution is well mixed, no concentration gradients will exist within the bulk
solution and the bulk diffusion term may be ignored. It can also be assumed
that adsorption on an interior site is rapid with respect to the remaining two
steps (11). In the initial phases of adsorption, external mass transfer is the
controlling mechanism. As time progresses or as agitation rates increase,
external mass transfer plays a smaller role and intraparticle diffusion
(2)
A linear isotherm has been validated for this system for contact times of
<10 min.
The effective diffusivity is then determined. Although diffusivity
terms include bulk, surface, and intraparticle diffusivities, these indi-
vidual parameters are difficult to determine. By calculating the effective
diffusivity, all of the individual diffusivities are lumped into a single
parameter that may be determined by observation of bulk fluid proper-
ties. A shell balance on the system for constant density and diffusivity is
found in Bird et al. (12). With no reaction, assuming no convection, and
diffusion occurring only radially in the carbon particle, this equation
reduces to Fick's law of diffusion, Eq. 3. The differential mass balance for
this system can be seen in Eq. 4. Equation 4 has the following initial con-
dition: at t = 0, Cb = C bo and C = 0 for 0 s r s R:
(4)
Boundary conditions:
t>O a;:
aC I r=O=O and Dea;:
ac I r=R=kj(Cb-Cs)
t>O BC I r=O=O
a;: and C=Cbatr=R
tans n
3s n 2 (7)
3 + BSn
In all cases, the following assumptions are made: linear isotherm re-
gion, well-mixed bulk solution, sample times close to to, initially solute-free
carbon pores, spherical carbon particles, and constant effective diffusivity.
From these equations it can be seen that a plot of
In (CC b
bo
1)
1 + mK
vs t is linear with a slope of
desired. When Calgon carbons and Carbon Resources carbons were com-
pared on the adsorption of acetic acid, two of the tested carbons, Calgon BL
and Carbon Resources 2SAP, performed the best. Each of these carbons had
isotherm slopes at least 1.5 times smaller than the nearest competing carbon
and isotherm intercepts 1.36 times larger than the other carbons. Both of
these carbons were also capable of removing >67% of the initial acetic acid
from solution at the 15°C reaction temperature. However, one aspect of
activated carbon usage-cost-eliminated the Carbon Resources carbon.
Therefore, utilizing the criteria mentioned previously (isotherm slope, iso-
therm intercept, and final substrate concentration) and cost factors, a single
activated carbon was selected for further testing: Calgon Carbon BL at a
usage rate of 80 giL. Although not presented in graphic form here, iso-
therms for the adsorption of glucose were also performed. Calgon Carbon
BL adsorbed the least amount of glucose from solution, approaching nearly
20% of the initial concentration. This amount of sugar is lost only in the pore
volume of the carbon and is not actually adsorbed to the carbon surface.
Even this level of sugar loss is considered unacceptable, future process
modifications may decrease this loss.
Following the selection of an activated carbon, adsorption kinetic tests
were performed using the 4-L reaction kettle shown in Fig. 1. The curves
resulting from these tests as shown in Fig. 3. Two important pieces of infor-
mation may be gleaned from this plot. First, the curves help determine the
.=
'0
250 rpm
'v
-<...
',c
...
...-<'"
o
.:
o
:c 5
e
Eu
g 4
U
3 +---------.--------.---------.------~
o 50 150 200
Time, min
Fig. 3. Acetic acid concentration as function of time and rpm at 15°C using Calgon
Carbon BL.
time required to reach equilibrium. Calgon Carbon suggested that the time
required to reach equilibrium for this system would be >24 h. However,
from these curves it can be seen that local equilibrium concentrations were
reached in <30 min for all agitation rates and in as little as 20 min for the
highest agitation rates. These fast equilibrium times may be attributed to
the affinity of this carbon for acetic acid. Figure 3 also indicates final local
equilibrium concentrations. Note that after a great amount of time passed
(>48 h), the same equilibrium was achieved, and that the equilibrium
recorded was a local, not a true, equilibrium. Clearly, the 50-rpm agitation
rate does not perform well, achieving half of the equilibrium concentration
of the remaining rates. This can be attributed to incomplete mixing of the
carbon particles since it was observed that a quantity of carbon remained
at the bottom of the reaction vessel at the end of the kinetic experiment.
Equilibrium concentrations also were observed to decrease with agitation
rate. This result was not originally expected but indicates that a controlling
mass transfer resistance exists for the lower agitation rates and shows that
the degree of agitation does indeed have an effect on the adsorption of
acetic acid by activated carbon.
Having completed the kinetic studies, we applied the developed
model to the collected data. The results of the model application are given
in Fig. 4, describing the external mass transfer coefficient, and in Fig. 5,
describing the effective diffusivity. The calculated values for the external
0,------------------------------------,
-0.5
-1
-1.5
~
~ -2
Ei
+
-.a
.-!
"r' -2.5
"";;'
U
.~~
-3
U
;:::;
-3.5
• 100 rpm
-4 • 150 rpm
x 200 rpm
-4.5
:I: 250 rpm
-5
0 2 4 6 8 10 12
Time,min
Fig. 4. Dimensionless external film coefficient term as function of time and rpm at
15°C using Calgon Carbon BL.
1.2
• 50 rpm
• 100 rpm
1 • 150 rpm
x 200 rpm
GI 0.8 :Ie 250 rpm
!<1.1
!B
1
0.6
GI
~ 0.4
0.2
0
0 2 4 6 8 10 12
Time, min
Fig. 5. Dimensonless time as function of time and rpm at 15°C using Calgon Car-
bon BL.
Conclusions
The results of the adsorption kinetic experiments are valid for 10 giL
acetic acid solutions, agitated by a Rushton turbine impeller at SO, 100, 150,
200, and 2S0 rpm in a 4-L glass reaction vessel, and contacted with 80 giL
of the powdered activated carbon Calgon BL at lS°C. Equilibrium was
achieved 24 times faster than the time recommended by the manufacturer
of the activated carbon for this tested system. For lS0, 200, and 2S0 rpm,
>62% of the initial acetic acid was adsorbed. The presented model describ-
ing a linear approach to the external film resistance is supported with
coefficients of correlation ranging from 0.93 to 0.99, and those describing a
linear approach to the effective diffusivity are supported with coefficients
of correlation ranging from 0.84 to 0.99.
Acknowledgments
We are grateful to Judy Grady of Jim Beam Brands and Tom Effler of
Brown-Forman for their help in the sample analysis. This work was funded
by the US Department of Energy, Office of Fuels Development with the
National Renewable Energy Laboratory subcontract XCO-1-31016-01.
References
1. Nguyen, Q. A, Tucker, M. P., Keller, F. A, Beaty, D. A., Connors, K M., and Eddy,
F. P. (1999), Appl. Biochem. Biotechnol. 77-79, 133-142.
2. Larsson, S., Palmqvist, E., Hahn-Hagerdal, B., Terrborg, c., Stanberg, K, Zacchi, G.,
and Nilvebrant, N. O. (1999), Enzyme Microbiol. Technol. 24, 151-159.
3. Ranatunga, T. D., Jervis, J., Helm, R. F., McMillan, J. D., and Hatzis, C. (1997), Appl.
Biochem. Biotechnol. 67,185-198.
4. Larsson, S., Reimann, A, Nilvebrant, N. 0., and Jonsson, L. J. (1999), Appl. Biochem.
Biotechnol. 77-79,91-103.
5. Lee, W. G., Lee,J. S.,Shin,C. S.,Park, S. C.,Chang,H. N., and Chaik, Y.K. (1999),Appl.
Biochem. Biotechnol. 77-79,547-559.
6. Rivard, C. J., Engel, R. E., Hayard, T. K, Nagle, N. J., Hatzis, c., and Philippidis, G.
P. (1996), Appl. Biochem. Biotechnol. 57-58,183-191.
7. Jonsson, L. J., Palmqvist, E., Nilvebrant, N. 0., and Hahn-Hagerdal, B. (1998), Appl.
Microbiol. Biotechnol. 49, 691-697.
8. Hassler, J. W. (1974), Purification with Activated Carbon, Chemical Publishing Com-
pany, New York, NY.
9. Morresi, A. C. and Cheremisinoff, P. N. (1978), in Carbon Adsorption Handbook,
Cheremisinoff, P. Nand Ellerbusch, F., eds., Ann Arbor Science, Ann Arbor, MI,
pp.I-54.
10. Mathews, A P. and Weber, W. J. (1977), AIChE Symp. Ser. 16673,91-98.
11. McKay, G. (1983), J. Chem. Technol. Biotechnol. 33A,205-218.
12. Bird, R. B., Stewart, W. E., and Lighfoot, E. N. (1960), Transport Phenomena, John Wiley
& Sons, New York, NY.
13. Suzuki, M. (1990), Adsorption Engineering, Elsevier Science, New York, NY.
14. Crank, J. (1956), The Mathematics of Diffusion, Oxford University Press, London, UK
Enzymatic Digestibility
of Used Newspaper Treated with Aqueous
Ammonia-Hydrogen Peroxide Solution
Abstract
Wastepaper constitutes approximately half of municipal solid waste,
making it a potential source of bioenergy. Newspaper was pretreated with
an ammonia-hydrogen peroxide (H20 2) mixture in a shaking bath from room
temperature to 80 a C, and then its enzymatic digestibility was measured. A
significant amount of ink was removed from the newspaper slurry by the
reciprocating movement of the shaking bath. In addition, the ammonia-H 20 2
significantly swelled the substrate, thereby greatly increasing its susceptibil-
ity to enzymatic digestion. After pretreating the newspaper with conditions
of 40 a C, 3 h, 130 strokes/min, and 4 wt% ammonia-2 wt% H 20 2, the enzy-
matic digestibility was almost 90% of theoretical, or about 25% higher than
that of untreated substrate. Digestibility was also investigated as a function
of ammonia concentration, H 20 2 concentration, shaking speed, pretreatment
temperature, and time.
Index Entries: Pretreatment; newspaper; ammonia; hydrogen peroxide;
enzymatic digestibility.
Introduction
Lignocellulosic materials have considerable promise as a source of
future energy. Wastepaper is a plentiful and low-cost feedstock for making
bioethanol (1). Typically, wastepaper constitutes half of municipal solid
waste, and newspaper alone 14% of the waste (2). In the past, most of this
material was used only once and then was landfilled or incinerated. Even
recycled wastepaper can be used only two to three times before the fibers
become unacceptably short.
Lignocellulosic biomass generally resists enzymatic hydrolysis; thus,
effective pretreatment is an essential prerequisite to enhance the digestibil-
*Author to whom all correspondence and reprint requests should be addressed.
Applied Biochemistry and Biotechnology 365 Vol. 105-108,2003
366 Kim and Moon
ity of lignocellulosic residues. Of a number of studies on the pretreatment
of lignocellulosic materials, there have been limited studies on wastepaper
pretreatment using electron beam irradiation (3), carbon dioxide (4), steam
explosion (5), ammonia fiber explosion (6), and ammonia-hydrogen perox-
ide (H20 2) in a percolation reactor system (7). The pretreatment methods
used in most of these studies, however, were the same as those used in
woody and herbaceous materials. Because paper has already had consid-
erable chemical and/or physical treatment, wastepaper does not require
the extensive pretreatment developed for woody and herbaceous materi-
als. Another difference between wastepaper and raw lignocellulosic mate-
rial is ink and fillers added in the paper-making process. These chemicals
could potentially interfere with the enzymatic hydrolysis of wastepaper.
H 20 2 in aqueous ammonia solution is very effective for pretreating
lignocellulosic materials (8,9). It also has been used to pretreat wastepa-
per (6,7). However, the reported methods appear to be uneconomical
because of high chemical costs. To increase enzymatic digestibility with-
out severe pretreatment, a pretreatment process was devised that can
remove ink and swell the substrate easily on a shaking bath. In our pre-
vious study (10), this process proved to be extremely effective at remov-
ing ink from newspaper. The main purpose of the present study was to
investigate parameters that affect enzymatic digestibility when treating
newspaper in an ammonia-H20 2 mixture on a shaking bath. The pretreat-
ment temperatures used were <80 a C, which are very mild compared to
conventional pretreatment conditions.
___ untreated
-6- 4 wt% ammonia
---6.
4 wt% ammonla+2 wt% HP2
___ 8 wt% ammonia
o 20 40 60 80
Time (h)
80
____ untreated
-0- 70 strokeslmin
-T- 100 strokeslmin
20
--v- 130 strokeslmin
o 24 48 72
Time (h)
100~--------------------------------------------~
80 ---~ ~ ....,::;:~~
.
................................ .
................................
•
·······0·······
untreated
2 wt% ammonia
---T"-- 4 wt% ammonia
_ .. -v-.. - 6 wt% ammonia
20
- .... - 8 wt% ammonia
_.-0-.- 10 wt% ammonia
o 24 48 72
Time (h)
80
•
·······0·······
untreated
---T---
_ . -v--.. -
20
- .... -
o 24 48 72
Time (hour)
100
90
80
•
;e
~
70
60
•
~
:c 50
~
:g,40
is
30
0
20 40 60 80
Temperature(°C)
___ untreated
-0- 1h
--T- 2h
-V- 3h
48 72
Time (h)
Acknowledgments
We gratefully acknowledge the financial support provided for this
work by the Ministry of Commerce, Industry and Energy, Korea.
References
1. Wyman, C. E. (1994), Bioresour. Technol. 50,3-16.
2. Scott, C. D., Davison, B. H., Scott, T. c., Woodward, J., Dees, c., and Rothrock, D. S.
(1994), Appl. Biochem. Biotechnol. 45/46, 641-653.
3. Khan, A W., Labrie, J., and McKeown, J. (1987), Radiat. Phys. Chem. 29, 117-120.
4. Zheng, Y., Lin, H., and Tsao, G. T. (1998), Biotechnol. Prog. 14,890-896.
5. Cuna, D., Ricci, E., Alfani, F., Cantarella, M., D'Ercole, 1., Gallifuoco, A, Spera, A,
Zimbardi, F., and Viggiano, D. (1998), in Proceedings of International Conference of
Biomass for Energy and Industry, Wiirzburg, Germany, pp. 560-563.
6. Holtzapple, M. T., Lundeen, J. E., Sturgis, R., Lewis, J. E., and Dale, B. E. (1992), Appl.
Biochem. Biotechnol. 34135, 5-21.
7. Kim, J. S., Lee, Y. Y., and Park, S. C. (2000), Appl. Biochem. Biotechnol. 84-86, 129-139.
8. Kim, S. B., Urn, B. H., and Park, S. C. (2001), Appl. Biochem. Biotechnol. 91-93,81-94.
9. Kim, S. B. and Lee, Y. Y. (1996), Appl. Biochem. Biotechnol. 57/58,147-156.
10. Moon, N. K. and Kim, S. B. (2001), Korean J. Biotechnol. Bioeng. 16,446-451.
Abstract
Acetone, butanol, ethanol (ABE, or solvents) were produced from
starch-based packing peanuts in batch and continuous reactors. In a batch
reactor, 18.9 giL of total ABE was produced from 80 giL packing peanuts
in 110 h of fermentation. The initial and final starch concentrations were
69.6 and 11.1 giL, respectively. In this fermentation, ABE yield and pro-
ductivity of 0.32 and 0.17 g/(L·h) were obtained, respectively. Compared
to the batch fermentation, continuous fermentation of 40 giL of starch-
based packing peanuts in P2 medium resulted in a maximum solvent pro-
duction of 8.4 giL at a dilution rate of 0.033 h-1• This resulted in a
productivity of 0.27 gl (L·h). However, the reactor was not stable and fer-
mentation deteriorated with time. Continuous fermentation of 35 giL of
starch solution resulted in a similar performance. These studies were per-
formed in a vertical column reactor using Clostridium beijerinckii BA101 and
P2 medium. It is anticipated that prolonged exposure of culture to
acrylamide, which is formed during boiling I autoclaving of starch, affects
the fermentation negatively.
Index Entries: Starch-based packing peanuts; continuous fermentation;
butanol; Clostridium beijerinckii BAlOl; reactor; dilution rate.
Introduction
and the reactor was filled with the starch/packing peanut-based fresh P2
medium described earlier. Cell growth was allowed inside the reactor for
6 h, after which the P2 medium was continuously fed using a peristaltic
pump (Cole-Parmer, Veron Hills, IL) and silicone tubing. The reactor was
fed at the bottom, thus getting effluent at the top. Since it was a free-cell
reactor, feed rate was kept low for solventogenesis (Dilution rate [D, h-1]
< !! [specific growth rate constant, h-1] and v [specific rate of solvent produc-
tion, h-l]). Water at 35°C was circulated through the jacket of the column to
control temperature using a circulating water bath (Polystat; Cole-Parmer).
Analytical Procedures
Because of the opaque nature of starch and of peanut solutions, cell
concentration measurement by optical density was not possible. ABE and
acids (acetic and butyric) were measured using a 6890 Hewlett-Packard
gas chromatograph (Hewlett-Packard, Avondale, PA) equipped with a
flame ionization detector and 6 ft x 2 mm glass column (10% CW-20M,
0.01% H 3P04, support 80/100 Chromosorb WAW). Batch fermentation
productivity was calculated as total ABE concentration (g/L) divided by
fermentation time (h). Fermentation time was defined as the time period
when a maximum ABE concentration was reached. ABE yield, which
does not have a unit, was calculated as total ABE produced (g) divided by
total carbohydrate (as starch) utilized (g). In the continuous fermentation,
productivity was calculated as ABE concentration (g/L) multiplied by
dilution rate (h-l). Dilution rate is defined as feed flow rate (mL/h) per
reactor volume (mL).
Glucose concentration was determined using a hexokinase and glu-
cose-6-phosphate dehydrogenase (Sigma, St. Louis, MO) coupled enzy-
matic assay. To measure glucose, the fermentation broth was centrifuged
(microfuge centrifuge) at 16,OOOg for 3 min at 4°C. A portion of the super-
natant (10 !!L) was mixed with glucose (HK 20) reagent (1.0 mL) and incu-
bated at room temperature for 5 min. Standard solutions of anhydrous
D-glucose containing 1-5 mg/mL of glucose in distilled water were pre-
pared. Ten microliters of each of the standard solutions was mixed with
glucose (HK 20) reagent (1.0 mL) and incubated at room temperature for
5 min. A blank (deionized water) (10 !!L) was incubated with the reagent
and used for zero adjustment of the spectrophotometer. After 5 min, the
absorbance was measured at 340 nm using a Beckman Du 640 spectropho-
tometer, and the glucose content in the sample was computed by least
squares linear regression using a standard curve.
Starch concentration of the sample was determined using a modified
method of Holm et al. (10). A sample (250 mg) was suspended in distilled
water (15 mL) in a 50-mL beaker. Heat-stable a-amylase (100 !!L) (Sigma)
was added and mixed gently with a magnetic stirrer. The beaker was
placed in a boiling water bath for 30 min with mixing every 5 min. The
suspension was allowed to cool under continuous agitation on a magnetic
stirrer and was transferred to a 25-mL volumetric flask followed by filling
Applied Biochemistry and Biotechnology Vol. 105-108,2003
Production of Butanol from Waste Substrate 379
it with water to the volume. One milliliter of the solution was transferred
to a test tube followed by the addition of 2.9 mL of 0.1 M sodium acetate
buffer (pH 4.75) and 100 t-tL of amyloglucosidase (Sigma). The mixture was
incubated for 60 min at 55°C with careful mixing every 5 min. The sample
was then transferred to a 50-mL volumetric flask and filled to volume with
distilled water. Ten microliters of the solution was assayed for glucose
according to the hexokinase and glucose-6-phosphate dehydrogenase
assay method as described earlier.
% starch = (mg glucose x 25 a x 50 a x 0.9 b x 100)/( Sample weight [250 mg])
in which a is the dilution factor and b is the correction glucose ~ glucan.
At the time of these studies, it was not possible to analyze starch-based
packing peanuts for all of their constituent components.
Table 1
Continuous Production of ABE
from Starch-Based Packing Peanuts Using C. beijerinckii BAlOl
Products (giL) ABE
Time Acetic Butyric Total productivity
(h) Acetone Butanol Ethanol acid acid ABE (g/(L·h])
24 0.9 2.8 0.1 2.7 1.1 3.8 0.12
48 1.7 4.9 0.1 2.3 1.0 6.7 0.22
72 1.6 6.4 0.1 1.6 1.1 8.1 0.26
83 1.7 6.6 0.1 1.3 0.9 8.4 0.27
102 1.4 5.7 0.1 1.8 0.8 7.2 0.24
121 1.7 6.5 0.1 1.4 1.3 8.3 0.27
143 1.0 4.2 0.1 1.9 1.3 5.3 0.17
151 1.1 4.7 0.1 1.8 2.2 5.9 0.19
169 1.0 2.8 0.1 3.0 1.5 3.9 0.13
175 0.7 2.1 0.1 1.9 2.1 2.9 0.09
196 0.7 2.2 0.1 2.2 2.3 3.0 0.09
216 0.7 2.1 0.1 3.7 3.3 2.9 0.09
225 0.8 2.2 0.1 3.5 2.2 3.1 0.10
241 0.6 1.8 0.0 3.5 2.2 2.4 0.08
246 0.6 1.7 0.0 3.5 2.2 2.3 0.08
20 A
-
15~~---+--~--+-~r-~
:J'
.9 • Acetone
~ 10 1---+---1:-........-+--.",-::=--+__--1 • Butanol
e
:l • Ethanol
* TotalABE
a.
0_:.......J.J,..............................___=.l...----l
o 20 40 60 80 100 120
Fermentation Time [h]
20
B
15
o Acetic acid
o Butyric acid
~
A Total acids
\.. ....
5 ..(]
no. ~
oV
~
o 20 40 60 80 100 120
Fermentation Time [h]
Acknowledgments
We gratefully acknowledge the kind gift of the packing peanuts from
Storopack, Cleveland, OH. This work was supported by grants from Illi-
nois Corn Marketing Board and Illinois Council on Food and Agricultural
Research (CFAR IDA CF 01E-35-1).
Applied Biochemistry and Biotechnology Vol. 105-108,2003
382 Ezeji et a/.
Table 2
Continuous Production of ABE from 35 giL
of Starch Using C. beijerinckii BA101
References
1. Qureshi, N. and Blaschek, H. P. (2001), J. Ind. Microbiol. Biotechnol. 27,292-297.
2. Davison, B. H. and Scott, C. D. (1988), Appl. Biochem. Biotechnol. 18, 19-34.
3. Davison, B. H. and Thompson, J. E. (1993), Appl. Biochem. Biotechnol. 39,415-425.
4. Friedl, A., Qureshi, N., and Maddox, I. S. (1991), Biotechnol. Bioeng. 38,518-527.
5. Ennis, B. M., Maddox, I. S., and Schoutens, G. H. (1986), NZJ Dairy Sci. Technol. 21,
99-109.
6. Chen, C. K. and Blaschek, H. P. (1999), Appl. Microbiol. Biotechnol. 52,170-173.
7. Qureshi, N. and Blaschek, H. P. (2000), Trans IChemE 78(Part C), 139-144.
8. Formanek, J., Mackie, R., and Blaschek, H. P. (1997), Appl. Environ. Microbiol. 63,
2306-2310.
9. Qureshi, N. and Blaschek, H. P. (1999), Biomass Bioenergy 17,175-184.
10. Holm, J., Bjorck, I., Drews, A., and Asp, N.-G. (1986), Starch/Starke 38, 224-226.
11. Jesse, T. W., Ezeji, T. c., Qureshi, N., and Blaschek, H. P. (2002) J. Ind. Microbiol.
Biotechnol. 29,117-123.
Abstract
Corn stover is currently being evaluated as a feedstock for ethanol pro-
duction. The corn stover suspensions fed to reactors typically range between
10 and 40% solids. To simulate and design bioreactors for processing highly
loaded corn stover suspensions, the rheologic properties of the suspension
must be measured. In systems with suspended solids, rheologic measure-
ments are difficult to perform owing to settling in the measurement devices.
In this study, viscosities of corn stover suspensions were measured using a
helical ribbon impeller viscometer. A calibration procedure is required for
the impeller method in order to obtain the shear rate constant, k, which is
dependent on the geometry of the measurement system. The corn stover
suspensions are described using a power law flow model.
Index Entries: Corn stover; rheological properties; helical impeller; cone-
and-plate impeller; power law parameters.
Introduction
Production of fuel ethanol from renewable lignocellulosic material
(bioethanol) has the potential to reduce world dependence on petroleum
while decreasing net emissions of CO2, the principal greenhouse gas.
Lignocellulosic biomass includes hardwoods, herbaceous crops, agricul-
tural residues (i.e., com stover), and wastepaper and other fractions of
municipal solid waste. These materials are primarily cellulose, hemicellu-
lose, and lignin (1-3).
The lignin-hemicellulose network of biomass retards cellulose bio-
degradation by cellulolytic enzymes. To remove the protecting shield of
lignin-hemicellulose and make the cellulose more readily available for
enzymatic hydrolysis, biomass must be pretreated (4).
Thermochemical treatment (e.g., with steam and dilute H2S04) is a
popular pretreatment process. This treatment opens the lignocellulose pore
"Author to whom all correspondence and reprint requests should be addressed.
pND~ (2)
Rei=-~-
0.6
E
~ 0.4
<Il
:l
~
~
0.2
0
0 2 3 4 5 6 7
Rotational Speed (rpm
Results
From the Newtonian calibration fluids measurements, the value for
the constant, c, was determined to be 135. Figure 2 shows the typical
example of the torque-impeller speed curves in the case of silicone oil.
Figure 3 shows the relationship between the impeller constant, c, and the
Applied Biochemistry and Biotechnology Vol. 105-108,2003
388 Pimenova and Hanley
100 r-----------------------------------------------~
155
U 145
135 c Glycerol
o 2 3 4 5 6 7 8 9
Re
Fig. 3. Relationship between c and Re for glycerol and silicone oil DMPS-IM using
helical impeller.
Re for silicone oil and glycerol. The deviation in the value of c between Re
from 1 to 10 was <5%.
The value of the shear rate constant, k, was determined for solutions
of xanthan gum and guar gum with concentrations of 0.5,1.0, and 1.5%.
Figure 4 compares the helical impeller and cone-and-plate data for the 0.5
and 1.0% xanthan gum solutions.
The average value for k determined for each solution is shown in
Table 1 along with the power law indices calculated from the cone-and-
plate and impeller viscometer data for each fluid. The shear rate constant
k obtained from the cone-and -plate and helicalimpellers was 10.9. A simi-
lar value of k was obtained for 1.0 and 1.5% of xanthan and guar gum
solutions. The same value of k was reported for this type of impeller in
earlier investigations (6,11).
The results of the rheologic measurements for the corn stover suspen-
sions are presented in Fig. 5. Corn stover suspensions of 5, 10,20, and 30%
were used. The viscosity of the suspension increased as the fiber loading
increased, as expected. The power law parameters (the consistency index
number, n; the power law parameters, ~l) for the various fiber suspensions
are presented in Table 2 and may be compared with the results of Dronawat
et aL (11), who conducted tests with the Solka-Floc fiber of similar length
(215 !lm). The parameters are independent of the method of measuring
rheologic data and dependent on the fluid.
Applied Biochemistry and Biotechnology Vol. 105-708,2003
Rheological Properties of Corn Stover 389
A 100
I ~ Cone-and-P1ate I
I. I Ielical Impelle~
<0 0
0
-v0 6
--0
.t.
... ~
0.01
100 10000
Shear Rate ( lis)
B 10
J 0 Conc-and-P1atc
l. Helical Impelle
<>
~
-~
. ... ~
0.001
1 100 10000
Fig. 4. Shear rate vs viscosity for (A) 0.5 % and (B) 1.0 % xanthan gum.
Table 1
Values of Shear Rate Constant for Different Fluids and 1000-mL Vessel
n
Solution k Cone-and-plate impeller Helical impeller
XanthanGum
0.5% 10.8 ± 1.2 0.37 0.39
1.0% 10.1 ± 1.7 0.26 0.23
1.5% 10.8 ± 0.6 0.19 0.19
Guar gum
0.5% 11.6 ± 1.3 0.45 0.44
1.0% 11.2 ± 0.7 0.31 0.29
1.5% 11.0 ± 1.0 0.19 0.18
. .. .5%
.10% f- c-
• •
D
..
100 .. " .tl:lO%
.. 30% t:- ~
~
.tl
~
.. ... ..
.tl
.tl
.tl .tl
- - . • ...
0.01
10
'"' - 100
Shear Rate. lis
Discussion
Calibration Procedure
The basic assumption of the impeller viscometer approach is that the
shear rate constant is independent of the rheologic properties of the fluid.
It allows the helical impeller viscometer to be calibrated for homogenous
non-Newtonian fluids, which are difficult to analyze by conventional
rheologic instruments. Xanthan and guar gum solutions were chosen as
non-Newtonian calibration fluids, because their rheologic behavior at low
shear rates is similar to that of yield stress fluids. The calibration results for
guar and xanthan gum solutions ranging in concentration from 0.5 to 1.5%
produced a single value of k = 10.8 sufficient to represent all the data.
The power law indices obtained using the helical impeller compare
well with the cone-and-plate viscometer results, as can be seen in Tables 1
and 2. The difference in the value of k may be explained by the fact that in
the vicinity of the low-shear Newtonian transition, the viscosity is relatively
insensitive to the shear rate, which is not desirable for determining k.
Conclusions
The parameter c is a linear function of Re. The linear regression analy-
sis performed on the data collected for glycerol and silicone oil yielded
regression coefficients ranging from 0.98 to 0.998. Furthermore, the shear
rate constant is independent of the rheologic properties of the fluid. The
percentage difference between the highest and lowest values of shear rate
constant calculated for the xanthanand guar gum was 10% (10.9 ± 1.1). The
impeller method can accurately and reliably measure the rheologic prop-
erties of filamentous suspensions, based on the results obtained from the
corn stover suspension experiments.
Acknowledgment
Funding for this project was provided by the National Renewable
Energy Laboratory (subcontract no. XCO-1-31016-01).
References
1. McMillan, J. D. (1997), Renewable Energy 10(2/3), 295-302.
2. Wenzl, H. F. J. (1996), The Chemical Technology of Wood, Academic, New York, NY.
3. Hayn, M., Steiner, W., Klinger, R, Steinmueller, H., Sinner, M., and Esterbauer, H.
(1993), in Bioconversion of Forest and Agricultural Plant Residues, Saddler, J. N., ed.,
CAB, Wallingford, UK, pp. 33-72.
4. Esteghlalian, A., Hashimoto, A. G., Fenske, J. J., and Penner, M. (1997), Bioresour.
Technol. 59,129-136.
5. Ranatunga, T. D., Jervis, J., Helm, R. F., McMillan, J. D., and Wooley, R J. (2000),
Enzyme Microb. Technol. 27,240-247.
6. Svihla, C. K., Dronawat, S. N., and Hanley, T. R (1995), Appl. Biochem. Biotechnol. 51152,
355-366.
7. Allen, D. G. and Robinson, C. W. (1990), Chem. Eng. Sci. 45(1),37-48.
8. Kemblowski,1. and Kristiansen, B. (1986), Biotechnol. Bioeng. 28, 1474-1483.
9. Metz,B.,Kossen,N. W.F.,and VanSuijdam,J.C. (1979), Adv. Biochem. Eng. 11,103-155.
10. Charles, M. (1978), Adv. Biochem. Eng. 8, 1-62.
11. Dronawat, S. N., Rieth, T. c., Svihla, C. K., and Hanley, T. R (1996) in Proceedings of the
5th World Congress of Chemical Engineering, vol. I, AIChE, New York, NY, pp. 629-633.
12. Svihla, C. K., Dronawat, S. N., Donnely, J. A., Rieth, T. c., and Hanley, T. R (1997)
Appl. Biochem Biotechnol. 63/65, 375-385.
Abstract
The alkalophilic Bacillus circulans 01 was isolated from decayed wood.
It produced high levels of extracellular cellulase-free xylanase. The enzyme
was thermally stable up to 60°C, with an optimal hydrolysis temperature
of 70°C. It was stable over a wide pH range (5.5-10.5), with an optimum
pH at 5.5 and 80% of its activity at pH 9.0. This cellulase-free xylanase
preparation was used to biobleach kraft pulp. Enzymatic treatment of kraft
pulp decreased chlorine dioxide use by 23 and 37% to obtain the same
kappa number (K number) and brightness, respectively. Separation on
Sephadex G-50 isolated three fractions with xylanase activity with distinct
molecular weights.
Index Entries: Bacillus circulans; biobleaching; kraft pulp; thermophilic;
xylanase.
Introduction
After cellulose, hemicelluloses are the most abundant organic materi-
als found on Earth and are the main polysaccharides of plant cell walls.
They are closely associated with cellulose in plant tissues and account for
40-45% of the dry weight of hardwood and softwood. Xylan is the main
constituent of hemicellulose from wood, and it accounts for >90% of the
hemicellulose in kraft pulp from hardwood, and about 50% of hemicellu-
loses in softwood pulps (1). There is evidence that xylan binds to lignin by
Fractionation of Xylanase
The crude enzyme was precipitated by adding ethanol to make a 70%
(v Iv) solution; the precipitate was collected by centrifugation. The concen-
trated crude enzyme (12 mL), containing a total of 601 IU, was applied to
a Sephadex G-50 column that had been equilibrated with 20 mM acetate
buffer, pH 5.0, and was eluted with the same buffer.
Chemical Bleaching
Pulps, treated and untreated with enzyme, were bleached with chlo-
rine dioxide (CI02) followed by extraction with NaOH(E) (DE bleaching
stages). The amount of Cl02 used in the bleaching was determined by cal-
culating the concentration of active chlorine on the aqueous solution of
Cl02 and varied around the kappa (K) factor recommended (K factor is a
standard quantity, determined experimentally, used in studies comparing
bleaching processes and represents the percentage of active chlorine di-
vided by the K number of the pulp: K number x K factor =% of Cl02), which
under typical industrial conditions is 0.26. The samples contained 10.0 g of
oven-dried pulp and Cl021 at a 10% slurry concentration. Each sample was
homogenized, maintained in a bath at 60°C for exactly 30 min, cooled, and
then washed with distilled water in a Buchner funnel. The alkaline extrac-
tion was made with pulp at 10% concentration, at 70°C for 1 hand NaOH
final concentration of 1.6%. Afterward, the samples were washed with
distilled water and filtered in a Buchner funnel.
Pulp Properties
Pulp properties were investigated according to the Standard Methods
of the Technical Association of the Pulp and Paper Industry (TAPPI Stan-
dard Methods). For determination of K number, the microKappa method-
ology was used, by reacting pulp samples with acidified potassium
permanganate, as described in TAPPI protocol T-236 OM-85. After
delignification, the pulp was pressed and transformed in dried sheets, at
room temperature, for viscosity and brightness experiments. Viscosity was
evaluated by dissolving pulps in cupriethylenodiamine and by measuring
the viscosity with an Ostwald viscosimeter, as described in TAPPI protocol
T-230 OM-82. The brightness of the paper sheets was measured by reflec-
tance at 457 nm with an Elrepho 2000 instrument, according to TAPPI pro-
tocol T-452 OM-87.
Applied Biochemistry and Biotechnology Vol. 105-108,2003
B. circulans 01 and Biobleaching of Kraft Pulp 397
Table 1
Characteristics of Treated and Untreated Kraft Pulp
Untreated pulp Pulp treated with xylanase
Q) 4
.0
E
::l
c:: 3
to
a.
a.
~ 2
Fig. 1. K Number of kraft pulp (-e-) treated and (-0-) untreated withxylanase
from B. circulans D1. Data are mean of two replicates.
_60
oC/)
- g j56
-c:
..c:
Q)
.g> 52
ID
48+-~-.~-''-~~~~~--r-~.
Fig. 2. Brightness of kraft pulp (-0-) treated and (-e-) untreated with xylanase
from B. circulans 01. Data are mean of seven replicates.
3 0.35
--
::J 2.5 0.3
E
::J 0.25
2 E
~ c:
0.2
~al 1.5
0
co
N
Q) 0.15 f/)
f/) .0
al <C
c: 0.1
al
>.
X 0.5
0.05
30 40 50 60 70 80 90 100 110
Fraction number
Conclusion
The extracellular cellulase-free xylanase produced by alkalophilic
B. circulans D1 exhibited desirable properties such as activity at elevated
temperature, and alkali and thermal stability, which are advantageous
for application in the pulp and paper industry. Application of xylanase to
the kraft pulp significantly reduced the requirement of oxidizing CI02 in
the bleaching process. The crude xylanase displayed action of endoxylanase
and was separated in three fractions of distinct molecular weight.
Acknowledgments
We gratefully thank Champion Paper and Cellulose Uda for provid-
ing the pulp samples, Dr. Jorge L. Colodette for the analytical tests of pulp
samples, and Funda~ao de Amparo aPesquisa do Estado de Sao Paulo for
financial support.
References
1. Erikson,O.,Goring,D.A.I.,and Lindgren,B.O. (1980), Wood Sci. Technol.14,267-269.
2. Ferreira Filho, E. X. (1994), Braz. ,. Med. BioI. Res. 27, 1093-1109.
3. Tavares, V.B., Gomes, E., lembo, T., Bocchini, D. A., and Da Silva, R. (1997), in Fifth
Brazilian Symposium on the Chemistry ofLignins and other Wood Components, pp. 367-371.
Abstract
Allergenic extracts were produced from Drechslera (Helminthosporium)
monoceras biomass cultured by solid-state fermentation using wheat bran as
the substrate. The main fermentation variables were selected by statistical
design, and the optimized biomass yield (1.43 mg/[g of dry substrate· d])
was obtained at pH 9.5 and 45.8% moisture. The allergenic extracts were
produced from crude extract by protein precipitation and polyphenol
removal. Proteins in the range of 16-160 kDa were identified in the extracts.
Their reactions in patients were characterized by in vivo cutaneous tests
(positive in 40% of the atopic patients) and by dot-blotting assays.
Index Entries: Allergenic extract; Drechslera (Helminthosporium) monoceras;
solid-state fermentation; statistical experimental design; wheat bran; pro-
teins; biomass.
Introduction
Their allergenic compounds are usually proteins that induce in humans the
formation of IgE isotype antibodies when inhaled, swallowed, or injected
(1). About 340 genera of molds associated with respiratory allergies are
listed in the literature. Alternaria, Cladosporium, Aspergillus, and Penicillium
are the most extensively studied genera, and their extracts have been char-
acterized and standardized (2).
Previous studies showed intense allergic reactions to Drechslera
(Helminthosporium) monoceras extracts in asthmatic patients, as measured
by cutaneous tests (2,3). These extracts were obtained from the fungi bio-
mass cultured by liquid fermentation. The main antigens were identified as
14.4,36, and 60 kDa proteins, and these extracts were successfully used in
allergy diagnosis (2,3).
D. monoceras is a saprophyte fungi that is found in the soil and is
associated with pathogenicity in plants such as maize, oats, wheat, sugar-
cane, and grasses. This characteristic suggests that solid-state fermentation
using agricultural residues as substrates could be a suitable process for
saccharification and fermentation, owing to the similarity to its natural
habitat. In addition, it could be a less expensive process to produce aller-
genic extracts on a large scale. Solid-state fermentation can be a powerful
process for microorganism growth using agroindustrial residues, and it is
more advantageous in many ways than liquid fermentation, especially
when yeasts or filamentous fungi are used (4). In recent years, several pro-
cesses that utilize agroindustrial residues as raw materials for the produc-
tion of bulk chemicals and value-added products, such as ethanol,
single-cell protein, edible mushrooms, enzymes, organic acids, amino ac-
ids, and biologically active secondary metabolites, have been reported (5).
This article describes a statistical process optimization for production
of D. monoceras biomass cultured by solid-state fermentation and presents
the characterization of the allergenic extracts obtained.
MS Pure Error=O.0193
Yield
p=0.1
pH -6.10784
M ~===;~~~=+~--3-,2-5-75-l--~~~=-~~
t=====;::=:~=+;--'
pHxF
~::::;::::==::;-I
dp I==::;;::::=:::;--.J
F
1==::;::::;---1
Co
!---....I
pHxdp
Fig. 1. Pareto chart of effects (at 90% of confidence level) for two-level fractional
factorial design (2 5•2).
Xz = (M - 40)/7 (2)
The biomass yield results obtained for the initial central composite
design varied from 0.7 (corresponding to the experiment at Xl = _2l/Z,
Xz = 0) to 1.56 mgl (g of dry substrate· d) (corresponding to the experi-
ment at Xl = +1, Xz = +1). The values used in the experiments for F, dp, and
Co were 2 Llh, 0.59 mm, and 0.4 giL, respectively. The experimental data
for yield as a function of the coded variables pH and M (Xl and Xz) could
be better fitted by a linear model (Eq. 3), indicating that yield tends to
increase with pH and M. The linear model was validated by ANOV A with
a confidence level of 95%, and the correlation coefficient value obtained
(R2 = 0.977) was considered satisfactory for this kind of experiment:
Yield = 1.187 + 0.21·Xl + 0.08·Xz + 0.04,Xl ,X2 (3)
:;::
-
co
-c 1.8
en
-c 1.4
C)
--
C
.Ci)
1.0
o 0.6
c .. 0.2
-
C)
E -0.2
f'o~
~
~~
+ I"'"~ ~
~~
~Co 1
~
Fig. 2. Response surface for yield obtained from Eq. 6 for real values of pH and M.
X2 = (M - 45)/7 (5)
A 1.2
12
1.0
"U
.,
fl! 0
>" 0.8 10
S'
0:- 3'
Ii 0.6
-
8 -3
3: ca
0.4 6 ca
0.2
0.0
4 -
0..
(n
B 58
200
180 /~
/"--'" 56
/ s::
160
en
~
ui
140
120
ti 54
--
0
i'
c
CiJ
-
100
J!: 52 '#.
80 +",--
60 +-+-+--+
--+-+-+-+ 50
40
0 50 100 150 200 250 300
Fennentation time (h)
Fig. 3. Time course of solid-state fermentation. (A) Water activity (-D-), polyphe-
nols (mM, -T-), YXIS (mg protein/mg glucose, -_-, and protein (mg/ g of dry
substrate [gds], -e-); (B) total reducing sugars (TRS) (mg glucose/gds, -+-),
reducing sugars (RS) (mg glucose/gds, -+-), and moisture (%,-6-).
kDa
94.0
67.0
43.0
30.0
20.0
14.4
kDa
212
170
116
76
53
Fig. 4. 50S-PAGE of allergenic extracts, revealed by silver strain. (A) Fifteen percent
polyacrylamide gel; (B) 10% polyacrylamide gel. MM, molecular marker; tf' fermenta-
tion time (h).
PI P2 P3 P4 PS P6 P? P8 c
EtOH,96h
dilution 1:4
SAm,240 h
SAm,96 h
EtOH, 240 h
EtOH, 0 h
Conclusion
References
1. Basomba, A (1982), in Purificaci6n y Estandardizaci6n de Alergenos, Departamento
Alergia de Abello, Madrid, Spain, pp. 91-98.
2. Menezes, E. A, Gambale, W., Macedo, M.S., Abdalla, D. s. P., Paula, C. R., and Croce,
J. (1995), Mycopathology 131, 75-81.
3. Mohovic, J., Gambale, W., and Croce, J. (1998), Allergol. Immunopathol. 16,397-402.
4. Pandey, A, Selvakumar, P., Soccol, C. R, Soccol, V. T., Krieger, N., and Fontana, J. D.
(1999), Appl. Biochem. Biotechnol. 81,35-52.
5. Pandey, A, Benjamin, S., Soccol, C. R., Nigam, P., Krieger, N., and Soccol, V. T. (1999),
Biotechnol. Appl. Biochem. 29, 119-131.
6. Yunginger, J. W., Jones, R T., Nesheim, M. E., and Geller, M. (1980), J. Allergy Clin.
Immunol. 66, 138-147.
7. Raimbault, M. and Alazard, D. (1980), Eur. J. Appl. Microbiol. 9, 199-209.
8. Moraes, R O. (1999), MS thesis, FEQ/UNICAMP, Sao Paulo, Brazil.
9. Bradford, M. M. (1976), Anal. Biochem. 72,248-254.
10. Miller, G. L. (1959), Anal. Chem. 31,426-428.
11. Saraiva, c.P. (2000), MS thesis, FEQ/UNICAMP, Sao Paulo, Brazil.
12. Price, M. L. and Butler, L. G. (1977), J. Agric. Food Chem. 25, 1268-1273.
13. Barros-Neto, B., Scarminio, I.S. and Bruns, RE. (1996), Planejamento e Otimiza~iio de
Experimentos, 2nd ed., Unicamp, Campinas, Brazil.
14. Laemmli, U. K. (1970), Nature 227,680-685.
15. Bio-Rad. (1998), Mini Protean® Electrophoresis Cell. Instruction Manual, Bio-Rad,
Hercules, CA
16. Morrissey, J. H. (1981), Anal. Biochem. 117,307-310.
Abstract
Cheese whey proteolysis, carried out by immobilized enzymes, can either
change or evidence functional properties of the produced pep tides, increas-
ing the potential applications of this byproduct of the dairy industry. Opti-
mization and scale-up of the enzymatic reactor relies on its mathematical
model-a set of mass balance equations, with reaction rates usually given by
Michaelis-Menten-like kinetics; no information about the distribution of
peptides' molecular sizes is supplied. In this article, a hybrid model of a batch
enzymatic reactor is presented, consisting of differential mass balances
coupled to a "neural-kinetic model," which provides the molecular weight
distributions of the resulting peptides.
Index Entries: Cheese whey proteolysis; enzymatic reactor; hybrid model;
mass balance equations; artificial neural networks.
Introduction
Reduction in the discharge of liquid protein residues generated in the
food industry process is a relevant concern (1). An interesting possible
solution to the problem is the conversion of those residues into market
products. Milky whey, arising from cheese manufacture, was considered,
for a long time, a product to be discharged. However, its high biologic
oxygen demand (35,000 mg/L) (2) and the associated treatment cost have
turned it into a byproduct of the food industry.
Whey and its products have been increasingly used in a great number
of applications such as for the production of creamer for foaming bever-
ages, edible food films, and milk and salt substitutes. On the other hand,
*Author to whom all correspondence and reprint requests should be addressed.
2.4
:::r A MW67000 Da
g 2.0
T
•
MW18000 Da
MW5000 Da
c::: • MW 1047 Da
0
;; 1.6
• MW556Da
Unearfits
-=CDc:::
CJ 1.2
c:::
0
CJ
en 0.8
en
as
E 0.4
0.0
0.0 6.0x107 1.2x1OS 1.8x1OS
peak area (!J.V*min )
algorithm was used (10). Finally, the classic Runge-Kutta method solved
the differential mass balances (11).
Results
Some calibration procedures were necessary for obtaining the pep-
tides' molecular weight distribution for each sample. Initially, five stan-
dards were injected into the column (Table 1). Then a calibration curve
mass concentration (giL) vs peak area (~V x min) was built for each stan-
dard (Fig. 1).
Applied Biochemistry and Biotechnology Vol. 105-108,2003
416 Sousa et al.
hidden
layer
m1 --+ --+ , 1
m2 --+ --+ '2
m3 --+ --+ '3
m4 --+ --+ '4
m5 --+ --+ '5
biBs --+
The linear coefficient of the curves in Fig. 1 was assumed constant and
equal to 0.03 giL «0 giL). The slopes, in turn, could be properly fitted as
a function of molecular weight (MW, Daltons) (Eq. 1):
Slope = -9.14 x 10-9 + 5.03 x 1O-9 1og 1o (MW) (1)
Molecular weights could be expressed as a function of the retention
time (retention, min) inside the column, as presented in Table 1:
loglO (MW) = 5.40 - 0.04 retention (2)
By combining Eqs. 1 and 2, a general equation was obtained that
relates mass concentration (Cone, giL) to the area in the chromatogram
(area, !A.V x min), as a function of retention time (min):
Cone = 0.03 + (-9.14 x 10-9 + 5.03 x 10-9[5.40 - 0.04 x retention]) x area (3)
Through HPLC analysis, it was possible to obtain the peptides' con-
centrations, for each sample, within five predefined ranges of interest
(MWI :s 650 Daltons, 650 Daltons < MW2 :s 1050Da, 1050 Daltons < MW3 <
4150 Daltons, 4150 Daltons :s MW4 < 14,000 Daltons, 14,000 Daltons :s MWs
:s 67,000 Daltons).
Considering each of the five molecular weight ranges as a pseudo-
component, feedforward MLP NNs were trained. The NNs were capable
of mapping the mass concentrations m1 (MWI :s 650 Daltons), m2 (650
Daltons < MW2 :s 1050 Daltons), m3 (1050 Daltons < MW3 < 4150 Daltons),
m4 (4150 Daltons s MW4 < 14,000 Daltons) and ms (14,000 Daltons s MWs
:s 67,000 Daltons) into an output vector constituted by the reaction rates
'2t
of the respective MW ranges, '1' '3' '4, and 's'
The feedforward NN (Fig. 2) comprises interconnected layers of pro-
cessing units (neurons). Processing units in adjacent layers are joined by
Applied Biochemistry and Biotechnology Vol. 105-108,2003
Hybrid Model for Enzymatic Reactor 417
Table 2
Mass Concentrations of Each Range
of Peptides' MW (pH 10.0) for Input to NN
m1 (giL) m2 (g/L) m3 (g/L) m4 (g/L) ms(g/L)
54.22 0.00 0.00 0.00 0.00
47.44 3.43 1.86 0.88 0.62
34.96 10.46 5.82 1.92 1.06
26.63 13.51 8.17 2.64 3.27
24.17 12.54 8.98 2.97 5.56
20.92" 12.41 10.02 3.38 7.50
19.05 12.31 11.06 3.82 7.98
8.20 14.02 14.72 5.41 11.86
5.22 14.17 15.52 6.13 13.19
4.87 12.64 16.37 7.01 13.33
3.77 11.77 16.33 7.60 14.75
2.94 11.32 16.68 8.25 15.03
2.47 10.56 16.57 8.50 16.12
aOne validation datum point.
weighed connections (wji ). Each unit sums the input weighed signal (WjiX i )
and an offset term (a bias wjb ).
" .. x. + W'b
net.J =i=1
~w (4)
JI I J
(5)
The experimental reaction rates ri were obtained after the direct dif-
ferentiation of mi x time by the proper "calculus tool" of the software
Microcal Origin®. Tables 2 and 3 show typical data (with experimental and
predicted rates). The dispersion ofNN learning can be assessed by exam-
ining Fig. 3A. Figure 3B shows the dispersion of a validation test using
extra data. The numbers of neurons in the hidden layer are 40 (pH 7.0),
45 (pH 8.0), 48 (pH 9.0) and 48 (pH 10.0).
The mass balance equation for the batch stirred-tank reactor (BSTR) is
as follows:
d(m i v)
---=r.pV (6)
dt I
~
a
,Cx:l
N
§
Hybrid Model for Enzymatic Reactor 419
o.
A
-0.03 ·(102 -0.01 0.00 0.01 0.02 -0.015 -0.010 -0.005 0.000 0.005 0.010
-0.06 -0.04 -0.02 0.00 0.02 0.04 -0.08 -0.06 -0.04 -0.02 0.00 0.02 0.04
experimenlal reaction rates experimental reaction rates
(g J UBAEE min) (g J UBAEE min)
B
0.01
~
I:
,gu -0.01 14000 Da <= MW < 67000 Da [l
4150 Da<= MW< 14000Dao
m 1050Da< MW< 4150Da~
z 650 Da< MW<= 10500a'>.7
z /~J' MW<= 6500ao
"
-0.03V+-"----.,----r-----.----r---.-----,
-0.030 -0.015 0.000 0.015
experimental reaction rates (9 I USAEE min)
Fig. 3. (A) Dispersion of NN learning; (B) dispersion in a validation test (pH = 9.0,
T= 50°C).
-
\u
~ 40 u
I ::
Q)
u 30 o
I:: n
8
:g 20
o
CIS ~
::::il
10
0
~~~,,:':;=:~;:"==!
o 50 100 150 200 250 300
time (min)
-
.Q
~
I ::
~ 30
I::
8
Ul 20
gj
::::il
10
o
o 50 100 150 200 250 300
time (min)
Note that m1(0) is not exactly the same for all experiments. The average
of the obtained values is 58.14 giL. This is very close to the nominal cheese
whey concentration determined through the Kjeldhal method. Figures
4-7 show the model predictions compared to experimental data, for each
of the experimental assays.
Applied Biochemistry and Biotechnology Vol. 705-70B, 2003
Hybrid Model for Enzymatic Reactor 421
-..
4150 Da <= MW < 14000 Da 0 experimental-------model
1050 Da < MW < 4150 Da 8 experimental- -- -- -- model
:J 50 650 Da < MW <= 1050 Da v experimental------model
S MW <= 650 Da <> experimental--------model
r::
-
0
40
~
r::
~ 30
r::
8
I
::!!
20
10
60
14000 Da <= MW < 67000 Da:J experimental--model
4150 Da <= MW < 14000 Da 0 experimental-------model
-
50 1050 Da < MW < 4150 Da 8 experimental-model
:J 650 Da < MW <= 1050 Da v experimental-------model
S MW <= 650 Da <> experimental----model
r:: 40
0
-
',1:1
~
r:: 30
CD
0
r::
8 20
Ul
Ul
III
::::iii
10
Discussion
Using HPLC and an appropriate calibration procedure, it was pos-
sible to quantify the distribution of peptides' molecular weights along
time for different experiments of cheese whey hydrolysis. Feedforward
MLP NNs can map accurately the reaction rates as a function of peptides'
molecular weight distribution, at different pHs. For intermediary pH e.g.,
9.5, it is possible to use direct interpolation.
Applied Biochemistry and Biotechnology Vol. 105-108,2003
422 Sousa et al.
It was possible to observe that the model predictions for molecular
weight distribution of peptides are quite accurate. In this work, the trained
NNs were used for simulating the BSTR itself. They can be used for mod-
eling any other kind of reactor utilized in whey enzymatic hydrolysis. In a
different work (12), by coupling a reactor modeling presented by Giordano
et al. (13) and the neural-kinetic model presented here, we built up a hybrid
model in order to represent whey proteolysis in a continuous vortex flow
reactor. Combining mathematical models with artificial NNs seems to be
an important trend in bioprocess modeling (14-16).
Acknowledgments
We thank Funda~ao de Amparo a Pesquisa do Estado de Sao Paulo,
Conselho Nacional de Desenvolvimento Cientilico e Tecnol6gico, Programa
de Apoio ao Desenvolvimento Cientifico e Tecnol6gico/Conselho Nacional
de Desenvolvimento Cientilico e Tecnol6gico, and Cooperativa de Lactidnios
Sao Carlos (Brazil).
References
1. Viotto, W. H. (1993), PhD thesis, Unicamp, Campinas, Brazil.
2. Demetrakakes, P. (1997), Food Processing 58, 75-79.
3. Mann, E. (2000), Dairy Ind. Int. December, 13-14.
4. Segel, I. H. (1975), Enzyme Kinetics, a Wiley-Interscience, New York, NY.
5. Svendsen, I. (1976), Carlsberg Res. Commun. 41,237-291.
6. Adler-Nissen, J. (1986), Enzymic Hydrolysis ofFood Proteins, Elsevier Applied Science,
London, England and New York, NY.
7. Scarselli, F. and Tsoi, A. C. (1998), Neural Networks 11, 15-37.
8. Medler, D. A. (1998), Neural Comput. Surv. 1,61-101.
9. Silvestre, M. P. C. (1997), Food Chem. 60,263-271.
10. Rumelhart, D. E., Hinton, G. E., and Williams, R. J. (1986), Nature 323, 533-536.
11. Press, W. H., Teukolsky, S. A., Vetterling, W. T., and Flannery, B. P. (1996), Numerical
Recipes in Fortran 90: The Art of Parallel Scientific Computing, Cambridge University
Press, Cambridge, NY.
12. Resende, M. M., Sousa, R., Jr, Tardioli, P. W., Giordano, R. L. c., and Giordano, R. C.
(2002), submitted.
13. Giordano, R. c., Giordano, R. L. c., Prazeres, D. M. F., and Cooney, C. L. (2000), Chem.
Eng. Sci. 55,3611-3626.
14. Liibbert, A. and Simutis, R. (1994), Trends Biotechnol. 12,304-311.
15. Azevedo, S. F., Dahm, B., and Oliveira, F. R. (1997), Comput. Chem. Eng. 21, S751-S756.
16. James, S., Legge, R., and Budman, H. (2002), J. Process Control 12, 113-121.
Abstract
Straw utilization for composites is limited by poor resin and polymer
penetration, and excessive resin consumption owing to the straw cuticle,
fines, and lignin-hemicellulose matrix. White-rot fungi degrade these com-
ponents of straw and could, therefore, potentially be used to improve resin
penetration and resin binding without the use of physical or chemical pre-
treatments. Although long treatment times and large footprints the limit use
of fungal treatments on a large scale, distributed fungal pretreatments could
alleviate land requirements. In this article, we present progress toward the
development of a passive fungal straw upgrading system utilizing white-
rot fungi.
Index Entries: Fungal upgrading; white-rot fungi; wheat straw; Pleurotus
ostreatus; straw composite.
Introduction
The principal barriers to straw utilization for straw-thermoplastic
composites are resin penetration and resin consumption. Resin penetration
is limited by the physical barrier presented by the cuticle and underlying
epidermis on the external surface of the straw, and by the lignin-hemicel-
lulose matrix in the internal vascular layer. Resin consumption is increased
because the resin does not bind well to the cuticle, and because fines, cre-
ated when the nodes and leaves are ground, have high surface areas and
require much more resin. Since straw thermoplastics can contain as much
as 50-70 wt% straw, resin binding and performance are of the utmost
importance, as has been shown in wood-plastic composites (1,2).
*Author to whom all correspondence and reprint requests should be addressed.
The physical barriers to resin penetration are the same physical barri-
ers that limit access of cellulase enzymes to the cellulose fibers when pro-
ducing glucose from straw cellulose for fermentation to ethanol or for
production of fuels and chemicals. Much of the research on removal of the
lignin-hemicellulose barrier to date has been on conversion of the cellulose
to glucose, since glucose can easily be fermented to ethanol using common
yeasts (3). Dilute-acid hydrolysis of the cellulose to glucose lowers ferment-
able carbohydrate yields due to thermal decomposition of xylose to fur-
fural and glucose to hydroxymethylfurfural (4). Thus, much work has been
done on the use of cellulase enzymes, since they are specific for cellulose,
form only glucose, and the hydrolysis is performed at mild temperatures.
However, cellulases are relatively large enzymes and cannot fit through
most of the spaces in the intact vascular layer of straw (5,6). Thus, physical,
chemical, and thermal pretreatments are employed to increase the penetra-
tionofcellulases into this lignocellulose matrix (3,5,7). Manypretreatments
have been developed, including acids (8,9), alkalis (10,11), organosolvents
(12), steam explosion (10,13), and physical treatments. Although effective,
the pretreatments are costly, negatively affecting the economics of utiliza-
tion. Pretreatments with white-rot fungi, which have been shown to com-
pletely degrade lignocellulose, increase glucose yields without significant
capital or energy-intensive steps (14). The principal drawbacks to central-
ized white-rot fungal pretreatments are that the process footprints are large
and that treatment times are often 8 wk or longer, much too long for use at
large industrial facilities (14).
Since lignin and hemicellulose limit resin penetration just as they
limit cellulase penetration into the matrix, these pretreatments would be
expected to improve resin penetration as well. Indeed, steam explosion
has been investigated to remove lignin and hemicellulose to allow better
resin penetration and adhesion (15). While significant improvement in
interfacial adhesion was seen in steam exploded broom fibers, the exten-
sive physical damage to the fibers imparted by the steam-explosion pro-
cess eliminated any mechanical property improvements. Of course, steam
explosion pretreatment, whether for better resin penetration or for better
penetration of cellulases, requires significant capital equipment and
energy input. Thus, an inexpensive, low-capital, low-energy-input treat-
ment, such as a fungal pretreatment, that removes the cuticle, lignin, and
hemicellulose would be ideal. Physical removal of straw components that
form fines (16) would also help to reduce resin consumption. Combining
physical removal of fines (16) and fungal treatment into a distributed
process that could be done on-site at a small scale would minimize the
land area required as well as capital and energy inputs.
White-rot fungi remove lignin using extracellular peroxidase
enzymes, attacking the lignocellulose matrix by growing into the cell
walls, where they secrete extracellular cellulases, hemicellulases, and per-
oxidases (17). Ligninolytic enzymes are produced in secondary metabo-
lism under conditions of carbon or nitrogen deprivation (17). The
Applied Biochemistry and Biotechnology Vol. 105-708,2003
Fungal Bioprocessing of Wheat Straw 425
degraded lignin is not used as a growth substrate but is removed to open
up the matrix to cellulases and hemicellulases so that over time near-
complete degradation is possible (18). While cellulose and hemicellulose
are the principal growth substrates for white-rot fungi (17), some white-
rot fungi, including several Pleurotus species, attack straw lignin and
hemicellulose without much cellulose removal (19,20). There is also evi-
dence of degradation of the cuticle during degradation by white-rot fungi
(21). Once through the cuticle, the fungi possess the necessary cellulases
and hemicellulases to degrade the epidermal layer, allowing access to the
vascular layer from the outer surface of the residue. Thus, in a single
degradation step, white-rot fungi could potentially upgrade the straw to
a more desirable feedstock for straw-thermoplastic composites. That is,
the upgraded straw product should have a higher cellulose content, and
partial degradation of the vascular hemicellulose and lignin, the cuticle
layer, and the epidermis should allow better penetration by resins used
in thermoplastic extrusion processes.
This article describes preliminary results from ongoing work at the
Idaho National Engineering and Environmental Laboratory (INEEL) to
bracket the process parameters necessary to reproducibly operate a pas-
sive, distributed, fungi-based straw "bioupgrading" system. These data
will be used by INEEL, together with Washington State University, to
devise and build a pilot-scale fungal bioupgrading system suitable for
use in both centralized and distributed systems. Included in this work are
the preliminary results of ongoing exploratory tests conducted at INEEL
to bracket the "best" conditions of inoculum and moisture for fungal
upgrading of the straw. Although preliminary, the results show that by
limiting nitrogen and providing sufficient inoculum, it is possible to
operate a selective fungal degradation system without prior sterilization
of the wheat straw. The pilot-scale design, as well as testing of the fungal-
treated straw in composite materials, is being implemented at Washing-
ton State University.
Glucan 37.2
Xylan 22.1
Galactan 1.2
Mannan 3.0
Arabinan 1.6
Lignin with extractives 18.9
Ash 10.1
Total b 89.7
aBased on 100% dry wt of material.
bRemaining fraction attributed to unknown contents of uronic acids,
protein, and so on and to recovery errors in analysis techniques.
bales containing about 22.7 kg (50 lb) each and placed in covered storage.
To remove the plant components that are the sources of high-surface-area
fines (leaves, sheaths, nodes, and fines), the straw was rethreshed before
use as described by Hess et a1. (16). Only the separated straw stems were
used in the laboratory studies. The composition of the untreated straw stem
fraction, determined as described under Compositional Analysis, is shown
in Table 1.
Cultures and Maintenance
Pleurotus ostreatus NRRL 2366 was chosen for use in the fungal degra-
dation tests based on its ability to selectively degrade the noncellulose com-
ponents of wheat straw (22,23). It was obtained from the Northern Regional
Research Laboratory (NRRL) (Peoria, IL). Stock cultures were maintained
on agar slants at room temperature prepared at 20 giL of YM agar (Difco,
Detroit, MI) and containing the following trace minerals- 0.02 giL of
FeS04 ·7H20, 0.004 giL of CuS04 ·5H20, 0.002 giL of ZnS04 ·7H20, 0.002 gl
L of MnS04 ·H20, and 0.001 giL of ammonium molybdate tetrahydrate-
and were subcultured every 2 wk. Stock mycelial inocula were produced as
follows. Fungal mycelia were transferred from the maintenance slants to
100 mL of 20 giL YM broth (Difco) using a sterile loop and grown in agitated
culture for 2 to 3 d at room temperature and 180 rpm. This culture was
transferred to a sterile Fernbach flask containing 1 L of 20 giL YM broth with
trace minerals as just described, and agitated for 4 d at room temperature
and 180 rpm. The fungal pellets were harvested by light centrifugation (380g)
in sterile centrifuge bottles, transferred to sterile bottles with sufficient spent
medium to submerge the pellets, and stored at 4°C until use, typically 2 to
3 wk or less.
Compositional Analysis
Carbohydrate and lignin compositions of untreated and treated straw
samples were determined by quantitative saccharification using the
method of Saeman et al. (29). Two aliquots of each sample were analyzed
per column by quantitative saccharification for each set of three replicate
columns at each condition, for a total of 12 independent measurements of
each composition. Carbohydrate analyses were done by high-performance
liquid chromatography using a Bio-Rad HPX-87P carbohydrate column,
and lignin was calculated by weight difference as Klason lignin with extrac-
tives and ash, as previously described (6).
I~ -0- Agitated
400.l-~===~--~~:::::::::t
..a
iii
200+-------~~------------------~
~
~
c 0 D'I=::::::::;:...--r-----,~___r-....,..-__r-_I
o 2 4 6 8 10 12 14
Time (days)
not to measure the extractives for treated straw samples until the final
conditions were chosen. Thus, lignin is expressed as "lignin with extrac-
tives" in this article. The extractives will be determined by soxhlet extrac-
tion for the final conditions chosen.
-
:J 300
Cl
§.
z 200
~
I-
100
0
0 2 4 6 8 10 12 14
Time (days)
Fig. 2. Effect of yeast extract addition (which contains about 10 wt% nitrogen) on
minimum nitrogen level attainable in inoculum production cultures.
40
30
wt% 20
10
o
o
1.6
mg p 5.1
. OS/reatus 19 8 .2 10.9
stems
!•
30
• • •A
:2
~ ~
20
'ii
u
r-
"e ""0 days
•
::c 10 ~22days
-t:r56 days
r-
jfe ...... 84 days
i r-
0
30
B
• • •
!• --:
:2 20
'i
u
"e ""0 days
-
•
::c 10 ~22days
-t:r 56 days
-
~ ...... 84 days -
0
40 50 60 70
% Moisture (9 H20 I 9 dry straw)
Conclusions
A minimum of 80-100 ppm of nitrogen was carried over to the straw
stems in the mycelial inoculum. Above inoculum levels of 5.1 mg of
P. ostreatus/g dry stems, the inoculated fungus has overtaken the indig-
enous microbes in nonsterile stems by 3 to 4 wk into the treatment, at the
conditions tested. Moisture content was shown to have little effect on
degradation below about 70% gravimetric moisture content. An inocu-
lum amount of 10.9 mg of P. ostreatus / g stems was shown to be sufficient
to effect the desired degradation trends, but not in the desired time frame
of 12 wk or less. Higher amounts of inoculum or inoculum that is
Applied Biochemistry and Biotechnology Vol. 105-108,2003
Fungal Bioprocessing of Wheat Straw 435
pre acclimated to straw may be required for this to occur. Future work
includes testing up to 150% moisture and 100 mg/ g of fungal inoculum.
Acknowledgments
We thank the University of Idaho, Aberdeen Research and Extension
Center for use of its plot-harvesting equipment for the mechanical straw
stem separation; Dr. Stephen Aust and Paul Swaner at Utah State Univer-
sity for maintaining and supplying the fungal cultures for inoculum pro-
duction; and Karen Miller, Neal Yancey, and Jeff Parry at the INEEL. This
project is administered by the Idaho Department of Water Resources En-
ergy Division. This work is supported in part by the US Department of
Energy, Assistant Secretary for Energy Efficiency and Renewable Energy
(EE) under DOE Idaho Operations Office Contract DE-AC07-99ID13727.
Additional support is provided by the Idaho Wheat Commission, Grant 4-
D Farms, and Energy Products of Idaho.
References
1. Wolcott, M. P. and Englund, K. (1999), in Proceedings of the 33rd International Particle-
board/Composite Materials Symposium, Wolcott, M. P., Tichy, R. J., and Bender, D. A.,
eds., Washington State University, Pullman, WA, pp. 103-111.
2. Sanadi, A. R., Caulfield, D. F., and Jacobson, R. E. (1997), in Paper and Composites from
Agro-Based Resources, Rowell, R. M., Young, R. A., and Rowell, J. K., eds., CRC, Boca
Raton, FL, pp. 377-402.
3. Marsden, W. L. and Gray, P. P. (1986), Crit. Rev. Biotechnol. 3(3),235-276.
4. Converse, A. 0., Kwarteng, I. K., Grethlein, H. E., and Ooshima, H. (1989), Appl.
Biochem. Biotechnol. 20/21, 63-78.
5. Cowling, E. B. and Kirk, T. K. (1976), Biotechnol. Bioeng. Symp. 6,95-123.
6. Thompson, D. N., Chen, H.-C., and Grethlein, H.E. (1992), Bioresour. Technol. 39,
155-163.
7. Fan, L. T., Lee, Y.-H., and Gharpuray, M. M. (1982), Adv. Biochem. Eng. 23, 157-187.
B. Knappert, D., Grethlein, H., and Converse, A. (1980), Biotechnol. Bioeng. 22, 1449-1463.
9. Goldstein, I. S., Pereira, H., Pittman, J. L., Strause, B. A., and Scaringelli, F. P. (1983),
Biotechnol. Bioeng. Symp. 13, 17-25.
10. Playne, M. J. (1984), Biotechnol. Bioeng. 26,426-433.
11. Weimer, P. J., Chou, Y.-C.T., Weston, W. M., and Chase, D. B. (1986), Biotechnol.
Bioeng. Symp. 17, 5-18.
12. Avgerinos, G. C. and Wang, D.1. C. (1983), Biotechnol. Bioeng. 25,67-83.
13. Taylor, J. D. (1981), in Energy from Biomass, 1st E. C. Conference, Palz, W., Chartier,
P., and Hall, D.O., eds., Applied Science, London, UK, pp. 330-336.
14. Hatakka, A. I. (1983), Eur. J. Microbiol. Biotechnol. 18,350-357.
15. Avella, M., Casale, L., Dell'erba, R., Focher, B., Martuscelli, E., and Marzetti, A. (1998),
J. Appl. Polym. Sci. 68, 1077-1089.
16. Hess, J. R., Thompson, D. N., Hoskinson, R. L., Shaw, P. G., and Grant, D. R., (2003),
Physical Separation of Straw Stem Components to Reduce Silica, in Applied Biochem-
istry and Biotechnology, vol. 105-108, Humana Press, Totowa, NJ, pp. 43-52.
17. Boominathan, K. and Reddy, C. A. (1992), in Handbook of Applied Mycology, vol. 4,
Arora, D. K., Elander, R. P., and Mukerji, K. G., eds., Marcel-Dekker, New York, NY,
pp. 763-822.
lB. Blanchette, R. A., Abad, A. R., Farrell, R. L., and Leathers, T. D. (1989), Appl. Environ.
Microbiol. 55,1457-1465.
Abstract
The aim of this study was to develop an empirical model that provides
accurate predictions of the biochemical oxygen demand of the output
stream from the aerated lagoon at International Paper of Brazil, one of the
major pulp and paper plants in Brazil. Predictive models were calculated
from functional link neural networks (FLNNs), multiple linear regression,
principal components regression, and partial least-squares regression
(PLSR). Improvement in FLNN modeling capability was observed when
the data were preprocessed using the PLSR technique. PLSR also proved to
be a powerful linear regression technique for this problem, which presents
operational data limitations.
Index Entries: Biochemical oxygen demand; functional link neural net-
works; partial least squares; principal components regression; multiple lin-
ear regression.
Introduction
Industrial and municipal wastewater are major sources of contamina-
tion of aquatic biota, accounting for several thousand types of chemicals
released into the environment. Thus, the importance of implementing
efficient monitoring and control techniques for wastewater treatment sys-
tems is well known. Operational control of biologic wastewater treatment
plants is often complicated because of variations in raw wastewater com-
positions, strengths, and flow rates, owing to the changing and complex
nature of the treatment process (1). Moreover, the lack of suitable process
variable measurements limits the effective control of effluent quality (2,3).
*Author to whom all correspondence and reprint requests should be addressed.
Table 1
Basic statistical Descriptors for Selected Variables
Parameter Average Minimum Maximum SO Skewness Kurtosis
sion (20,21). Even though PLSR is closely related to the PCR method, PLSR
is designed to maximize the prediction rather than fit the input data; that
is, this method optimizes LVs in order to maximize the proportion of vari-
ance of their description of the prediction variables. Hense, the risk of los-
ing predictive information is discarded or minimized. Mardia et a1. (22) and
Draper and Smith (23) provide detailed information on MLR and PCR.
Geladi and Kowalski (21), Wold et a1. (24), and Wold and Kowalski (25)
provide details of the PLSR methodology.
FLNN
A conventional multilayer neural network contains one or more stages
of neural processing between inputs and outputs. These stages, known as
hidden layers, add to the complexity and cost of neural training (13,26).
When the number of inputs to the model and the number of records avail-
able for training becomes extremely large, the training procedure for this
neural network architecture become increasingly more time-consuming
(27), whereas when the records available are too small, there is a problem
of overfitting (9).
The FLNN is a neural network with no hidden layers, trained using
supervised learning. The input is "enhanced" by generating additional
terms via some transformation rule, such as a polynomial expansion. The
idea is to increase the dimensionality of the feature-space without requir-
ing any additional information. These enhanced values are passed through
to a summation node (the output), which transforms these weighted values
via some nonlinear activation function. The use of the activation function
is a modification of the structure of the FLNNs proposed by Henrique (28).
It increases the non-linear approximation ability of the network, while
estimation of the parameters remains a linear problem (26). In addition,
y = f(T) =1 log
2
(0.5I-T+ T) (3)
Results
The data were auto scaled to mean zero and unit variance prior to
analysis. Table 2 provides the eigenvalues and the variance percentages
(accounted for and cumulative) corresponding to the PCs for the predic-
tor variable. PC modeling does not involve the predicted variable space.
Table 2 also gives the variance percentages (accounted for and cumula-
tive) corresponding to the LVs in both predictor and predicted variable
space. Loadings were normalized to 1 and scores to their corresponding
eigenvalues.
By taking a close look at the variance of the LVs and PCs, it can be
verified that for any particular number of LVs or PCs, the LVs always
describe more predicted variable variance and less predictor variable vari-
ance than the PCs.
Applying the Todeschine (38) criterion to the data matrix, we obtained
K =0.3747, which suggests a moderate degree of correlation, KL =8, corre-
sponding to 92.6% of AV and KP = 5 (75.7% AV) for PCA. This measure
Applied Biochemistry and Biotechnology Vol. 105-108, 2003
Simulation of Aerated Lagoon Using ANNs 443
Table 2
Statistical descriptors for PCs and LVs·
i·. ·
0.6
N.~. ~.AM'RAIN FLOW COLOR
0.2
: PAPER
• 0.4
N.N.
• ~N i pH •
0.0 -····-···-····-··-·-··--·--····-···+··-··-·Clioii--··-·--.. ---.--.--.. i •
PAPER .CO~. ~OW
..
0.2
N C~ND. 1 '1lLP T.. i
~ -0.2 rfH i • ~ 0.0 .-...- ..--..- ----..- ..-.~.-..- ..-.. --.-.-------
T. COD • i
~l
-0.4 -0.2
COD
-0.6
s.s.
• •
-0.4
-0.4 -0.2 0.0 0.2 0.4 0.6 -0.6 -0.4 -0.2 0.0 0.2 0.4 0.6
PC1 PC3
4,..--------~~-~
4
3 •
.... . ..
3
2 • • •
• i !C •
~ 0
. . . _. . __.._._. _._:. . _. . _. __._. __...__..._. - . -.. -~~--!. -
Q. -1
~
.i ..
-2 ~
• i
-3
~+-~~~~~--,..-~~~~
.. • I
-10 -8 ~ -2 2 o -3 -2 -1 0 2 3
PC1 PC3
Fig. 1. Loading (top) and score plots (bottom), corresponding to first four PCs.
LVs. As expected, since the COD is the parameter most correlated with
BOD, the first LV is exclusively related to the COD (loading 0.70) and COD
is the first parameter included in the MLR by the stepwise method. The
multivariate regression models were then constructed and their prediction
performance results are given in Table 3. As expected, MLR, PCR, and
PLSR models present the same performance results when there is no pa-
rameter exclusion. The p values for the adjusted coefficient of multiple
determination (R2 adj.) are zero for all models, indicating their high statis-
tical significance. In spite of this, the p values for the normality test of the
residuals and the F test for model adequacy analysis indicate that predic-
tive information has been lost by exclusion of the last seven PCs. It had not
occurred when the stepwise method was used for identifying the most
significant PCs for the predictive model (eighth and ninth have been ex-
cluded). Only the stepwise-MLR model residuals did not pass in the nor-
mality test. From the modeling and validation statistical results, it can be
seen that best prediction performance was achieved using the shortest
PLSRR model.
The FLNN models were then generated. The number of monomials
generated is a function of the number of inputs and the degree of the poly-
nomial expansion, in this case 12 and 3, respectively. Then, the number of
monomials generated is 455. Using the orthogonal least-squares estimator,
Modeling Validation
Modeling Validation
.
0.8 r;:::::=========;:------/,,~ 0.8 Tr======;:-----"~,,,7'1
Regression Regression /
0.7 ------ 95% PI
. . .
."",,"". 0.7 ------ 95% PI
.......... . .
.. .,,/.
: •
.."...
,,;.,. . .
# .......... . ........
0.6
.........." 0.6
"0 "0
.......... .. ........
:c~ 0.5 .. ,"
/;"
....
.' --: ....... . ,,/
~ 0.5 " "...... /"
,,,,,
.
~ ,............ ....... . CD
.....
...
c. 0.4
o
I
:. /~••........ ,"
Q. 0.4
o
/'
=
....... . """
,.. . .
oco oco ......~ ......
0.3
0.2
.........
~..........
,,'
Fig. 2. Relation between predicted vs measured BOD (solid lines). Upper and lower
dashed lines indicate the 95% prediction estimation interval (according to the PLSR
and PLSR-FLNN models, without the last seven pes).
does not help FLNN and PCA-FLNN prediction results for the validation
data set.
Comparison of multivariate regression and neural network results,
reveals that PLSR and PLSR-FLNN models gave similar prediction re~ults
when the last seven LVs were excluded. It really shows that the linear PLSR
technique can be used to approximate complex relationships over the
regions of the predictor variables available for the considered process. How-
ever, for the validation set, PLSR-FLNN gave slightly better results.
Statistical results also show that the best modeling structures-i.e.,
PLSR and PLSR-FLNN without the last seven Pes-although still far from
the perfect, do capture prediction information and are able of estimating
outputs within a 95% prediction band (see Fig. 2). This is particularly impor-
tant when one takes into account the complexity of the wastewater treat-
ment system and the large quantity of missing data in the modeling set.
Figure 3 presents a graphic representation of the measured and pre-
dicted BOD data for the modeling and validation data sets using PLSR and
PLSR-FLNN models without the last seven PCs. The modeling features
were well reproduced by both modeling structures, whereas the validation
features were slightly better reproduced by the PLSR-FLNN model.
Multivariate regression and the neural network have also provided
robust models. Their model parameters do not change very much when
the samples identified as possible outliers were taken from the training
data set.
Discussion
In recent years, ANNs have become extremely popular for predic-
tion and forecasting in a number of areas, including water resources,
bioprocesses, and environmental science. The FLNN appeared as a good
modeling validation
- - Measured values
0,8 set set
., '0" Predicted values (PLS)
- ..... - Predicted values (PLS-FLNN)
__ 0,6
~
c
0::1
O~
COl!
:e 0,4
.!!
0,2
o 5 10 15 20 25 30 35 40 45 50 55 60 65 70 75
Sequential number of data
Fig. 3. Measured and predicted BOD, using the PLSR and PLSR-FLNN models
(without last seven PCs).
Acknowledgments
We are grateful to professor Dr. Fernando Von Zuben, Vitaly F.
Rodriguez Esquerre, Roberto C. Colacioppo, and Celeste M. Diaz C6nsul for
the many stimulating discussions held during the development of this work;
and to International Paper of Brazil for providing the data set. We also thank
Funda~ao de Amparo aPesquisa do Estado de Sao Paulo (Proc. N. 99 110257-
0) for their financial support.
Nomenclature
BOD = outlet wastewater BOD (mg/L)
COD = inlet wastewater COD (mg/L)
COLOR = color (ppm or mg/L)
CONDo = conductivity (!-lS/cm at 20°C)
f = transfer function proposed by Henrique (28)
FLOW = inlet flow rate (m3 I d)
h = polynomial expansion
N = number of monomials
N.AM. = inlet ammonia concentration (mg/L)
N.N. = inlet nitrate concentration (mg/L)
PAPER = paper production (tl d)
PULP = pulp production (tl d)
RAIN = rainfall (mLI d)
5.5. = inlet suspended solids (mg/L)
T. = temperature (OC)
x = input matrix
y = predicted output
w ij = neural network weights of i input and j monomial
References
1. Hamoda, M. F., AI-Ghusain, I. A., and Hassan, A. H. (1999), Water Sci. Technol. 40,
55-65.
2. Harremoes, P., Capodaglio, A. G., Hellstrom, B. G., Henze, M., Jensen, K. N.,
Lynggaaard-Jensen, A., Otterpohl, R., and Soeborg, H. (1993), Water Sci. Technol. 27,
71-115.
3. Lee, D. S. and Park, J. M. (1999), J. Biotechnol. 75,229-239.
4. Cote, M., Grandijean, B. P. A., Lessard, P., and Yhibault, J. (1995), Water Res. 29,
995-1004.
5. Steyer, J. P., Rolland, D., Bouvier, J. c., and Moletta, R. (1997), Water Sci. Technol. 36,
209-217.
6. Baffi, G., Martin, E. B., and Morris, A. J. (1999), Comp. Chern. Eng. 23, 1293-1307.
7. Gontarski, C. A., Rodrigues, P. R., Mori, M., and Prenem, L. F. (2000), Comp. Chern.
Eng. 24, 1719-1723.
8. Hack, M. and Kohne, M. (1996), Water Sci. Technol. 33,101-115.
9. Oliveira-Esquerre, K. P., Mori, M., and Bruns, R. E. (2002), Braz. J. Chern. Eng. 19,
365-370.
10. Pu, H., Hung, Y. (1995), Environ. Manage. Health 6, 16-27.
11. Wilcox, S. J., Hawkes, D. L., Hawkes, F. R., and Guwy, A. J. (1995), Water Res. 29,
1465-1470.
.
Applied Biochemistry and Biotechnology Vol. 105-108,2003
Copyright © 2003 by Humana Press Inc.
All rights of any nature whatsoever reserved.
0273-2289/03/105-108/0451/$20.00
Abstract
The classic kinetic model for cellulose hydrolysis is often referred to as
pseudo-homogeneous, a term revealing the insight that the process is actually
heterogeneous. During the past 10-15 yr, the shortcomings of this model
have been demonstrated in various studies and the interest in the heteroge-
neous aspects has increased. The present work presents a simplistic model in
which the intrinsic, heterogeneous hydrolysis and transport rates are coupled
by the assumption of a constant glucosidic surface concentration. The mecha-
nisms affecting these two rates are largely unknown, but the model serves as
a guideline for further exploration of the process.
Index Entries: Dilute-acid hydrolysis; kinetic model; heterogeneous
model.
Introduction
The model presented here deals with glucan hydrolysis alone, ignor-
ing sugar degradation. The model is simplistic, and its validity is discussed
following its presentation.
By sugar we mean all mono-, di-, or oligomers that are solvable. The
mass change owing to hydration is ignored for simplicity. The hydrolysis
step does not leave the sugar solubilized, but attached to the surface. Once
the sugar is solubilized (i.e., released from the surface), an underlying
glucan unit is revealed, thereby keeping the total surface concentration Cr
constant. The two processes of hydrolysis (h) and transport (t) (...solubiliza-
tion) are assumed to be first order:
rh = k h · CG (kg/lm 2s]) (2)
r t =k t · Cs (kg/lm 2s]) (3)
in which kh and kt are rate constants. We use the term transport for the entire
escape of the hydrolyzed sugar from the domain of the solid surface. Note
that the rate of transport is assumed independent of the sugar concentra-
tion in the bulk. Since the sugar is a mix of mono-, di-, and oligomers, the
rate constants are lumped entities, averaging a set of hydrolysis and trans-
port mechanisms.
The surface concentration of sugar (C s) is then determined from the
rate:
dCs
dt = rh - rt = k h • (C r - Cs)- k t · Cs (4)
(9)
(12)
Parameter values used in our simulations are p = 2000 kg/m3, CT =
10--6 kg/m2, ro = 3 x 10-9 m. Some values of kh and kt are given in the next
section. MATLAB's ode-solver ode45 was used to simulate m{t) / mo, which
has a real-value solution only up to a critical time tc with m(tc) = O. If <p{t)
were equal to 1 (it actually starts off at 0 and approaches 1 exponentially),
the analytical solution would be given by Eq. 13, and tc would then be
equal to 2/ Q. Since <p{t) is not constantly 1, tc is somewhat bigger than this
value. Numerically, there is a breakdown around m{t) = O.Olmo.
(13)
This numerical limitation does not limit the use of this model, since we
have plenty of reasons to mistrust the model at high conversion anyway.
Discussion
The model invariably yields glucan profiles with a certain curvature,
but the overall rate is determined by the parameter Q (Eq. 11). In Fig. 1, two
simulations are shown, in which a 12-fold difference in the value of kt yields
different overall rates. Figure 1 also shows two experimental data sets, one
for batch and one for percolation. These data were presented earlier (2), as
were the experimental procedures (3) under which they were produced. As
can be seen in Fig. 1, the simulations coincide, to some extent, with the
experimental data. This is just a simple example to show the fundamental
applicability of the model. The observed difference between two reactors
could, in this example, be qualitatively explained by a hypothesized differ-
ence in transport efficiency.
In fact, the notational distinction between hydrolysis and transport
may be short on physical significance, since the two processes are linked in
a more complicated way than the model describes. Hydrolysis itself infers
steric changes that alter the structure of the surrounding solvation shell,
which is the beginning of solvation.
The two so-called rate constants kh and kt are hardly constant, and we
therefore refer to them hereafter as rate parameters. Not only are tempera-
ture, pH, and flow likely to influence the rate parameters, but conversion
Applied Biochemistry and Biotechnology Vol. 705-108,2003
454 Pettersson et at.
% Remaining Glucan
10'~~~---.--------,--------,--------,
40
20 ..,..,
1%~------~5~----~7.10~------~15~------=20
Time (min)
Fig. 1. Measured hydrolysis profiles for pretreated yellow poplar in (A) batch and
(T) percolation at 225°C, 0.07% (w /w) (2). The lines are simulations, in which kh =
4.93 X 10-3 in both cases, but kt differs 12-fold (1.97 x 10-3) for the upper profile, (23.68
x 10-3 for the lower).
Conclusions
There is little reason to assume that heterogenous dilute-acid hydroly-
sis of cellulose microcrystallites can be adequately described by a simple
model with only a few parameters. There is a multitude of interdependent
mechanisms, and a comprehensive model is far out of reach. However,
insights can be gained by exploring new modelling concepts.
This work has presented a simplistic model in which the intrinsic,
heterogeneous hydrolysis rate and the heterogeneous transport rate are
coupled by the assumption of a constant glucosidic surface concentra-
tion. The mechanisms affecting the hydrolysis and transport rates are
largely unknown, but the model serves as a guideline for further explor-
ing the process.
Acknowledgments
We gratefully acknowledge the financial support of the Swedish
Energy Agency and the county of Vasternorrland.
References
1. Bouchard,J.,Abatzoglou,N.,Chornet,E.,andOverend,RP.(1989), Wood Sci. Technol.
23,343-355.
2. Torget, R W., Kim J. 5., and Lee Y. Y. (2000), Ind. Eng. Chem. Res. 39,2817-2825.
3. KimJ. 5., Lee Y. Y., and Torget R W. (2001), Appl. Biochem. Biotechnol. 91-93,331-340.
4. Mok, W. S. 1., Antal, M. J., and Varhegyi, G. (1992), Ind. Eng. Chem. Res. 31,94-100.
5. Xiang, Q., Kim, J. 5., and Lee Y. Y. (2003), Appl. Biochem. Biotechnol. 105-108,337-352.
6. Xiang, Q. and Lee, Y.Y. (2001), presented at the 23rd Symposium on Biotechnology for
Fuels and Chemicals, Breckenridge, CO.
7. Lee, Y.Y., Xiang, Q., Zhu, Y., Kim, J.S., and Kim, S.B. (2001), Annual final report to
DOE no. DE-FC36-00G010592, US Department of Energy, Golden Field Office,
Golden,CO.
Abstract
Iogen (Canada) is a major manufacturer of industrial cellulase and
hemicellulase enzymes for the textile, pulp and paper, and poultry feed indus-
tries. Iogen has recently constructed a 40 t/ d biomass-to-ethanol demonstra-
tion plant adjacent to its enzyme production facility. The integration of enzyme
and ethanol plants results in significant reduction in production costs and
offers an alternative use for the sugars generated during biomass conversion.
Iogen has partnered with the University of Toronto to test the fermentation
performance characteristics of metabolically engineered Zymomonas mobilis
created at the National Renewable Energy Laboratory. This study focused on
strain AXIal, a xylose- and arabinose-fermenting stable genomic integrant
that lacks the selection marker gene for antibiotic resistance. The "Iogen Pro-
cess" for biomass depolymerization consists of a dilute-sulpfuric acid--cata-
lyzed steam explosion, followed by enzymatic hydrolysis. This work examined
two process design options for fermentation, first, continuous cofermentation
of Cs and C6 sugars by Zm AXIal, and second, separate continuous fermenta-
tions of prehydrolysate by Zm AXIal and cellulose hydrolysate by either wild-
type Z. mobilis ZM4 or an industrial yeast commonly used in the production of
fuel ethanol from corn. Iogen uses a proprietary process for conditioning the
prehydrolysate to reduce the level of inhibitory acetic acid to at least 2.5 giL.
The pH was controlled at 5.5 and 5.0 for Zymomonas and yeast fermentations,
respectively. Neither 2.5 giL of acetic acid nor the presence of pentose sugars
(C 6 :Cs =2:1) appreciably affected the high-performance glucose fermentation
of wild-type Z. mobilis ZM4. By contrast, 2.5 giL of acetic acid significantly
reduced the rate of pentose fermentation by strain AXIal. For single-stage
continuous fermentation of pure sugar synthetic cellulose hydrolysate
(60 giL of glucose), wild-type Zymomonas exhibited a four-fold higher volu-
metric productivity compared with industrial yeast. Low levels of acetic
acid stimulated yeast ethanol productivity. The glucose-to-ethanol conver-
sion efficiency for Zm and yeast was 96 and 84%, respectively.
*Author to whom all correspondence and reprint requests should be addressed. (Present
address: RRG, Mordale, ON Canada NOC 1HO.)
Introduction
Lignocellulosic feedstocks, in the form of either waste materials or
designated energy crops, offer an opportunity to greatly expand the capac-
ity of the fuel ethanol industry. Lignocellulose is recalcitrant to enzymatic
digestion by cellulase unless it has been "pretreated" to remove the hemi-
cellulose and lignin components. The hemicellulose that comprises 15-25%
of the lignocellulosic feedstock is easily hydrolyzed by dilute-acid hydroly-
sis to its monomeric sugars, the pentose (5-carbon) sugars xylose and ara-
binose; and, to a smaller extent, the hexose sugars mannose and galactose.
The amount of xylose produced is one-third to one-half the amount of
glucose produced from the saccharification of lignocellulosic material.
Hence, fermentation of the pentose sugars represents an opportunity for
major improvement in ethanol yield. Economic analyses have suggested
that, to be well positioned in the competitive liquid fuels market, cellulosic
ethanol must be produced by the rapid and efficient conversion of all the
major sugar components of the hydrolyzed cellulosic feedstock (1). Mod-
ern recombinant DNA technology has been successfully used to create
many different microbial biocatalysts-both yeast and bacteria-that are
capable of fermenting the constituent monosaccharides to ethanol.
Because the fermentation unit operation in the biomass-to-ethanol
process is located downstream from the feedstock pretreatment and
hydrolysis operations, the fermentation biocatalyst is impacted by both the
type of feedstock and the process flow configuration of the process with
respect to the distribution of the process streams from the pretreatment
(hemicellulose hydrolysis or prehydrolysis) and cellulose digestion opera-
tions (saccharifying stage reactor). From a bioengineering perspective, the
biocatalyst must conform to the performance characteristics demanded by
a particular process with respect to both feedstock and overall process
design. The feedstock affects the composition of the prehydrolysate with
respect to the type and amount of the different C 6 and Cs sugars as well as
other potentially inhibitory substances such as acetic acid (HAc).
Iogen (Ottawa, Canada) is a major manufacturer of industrial enzymes.
Iogen primarily produces cellulase and hemicellulase enzymes for the tex-
tiles, pulp and paper, and poultry feed industries. Iogen has recently built
a 40 tf d biomass-to-ethanol demonstration plant adjacent to its enzyme
production facility (2). The location of the ethanol demonstration plant
offers the advantages that the enzyme can be used without the expenses of
stabilization and preservation, and that the process sugars can be used for
enzyme production.
Although Saccharomyces yeast currently enjoys a monopoly as the fer-
mentation process biocatalyst in the fuel ethanol industry, it is not the only
ethanol-producing microorganism. By virtue of its demonstrated superior
Acetic acid D
......1 - - - Conditioning
Feedstock
--J
_ _-'~~ Pretreatment Cellulase Cellulase
enzyme
Digester production
Acetic acid
Conditioning
<2.5g/L HAc
C6 Fermentor
Cs Fermentor
Ethanol
Fig. 2. Revised Iogen process flow diagram. The process involves the separate
hydrolysis and continuous fermentation of Cs and C6 components of lignocellulosic
biomass for the production of fuel ethanol.
Fermentation Media
The synthetic biomass hydrolysate media contained 3 giL of Difco
yeast extract (Difco Laboratories, Detroit, MI), 0.8 giL ofNH4Cl, and "Zymo
salts" as described previously (6). The amounts of D-glucose, D-xylose,
L-arabinose (Sigma, St Louis, MO), and HAc that were added to the differ-
ent fermentation media were variable. The media and stock sugar solutions
were autoclaved separately.
Preparation of Inoculum
A 1-mL aliquot of a glycerol-preserved AXIOI culture was removed
from cold storage (freezer) and transferred to about 200 mL of RM medium
(10 giL of yeast extract and 2 giL of KH 2P04) containing about 10 giL of
xylose, 10 giL of arabinose, and 30 of giL glucose in loosely capped 250-mL
Erlenmeyer flasks and grown in a waterbath shaker overnight at 30°C. This
preseed was subcultured into inoculation flasks containing the synthetic
hydrolysate medium with 30 giL of glucose, 10 giL of xylose, and 10 giL
of arabinose and grown in a water bath shaker overnight at 30°C . This
overnight culture was used as inoculum at a level of approx 10% (v Iv). The
initial optical density (l-cm light path at 600 nm) was in the range of 0.25-
0.5, corresponding to 70-140 mg of dry cell mass/L. Inocula for both wild-
type Zymomonas and the Alltech yeast culture were prepared by overnight
growth in RM medium containing 60 giL of glucose.
Fermentation Equipment
pH-controlled continuous fermentations were conducted with either
NBS C30 BioFIo chemos tats or 2-L NBS Bioflo 2000 bioreactors. The work-
] 15
rn
10
O+---~----~--~----~--~----~--~--~
0.02 0.03 0.04 0.05 0.06 0.07 0.08 0.09 0.10
Steady-State Dilution Rate (lib)
higher than 5.5. Using integrated 2m strain AXlOl, the maximum volumet-
ric productivity in the absence of acetic acid was 3.3 gl (L·h) (Table 1). For
85% xylose utilization, Dmax was 0.078 Ih and the ethanol concentration was
42 giL (Fig. 3), representing a process yield of 0.45 gig or 88% overall
conversion efficiency (Table 1). The pH was 5.5 and the temperature was
30°C. Although the Iogen process incorporates a hydrolysate conditioning
stage, not all the acetic acid is removed. Figure 3 shows the sensitivity of
strain AXlOl to inhibition by acetic acid. With the estimated upper level of
2.5 giL of HAc in the synthetic biomass hydrolysate feed, the maximum
volumetric productivity decreased to 1.7 gl (L·h) (Dmax was 0.04/h), but the
overall conversion efficiency remained at the 88% level (Table 1). Previous
experimentation has shown that the fermentation performance can be
slightly improved by elevating the pH set point from 5.5 to 6.0 (7). In a study
reported at last year's symposium, Mohagheghi et a1. (18) compared C61Cs
cofermentation results obtained with strain AX101 with those reported by
Toon et a1. (21) for recombinant Saccharomyces yeast strains and noted that
AXlOl achieved significantly higher process yields.
Ethanol
,-., 25
~
'-'
Medium: 60gIL Glu/30gIL Xyl/3.5g/L Ara
III (+ 2.5gIL acetic acid) pH 5.5
= 20
=
~ [J
.l:I
=
GI
l:!
U= 15 [J
....
GI [J
S
r;LJ
;;., 10
"$=
r;LJ Note: xylose and arabinose are not fermented
5
Glucose
0
0.10 0.15 0.20 0.25 0.30 0.35 0.40 0.45 0.50
Steady-state Dilution Rate (lib)
Fig. 4. Steady-state levels of glucose, cell mass, and ethanol as function of dilution
rate in continuous fermentation of synthetic biomass hydrolysate by wild-type Zm
strain ZM4 (ATCC 31821). The yeast extract-based medium contained 60 giL of glu-
cose, 30 giL of xylose, 3.5 giL of arabinose, and 2.5 giL of acetic acid. The pH was
controlled at 5.5. For 95% utilization of the glucose (effluent contains 3 giL), the Dmax
=O.4/h. Fermentation parameters are summarized in Table 1.
side to this option is the potential for fouling of the distillation columns by
the unfermented Cs sugars during ethanol recovery.
Over the course of our work with rogen, the overall process design
evolved from a single fermentation process to a double fermentation process
with separate continuous fermentations of the pentose-rich hemicellulose
hydrolysate ("prehydrolysate") and the cellulose hydrolysate (see Fig. 2).
Xylose
inose
O+-------~--~--~----~~------~~~
0.020 0.030 0.040 0.050 0.060
Steady-state Dilution Rate (lib)
Fig. 5. Steady-state levels of sugars and ethanol as function of dilution rate continu-
ous fermentations of pure sugar synthetic prehydrolysates by integrated 2m strain
AXI01. The yeast extract-based medium (seeMaterials and Methods) contained 30
giL of xylose, 5 giL of glucose, and 3.5 giL of arabinose. The pH was controlled at
5.5. When acetic acid was added, the concentration was 2.5 giL and the glucose
concentration was 10 giL. Fermentation parameters are summarized in Table 1.
•
55
~ 50
J ...
Ethanol
45 60g/L Glucose
... 40
CI
~
• I OOg/L Glucose
•
35
Ethanol
I 30 Ethanol
~
Cl 25
j 20
1 15
10
0
0.0 0.1 0.2 0.3 0.4 0.5
Steady-State DUution Rate (lib)
remained at the 90% level (Fig. 5 and Table 1). For glucose fermentation in
the C6 fermentor, at a sugar loading of 60 giL, the wild-type Zm by far
outperformed the industrial yeast in terms of both conversion efficiency
(96% for Zm vs 84% for Alltech yeast) and productivity (11.2 g/(L·h) for
Zm vs 2.6 for the yeast) (Fig. 6 and Table 1). For strain ZM4 and Allyeast
the respective Dmax values were 0.385/handO.1/h (Table 1). A particularly
interesting observation was the seemingly stimulatory effect of 2.5 giL of
acetic acid (pH 5.0) on the productivity of the yeast fermentation (Fig. 6
and Table 1). The stimulatory effect of low levels of HAc on yeast ethanol
productivity has been reported by others (22,23). At a sugar loading of 10%
glucose, Dmax for Zymomonas decreased to 0.235/h (Fig. 6), but the produc-
tivityremained at 11.5 g/(Loh) (Table 1). In the present work, replacing the
more traditional yeast biocatalyst in the C6 fermentor with wild-type
Zymomonas resulted in a significant increase in yield and more than a
fourfold improvement in productivity (Table 1). It was concluded that, for
this type of SHF process (Le., with separate Cs and C6 fermentation), the
biocatalyst of choice would be NREL's metabolically engineered stable
Acknowledgment
We are grateful to Dr. Min Zhang (NREL) for providing the integrated
recombinant Zm strain AXIOL We also thank Drs. Ali Mohagheghi (NREL)
and Jeffrey Tolan (rogen) for helpful advice and Drs. Pearse Lyons and David
Kelsall (Alltech) for the sample of industrial yeast. This work was funded
jointly by rogen (Ottawa, Canada) and the Biochemical Conversion Element
of the Office of Fuels Development of the US Department of Energy (NREL
subcontract ZDH-9-29009-02).
References
1. Hinman, N. D., Wright, J. D., Hoagland, W., and Wyman, C E. (1989), Appl. Biochem.
Biotechnol. 20/21, 391-401.
2. Foody, B. F. and Tolan, J.5. (2001), in 23rd Symposium on Biotechnology for Fuels and
Chemicals, Finkelstein, M. and Davison, B., eds., Breckenridge, Breckenridge, CO,
Abstract no. 6-05.
3. Rogers, P. L., Lee, K. J., Skotnicki, M. L. and Tribe, D. E. (1982), Adv. Biochem. Eng. 23,
37-84.
4. Bringer, S., Sahm, H., and Swyzen, W. (1984), Biotechnol. Bioeng. Symp. 14,311-319.
5. Doelle, H. W., Kirk, L., Crittenden, R, Toh, H., and Doelle, M. (1993), Crit. Rev.
Biotechnol. 13,57-98.
6. Lawford, H. G., Rousseau, J. D., and Tolan, J.5. (2001), Appl. Biochem. Biotechnol. 91-
93,133-146.
7. Lawford, H. G. and Rousseau, J. D. (2002), Appl. Biochem.Biotechnol. 98-100,429-448.
8. Lawford, H. G. and Rousseau, J. D. (2000), Appl. Biochem. Biotechnol. 84-86,277-294.
9. Lawford, H. G., Rousseau, J. D., Mohagheghi, A., and McMillan, J. D. (2000), Appl.
Biochem. Biotechnol. 84-86, 295-310.
10. Lawford, H. G. and Rousseau, J. D. (2001), Appl. Biochem. Biotechnol. 91-93,117-131.
11. Tolan, J. S. (1999), in The Alcohol Textbook, Jacques, K. A., Lyons, T. P., Kelsall, D. R,
eds., Nottingham University Press, Nottingham, UK, pp. 117-128.
12. Timell, T. E. (1964), Adv. Carbohydr. Chern. 9,247-302.
13. McMillan, JD.(1994), in Enzymatic Conversion of Biomass for Fuels Production, ACS
Symposium Series 566, Himmel, M. E., Baker, J. 0., and Overend, R A., eds., Ameri-
can Chemical Society, Washington, DC, pp. 411-437.
14. Lawford, H. G. and Rousseau, J. D. (1994), Appl. Biochem. Biotechnol. 45/46,437-448 .
15. Lawford, H. G. and Rousseau, J. D. (1993), Appl. Biochem. Biotechnol. 39/40,687-699.
16. Lawford, H. G., Rousseau, J. D., and McMillan, J. D. (1997), Appl. Biochem. Biotechnol.
63-65, 269-286.
17. Zhang, M., Chou, Y-C, Picataggio, S. K., and Finkelstein, M. (1998), US patent no.
5,843,760.
18. Mohagheghi, A., Evans, K., Chou, Y.-C and Zhang,M. (2002), Appl. Biochem.
Biotechnol. 98-100, 885-898.
19. Roger, P.L. and Tribe, D. E. (1984), US patent no. 4,443,544.
20. Ingledew, W.M. (1999), in The Alcohol Textbook, ACS Symposium Series 566, Jacques,
K. A., Lyons, T. P., Kelsall, D. R, eds., Nottingham University Press, Nottingham,
UK, pp. 49-87.
21. Toon, S., Philippi dis, G. P., Ho, N. W. Y., Chen, Z. D., Brainard, A., Lumpkin, R E.,
and Riley, C J. (1997), Appl. Biochem. Biotechnol. 63-65,243-255.
Abstract
Pressure pulsation (PP) was investigated for its effects on oxygen transfer
rate (OTR) measured by sulfite oxidation. By manipulating airflow rate, 0.41-
1.2 vvm, and a control valve in a 4-L bioreactor, the frequency of PP was varied
at different gas pressures3-15 psig. A mathematical model of OTR was built
and compared to experimental data. OTR was also examined at constant gas
pressure, 4.5-15.0 psig. The results indicate a good agreement between mea-
surement and model prediction. OTR above 9 psig during PP showed signifi-
cant enhancement at 25°C. This proves that PP not only affects the elevation of
DO level, but also increases the interfacial area and mass transfer coefficient.
Introduction
Oxygen limitation is a long-term problem in aerobic fermentation or
cell culture, because oxygen has low solubility in water. Dissolved oxygen
(DO) concentration is generally kept as high as possible by increasing the
oxygen transfer rate (OTR) to support aerobic processes. High agitation
and/ or airflow rate is the most commonly used strategy to improve OTR
(1,2). There are also some studies on the effects of DO (3) and periodic
changes in pressure on the bioprocess (4-6). In recent years, the techniques
of pressure pulsation (PP) (7) and oscillating dissolved oxygen tension (8)
have been applied to biologic systems, to enhance OTR or DO level in
fermenting liquid to produce more desired product (metabolite).
Our previous report showed increased productivity and yield of glyc-
erol in highly aerobic yeast fermentation by about 6.8 and 26%, respectively
(7), owing to enhanced OTR resulting from PP. The OTR was not affected
by gas flow rate above the loading point. To evaluate quantitatively the
effect of PP on OTR, a sulfite oxidation method was applied to measure
OTR at different peak pressure, Pm! and cycle, t 2 , (reciprocal of frequency)
*Author to whom all correspondence and reprint requests should be addressed.
Results
Effect of Different PPs on OTR
OTR with different PPs (same cycle, t2 = 30 s) was measured three
times for each set of experimental conditions at 25°C. Table 1 shows that a
higher peak pressure of PP can reach a faster OTR. OTR with 15 psig of PP
was about 35% faster than that with 3 psig ofPP. OTR without PP was about
5% faster than that with 3 psig of PP and was close to that with 6 psig of PP.
Since kL is related to airflow rate below loading point (12), OrR with an
aeration rate below 0.65 vvm or 3 psig will be a function of aeration rate.
OTR decreased by lowering gas flow rate has a greater effect than that
increased by higher Pm. Nevertheless, this does not affect the result of our
mathematical model. The model was derived, as shown subsequently, from
OTR based on unit gas volume in the dispersion.
Effect of Different PP Cycles on OTR
The OTRs at various PP cycles were determined in triplicate at 25°C
(see Table 2). Generally, if a longer PP cycle (lower frequency) was applied,
the measurement of sulfite oxidation gave a lower OTR. For example, the
OTR with a 15-s PP cycle was 43% larger than that with a 50-s PP cycle. With
a higher frequency of PP, there was more frequent, quick expansion of gas
bubbles during the depressurization phase, which would create more fresh
bubble surface area. According to Danckwerts's (13) surface renewal model,
a freshly formed surface allows much faster interfacial mass transfer rates
including OTR.
Table 3
Effect of Different Constant Pressures
on OTR Measured by Sulfite Oxidation
P (psig) Aeration rate (vvrn) OTRa SE
4.5 0.93 2.7E-03 1.7E-04
9 1.1 3.1E-03 1.9E-04
12 1.1 3.3E-03 1.7E-04
15 1.0 3.3E-03 1.7E-04
"OIR (M/min) measured at 25°C with a working volume of 41.
(2)
in which n is the total number of bubbles, and r is the assumed average
radius of bubbles.
Then by dividing Eq. 1 by Eq. 2, the gas-liquid interfacial area, a, is
defined as follows:
a =A/V = 3/T (3)
Assuming the gas in the dispersion obeys the idea gas law,
pV=K (4)
in which K is a constant.
From Eq. 2 and 4, assuming no coalescence of bubbles, so that n is a
constant, and taking the reciprocal of radius, then
1/T = Bp 1/3 (5)
in which B, a constant, is defined as [4mt j(3K)F/3.
Substituting Eq. 5 into Eq. 3, and taking the first-order time derivative
of interfacial area, a,
a = 3Bp1/3 (6)
(9)
Model Fitting
The model of OTRs with different PPs, Pm = 3-15 psig (same cycle,
30 s), was fitted with nonlinear regression provided by Flying Raichu's
3.2e-3
3.0e-3
,-..
1:E
~ 2.8e-3
'-'
2.6e-3
2.4e-3
o 3 6 9 12 15 18
Pm (psig)
Fig. 1. Model of OTR with different PPs and same cycle, t2 =30 s.
SigmaPlot 2000 ver 6.10 (SPSS Science). Assuming that Danckwerts's (13)
model is obeyed, the experimental data in Fig. 1 show good agreement
with the model curve from Eq. 19 (M = 9.5e-5, I = 7.0e-4, Rsqr = 0.98, in
which Rsqr = 1.0 if 100% matching).
In the case of different PP cycles, t2 = 15-50 s, fitting with the same
computer program and assumption, the result of fitting also gave good
agreement between experimental data and the model curve (M = 7.0e-5, I
= 1.3e-3, and Rsqr = 0.97; see Fig. 2). However the parameter M was 26%
smaller, and I was 46% larger than that estimated from different PPs. This
can be caused by deviation from the assumptions of ideal gas law, unifor-
mity of the bubbles' size, and/or Danckwerts's (13) model.
Danckwerts's (13) model was checked by applying the parameters M
and I computed from the model with different PPs, as shown in Fig. 3. The
fitted power of t2 is -0.50 and Rsqr is 0.85, which should be reasonable
enough. However, some assumptions may need to be modified to get a
better fit.
3.4e-3
3.2e-3
-..
3.0e-3
~
E:
~
!l:: 2.8e-3
S
2.00-3
2.4e-3
•
2.2e-3 L -_ _ _.L..-_ _ _.L..-_ _ _-'---_ _ _-'---_ _- - 1
10 20 30 40 50 60
tz (sec)
Fig. 2. Model of OTR with different cycles and same PP, Pm = 9 psig.
3.4e-3
3.2e-3
"""'
~
E
3.0e-3
~
S 2.8e-3
2.6e-3
2.4e-3
2.2e-3
10 20 30 40 50 60
~ (sec)
Fig. 3. Model of OTR with different cycles and same PP, Pm = 9 psig, by applying
parameters M and I from Fig. 1.
higher peak pressure. From the surface renewal model, fresh interfacial
area had a much higher rate of oxygen transfer than the old bubble surface
area. In addition, the higher frequency of PP created a higher level of
turbulence next to the bubble surface, which enhanced the value of kL by
increasing the frequency of surface renewal. Our studies indicated that a
good agreement of measurement and theoretical model was achieved,
and that the OTR above 9 psig of PP showed significantly more enhance-
ment than that above the corresponding time-integrated average pres-
sure at 25°C. Futhermore, keeping the aeration rate above the loading
point can provide better improvement of OTR by PP.
Acknowledgments
We acknowledge the assistance provided by Tom Huang for the de-
sign of the fermentor. This research was supported in part by a grant from
the National Science Foundation.
Applied Biochemistry and Biotechnology Vol. 105-108, 2003
480 Huang et al.
3.4e-3
• Expt. Data (Const. p)
0 Expt. Data (Integ. Avg. Pm)
- - Model Curve
• •
3.2c-3
•
3.0e-3
........
1:
.~
2.8c-3
~
~
b
2.6e-3
2.4e-3
o 3 6 9 12 15 18
P (psig)
References
1. Finn, R. K. (1954), Bacteriol. Rev. 18,254-274.
2. Hixson, A W. and Gaden, E. L. Jr. (1950), Ind. Eng. Chem. 42, 1792-1801.
3. Kilburn, D. G. and Webb, F. C (1968), Biotechnol. Bioeng. 10,801-814.
4. Kataoka, H., Sato, 5., Mukataka, 5., et al. (1986), Biotechnol. Bioeng. 28, 663-667.
5. Trager, M., Qazi, G. N., Buse, R., and Onken, U. (1992), J. Ferment. Bioeng. 74,282-287.
6. Rhiel, M. and Murhammer, D. W. (1995), Biotechnol. Bioeng. 47, 640-650.
7. Huang, W.-C, Gong, C 5., and Tsao, G. T. (2002), Appl. Biochem. Biotechnol. 98-100,
909-920.
8. Trujillo-Roldan, M. A, Pena, C, Ramirez, O. T., and Galindo, E. (20m), Biotechnol.
Prog. 17, 1042-1048.
9. Yoshida, F., Ikeda, A, Imakawa, 5., and Miura, Y. (1960), Ind. Eng. Chem. 52,435-438.
10. Shuler, M. L. and Kargi, F. (1992), Bioprocess Engineering, Prentice Hall, Englewood
Cliffs, NJ, p. 165.
11. Schultz, J. S. and Gaden, E. L. Jr. (1956), Ind. Eng. Chem. 48,2209-2212.
12. Cooper, C M., Fernstrom, G. A, and Miller, S. A (1944), Ind. Eng. Chem. 36,504-509.
13. Danckwerts, P. V. (1951), Ind. Eng. Chem. 43, 1460-1467.
Permeation Associated
with Three-Phase-Partitioning Method
on Release of Green Fluorescent Protein
Abstract
Transformed cells of Escherichia coli expressing recombinant green fluo-
rescent protein (GFPuv) were subjected to two methods of extraction:
(1) freezing/ thawing/ sonication (FTS) cycles prior to the three-phase par-
titioning (TPP) method, or (2) directly to TPP extraction. The amount of
GFPuv released by the FTS plus TPP method varied: 374 Ilg/ mL (first cycle),
93-442 Ilg/mL (second cycle), 32-359 Ilg/mL (third cycle), 18-115 Ilg/mL
(fourth cycle). The GFPuv yields by the second method (TPP only) were,
23-54 Ilg/ mL for the first extract and 33-91 Ilg/ mL for the second. The FTS
plus TPP method released similar amounts of GFPuv to that extracted by
TPP; and provided a better mixture elution through the hydrophobic inter-
action column: 13-63 Ilg/ mL for FTS plus TPP methods, and 2.5-13 Ilg/ mL
for TPP. The results showed that although selective permeation is a more
laborious methodology, it was more efficient for obtaining of GFPuv in
relation to the direct extraction of the cells for TPP.
Index Entries: Recombinant green fluorescent protein; Escherichia coli;
protein purification; three-phase-partitioning method.
Introduction
The native form of the green fluorescent protein (GFP), extracted from
jellyfish Aequorea victoria, emits a brilliant green fluorescent light when
exposed to ultraviolet (uv) light (1..-360-400 nm) (1). The recombinant form
of the green fluorescent protein, GFPuv, can be successfully expressed in
prokaryotic and eukaryotic cells (2).
Expression
An overnight culture of E. coli in LB broth/ ampicillin was transferred
to the surface of LB / ampicillin/ isopropyl-~-D-thiogalactopyranoside
(IPTG) USB) agar and incubated (37°C for 24 h at 100 rpm). Using a hand
held uv lamp (395 nm, model UVL-4; UVP), four brilliant fluorescent colo-
nies were selected and transferred, each one to a tube containing LB / ampi-
cillin broth and incubated (37°C for 24 h). The 8 mL suspension of (from
four tubes) was mixed and transferred into 200 mL of LB / ampicillin broth.
The seeded broth was divided into 50-mL (cultures 1-4) lots and each trans-
ferred to a 250-mL Erlenmeyer flask. The flasks were incubated (100 rpm
at 37°C for 3 h) to an OD66onm of 0.8 (10 8 CFU /mL) when IPTG was added
(0.5 mM final concentration). After 21 h (100 rpm at 37°C), the GFPuv
expressed by induced cells was confirmed under UV light (395 nm). For all
cultures, the cellular concentration was obtained by the gravimetric method
of the biomass (mg/L) held on the surface of a 0.22-!!m membrane
(Millipore) and submitted to 105°C for about 24 h, attaining constant weight.
The biomass concentration related to isolated GFPuv was expressed by
specific productivity (!!g of gfpuvlmg of dry cell weight [DCW]).
Permeation (18)
Selective permeation of the pelleted cultures 2-4 was performed by
four cycles of slow freezing (-20°C; 0.S3°C / min), followed by thawing (20°C)
and sonication (or freezing/thawing/sonication [FTS]) (High Intensity
Ultrasonic Processor, Vibram cells, model 100; Sonic & Materials). The freez-
ing/thawing cycles were performed in a freeze-dryer (FTS System™,
Secfroid; Lyolab G) chamber (Dura StopTM MP). With a PT-100 thermo-
couple inserted into a pellet, the freezing/ thawing temperature was regis-
tered every minute using the software Lyphoware for Windows. Between
the freezing/thawing cycles, the microtube was kept immersed in an ice-
salt bath, and a 3.0-mm microtip ultrasonic processor was placed into the
sample, which was submitted to threefold pulse sonication at O°c. Each
pulse was at 25 vibration amplitude at alternating cycles of 6.0 s on and 1.0
s off. Thus, the permeate was subjected to TPP extraction.
Partial Purification of GFPuv with Hydrophobic Interaction Column
Extract (250 ilL) was mixed with 250 ilL of 4 M (NH4}2S04 and trans-
ferred to the top of a fast-flow, methyl support hydrophobic interaction
column (HIC). The column was previously equilibrated with 2 M
(NH4)zS04. After the column was loaded, GFPuv was retained near the
top of the column by affinity binding to the HIC resin. The loaded column
was washed first with 250 ilL of 1.3 M (NH4hS04 to elute proteins other
than GFPuv that bind with low affinity. GFPuv was eluted with 750 ilL of
buffer solution (lOmMTris-HCI,lOmMEDTA, pHS.O) and stored at 4°C.
The progress of the GFPuv through the column was observed with a UV
light, as well as confirmation of the eluted material.
Fluorescence Intensity
The fluorescence intensity of GFPuv was measured in the eluted
samples in the spectrofluorophotometer (RF-5301 PC; Shimadzu, Kyoto,
Japan), with an excitation filter of 394 nm and an emission filter of 509 nm.
Purified recombinant GFPuv purchased from Clontech ("standard
GFPuv") was used to generate a standard curve to relate protein concen-
tration to fluorescence intensity. A standard curve was prepared using
known amounts (1.52, 2.44, 3.90, 6.25, and 10.00 Ilg/mL) of standard
GFPuv diluted in buffer solution (10 mM Tris-HCI, pH S.O; 1.0 mM ~-ME;
0.1 mM PMSF). The fluorescence intensity of the samples was compared
to the standard curve from the standard GFPuv (GFPuv Ilg/mL = 0.0256
x [fluorescence intensity] + 0.S576; R2 = 0.99) and was expressed as
micrgrams of GFPuv per milliliter.
Total Protein Concentration Released
The total protein concentration released in the eluted samples was
compared to purified bovine serum albumin (BSA) in buffer solution (mol
wt of 66 kDa; Sigma) at A 280 in a spectrophotometer and expressed in mil-
25
O+-----~------~------~--~~------;
300 350 400 450 500 550
~~I------------------------------------~I
Wavelength (nm)
Fig. 1. The spectrum of excitation (maximum peak: 394 nm) for (a) standard GFPuv,
(b) extracted GFPuv, and (c) extracted/purified GFPuv is shown. Also shown is the
spectrum of emission (maximum peak; 509 nm) of (d) standard GFPuv, (e) extracted
GFPuv, and (f) partially purified.
,----,--,-l)J
6,00 -r-----,------,------,----,------,-----y------,
~ A. ..... ~
"b~~§tif:~~~r«..,!~,.--rc:::;;;~-c.r1
i
S,OO
1fI?~
4,00 +----+-----t-J"R!i!!!'-+----II----t---+----t
~ 3,00 +---+---A--I~'1IJ---+----+----i----+------l
2,00 i----+-~rF7.r'9------+----+---__II-----+_---I
[~
--
1,00 hi~g~pIL-r--_j---1--__t--__t--__1
Fig. 2. GFPuv extracted from E. coli at different pH values: (-/1-) extracted GFPuv;
(-0-) extracted/purified with HIe; (-D-)standard GFPuv.
200kDa
97,4 kDa
29kDa
27 kDa (GFPuv)
2 3 4 5 6 7 8
Fig. 3. SDS-PAGE of sample 3. Lane 1, molecular mass weighed 18-200 kDa (Gibco);
lane 2, standard GFPuv (20 !lg/mL); lane 3, permeate of First-cycle FIS (32 !lg/mL);
lane 4, permeate of second-cycle FIS (60 !lg/mL); lane 5, permeate of third-cycle FIS
(39 !lg/mL); lane 6, permeate of fourth-cycle FIS (46 !lg/mL); lane 7, mixture of per-
meate after IPP extraction (13 !lg/mL); and lane 8, mixture of eluted extracts from
column HIe (60 !lg/mL).
increased up to 42% (150 Ilg of GFPuv fmg for first FTSfTPP) resulting in
the largest sample concentration in the pool (83 Ilg of GFPuv fmg).
The combination of first and second FTS cycles followed by TPP
extractions resulted in yields>SO% GFPuv, respectively: 67% for sample 2,
77% for sample 3, and 93% for sample 4, indicating that the third and fourth
FTS plus TPP steps can be eliminated.
In sample 4, the pool obtained from the first through fourth FTS
cycles (equal volumes) and subjected to the first through third TPP extrac-
tions showed 10 times less total proteins (2.4 mg of BSAf mL) and specific
mass two times larger (18 Ilg of GFPuv fmg) than for sample 2 (9.4 Ilg of
GFPuv fmg), owing to the effectiveness of TPP extractions.
The samples run on gel electrophoresis showed a progressive
increase in impurity from the first up to the fourth FTS permeation (Fig. 3,
lanes 4-6), owing to a simultaneous increase in the intracellular release of
molecules other than GFPuv by successive FTS cycles (Fig. 1). A significant
removal of molecules other than GFPuv, by TPP extraction of permeated
sample 3, was confirmed in lanes 7 (before HIC) and 8 (after HIC) (see Fig. 3).
A single band between 27 (standard GFPuv) and 29 kDa (standard mol wt)
can be visualized. Therefore, the HIe procedure did not improve TPP effec-
tiveness on the GFPuv purification, confirming Sharma and Gupta's (11,12)
and Yakhnin's (5) observations.
Conclusion
The recombinant GFPuv, which was expressed by transformed cells of
E. coli DHS-u, showed similarities in fluorescence, stability, and solubility
Acknowledgments
We thank biologist Irene A. Machoshvili for providing technical
assistance, and Olivia Cholewa for technical revision of the manuscript.
This study was made possible by financial support provided by Brazilian
Committees for Scientific Technology Research (Conselho Nacional de
Desenvolvimento Cientifico e Tecnol6gico and Funda<;ao de Amparo a
Pesquisa do Estado de Sao Paulo).
References
1. Ward, W. W. (1998), in Green Fluorescent Protein: Properties, Applications and Protocols,
Chalfie, M. and Kain, S., eds., Wiley-Liss, New York, NY, pp. 45-75.
2. Chalfie, M., Tu, Y., Euskirchen G., Ward, W. W., and Prasher, D.C. (1994), Science 263,
802-805.
3. Sambrook, J., Fritsch, E.F., and Maniatis, T. (1989), Molecular Cloning: a Laboratory
Manual, 2nd ed, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY.
4. Johnson, B.H. and Hecht, M.H. (1994), Bio!Technology 12, 1357-1360.
5. Yakhnin, A. V., Vinokurov, L.M., Surin, AK., and Alalhov, Y.B. (1998), Protein Expres-
sion Purif. 14,382-386.
6. Naglak, T.J., Hettwer, D.J., and Wang, H.Y. (1990), in Separation Process in Biotechnol-
ogy, Asenjo, J. A, ed., Marcel Dekker, New York, pp. 143-175.
7. Wheelwright, S.M. (1994), Protein Purification: Design and Scale Up of Downstream
Processing, Wiley, New York.
8. Endow, S.A and Piston, D. W. (1998), in Green Fluorescent Protein: Properties, Appli-
cations and Protocols, Chalfie, M. and Kain, S., eds., Wiley-Liss, New York, NY,
pp.271-294.
9. Dennison, C. and Lovrient, R. (1997), Protein Expression Purif 11, 149-161.
10. Dennison, c., Moolman, L., Pillary, C. S., and Meinesz, R. E. S. (2000), Afr. J. Sci. 96,
159-160.
11. Sharma, A and Gupta, M. N. (2001), Process Biochem. 37, 193-196.
12. Sharma, S. and Gupta, M. N. (2001), Protein Expression Purif. 21,310-316.
13. Bell, D. J., Hoare, M., and Dunnill, P. (1983), Adv. Biochem. Eng. 26, 1-72.
14. Conn, E. E. and Stumpf, P. K. (1980), Introdufiio it Bioquimica, Edgard Blucher, Sao
Paulo, Brazil.
15. Lehninger, A L. (1990), Principios de Bioquimica, Sarvier, Sao Paulo, Brazil.
16. Scopes, R.K. (1994), Protein Purification: Principles and Practices, 3rd ed., Springer-
Verlag, New York, NY.
U. Rothstein, F. (1994), in Protein Purification Process Engineering, vo1.18, Harrison, R. G.,
ed., Marcell Dekker, New York, NY, pp. 115-208.
18. Vessoni Penna, T. c., Chiarini, E., Machoshvili, 1. A, Ishii, M., and Pessoa, A. Jr.
(2002), Applied Biochem. Biotechnol. 98-100,791-802.
19. Bokman, S. H. and Ward, W. W. (1981), Biochem. Biophys. Res. Commun.101, 1372-1380.
Abstract
This study investigated the effects of flask-to-liquid volume ratio on
the growth of Panax ginseng hairy root, transformed by Agrobacterium
rhizogenes, in flask cultures and compared the characteristics of various
bioreactors for scale-up. The flask-to-liquid volume ratio was optimum at
1.5 mL of air / mL of medium in flask cultures, and hairy root growth was
not affected above the optimum ratio. In 500-mL flask culture, hairy root
showed two growth phases. After the first exponential growth, specific
growth rate decreased. The growth characteristics of P. ginseng hairy root
in various bioreactors were investigated. Hairy root growth was about 55-
fold ofinoculum after 39 d in a 5-L bioreactor and about 38-fold of inoculum
after 40 d in a 19-L bioreactor. Carbon yield was higher in a 19-L bioreactor
than in others, but it did not show any linear relationship to the growth rate
of hairy roots in bioreactors.
Index Entries: Panax ginseng; transformed hairy root; ginseng polysaccha-
ride; bubble bioreactor; flask-to-liquid volume ratio.
Introduction
Plants are the potential source of a large number of important bio-
chemical constituents such as pharmaceuticals, food additives, pigments,
flavors, fragrances, and fine chemicals. Large-scale plant cell and tissue
*Author to whom all correspondence and reprint requests should be addressed.
+
14
12 r+ r+
10
r+
~
g
0
.~
8
+
oS
~
6 r%-
...
0
0
4
0
50/250 lOon5O 15On5O 150/250+ 100/500 200/500
Fig. 1. Effect of medium volume size on growth of hairy roots cultured for 26 d in
250 and 500-mL flasks. All flasks were covered with aluminum foil except for 100/250+
(covered with cotton stopper).
root cultures, initial specific growth rates were higher at a SO-mL medium
volume than at 100 mL (16). In addition, Auro et al. (8) and van Suijdam
et al.(17) reported that reducing the liquid volume in flask culture allows
an increase in oxygen transfer rate. These reports suggested that air /
liquid volume ratio is a limiting factor affecting the plant cell growth, and
this parameter influences the effectiveness at mass transfer of gas-liquid
and liquid-solid in flask cultures.
Characteristics of Hairy Roots in Flask Cultures
Figure 2 shows the growth characteristics, such as biomass growth on
semilogarithmic coordinates, sugar consumption, changes in pH, and con-
ductivity of the medium, of P. ginseng hairy roots in SOO-mL Erlenmeyer
flask culture. Two phases of lag and exponential growth were observed
from a semilogarithmic representation of the data. Diauxic growth in plant
cell and tissue cultures may occur when the cell is offered a catabolizable
energy source in the presence of a more readily catabolizable energy source
(18). After a short lag period of about 4 d, the first exponential growth
phase occurred between d 4 and 12 of the culture periods, and hairy roots
had a specific growth rate ("") of 0.057 d-1• The second growth phase was
between d 12 and 42 of the culture periods ("" = 0.019 d-1). Generally, expo-
nential growth has been reported to occur only during the first few d of
hairy root culture periods by several researchers and for a range of plant
Applied Biochemistry and Biotechnology Vol. 105-108, 2003
498 Jeong et al.
6.0
s.o i
30.0 4.0 6
20.0 30
...... S
.....
..J
2S::J'
.....
S tOI
c
0
:g
:8
7.0
s
c i
~
c
6.0
20j 41
.....,
CII
u
c
4.0
IS
CII
!:! .g.~
8
0
u 3.0 0 3.
III
:a 2.0
...
U
8
E 10 ;
0 -0- Biomass (/)
iii -+- Reducing sugar 2
- 0 - Talal Sugar S
~1
0.7
--.op- pH
- - ConducIivity
0.6 0
0 10 20 30 40 SO
Time (Day)
+
6
rr
2
rr r+ rr
o
o 2 4 6 8
Agar concentration (gIL)
Fig. 3. Growth of hairy roots cultured for 27 d in 1/2 MS solid medium containing
agar as solidifier.
3.0 30
5 pH
2.5 25 "......
'""""'
e .... ~ 4
l 2.0
··0
20 .9
'OJ
c::
.~ ~Gl
.~
t)
::s 1.5 15 g
0
"80 u
:a
u ~
1.0 10 ~
___ Conductivity
0.5 -+- Reducing sugar 5
···0·· Total sugar
~pH
0.0 0
0 5 10 15 20 25 30 35 40
Time (Day)
First, hairy roots grew on the upper partition of the bioreactor, causing a
more limited use of culture space than suspension cultures. Second, at
liquid culture, the meristem-dependent growth pattern of hairy roots con-
structed a root ball or mat, which consists of old tissue at the core, and grew
young lateral roots around it. This root mat inhibited the mass transfer of
nutrients and oxygen to the root mat core. Hairy roots in large-scale culture
constructed greater root mats than those in small-scale culture at latter
periods of cultivation.
Figure 5 shows the time course of the growth and nutrition consump-
tion of P. ginseng hairy roots in a 19-L bioreactor. After 40 d, hairy roots
increased about 38-fold of inoculum and showed a growth rate of 0.96 d-1•
This result was about 2.6 times higher than that observed in the 250-mL
flask. Kim (19) reported that hairy roots grew about 37 times (2.7-101 g dry
wt) in a 20-L airlift bioreactor using Phytolacca esculeuta hairy root culture.
These results showed the possibility that the mass cultivation of P. ginseng
hairy roots could be accomplished in a bioreactor. Sucrose was first hydro-
lyzed and continuously consumed afterward from 32.1 to 16.8 giL during
the culture periods. The pH of the medium was consistently maintained at
4.87 after the first 20 d and slowly increased to 5.2 afterward. Medium
conductivity decreased from 2.82 to 0.82 ms I em during the culture period.
The intracellular polysaccharide content was 0.13 gl g on a dry wt basis.
This value was lower than that of natural roots (12).
Table 1 summarizes the results of hairy root growth characteristics
and metabolite production in bioreactors. The growth rates obtained from
__ Conductivity
0.5 - . - Total sugar 5
···0·· Reducing sugar
~pH
0.0 ...I.--.----.....----.------.r-----.----.....----.-------,r----,--.L. 0
o 5 10 15 20 25 30 40
Time ( Day)
Conclusion
In flask and bioreactor cultures, oxygen transfer to hairy roots sub-
merged in medium have three external mass-transfer resistances. Thus, the
most important parameters affecting flask culture properties are flask size,
shaking speed, closure type, and medium volume. The liquid-to-flask vol-
ume ratio was optimum at 1.5 mL of air / mL of medium in flask cultures.
In 500-mL flask culture, hairy roots showed two growth phases. After the
first exponential growth phase, specific growth rate was decreased. Hairy
roots showed a growth rate of about 1.38 and 0.96 d-1 in 5 and 19-L
bioreactors, respectively. The yields of sugar and conductivity were higher
in the 19-L bioreactor than in the others, butthere was no linear relationship
to the growth rate of hairy roots in bioreactors. Intracellular polysaccharide
content of hairy roots on various bioreactors was in the range of 0.11-0.13
g/ g on a dry wt basis. It was lower than those of natural ginseng roots, 0.45-
0.79 g/ g on a dry wt basis.
Applied Biochemistry and Biotechnology Vol. 105-108, 2003
~
[
Il:J
c'
g.
~
iii'
q-
-.::
~
::J
0..
Il:J Table 1
c' Comparison of Growth Kinetics and Metabolite Production
~
::J of p, ginseng Hairy Roots in Bioreactors·
o
~
-.:: Culture Aspect Working Growth Growth Intracellular Carbon
Type of time ratio volume ratio rate polysaccharide yield
bioreactor (d) (height/ diameter) (L) (fold) (d-1) (g/g) (g dry wt/ g sugar)
V1
o Static culture 28 0.05 5.8 0.21 NT NT
N
Shake-flask culture 48 0.20 16.5 0.34 0.19 0.19
Stirred type 27 1.43 0.80 24.0 0.85 NT 0.19
Bubble column type 25 7.14 2.60 11.0 0.44 0.11 0.13
Bubble column type 39 1.41 4.00 55.0 1.38 0.11 0.22
Bubble column type 40 1.48 17.00 38.0 0.96 0.13 0.18
aNT, not tested.
~
:--
o
-~
~
N
§
Growth of Pan ax ginseng Hairy Roots 503
References
1. Stafford, A., Moris, P., and Fowler, M. W. (1986), Enzyme Microb. Technol. 8,578-587.
2. Dicosmo, F. and Misawa, M. (1995), Biotechnol. Adv. 13(3),425-453.
3. Chattopadhyay, 5., Farkya, 5., Srivastava, A. K., and Bisaria, V. S. (2002), Biotechnol.
Bioprocess Eng. 7, 138-149.
4. Giri, A. S. and Narasu, M. L. (2000), Biotechnol. Adv. 18, 1-22.
5. Hooykaas, P. J. J. and Schilperoort, R. A. (1992), Plant Mol. BioI. 19,15-38.
6. Nam, K. Y. (1996), Recent Korea Ginseng, Korea Ginseng & Tobacco Research Institute,
Taejon, Korea.
7. Nobuyuki, V. and Takesh, K. (1994), in Advances in Plant Biotechnology, Ryu, D. D. Y.
and Furusaki, 5., eds., Elsevier, Amsterdam, The Netherlands, pp. 307-338.
8. Auro, M. A., Hodge, H. M., and Roth, N. G. (1957), Ind. Eng. Chem. 49, 1237-1238.
9. Jung, N. P. and Jin, S. H. (1996), Korean J. Ginseng Sci. 20(4),431-471.
10. WU, J. and Zhong, J. J. (1999), ,. Biotechnol. 68,89-99.
11. Baek, N. I., Park, C H., and Park, C E. (2000), Biotechnol. Bioprocess Eng. 6(6),433-437.
12. Jeong, G.T., Park, D.H. and Hwang, B. (2002), Appl. Biochem. Biotechnol. 98-100,
1129-1139.
13. Murashige, T. and Skoog, F. (1962), Physiol. Plant. 15,473-497.
14. Miller, G. L. (1959), Anal. Chem. 31(3),426-428.
15. Chapline, M. F. and Kendy, J. (1986), Carbohydrate Analysis: A Practical Approach, IRL
Press, Oxford, UK.
16. Kanokwaree, K. and Doran, P. M. (1997), J. Ferment. Bioeng. 84(4), 378-381.
17. van Suijdam, J. C, Kossen,N. W. F., and Joha,A. C. (1978), Biotechnol. Bioeng. 20, 1695-
1709.
18. Peraza-Luna, F., Rodriguez-Hedida, M., Arios-Castro, C, Bessiere, J. M., and Calva-
calva, G. (2001), J. Agric. Food Chem. 49,6012-6019.
19. Kim, Y. H. (1994), PhD thesis, Chungbuk National University, Chungbuk, Korea.
Heterogeneous Aspects
of Acid Hydrolysis of a-Cellulose
Abstract
Hydrolysis of a-cellulose by H 2S04 is a heterogeneous reaction. As such
the reaction is influenced by physical factors. The hydrolysis reaction is there-
fore controlled not only by the reaction conditions (acid concentration and
temperature) but also by the physical state of the cellulose. As evidence of
this, the reaction rates measured at the high-temperature region (above
200°C) exhibited a sudden change in apparent activation energy at a certain
temperature, deviating from Arrhenius law. Furthermore, a-cellulose, once
it was dissolved into concentrated H 2S04 and reprecipitated, showed a reac-
tion rate two orders of magnitude higher than that of untreated cellulose,
about the same magnitude as cornstarch. The a-cellulose when treated with
a varying level of H 2S04 underwent an abrupt change in physical structure
(fibrous form to gelatinous form) at about 65% H 2S04, The sudden shift of
physical structure and reaction pattern in response to acid concentration and
temperature indicates that the main factor causing the change in cellulose
structure is disruption of hydrogen bonding . Finding effective means of
disrupting hydrogen bonding before or during the hydrolysis reaction may
lead to a novel biomass saccharification process.
Introduction
Acid-catalyzed cellulose hydrolysis is a complex heterogeneous reac-
tion. It involves physical factors as well as the hydrolytic chemical reaction.
~\~~~~
nr +H· m
- DomiaantPalhway
205"C
215 D C
10+-----~------~----_,------~------r_----~------~----_,~
o 6 10 15 20 26 30 35 40
Time (min)
0.5.---------------------------------------------------------,
·05
•
·15 •
sc •
:"
-- ·25
.E
....... """"'" "'"''""'"'' "'" .. .. ".. ......
-35
1 .......................................................................... . ......... . .
0. 1 +-----~------~-----.------r-----_r------r------r------r---~~
10 10 30 40
Tune (min)
50 10 70 10 '0
7000
6000 Alpha-Cellulose
5000
2000
1000
0
10 12 14 16 18 20 22 24 26 28 30
Angle
Fig. 5. X-ray diffractograms of a-cellulose (original and treated with 65% H 2S04 ),
and samples treated with 55 and 60% acid are seen to retain the original
fibrous structure although the fibers were broken into smaller fragments by
acid treatment (Fig. 6). However, the sample treated with 65% acid shows
a completely different picture. The original fibrous form of cellulose disap-
peared and changed into a gel-like substance. When the cellulose fibers are
dissolved into concentrated acid, the bundles of glucan chains are sepa-
rated into multiple single chains. As the acid is diluted, the dissolved glucan
chains reassociate. When this happens, the glucan chains do not go back to
the original orderly structured fibrillar form but form an irregular bundle.
We note that the change in cellulose structure owing to acid treatment is
gradual to a certain point (60% acid in this case) and then undergoes a
drastic change beyond that point. At higher temperature, it requires less
concentrated acid to undergo this drastic change. For example, at 70°C, it
requires only 50% H 2S04 • We mentioned earlier a similar behavior with
respect to temperature: a drastic increase in hydrolysis rate at a certain
temperature. We have confirmed that these sudden changes in kinetic
behavior and crystallinity are owing to structural changes in the cellulose.
Applied Biochemistry and Biotechnology Vol. 105-108,2003
Acid Hydrolysis of a-Cellulose 513
The cellulose structure is closely related with the hydrogen bonding exist-
ing inside the cellulose chains. The existence of hydrogen bonds in cellulose
molecule is well documented (1). The hydrogen bonding exists within a
single chain of glucan (intramolecular hydrogen bonding) and between
the adjacent glucan chains (intermolecular hydrogen bonding ). The inter-
molecular hydrogen bonds are believed to be the primary factor holding
the cellulose chains together forming the fibrous structure. The state of
hydrogen bonding in cellulose also determines other physical properties
of cellulose, such as the extent of crystallinity.
Among all possible nonreaction factors (e.g., physical conformation,
diffusion, crystallinity, chemical composition), the state of hydrogen bond-
ing stands out as the primary factor controlling the main resistance in acid
hydrolysis of cellulose. There is yet another support for this contention. Of
all the physical factors, only hydrogen bonding can undergo such an abrupt
change in reaction rate and structure in response to temperature and con-
centration of acid as seen in our experiments.
The state of hydrogen bonding is the primary factor determining the
molecular level structure of cellulose. Kinetics of acid hydrolysis of cellu-
lose is therefore strongly dependent on the state of hydrogen bonding. A
better understanding of hydrogen bonding as to how it relates to the
molecular structure of cellulose and finding an effective means to disrupt
the hydrogen bonding may prove to be a fruitful way to establish acid
hydrolysis as a viable biomass saccharification process.
Acknowledgments
We wish to acknowledge the help of Dr. Changshin Sunwoo from
Chonnam National University, Korea; Dr. Mike Miller from Auburn Uni-
versity for SEM photographs; and for David Wood and Wei Zhang assis-
tance in the reaction experiments. This research was sponsored by the
US Department of Energy under Cooperative Agreement DE-FC36-
01GOl1072, and by NREL under subcontract ACO-1-31003-01.
References
1. Fengel, D. and Wegener, G. (1984), Wood Chemistry, Ultrastructure, Reactions, Walter
de Gruyter, Berlin, Germany.
2. Shafizadeh, F. (1963), TAPPI J. 46, 381-383.
3. Timell, T. E. (1964), Can. J. Chem. 42, 1456-1472.
4. Harris, J. F. (1975), Appl. Polym. Symp. 28,131-144.
5. Philipp, B., Jacopian, V., Loth, F., Hirte, W., and Schulz, G. (1979), in Hydrolysis of
Cellulose: Mechanisms of Enzymatic and Acid Catalysis, Advances in Chemistry Series
No. 181, Brown, Jr. R. D. and Jurasek, L., eds., American Chemical Society, Washing-
ton, DC, pp. 127-143.
6. Saeman, J. F. (1945), Ind. Eng. Chem. 37,43-52.
7. Springer, E. L. (1966), Tappi 49,102-106.
8. Daruwalla, E. H. and Shet, R. T. (1962), Text. Res. J. 32,942-954
9. Nelson, M. L. (1960), J. Polym. Sci. 43, 351-37l.
10. Millett, M. A., Effland, M. J., and Caulfield, D. F. (1979), in Hydrolysis of Cellulose:
Mechanisms of Enzymatic and Acid Catalysis, Advances in Chemistry Series No. 181,
Abstract
Oat spelt xylan was treated with water in a batch reactor at temperatures
of 180 and 200°C. Ion-moderated partition (IMP) chromatography was then
applied to separate oligomers in solution according to their molecular size.
Calibration of the IMP measurements based on peak height was found to
quantify dissolved monomer and oligomer yields welL Oligomer concentra-
tions in the liquid hydrolysate were also determined from the difference in
xylose monomer concentrations measured by high-performance liquid chro-
matography before and after posthydrolysis of dissolved xylooligosaccha-
rides to xylose. Delayed formation and then rapid disappearance of oligomers
from DP10 to DP2 was observed by IMP, and total oligomer yields measured
by IMP and posthydrolysis were very similar at these times. However, while
IMP detected virtually no oligomers initially, posthydrolysis measurements
gave significant amounts of soluble oligomers at these times, indicating that
oligomers with chain lengths> 10 were in solution but not detectable by the
IMP system used.
Index Entries: Autohydrolysis; hydrolysis; ion-moderated partition chro-
matography; oligomers; thermochemical; xylan.
Introduction
The fractionation of lignocellulosic materials for production of a va-
riety of marketable chemicals is an attractive approach for biomass utili-
zation, and the hemicellulose portion can be hydrolyzed into sugars for
fermentation to a variety of valuable products. Xylooligomers are impor-
tant intermediates in hemicellulose hydrolysis for pretreatment and sugar
recovery. They also have potential applications in many fields including
pharmaceuticals, feed formulations, agricultural applications, and func-
*Author to whom all correspondence and reprint requests should be addressed.
tion of 4%. These samples were then autoclaved for 1 hat 121°C in sealed
autoclave bottles. Next, the hydrolysate was neutralized with calcium
carbonate to a pH of 5.0-6.0 before being analyzed by HPLC. A set of
sugar standards of known concentration was taken through the same
analytical procedure in parallel to determine losses owing to the destruc-
tion of sugars and to provide a correction factor for adjusting the sugar
concentrations following posthydrolysis(4). The increase in monomer
concentration resulting from the posthydrolysis procedure provided a
measure of the fraction of the total dissolved xylose that is oligomeric(5,6).
The solid residues from the centrifuge tubes were vacuum dried and
subjected to quantitative saccharification to measure the remaining xylose
content (7).
Molecular Weight Determination for Oligomers
A Waters model 717 chromatography system, equipped with a Waters
RI detector 410 and a Bio-Rad Aminex HPX-42A ion-moderated partition
(IMP) column was connected to a Waters Fraction Collector II. Centrifuged
samples were filtered and analyzed by IMP at a flow rate of 0.2 mL/min and
a column temperature of 85°C. Concentrations were converted to yields on
a weight basis.
100
-SOil d resl duel 18OC)
-o-SOII d resl due(200C)
~ 80 ••• A· •• Xylose I n t he II quor( 18OC)
.. ·6· .. XyI ose I n t he II quor (2OOC)
~
jij - -+- - Xyl 0011 goners I n t he II quor (18OC)
:c 60 - -0- - Xvi 0011 CIO/II!rs I n t he II auor (2000
c
i
,----0., __ ---
40
':---- .. :::::. . "'111:=------- . . . --------
'0
'#
-d' 20
Qi
>= .. .... .. -.... ....................................... .
0
0 5 10 15 20 25 30
Time, min
Fig. 2. Sugar recovery for uncatalyzed xylan hydrolysis at 180 and 200°C with 5%
solids concentration.
180°C over the 30-min run time. At 200°C, the yield of xylooligomers
reached a maximum of about 50% of potential xylose at 10 min and then
dropped. At 180°C, the xylooligomer yield reached about 50% of poten-
tial xylose at 30 min, the end of our run time, but appeared to be still
increasing. On the other hand, the amount of xylose in the solid residue
decreased with increasing reaction time, reaching a nearly constant value
after 10 min at 200°C but still continuing to drop after 30 min at 180°e.
Applied Biochemistry and Biotechnology Vol. 105-108,2003
Oligomer Molecular Weight Distribution 519
for a 5% solids concentration at 200°C for 10 min. I, DPl; 2, DP2; 3, DP3; 4, DP4.
''.
,<0.
,30.
'20.
110.
'00.
4
3
2
'O. ""j-,-.......,~,.......,,...,...-......,~-,-.-.-....,,.-.-.-..,r-.-.-..,...,-....,..,.-.-.,.....,,.......-.,....,.......,..,~,...........,,.....,.....,.,,..........,,.....,....,....,.....,,~,.....-.-.-I
0.00 5.00 10.(1) 15.00 20.00 25.00 30.00 35.00 40.00 45.00 50.00 MOO 80.00 85.00 70.00 75.00 10.00 85.00 .00 15.00 100.00
0 10 20 30 --O--1P10
Time, min
Fig. 5. Oligomer time profiles for uncatalyzed xylan hydrolysis at 200°C with a 5%
solids concentration.
/'-
10
O--~-'c----'----'----'------'------""
o 5 10 15 20 25 30
Time, min
highest yields being for monomers and the lowest for the DPI0 oligomers.
We also observed that those species from DP4-DPI0 dropped from the
peak seen at the previous time while xylose monomer yields continued to
increase until the 25-min time. DP2 and DP3 reached their maximum
levels at the 15-min sample time.
Because no significant yields of oligomers were observed via IMP
until about 10 min into the run, we wished to determine whether very little
solubilization occurred in these earlier times or whether the chains lengths
were too long for our IMP system to measure them. Accordingly, we mea-
sured overall oligomer yields at each time by the posthydrolysis procedure
and compared the results to the total oligomer yields measured by adding
the yields of DP2-DPlO, as shown in Fig. 6. Very good agreement was
found between the total oligomer yield measured by both approaches from
about 10 min on, suggesting that the IMP did a good job of capturing most
of the oligomers in solution at longer run times and that use of the peak
height ratios is reasonable. On the other hand, posthydrolysis revealed
levels of oligomers in solution atthe 3- and 7-min marks similar to at 10 min
while almost no oligomers were measured via IMP for these earlier times.
Applied Biochemistry and Biotechnology Vol. 105-108, 2003
522 Li et al.
These differences suggest that the chain length of the oligomers in solution
is too long for the IMP column used to measure.
Conclusion
The oligomer yield profiles measured by IMP follow the expectation
that longer chains depolymerize to form shorter chains that ultimately
result in release of soluble oligomers and monomer. However, it is some-
what surprising how rapidly oligomers and monomer from DPI0 to DPI
appeared and then mostly disappeared. Virtually no oligomers or mono-
mers were observed with IMP until several min into the reaction, and at
that time, the total yields measured by IMP and posthydrolysis of oligo-
mers were very similar, suggesting that the peak height method of deter-
mining oligomer concentrations is reasonably accurate. However, while
IMP provided no evidence of significant yields of oligomers at early times,
posthydrolysis indicated that significant amounts of soluble oligomers with
degrees of polymerization> 10 were in solution but not detectable by the
IMP system used. Accordingly, we plan to try other systems in an attempt
to find columns that can measure longer soluble oligomers.
Acknowledgment
We are very grateful to the National Science Foundation Division of
Bioengineering and Environmental System for supporting this research
through contract BES-9985351.
References
1. Garrote, G., Dominguez, H., and Parajo, J. C. (2001), Bioresour. Technol. 79, 155-164.
2. Garrrote, G., Dominguez, H., and Parajo, J. C. (1999), Holz Roh Werkst 57, 191-202.
3. Heitz, M., Capek-Menard, E., Koeberle, P. G., Gagne, J., and Chornet, E. (1991),
Bioresour. Technol. 35,23-32.
4. Ruiz, R. and Ehrman, T. (1996), NREL Chemical Analysis and Testing Standard
Procedure, No. 014, National Renewable Energy Laboratory, Golden, CO.
5. Garrrote, G., Dominguez, H., and Parajo, J. C. (2001), Process Biochem. 36,571-578.
6. Shevchenko, S. M., Chang, K., Robinson, J., and Saddler, J. N. (2000), Bioresour. Technol.
72(3),207-211.
7. Ruiz, R. and Ehrman, T. (1996), NREL Chemical Analysis and Testing Standard
Procedure, No. 002, National Renewable Energy Laboratory, Golden, CO.
Abstract
Using the MixAlco process, biomass can be converted into carboxylic
acids, which can be chemically converted into mixed alcohol fuels. This
study focused on the use of countercurrent fermentation to anaerobically
convert sugarcane bagasse and chicken manure to mixed carboxylic acids
using a mixed culture of mesophilic microorganisms from terrestrial and
marine sources. Bagasse was pretreated with lime to increase digestibility.
The continuum particle distribution model (CPDM) simulated continuous
fermentors based on data collected from batch experiments. This model
saves considerable time in determining optimum operating conditions. For
an 80% bagasse/20% chicken manure fermentation with terrestrial inocu-
lum at a volatile solids loading rate (VSLR) of 7.36 g/(L of liquid·d) and a
liquid residence time (LRT) of 8.88 d, total carboxylic acid productivity, total
acid selectivity, and yield were 2.49 g/(L of liquid·d), 0.581 g of total acid/
g of VS digested, and 0.338 g of total acid/ g of VS fed, respectively, at a
concentration of 18.7 g of total acid/L. At the same VSLR and LRT, fermen-
tation with marine inoculum gave higher total acid productivity, total acid
selectivity, and yield than fermentation with terrestrial inoculum. For an
80% bagasse/20% chicken manure fermentation with marine inoculum at a
VSLR of 3.83 g/(L of liquid·d) and an LRT of 12.1 d, total carboxylic acid
productivity, total acid selectivity, and yield were 1.38 g/(L of liquid-d),
0.667 g of total acid/ g of VS digested, and 0.359 g of total acid/ g of VS fed,
respectively, at a concentration of 16.2 g of total acid/L.
Index Entries: Bagasse; carboxylic acids; lime pretreatment; sugarcane;
fermentation.
Mixed a1cohols~-fC1
Introduction
In 1995, more than 250,000,000 t of agricultural waste including
bagasse was generated in the United States (1). The conversion of waste
biomass into liquid fuels has attractive environmental benefits, such as
reducing the greenhouse effect and increasing resource availability. The
most common method to convert lignocellulosic biomass to useful prod-
ucts is simultaneous saccharification and fermentation, which enzymati-
cally hydrolyzes lignocellulose to sugars that are fermented to alcohol.
Currently, the cost of cellulase is too expensive. Moreover, this process
requires sterile operation. To solve these problems, Holtzapple et al. (2)
developed the MixAlco process (Fig. 1).
The MixAlco process converts any biodegradable material into mixed
alcohol fuels. The biomass is treated with lime to increase digestibility.
Then it is fermented with a mixed culture of acid-forming microorganisms
that degrade the major substrates (e.g., polysaccharides, proteins, and lip-
ids) to carboxylic acids under nonsterile, anaerobic conditions. To maintain
the pH, calcium carbonate is added, which reacts with the acid to form
carboxylate salts. The carboxylate salts can be converted to ketones, which
may be hydrogenated to alcohol fuels that are clean burning and do not add
net carbon dioxide to the environment (3,4).
Both high conversion and high product concentrations are possible by
using a countercurrent fermentation in which solid and liquid pass in op-
posite directions through a series of fermentors (Fig. 2). The countercurrent
flow arrangement is beneficial because the inhibitory effects of high prod-
uct concentration (in F1 in Fig. 2) is partially offset by the fresh, highly
reactive substrate, and the lower reaction rate of highly digested biomass
(in F4 in Fig. 2) is partially offset by a lower product concentration (3,4).
In mixed-culture acid fermentations, methane production can be
inhibited by methane analogs such as iodoform and bromoform (5-7) or the
coenzyme M analog, 2-bromoethanesulfonic acid (6,8,9). By inhibiting
methane, a potential hydrogen sink is eliminated and the reducing power
is used to produce higher carboxylic acids, such as butyric and caproic
acids (4-6).
Product Fresh
liquid liquid
Undigested
bioma s
Biomass feed consists of volatile solids (VS) and ash. Fig. 3 shows that
the biomass VS are converted into gaseous and liquid products, with some
remaining solid residues. In the liquid products, VS consist of carboxylic
acids and other components, extracellular proteins, and energy storage
polysaccharides (4). The following definitions are employed throughout
this article:
. ld _ total acids produced
Yle - VS field (1)
. VS digested
converSIOn = VS fed (2)
total acids produced
total acid selectivity = ---~-- (3)
VS digested
·d d .. _ total acids produced
tota1 aCl pro UCtiVlty - totall··d
lqUl vo1ume m . a11 fermentors . time
. (4)
ture content of treated bagasse was 0.070 g of water / g of wet bagasse, and
the average ash content was 0.140 g of ash/ g of dry bagasse. The treated
bagasse consisted of 0.S60 g of VS/ g of dry bagasse (0.651 g of carbohy-
drate/ g of dry bagasse, 0.029 g of crude protein/ g of dry bagasse, and 0.lS0
g of lignin/ g of dry bagasse).
Chicken manure was collected from the Poultry Science Center, Texas
A&M University, College Station, TX. The manure was air-dried and then
pretreated with 0.1 g of Ca(OH)z/ g of dry biomass at lOODC for 1 h. The
treated chicken manure consisted of 0.052 g of water / g of wet chicken
manure and 0.340 g of ash/ g of dry chicken manure. The average moisture
Medium
The liquid medium used in the bagasse I chicken manure system was
the modified Caldwell & Bryant (C&B) medium deoxygenated water,
which consists of a dry nutrient mixture in deoxygenated water at a concen-
tration of 1.4 g of dry nutrient mixturelL of deoxygenated water (11);
Deoxygenated water was prepared by boiling distilled water under a
nitrogen purge for 5 min. The medium was allowed to cool to room tem-
perature, and then 0.275 giL of cysteine hydrochloride and 0.275 giL of
sodium sulfide was added under a nitrogen purge. The medium solution
was stirred and poured into storage bottles with a nitrogen purge.
Dry nutrient mixture contained (g/100 g of mixture) K2HP04 (16.3),
KH2P04(16.3),(NH4)2S04(16.3),NaCl(32.6),MgS04·7H20(6.8),CaC12·2H20
(4.4), HEPES (0.86), hemin (0.71), nicotinamide (0.71), p-aminobenzoic acid
(0.71), Ca-pantothenate (0.71), folic acid (0.35), pyridoxal (0.35), riboflavin
(0.35), thiamine (0.34), cyanocobalamin (0.14), biotin (0.14), EDTA (0.35),
FeS04·7H20 (0.14), MnCl2(0.14), H 3B03 (0.021), CoCl2(0.014), ZnS04·7H20
(0.007), NaMo04 (0.0021), NiCl2 (0.0014), and CuCl2 (0.0007) (4).
Inoculum
Two primary sources of inoculum were used: terrestrial and marine.
The terrestrial source included the rumen fluid from a forage-fed fistula ted
steer located at the Meat Center, Department of Animal Science, Texas
A&M University, College Station, TX. In addition to rumen fluid, compost
from Dr. Mark Holtzapple's residence and swamp material from Wolf Pen
Creek, College Station, were used. They were collected in bottles filled with
deoxygenated medium, which consisted of distilled water, 0.275 giL of
sodium sulfide, and 0.275 giL of cysteine hydrochloride.
Another source was marine microorganisms, a salt-resistant inocu-
lum, from sediments at East Beach, Harborside Street, 51st Street, and
Sportsman Road on Galveston Island, TX. The sediment was collected from
O.5-m-deep holes and placed in bottles filled with deoxygenated medium,
which consisted of distilled water, 0.275 giL of sodium sulfide, and 0.275
giL of cysteine hydrochloride.
Inhibitors
The inhibitor in this experiment was iodoform (CHI3) prepared in a
solution containing 20 g of inhibitor IL of ethanol. The inhibitor was kept
in a tinted bottle. The cap was replaced immediately after use owing to light
and air sensitivity.
pH Control
To control the pH between 6.0 and 6.5, excess CaC03 was added to the
fermentors. In addition, as a nitrogen supplement, urea was added if the
pH was <6.5.
Fermentor
Figure 4 shows the assembled fermentor used in this research. The
fermentor was a 1-L polypropylene copolymer centrifuge bottle (98 x 169
mm),Nalgene brand NNI 3120-1010, 7100g maximum force. The centrifuge
bottle was placed on a Wheaton Modular Cell Production Roller Apparatus
(Model III). The apparatus, which was located in an incubator, consists of
rollers that rotated the fermentors horizontally at 1 rpm. The bottles were
capped with a size 11 rubber stopper with a glass tube inserted through it.
The glass tube was capped with a rubber septum for gas sampling and
release. The septum was replaced when there was a visible hole resulting
from frequent gas venting. Two pieces of 0.25-in. stainless steel tubing,
with ends welded shut, were inserted into holes in the stopper. The tubes
formed a stir bar to assist in mixing the components inside the bottle; thus,
this fermentor could use a high solids concentration. The fermentor could
not stand a pressure >2 atm (15 psig); above this pressure, it would leak or
explode if the gases were not released.
Experimental Procedure
Continuous countercurrent fermentations were performed in anaero-
bic fermentors at 40°C. The transfer process occurred every 1 or 2 d,
depending on the system. To maintain anaerobic conditions, a nitrogen
purge was used during transferring, or whenever the fermentors were open.
Two grams of calcium carbonate were added every 1 or 2 d to each fermen-
tor to neutralize the carboxylic acids.
Countercurrent fermentations were conducted at varying LRT and
VSLR, as described in Tables 1 and 2. The operating parameters for each
Applied Biochemistry and Biotechnology Vol. 105-708,2003
).
:g
~
0..
r")
'"o·
::l-
rt>
3
<n' Table 1
'<:
II>
'" Operating Parameters for Bagasse/Chicken Manure Countercurrent Fermentation with Terrestrial Inoculum
::,
0..
o· Fermentation train A B C D E F G H I J K L M
'"
<ii
r")
::l- LRT (d) 11.7 11.4 13.5 9.70 10.8 13.1 8.87 8.88 12.1 20.5 19.0 20.0 19.7
::,
Cl
VSLR
~
'<: (g VS/[L of liquid in all fermentors·d]) 10.1 10.3 17.9 11.2 14.4 10.1 10.9 7.36 3.81 2.13 2.00 4.82 6.54
VS feed to F1 at each transfer (g VS) 9.3 7.3 19.6 12.2 15.7 7.3 11.7 7.40 3.90 3.90 3.90 12.4 16.5
VI Liquid feed to F4 at each transfer (L) 0.1 0.08 0.15 0.15 0.15 0.08 0.15 0.15 0.10 0.10 0.15 0.15 0.15
N
<.0 Frequency of transfer" lid lid lid lid l/d lid lid l/d lid E2d E2d E2d E2d
Liquid volume in all fermentors (L) 0.920 0.708 1.10 1.10 1.04 0.728 1.08 1.00 1.02 0.916 0.976 1.28 1.26
Iodoform addition rate
(mg iodoform added to each
fermentor/L of liquid fed to F4) 16.0 20.0 10.7 5.3 10.7 20.0 10.7 10.7 24.0 24.0 16.0 10.7 10.7
Urea addition rate
(g urea added to each fermentor/L
of liquid fed to F4) (if pH < 6.5) 1.00 1.25 0.67 0.67 0.67 1.25 0.67 0.67 1.0 1.0 0.67 0.67 0.67
a1 I d, once a day; E 2 d, every 2 days.
6=
,....
a
I
a
-'"
,Co
I\.)
a
a
w
)..
:g
[
OJ
0'
3-
ro
3
;:n'
~ Table 2
OJ
;:,
0... Operating Parameters for Bagasse/Chicken Manure Countercurrent Fermentation with Marine and Terrestrial Inoculum
OJ
0'
fii Fermentation train N P Q R I J
3-
;:,
o LRT (d) 12.1 12.1 20.5 20.5 12.1 20.5
~
'<:: VSLR (g VS/[L of liquid in all fermentors·dD 3.83 3.84 2.13 2.13 3.81 2.13
Marine inoculum (wt%) 100 40 100 40 a a
Ul Terrestrial inoculum (wt%) a 60 a 60 100 100
W
o VS feed to F1 at each transfer (g VS) 3.9 3.9 3.9 3.9 3.9 3.9
Liquid feed to F4 at each transfer (L) 0.1 0.1 0.1 0.1 0.1 0.1
Frequency of transfer Daily Daily Every 2 d Every 2 d Daily Every 2 d
Liquid volume in all fermentors (L) 1.02 1.02 0.916 0.916 1.02 0.916
Iodoform addition rate (mg iodoform added 24.0 24.0 24.0 24.0 24.0 24.0
to each fermentor/L of liquid fed to F4)
Urea addition rate (g urea added to each 1.0 1.0 1.0 1.0 1.0 1.0
fermentor /L of liquid fed to F4) (if pH < 6.5)
c;::
;--
~
Cl
,C>:>
~
Cl
8
Carboxylic Acids from Sugarcane Bagasse 531
+. . . . . . . . . .
liquid
~
..
liquid
..
.. _... ............ ... .
liquid
..........................
liquid
.......................
: :
Collection Fre h
bottle medium
F3
" e(1-x) f
r pred = h (15)
1 + g{<I>Ae)
(16)
2.5 •
0
'>·E~ 2.0 •
="9
'8~
'"Ag= 1.5
'"C)
'~d
S~ 1.0 •
~ •
0.5
0.0
0 5 10 15 20
VSLR (g VS/(L liquid' d»
.ecn;a •
-
0.4
.~:>
UOJ)
• • •
..!:l:O
a) .....
0.3
• • ••
•
(/J~
0.2
S
B 0.1
~
0
0 5 10 15 20
VSLR (g VS/(L liquid' d»
0.1
0
0 5 ill ~ W
VSLR (g VS/(L liquid'd))
30
.-..
~
'-'
25
§
'l:) 20
!;l
~
u
15
Fig. 10. Total acid concentration for baggasse/ chicken manure fermentation with
different inoculum sources at LRT =12.1 d and VSLR =3.8 g/(L·d).
~ 25
= ~ 100 % marine
.g 20 l------------.~O<=..
~ .....~:-:::*:,.,..-~~~Ik:-'~'>E!II;l~1r
~§ 15 •
-V~!!inH
Mg ........... 11'""'-... A
......, .......... --
-....r,.- - 100% terrestrial 60% terrestrial
~ 10
'5 5
F:
O+---.---.---.---,---.---.--~
20 30 40 50 60 70 80 90
Time (days)
Fig. 11. Total acid concentration for baggasse/chicken manure fermentation with
different inoculum sources at LRT = 20.5 d and VSLR =2.13 g/(L·d).
inoculum had slightly higher acid productivity, selectivity, and yield than
fermentation trains P and R with a 40% marine + 60% terrestrial inoculum.
Conversion in fermentation trains I, N, and P were similar at LRT =12.1 d
and VSLR = 3.8 g/(L·d). However, conversion increased with increasing
percentage of marine inoculum at LRT = 20.5 d and VSLR = 2.13 gl (L·d).
The carboxylic acid produced in the fermentation is combined with cal-
cium carbonate and transformed to carboxylate salt. At high salt con-
centrations, the terrestrial microorganisms could not grow well compared
to the marine inoculum. Therefore, the fermentation with 100% marine
inoculum resulted in the highest acid productivity, yield, and acid selec-
tivity in this experiment.
Continuum Particle Distribution Modeling
The data from the batch fermentation at varying initial substrate con-
centrations can be found in Thanakoses (14). The values of e, f, g, and h for
Eq. 15 and selectivity used in the CPDM Mathematica program are given
in Table 5. Other parameters used in the CPDM Mathematica program are
presented in Table 6. From the Mathematica program, the predicted total
acid concentration and conversion for the countercurrent fermentation at
various LRT and VSLR were obtained. Figure 12 shows the CPDM "maps"
for the 80% bagasse/20% chicken manure fermentation system (solids con-
centration = 127 g of VS I [L of liquid]) with different inoculum sources. The
results indicated that the fermentation with marine inoculum yielded
higher acid concentration and conversion than the fermentation with ter-
restrial inoculum at any VSLR and LRT. Furthermore, the CPDM "map" for
fermentation with marine inoculum showed that 90% conversion is pos-
sible and that the carboxylic acid concentrations could reach 23.4 giL at a
VSLR of 2 gl (L·d) and LRT of 20.5 d.
~
~
in"
q-
'<:
III
::.
Cl..
tlJ
[
::.
o
& Table 5
'<:
The Values of e, f, g, h and Selectivity Used in CPDM Mathematica Program for Bagasse/Chicken Manure Fermentation
Inoculum Selectivity e f g h
V1
~ sources (g AJ g VS digested) (g AJ[g VS·d]) (dimensionless) (L/ g total acid)l/h (dimensionless)
.....
100% Terrestrial 0.512 0.069 2.60 0.003 2.57
40% Marine + 60% Terrestrial 0.675 0.156 2.80 0.015 1.99
100% Marine 0.752 0.153 2.55 0.047 1.38
~
~
-..
C
,QQ
§'"
542 Thanakoses et al.
Table 6
Average Parameter Constant Values for Bagasse/Chicken
Manure Fermentation with Terrestrial and Marine Inocula
Used in CPDM Mathematica Program
Parameter constant Value
Holdup (g liquid/g VS wet cake) 4.56 ± 0.828
Moisture (g liquid/ g wet solid) 0.066 ± 0.008
FI-F4 solids concentration (g VS/L) 127 ± 17.4
FI-F4liquid volume (L) 0.250 ± 0.062
<I> (g total acid/ g Ae) 0.815 ± 0.033
- - 100% marine
60
....... 40% marine + 60% terrestrial
,....,
t::! 50 - - - - 100% terrestrial
~
=
0
.;j 40
§
=
<1l
30
=
t)
0
t)
~ 20
<il
~ 10
0
0 0.2 0.4 0.6 0.8
Conversion
Expected conversion 0.343 0.342 0.220 0.347 0.278 0.325 0.368 0.484 0.641 0.722 0.741 0.581 0.366
(from Eq. 23)
Error (%)< -20.3 -24.3 -46.6 -9.8 1.6 -25.7 -4.3 -16.8 19.2 20.3 39.9 20.1 -11.2 20.0
~
:-
.... "Average = average absolute error.
bError = (predicted - experimental) x 100/experimental.
....c~ cError = (expected - experimental) x 100/experimental.
~
""....,cc
~
[
g.\Xl
::r-
3<;:;.
~
:;,
""Cl.. Table 8
\Xl Comparison of Experimental and Predicted Carboxylic Acid Concentration and Conversion
o· for Bagasse/Chicken Manure Fermentation with 40 and 100% Marine Inoculum
~
::r-
:;,
o 100% Marine inoculum 40% Marine + 60% terrestrial inoculum
~ Train N Train Q Average (%)" Train P Train R Average (%)"
Experimental carboxylic acid concentration (g/L) 16.2 19.7 14.0 18.8
U1
~ Predicted carboxylic acid concentration (g/L) 22.9 24.6 19.4 21.0
~
Error (%)b 41.3 24.9 33.1 38.6 11.7 25.2
Experimental conversion 0.538 0.760 0.556 0.695
Predicted conversion 0.809 0.917 0.769 0.876
Error (%)b 50.4 20.6 35.5 38.3 21.0 32.2
aAverage = average absolute error.
bError = (predicted - experimental) x 100/ experimental.
-~
,~
N
Cl
:::3
Carboxylic Acids from Sugarcane Bagasse 545
• Result data
- Best line fit
•
0.5
• ••
O+---r--~·~-F~L-.---.-on,--,
0.1 0.2 •0!3· 0.4 0.5 0.6 0.7
-0.5 •
Selectivity (g total acid/g VS digested)
Fig. 13. Correlation of error with selectivity for bagasse/ chicken manure counter-
current fermentation:
Figure 13 shows the error between the predicted conversion, x pred' and
the experimental conversion, x exp' as a function of selectivity. Linear regres-
sion of the data gives the correlation in Eq. 22.
X pred - xexp
error = x = 1.12s - 0.307 (22)
exp
Substituting Eq. 19 into Eq. 22 gives the correlation among VSLR, x pred'
and xexp:
(23)
Xexp = _0.0086 VSLR + 1.23
In Eq. 23, xexp may be interpreted as the "expected conversion." The
expected conversions for fermentation trains A-M are presented in Table 7.
The results indicate that the average expected conversion error from Eq. 23
(20.0%) was less than the average predicted conversion error from the CPDM
map (24.1%). Applying these corrections reduces the error in conversion
that was directly obtained from the CPDM model, in which the selectivity
was kept constant.
Conclusion
The 80% bagasse/20% chicken manure countercurrent fermentation
with terrestrial inoculum operated at LRT = 8.88 d and VSLR = 7.36 g/ (L of
liquid·d) had the highest acid productivity (2.5 g/[L·d]) with the highest
acid selectivity (0.581 g of acid/ g of VS digested) and highest yield (0.338
g of acid/ g of VS fed). The fermentation operated at a LRT = 20.5 d and a
VSLR = 2.13 g/(L of liquid·d) had the highest conversion (0.60 g of VS
digested/ g ofVS fed). Using marine inoculum, instead of terrestrial inocu-
lum, increased the total acid productivity, yield, and acid selectivity. CPDM
predicted the total acid concentration and conversion within 20.1 and 24.1 %,
respectively, of experimental results. By applying a correction for varying
selectivity, the experimental conversion could be predicted within 20%.
References
1. Klass, D. L. (1998), Biomass for Renewable Energy, Fuels, and Chemicals, Academic Press,
New York, NY, p. 150.
2. Holtzapple, M. T., Ross, M. K., Chang, N. S., Chang, V. S., Andelson, S. K., and Brazel,
C. (1997), in Fuels and Chemicals from Biomass, Saha, B. C. and Woodward, J., eds.,
American Chemical Society, Washington, DC, pp. 130-142.
3. Holtzapple, M. T., Davison, R R, Ross, M. K., Aldrett-Lee, S., Nagwani, M., Lee, C.
M., et al.. (1999), Appl. Biochem. Biotechnol. 77-79,609-631.
4. Ross, M. K. (1998), PhD thesis, Texas A&M University, College Station, TX.
5. Russell J. B. and Martin S. A. (1985), J. Anim. Sci. 59, 1329-1338.
6. Bauchop, T. (1967), J. Bacteriol. 94, 171-175.
7. Chapula, W. (1980), in Digestive Physiology and Metabolism in Ruminants, Ruckebusch,
Y. and Thivend, P., eds., MTP, London, UK, pp. 325-347.
8. Martin, S. A. and Macy J. M. (1985), J. Anim. Sci. 60,544-550.
9. Sauer, F. D. and Teather, R M. (1987), J. Dairy Sci. 70, 1835-1840.
10. Loescher, M. E. (1996), PhD thesis, Texas A&M University, College Station, TX.
11. Domke, S. B. (1999), PhD thesis, Texas A&M University, College Station, TX.
12. Playne, M. J. (1981), Adv. Biotechnol. 2, 85-90.
13. Chang, V.S.,Nagwani,M.,andHoltzapple,M. T. (1998), Appl. Biochem.Biotechnol. 74,
135-159.
14. Thanakoses, P. (2002), PhD thesis, Texas A&M University, College Station, TX.
15. South, C. Rand Lynd, L. R(1994), Appl. Biochem. Biotechnol. 45/46,467-481.
Abstract
A new approach for the utilization of hemicellulosic hydrolysate from
sugarcane bagasse is described. This approach consists of using the hydroly-
sate to dilute the conventional feedstock (sugarcane juice) to the usual sugar
concentration (150 giL) employed for the industrial production of ethanol.
The resulting sugar mixture was used as the substrate to evaluate the perfor-
mance of a continuous reactor incorporating a cell recycle module, operated
at several dilution rates. An induced flocculent pentose-fermenting yeast
strain was used for this bioconversion. Under the conditions used, the reactor
performance was satisfactory at substrate feed rates of 30 g/(L·h) or less,
corresponding to an ethanol productivity of about 11.0 gl (L· h) and an overall
sugar conversion >95%. These results show real advantages over the existing
alternatives for a better exploitation of surplus bagasse to increase industrial
alcohol production.
Index Entries: Sugarcane bagasse; sugar mixture; Pichia stipitis; floccula-
tion; ethanol.
Introduction
The main objective of the studies related to pentose fermentation is to
establish favorable process conditions, which can also be applied to hemi-
cellulosic hydrolysate obtained from agricultural residues. The prepara-
tion of this kind of hydrolysate often generates inhibitory components
(acetic acid, hydroxymethylfurfural), which have negative effects on the
fermentation process (1,2). Because the formation of these components
*Author to whom all correspondence and reprint requests should be addressed.
Sugarcane
1
--
Sugar cane juice Medium Preparation
Sugar extraction
Total sugars> 20%
• (Sucros9+glucos9+xylose)
1
(sucrose, hexose)
1
Lignin
Fig. 1. Flow chart for ethanol process by P. stipitis based on utilization of sugarcane
juice diluted with pentose stream from sugarcane bagasse.
Table 1
Substrate Characteristics"
Substrate Reducing Total Furfural Acetic acid
type sugars (giL) sugars(g/L) (giL) (giL)
Sugarcane juice 15.00 237.00 0.49
Bagasse hydrolysate 23.00 23.00 1.10 3.37
Sugarcane juice diluted 19.80 149.90 0.66 0.92
with bagasse hydrolysate
"Average values are given.
F+FR
VF
X
P Vs
TS
F F
TSo
Fig. 2. Schematic diagram of experimental system used in continuous fermentation
runs (VF = 0.221, Vs = 0.025 L; FR = recycle rate).
Fermentation Conditions
Fermentation runs were carried out in a simple column reactor fitted
with a separate settling device and working volume of 0.245 L. The fer-
mentation system utilized appropriate sensors to control the temperature
and pH, as shown schematically in Fig. 2. Continuous fermentation was
started by loading the reactor with substrate medium at a low sugar con-
centration and adjusting the control parameters (pH 5.0, temperature of
30°C, and airflow rate of 0.1 vvm). Then the reactor was inoculated with
cell suspension using five precultured conical flasks. A start-up period of
4-6 d was required to accumulate a working cell density (X> 80 giL, dry
wt), and for this purpose, the fermentation system was continuously fed
with substrate medium at increased sugar levels ranging from 50 to 150
giL. Several dilution rates (D = 0.1 to 0.4 h-1) were imposed in order to
determine the limit performance of the reactor for this specific substrate.
During the continuous runs, periodic samples were taken from the reac-
tor vessel for analysis of the relevant variables, such as sugar output,
biomass density, and product concentration. For each tested dilution rate,
the fermentation parameters were determined when the concentrations
within the reactor remained relatively constant over a period correspond-
ing to at least three residence times. For comparison, the reactor was also
run with pure sugarcane medium containing 150 giL of total sugars.
Analytical Procedures
The cell concentrations in the overflow were determined from a cali-
bration curve relating the optical density (600 nm) to cellular biomass. Cell
density in the reactor was directly determined by centrifuging 10 mL of
culture, resuspending cells in distilled water, recentrifuging, and then dry-
ing at 105°C to constant weight. The degree of flocculation, expressed as
60
~ 45
L::
o
~
~ 3
L::
8
5
TOlalre~
O+--r~--~~-r~--~~~O
0.0 0.1 0.2 0.3 0.4
Dilution rale' 1)(h)
Continuous Runs
The performance of the fermentation system was evaluated by plot-
ting ethanol productivity (Qp), residual sugar concentration (5), and prod-
uctconcentration (P) as a function of the dilution rate (D) (Fig. 3). An average
ethanol concentration of 56 giL was achieved at dilution rates ranging
from 0.12 to 0.4 h-1, which corresponded to ethanol productivities from 6.6
to 22.6 gl (L·h).
Table 4 shows that sugars metabolized as hexoses (sucrose and glu-
cose) were almost fully converted, while pentose (xylose) conversion
markedly decreased with the increase in dilution rate. Although both
sugars were consumed simultaneously, the hexose consumption rate by
P. stipitis was much higher than the pentose one. As a consequence, a
progressive loss of sugars in the output stream (as pentose) was observed
when the dilution rate increased. This is in agreement with findings that
xylose metabolism in P. stipitis is inhibited but not repressed by hexoses.
Thus, in our case, the rate of xylose fermentation was found to be the
limiting step of the process, and maximum dilution rate for effective con-
version was 0.20 h-1 • Increasing dilution rate above this level resulted in
a progressive loss of sugars, namely, pentose in the output stream.
No significant differences were observed in the apparent product
yield (Yp/s) throughout the continuous runs (Table 5), with an average
value of 0.39 gl g. Since most of the ethanol was produced from hexoses,
Table 3
Flocculent Properties of P. stipitis Using Sugarcane Juice
Diluted with Hemicellulose Hydrolysate
Characteristics Values
Sedimented cells in 5 min (%) 75
Flocculation velocity (cml s) 0.14
Specific rate of sedimentation (mLI g) 27.5
Washout resistant D = 0.4 1h-1 , X = 93.0 giL
Table 4
Influence of Substrate Feed Rate on Individual and Overall Sugar Conversion
Substrate Substrate Substrate
input (giL) output (giL) conversion (%)
o (h-1) Xyl Suc+Glu IS Xyl Suc+Glu IS Xyl Suc+ Glu Overall
0.12 18.5 129.2 147.7 4.9 0.3 5.2 73.5 99.7 96.5
0.14 13.8 139.1 152.9 5.9 0.6 6.5 57.2 96.6 95.7
0.20 11.4 141.9 152.4 4.9 0.5 5.4 57.0 99.6 96.4
0.37 20.2 131.0 151.2 7.4 0.5 7.9 62.0 99.7 94.7
0.41 15.1 141.3 156.4 10.1 0.7 10.8 33.1 99.5 93.1
aXyl, xylose; Sue, sucrose; Glu, glucose; IS, total sugar.
the average (Yp / s) value was unexpectedly lower than the one observed for
hexose-fermenting yeasts, such as S. cerevisiae (Yp/s = 0.45 g/ g) (20). This
suggests that there are distinct physiologic differences between pentose
and hexose yeasts.
Applied Biochemistry and Biotechnology Vol. 105-108, 2003
554 de Castro et al.
Table 5
Performance of Bioreactor Characteristics
on Different Substrates Using Pichia stipitis
Substrate type
Reactor Sugarcane Sugarcane juice diluted
parameters juicea with pentose stream
Dilution rate (h-1) 0.36 0.37
Substrate input (giL) 147.9 151.2
Residual sugars (giL) 3.3 7.9
Product (giL) 59.9 55.9
Biomass (giL) 90.0 94.7
Sugar conversion rate (%) 97.8 94.7
Y p/ s (gig) 0.41 0.39
Qp (g/L·h) 21.6 20.7
f.tp(g/g·h) 0.24 0.22
DSo (g/[L·hD 53.2 55.9
aData obtained using the same reactor system running on sugarcane medium.
Conclusions
Research and development studies of alcohol fermentation technol-
ogy have been conducted over the last two decades to make alcohol pro-
duction more efficient. In this context, there are clear advantages in using
surplus bagasse from ethanol plants as a raw material for the same end
product. Alcohol fermentation of pentose has become an attractive research
topic and publications are numerous. In principle, biochemical and micro-
biologic problems, such as finding strains and establishing the somewhat
unusual (e.g., semiaerobic) optimal conditions, have been solved at a labo-
ratory-research leveL However, so far, a suitable process technology has
not been established.
Given our background in developing very effective ethanol technol-
ogy based on disaccharide feedstock (19,20), it would be logical to con-
tinue this research program using pentose feedstocks. The present study
investigated the feasibility of using hemicellulosic hydrolysate to dilute
the conventional raw material (sugarcane juice) to a standard sugar con-
centration employed for the industrial production of ethanoL Under the
conditions used here, the reactor performance was satisfactory at sub-
strate feed rates of 30 g/ (L·h) or less, corresponding to an ethanol produc-
tivity of about 11.0 g/ (L·h) and an overall sugar conversion >95%. On a
laboratory scale, this process has shown to be an attractive alternative for
utilization of the bagasse generated by the ethanol plants. Moreover, this
process has the potential to attain high ethanol levels; avoid treatment for
removing inhibitory compounds normally found in the hemicellulosic
acid hydrolysate; decrease the addition of microbial nutrients; and require
Acknowledgments
We thank Maria Eunice M. Coelho for revising the manuscript. We
also gratefully acknowledge Conselho Nacional de Desenvolvimento
Cientffico e Tecnol6gico (CNPq) for financial support.
References
1. Olsson,1. and Hahn-Hagerdal, B. (1996), Enzyme Microb. Technol. 18, 312-33l.
2. Clark, T. and Mackie, K 1. (1984), J. Chem. Biotechnol. 34B, 101-110.
3. Palmqvist, E., Hahn-Hagerdal, B., Szengyel, Z., Zacchi, G., and Rczey, K (1997),
Enzyme Microb. Technol. 20,286-293.
4. Silva, S. 5., Ribeiro, J. D., Felipe, M. G., and Vitolo, M. (1997), Appl. Biochem. Biotechnol.
63/65,557-564.
5. Parekh,S., Parekh, R, and Wayman, M. (1987), Process Biochem. 22, 86--9l.
6. de Castro, H. F., Castro, 1. A B., and Nunes, A 1. 1. (1989), in Biomass for Energy and
Industry, vol. 2, Grassi, G., Gosse, G., and dos Santos, G., eds., Elsevier Applied
Science, London, UK, pp. 2318-2322.
7. de Castro, H. F. and Oliveira, P. C. (1998), Revista Microbiologia 29, 27-30.
8. Nelson, N. A (1944), J. Bioi. Chem. 153,357-380.
9. Roberto, I. c., Mancilha, I. M., Felipe, M. G. A, Silva, S. 5., and Sato, S. (1994), Arq. Bioi.
Tecnol. 37,55-63.
10. Calleja, G. B. (1987), in The Yeasts, vol 2, Rose, A H. and Harrison, J. S. , eds.,
Academic Press, New York, NY, pp.165-20l.
11. Stratford, M. (1996), Cerevisiae 1, 38-45.
12. Grenshields, R N. and Smith, E. 1. (1974), Process Biochem. 9,11-28.
13. Jones, S. T., Korus, R. A, Admassu, W., and Heimsch, R C. (1984) Biotechnol. Bioeng.
26,742-747.
14. Weeb, S. R. and Lee, H. (1990), Biotechnol. Adv. 8,685-697.
15. Chung, I. S. and Lee, Y.Y. (1986), Biotechnol. Bioeng. Symp. 17,391-400.
16. Pereira Jr., N. and Bu'Lock, J. D. (1993), Revista Microbiologia 24, 132-139.
17. Groo~en, D. R J., Vleesenbeek, R, Windmeijer, M. G. A, van der Lans, R G. J. M.,
and Luyben, KC.A M. (1991), Enzyme Microb. Technol. 13,734-739.
18. Denverell, K F. and Clark, T. A (1985), Biotechnol. Bioeng. 27, 1608-161l.
19. Paiva, T. C. B., 5ato, 5., Visconti, A E. 5., and Castro, 1. A B. (1996), Appl. Biochem.
Biotechnol. 57/58, 535-54l.
20. Oliveira,S. c., Paiva, T. C. B., Visconti, A E. 5., and Giudici, R. (1999), Appl. Biochem.
Biotechnol. 74(3),161-172.
Hydrogen Production
from Paper Sludge Hydrolysate
Abstract
The main objective of this study was to develop a system for the produc-
tion of "renewable" hydrogen. Paper sludge is a solid industrial waste
yielding mainly cellulose, which can be used, after hydrolysis, as a feed-
stock in anaerobic fermentation by (hyper)thermophilic organisms, such as
Thermotoga elfii and Caldicellulosiruptor saccharolyticus. Tests on different
medium compositions showed that both bacteria were able to produce
hydrogen from paper sludge hydrolysate, but the amount of produced
hydrogen and the requirement for other components differed. Hydrogen
production by T. elfii strongly depended on the presence of yeast extract
and salts. By contrast, C. saccharolyticus was less dependent on medium
components but seemed to be inhibited by a component present in the
sludge hydrolysate. Utilization of xylose was preferred over glucose by
C. saccharolyticus.
Introduction
The Earth's climate has changed because of human activities. Since
the beginning of the industrial revolution, atmospheric concentrations of
the greenhouse gases-carbon dioxide, ~ethane, and nitrous oxide-
have increased continuously. Transportation specifically contributes to
global warming through the burning of gasoline and diesel produced
from fossil feedstock. The use of noncarbonaceous fuels, produced from
*Author to whom all correspondence and reprint requests should be addressed.
Preparation of Hydrolysate
As carbon and energy source, glucose or paper sludge hydrolysate
was used. The paper sludge (generally 45% carbohydrate content based
on dry matter; dry matter content is 60%) originated from Dunapack Pulp
and Paper Mill, Dunapack Paper and Packagings, Hungary. Large-scale
hydrolysis was performed at a substrate concentration of 4% (w Iv) in a
pH- and temperature-controlled 31-L Braun fermentor. The paper sludge
was suspended in water and the pH was set to 4.8 by the addition of
concentrated H 2S04 , The slurry was sterilized at 121°C for 20 min. After
cooling the mixture to 50°C, 15 filter paper units (FPU) I g of dry matter
(DM) of Celluclast 1.5L and 15 IU I g of DM of Novozym 188 were added
to hydrolyze the cellulose. The final paper sludge hydrolysate contained
12.8 giL of glucose and 2.4 giL of xylose after 48 h of hydrolysis. The
hydrolysate was pretreated by mixing with 3-morpholinopropane sul-
fonic acid (MOPS) (10 mM) or phosphate buffer (the concentrations of
phosphates were the same as used in the culture media) to a final pH of
7.2, and cleared by centrifugation (10 min, 13,200g) prior to the addition
of other components.
Fermentation Assays
Cultures were grown in duplicate in anaerobic 100-mL serum bottles
with 30-mL volumes. Active cultures for inoculation were prepared by
growing T. elfii and C. saccharolyticus for 72 h at 65°C and 24 h at 70°C,
respectively.
Applied Biochemistry and Biotechnology Vol. 105-108,2003
560 Kadar et at.
Paper sludge hydrolysate was diluted to initial glucose and xylose
concentrations of 9.2 and 1.9 giL, respectively. The flasks were incubated
under different temperatures: 65°C for T. elfii and 70°C for C. saccharolyticus.
Flasks were periodically sampled during fermentation for determina-
tion of hydrogen production, soluble sugar and organic acid contents,
optical density, and pH.
Analytical Procedures
The optical densities of the cultures were determined at 5BO nm on an
Ultrospec 2000 Spectrophotometer.
Glucose, xylose, and organic acids were analyzed by high-perfor-
mance liquid chromatography with differential refractometry detection
and a Shodex ionpack KCBll column at BO°C. H 2S04 (3 mM ) was used as
eluent at a flow rate of 1 mL/min. The samples were 1:1 diluted in 1 M
H 2S04 with 250 mM propionic acid, as the internal standard, and filtered
through a 0.45-!!m filter prior to injection.
Hydrogen was determined by gas chromatography with thermal con-
ductivity detection and an RVS MolSieve SA, 60lBO mesh, 3 m x 0.125-in.
column at 50°C. The temperature of the detector and the injector were tOO
and BO°C, respectively. N2 was used as carrier gas.
Statistical analyses were done using MINITAB software.
Results
Effect of Phosphate and MOPS Buffer
In the paper sludge, the main mineral components are typically kaolin
and CaC03 (used for coating and/ or as filler) and Ti02(used for whitening)
(6). When paper sludge hydrolysate was mixed with the culture medium
used for growth of the microorganisms, probably precipitation of Ca-phos-
phate occurred. To avoid this precipitation, phosphate buffer was added
first and the pH was adjusted to 7.2. After centrifugation, the other medium
components were added to the clarified supernatant and no further pre-
cipitation occurred. In a control experiment, MOPS was used to replace the
phosphate buffer.
As can be seen from Table 1, hydrogen was produced from paper
sludge hydrolysate by T. elfii and C. saccharolyticus. Replacement of phos-
phate by MOPS buffer had no effect on glucose consumption or on hydro-
gen and acetate production. During fermentation, the pH decreased
continuously to 5.2. Although both T. elfii and C. saccharolyticus seemed to
grow well without supplementation with phosphate, in further experi-
ments the hydrolysate was always pretreated with phosphate buffer and
the precipitate was removed prior to fermentation.
Effect of Medium Composition
The medium components required for optimal hydrogen production
by T. elfii and C. saccharolyticus on paper sludge hydrolysate were studied.
T. elfii C. saccharolyticus
Glucose H2 Acetate Glucose H2 Acetate
Medium (mM) (mM) (mM) (mM) (mM) (mM)
Table 2
Scheme for Addition of Salts, Yeast Extract, and Trace Elements
to Media Used for Growth of T. elfii and C. saccharolyticus'
35
o
25
20
::s:
E 15
.-
- -
10
...
I- I- i--
. • • 1l-
5 - - - fo-
n
I--
o
Sic pos psh pos - Le. - ailS - all . le. - ye. - y.c.. I.e - y.e.. - y.c..
conI conI sailS salIs. le.
In the absence of all salts (except cysteine-HCl and resazurin) and plus or
minus trace elements, hydrogen production was lower. This is not surpris-
ing since T. elfii is known as a halophilic bacterium. However, it is surpris-
ing that hydrogen production decreased while glucose consumption and
acetate production remained the same. Other experiments showed that
when either NaCl or the other salts were added to this medium, hydrogen
production was partly restored but still lower compared to the complete
paper sludge hydrolysate medium (results not shown). The omission of
yeast extract had the greatest effect. Hydrogen production in cultures with-
out yeast extract was much lower or absent when salts were also omitted.
In the latter cultures, glucose concentration decreased even though no
products were detected. At present, it is unclear whether this is owing to
Maillard reactions or other nonspecific reactions. Maillard reactions have
been observed before but are hardly reproducible and difficult to quantify.
Lactate was only produced in paper sludge hydrolysate based medium
enriched with yeast extract.
The results were supported by statistical calculations (Fig. 2). Supple-
mentation of the medium with either yeast extract or salts had the greatest
effect, and trace elements were practically without any influence. The
effects of these variables on hydrogen production were independent.
A similar experiment was performed with C. saccharolyticus. The
results are shown in Fig. 3. Hydrogen production in the control culture on
glucose was comparable with hydrogen production on glucose by T. elfii.
However, the production of hydrogen by C. saccharolyticus on paper sludge
hydrolysate supplemented with all medium components was much lower
than the positive control on glucose. In contrast to T. elfti, both glucose and
19
16
10
35.0
30.0
25.0
20.0
:E
E
15.0 10.-
10.0 - f- - f- - f-
5.0 - - - - - - - -
f ~ tf
f-- f-
0.0 I ~I ~I ~I ~
'.
:I l:r
glc pos xyl po psb pos - c. - salts - salts, - y.. - y.c ., - y.c .. - y . ..
coni conI COOl l.c . I.c. . Its saJts.
I.c .
• •
0 20 40 60 80 100
time (h)
Discussion
There is an abundance (50,000 t annually in Hungary) of paper sludge
(industrial byproduct) with high carbohydrate content, which, after enzy-
matic hydrolysis, could be a substrate for hydrogen fermentation. T. elfii
and C. saccharolyticus have been identified as extremely thermophilic micro-
organisms able to convert sugars to hydrogen, carbon dioxide, and organic
acids. Therefore, the growth of these two bacteria on paper sludge hydroly-
sate was studied.
Both T. elfii and C. saccharolyticus could grow and produce hydrogen
on paper sludge hydrolysate, but the levels of hydrogen production and
the medium requirements for optimal hydrogen production differed.
T. elfii produced a high amount of hydrogen, but needed yeast extract to do
so. Moreover, because it is a halophilic bacterium, 1% NaCl was required.
C. saccharolyticus seemed to be less dependent on additional medium com-
ponents, since the hydrogen production was not stimulated by the addition
of yeast extract, salts, or trace elements to paper sludge hydrolysate. In
contrast to T. elfii, hydrogen production by C. saccharolyticus seemed to be
Acknowledgments
This study was financially supported by the Commission of the Euro-
pean Communities, Quality of Life and Management of Living Resources
(project no. QLK5-1999-01267), the Netherlands Organisation for Interna-
tional Cooperation in Higher Education (Huygens Programme), and the
Dutch EET Programme.
References
1. Claassen, P. A. M., van Lier, J. B., Lopez Contreras, A. M., van Niel, E. W. J., Sijtsma,
L., Starns, A. J. M., de Vries, S. 5., and Weusthuis, R. A. (1999), Appl. Microbiol.
Biotechnol. 52,741-755.
2. Dunapack Paper and Packagings Ltd. (2000), Environmental Report 2000, Mikl6s
Galli, Dunapack Ltd., Hungary.
Abstract
Korean food waste was treated with a single-stage anaerobic codigester
(SSAD) using waste activated sludge (WAS) generated from a municipal
wastewater treatment plant. The stability and performance of the system
was analyzed. The C/N ratio was improved with increasing food waste
fraction of feed mixture. The pH, alkalinity, and free ammonia nitrogen
concentration were the parameters used to evaluate the digester's stability.
The experimentally determined values of the parameters indicated that there
were no methane inhibitions in the digester. Digester performance was
determined by measuring the total chemical oxygen demand TCOD), volate
solids (VS) removal, methane content in biogas, methane production rate
(MPR), and specific methane productivity. Methane content in biogas and
MPR were significantly dependent on hydraulic retention time (HRT) and
ratio of food waste to WAS. The methane content in biogas decreased at
shorter HRT or higher organic loading rate (OLR) with increased food waste
fraction. Concerning the performance of the codigester, the optimum oper-
ating condition of the SSAD was found to be at an HRT of 10 d with a feed
mixture ratio of 50% food waste and 50% WAS. A TCOD removal efficiency
of 53.6% and a VS removal efficiency of 53.7% were obtained at an OLR of
5.96kgofTCOD/(m3·d)and3.14kgofVS/(m3·d),respectively.Amaximum
MPR of 1.15 m3 CH4/(m3·d) and an SMP of 0.37 m 3 CH4/kg of VSfeed were
obtained at an HRT of 10 d with a methane content of 63%.
Introduction
In 2000, Korea generated about 46,438 tid of municipal solid waste
(MSW). Korean food waste (KFW) constitutes approx 25% of MSW (1). Most
of the food waste is disposed by landfill (45.4%) and incineration (9.5%), and
the rest is recycled as feedstuff, composting, or anaerobic digestion (1). Food
waste is difficult to treat or recycle because it contains high levels of sodium
salt and moisture and is mixed with other collected wastes (2,3). In 2005,
landfilling of food waste, which causes various problems such as a foul odor
and ground and surface contamination by leachate, will be prohibited.
Therefore, for KFW, anaerobic digestion has been considered as a fea-
sible alternative to reduce waste volume and recover renewable energy as
methane. Presorted KFW with 15-30% of total solid (TS) has a high volatile
solid (VS) content (88-92% of TS), and the methane potential of KFW is
estimated to be about 0.44-0.47 m 3 of CH4/kg ofVSfeed (4,5). A characteristic
of food waste that contains highly soluble organics is that it is converted
rapidly to volatile fatty acids (VFA) in the early stage of digestion. A drastic
drop in pH corresponding to VFA accumulation may lead to irreversible
acidification of the digester, owing to poor buffering capacity (4-6). There-
fore, anaerobic digestion is often a two-phase system in order to separate
acid and methane-forming phases (4,5,7).
One of the most interesting options for improving biogas yield and
reducing the volume of organic solid wastes is anaerobic codigestion, i.e.,
codigestion of the organic fraction of municipal solid wastes (OFMSW)
together with sewage sludge (8-12). Cecchi et a1. (13) and Mata-Alvarez et a1.
(14) described the codigestion of OFMSW with sewage sludge in existing
digesters and the advantages of codigestion. The advantages include dilu-
tion of potential toxic compounds coming from wastewater or cosubstrate,
improved balance of nutrients, synergistic effects of microorganisms,
increased organic loading of biodegradable matter, and better methane gas
yields per unit of digester volume. In addition, using existing anaerobic
digesters to treat OFMSW together with sewage sludge in municipal waste-
water treatment plants could reduce capital and operating costs (15-19).
In Korean municipal wastewater treatment plants, the existing anaero-
bic digesters conventionally are two-stage anaerobic digesters operated at
mesophilic temperature (33-37°C); they do not operate properly because
the actual loading rate is much less than the design loading rate. Therefore,
using the extra capacity by adding OFMSW to existing municipal waste-
water treatment plants anaerobic digesters may be a good alternative,
especially for treating KFW and it may be possible to enhance the operating
efficiency of anaerobic digesters. The present study was performed in a
single-stage anaerobic codigester (SSAD) at 35°C, with feed mixture ratios
of simulated KFW (SKFW):WAS of 10:90, 30:70, and 50:50. The objectives
~ Table 1
3 Chemical Characteristics and Elemental Analysis
ii;' of Inoculum, SKFW, WAS, and Three Feed Mixtures·
q-
'<:
~
::J Feed Mixtures (g SKFW : g WAS)
Q..
0;)
0' Inoculum SKFW WAS 10:90 30:70 50:50
~
::J TCOD (giL) 23.8 100 (10) 36 (2.0) 44.3 (1.0) 45.4 (1.39) 58.5 (2.17)
o
~ SCOD (giL) 0.31 43.0 (3.8) 0.3 (0.2) 2.77 (0.51) 4.01 (0.93) 10.8 (0.77)
'<:
TS (giL) 21.7 80.0 (5.0) 30 (1.0) 31.6 (0.40) 33.1 (0.70) 37.6 (1.10)
VS (giL) 14.2 75.0 (5.0) 18.5 (0.5) 23.7 (0.60) 26.0 (0.60) 31.4 (0.90)
U1 pH 7.4 4.50 (0.5) 6.8 (2.0) 6.08 (0.15) 5.26 (0.24) 4.09 (0.26)
o Alkalinity as CaCO (giL) 3.65 0.15 (0.1) 0.8 (0.2) 0.95 (0.13) 0.51 (0.13)
" NH4+ (giL) 0.81 0.29 (0.1) 0.03 (0.01) 0.16 (0.04) 0.12 (0.04) 0.16 (0.02)
VFA (g/L)b 0 0.75 (0.15) 0 0.37 (0.13) 0.53 (0.32) 0.68 (0.16)
Elemental analysis (% TS)
C 45.76 30.05 30.92 34.02 36.43
H 6.68 5.10 3.4 4.22 5.21
0 38.80 20.94 24.55 25.55 29.09
N 2.84 5.03 4.44 4.34 4.13
S 0.24 0.97 0.94 0.89 0.78
C/N ratio 16.11 5.97 6.97 7.84 8.82
~
:-
• Numbers in parenthesis are the SD about the mean.
b VFAs: C 2-C 6 •
-~
~
to..>
§
Use of SSAO for Mixture Wastes of SKFWaste and WAS 571
Analytical Methods
The pH and temperature were monitored. Chemical oxygen demand
(COD), TS, VS, alkalinity, and NH/ of the samples were determined
according to standard methods (APHA, AWW A & WEF, 1998) and were
analyzed three times per wk during the start-up. In particular, the sample
for the analysis of soluble chemical oxygen demand (SCOD), NH4 +, and
VFA was prepared by filtration using a 0.45-f.-tm cellulose acetate mem-
brane after centrifugating at 15,000 rpm for 15 min. Elemental composi-
tion of the sample was analyzed with an elemental analyzer (CHN-1000;
Leco) and a sulfur analyzer (SC-432DR; Leco).
The percentage of methane and carbon dioxide was analyzed using a
gas chromatograph (HP-5890A GC) eqUipped with a thermal conductivity
detector and a 6-ft stainless column packed with Hayesep Q (80/100 mesh).
The injection and detector temperatures were 120 and 150°C, respectively,
and the column oven operated isothermally at 60°C. Helium was used as
the carrier gas at a flow rate of 30 mL/min. The concentration of VFA was
determined using the same gas chromatograph equipped with a flame
ionization detector and a capillary column (25 m x 0.2 mm x 0.33-f.-tm;
Hewlett Packard-FFAP), with helium as the carrier gas (flow rate of 0.8
mL/min). The injection and detector temperatures were 200 and 220°C,
respectively. The initial temperature of the column oven was 80°C and
increased gradually by 13°C/min, reaching a final temperature of 180°C.
~
'0
1:
..... 3
0 en
>
I-
Jf2
ci
....l
0
0
10 13 16 20 10 13 16 20
HRT, day. HRT, days
Fig. 1. OLRs of SSAD at different HRTs: (A) TeOD basis; (B) VS basis.
40 20
III 10' 90 • 30:70 .. 50:50 A III 10'90 • 30'70 • 50"50 B
30 IS
~
ci ~
§ 20 ell
> 10
.,
C
...:::>
C :::>
E
E 10 ~ 5
~
0 0
10 13 16 20 10 13 16 20
HRT, days HRT, clay
Fig. 2. Effluent TeOD and VS concentrations from SSAD at different HRTs: (A)
TeOD; (B) VS.
Figure 1 presents the organic loading rate (OLR) expressed as total COD
(TCOD) and VS on three feed mixtures as the function of HRT. The OLR was
gradually increased as the HRT became shorter or the SKFW fraction of the
feed mixture increased. Figure 2 shows the TCOD and VS concentration of
the effluent; and the levels were nearly similar without the effect of HRT.
However, the effluent VS concentration in the mixture ratio of 50:50 feed was
the lowest compared with the other feed mixture, in spite of the higher OLR
and shorter HRT. This was owing to the high biodegradability of SKFW.
74 0-
~ 42
::r: 7.3
U
Cl. ~
.~ 3.8
72
"
~
-'" 3.4
7. 1
~
7 3 .......................
10 13 16 20 10 13 16 20
HRT, doy. HRT. dsJ
Fig. 3. pHs and alkalinities of SSAD at different HRTs: (A) pH; (B) alkalinity.
15 50
I!l 10:90 . 30.70 . 50:50 A Ell 10:90 . 30.70 . 5050 B
1.2 40
..J
~ Ob
E 30
C 0.9
.2 .;
E 'c0
'"" ..E
0.6 E 20
0
E
E ~
-< 0.3 "- to
0 0
10 13 16 20 10 13 16 20
IIRT, doy. IIRT, days
Fig. 4. Ammonium ion and FAN concentrations of SSAD at different HRTs: (A)
ammonium ion; (B) FAN.
7 0 r - - -- - - - - - - - - - - -__~ 70 r-----------------~
60 EI 1090 D 30.70 • 50,50 A 60 III 10:90 • 30:70 • 50:50 B
50
!jo!
e; 40
~~ 30
C
8I- 20
10
o
10 13 16 20 10 13 16 20
HRT, cia" II RT, dB,..
Fig. 5. TCOD and VS removals of SSAD at different HRTs: (A) TCOD; (B) VS.
HRT on three feed mixtures. The ammonia nitrogen, which is formed by the
anaerobic biodegradation of organic nitrogenous compounds such as pro-
teins or amino acids, significantly affects methanogenic activity. The inor-
ganic nitrogen produced, the ammonium ion, and FAN exist in two forms
in the liquid phase. In particular, because the FAN concentration depends
on pH, it is important to control the pH of an operating digester. Braun
et al. (24) and Bhattacharya and Parkin (25) suggested that the maximum
tolerable FAN concentration is 55-80 mg/L for a stable digestion. Lay et al.
(23) investigated the influence of ammonia nitrogen on methanogenic
activity in the wide pH range of 6.5-8.5. The methanogenic activity
decreased with increasing NH/ concentration and dropped 10% at a con-
centration of 1670-3720 mg/L, 50% at 4090-5550 mg/L, and 0 at 5880-6600
mg/L. In the present study, at an HRT of 20 d with a 50:50 feed mixture, the
ammonium ion concentration was the highest at 1160 mg/L, and the FAN
concentration was 37 mg/L as a function of pH 7.5 at 35°C. Therefore, the
FAN concentration was estimated to be below the concentration that inhib-
its the methanogenic activity mentioned in the literature. The FAN concen-
tration was calculated using Eq.1, presented by Kayhanian (26) as a function
of pH at 35°C. Judging from the stability parameters of an SSAD, there was
no inhibition of methane production owing to pH drop, insufficient alka-
linity, or inhibition by FAN for all the experiments.
TAN x (Ka + lHJ)
NH3(mg/L) = (Ka + [H]) + 1 (1)
in which NH3 is the free ammonia nitrogen concentration (mg/L), TAN is
the total ammonia concentration in solution including ammonium and free
ammonia (mg/L), [H] is the hydrogen ion concentration (lO-pH), Ka is the
temperature-dependent dissociation constant (1.097 x 10-9 at 35°C).
Performance of SSAD System
Figure 5 presents the TCOD and VS removal efficiencies of SSAD as
a function of HRT on three feed mixtures. For the TCOD and VS removal
Applied Biochemistry and Biotechnology Vol. 105-108,2003
Use of SSAD for Mixture Wastes of SKFWaste and WAS 575
0.9
~
...8x 0.8
....'"c:
~
c: 0.7
8
GI
c:
(\I
oSGI 0.6
~
0.5
0 30 60 90 120 150
Operating time, days
efficiencies, the trend was similar and slightly increased as the HRT
became longer for the same feed mixture. However, the magnitude of the
TCOD and VS removal efficiencies was remarkably different among
the three feed mixtures at the same HRT. Therefore, it became clear that
the TCOD and VS removal efficiencies were more affected by the SKFW
fraction of the feed mixture than the influence of the HRT; that is, their
removal efficiencies depended on the biodegradability of the feed mix-
ture. Among three feed mixtures, the TCOD and VS removal efficiencies
were the highest at a feed mixture of 50:50. The maximum TCOD removal
of 57.9% and VS removal of 56.3% were achieved when the digester was
operated at an HRT of 20 d with an OLR of 2.98 kg of TCOD / (m3·d) and
1.61 kg ofVS/(m3 ·d), respectively. Even at a shorter HRT of 10 d with an
OLR of 5.96 kg of TCOD/(m3·d) and 3.14 kg of VS/(m3 ·d), the TCOD
removal was 53.6% and VS removal was 53.7%. These results are compa-
rable to previous research for the anaerobic codigestion of OFMSW and
sewage sludge. Mata-Alvarez et al. (14) investigated the mesophilic (35°C)
anaerobic codigestion of the mixture of 50% OFMSW and 50% sewage
sludge. They reported that VS removal was 57% at an HRT of 14.5 d with
an OLR of 2.8 kg of VS/(m3·d). Del Borghi et al. (11) investigated the
thermophilic (55°C) anaerobic codigestion of a mixture of 50% OFMSW
and 50% sewage sludge. The VS removal was 64% at an HRT of 12 d with
an OLR of 4.0 kg of VS/(m3 ·d).
Figure 6 shows the methane percentage in the biogas. The methane
content of biogas produced from all digesters was higher than the usual
values of 60% and had significant differences among three feed mixtures.
Applied Biochemistry and Biotechnology Vol. 105-108,2003
576 Heo et al.
1.5 ,.-----_ _ _ _ _ _ _ _----, 05 ,.-----_ _ _ _ _ _ _ _----,
o o
10 13 16 20
Fig. 7. MPRs and SMPs of SSAD at different HRTs: (A) MPR; (B) SMP.
Reactor characteristics
TCOD (giL) 26.4 27.2 27.6 28.7 25.1 26.5 27.4 28.0 25.1 25.8 27.0 27.7
U1
'.J SCOD (giL) 0.89 0.85 0.85 0.85 0.72 0.75 0.79 0.79 0.74 0.81 0.76 0.76
'.J 22.7 22.8 23.5 21.9 22.9 23.0 23.4 20.6 20.8 20.7 20.8
TS (giL) 22.1
VS (giL) 14.6 15.3 15.6 16.1 14.6 15.1 15.2 15.7 13.7 14.0 14.2 14.5
pH 7.45 7.37 7.29 7.19 7.51 7.48 7.41 7.38 7.48 7.42 7.40 7.37
Alkalinity as CaC03 (giL) 3.54 3.4 3.28 3.11 4.04 3.95 3.91 3.74 4.91 4.75 4.64 4.37
NH4-N (giL) 0.76 0.74 0.72 0.68 0.93 0.91 0.91 0.89 1.16 1.14 1.09 1.01
VFAs (giL) 0 0 0 0 0 0 0 0 0 0 0 0
Digester performance
TCOD removal (%) 39.1 37.2 36.4 33.9 49.5 45.8 44 42.8 57.9 56.7 54.7 53.6
TVS removal (%) 38.6 36.5 36.1 33.9 43.9 41.1 40.0 38.0 56.3 55.3 54.8 53.7
~
:- Methane content (%) 85.7 82.6 78.5 76.5 80.2 77.0 72.5 70.4 69.4 66.8 64.5 63.3
....
<::> SMP, m 3 CH4/kg TVS feed 0.194 0.192 0.218 0.202 0.23 0.228 0.235 0.232 0.339 0.359 0.375 0.366
1"
.... MPR, m 3 CH4 1(m3 ·d) 0.230 0.286 0.4 0.48 0.298 0.356 0.471 0.601 0.532 0.708 0.907 1.150
<::>
,0:>
N
<::>
8
578 Heo et al.
of SSAD to treat the mixture wastes of SKFW and WAS. The data pre-
sented are the mean values at the steady-state condition.
Conclusion
The effects of HRT and mixture ratio of SKFW:WAS on the stability
and performance of the SSAD were investigated. The SSAD was quite
efficient for treating KFW.
Maintaining the proper pH in the digester is important to keep the
FAN concentration, a strong inhibitor, low. The digester pH was main-
tained within the stable range of 7.2-7.5 with sufficient alkalinity ranging
from 3.1 to 4.91 giL as CaC03• In addition, the accumulation of VFA was
not observed in all experiments after reaching the first steady state. Under
the investigated operating conditions, there were no inhibitions of the
methanogenic activity in the digester.
The optimum operating conditions of the SSAD, concerning the MPR
and SMP, was found to be at an HRT of 10 d with a feed mixture ratio of
50% WAS and 50% SKFW. The TCOD removal efficiency of 53.6% and VS
removal efficiency of 53.7% were obtained at the highest OLR of 5.96 kg of
TCOD/(m 3·d) and 3.14 kg ofVS/(m3·d),respectively. ThemaximumMPR
of 1.15 m 3 of CH 41(m3·d) and SMP of 0.37 m 3 of CH4/kg of VSfeed with the
methane content of 63% were obtained at an HRT of 10 d. Therefore, the
optimum operating conditions in the SSAD, and the corresponding per-
formance of the digester indicate that the anaerobic codigestion of KFW
with sewage sludge is a good option for food waste and WAS treatment.
Acknowledgment
This work was supported by a grant from the Ministry of Commerce,
Industry and Energy of Korea.
References
1. KMOE (2002), Korea Ministry of Environment (Website: http://www.me.go.kr).
2. Kim, P. J., Chang, K. W., and Min, K. H. (1995),J. Korea Organic WasteRecyclingCounc.
3,35-42.
3. Yun, Y. 5., Park, J.I., Suh, M.S., and Park, J. M. (2000), Bioresour. Technol. 73,21-27.
4. Cho, J. K., Park, S. c., and Chang, H. N. (1995), Bioresour. Technol. 52,245-253.
5. Lee, J. P., Lee, J. 5., and Park, S. C. (1999), Appl. Biochern. Biotech. 77-79,585-593.
6. Kang, H. and Jewell, W. J. (1990), /. Korean Soc. Environ. Eng. 12(1),55-64.
7. Cho,J. K., Lee,J. P., Lee,J. 5., Park, S. C.,and Chang, H. N. (1996),/. Korean Solid Waste
Eng. Soc. 13(5), 616-624.
8. Rintala, J. A and Jarvinen, K. T. (1996), Waste Manage. Res. 14, 160-170.
9. Converti, A, Drago, F., Ghiazza, G., and Del Borghi, M. (1997), J. Chern. Tech.
Biotechnol. 69,231-239.
10. Demirekler, E. and Anderson, G. K. (1998), Environ. Technol., 19, 837-843.
11. Del Borghi, A, Converti, A, Plazzi, E., and Del Borghi, M. (1999), Bioprocess Eng. 20,
553-560.
12. Dinsdale, R. M., Premeier, G. c., Hawkes, F. R., and Hawkes, D. L. (2000), Bioresour.
Technol. 72,159-168.
Abstract
Batch biosorption experiments were conducted to investigate the removal
of Cu2+ ions from aqueous solutions by a series of bacterial strains isolated
from a local activated sludge process. The characteristics of 12 isolates were
identified and examined for their ability to bind Cu2+ ions from aqueous
solution. Among the isolates, two species exhibited biosorption capacity
>40 mg of Cui g of dry cell. Isotherms for the biosorption of copper on
bacterial cells were developed and compared, and the equilibrium data
fitted well to the Langmuir and Freundlich isotherm models. The bio-
sorption of copper increased significantly with increasing pH from 2.0 to 6.0
regardless of the species. More than 90% of copper sorbed on the cells of
Bacillus sp. could be recovered by washing with 0.1 M HN03 for 5 min. The
performance of two different desorption processes was also tested and com-
pared. The results show that five biosorption and desorption cycles are a
better operation process than five successive biosorptions followed by one
desorption to remove and recover copper from aqueous solution. The
biosorbent could be used for at least five biosorptions and desorption cycles
without loss of copper removal capacity. It can be concluded that the acti-
vated sludge or sludge-isolated bacteria could be a potential biosorbent for
copper removal.
Index Entries: Activated sludge; bacteria; bioremediation; copper; des-
orption; heavy metal; metal removal; wastewater treatment process.
Introduction
Heavy metals, namely copper, zinc, nickel, chromium, cobalt, and sil-
ver, are commonly found in the effluents from electroplating and metal-
processing industries. Heavy metals are also the major waste constituents
from the manufacturing of paints, plastics, batteries, alloys, and scientific
instruments. It is well documented that are at high concentrations, heavy
metals toxic to living organisms, particularly to those in aquatic environ-
ments. In the past few decades, metal-laden effluent discharges into munici-
pal sewers without treatment have been strictly prohibited. In recent years,
more stringent industrial effluent discharge standards have been promul-
gated. In Hong Kong, effluents from industrial sources are required to be
pretreated to substantially reduce the heavy-metal contents to an acceptable
level before discharging into municipal sewers, especially for Cu (1).
Conventional methods employed for the removal of Cu ions from
industrial effluents include chemical precipitation, filtration, electro-
chemical treatment, and ion exchange. Most of these methods are expen-
sive and incapable of removing trace levels of Cu ions. The chemical
precipitation method produces a large amount of sludge for disposal. In
addition to physical and chemical methods, the potential of biosorption
has been demonstrated (2,3).
Biomass of bacteria has been known to readily adsorb or accumulate
metal ions. Bacteria's ability to uptake metals has attracted much atten-
tion because of its potential use as an effective and economic means for the
remediation of wastewater polluted by heavy metals (4). Microbial cells
can be supplied as waste in industrial fermentation process and biologic
wastewater treatment processes (5-7). Hence, biosorption may provide
an economical and effective alternative to the conventional techniques for
Cu removal.
It is important to identify more microbial strains that could uptake
metals with high efficiency and specificity as well as to design better
bioprocesses that effectively remove or recover heavy metals from aquatic
systems. To optimize design and operation of a biosorbent system for Cu
removal, a thorough understanding of biosorption behavior and desorp-
tion kinetic characteristics of microbial cells is needed. This motivated us
to evaluate the feasibility and ability of the activated sludge or sludge-
isolated bacteria to remove Cu in wastewater. The Cu biosorption charac-
teristics of one of the bacterial isolates, Micrococcus sp., have been reported
previously (8).
In the present study, the biosorption characteristics of other bacterial
strains isolated (Bacillus sp. and Pseudomonas sp.) from activated sludge were
examined and compared with Micrococcus sp. The effects of Cu concentra-
tion and pH on biosorption were systematically examined. The desorption
kinetics, efficiency of Cu removal and recovery by repeated biosorption and
desorption operations, efficiency of the desorption of metals from metal-
loaded biosorbents, and reusability of Bacillus sp. were studied.
Applied Biochemistry and Biotechnology Vol. 105-108, 2003
Biosorption of Cu Ions by Bacillus sp. 583
Effects of pH on Biosorption
eu uptake was negligible at pH 2.0 and then increased rapidly as the
pH was increased from 3.0 to 5.0 (Fig. 1). The pH of the solution obviously
affected eu removal by the three selected isolates. As suggested in previ-
ous studies (6,9), the biosorption process of metal is analogous to the ion-
exchange process. Therefore, metal cations and protons compete for
binding sites on the cell walls as pH decreases, lowering uptake of metal.
Additional support for this assumption was the finding that eu could
easily be desorbed from the cells by lowering the pH in the following
desorption study. This finding also indicated that the eu removed was
mainly bound to cell walls and external surfaces of the biomass.
Biosorption Isotherms
Biosorption isotherms for eu are presented in Fig. 2. The estimated
model parameter values and the correlation coefficients for the Langmuir
and the Freundlich isotherms are given in Table 2. The goodness of fit was
satisfactory over the range of the experiments. Values of Langmuir maxi-
mum biosorption capacity, qmax, for the different materials ranged from 21
to 47 mg/ g. The Freundlich coefficient k ranged from 4.9 to 15 mL/ g.
These values varied among the tested biosorbents, indicating large differ-
ence in their eu sorption behavior.
Based on the Langmuir biosorption maximum, qmax' the species of
Micrococcus and Pseudomonas showed the highest biosorption capacity.
However, the corresponding Freundlich coefficient, k, was similar among
the three species. The parameters k and qmax reflect different characteristics.
The Freundlich k represents the amount of eu sorbed when the solution
100
i 80
t'
-r
"CI
60
t.l
III
.!.
c:r 40
20
0
0 2 3 4 5 6 7
pH
A~------------------------~
o M"u:rococcus sp.
!:J. Btu:lIbtssp.
50 o helllilnMnllSJIIIt/ds
\7 Aetlvated sludge
o ro ~ ~ ~ 50 A ~ " H ~
Ce (mg CulL)
Table 2
Parameters of the Langmuir and Freundlich Isotherms
for Activated Sludge and Bacteria
Langmuir equation Freundlich equation
qmax b r2 k n r2
Activated sludge 31 0.20 0.99 4.9 0.46 0.99
Micrococcus sp. 43 2.06 0.99 14.0 0.37 0.96
Pseudomonas sp. 47 0.06 0.99 14.0 0.37 0.96
Bacillus sp. 21 1.0 0.99 15.0 0.12 0.94
Kinetics of Desorption
The kinetics of the desorption of Cu from the Cu-Ioaded cells of Bacil-
lus sp. is demonstrated in Fig. 3. It can clearly be seen that Cu desorbed very
rapidly, and the desorption reached equilibrium within 15 min regardless
of nearly or partially Cu-saturated biomass. Chang et al. (10) also found
that equilibrium was shortly reached after 5 min contact in the case of P.
aeruginosa PU 21 for Pb, Cu, and Cd desorption. The desorption efficiency
was about 95%. Diluted HN03 (0.1 M) is efficient for the recovery of Cu
from Bacillus sp.
Biosorption and Desorption Cycles
Figures 4 and 5 illustrate the metal removal and recovery efficiencies
of Bacillus sp. during five regeneration cycles. There was no significant
difference in the Cu biosorption capacity of the biomass from cycle 1 to 5.
o l-wL
.1III-cfL
18
,... ...
i=-
to
'1:1
r
...
~
!.
12
0::1'
I'>"~ "
0
0 500 1000 1500
TlDle(mJa)
3,-------------------------------,
t?Z22 Sorptioa
c:J Desorptioa
1 1 3 4 5
Cycle
For all cycles, about 90% and 95% of sorbed eu could be recovered by 0.1 M
HN03-induced desorption at low and high eu-Ioaded biomass, respec-
tively. eu recovery from the biomass was very effective with 0.1 M HN03•
In addition, the biosorption capacity of the biomass in subsequent cycles
was not reduced by 0.1 M HN03•
3 4 5
Cycle
50
=-...
;:;
0
e
2mgIL
..
50mgIL
>. 40
"1:1
1)1)
.....
U
=
1)1) 30
6
'-'
=
a..
0
20
0
'"
"1:1
~
01
:; 10
6
......=
-<
0
0 2 3 4 5 6
Cycle
Table 3
Performance of Two Different Biosorption and Desorption Processes
Five successive biosorption Five biosorption
and one desorption cycles and desorption cycles
Total sorption Total desorption Total sorption Total desorption
(mg/ g) (mg/ g) (mg/ g) (mg/ g)
2mg/L 8.8 5.9 7.9 7.0
50mg/L 42.0 37.0 81.0 77.0
cycles and much higher sorption than indicated by the Langmuir sorption
maximum. At low Cu concentration contact, Cu uptake continued at a
steady rate in small increments even after five cycles since the amount of Cu
sorbed during repeated contacting was less than the Langmuir sorption
maximum. Therefore, the biomass could be used repeatedly without des-
orption to remove Cu from a low Cu solution.
The total amount of Cu sorbed onto the Bacillus sp. in the two different
biosorption and desorption processes is compared in Table 3. At high Cu
concentration, the alternative biosorption and desorption process could
remove more copper. More frequent regeneration of Cu sorption sites was
needed to maintain the removal efficiency at high Cu concentration (higher
than the Langmuir sorption maximum, qrnax). Unlike the high concentra-
tion, the amount of Cu sorbed for reused cells and regenerated cells was
quite similar at low concentration. Five successive biosorptions with one
desorption process is less expensive and more environmentally friendly in
the treatment of low effluent Cu. Less desorption solution will be used to
regenerate the sorption sites. However, the total amount of Cu desorbed
from successively reused cells without desorption was lower than that
from cells regenerated by desorption during each cycle. The unrecoverable
Cu in reused cells after five successive sorptions might be owing to the Cu
diffusion into the interior of the cell walL
Conclusion
Among the 12 isolates, Micrococcus sp., Pseudomonas sp., and Bacillus
sp. exhibited Cu biosorption capacity >20 mg/ g of dry cell. Copper
biosorption by these bacterial strains was strongly affected by Cu solution
concentration. Based on the Freundlich parameter k, Bacillus sp. was found
to have a biosorption extent comparable with that of Micrococcus sp. at
low Cu concentration. The biosorption of Cu increased significantly with
increasing pH from 2.0 to 6.0 regardless of the species, thereby suggesting
ion exchange as one of the dominant biosorption mechanisms. More than
90% of eu sorbed on the cells of Bacillus sp. could be recovered by washing
with 0.1 M HN03 for 5 min. Alternative biosorption and desorption cycles
was a better operation process than successive biosorption followed by
Acknowledgments
We thank Dr. K. C. Cheung and Louisa Fok for isolating the micro-
bial strains. We also wish to express our sincere gratitude to the Hong
Kong Research Grants Council (grant no. PolyU 5001/00E) and the Hong
Kong Polytechnic University Area of Excellence Scheme for supporting
this research.
References
1. Environmental Protection Department (1991), Technical memorandum-Standards
for effluents discharged into drainage and sewerage systems, inland and coastal
waters, Hong Kong Government, Hong Kong SAR.
2. Volesky, B. and Holan, Z. R. (1995), Biotechnol. Prog. 11,235-250.
3. Butter, J., Evison, L. M., and Hamcock, I. C. (1998), Water Res. 32(2),400-406.
4. Lo, W., Chua, H., Wong, M. F., and Yu, P. F. (2003), Water Sci. Technol. 47,251-256.
5. Kasan, H. C. (1993), Crit. Rev. Environ. Sci. Technol. 23(1), 79-117.
6. Lo, W., Chua, H., Lam, K. H., and Bi, S. P. (1999), Chemosphere 39(15), 2723-2736.
7. Leung, W. c., Wong, M. F., Chua, H., Lo, W., Yu, P. H. F., and Leung, C. K. (2000),
Water Sci. Technol. 41(12), 233-240.
8. Wong, M. F., Chua, H., Lo, W., Leung, C. K., and Yu, P. H. F. (2001), Appl. Biochem.
Biotechnol. 91-93,447-457.
9. Zhang, L., Zhao, L., Yu, Y., and Chen, C. (1998), Water Res. 32(5), 1437-1444.
10. Chang, J. 5., Law, R., and Chang, C. C. (1997), Water Res. 31(7), 1654-1658.
11. Volesky, B. and May-Phillips, H. A. (1995), Appl. Microbiol. Biotechnol. 42, 797-806.
12. Niu, H., Xu, X. 5., Wang, J. H., and Volesky, B. (1993), Biotechnol. Bioeng. 42,785-787.
Abstract
A shrinking-bed reactor was designed by the National Renewable Energy
Laboratory to maintain a constant bulk packing density of cellulosic biom-
ass. The high solid-to-liquid ratio in the pretreatment process allows a high
sugar yield and avoids the need to flush large volumes of solution through
the reactor. The shrinking-bed reactor is a promising pretreatment reactor
with the potential for scale-up for commercial applications. To scale up the
shrinking-bed reactor, it is necessary to understand the flow pattern in the
reactor. In this study, flow field is simulated with computational fluid
dynamics using a porous medium model. Different discrete" snapshots" and
multiple steady states are utilized. The bulk flow pattern, velocity distribu-
tion, and pressure drop are determined from the simulation and can be used
to guide reactor design and scale-up.
Introduction
Decades ago, the National Renewable Energy Laboratory (NREL)
investigated the possibility of producing high yields of glucose from cellu-
lose by thermochemical methods. Complications arose owing to the use of
strong acid and high temperatures. Strong acids require significant alkali
neutralization. High temperature requires a short residence time to pre-
vent glucose degradation into toxic chemicals. High acid solution flow
rates produce large volumes of acid solution that require treatment and
heating. Recently, NREL investigated a two-stage, two-temperature
dilute-acid pretreatment process (1-3). In the first stage, the temperature is
relatively low and much of the hemicellulose hydrolyzes. In the second
stage, the temperature rises, hydrolyzing more of the hemicellulose. The
! Spring
Moveable end
Biomass
Fixed end
The first part of Eq. 1 is a viscous loss term and the second is an inertial
loss term. For simple homogeneous porous media, Si can be written as
Il 1
$.1 = -a V·1 + C2 -2 P IV·I1 v.
1
(2)
VP = 1: V (3)
a
in which VP is the pressure drop.
For turbulent flows and for cases in which the permeability term can
be eliminated, the porous media model can be rewritten as follows:
a-=
iJP
~3 C
Xi J-l
2ij
(1-2 pvjlvil) (4)
150ll (1_E)2
VP=-2- 3 V (6)
DP £
3.5 (I-E)
C2 =v P
--2-
E
(8)
in which Dp is the mean particle diameter, and 10 is the void volume fraction
of the packed bed.
Experimental Method
The commercial CFD package FLUENT 5.5 was used to simulate a
laboratory-scale shrinking-bed reactor. Since the shrinking process cannot
be simulated inFluent 5.5, we took several discrete "snapshots" to simulate
the shrinking process assuming the biomass particle diameter and void
fraction remain constant.
The shrinking-bed reactor's operation conditions were as follows:
Flowing media: water (liquid); temperature: 298K; heattransfer: none;
flow regime: laminar; inlet velocity: 2.5 x 10-3 m/ s; outlet pressure: 1 atm;
particle diameter (Dp): 1 mm; packed-bed void fraction (E): 0.2; (l/a) =1.72
x 1011; and C2 = 3.5 X 105 •
Initial and subsequent snapshot states are given in Table 1.
To keep plug flow in the entire shrinking bed, one option is to create
even fluid distribution in the inlet and outlet. Figure 3 shows the flow pat-
tern of the shrinking-bed reactor with the inlet acid solution evenly distrib-
uted over the bed diameter. Apparently, this change reduces radial flow in
the top comer and improves the mass transfer efficiency. If the outlet flow
could also be evenly distributed, the radial flow in the bottom comer would
disappear, enhancing the shrinking-bed reactor's performance.
Axial and Radial Velocity Distributions
In this simulation, the X direction is radial, with positive X velocity
toward the reactor wall; Y is for axial direction, with positive Y velocity
indicating upward flow.
X velocity distributions for 80% initial bed height are shown in Fig. 4.
Clearly, radial flow exists in the comers of the shrinking bed. The radial
flow can increase the residence time and has different impacts on produc-
tion of sugars. If the hydrolysis process is controlled by chemical kinetics
and has not reached equilibrium, then an increase in residence time can
enhance production of sugars; if the hydrolysis has reached equilibrium,
the increase in residence time will result in sugar degradation.
Applied Biochemistry and Biotechnology Vol. 105-108,2003
598 Wan and Hanley
4.95e-04 IlillllllllIlIlillilllllJilIUlUlIUI
1lUlUIIIIIIIIUlUIIIIIIIIUlIIIIUI
IIUJlIIllIlIIlllIUllllJUlUllIIllI1
1IUllUIIIIIIIUlUIIIIJUlIIIIIIIUI
1IIIIlIIIIIJillUIUlIIIJIIIUIIIIIUI
4.476-04 U11IUIUIIIIIUIUIIIIIUIUIIIIIUI
IIUIUIIIIIIIIUIUIIIIIUIUIIIIIUI
IJUIUlUlllUUIUlllIlUlUlllilUl
IIUIUIIIIIIIIUIUIIlIIUIUIIlIIUI
IJUlUlllIlIlIUlllllillUllllllllUl
3.996-04 1J1liUllUUllillUIIlIIUIIlIIlIIlII
IIIIIUIUlJlIJUIUIIIIIUIUIIIlIUI
III11UIJIIUIIUIUIJIIJIIIUIlIlIUI
IIUJUIIUlIllUIUlJlIIUlUllUWI
1I11l1l1l1l11liUlUIIIIIUIUIUIIUI
3.51&-04 IIUJUIIUJlllUIUlIlIIUlIIlIlllUI
IIUJlIlIUllIllIIUlllllUllIlJlIlUJ
IUIUIIIIJIIIUUJIIIIIUIIJIIIIIUI
IIUlIIlIliJIllIlIUllIlJllIUlUliU
IIUIIIIIIIIIIIIIIUIIIIJltIUlIllIUI
3.02e-04 IIUIIIIIUJJlIIIIUIIIIJJJlUIIIIIUJ
1II111111111111111UlIIIJJIlUIIIIIUJ
IIUIIIIUIIJIIIUUIUIIIIIUIUlIJlJ
UUlllllllJlUlllilIUlJlUUlJlII1II
UlIIlJlIllllllUllIlIIlllIIlIlIUl1II
2.54&-04 1JIIIIIIIIIIJlIJlIIIIlIlIlllUIJJlIUJ
WllIllIIIllllIIlUlIlIllIIJlllJIUIJ
IJIIlIUJIlIIIJUIUlDlIIIIIIIIJIIIII
1IJJ11l1J111J1J11IUlIIlIIIIIIIIIIIUI
IUlllillIllIlIJlIJllUlIlIlJlIlIlUlI
2.06&-04 1IIIIIlIlHIIIJIIIUIJJlllllUIIIIIUI
IlIIlUlIIIJJllIIlUIlJUllilHllIJIII
IlJUIIIIUIIIIIIIIIIIJIIUIIIIIIIIlIJ
IIUJIlIIIllIIIUIUIIlIlUIIUIIIDtI
1IU1I1I1I11IIIIl1UIIlIIIIUlUUIlU
1.58&-04 1IIIIIIIIIIUIIUlUIIIIJllllUIIIIJJI
IIUlllIUUllilUlllIlIJUllUlIllI1I
IIJUllIllIlIlIUlllIllIlIlIUUlllJlI
llUlJJlUllIlllllUUlIllIlUUl1ll11
UUUUUlIllIUIUlIIlIllUllJllI1I
1.096-04 UIIIIlIUIIIIIIlIJlIlIlII1UIIIIIIUI
IJIUIlIIlIIIIUlIUIlIlIIUUIIIlUU
1JIlllIJJllUIIIIIIJIIIllllIIJIIIJIUI
1I1l1111UIIUIlIIUIJIIIIIUlUUIIII
Lx
1IIIIIIIIIIUIWIlliUlIJUlllIIIUlI
6.109-05 lUllIlIUlllIUIIWllUw/JIlIUli1
III1UIIIIIIIUJ IUIU/WII
IIII11UIII 11/11111111
um'm"~ /IIIIIIIIU
mun: 1111
1.28&-05
Fig. 3. Flow pattern and fluid velocities in meters per second in the shrinking-bed
reactor with optimized inlet.
• default-mtenor
1.40e+02
1.20e+02
... . ... .
1.00e+02
8.ooe+01
Position
(mm) 6.00e+01
4.00e+01
2.00e+01
0.00e+00 -i't~.'--'.y-.-'r-.'"**""'-.-''--'-*,-r'-'-T-'~--,-.--.---,-.--.-.-.--,-
-1 - 0.8 .(l.6 -0.4 -0.2 0.0 0.2 0.4 0.6 0.8
X Velocity (mm/s)
Results from the Yvelocity distributions along the axis in 100, 80, 60,
40, and 20% initial bed height show a uniform Y velocity distribution, or
plug flow, in the middle of the bed. The uniform Yvelocity area decreases
rapidly from about 60 to 0% in the whole bed volume when the bed height
shrinks from 100 to 20%. Moreover, it is observed that with no positive Y
velocity, no backflow occurs in the shrinking-bed reactor. Thus, the shrink-
ing-bed reactor is ideal for mass transfer and, as a result, can stimulate the
hydrolysis reaction. In this aspect, the shrinking-bed reactor is suitable for
bioethanol production. Typical Y velocity distribution along the axis is
shown in Fig. 5.
Pressure Drop
Typical pressure distribution contours in the shrinking-bed reactor
are shown in Fig. 6, where it is indicated that the pressure distribution is not
even. The highest static pressure occurs in the fluid inlet while the lowest
pressure appears in the fluid outlet. The higher pressure in the upper bed
level may result in higher hydrolysis reaction rates in this area.
In Fig. 7, pressure distributions for different bed heights are plotted
in the central axis (symmetry line). As the bed shrinks, the pressure drop
decreases. As the bed height decreases from 100 to 20% of initial height,
the pressure drop decreases from 1.7 x 104 to 5.8 X 103 Pa. The decreased
pressure drop has a positive effect on biomass hydrolysis. Initially, a large
pressure drop produces greater fluid flow and counters the effect of larger
Applied Biochemistry and Biotechnology Vol. 105-108,2003
600 Wan and Hanley
8.5ge+06
7.73e+06
6.87e+06
6.02e+06
5.16e+06
· 4.30e+06
3.44e+06
2.58e+06
1.72e+06
Lx
8.5ge+05
O.OOe+OO
180
........ 20%
-0-40%
160 +-----------------------------~_6_W% ~----------------~~~
-_80%
-lIE-1000k
140
120
E 100
.s.c
.
0
E
0 80
CI.
60 -"
40
20
0
0 2 3 456 7 8 9 10 11 12 13 14 15 16 16.6
Sialic Pressure (KPa)
~ ~~
~\ tiL
40"10
,
[I] 20%
bed height. Increased residence time of fluid in the bed means higher risk
of decomposition of sugars into toxic chemicals. In the latter stages, the
smaller pressure drop increases residence time and allows more lignocel-
lulose to be hydrolyzed.
Flow Path
Pathlines are used to visualize the flow of massless particles in the
problem domain. The particles are released from one or more defined sur-
faces. In the present work, 10 massless particles were released from the
fluid inlet. Figure 8 shows the path lines of the shrinking-bed reactor at
different heights and confirms the flow pattern described in Fig. 2.
Conclusions
The CFD simulation for a laboratory-scale shrinking-bed reactor in-
dicated mostly plug flow with some radial flow in the bed corners. No
backflow was found. As the bed shrank, the pressure drop of the bed
decreased. One suggestion to optimize the flow in this reactor is to adjust
the fluid inlet and outlet to produce more even flow distribution. Com-
Applied Biochemistry and Biotechnology Vol. 105-108,2003
602 Wan and Hanley
Nomenclature
C, C2, D = matrix
Dp = particle diameter (m)
P = pressure (Pa)
Sj = source term for ith momentum equation
Vj = velocity of i direction
a = permeability
E = void fraction
!..t =molecular viscosity (kg/m·s)
p = density (kg/m3)
Acknowledgments
This research was supported by NREL (contract no. XCO-1-31016-01).
References
1. Tucker,M. P.,Farmer,J. D., Keller,F. A,Schell, D.J., and Nguyen, Q. A (1998),Appl.
Biochem. Biotechnol. 70-72, 25-35.
2. Nguyen, Q. A, Tucker, M. P., Keller, F. A, Beaty, D. A, Connors, K. M., and Eddy,
F. P. (1999), Appl. Biochem. Biotechnol. 77-79, 133-142.
3. Nguyen, Q. A, Tucker, M. P., Keller, F. A, and Eddy, F. P. (2000), Appl. Biochem.
Biotechnol. 84-86, 561-576.
4. Torget, R W., Hayward, T. K., and Elander, R (1997), presented at the 19th Sympo-
sium on Biotechnology for Fuel and Chemicals, Colorado Springs, CO.
5. Chen, R, Wu, Z., and Lee, Y. Y. (1998), Appl. Biochern. Biotechnol. 70-72,37-49.
6. Lee, Y. Y., Wu, Z., and Torget, R. W. (2000), Bioresour. Technol. 71,29-39.
7. Converse, A O. (2002), Bioresour. Technol. 81, 109-116.
8. Fluent, Inc. (1998) FLUENT 5 User's Guide, vol. 1., Fluent, Inc., Lebanon, NH.
9. Ergun, S. (1952), Chern. Eng. Prog. 48(2),89-94.
Abstract
The effect of various nitrogen sources on cell growth and lactic acid pro-
duction was investigated. The most effective nitrogen source was yeast
extract; more yeast extract gave higher cell growth and lactic acid productiv-
ity. Yeast extract dosage and cell growth were proportional up to a yeast
extract concentration of 30 giL, and lactic acid productivity was linearly cor-
related up to a yeast extract dosage of 25 giL. However, increasing the yeast
extract content raises the total production cost of lactic acid. Therefore, we
attempted to find the optimum yeast extract dosage for a repeated-batch
operation with cell recycling. The results show that when using Enterococcus
faecalis RKYI only 26% of the yeast extract dosage for a conventional batch
fermentation was sufficientto produce the same amount oflactic acid, whereas
the lactic acid concentration in the product stream (92-94 giL) and lactic acid
productivity (6.03-6.20 g/[L·hD were similar to those of a batch operation.
Furthermore, long-term stability was established.
Index Entry: Lactic acid; repeated-batch; cell-recycle; hollow-fiber mod-
ule; nitrogen source; yeast extract.
Introduction
Lactic acid (CH3CHOHCOOH) is an organic hydroxy acid with wide-
spread industrial applications. Recently, much attention has been paid to
lactic acid as a monomer for biodegradable plastic. Between the two meth-
ods for producing lactic acid, fermentation is reported to be more favorable
than the chemical synthetic method, because of its environmental friendli-
ness and selectable production of a single enantiomer (1-4).
However, there are two major problems that make the biological
production of lactic acid economically unfavorable. One is the fastidious
*Author to whom all correspondence and reprint requests should be addressed.
~
® <D
.... ®
--
--
®
<D
®
Fig. 1. The schematic diagram of cell-recycle membrane bioreactor. I, Bioreactor;
2, hollow-fiber membrane filtration module; 3, product storage tank; 4, fresh medium
storage tank; 5, neutralizer reservoir; 6, peristaltic pump; and 7, three-way valve.
Results
Effect of Nitrogen Sources
To investigate the effect of various nitrogen sources on lactic acid
fermentation, organic, inorganic, and several cereal-derived nitrogenous
materials were tested. Table 1 presents the results of 50-mL serum bottle
experiments containing 10 giL of each nitrogen source.
The highest dry cell weight (6.7 giL) and overall lactic acid produc-
tivity (2.4 g/[L·h]) were recorded when yeast extract was used as the
nitrogen source. Bactopeptone, polypeptone, corn steep liquor and beef
extract showed comparable results. Next to those nitrogen sources were
corn steep solid and some cereal-based materials, which showed some
possibilities as substitutive nitrogen sources. However, adding single
organic or inorganic substrates, such as sodium L-glutamate, ammonium
sulfate, ammonium chloride, and urea, promoted little in both the cell
growth and lactic acid production.
Effect of Yeast Extract Dosage on Batch Cultivation
Because yeast extract was proven to be the most effective nitrogen
source, we investigated the influence of yeast extract dosage during batch
cultivation with the 2.5-L fermentor experiments. Figure 2 presents cell
growth and lactic acid production in the medium with 100 giL of glucose
and 0-40 giL of yeast extract. As the yeast extract dosage was increased, the
dry cell weight and lactic acid production rate increased linearly up to 30
and 25 giL of yeast extract, respectively. For yeast extract dosage >30 giL,
however, both cell growth and lactic acid production rate did not increase.
Applied Biochemistry and Biotechnology Vol. 105-108, 2003
Lactic Acid Production by E. faecalis RKYI 607
-0-- y=o
20 ____ Y=2
-0-- Y=5
---+--- Y = 10
--t:r- Y=15
15 --4- Y=20
-v- Y=25
----T- Y=30
-<>- Y=40
100
80
::r
--
~
"0
60
.~
CJ
.;:: 40
~
....1
20
25
Time [h]
Fig. 2. Effect of yeast extract dosage on cell growth and lactic acid production
during batch cultivation of E. faecalis RKYl. Medium composition: 100 giL of glu-
cose, 0-40 giL of yeast extract.
12
10
~ 8
te
CO 6
=i3
u 4
0
120 -+- Lactic acid
-0- Glucose
100
~
.....
~ 80
0
g
Oh
't:l 60
!a
....'t:lg 40
(.)
'p
g 20
...:l
0
0 15 30 45 60 75
Time [h]
Fig. 3. Time course for cell-recycle repeated-batch operation with no yeast extract.
Culture conditions: 2.5-L jar fermentor containing 1 L of medium at 38°C, 200 rpm;
composition of fresh medium: 100 giL of glucose, 0 giL of yeast extract.
extract. After the fifth batch, the accumulated cell growth was about 17
gIL, but the lactic acid productivity and the substrate consumption rate
were lower than those of the first batch by 14 and 13%, respectively.
Figure 5 shows the fermentation profiles of repeated-batch opera-
tion with cell-recycle using fresh medium containing 100 gIL of glucose
and 4 gIL of yeast extract. A consistent cell growth was seen from the
second to tenth batches, with the maximum cell growth of 28.5 gIL.
Through the repeated-batch runs, the lactic acid productivities and the
substrate consumption rates were stable, in the range of 6.03-:-6.39 gl (L·h)
and 95-100%, respectively.
Figure 6 shows the results of the cell-recycle repeated-batch opera-
tion using fresh medium supplemented with 150 gIL of glucose and 7 gl
Applied Biochemistry and Biotechnology Vol. 105-108, 2003
Lactic Acid Production by E. faecalis RKYI 609
20.--------------------------------,
0
120 _ Lactic acid
-0- Glucose
~ 100
.......
Q)
'"0 80
.E
01)
] 60
.....
"0
~ 40
()
.J::
~ 20
~
Time [h]
Fig. 4. Time course for cell-recycle repeated-batch operation with 3 giL of yeast
extract. Culture conditions: 2.5-L jar fermentor containing 1 L of medium at 38°C,
200 rpm; composition of fresh medium: 100 giL of glucose, 3 giL of yeast extract.
25
20
~
~
ofi 15
~
I)Il
:=1 10
41
U
0
120 ___ Lactic acid
--0- Glucose
.....,
100
~(1)
rfJ
0 80
U
..=OIl
'e 60
§
'e
.~ 40
.;:l
~ 20
.....:I
Fig. 5. Time course for cell-recycle repeated-batch operation with 4 giL of yeast
extract. Culture conditions: 2.5-L jar fermentor containing 1 L of medium at 38°C,
200 rpm; composition of fresh medium: 100 giL of glucose, 4 giL of yeast extract.
[g of cell·h]) was higher than any other nutrient sources. The highest cell
growth and lactic acid productivity were found with undefined organic
substrates. Like most studies on lactic acid biosynthesis, the most effective
nitrogen source was yeast extract (1,2,7).
During batch operation, when the effects of yeast extract dosage on
lactic acid fermentation were tested, it was found that more added yeast
extract caused higher cell growth and lactic acid productivity. Figure 7 pre-
sents the relationship between the yeast extract dosage and maximum cell
growth, and the relationship between yeast extract dosage and overall pro-
ductivity. Figure 7 also shows that the yeast extract dosage and cell growth
were proportional up to a yeast extract dosage of 30 giL, and that lactic acid
productivity was linearly correlated up to a yeast extract dosage of 25 giL.
Applied Biochemistry and Biotechnology Vol. 105-108,2003
Lactic Acid Production by E. faecalis RKYI 611
30~~~~~~~~~~~~~~~~~~~
25
-
'U
U
10
0
0 24 48 72 96 120 144 168
Time [h]
Fig. 6. Time course for cell-recycle repeated-batch operation with 150 giL of glucose
and 7 giL of yeast extract. Culture conditions: 2.5-L jar fermentor containing 1 L of
medium at 38°C, 200 rpm; composition of fresh medium: 150 giL of glucose, 7 giL of
yeast extract.
20r-~~~--------------------------'
__ Cell growthmax
-+- LA productivity
10 20 30 40
Yeast extract dosage [gIL]
Fig. 7. Effect of yeast extract dosage on cell growth and volumetric productivity of
lactic acid during batch cultivation of E. faecalis RKYl. LA, lactic acid.
Conclusion
Among the various nitrogen sources tested, the most effective nitro-
gen source was yeast extract. As well, with greater addition of yeast
extract, higher cell growth and lactic acid productivity were achieved.
When the repeated-batch operation with cell-recycle was performed with
glucose and yeast extract concentration of 100 and 4 giL, respectively,
only 26% of the yeast extract dosage required for batch fermentation was
needed to produce 1 kg of lactic acid, whereas the lactic acid concentra-
tion in the product stream (92-94 giL) and the lactic acid productivity
(6.03-6.20 g/[L·hD were similar to those of batch operations. Further-
more, long-term stability was established.
Acknowledgments
This work was supported by the Ministry of Commerce, Industry and
Energy through the Korea Institute of Industrial Technology Evaluation
and Planning.
References
1. Hofvendahl, K. and Hahn-Hagerdahl, B. (2000), Enzyme Microb. Technol. 26,87-107.
2. VickRoy, T. B. (1985), in Comprehensive Biotechnology, vol. 3, Moo-Young, M., ed.
Pergamon Press, Tarrytown, NY, pp. 761-776.
Abstract
In addition to fermentable sugars, dilute-acid hydrolysates of lignocel-
lulose contain compounds that inhibit fermenting microorganisms, such
as Saccharomyces cerevisiae. Previous results show that phenolic compounds
and furan aldehydes, and to some extent aliphatic acids, act as inhibitors
during fermentation of dilute-acid hydrolysates of spruce. Treatment of
lignocellulose hydrolysates with alkali, usually in the form of overliming
to pH 10.0, has been frequently employed as a detoxification method to
improve fermentability. A spruce dilute-acid hydrolysate was treated
with NaOH in a factorial design experiment, in which the pH was varied
between 9.0 and 12.0, the temperature between 5 and 80°C, and the time
between 1 and 7 h. Already at pH 9.0, >25% of the glucose was lost when
the hydrolysate was treated at 80°C for 1 h. Among the monosaccharides,
xylose was degraded faster under alkaline conditions than the hexoses
(glucose, mannose, and galactose), which, in turn, were degraded faster
than arabinose. The results suggest that alkali treatment of hydrolysates
can be performed at temperatures below 30°C at any pH between 9.0 and
12.0 without problems with sugar degradation or formation of inhibiting
aliphatic acids. Treatment with Ca(OH)z instead of NaOH resulted in more
substantial degradation of sugars. Under the harsher conditions of the
factorial design experiment, the concentrations of furfural and 5-hydro-
xymethylfurfural decreased while the total phenolic content increased.
The latter phenomenon was tentatively attributed to fragmentation of
soluble aromatic oligomers in the hydrolysate. Separate phenolic com-
pounds were affected in different ways by the alkaline conditions with
Introduction
Consumption of fossil fuels in the transportation sector generates
carbon dioxide, which may act as a greenhouse gas promoting global warm-
ing. Ethanol produced from renewable resources serves as an alternative to
fossil fuels and may not result in a net addition of carbon dioxide to the
atmosphere. Ethanol can also be used as an additive to gasoline instead of
methyl tert-butyl ether. Lignocellulose (e.g., forestry wastes), is an abun-
dant and inexpensive raw material considered for production ofbioethanol
(1). Cellulose and hemicellulose can be degraded to monosaccharides that
are subsequently converted to ethanol by microorganisms, such as baker's
yeast, Saccharomyces cerevisiae.
One problem associated with degradation of lignocellulose polysac-
charides to monosaccharides by dilute-acid hydrolysis is the simultaneous
formation of compounds that are toxic to the fermenting organism. These
inhibitory compounds include furan derivatives, phenolics, and aliphatic
acids (2-11). Since the inhibitors decrease the ethanol productivity and
consequently make the production of ethanol more expensive, it is desir-
able to decrease the concentration of the toxic compounds in the hydroly-
sates prior to fermentation. Various detoxification methods for removal of
inhibitors have previously been carefully investigated, such as alkaline
treatment at pH values of about 10, enzymatic treatment, and treatment
with ion-exchange resins (5,7-9). Overliming-i.e.,treatmentwithCa(OH)2
at pH values of about 10, and sometimes at elevated temperature-is a
widely used method for detoxification of lignocellulose hydrolysates
(5,7,8,10,12). However, the center of interest in these investigations has
been on fermentability as well as on concentration of inhibitors before and
after treatment, and little effort has been made to optimize the parameters
during alkali treatment. A possible drawback with alkali detoxification
that has so far not been carefully investigated is the concomitant decrease
in the concentration of fermentable sugars.
It is well known that sugars degrade in aqueous alkaline solutions (13-
19). The parameters that influence the different degradation pathways and
rearrangements of sugars is also known. However, most of the investiga-
tions (14-19) providing this evidence were performed on standard solution
mixtures, and therefore, the knowledge gained might not necessarily apply
for dilute-acid hydrolysates because of their complex nature. Furthermore,
alkali treatment ofhydrolysates has proven to be an efficient detoxification
method; thus, it would be desirable to perform an investigation to clarify
which factors are the most important during the alkali treatment. The main
goal would be to find experimental settings in which the detoxification
effect is at a maximum and in unison with the degradation of fermentable
sugars at a minimum.
In the present study, a factorial design experiment was used to eluci-
date the limits for alkaline detoxification of a dilute-acid hydrolysate of
spruce regarding the individual and synergistic effects of temperature,
concentration of hydroxyl ions (pH), and duration of treatment on the con-
centrations of inhibitors and fermentable sugars. The variables-tempera-
ture, pH, and time-were changed simultaneously. Normally, Ca(OHh is
used in alkali treatments of hydrolysates, so called overliming, but to avoid
solubility problems, NaOH was used to raise and maintain the pH, using
a pH-control unit. In addition, some experiments were performed with
Ca(OH)2 to examine whether sodium and calcium had different effects on
the hydrolysate composition at the applied conditions. The concentrations
of different monosaccharides were analyzed as well as changes in the con-
centration of furan aldehydes, aliphatic acids, total phenolics, and selected
separate phenolic compounds. Finally, the results were evaluated using
response surface modeling.
Preparation of Hydrolysates
A two-step dilute-acid hydrolysate of Norway spruce (Picea abies) was
used. Chipped Norway spruce was impregnated with H 2S04 (0.5% [w Iv])
prior to loading in a 2S0-L batch reactor. Steam at a pressure of 12 bar
(190°C) was loaded and kept for 10 min. Subsequently, the liquid and solid
fractions were separated, after which the solid fraction was washed with
water, reimpregnated with H 2SO4 and loaded into the reactor again. Steam
at a pressure of 21 bar (215°C) was loaded and kept for 10 min. After filtra-
tion, the liquid fractions from steps 1 and 2 were pooled to form the final
hydrolysate. The pH of the final hydrolysate was 1.9.
Applied Biochemistry and Biotechnology Vol. 105-108, 2003
618 Nilvebrant et al.
Procedure
Optimal conditions for preventing decomposition of sugars during
alkali detoxification were investigated using a fractional factorial experi-
mental design with MODDE 4.0 software from Umetrics AB (Umea, Swe-
den). The experimental design was used to investigate the influence of pH,
temperature, and duration of treatment. To cover the entire area of interest
with as few experiments as possible, all variables were changed simulta-
neously and the influences of the factors on the responses were investi-
gated (n = 17 and degrees of freedom = 11). All variables were given
minimum and maximum values based on previous knowledge on the topic.
The acidity was varied between pH 9.0 and 12.0, temperature between 5
and 80°C, and time between 1 and 7 h, at the high (H) and low (L) levels with
an additional midpoint (M) at pH 10.5, 42.5°C, and 4 h, respectively. The
MODDE software (Umetrics AB) generated the plan for the factorial
experiment (17 experiments; LLL, HLL, LHL, HHL, LLH, HLH, LHH,
HHH, LMM, HMM, MLM, MHM, MML, MMH, and triplicate of MMM to
yield the reproducibility).
Portions of the hydrolysate (40 mL) were treated according to the plan.
A pH-stat, TIM 900 Titration Manager (Radiometer Analytical A/S,
Copenhagen, Denmark) was used in titration mode where the titrator kept
a constant pH by continuously adding a titrant. The titrant used was 5 N
NaOH. It was necessary to use a pH-stat since degradation of carbohy-
drates will occur with formation of various organic acids that could alter
the pH of the samples during the experiment. The experiments were per-
formed in the presence of air to resemble real-life conditions for detoxifica-
tion of hydrolysates. After treatment the solution volume was adjusted to
100 mL with Milli-Q water prior to analysis.
To compare the effect of using either NaOH or Ca(OHh for the alkali
treatments, an additional set of experiments was conducted at six selec-
tions of pH, temperature, and reaction time. These settings comprised treat-
ment at pH 10.0 and 25 or 60°C for 1 h, pH 9.0 and 80°C for 1 and 7 h, and
pH 10.5 and 42.5°C for 4 and 7 h.
Ultraviolet Absorbance
The absorbance of the hydrolysates (largest peak in the UV spectrum)
was measured at 282 nm using an HP 8453 UV-VIS spectrophotometer
(Agilent, Palo Alto, CA). The hydrolysates were diluted 1000 times with
Milli-Q water prior to determination of absorbance.
Measurement of Total Phenolics
The total amounts of phenolics in the hydrolysates were estimated
with a spectrophotometric method based on the Folin & Ciocalteu reagent
(Sigma, Steinheim, Germany). The samples were diluted 25 times with
Milli-Q water, and 1 mL of the diluted sample was transferred to a 50-mL
volumetric flask, to which 3 mL of the Folin & Ciocalteu reagent (2 mol/L)
Applied Biochemistry and Biotechnology Vol. 105-108,2003
Alkaline Detoxification of Hydrolysates 619
and 30 mL of Milli-Q water were added followed by thorough mixing.
After 5-8 min, 10 mL of 20% sodium carbonate solution was added and the
volume was adjusted to 50 mL. The mixture was stirred for 2 h, after which
the absorbance was measured at 760 nm. The amounts of phenolics were
determined from an external calibration curve based on vanillin, since it
was the most abundant phenol in the hydrolysate.
HPLC-Analysis of Furans and Phenolics
Analysis of furfural, HMF, catechol, coniferyl aldehyde,
4-hydroxybenzoic acid, vanillic acid, vanillin, and cinnamic acid was per-
formed using an HP 1100 Series HPLC-system consisting of an automatic
degasser; a binary pump; an auto-sampler; a UV detector; and an HP 1050
Series diode-array detector, DAD (Hewlett-Packard, Palo Alto, CA). The
analytes were separated on an XTerra™ MS C18, 5 ~m, 2.1 x 150 mm analyti-
cal column withanXTerraMSC18 5 ~,2.1 x 10 mmguard column (Waters,
Milford, MA). A mobile phase gradient, consisting of Milli-Q water and
acetonitrile both containing 75 ~L/L of formic acid, started with 5% aceto-
nitrile for 5 min, after which the acetonitrile content increased linearly to
10% after 10 min; 30% after 20 min; 50% after 40 min; and, finally, 90%
acetonitrile after 50 min. The column was equilibrated with 5% acetonitrile
for 10 min before every injection. The injection volume was 5 ~L. All analy-
ses were performed as duplicates.
Five point calibration curves for each individual compound were used
for quantification. Furthermore, to quantify the furans, the samples had to
be diluted 75 times prior to injection. The UV detector was set at 254 nm and
the DAD was set at 210,254,280, and 330 nm. Wavelengths for quantifica-
tion were selected for each compound on the basis of absorption maximum
for the analyzed compound as well as absorption patterns for coeluting
compounds. The furans, furfural and HMF, as well as vanillic acid and
cinnamic acid were quantified at 254 nm, coniferyl aldehyde and catechol
at 280 nm, 4-hydroxybenzoic acid at 210 nm, and vanillin at 330 nm. More-
over, sum integrations of two retention time windows were performed at
280 nm to obtain rough estimations of the relative furan and phenolic con-
tent of the samples. The first retention time window ranged from 0 to 13.5
min and the second from 13.5 to 50 min. The former gave an approximate
value of the furan content and the latter an approx value of the phenolic
content of the samples.
The analyzed phenolics were chosen owing to their high abundance
in the hydrolysates. Together, they account for >90% of the phenolics
known to be present in this type of hydrolysate (12).
Analysis of Aliphatic Acids
Analysis of aliphatic acids was performed ona Beckman P / ACE MDQ
capillary electrophoresis instrument with a 60 cm x 50 ~m id fused silica
capillary. All samples were filtered through a 0.45-~m Whatman cellulose
acetate filter prior to hydrodynamic injection at 15 psi for 4 s. The voltage
the longer time the treatment lasted (data not shown). Moreover, degra-
dation of all the individual monomeric sugars followed practically the
same pattern at the various temperatures and pH values (Fig. 1A). How-
ever, xylose had a tendency to degrade slightly more easily than the other
sugars at increased temperature and pH, while arabinose tended to be the
most resistant (Fig. 1B,C). Furthermore, the individual sugar concentra-
tions seemed to be independent of the pH at low temperatures (5°C), but
the pH dependency increased with increased temperature (Fig. 1A). That
is, higher pH resulted in more extensive degradation; all sugars totally
disappeared at 80°C and pH 12.0, whereas 40-50% disappeared after treat-
ment at 80°C and pH 9.0.
The results on aliphatic acids showed that increased temperature
and pH had significant effects, temperature being more important, on
the formation of formic acid, but only temperature had a significant effect
on the formation of acetic acid and neither temperature nor pH had sig-
nificant effects on the concentration of levulinic acid according to the
coefficient plots (not shown). The model had a very good fit for formic
acid, with an R2 value of 0.92 and a Q2 value of 0.80, an acceptable fit for
acetic acid (R2 = 0.68 and Q2 = 0.36), whereas there was a poor fit for
levulinic acid.
Formic acid and acetic acid showed an increase in concentration at
elevated temperature and pH according to the response surfaces (Fig. 2A,B).
However, there was an approx fourfold increase in formic acid and only a
twofold increase in acetic acid at the harshest conditions (80°C and pH
12.0). Furthermore, formic acid and acetic acid were not degraded to any
larger extent since the relative concentration never fell below 100% in the
response surface plots (Fig. 2A,B).
The concentration changes in levulinic acid were far more moderate
than those of acetic and formic acid, that is, the concentration changes were
no more than ±20% around the initial value for levulinic acid (Fig. 2C).
Both the temperature and pH were significant for the changes in con-
centrations of furfural and HMF according to the coefficient plots (not
shown). The R2 and Q2 values were 0.85 and 0.58 for furfural and 0.81 and
0.48 for HMF. Both furfural and HMF were more easily degraded, probably
to acetic and formic acid, when pH was increased from 9.0 to 12.0 and the
degradation increased with increasing temperature Fig. 3A,B). Furfural
and HMF were absent after 1 h at 80°C and pH 12.0.
Regarding separate phenolic compounds, determined with HPLC,
the temperature and pH were only significant (R2 =0.87 and Q2 =0.68) for
the concentration of vanillic acid. Roughly a threefold increase in the con-
centration of vanillic acid was observed at 80°C and pH 12.0 (Fig. 3C).
According to the UV measurements at 282 nm both the temperature
and pH (R2 =0.87 and Q2 =0.68) were significant for the concentration of the
compounds that absorbed light at this wavelength. At low temperatures, a
decrease in absorptivity from 100 to 70% was observed when the pH was
increased from 9.0 to 12.0 (Fig. 4A). When the temperature was increased
Applied Biochemistry and Biotechnology Vol. 105-108,2003
~ A B C
~
Q.. 100
t1:J IS tOO c: 100
'Q 0 IS
';:1 .:z
~ § 80 80
i fi
3iii' 60 60
~ 60
~ iii ~ _. - Alabinose
~
tu .:z iii 40 - • - Alabin_
::l ';:I 40 ......... Oalactose
] ......... Galactose
Q.. :§ :§
... :§ --01_ -01_
t1:J 0 12 ... ...
o· 0 0 20
~ 20 - - - Mannose - - - MIII\lIose
-;t. ~
~ o ....•.•.. Xylose o ....•.•.• Xylose
::l
o to 20 30 40 50 60 70 80 9 10 11 12
~ Temperature ("C) pH
'<:
Fig. 1. Response surface (4-h treatment) for glucose (A) as well as models for degradation of monosac-
0"1
charides as a function of increasing temperature at pH 10.0 for 1 h (B) and increasing pH at 60°C for 1 h (C).
N
N
A B C
400 CI
120
IS IS 0
.:z .:z '.c!
i .sc 110
I 300
~ ~
8 8 8 100
iii 200 iii 140 iii
'Q .:z '.c!
:!11 :§ :§
ci=
:- ~
....0
12
...
0
~ -;t. ~
-~ 2~
- 60 9
~ Temperature ("C) 80
§'" Fig. 2. Response surfaces (4-h treatment) for (A) formic, (B) acetic, and (C) levulinic acid.
Alkaline Detoxification of Hydrolysates 623
from SoC, there was an initial decrease in absorbance. By contrast, at tem-
peratures above 40°C the absorbance increased drastically at high pH.
The content of phenolic compounds could be estimated by integration
of the area in the HPLC chromatogram corresponding to compounds elut-
ing after 13.5 min. High temperature and pH gave an increase in total
phenolics (Fig. 4B).
The Folin & Ciocalteu measurements, used to estimate the total con-
centration of phenolics, largely showed an increase with increased tem-
perature and pH (Fig. 4C). The temperature and pH were significant (RZ =
0.94 and Q2 = 0.86) for the total phenolic content. A fivefold increase in
phenolic concentration was seen under the harshest conditions, 80°C and
pH 12.0. However, note that a small decrease could be found at 2SoC and
pH 10.0, i.e., under normal overliming conditions.
Comparison of NaOH and Ca{OH)2
Under mild conditions, no significant degradation of sugars could be
determined with either NaOH or Ca(OH)z. At 60°C and pH 10.0, approx
10% of the monosaccharides were lost and a small difference between
NaOH and Ca(OHh was observed (Table 1). When the conditions were
more severe, Ca(OH)z treatment clearly resulted in more extensive degra-
dation than treatment with NaOH (Table 1).
Discussion
It is well known that sugars can mutarotate under mild alkaline con-
ditions in aqueous solutions. Moreover, it is also known that harsher alka-
line conditions catalyze enolization reactions, provided the sugars have an
a-hydrogen atom, which, in tum, might lead to isomerization reactions
(13,20). Furthermore, ~-elimination reactions, leading to the formation of
dicarbonyl compounds, might occur simultaneously or subsequent to an
enolization reaction (13,20). In time, the ~-eliminations will lead to forma-
tion of saccharinic acids (13,20). In addition to saccharinic acids, compounds
with fewer carbon atoms than the monosaccharides, such as formic acid,
are formed. These reactions can occur through retroaldolization as well as
splitting or benzilic acid rearrangement of dicarbonyl compounds (13,14).
The degree of degradation or rearrangement of the sugars depends on
a variety of factors, such as concentration and type of sugar, temperature,
duration of treatment, as well as concentration and type of alkali (14,16,18-
20). Because of the high reactivity of ketoses, they appear to be more impor-
tant as intermediates in degradation of monosaccharides than aldoses.
Furthermore, enolization seems to be the rate-limiting step during isomer-
ization and degradation of monosaccharides in aqueous alkaline solutions
(15). Higher pH values and the presence of calcium ions increase the eno-
lization and retroaldolization rate (14,15).
The most critical area of question of this study was the possible degra-
dation of fermentable sugars during the treatments. When the temperature
Applied Biochemistry and Biotechnology Vol. 105-108,2003
).. 0'1
:g A B C N
~ ~
[ c 340
0
OJ '0
0' c
n ,8 80 ~
c
::,- '.g, 80 ...
~ E60 ~6O 8
<n' 8 g 240
~ "ii
8 40 '0
~4O .-J
;:,
"" Ol 20 ~ 20 :5
Q.. '0 ...
12 0
OJ :5 0 12 :9 0 140
0' ... .... -;;.
0 0
<ii
g. -;;. -;;.
;:,
o 64
Temperature ("C) Temperature ("C)
~
Fig. 3. Response surfaces (4-h treatment) for (A) furfural, (B) HMF, and (C) vanillic acid.
0'1
i',.)
~
A B C
160
...... 8 500 8 500
~ 400 ~ 400
120
j. ~ 300
.. ~ 300
.
«I
] '0 ~ 200
:s :9.... :5
....
...
0 0
100 12 0
?
"I- -;;. -;;.
~ ~
0-
~ 60 iil
Temperature ("C) :::J
......
~ !1l
N ......
Fig. 4. Response surfaces (4-h treatment) for (A) UV absorbance at 282 nm, (B) total phenolics determined by ~
§ HPLC (after 13.5-min elution), and (C) total phenolics determined by the Folin & Ciocalteu method. :-
Alkaline Detoxification of Hydrolysates 625
Table 1
Comparison of Relative Concentrations of Monosaccharides
(Percent Compared to Untreated Hydrolysate)
After Treatment with NaOH or Ca(OH)2 at Various Settings
Temperature Time
Alkali pH (0C) (h) Arabinose Galactose Glucose Mannose Xylose
NaOH 10.0 25 1 97 97 97 97 98
Ca(OHh 10.0 25 1 99 99 100 100 100
NaOH 10.0 60 1 92 92 89 87 86
Ca(OH)2 10.0 60 1 88 83 83 81 77
NaOH 9.0 80 1 85 78 76 71 67
Ca(OH)2 9.0 80 1 74 61 60 59 49
NaOH 9.0 80 7 59 42 45 38 20
Ca(OH)2 9.0 80 7 21 8 12 8 4
NaOH 10.5 42.5 4 89 84 80 79 73
Ca(OH)2 10.5 42.5 4 85 83 79 88 78
NaOH 10.5 42.5 7 81 79 75 74 69
Ca(OHh 10.5 42.5 7 65 46 65 63 42
Conclusion
The sugars in a dilute-acid hydrolysate of spruce treated with NaOH
showed no major changes in concentrations between pH 9.0 and 12.0 as
long as the temperature did not exceed 30°C. However, at 80°C and pH 12.0
all the sugars were completely degraded. Substituting NaOH for Ca(OH)2
led to more rapid sugar degradation. Along with the degradation of the
sugars, furfural and HMF were degraded whereas acetic and formic acid
were formed. However, the concentration of levulinic acid did not increase.
Separate phenolic compounds were affected differently by treatment with
alkali. Severe conditions resulted in an increase in total phenolics, possibly
as a combined result of sugar degradation and fragmentation of lignin
oligomers. The results suggest suitable limits for the conditions that should
be used for treatment with alkali and reveal the effect of the treatment on
specific sugars and inhibitory compounds.
Acknowledgments
This work was supported by grants from the Swedish National Energy
Administration.
References
1. Wheals, A. E., Basso, L. c., Alves, D. M. G., and Amorim, H. V. (1999), Trends
Biotechnol. 17,482-487.
2. Ando, 5., Arai, I., Kiyoto, K, and Hanai, S. (1986), J. Ferment. Technol. 64,567-570.
3. Clark, T. A. and Mackie, K L. (1984), J. Chern. Technol. Biotechnol. 34B, 101-110.
4. Larsson,S., Palmqvist, E., Hahn-Hagerdal, B., Tengborg, c., Stenberg, K, Zacchi, G.,
and Nilvebrant, N.-O. (1999), Enzyme Microb. Technol. 24, 151-159.
Abstract
Conversion of food wastes into lactic acid by simultaneous saccharifica-
tion and fermentation (SSF) was investigated. The process involves sacchari-
fication of the starch component in food wastes by a commercial amylolytic
enzyme preparation (a mixture of amyloglucosidase, a-amylase, and pro-
tease) and fermentation by Lactobacillus delbrueckii. The highest observed
overall yield of lactic acid in the SSF was 91% of theoretical. Lactic acid
concentration as high as 80 giL was attainable in 48 h of the SSF. The opti-
mum operating conditions for the maximum productivity were found to be
42°C and pH 6.0. Without supplementation of nitrogen-containing nutrients,
the lactic acid yield in the SSF decreased to 60%: 27 giL of lactic acid from
60 giL of food waste. The overall performance of the SSF, however, was not
significantly affected by the elimination of mineral supplements.
Index Entries: Food waste; lactic acid; simultaneous saccharificaiton and
fermentation; Lactobacillus delbrueckii; amyloglucosidase.
Introduction
Approximately 5,000,000 t of food wastes are generated annually in
South Korea. Most of the food wastes are landfilled or incinerated, and
groundwater contamination and emission of noxious gases and dioxins
have been frequently cited. Food waste management has therefore been an
important issue from the standpoint of environmental protection and con-
servation of resources.
Among the major components in food wastes are carbohydrates (starch
and cellulose) and proteins. The starch and cellulosic components of the
food waste can be hydrolyzed into monomeric sugars. The sugars from the
food wastes can be utilized as substrates for fermentative production of a
variety of chemicals including lactic acid. Lactic acid is widely used in the
*Author to whom all correspondence and reprint requests should be addressed.
food and chemical industries. Current demand for lactic acid in production
of biodegradable polymers (polylactic acid) (1) is bringing its status from a
specialty chemical to a commodity chemical.
Traditionally, hydrolysates of corn or potato starch have been used
as the feedstock for the fermentative lactic acid production process (2).
Lignocellulosic biomass has been currently tested as an alternative feed-
stock for lactic acid production (3-5). Municipal solid wastes have also
been evaluated as feedstock forlactic acid (6,7). Recently, Leeetai. (8) and
Loh et al. (9) studied lactic acid production from food wastes and reported
a product concentration of 20-40 giL from direct fermentation of food
wastes lasting 4 to 5 d. Amylolytic lactobacillus strains and other lactic
acid-producing organisms, such as Rhizopus oryzae (10,11), can directly
metabolize starch to produce lactic acid. However, they do so with a very
low fermentation rate giving a relatively low product yield, and low prod-
uct concentration (12). Enzymatic hydrolysis of starch and fermentation
of glucose to lactic acid are well-established industrial processes. Sepa-
rate enzymatic and microbial processing of food wastes can improve lac-
tic acid production over that of direct microbial conversion. In the present
study, we were interested in applying the enzymatic hydrolysis and fer-
mentation for conversion of food wastes to lactic acid in order to achieve
high product yield and production rate. The hydrolysis and fermentation
can be carried out separately or simultaneously. Simultaneous sacchari-
fication and fermentation (SSF) has been extensively investigated in con-
nection with ethanol production from starch or cellulosic feedstock.
Recently, it has been evaluated as a means of producing lactic acid (13).
Our research was undertaken to assess the technical feasibility of an SSF
process based on starch-hydrolyzing enzymes and lactic acid bacteria for
production of lactic acid from food wastes.
240L was specified to be 240 AGU ImL by the supplier, in which 1 AGU is
defined as the amount of enzyme hydrolyzing 1 !lmol of maltoselmin at
25°C and pH 4.3. It also contains controlled amounts of fungal amylase and
protease activities.
Microorganisms and Inoculumn Preparation
Homofermentative Lactobacillus delbrueckii NRRL B-445 (KCCM 40069,
renamed as Lactobacillus rhamnosus) was obtained from Korean Culture Cen-
ter of Microorganisms (KCCM). The lyophilized culture was transferred to
plates of solid Elliker broth (Difco) medium. The plates were incubated at
37°C for 36 h. The grown colonies either were used to prepare inoculum or
were stored at 4°C for later use. The microorganism on agar slants was trans-
ferred to a liquid Elliker broth medium and cultivated at 37°C for 36 h to be
used as inoculum in lactic acid fermentation experiments.
o 6 12 18 24
Time (h)
Fig. 1. Effect of enzyme loading on the enzymatic hydrolysis of food waste (65 giL)
at 55°C and pH 5.5.
40
-
-
~30
~\;:\
,
C
0
;:
......as
c
20
\
\
II)
u - lactic acid
c --- glucose
o 10
0
0
0 12 24 36 48 60 72
Time (h)
Fig. 2. Time course of lactic acid fermentation with pure glucose (30 giL) by L. del-
brueckii at 42°C and pH 6.0 using two different nitrogen supplements: (e) 15 giL of
yeast extract; (A) 15 giL of peptone.
---
0
..J
C)
C
80
60
-
:;
I!
C 40
CD
()
C __ glucose
0 --- lactic acid
0 20
0
0 12 24 36 48
Time (h)
Fig. 3. Time course of batch SSF run with food waste (120 giL) at 42°C.
The typical time course of lactic acid production from food waste by
SSF with SAN SUPER 240L enzyme and L. debrueckii is illustrated in Fig. 3.
During the SSF process, the food waste was saccharified to glucose, and the
glucose was then metabolized by the microorganism and converted into
lactic acid. Accumulation of glucose was seen in the initial phase of the SSF.
The fermentation then proceeded at a rate comparable with the fermenta-
tion rate of lactic acid by the same organisms under similar conditions
using glucose (Fig. 2). At the given SSF conditions, 70.1 giL of lactic acid
was produced from 120 giL of food waste in about 48 h, giving a yield of
78%. From this preliminary experiment, it was clear that food wastes can be
used as a resource for lactic acid production and that SSF could be an
effective bioprocess for producing lactic acid from the food wastes. To
further develop an SSF process for lactic acid production from food waste,
the effect of various operating parameters on performance was examined.
The parameters studied were pH, temperature, substrate concentration,
and nitrogen and mineral supplements.
Effect of pH and Temperature
In the SSF process, both bioreactions of carbohydrate hydrolysis by
enzymes and glucose fermentation by microorganisms occur simulta-
neously. Thus, optimum conditions of both bioreactions should be coinci-
dent for effective SSF operation. Generally, the SSF process requires
operating conditions that represent a compromise between the optimum
conditions of the enzyme and the microorganisms.
The optimum temperature of the L. delbrueckii was reported to be 37°C
by the supplier (KCCM). On the other hand, the optimum temperature for
Applied Biochemistry and Biotechnology Vol. 105-108, 2003
Production of Lactic Acid from Food Wastes 643
100 T'"""-------------------,
---
-lactic acid
---glucose
80
...I
C)
C 60
0
!...
A-~
(~~----
C
CD
U
40
I \
~
""-----
,i
c
-- ---- -- ----"1
.:a-_----...
0
0 20
----.............................
----
0
0 12 24 36 48
Time (h)
Fig. 4. Effect of temperature on batch SSF of food waste (145 giL): (e) 35°C;
(_) 45° C; (A) 55°C.
the SAN Super 240L enzyme was specified to be 40-55°C, as stated earlier.
We therefore selected 35, 45, and 55°C for the optimization study. As shown
in Fig. 4, at 35 and 45°C, 79.7 (yield 73%) and 77.2 giL (yield 71 %) of lactic
acid, respectively, were produced from 145 giL of food waste in 48 h. At
55°C, however, the fermentation rate was significantly reduced. The final
lactic acid concentration was reduced to 50.7 giL (yield 47%), leaving a
higher residual glucose concentration within the 48-h experiment. From
these studies, the optimum temperature would appear to be between 35
and 45°C. An operating temperature of 42°C was chosen for subsequent
SSF experiments. Note that this optimum temperature might vary with
different enzyme loadings and thus needs further study.
The optimum pHs for both the enzyme and the microorganisms were
similar, at about 6.0. The optimum pH of the SSF process was therefore
expected to be about 6.0. Figure 5 depicts the effect of pH on the lactic acid
production rate and yield. Lactic acid concentrations produced from 120
giL of the food waste in 48 h were 11.5, 54.2, 63.4, and 57.6 giL at the
operating pHs of4.0, 5.0, 6.0, and 6.5,respectively. The corresponding lactic
acid yields were 13,60, 71, and 64%. Maximum lactic acid production rate
was indeed observed at pH 6.0. In the SSF at pH 4.0, glucose was accumu-
lated throughout the reaction time, and lactic acid was formed very slowly.
This indicates that the SSF process was limited by the fermentation, prob-
ably owing to suppressed cell growth at this pH. In this set of experiments,
the pH was continuously controlled with 5 N NaOH in a 1.0-L (working
volume) fermentor. Interestingly, a slightly higher lactic acid yield (78%)
was produced in the shake-flask operation in which pH was controlled by
Applied Biochemistry and Biotechnology Vol. 105-108,2003
644 Kim et at.
~~-----------------------------------,
___ pH4
__ pH5
_ 60
~pH6
-
.J __ pH 6.5
0,
o 12 24 36 48
Time (h)
Fig. 5. Effect of pH on batch SSF of food waste (120 giL) at 42°C.
~~----------------------------------~
--
. .J
c;,
-a
30
'uas 20
:nas
U
o+-------~------~------~------~--~
o 12 24 36 48
Time (h)
Fig. 6. Effect of nitrogen sources on batch SSF of food waste (60 gil) at 42°C.
100
--
. .J
c;,
80
60
-a
'uas
u
:= 40
u
as
..J
_____ with mineral supplement
20
--- wlo minerai supplement
0
0 12 24 36 48
Time (h)
Fig. 7. Effect of mineral supplements on batch SSF of food waste (130 gil) at 42°C.
-a,
-
.J
"C
80
60
BO
60
--
ffl.
"C
'ii
':;'
'0 'C
co '0
,~ CO
...
40 40
ti U
j U
20 20 CO
__ lactic acid concentration .J
- - lactic acid yield
Fig. 8. Effect of food waste concentration on lactic acid yield in batch SSF at 42°C.
Conclusions
We have demonstrated that lactic acid production from food wastes
by way of SSF is technically feasible. The highest yield of lactic acid on the
Applied Biochemistry and Biotechnology Vol. 105-108,2003
Production of Lactic Acid from Food Wastes 647
basis of available carbohydrates in the food waste was 91 % of theoretical:
44.3 giL of lactic acid from 65 giL of food waste. A total lactic acid concen-
tration of 80 giL was attainable from 145 giL of food waste within 48 h of
the SSF, which is remarkably higher than the lactic acid concentration of
20-40 giL obtained in 4-5 d in a direct fermentation of food wastes (8,9).
Within the scope of our study, the optimum operating conditions for the
production of lactic acid were 42°C and pH 6.0. Without supplementation
of nitrogen sources, the yield of lactic acid in the SSF decreased to 60%:
27 giL of lactic acid from 60 giL of food waste. Elimination of all the
noncarbon nutrients other than yeast extract from the SSF medium did not
adversely affect lactic acid production. Yeast extract therefore appears to be
the only additional nutrient required to maintain optimum performance of
the SSF. This clearly indicates that the food waste used in this investigation
contains a sufficient amount of mineral sources needed for bacterial growth
and lactic acid production, which would be one of the economic benefits
associated with food waste. Although further, detailed economic analysis
is needed, the preliminary results of our study demonstrate that lactic acid
production using food wastes can be considered a promising way of food
waste management.
Acknowledgment
This research was supported financially by Kyonggido through
Kyonggi Regional Research Center at Kyungwon University, Korea.
References
1. Lipinsky, E. S. and Sinc1are, R. G. (1986), Chern. Eng. Prog. 82,26-32.
2. Vickroy, T. B. (1985), in Comprehensive Biotechnology, vol. 3, Blanch, H. W., Drew, S.,
and Wang, D.1. c., eds., Pergamon, New York, NY, pp. 761-776.
3. Schmidt, S. and Padukone, N. (1997), J. Ind. Microb. Biotechnol. 18,10-14.
4. Parajo, J. c., Alonso, J. L., and Santos, V. (1996), Process Biochem. 3,271-280.
5. Chen, R. and Lee, Y. Y. (1997), Appl. Biochem. Biotechnol. 63-65,435-447.
6. McCaskey, T. A., Zhou, S. D., Britt, S. N., and Strickland, R. (1994), Appl. Biochem.
Biotechnol. 45/46, 555-568.
7. Zhou, S. D. and McCaskey, T. A. (1996), Appl. Biochem. Biotechnol. 57/58,517-524.
8. Lee, B. S., Yoon, H. H., and Kim, E. K. (2001), Korean J. Biotechnol. Bioeng.16,207-211.
9. Loh, C. W., Fakhru'l-Razi, A., Hassan, M. A., and Karim, M. I. A. (1999), Artif. Cells
Blood Substit. Immobil. Biotechnol. 27,455-459.
10. Hang, Y. D. (1989), Biotechnol. Lett. 11,299-300.
11. Hamamci, H. and Ryu, D. D. Y. (1994), Appl. Biochem. Biotechnol. 44, 125-133.
12. Bigelis, R. and Tsai, S. P. (1995), in Food Biotechnology-Microorganisms, Hui, Y. H. and
Khachatourians, G. G., eds., VCH, New York, NY, pp. 239-280. .
13. Linko, Y. Y. and Javanainen, P. (1996), Enzyme Microb. Technol. 19, 118-123.
14. Ehrman, T. (1992), NREL Chemical Analysis and Testing Standard Procedure, No. 002,
National Renewable Energy Laboratory, Golden, CO.
15. Nelson, N. (1944), J. BioI. Chern. 153,375-380.
Microbiologic Oxidation
of Isosafrole into Piperonal
Abstract
The biotransformation ofisosafrole by Cladosporium sphaerospermum yielded
piperonal, which is a compound of great commercial importance in the flavor
and fragrance industries. The experiments were performed in SOO-mL conical
flasks containing 100 mL of Czapek-modified medium in an orbital shaker
with controlled agitation and temperature. Spores of C. sphaerospermum were
used as inocula, and after 96 h of incubation the substrate was added to the
culture. Samples of 2 mL were withdrawn at 24-h intervals and analyzed by
gas chromatography, (GC) and/or GC/MS spectroscopy.
Introduction
Oxidation is one of the most studied processes in the biologic transfor-
mation of organic compounds besides reduction (1). The simplest and most
suitable microbiologic process is the direct incorporation of oxygen to an
exogenous (or xenobiotic) substrate from molecular oxygen, because
dioxygen is the cheapest oxidant in the chemical industry (2). Therefore,
"Author to whom all correspondence and reprint requests should be addressed.
oyyCHO
~-V
E- and Z-Isosafrole Safrole Piperonal
Table 1
Compositions of Different Media for First Adaptation
of Lyophilized Microorganisms
Luria-Bertani Czapek-Dox Sabouraud-dextrose
Compound broth (giL) agar (giL) agar(g/L)
NaN03 3.00
K2HP04 1.00
MgS04·7H20 0.50
KCl 0.50
FeS04·7H20 0.30 0.01
Sucrose 30.00
Glucose 40.00
Agar 30.00 30.00
Tryptone 10.00
NaCl 10.00
Yeast extract 5.00
Neopeptone 10.00
Brazil). The solvents used were of analytical grade and were supplied from
VETEC (Rio de Janeiro, Brazil). All other chemicals and those used in the
broth medium were of analytical grade and purchased from Sigma/ Aldrich
(St. Louis, MO).
Microorganisms
The strains of lyophilized microorganisms belonging to different gen-
era were obtained from the different institutions: Aspergillus flavus, C.
sphaerospermum, Aspergillus niger, Pseudomonas putida, and Pseudomonas
aeruginosa were generously supplied by the Funda<;ao Instituto Oswaldo
Cruz (Rio de Janeiro, Brazil). Bacillus subtilis and Saccharomyces cerevisiae
were obtained from the Instituto de Microbiologia of the Universidade do
Brasil (Rio de Janeiro, Brazil).
Bacteria were cultivated in Luria-Bertani broth (20), and fungi and
yeast inCzapeck-Dox agar andSabouraud-dextrose agar (21),respe ctively.
Bacteria and yeast were cultivated at 26°C for 48 h and fungi at 26°C for 120
h. We used this procedure in the first inoculum condition (Table 1).
Applied Biochemistry and Biotechnology Vol. 105-108,2003
Oxidation of Isosafrole into Piperonal 653
Screening of Biotransformation Assay
Glass tubes (1 x 20 cm) were filled with 5 mL of the different broth
media. Each strain was inoculated in an individual tube, by a platinum
loop, containing its respective culture medium. Only spores were trans-
ferred from fungi. Bacteria and yeast were grown normally. The tubes were
properly closed with a wad of hydrophilic cotton and maintained in an
orbital shaker (150 rpm, 26°C). Under these conditions bacteria and yeast
were grown for 12 h and filamentous fungi for 96 h. After these periods, 0.2
mL of substrate emulsified with a 1% tween-80 suspension was added to
each respective tube. These cell cultures were incubated in the same initial
cultivation conditions. After 24 h, two tubes of each strain were removed
from the culture and submitted to the extraction procedure. All experi-
ments were carried out in parallel with controls, in the same conditions,
without the presence of microorganism.
Fungal Growth and Culture Medium
The strain of lyophilized spores of C. sphaerospermum 2950 was sus-
pended in 1 mL of 1% NaCl solution. This suspension was used to inoculate
Czapeck-modified agar plates. The growth and sporulation of mycelia was
maintained at 26°C for 5 d. Cultivation conditions were accomplished in
Czapeck-modified broth medium, containing 20 giL of sucrose, 2.0 giL of
NaN03, 1.0 giL ofKH2P04,1.0 giL of MgS04·7H20, 0.010 giL of (NH4)S04
and 0.50 giL of FeS04·7H20. The salts and carbon source were dissolved in
distilled water, made up to 100 mL, and transferred to 250 mL Erlenmeyer
flasks. The flasks containing the medium were sterilized at 121°C (1 atm)
for 15 min.
Several strains of different filamentous fungi microorganisms were
inoculated in a slant test tube containing 20 mL of Czapeck-modified agar
(30 giL) by a platinum loop. Only spores were transferred from the agar
plate. They were cultivated at 26°C for 5 d. After this period, the spore
suspensions were prepared with 10 mL of 1% NaCl solution. One milliliter
of the microbial suspension was used to inoculate 100 mL of sterilized
medium in a baffled 250-mL Erlenmeyer flask and maintained in a shaker
at 150 rpm and 26°C.
Addition of Substrate
After 4 d, 2 mL of substrate emulsified in a 1% Tween-80 and 1 mL
of 30% (v Iv) H 20 2 were added to the Erlenmeyer flask, and the pH was
adjusted to 3.0 with glacial acetic acid. The flask was returned to the initial
incubation conditions. Samples of 2 mL were withdrawn at 24-h intervals
from the medium and submitted to an empty test tube for extraction of the
product, as described next.
Extraction Procedure
The addition of 2 mL of ethyl acetate to the cell cultivation allowed
extraction. In each experiment, the mixture was submitted to agitation in
Applied Biochemistry and Biotechnology Vol. 105-108,2003
654 Santos et al.
a vortex shaker (without glass beads) for 20 s. Then it was left to decant for
3 min, and after organic phase separation, a lo5-mL aliquot was withdrawn,
filtered (through a Millipore 0.45-~m membrane), and transferred to a
4-mL glass septum capped viaL The samples were then submitted to gas
chromatography (GC) and/or GC/mass spectroscopy (MS) analyses.
<.
o~ I C. sphaerospermum..
o ~
4-( 1- propenila- E)-I,2- methylenedioxybenzene 4-carboxaldehyde-l,2methylenedioxybenzene
2.4e4 (I)
2.2e4
c!O'
5·
2.0e4 (j
1.8e4 ii
1.6e4
'"~
(j
1.4e4 ~
1.2e4
51>-l
l.0e4
§
~
.s>.
8000 b
6000
4 6 8 10 12 14 16
Time (min.)
(I)
c!O.
7.0e4
5'
6.0e4 (j
ii
S.0e4
'"
(j
~
4.0e4
~
3.0e4 51>-l
2.0e4
§
t:l
>-'
1.0e4 b
4 6 8 10 12 14 16
Time (min.)
(Fig. 4). Results of the GC/MS analysis confirmed the presence of the prod-
uct, which was characterized through the mass spectrum, compared with
standards in the Wiley /NBS database libraries.
Applied Biochemistry and Biotechnology Vol. 105-108,2003
656 Santos et al.
Table 2
Results from Screening of Biotransformation
Microorganisma Strain Product yield (%)
P. aeruginosa INCQS 00311 3.01
P. putida INCQS 00113 1.38
Control C1 0.00
A. niger IOC 4222 3.71
A.flavus IOC 3974 3.53
C. sphaerospermum IOC 2950 4.74
Control C2 0.65
aCl was the control for bacteria and C2 was the control for fungi.
Conclusion
Our results show that C. sphaerospermum, in the presence of H 20 2,
effected the formation of 4-carboxaldehyde-1,2-methylenedioxybenzene
with 100% selectivity. This microorganism is a promising biotransforma-
tion agent capable of reaching high conversion yields of isosafrole in the
desired product. The need of for H 20 2 indicates the action of a peroxidase
instead of a monooxygenase, wich should be specifically involved since it
is normally expressed in conditions of stress.
Acknowledgments
We acknowledge financial support from CAPES, PROCAD, CNPq,
FAPERJ, and PRONEX.
References
1. Roberts, S. M. (2000), J. Chem. Soc. (Perkin Trans. 1) 611-633.
2. Moro-oka, Y, and Akita, M. (1998), Catalysis Today 41, 327-338.
3. DeMontellano, P. R. O. (1995), Cytochrome P-450 Structure, Mechanism and Biochemis-
try, 2nd ed., Plenum, New York.
4. Archelas, A. and Furstoss, R. (1997), Annu. Rev. Microbiol. 51,491-525.
5. Groves, J. T. and Neumann, R. (1989) J. Am. Chem. Soc. 111,2900-2909.
6. Mansuy, D. (1994), Pure Appl. Chem. 66(4), 737-744.
7. Narimatsu, S; Kobayashi, N.; Masubuchi, Y., Horie, T., Kakegawa, T., Kobayashi, H.,
et al. (2000), Chem. Bioi. Int. 127, 73-90.
8. Faber, K (1995), Biotransformations in Organic Chemistry, 2nd ed., Springer-Verlag,
Berlin, Germany.
9. Prelog, V. (1964), Pure Appl. Chem. 9,119-130.
10. Seebach, D., Sutter, M. A, Weber, R. H., and Zuger, M. F. (1984), Org. Synth. 63,1-10.
11. Welsh, F. W., Murray, W. D., and Williams, R E. (1989), Crit. Rev. Biotech. 9(2),105--169.
12. Costas, M., Chem, K, and Que, L. Jr. (2000), Coord. Chem. Rev. 200-202,517-544.
13. Gonsalves, A M. d' A R, and Pereira, M. M. (1996), J. Mol. Catal. A: Chem. 113,209-211.
14. Kato, Y. and Asono, Y. (2001), J. Mol. Catal. B: Enzymat. 13,27-36.
15. Conesa, A, Punt, P. J., and van den Hondel, C. A M. J. J. (2002), J. Biotechnol. 93,
143-158.
16. Delaforge, M., Jaouen, M., and Bouille, G. (1999), Envir. Toxicol. Pharm. 7, 153-158.
17. Keseru,G.M., Balogh,G. T.,Arvai,G.,and Bert6k, B. (1999), Tetrahedron 55,4457-4466.
18. Shimoni, E.; Ravid, V., and Shoham, Y. (2000), J. Biotechnol. 78, 1-9.
19. Kakko, I., Toimela, T., and Tahti, H. (2000), Chemosphere 40, 301-305.
20. Cappuccino,J. G. and Scherman, N. (1992), Microbiology: A Laboratory Manual, 3rd ed.,
Beijamings Curmmings, New York, NY.
21. Demain, A L. and Solomon, N.A (1986), in Manual of Industrial Microbiology and
Biotechnology, John Wiley & Sons, New York, NY, 97-121.
22. Adams, R P.(1995), Identification of Essential Oil Components by Gas Chromatography/
Mass Spectroscopy, Allured Publishing, Carol Stream, IL.
23. Barreiro, E. J. and Fraga, C. A M. (2001), in Quimica Medica: As Bases Moleculares da
Apio dos Ftirmacos, Artmed Editora, Porto Alegre, Brazil, pp. 182-185.
24. Adam, W., Lazarus, M., Saha-M6ller, C. R, Weichold, 0., Hoch, V., Haring, D., and
Schreier, P. (1999), Adv. Biochem. Eng. Biotechnol. 63,73-108.
Abstract
Protein foams can be used to extinguish fires. If foams are to be used to
extinguish fires where people are present, such as in high-rise buildings or
ships, then a method for allowing people to breathe in a foam-filled envi-
ronment is needed. It is proposed that the air, used to create the foam be
used for breathing. A canister that will break incoming air-filled foam has
been designed for attachment to a standard gas mask, in order to provide
breathable air to a trapped person. Preliminary results for the modified
mask indicate feasibility of breathing air from air-filled protein foam.
Index Entries: Protein foams; egg albumin; canister; polypropylene sheet;
airflow; breakthrough.
Introduction
Protein foams, such as egg albumin foam, are comprised ofhydropho-
bic proteins that are efficient and inexpensive products for extinguishing
smoldering or other difficult-to-put-out fires. These fires can even be those
fed by large amounts of fuel such as in oil, coal, and chemical fires. These
types of fires also have the ability to give off considerable heat, which
creates resistance toward conventional fire suppression with water. Unlike
water, protein foam has the ability to extinguish a fire through its ability to
separate the oxygen supply from the fire. To exclude air from a fire, the
foam must completely fill the fire zone and the fire zone must remain com-
pletely filled to allow cooling to proceed.
When people are present in fires such as those in warehouses, air-
planes, ships, or even space capsules, an additional problem occurs: people
Model No. 1
I
Screen Cone
12
t
I
Model No. 2
I ~ ~ ~ I
'\ t t
Screen Cone
Model No. 3
I [> I
t
Shop-Vac Foam Sleeve Cone
Model No. 4
I ~ ~ I
t '\
Shop-Vac Foam Polypropylene\
Sleeve Cone Screen Cone
I ~
J
~ I
'\pOlypropylene\
Screen Cone
Shop-Vac Foam
Sleeve Cone
Fig. 1. Diagrams of each model as described in Materials and Methods. Each filter-
ing device is labeled and indicated with an arrow. Diagrams are not drawn to scale.
air intake port of the gas mask. The other end was open and submerged
in foam.
The foam-breaking devices included a 1 x 1 mm grid size fiberglass
screen rolled into a cone, a piece of the foam sleeve rolled into a cone, and
a polypropylene sheet, or a combination of the three. The foam sleeve is a
porous material approx 1 cm thick with openings about 0.5-1 mm in diam-
eter. The five canister models tested with the corresponding foam-breaking
methods are illustrated in Fig. 1.
Applied Biochemistry and Biotechnology Vol. 105-108,2003
662 Ackermann et al.
Table 1
Tested Canister Model Types and Corresponding Foam-Breaking Methods·
Model Foam-breaking Perceived resistance
no. method used (Borg CRI0 scale) (mean :t: SD)
1 One 15-cm fiberglass screen cone 2 :t: 0 (with and without foam)
2 Three 8-cm fiberglass screen cones 2 :t: 0 (with and without foam)
loaded in series
3 One 15-cm Shop-Vac foam sleeve cone 2.5 :t: 0 (with and without foam)
4 One to-cm Shop-Vac foam sleeve 3.25 :t: 0.35 (with and without
cone, one 10-cm polypropylene/ foam)
screen (skeleton) cone loaded in series
5 One 10-cm Shop-Vac foam sleeve cone, 3.75 :t: 0.35 (no foam)
one to-cm polypropylene/ screen
(skeleton) cone, polypropylene sheet
loaded in series, 5-cm-diameter
PVC elbow
6 One to-cm foam sleeve cone, one to-cm 8.5 :t: 0.71 (foam)
(model 5 polypropylene/screen (skeleton) cone,
with foam) polypropylene sheet loaded in series,
5-cm-diameter PVC elbow
•All perceived resistance values are based on evaluation by two of the authors (DA, DJ).
There was no noticeable difference between the perceived resistance for both dry and wet
foam-filled models for models 1-4. The perceived resistance with and without foam was
noticeable for model 5 and is indicated above.
Fig. 3. Laser foam fractionation column setup. (Bottom right) Laser beam shining
through foam in dark.
Zone 3
Best operating zone
for both extingui hing
fire and for breathing
through a rna k
Foam
Bubble
Diameter
Albumin
oncentration
Colle
Fig. 5. Evolution of foam through each model as described in Results and Discus-
sion. Foam flows from left to right. Denser bubbles indicate small-diameter foam. Each
filtering device is labeled and indicated with an arrow.
!c 4
!
:i'rJ
II: 3.5
.=0
OI(1)
.c..- 3
15
me'
'tJ 0 2.5
GIlD
> .....
•~ 2
~
1.5 +----.-------r-------r-----,
7.8 8.3 8.8 9.3 9.8
Flow Rate (Llmln)
12
10
>
~ 6
'0
'#.
4
0+---------.--------.,--------.---------,
o 5 10 15 20
Tim. (min)
Fig. 7. Percentage of maximum voltage from photocell reading transmitted laser light
with respect to time. The voltage across the photocell climbs to approx 9% of V max (mean
Vmax ± SO = 2350 ± 127.92 m V) after 15 min. This is a measure of the resistance to the
penetration of laser light through the foam in the column at approx 40 cm above the
initial bulk liquid/ foam interface. The initial solution contains an albumin protein con-
centration of 1 giL. The solution is allowed to foam to a height of 71 cm above the initial
bulk liquid/foam interface.
100
90
80
l§! 70
0 60
i
a: 50
c
0
:0:;
:::I 40
;g 30
~
20
10
0
0 5 10 15 20
Tim. (min)
10
8
>C
ca
E
> 6
'0
'#.
4
0
0 20 40 60 80 100
% Foamate Liquid Recovered
Fig. 9. Cross plot of percentage of foamate liquid recovered and percentage of maxi-
mum voltage from photocell reading transmitted laser light. This figure can be used to
determine the relative foamate liquid content as a function of laser light transmittance.
140
.c
....
at
::I 120
0
.s:
•..
0lil:
It
100
II
E
80
"
~ 60
'j!
:::)
40
..•
.c
..•"
II
20
0
0 1 2 3 4 5 6 7 8 9 10
Perceived Breathing Resistance (Borg 10 Scale)
Fig. 10. Correlation of breaths until foam breakthrough into mask to perceived
breathing resistance as determined using the Borg 10 scale. The trend shows an
increase in breaths until breakthrough with an increase in perceived breathing resis-
tance. The datum point to the right represents the type 5 model when saturated by
foam. Model no. 5 did not reach breakthrough but exceeded a feasible breathing
resistance on the Borg CR10 scale.
Conclusion
Further tests need to be run to design a canister model that allows for
the breakage of smaller-diameter and wetter foams. We have shown that it
is feasible to breathe air from an air-generated foam reaching 120 breaths
in succession. Further work is needed to extend the working time and
breakage ability of the canister-modified gas mask breathing device.
References
1. Snyder, D. (2001), C-3 Chem/bio Gas Mask. Gas Mask USA. (Website: www.gasmask
usa.com)
2. Borg, G. (1998), Borg's Perceived Exertion and Pain Scales, Human Kinetics, Champaign,
IL.
3. Daley, R. (2002), Exp 137: Electromagnetic Spectrum. Lab on Legs: Energy and Change
March 28,2002. CSIRO South Australia Education Programs. Available at Website:
www.csiro.au/adelcsirosec/Pdf/Exp137.PDF. Accessed April 27, 2002.
Abstract
The objective of this study was to obtain purer acid phosphatases than
produced by prior art by operating under conditions that improve the final
product. The study features are the use of a mild nonionic detergent, 40-80%
saturation with (NH4)2S041 maintained at low temperature to remove impu-
rity, and the use of chromatografic columns to concentrate the acid phos-
phatase and remove non-acid phosphatase proteins with lower or higher
molecular weights. Acid phosphatase was isolated and purified from garlic
seedlings by a streamline method without the use of proteolytic and lipolytic
enzymes, butanol, or other organic solvents. Grown garlic seedlings of 10-
15 cm height were homogenized with 0.1 M acetate buffer containing 0.1 M
NaCI and 0.1% Triton X-100. After homogenization, the supernatant was
filtered with paper filters. Filtrated supernatant was cooled to 4°C, followed
by a threestep fractionation of the proteins with ammonium sulfate. The
crude enzyme was isolated as a green precipitate that was dissolved in a
small amount of 0.1 M acetate buffer containing 0.1 M NaCI and 0.1 % Triton
X-100. Garlic seedling acid phosphatase was purified with ion-exchange
chromatography (DEAE cellulose). The column was equilibrated with 0.1 M
acetate buffer. Acid phosphatase was purified 40-fold from the starting
material. The specific activity of the pure enzyme was 168 U / mg. A variety
of stability and activity profiles were determined for the purified garlic seed-
ling acid phosphatase: optimum pH, optimum temperature, pH stability,
temperature stability, thermal inactivation, substrate specificity, effect of
enzyme concentration, effect of substrate concentration, activation energy,
and effect of inhibitor and activator. The molecular mass of acid phosphatase
was estimated to be 58 kDa by sodium dodecyl sulfate polyacrylamide gel
electrophoresis. The optimum pH was 5.7 and the optimum temperature was
50°C. The enzyme was stable at pH 4.0-10.0 and 40-60°C. Activation energy
was between 10 and 20 kcal, and as Michaelis Menten coefficients, Vm values
Introduction
Phosphate esters are widely distributed in any organism. While many
metabolic intermediates are activated through the transfer of phosphate
groups, it is equally important that phosphate esters can also be rapidly
broken down. The hydrolytic removal of phosphate groups from phos-
phoesters is catalyzed by phosphatases. Depending on the pH at which
such phosphatases have optimal activity, one can distinguish between
acidic phosphatases (also called acid phosphatases) and alkaline phos-
phatases. The latter enzymes require divalent metal ions as co factors and
are common in animal tissues and bacteria (1).
Acid phosphatases are enzymes that hydrolyze the terminal phosphate
of phosphomonoesters, thus releasing inorganic phosphate. The optimum
pH for hydrolysis is in the range of 4.0-6.0. These enzymes are ubiquitous in
bacteria, fungi, animals, and plants (2). Studies of acid phosphatases from
various plant sources suggested their roles during the solubilization of mac-
romolecular organic phosphates in soils and the mobilization of phospho-
rous reserves during germination (3). Most studies of acid phosphatase,
particularly those from plant sources, are largely of a descriptive nature.
With a few exceptions (notably human prostatic acid phosphatase), the acid
phosphatases occur in very small quantities, are unstable in dilute solution,
and are subject to surface denaturation when purified. These factors,
together with a tendency to occur in multiple forms or as isoenzymes, make
the isolation of highly purified acid phosphatase difficult (4).
Materials and Methods
Garlic seedlings were grown from Kastamonu Seedlings, Turkey.
Chemicals (paranitrophenyl (p-NP), paranitrophenylphosphate (p-NPP),
4-nitrophenylphosphate) were obtained from Sigma, England. All other
chemicals (ammonium sulfate, NaOH, ammonium, sodium acetate, acetic
acid, citric acid, NaCl, ammonium hydrogen phosphate, sodium hydrogen
phosphate, potassium dihydrogen phosphate, sodium pyrophosphate
decahydrate, sodium pyrophosphate, D-glucose-6-phosphate, pyridoxal-
5-phosphate) were obtained from Merck, Germany. DEAE-cellulose anion
exchanger (Sigma) was used for column chromatography.
Specific Activity Assay
For substrate p-NPP, hydrolysis was determined by measuring inor-
ganic phosphate released by the acid phosphatase reaction. Phosphatase
Applied Biochemistry and Biotechnology Vol. 105-108, 2003
Purification of Acid Phosphatase from Garlic 679
activity was assayed in 0.1 M of sodium acetate buffer (pH 5.5) containing
0.1 M NaCl and 0.1% Triton X-100, and 50 mM substrate at pH 5.5.
Enzyme 0.25 mL was added to 2.25 mL of substrate solution. Buffer solution
(0.25 mL) instead of enzyme was used for blank sample. The reaction mix-
tures were incubated at 37°C for 30 min. Reactions were quenched by
sequential addition of 2.5 mL of 20 mMNaOH solution. The absorbance was
read at 405 nm. A standard curve of p-NPP was constructed. One unit of
phosphatase activity was defined as the amount of enzyme required to
produce 1 (mol of free Pi/min from 5 mM of p-NPP at pH 5.5 and 37°C.
Protein concentration was determined with an ultraviolet spectrophoto-
meter at 280 nm.
Purification of Enzyme
Garlic seedlings were grown in 3-,6-, and 9-wk periods. Crude extract
was obtained and ammonium sulfate saturation was applied for each
period. It was observed that 3- and 6-wk-old seedlings were quite unstable
and lost their activities in a short time. On the other hand, 9-wk-old seed-
lings did not show activity loss during almost 10-12 wk. As a result, the
purification procedure was carried out with 9-wk-old seedlings. The steps
for purification were homogenization, centrifugation, saturation, and ion-
exchange chromatography.
Garlic seedlings (9 wk old) were first washed free from soil and
weighed. They were homogenized in 0.1 L of 0.1 M sodium acetate buffer,
pH 5.5 (O.lMNaCl,O.l % TritonX-100), with a Waring blender atlow speed
for 20 s and then high speed for 30 s. The crude extract was filtered through
black filter paper and white filter paper, respectively. The crude extract after
filtration was centrifuged for 5 min at 20,000 rpm to get a clear extract. The
supernatant and precipitate were obtained. The precipitate was then resus-
pended in a minimum amount of buffer solution. Solid ammonium sulfate
was added to the supernatant to change the solubility of proteins and to
precipitate the proteins. First 40% was brought to saturation with ammo-
nium sulfate (25 g/100 mL). Stirring at about 4°C was continued for 2 h, and
the mixture was then centrifuged for 30 min at 20,000 rpm. The supernatant
and precipitate were separated. The supernatant was retained and ammo-
nium sulfate concentration was increased first to 60% (39 g/ 100 mL) then to
80% (52.3 g/100 mL). After stirring and centrifuging as just described, the
second supernatant and precipitate were obtained, which were then resus-
pended in a minimum amount of buffer.
A 20-mL sample of supernatant obtained after ammonium sulfate satu-
ration and centrifugation was loaded onto a DEAE cellulose ion-exchange
chromatography column (2 x 60 cm) that had been preequilibrated with
0.1 M sodium acetate buffer, pH 5.5. The protein was eluted with the same
buffer using a fraction size of 5 mL at the rate of 1/7 mL/min. Fractions
containing the majority of the acid phosphatase activity were pooled for
activity assay. The activity of acid phosphatase at the end of each of the
preparative steps was measured by spectrophotometric method.
Applied Biochemistry and Biotechnology Vol. 105-108,2003
680 YenigOn and GOvenilir
6-
;--
-~
,~
I\.)
§
Purification of Acid Phosphatase from Garlic 683
100
80
ti 60
<r;
~ 40
Is'<
20
0
0 20 40 60 80 100
TEMPERATURE, C
120
O+---~~~~----r---~----~--~----~---'
3 4 5 6 7 8 9 10 11
pH
have been described, few present any evidence for the catalytic purity of
the preparations (8).
To determine the effect of some parameters on partially purified acid
phosphatase enzyme and its stability, pH and temperature assays were
done. Activity of garlic acid phosphatase toward p-NPP was investigated
since some enzymatic activity toward this substrate is present in many
plant-sourced acid phosphatases. p-NPP could be obtained in an optically
active form, with the chirality at phosphorus.
Enzyme activity was stable between pH 5.5 and 7.5 and 40-60°C.
Maximum activity was obtained at pH 5.7, and garlic seedling acid phos-
phatase presented high activity at 50°C, which is higher than described for
some other plant phosphatases, such as barley roots (30-35°C) and cotton
seed (37°C), when p-NPP was used as substrate (9) as shown in Figs. 1-4.
The activity of acid phosphatase toward various substrates is shown
in Table 2. We used some inorganic and organic phosphates that were not
commonly used in the literature, to examine whether the isolated enzyme
could be used in remediation as phosphate decomposer. Garlic acid phos-
phatase did not show activity with most of these substrates, a few of
which were utilized successfully with other acid phosphatases reported
in the literature (7).
Applied Biochemistry and Biotechnology Vol. 105-108,2003
684 Yenigiin and Giivenilir
120
><
~ 100
!-I 80
~
~ 60
~40
~ 20
~ 0 +-------r------.------~------,_----_.
o 20 40 60 80 100
TEMPERATURE. C
120
>-
t: 100
>
~ 80
~ 60
>
~ 40
5lc:: 20
~
0+----..----.----.-----.----.----.----,
4 5 6 7 8 9 10 11
pH
Fig. 4. PH stability.
2,5
E 2
E --17 U/ml
II')
1,5 ___ 8.5 U/ml
~
CIl --4.25 U/ml
a:I
« ___ 2. 125 U/n
0,5
0
0 10 20 30 40 50 60 70
TIME. min
Table 2
Substrate Specificity
Specific activity
Substrate name (U Img)
Di.-ammonium phosphate 0
Di.-sodium phosphate 0
Potassiium phosphate 0
Sodium pyrophyosphate 0
Tetrasodium pyrophosphate decahydrate 0
D-Glucose-6-phosphate 0
Pyridoxal-5-phosphate 1.5
0-Phosphorylethanolamine 0
Table 3
Substrate Concentration
Time (min) 1.25 mM p-NPP 2.5mMp-NPP SmMp-NPP
10 0.625 0.517 0.577
30 1.388 1.464 1.528
50 1.579 1.552 1.661
Fig. 7. Lineweaver-Burk plot of acid phosphatase activity with p-NPP and p-NP as
substrate at pH 5.5.
Table 4
Effect of Metal Ions on Enzyme Activites
None 100
Copper 66
Molybdate 40
Manganese 66
Dodium 163
Calcium 165
Potassium 215
"Relative activity is expressed as percentage of the
activity of no addition.
lipases. For further information about this situation, amino acid composi-
tion of this enzyme should be investigated.
Only two substrates, p-NPP and p-NP, were used for Michaelis kinetic
constants. Figure 7 shows that V mfor p-NPP was 100 mM/ s and Km was
21.27 mM, while V mfor p-NP was 20 mM/ sand K". is 8.33 mM. It is obvious
that the reaction was faster with p-NPP. Nonlinear plots may be owing to
diesterase contaminants. p-NPP could be a substrate for some possible
diesterase contaminants since it has been proposed as a specific substrate
for certain phosphodiesterases (5).
The effects of several substances on enzyme activity with p-NPP as
substrate were measured (Table 4). Inhibition of acid phosphatases by cop-
per, manganese, and molybdate has been observed in sweet potato, cul-
tured tobacco cells, rice bran, gladiolus bulbs (7), Japanese radish (7),lentil
seeds (10) and wheat germ (3). On the other hand, the activators sodium,
calcium, and potassium, are also listed Table 4. Calcium has been observed
in wheat germ (3), sweet Spanish (2), and rice bran (11).
Applied Biochemistry and Biotechnology Vol. 705-108,2003
Purification of Acid Phosphatase from Garlic 687
. The activation energies were between 10 and 20 kcal. Substrate con-
centrations ranged between 1.25 and 20 mM for p-NPP and p-NP, a result
quite parallel with findings in the literature. Activation energy was slightly
higher with p-NP.
Initial velocity rates were determined with different substrate con-
centrations of 5,10,15, and 20 mM. Activities after 5 min were found to
be 2.8 x 10-3, 4 X 10-3, 6.4 X 10-3, and 6.9 x 10-3, respectively.
Considering the specific activities despite the little weight of the
seedlings and small volume of the crude extract, it can be concluded that
the seedlings consist of a significant amount of acid phosphatase enzyme.
Further studies using a more appropriate purification procedure may
lead to the use of garlic seedlings as an economic source of acid phos-
phatase enzyme.
References
1. Price,N. C. (1982), Fundamentals ojEnzymology,Oxford University Press, Oxford, UK.
2. Guo, J., Pesacreta, T. C. (1997), Plant Physiol., 151, 520-527.
3. Kawarasaki, Y., Hiedo, N., and Yamane, T. (1996), Plant Sci. 119,67-77.
4. Van Etten, R. 1. and Waymack, P. P. (1991), Arch. Biochem. Biophys. 288,621--623.
5. Hye-Shin, C. P. and Van Etten, R. 1. (1986), Phytochemistry 25(2), 351-357.
6. Deveci, N. and Guvenilir, Y. (1995), Appl. Biochem. Biotechnol. 53.
7. Yoshimoto, M., Kimura, T., Miyamoto, T., Sakamoto, J., and Hatano, S. (1992), Biosci.
Biotech. Biochem. 56(1),147-148.
8. Van Etten, R. 1. and Waymack, P. P. (1991), Arch. Biochem. Biophysics 288(2), 634--645.
9. Verissima Ferreira, c., Granjeiro, J., Taga, E., and Aoyama, H. (1986), Biochem. Biophys.
Res. Commun. 242, 282-286.
10. Bose K. S. and Taneja V. (1998), Biochem. Biophys. Res. Commun. 25, 629--634.
11. Hayakawa, T., Toma, Y., and Igaue, I. (1989), Agric. Bioi. Chem. 53(6), 1475-1483.
Abstract
Recent developments in molecular breeding and directed evolution have
promised great developments in industrial enzymes as demonstrated by
exponential improvements in ~-lactamase and green fluorescent protein
(GFP). Detection of and screening for improved enzymes are relatively
easy if the target enzyme is expressible in a suitable high-throughput
screening host and a clearly defined and usable screen or selection is avail-
able, as with GFP and ~-lactamase. Fungal cellulases, however, are difficult
to measure and have limited expressibility in heterologous hosts. Further-
more, traditional cellulase assays are tedious and time-consuming. Mul-
tiple enzyme components, an insoluble substrate, and generally slow
reaction rates have plagued cellulase researchers interested in creating
cellulase mixtures with increased activities and/ or enhanced biochemical
properties. Although the International Union of Pure and Applied Chem-
ists standard measure of cellulase activity, the filter paper assay (FPA), can
be reproduced in most laboratories with some effort, this method has long
been recognized for its complexity and susceptibility to operator error. Our
current automated FP A method is based on a Cyberlabs C400 robotics deck
equipped with customized incubation, reagent storage, and plate-reading
capabilities that allow rapid evaluation of cellulases acting on cellulose and
has a maximum throughput of 84 enzyme samples per day when perform-
ing the automated FPA.
Index Entries: Filter paper assay; cellulase; cellulose; Trichoderma reesei;
filter paper unit.
Introduction
Fig. 1. Layout of Cyberlabs C400 robotics deck. 1, probe head; 2, ALPS plate sealer;
3, tip storage; 4, plate storage; 5, chilled reagent/plate rack; 6, plate reader; 7, incubators.
Fig. 2. Custom-modified microtiter plate incubators showing (A) brass insert guides,
lid, and aluminum form-fitting inserts and (B) closeup of brass plate lid and aluminum
insert. The gripper arm of the probe head moves the incubator lids and the individual
brass plate lids.
Automated:
1.325 mg glc 1 !J.ffiol glc 1 .
mL x 0.18016 mg glc x 60 min = 0.123 !J.ffiol glc/(mm . mL)
Evaporative Losses
Methods were examined to determine the extent of water loss from
the plates under various incubation conditions, including uncovering the
plates; humidifying the incubator with water-saturated filter pads; and
using plastic lids, mineral oil overlays, or preheated brass lids. Each
method was tested by filling the plate with 80 or 300 ilL of water, weigh-
ing, and heating it at 50°C for 1 h. After incubation, the plates were
weighed and average water loss per well was determined.
Applied Biochemistry and Biotechnology Vol. 105-108,2003
FPA to Determine Cellulase Activity 695
20 •
0
NREL grown - T. reesei Strain L27
Roal Oy Commercial Preps
•
V
Genencor Spezyme CP
logen 100L
15
•• CPN
Rhodia Penicillium funicu/osum cellulase
0
,2 = 0.9625
.e
...J
0
:::I
a.. 10
u..
O~~~~-r~~~~~~-r~,-~~~~~~~~
o 10 20 30 40 50
BeA Protein (mg/mL)
Protein Determination
Cellulase preparations were assayed using the traditional FPA and the
FPU value was plotted against total protein as determined using the Pierce
micro-bicinchoninic acid (BCA) method (Pierce Endogen, Rockford, IL)
standardized using bovine serum albumin (Fig. 3). The protein concentra-
tion of the cellulase preparations was measured following desalting of the
enzyme sample into 50 mM acetate, pH 5.0 buffer using a HiPrep 26/10
desalting column prepacked with Sephadex G-25 with a nominal exclusion
limit of 5 x 103 as specified by the manufacturer (Amersham Pharmacia
Biotech, Uppsala, Sweden). The samples were desalted to eliminate interfer-
ing compounds in the preparations, and to standardize the sample buffers.
Only the macromolecular fractions were collected and assayed according to
the manufacturer's instructions.
Enzyme Assays
The traditional FPA was carried out according to Ghose (12). The paper
was carefully rolled and inserted into the assay tubes in order to minimize
irregular and broken fibers that can affect the assay. For the scaled-down
automated version, the assays were carried out in 96-well polypropylene
microtiter plates containing a 1/4-in.-diameter filter paper disk in each well.
The disks were cut with a standard office paper punch and loaded into each
Fig. 4. Tests of evaporation control carried out in the microtiter plate incubators.
Ninety-six-well polypropylene microtiter plates were filled with the indicated amount
of distilled water, weighed, and incubated at 50°C under the various conditions for 1 h,
and weighed again. Average water loss per well was calculated as (initial wt - final wt) /
96 wells and converted to a percentage based on initial water volume per well. Each bar
represents data from a single 96-well plate (three plates per condition).
Data Analysis
The data exported to Excel contained absorbance data for duplicate
substrate assay plates and a no-substrate control plate, each with its own
internal glucose standard and blanks. To correct for any potential uneven
heating in the three plates, each plate was calculated based on its own inter-
nal glucose standard. Background color development was accounted for by
subtracting the average of the last two columns (no enzyme) from each col-
umnfor each plate. The no-substrate control plate was then subtracted from
each substrate assay plate. The resulting reducing sugar concentrations were
plotted against enzyme dilution, and the dilution yielding 1.325 mg/mL
glucose (3.6% hydrolysis) was determined by interpolation of the closest two
points. This dilution was then divided by the conversion factor to attain the
FPUnumber.
Results
Evaporation Studies
Tests of evaporation control carried out in the microtiter plate incuba-
tors indicated that no lids gave a base loss of approx 45% from 80 f..tL at 50°C
for 1 h (Fig. 4). To minimize this loss, several additional methods were
evaluated. Layering mineral oil over the sample was attempted but showed
a decrease to only a 25% loss. Placing standard polystyrene microtiter plate
lids on the plates or humidifying the chamber by placing water-saturated
filter paper pads along the sides reduced the loss to approx 13%. The result
of using heated brass lids was a water loss of only 7% during the test con-
ducted at 50°C for 60 min.
Automated FPA
Determination of the degree of hydrolysis of Whatman #1 filter
paper by a known cellulase was carried out in both normal scale and
miniature scale. The standard method, carried out by hand, resulted in an
FPU activity of 38.6 FPU/mL in the commercial preparation. Assaying
the same cellulase mixture on Whatman #1 filter paper and other cellu-
lose substrates in microtiter plates resulted in a varying range of activi-
ties. In the microtiter plate-based assays carried out on the C-400, the
commercial cellulase had apparent FPA activities of 60.4 FPU/mL on
filter paper, 35.2 FPU /mL on SigmaCell-20, 34.7 FPU /mL on Solka-Floc,
27.8 FPU / mL on A vicel PH101, and 14.1 FPU / mL on cotton linters. These
results are summarized in Table 1. Representative curves for each sub-
strate are shown in Fig. 5.
Discussion
Cellulase Assays
Current literature describing the assay of total cellulase activity (or of
individual component enzymes) has broadened considerably since the
first reports by Mandels et al. (13) that reducing sugar release and sub-
strate weight loss could serve as suitable cellulase assay methods. To some
extent, and for appropriate substrates, these methods are still considered
generally adequate and the basis for numerous product surveys (14).
However, considering the focus in biomass biotechnology on cellulase
improvement, and the desire to compare cellulase preparations rapidly
using smaller qualities of sample, application of laboratory automation to
cellulase performance measurement is important. To put the automated
assays in proper context, we review next the current state of the art for
cellulase assays.
Applied Biochemistry and Biotechnology Vol. 105-708,2003
FPA to Determine Cellulase Activity 699
, 1.500
-¥.
1.200
:~
~.
~"Y
'-'"
....
.::-~ T
. "'.
-.'
'~' .
iE .
1.000
~ l 'OOO~~~~~~~~~~~ 0 .800
:~ !- "-"-2.
~; ~.
t o!OO~~~----~~~~~~ OJIDC
0._ ~
0.200
0 .000
~~ ~~--------~ ~.200
d llullon
1800 ......- - - - - - - - - - - - ,
11100 1---------:-.,.-----:-""--1
I AOO t----------:-~-t-__;
=.
1.200 1-'----..,.-'---:-r~--'----1
-¥. l'OOO~~~~~----~~__;
I t=~~~::::::~=::==:=:::::--I
0_
0.200 ....... - - , - -........- - - - - -
0.000 t--....-~-~-~--+
~.200 ~-M~~--~.-~~MM~~
dllUlion
1.800
1800
I-
ii. ,.200
i 1.000
t 0.Il00 I--.--.,----~-
0.Il00
0._
Il.2OO 1--_ _ ._____. __. ____._ _ _ ----1
0000 l - -_ _ _ _ _ _ _ _ _ _-'
Fig. 5. Microtiter plate-based assays carried out on modified Cyberlab C400 system.
Reducing sugar equivalents concentrations (mg/mL of glucose) were determined
using the DNS method and plotted against various enzyme dilutions used to generate
the reducing sugar equivalents.
IUPAC Methods
As a result of significant effort by an international committee of cel-
lulase researchers and the IUPAC, a procedure was published in 1987
describing the use of filter paper and measurement of reducing sugar by
the DNS method of Miller (15) in the context of a highly specific assay
protocol (12). In fact, the text of this protocol must be followed carefully
to achieve comparable results. The rationale developed in this IUP AC
method is that to be maximally useful, all assays for cellulase activity
must be applied to an identical cellulosic substrate-Whatman #1 filter
paper-and that exposure of enzyme preparation to substrate must be
Applied Biochemistry and Biotechnology Vol. 105-108,2003
700 Decker et al.
permitted to proceed until 3.6% (w /w) of the cellulose in a SO-mg test
coupon; that is, 2 mg, is converted to glucose after a 60-min incubation at
50°C. The concentration (or actually dilution) of enzyme preparation
required to effect this is converted, through a somewhat indirect proce-
d ure, to the cellulase activity in filter paper units per milliliter. For example,
an undiluted cellulase preparation that yields exactly 2 mg of glucose dur-
ing the IUPAC assay has 0.37 FPU /mL. This fractional unit is the lowest
cellulase activity measurable with the IUPAC assay. Note that because the
IUP AC FPU assay is nonlinear owing to hydrolysis of an insoluble sub-
strate of variable structural composition, the use of traditional interna-
tional units of enzyme activities based on initial velocities is invalid. Here,
a single incubation time and temperature are used for all samples.
The IUPAC cellulase assay has many significant limitations; it merely
serves as the best existing method. The IUP AC commission warns, e.g., that
extrapolation of required glucose release from highly dilute or concen-
trated solutions of enzyme is not permitted. Indeed, the assays used to
confirm the release of 2 mg of glucose must be conducted with enzyme
dilutions that closely bracket the actual value. The implication is that cellu-
lase solutions too dilute to release 2 mg of glucose must be either concen-
trated to an appropriate level or pronounced unassayable by the IUP AC
method. This latter issue is important for consideration of the assay minia-
turization dictated by automation in micro titer plates.
Non-IUPAC Methods
Many cellulase enzyme preparations are simply not concentrated
enough to cause the required release of 2 mg of glucose from the SO-mg
filter paper sample in 60 min. If these samples cannot be concentrated
accurately (which is often the case) traditional FPU cannot be measured. In
such cases, however, the IUPAC committee recommends that the reducing
sugar release per unit time be accepted as a "provisional" measure of
enzyme activity. This is similar to the pseudo-initial rate approach often
used in the decade previous to the IUPAC report to measure cellulase
activity from a wide variety of substrates. These substrates may include
filter paper (16), Avicel (17), dewaxed cotton (18), or phosphoric acid-swol-
len cellulose (19). Methods based on the use of antibiotic disks (20) and
turbidity development (21) also predated the IUP AC study. More recently,
Johnson et al. (22) have developed methods to use cellulose solvents to
solubilize cellulose treated with purified enzymes and characterize these
products using size-exclusion chromatography.
Automated Cellulase Assays
To automate cellulase assays, several requirements are necessary,
including the following:
1. Creation of substrate plates.
2. Correct dilution of enzyme stock.
3. Scale-down of assay volume/ substrate.
Applied Biochemistry and Biotechnology Vol. 105-108,2003
FPA to Determine Cellulase Activity 701
Acknowledgments
This work was funded in part by the Ethanol from Biomass Program
of the Biofuels System Division of the US Department of Energy.
References
1. Wyman, C. E., Bain, R. L., Hinman, N. ,D. and Stevens, D. J. (1993), in Renewable
Energy: Sources for Fuels and Electricity, Johansson, T. B., Kelly, H., Reddy, A. K. N.,
and Williams, R.,H., eds., Island Press, Washington, DC, pp. 865-924.
2. Sheehan, J. J. (1994), in Enzymatic Conversion of Biomass for Fuels Production, vol. 566,
Himmel, M. E., Baker, J. O. and Overend, R. P., eds., American Chemical Society,
Washington, DC, pp. 1-52.
Adsorption of Components
of Enzymatic Synthesis of Ampicillin
on Different Hydrophobic Resins
Abstract
This work compared the performance of three hydrophobic resins for
the adsorption of ampicillin (AMP), D-phenylglycine (PC), D-phenylglycine
methyl ester (PCME), and 6- aminopenicillanic acid (6-AP A). The influence
of pH on adsorption efficiencies was assessed in the range of 4.5-8.5, at 4
and 25°C. The values at 4°C were slightly higher than those at 25°C. The
adsorption efficiency of AMP and 6-AP A decreased at higher pHs, for the
three resins. An opposite behavior was found for PGME, and the pH did
not affect PG adsorption efficiency. Isotherm models were fitted to experi-
mental equilibrium data and the best models were discriminated.
Introduction
Ampicillin (AMP) is one of the most widely used ~-lactam antibiotics,
with an annual production of 5.6 t (1). The enzymatic production of semi-
synthetic ~-lactam antibiotics has acquired a great relevance in order to
avoid the drawbacks of the conventional chemical processes, such as the
high toxicity of some reagents or the requirement of a high number of
synthetic steps (2).
The economic viability of a biochemical process depends not only on
the innovations achieved in reaction steps, but also on the innovations and
optimization of downstream processes (3).
*Author to whom all correspondence and reprint requests should be addressed.
(1)
(2)
PG 15 19 7 9 15 18
PGME 63 70 54 56 51 64
6-APA 19 20 10 10 17 25
AMP 76 79 32 48 49 56
75 -..r--APA
..-. ~PG
~ ---A--- PG ME
£)'60 --o--AMPI
c:
Q)
·u
~ 45
c:
.Q
a.
030
I/)
~
15
O+-~~~~--~~~~~~~-r--~
4,0 4,5 ,0 5,5 6;0 6;5 ,5 8;0
pH
()' 45 ---fJ--N'A
c ----*"- PG
Q)
'13 ----A-- PGME
:E -u-AMPI
~ 30
o
...
~
o
'"
~ 15
9 c
5 6 7 8 9
pH
Fig. 2. Influence of pH on the adsorption efficiency (%Ae) of compounds on XAD-
7 resin. T = 25°C
i:>'
c
Q)
'13
:E ______"- fJPA
Q)
c ----*"- PG
o ----A-- PG ME
~
o
-n--AMPI
'"
~
:-=::: 0-
N ~
-K
0
4 5 6 7 8 9
pH
Adsorption Isotherms
Batch experiments were carried out in a stirred tank in order to study
the equilibrium of the adsorption of AMP, PGME, 6-APA, and PG on
the hydrophobic resins XAD-4, XAD-7, and XAD-761. All experiments
were carried out at 25°C and pH 6.5. The experimental data were fitted to
the linear, Freundlich, and Langmuir models (Eqs. 3-5). The Lenberg-
Marquardt algorithm for nonlinear least squares fitting was employed
Applied Biochemistry and Biotechnology Vol. 105-108,2003
)..
:g
~
c..
OJ
0'
9-
3v;'
~
::J
""c.. Table 2
OJ Best Adsorption Isotherm Models Fitted for Adsorption of AMP, 6-APA, PGME, and PG
0' on Resins XAD-761, XAD-7, and XAD-4, with Respective Parameter Values of Models
fii
9-
::J
o XAD-761 XAD-7 XAD-4
~ Compound Isotherm Parameter Isotherm Parameter Isotherm Parameter
AMP Freundlich KF = 21.0 Linear KH = 11.8 Langmuir qm = 376.2
.....I (r 2 = 0.9984) n = 0.66 (r 2 = 0.9991) (r2 = 0.9988) KL = 5.45
'"
o
6-APA Langmuir qm = 190.0 Linear KH = 2.4 Linear KH = 5.2
(r 2 = 0.9986) KL = 42.1 (r 2 = 0.9980) (r2 = 0.9992)
PGME Langmuir qm = 590.2 Freundlich KF = 15.5 Langmuir qm = 1184
(r 2 = 0.9992) KL = 21.4 (r 2 = 0.9992) n = 0.81 (r 2 = 0.9998) KL = 39.4
PG Linear KH = 4.4 Linear KH = 2.5 Linear K H =4.0
(r2 = 0.9976) (r2 = 0.9986) (r 2 = 0.9995)
~
:-
-~
Cl
,00
N
§
Adsorption of AMP, PC, PCME, and 6-APA on Resin 711
2~r-----------------------------~
220
./
• XAD-761
o XAD-7
... XAD-4
,-",.--__ or,)
/JY
",;4/
-- ~.-----
._---"
/~
f _x----<
I /-',.
I ~;/;;-/
6 0i..' -9'-Y"
40
20~
O~~-r~~~~r-~~~'-~~~~
o 2 4 6 8 10 12 14
C*(mg/mL)
(using the software Microcal Origin 6.0). An example of the fitting of the
three tested isotherm models is shown in Fig. 4, for AMP. Tables 2 con-
tains the parameters of the best model fitted for each compound, on the
three resins. To discriminate which isotherm was the "best model," two
criteria were used: the minimum sum of the squares of the residues, and
a nonbiased distribution of these residues:
*
qm C
q* = (3)
KL +C *
q* =KHC* (5)
in which KL (mg/ mL) and qm (mg/ g) are constants of the Langmuir equa-
tion, KF (mL/mg) and n are constants of the Freundlich equation, and
KH (mL/mg) is the constant of the linear equation.
In Fig. 4 we provide a comparison of the adsorption isotherms of
AMP for the three adsorbents. As can be seen, the adsorption capacity of
XAD-4 was much greater than for XAD-7 and XAD-761. For example,
when the equilibrium concentration in the solution was 6 mM, the
amount of AMP adsorbed was approx 190 mg/ g for XAD-4, being only
65 mg/ g for both XAD-7 and XAD-761. Table 2 presents the parameters
corresponding to the best model fitted for all the tested compounds, on
each resin.
Applied Biochemistry and Biotechnology Vol. 105-108, 2003
712 Vieira et al.
It can be observed from the results in Table 2 that for 6-APA, XAD-4
resin reached higher adsorption capacity values thanXAD-7 and XAD-761.
Using the fitted models, it is possible to calculate that at a concentration of
15 mM, the amounts of 6-APA adsorbed would be approx 75, 45, and 30
mg/ g, for XAD-4, XAD-7, and XAD-761 resins, respectively.
The results showed in Table 2 also demonstrate that for PGME,
XAD-4 resin presented the best performance in the adsorption of the
compound. For the sake of comparison, the calculated amount of PGME
adsorbed on the resin, in equilibrium with 15 mM PGME in liquid phase,
would be approx 320, 230, and 140 mg/g for XAD-4, XAD-761, and
XAD-7, respectively. The results for PG, given in Table 2 indicate similar
adsorption capacities for the three tested resins. The calculated amount
of PG adsorbed on XAD-4 and XAD-761 was about 11 mg/g, while on
XAD-7 it was 7 mg/ g (all values were taken at an equilibrium concentration
in the solution of 3 mM PG).
Because PG presents low solubility, the range of concentrations used
to determine its equilibrium isotherms was very low. This may explain
why linear isotherms were obtained for equilibrium adsorption data of PG,
for all resins.
L Comparison of the adsorption isotherms of 6-APA, PG, PGME, and
AMP for the different resins shows that the highest adsorption capacities
were attained for XAD-4, for all compounds. Higher selectivity was
achieved using XAD-4 resin, too: AMP /PGME =2.2 (at pH 4.5), AMP /PG
=7.0 (at pH 8.5), and AMP / 6-APA ( 4.5 (pH between 7.5 and 8.5).
Conclusions
The effects of temperature and pH on the adsorption efficiency of
6-APA, PGME, PG, and AMP on polymeric hydrophobic resins were stud-
ied. An improvement in the adsorption efficiency of about 10% was obtained
at 4°C, compared to the results obtained at 25°C, for all compounds on the
three resins tested. This enhancement of adsorption capacity, however, was
not enough to overcome the higher energy costs that the industrial operation
at low temperature would impose.
Adsorption was affected by the solution pH, as expected, reflecting
the interactions among polymer resin, adsorbates, and mobile phase. PGME
adsorption increased at high pH values, whereas AMP, and 6-APA pre-
sented an opposite behavior, for all resins used. No significant effect of pH
on the adsorption of PG was observed.
The equilibrium isotherms of 6-APA, PG, PGME, and AMP were
determined in a batch stirred tank. A linear isotherm described satisfac-
torily PG experimental equilibrium data for all resins. The same model
described well 6-APA and AMP adsorption on XAD-7 and 6-APA on
XAD-4. Other equilibrium data were satisfactorily represented by nonlin-
ear models (Freundlich and Langmuir).
The batch tests allowed screening of adsorbents on the basis of
adsorption capacity. The results presented demonstrate that the hydro-
Applied Biochemistry and Biotechnology Vol. 105-108,2003
Adsorption of AMP, PC, PCME, and 6-APA on Resin 713
Acknowledgments
We acknowledge the financial support of the Brazilian research-fund-
ing agency, CNPq, and the research program PADCT-CNPq.
References
1. Ospina,S., Barzana, E., Ramirez, 0.,T., and Lopez-Munguia, A. (1996), Enzyme Microb.
Technol. 19,462-469.
2. Hermindez-Justiz, 0., Terreni, M., Pagani, G., Garcia, J. L., Guisan, J. M., Femandez-
Lafuente, R. (1999), Enzyme Microb. Technol. 25,336-343.
3. Wheelwright, S. M. (1987), Bio/Techn%gy 5(8), 789.
4. Doulia, D., Rigas, F., and Gimouhopoulos, C. (2001), J. Chern. Technol. Biotechnol. 76,
83-89.
5. Kirkby, N. F., Slater, N. K. H., Weisengerger, K. H.; Addo-Yobo, F. and Doulia, D.
(1986), Chern. Eng. Sci. 41(8),2005-2016.
6. Casillas, J. L., Martinez, M., Addo-Yobo, F., AracH, J. (1993), Chern. Eng. J. Biochem.
Eng. 52(3), B71-B75.
7. Grzegorczyk S. and Carta, G. (1996), Chem. Eng. Sci. 51,819-826.
8. Chaubal, M. V., Payne, F. G., Reynolds, C. H., and Albright, R. L. (1995), Biotech.
Bioeng. 47, 215-226.
Xylanase Production
by Trichoderma reesei Rut C-30
on Rice Straw
Abstract
Xylanase production of Trichoderma reesei Rut C-30 was examined at dif-
ferent initial pH values (4.8,5.9, and 7.0) on rice straw in shake flasks, and in
a fermentor, for the best pH condition. Enzyme performance was tested on
ammonia-treated dwarf elephant grass. The maximum xylanase activities,
92 and 122 IU / mL, were obtained atpH 4.8 in the shake flasks and fermentor,
respectively, in which good growth of the fungus was observed during the
first 24 h and consumption of proteins dissolved from the rice straw caused
the pH to rise later to values between 6.4 and 6.7 (optimal for xylanase pro-
duction). The xylanases from T. reesei were as effective as Multifect XL,
a commercial enzyme preparation, in hydrolyzing ammonia-treated
elephant grass.
Index Entries: Xylanase; Trichoderma reesei; rice straw.
Introduction
Potential uses of lignocellulosics are increasing. The development
of green technologies to use them usually includes several steps such as
enzyme production, substrate treatment, enzymatic hydrolysis of the sub-
strate, fermentation of hydrolysis products, and recovery of fermentation
products (1). Availability of cellulases and xylanases plays a very impor-
tant role in achieving this goaL
The capability of Trichoderma reesei strains to produce active and rela-
tively stable cellulases and xylanases is well known (2,3), but it is still under
active research because many factors affecting production and enzyme activ-
*Author to whom all correspondence and reprint requests should be addressed.
Enzymatic Hydrolysis
Enzymatic hydrolysis was carried out at a solids loading of 5% (w / v) in
250-mL Erlenmeyer flasks containing 50 mL of 0.05 M citrate buffer (pH 4.8)
placed at 50°C at 100 rpm for 24 h in an incubator shaker (Innova 4300; New
Brunswick Scientific). Sodium azide was added for preservation (0.15%).
Samples (10 mL) were taken at 0, 6, 12, and 24 h and subjected to reducing
sugar analysis with the dinitrosalicylic acid method (16). Hydrolysis was
performed with the xylanases produced by T. reesei Rut C-30 on rice straw
and with xylanases produced by Trichoderma longibrachiatum (Multifect XL;
Genencor, Helsinki, Finland) at 1 IU / g of dry substrate loading. Both prepa-
rations were supplemented with 1 IU / g of dry substrate of cellulase
(Spezyme CP; Genencor, Rochester, NY) and 5.56 cellobiase units/ g dry
substrate of cellobiase (Novozym 188, Novo Nordisk, Franklinton, NC).
~ - - -
~
-•
6 • - : y
~'--X--------l!---------
pH
•
2
o I I I I
o 24 48 72 96 120
time (h)
-+- pH 4.8 -+-- pH 5.9 --.- pH 7.0 ......X-..... Control pH 4.8
solid fraction indicates (Fig. 2). Although Fig. 2 shows similar slopes for
initial pHs of 4.8 and 5.9, that does not mean that fungus growth was the
same since rice straw proteins were being solubilized in the fermentation
with the initial pH of 4.8 as pH increased to 5.81 (24 h), which makes about
26% of the protein in the solids to be solubilized, meaning that less protein
remains in the solids. In other words, more fungus biomass must be in the
solids for the initial pH of 4.8 compared to fermentation with the initial pH
of 5.9, in which no more protein is solubilized since pH did not increase
much (6.02) by 24 h. The growth of the fungus for the initial pH of 4.8
was as dense as for the control fermentation, in which the pH variation was
about 0.88 pH units (from 4.8 to 3.92), indicating high metabolic activity
as well, and twice as dense as the fermentation with the initial pH of 5.9.
Growth for an initial pH of 7.0 was poor. Crude protein of rice straw was
much higher at pH 4.8 (0.6 mg/mL) than at pH 5.9 and 7.0. This is owing
to protein solubilization from the straw at pH near neutrality, as has been
reported for grasses; the higher the pH, the greater the protein solubiliza-
tion (17). Since crude protein content of rice straw was 6.75% and crude
protein in the solids of a 120-mL sample at the initial pH of 4.8 was 0.6
mg/mL, only 74% of the initial protein was present in the solids; in other
words, 26% of the crude protein was solubilized. On the other hand, initial
crude protein in solids for the pH 5.9 and 7.0 fermentations was 0.38
mg/mL, which represents a 50% protein solubilization.
Applied Biochemistry and Biotechnology Vol. 105-108,2003
Xylanase Production byT. reesei on Rice Straw 719
0.80
0.70
0.60
c 0.50
G_
o-
.. E
Q. ...... 0.40
~
..
-g .....
CD
0.30
0
0.20 ........
x· .................
·X
0.10 .........
o 24 48 72 96 120
time (h)
-+- pH 4.8 ---.- pH 5.9 ---.- pH 7.0···X·· Control pH 4.8
Fig. 2. Crude protein in solids from shake-flask fermentations of T. reesei Rut C-30
on rice straw at different initial pHs and on control substrate.
Figure 3, which shows the true protein (rice straw protein and/or
extracellular enzymes) released to the medium, confirms that soluble pro-
tein was about 26% (estimated by Lowry's method) atthe beginning ofthat
fermentation. Soluble protein decreased between 0 and 24 h in both the 4.8
and 5.9 initial pH rice straw fermentations, indicating protein consump-
tion. However, for pH 4.8 the decrease was about 25% (from 0.16 to 0.12
mg/mL), and for pH 5.9 was just 7.1 % (from 0.28 to 0.26 mg/mL), repre-
senting 100% more consumption of protein (0.04 vs 0.02 mg/mL). It is
known that the pH value in T. reesei fermentations decreases when the
fungus consumes cellulose and does not have either peptone or protein
(18). As pH decreased for the control substrate (no protein), one can infer
that solubilization of proteins from rice straw (6.75% protein) and subse-
quent consumption by the fungus were responsible for increasing the pH,
likely caused by protonation of amino groups released to the medium.
Therefore, since protein consumption is responsible for the increase in pH
in the broth (Fig. 1), this explains the greater metabolic activity at the initial
pH of 4.8, and thus greater fungus growth. Moreover, the difference
observed in protein consumption could be even higher since protein is
being solubilized at a greater extent in fermentation with the initial pH of
4.8, hence increasing the soluble protein in the broth. Later, protein in the
liquid phase started to increase, mainly owing to enzyme production. After
24 h, pH increased to 5.81, and more rice straw protein was released. This
Applied Biochemistry and Biotechnology Vol. 105-108,2003
720 Colina et al.
1.00
0.80
-
E
CI
0.60
.§.
.....
c
'Gi
0
c..
0.40
GI
:a:::J
"0 0.20
cn
o
o 24 48 72 96 120
time(h)
Fig. 3. Soluble pratein in shake-flask fermentations of T. reesei Rut C-30 on rice straw
at different initial pHs and on contral substrate.
was greater than the protein provided by fungus growth, and, as a conse-
quence, crude protein decreased.
The highest fungus growth was achieved in the control with a 0.3
mg/mL crude protein content in the solids by 72 h, which represents true
growth since there was no protein in the control substrate.
The results presented in Fig. 4 indicate that rice straw (initial pH of 4.8
and 5.9) is better as a substrate for xylanase production than commercial
pure cellulose and hemicellulose (control substrate) at the experimental
conditions used. Certainly, substrate selection plays a major role in enzyme
production. The results in Fig. 4 suggest that the pH developed in the rice
straw fermentations was more suitable for xylanase production since it
reached values between 6.0 and 7.0, and it has been reported that optimal
pH values for xylanase production are between 6.0 and 6.5 (7). On the other
hand, the low xylanase production on the control substrate can be explained
by pH va lues far from the optimal at the first stage of the fermentation.
The production of xylanases was higher at lower initial pH, with values
of 92, 46, and 8 IV /mL for initial pH values of 4.8,5.9, and 7.0, respectively
(Fig. 4). Since the pH values reached in the fermentations with initial pH
values of 4.8 and 5.9 were similar by 24 h, the difference in xylanase produc-
tion between both fermentations may be assigned to the greater fungus
growth in the fermentation starting at pH 4.8 (accelerated pH rise in the first
24 h, intense metabolic activity) since this is considered the optimal pH for
Applied Biochemistry and Biotechnology Vol. 105-108,2003
Xylanase Production byT. reesei on Rice Straw 721
100
90
80
--
C" 70
E
:2 60
>-
:t:
> 50
U
• 40
•c•
II
30
•
~ 20
10
0
o 24 48 72 96 120
time (h)
growth. On the other hand, xylanase production at the initial pH of 7.0 was
very low, likely owing to poor growth during the fermentation. By 96 h,
xylanase production decreased and later increased again. This behavior is
associated with oxygen deprivation in the shake flasks.
Xylanase activity was higher than that reported by Dekker (19) for
T. reesei QM 9414 cultured on sugarcane bagasse (6.4 IV / mL), by Bailey and
Poutanen (20) for Aspergillus oryzae (90 IV / mL) and A. niger (49 IV / mL) on
wheat bran, and by Gomes et al. (21) for Trichoderma viride on rice straw
(72.4 IV/mL) and newspaper (92.4 VI/mL), although lower than that
reported by Gomes et al. (21) for T. viride (190 ill /mL) on sulfited pulp and
by Bailey et al. (7) for T. reesei Rut C-30 on wheat bran (138 ill/mL).
Cellulase activities measured at 120 h showed a different trend com-
pared to xylanases.
Cellulase activity decreased as the initial pH decreased, giving values
of 0.51 ill / mL, 0.29 ill / mL, undetected, and 0.62 ill / mL, for initial pHs of
4.8, 5.7, 7.0, and the control, respectively. When T. reesei Rut C-30 was cul-
tured on rice straw and on the control substrate, production of cellulase was
lower than that found in other studies with the same microorganism (22,23).
Since the cellulase activities of the rice straw fermentation with initial of pH
4.8 and the control fermentation (the same initial pH) were similar, it appears
that cellulase activity was not affected by the pH developed during the fer-
mentation, contrary to what was found in xylanase production.
Applied Biochemistry and Biotechnology Vol. 105-108,2003
722 Colina et al.
7 1.0
- -
14
6 12
-
5 --
E
......
Cl
0.8
-
-
><
'<
- 10 iii
:::I
II
1/1
4 S-c 0.6 II
.--
-8 II
n
cr.
..
'u
J:
Q. <
3 0 6
-
-
Q. 0.4 '<
cu 2
2 :a:::I 4 3
.::
1
"0
en 0.2
- 2
-
0 0.0
- 0 24 48 72 96 120
0
time (h)
When the best rice straw fermentation obtained in shake flaks (initial
pH 4.8) was run in a fermentor, xylanase production was greater and more
consistent (123 IV / mL) than in shake flaks, although it was similar by 72 h
(Fig. 5). Better culture conditions in the fermentor could explain this behav-
ior, mainly owing to better agitation and an adequate air supply. As a
result, the decrease in xylanase production found in shake-flask fermenta-
tion by 96 h was not observed in the fermentor. The trends in pH and
soluble protein were similar to corresponding values in the initial pH 4.8
shake-flask fermentation.
Xylanases produced in the fermentor were used to hydrolyze
untreated and ammonia-treated dwarf elephant grass (Table 1) and com-
pared with the performance of a commercial xylanase. As expected, the
treated substrate had greater sugar yields (279-301 mg/ g of dry matter
[DM]) than the untreated one (89 to 90 mg/ g of DM), confirming the effi-
cacy of the ammonia treatment in increasing the susceptibility of ligno-
cellulosics to enzymatic hydrolysis. Susceptible fiber in the untreated
material was almost completely hydrolyzed by 6 h of hydrolysis, whereas
a 24-h period was not sufficient to hydrolyze the available fiber in the
treated material. More important, there were no significant differences
(p < 0.05) in sugar conversion between commercial enzymes and enzymes
produced by T. reesei Rut C-30 on rice straw. A sugar yield of 56% of
theoretical is considered high for a 24-h hydrolysis period and a very low
enzyme loading of 1 IV / g of DM for xylanases and cellulases.
Table 1
Reducing Sugar Yield (mg/ g DM) from Enzymatic Hydrolysis
of Untreated and Ammonia-Treated Dwarf Elephant Grass with Xylanases
Produced by T. reesei Rut C-30 on Rice Straw and Multifect XL"
Enzymes Hydrolysis time (h~
and substrates 0 6 12 24
T. reesei
Treated 83 ± 3.83 aA 210 ± 7.95 bA 244 ± 3.32 cA 301 ± 4.07 dA
Untreated 52 ± 6.75 aB 78 ±3.19 bB 94 ± 4.02 bB 89 ± 6.66 bB
Multifect XL
Treated 86 ± 1.34 aA 199 ± 9.91 bA 231 ± 16.6 cA 279 ± 14.75 dA
Untreated 53 ± 10.48 aB 78 ± 3.7 aB 92 ± 4.57 bB 90 ± 7.24 bB
"Results in rows with different capital letters are significantly different (p < 0.05). Results
in columns with different lower-case letters are significantly different (p < 0.05).
Conclusions
The differences observed in the fermentations are basically owing to
the nature of the substrates (lignocellulosic and commercial ones) and to
the effect of the initial and the developed pH on fungus growth and enzyme
production. Rice straw is an excellent substrate for the production of
xylanases.AninitialpHof4.8isappropriatefortheproductionofxylanases.
Xylanases produced by T. reesei Rut C-30 are effective for the hydrolysis of
ammonia-treated dwarf elephant grass.
Acknowledgments
We gratefully acknowledge financial support from the Technological
Park of the University of Zulia (Maracaibo, Venezuela), Fonacit (Caracas,
Venezuela), and Fundacite-Zulia (Maracaibo, Venezuela).
References
1. Kuhad, R and Singh, A. (1993), Crit. Rev. Biotechnol. 13, 151-172.
2. Ryu, D. and Mandels, M. (1980), Enzyme Microb. Technol. 2,91-102.
3. Wong, K. and Saddler, J. (1992), Crit. Rev. Biotechnol. 12,413-435.
4. Gibbs, P., Serviour, R, and Schmid, F. (2000), Crit. Rev. Biotechnol. 20, 17-48.
5. Domingues, F., Quiroz, J., Cabral, J., and Fonseca, 1. (2000), Enzyme. Microb. Technol.
26, 394-401.
6. Royer, J. and Nakas, J. (1989), Enzyme Microb. Technol. 11,405-410.
7. Bailey, M., Buchert, J., and Viikari, 1. (1993), Appl. Microbiol. Biotechnol. 40,224-229.
8. Ministerio de Producci6n y Comercio. (2001), Estadisticas, Caracas, Venezuela.
9. Mandels, M. and Weber, J., (1969), Adv. Chern. Ser. 95, 391-414.
10. Ghosh, V. (1987), Pure Appl. Chern. 59,257-268.
11. Bailey, M., Biely, Peters, and Poutanen, K. (1992), J. Biotechnol. 23,257-270.
12. Lowry, 0., Rosebrough, N., Farr, A., and Randall, R (1965), Anal. Chern. 16, 190-210.
13. Szakacs, G. and Tengerdy, R (1997), World J. Microbiol. Biotechnol. 13,487-490.
Abstract
A spectrophotometric method of measuring oxygenase activity in cell
extracts or in zymograms was developed. It is an easy and cheap method
that allows spectrophotometric measurement of activity by a colored reac-
tion and reveals activity bands in a polyacrylamide gel electrophoresis
(PAGE) gel as brown bands. To prove its usefulness, we report on a study
with the oxygenase present in strain YR-l, isolated from petroleum-con-
taminated soils, that uses hydrocarbons as its sole carbon source. Soluble
oxygenase activity was detected (under our conditions of cellular homog-
enization) in the mycelium of a filamentous fungus strain named YR-l.
Oxygenase activity from aerobically grown mycelium was detected in
growth medium containing the hydrocarbons decane or hexadecane; the
enzyme activity exhibited similar optimum pH for the hydroxylation of
different aliphatic or aromatic substrates (decane, hexadecane, benzene,
and naphthalene) to the corresponding alcohols. Zymogram analysis con-
ducted with partially purified fractions from cell extracts from the aerobic
mycelium of the YR-l strain indicated the existence of only one oxygenase
enzyme. Partially purified samples of enzyme, analyzed by sodium dodecyl
sulfate PAGE, indicated the presence of one major protein band with a mol
wt of 56 kDa that can be a constituent of the native enzyme. In samples of
the enzyme, the 56-kDa protein gave a positive reaction in immuno-
detection experiments with antibodies directed against oxygenase from
Introduction
Hydrocarbons represent an enormous energy resource and are mainly
exploited as fossil fuels. As well as being the predominant energy source in
most countries, hydrocarbons are an important feedstock for the chemical
industry. Their potential impact on biotechnology is enormous, but as yet
their exploitation has been limited. The chemical nature of these compounds
is very diverse, varying from simple saturated aliphatic alkanes to complex
polycyclic aromatic compounds. Such a range of carbon substrates can sup-
port the growth of many microorganisms using diverse and often not well-
understood metabolic pathways. The potential for innovative industrial
application is therefore high. The absence of a basic understanding of the
biochemical nature of hydrocarbon metabolism has slowed down and in
some cases halted many research projects. In addition, a variety of problems
associated with the development of high-productivity fermentation strate-
gies for insoluble high-energy status substrates necessitate an approach
somewhat different from sugar-based fermentation technology (1).
Several possible biochemical pathways are involved in hydrocarbon
biodegradation. The first step in hydrocarbon biodegradation is hydroxy-
lation, which is catalyzed by the cytochrome P-450 protein complex (2).
Two mechanisms have been proposed to explain the incorporation of
molecular oxygen into the hydroxylated product: one atom in the case of
monooxygenases (3), and two atoms in the bacterial dioxygenase case (4).
Cytochrome P-450 is capable of using a wide range of xenobiotic com-
pounds as substrates and, by means of many types of chemical transforma-
tions, leads to the production of alcohols found in microorganisms as well
as in plants and animals (5).
In the present article, we describe an easy and useful spectrophotom-
eter method to measure the oxygenase activity in cell-free extracts and a
variation of the same method for the detection of this activity in zymo-
grams. We also present some biophysical properties of the oxygenase activ-
ity present in cell-free extracts of strain YR-l filamentous fungi isolated
from petroleum-contaminated soils.
Enzyme Assays
To evaluate the enzyme activity in cell extracts, it was necessary to
implement a spectrophotometric method. Then, some variations to the
lipoxygenase method were made to detect oxygenase in zymograms after
a PAGE run (8). Briefly, the basic principle was based on the property of
oxygenases to use molecular oxygen to oxidize the hydrocarbon-substrate
molecules by means of an electron transport system (2,4). Similarly, the
enzyme is capable of oxidizing o-dianisidine, producing a brown solution.
Results
Oxygenase Activity in Cell Extracts from Mycelial Cells
Oxygenase activity with hexadecane as substrate was analyzed in a
164,500g supernatant of aerobically grown mycelium of strain YR-1
obtained in sMMP containing 1.0% hexadecane as carbon source. The pres-
ence of oxygenase activity was clearly detected in the cytosolic fraction
(164,500g supernatant) of these-mentioned cells. The appearance of oxy-
genase activity as a function of incubation time in growth medium with
decane was estimated. Enzyme production reached its maximum after
22 h and then declined (Fig. 1); this decrease coincided with the onset of the
stationary phase of growth.
Oxygenase activity with hexadecane as substrate was only detected
when the fungus was grown in minimal media containing decane or
hexadecane as carbon sources. This suggests that the fungus contains an
oxygenase that recognizes hexadecane as substrate and is induced in the
presence of the hydrocarbons decane or hexadecane (not shown).
Oxygenase activity from aerobically grown mycelial cells was mea-
sured over a range of pH using hexadecane as a substrate. Fig. 2 shows that
the optimum pH for the oxidation of hexadecane to the respective alcohol
was approx 8.5 in Tris-HCI buffer. No effect of incubation temperature was
observed at 28 or 37°C (not shown).
To test the possibility of the presence of more than one oxygenase
activity in cell extracts of the strain YR-1, the zymogram for oxygenase
activity was obtained using different concentrations of the 164,500g super-
Applied Biochemistry and Biotechnology Vol. 105-108,2003
730 Zazueta-Sandoval et al.
160 140
..'>
41
>-
:;:;
140
120
120
100
u 100 CD
..
as 80 c:::J
Q)
80
(I)
as 60 'ii
cQ) 60 e
CD
40 40 a..
~
0 20 20
0 0
0 10 20 30 40
Timeh
Fig. 1. Time course of oxygenase activity with respect to incubation time. Enzyme
activity was determined in the 164,500g supernatant from aerobically grown mycelial
cells in sMMP medium supplemented with decane. (A) Protein; (_) oxygenase activ-
ity. *Oxygenase activity expressed as 460 nm/min absorbance.
1.6~-----------------------------------------.
1.4
41
~ 1.2
.s;
t3as
.g 0.8
'0
CD
Q. 0.6
en
~ 0.4
0.2
O+------r-----r-----,------r-----,------r----~
6.5 7 7.5 8 8.5 9 9.5 10
pH
Fig. 2. Effect of pH on oxygenase activity. The enzyme activity was determined in
the 164,500g supernatant from aerobically grown mycelial cells in sMMP supple-
mented with decane as the sole carbon source. The reaction mixture contained 25 mM
potassium phosphate between pH 6.0 and 10.0, Tris-HCl between pH 6.0 and 10.0,
(0.5 M), 0.025 M decane 3,3'-diaminobenzidine in 0.1 M HCl and 100 Ilg of protein of
the 164,500g supernatant. (_) Tris-HCl buffer; (A) potassium phosphate buffer. *Oxy-
genase specific activity expressed as units per milligram of protein.
1 2 3 4 5
A 1 2 B 3 4
5 0.6
4.5
0.5
4
3.5
ac: 3
0.4 8
=
0 0
IX)
N
2.5 0.3 ~
Q 2 Q
0 0.20
1.5
0.1
0.5
0 0
15 20 25 30 35 40 45 50 55 60 65 70 75
fraction number
Fig. 5. Oxygenase activity elution profile after ion-exchange chromatography. The
164,500g supernatant of mycelium cells grown aerobically in sMMP medium supple-
mented with hexadecane as the sole carbon source was applied onto a DEAE-PREP Gel
column. Elution was done with a discontinuous NaCI gradient (0-0.5 M). Oxygenase
activity is expressed as optical density (OD) at 460 nm (.). Protein content of YR-l is
expressed as 00 at 280 nm (e).
2 3
A
Oxygenll5C activity
B
I 2 c
kDa
Oxygenase activity _I ~
66 _
4S -
-
29 -
gradient was used. This procedure allowed the removal of most of the
oxygenase activity from the column. As can be seen, there are two peaks
of oxygenase activity; one (fractions 22-26) showed highest activity when
benzene was used as the substrate. The second peak (fractions 64-71)
showed minor activity. Additional steps in the purification protocol
included the concentration of active fractions from the column, electro-
phoresis under nondenaturing conditions in a preparative PAGE gel, and
then electro elution of the enzymatic activity band. In later experiments,
only fractions 22-26 were used, because the other "peak" could be an
artifact owing the fact that its localization is in almost the final volume of
the column.
To gain information regarding the subunit composition of the native
enzyme, after PAGE a zymogram was performed and the activity band
(Fig. 6A) was cut and electroeluted from a preparative gel and submitted
Applied Biochemistry and Biotechnology Vol. 105-108,2003
734 Zazueta-Sandoval et al.
to SDS-PAGE. As shown in Fig. 6C, partially purified samples of oxygenase
were submitted to immunodetection experiments with polyclonal anti-
bodies against soybean lip oxygenase. The results obtained indicated that
two bands of 56 and 76 kDa were immunodetected, suggesting that these
protein bands could be related to lipoxygenase enzyme from other organ-
isms and may have some conserved epitopes. Additionally, the antibody
was capable of recognizing only one protein band in native conditions that
corresponded to the activity band in the zymogram (Fig. 6B).
General Properties:
Substrate Specificity and Preliminary Kinetic Parameters
The partially purified oxygenase was examined regarding substrate
specificity using different aliphatic and aromatic substrates in the enzy-
matic assay; oxygenase activity with different substrates was expressed as
specific activity (Table 1). The enzyme oxidized aliphatic and cyclic sub-
strates, although much higher activity was observed with cyclic substrates.
The complexity of the substrate molecule is important because when the
number of rings increased the activity was reduced. The same phenom-
enon was observed with the aliphatic hydrocarbons; that is, the activity
was lower with the increase in the number of carbon atoms in the molecule.
Km and V max values were determined for benzene and decane (Table 2); the
~ values for benzene (2.79 ~ and decane (0.56 JAM) suggest that the
higher affinity of the enzyme is for aliphatic substrates.
Discussion
We consider that the method implemented in our laboratory to detect
activity in zymograms and measure the oxygenase activity by spectropho-
tometric assay is easy and rapid. Furthermore when compared with the
electrode measurements of consumed oxygen in this oxidation reaction, it
is very inexpensive. This methodology allows us to make precise oxyge-
nase measurements and detect with high qualityactivity in zymograms.
Oxygenase activity in aerobically grown mycelium cells of strain
YR-1 obtained under different nutritional conditions was mainly found
in the 164,500g supernatant. This observation indicated that this fungus
oxygenase activity is cytosolic when using the ballistic homogenization
of cells method (drastic rupture). However, it is important to use a gentle
method of cellular homogenization, such as protoplast formation by lytic
enzymes and osmotic shock homogenization, to be sure of the intracellu-
lar localization of this enzyme. The enzyme was detected only when the
culture media contained a hydrocarbon as the sole carbon source, indicat-
ing a possible induction mechanism. However, the absence of activity
when the microorganism was grown in glucose as the sole carbon source
could indicate a possible regulatory effect of glucose.
The principal difference between the oxygenase from strain YR-1 and
other oxygenases in different organisms is the capacity of the former to use
Applied Biochemistry and Biotechnology Vol. 1O!!-108, 2003
Measuring and Detecting Mono- and Dioxyenase 735
Table 1
Oxygenase Activity from Strain YR-1
Using Different Substrates·
Aromatic
Benzene 18.58
Naphthalene 5.17
Phenanthrene 4.63
Anthracene 4.54
Pyrene 1.054
Toluene 14.35
Chlorobenzene 2.94
Aliphatic
Octane 12.09
Decane6.72
Hexadecane 3.59
Tetracosane 0.106
'Partially purified oxygenase activity by ion-exchange
DEAE-PREP chromatography was assayed as described in
Materials and Methods, except that the substrates listed here
were used in place of decane or hexadecane. All substrates were
of 60 mM final concentration. Activities are expressed as activ-
ity units. The given values are the mean of two independent
experiments with triplicate determinations in each instance.
Table 2
Kinetic Constants of Oxygenase from Strain YR-1·
References
1. Alper, J. (1993), Biotechnology 11, 973-975.
2. Kellner, D. G., Maves, S. A, and Sligar, S. P. (1997), Curro Opin. Biotechnol. 8,274-278.
3. Lindley, N. D. (1992), in Handbook of Applied Biotechnology. Fungal Biotechnology, vol. 4,
Philip, K, Richard, A, Elander, P., and Mukeri, KG., eds., Marcel Dekker, Inc., New
York, NY, pp. 905-929.
4. Gibson, D. T. and Parales, R. (2000), Curro Opin. Biotechnol. 11,236-243.
5. Rogers, M. R. and Kaplan, A M. (1982), Dev. Ind. Microbiol. 23, 147-165.
6. Bartnicki-Garcia, S. and Nickerson, W. J. (1962), J. Bacteriol. 84,841-858.
7. Torres-Guzman, J. c., Arreola-Garcia, G. A, Zazueta-Sandoval, R., Carrillo-Rayas,
T., Martinez-Cadena, G., and Gutierrez-Corona, F. (1994), Curro Genet. 26, 166-171.
8. Funk, M. 0., Whitney, M. A, Hausknecht, E. c., and O'Brien, E. M. (1985), Anal.
Biochem. 146, 246-251.
9. Janssen, F. W., Kerwin, 1. M., and Ruelius, H. W. (1975), in Methods in Enzymology,
vol. 16, Kolowick, S. P. and Kaplan, N. 0., eds., Academic, New York, NY, pp. 364-369.
10. Laemmli, U. K (1971), Nature 227, 680-685.
11. Lowry, 0. H., Rosebrough,N. J., Farr, A 1.,andRandall,R.J. (1951),J. BioI. Chem.193,
265-275.
12. Wende, P., Berhardt, F. H., and Pfleger, K (1989), Eur. J. Biochem. 181, 189-197.
Abstract
Filamentous fungi have been widely used to produce hydrolytic enzymes
for industrial applications, including xylanases, whose levels in fungi are
generally much higher than those in yeast and bacteria. We evaluated the
influence of carbon sources, nitrogen sources, and moisture content on
xylanase production by Penicillium canescens to-lOc in solid-state fermenta-
tion. Among agricultural wastes tested (wheat bran, untreated wheat straw,
treated wheat straw, beet pulp, and soja meal), untreated wheat straw gave
the highest production of xylanase. Optimal initial moisture content for
xylanase production was 83%. The addition of 0.4 g of xylan or easily metabo-
lizable sugar, such as glucose and xylose, at a concentration of 2 % to wheat
straw enhanced xylanase production. In solid-state fermentation, even at
high concentrations of glucose or xylose (10%), catabolic repression was
minimized compared to the effect observed in liquid culture. Yeast extract
was the best nitrogen source among the nitrogen sources investigated: pep-
tone, ammonium nitrate, sodium nitrate, ammonium chloride, and ammo-
nium sulfate. A combination of yeast extract and peptone as nitrogen sources
led to the best xylanase production.
Index Entries: Penicillium canescens; xylanase; solid-state fermentation.
Introduction
Xylans are one of the major components in wood and plant materials.
Xylan is a collective name of polysaccharides in which in most cases
~-l,4-linked o-xylopyranose residues are the main constituents. Depend-
ing on their origin, xylans may also contain variable amounts of ara-
binosyl- and 4-0-methylglucuronic acid residues and acetyl groups (1).
KCl, and 0.15 gil of MgS04·7H20, plus nitrogen source. Initial experi-
ments were performed using 5 g of different agricultural residues (as car-
bon sources) and a combination of 0.75 g of yeast extract and 0.2 g of
ammonium sulfate (as nitrogen sources). The effect of the nitrogen sources
was tested using yeast extract, peptone, ammonium nitrate, sodium ni-
trate, ammonium chloride, and ammonium sulfate. The concentration of
nitrogen sources used was 52.5 mg of N / 5 g of wheat straw. In other experi-
ments, yeast extract combined with one of the previous nitrogen sources
was used at a concentration of 105 mgofN/5 g of wheat straw. The pH was
adjusted to 6.5 before sterilization. The flasks were sterilized at 120 0 e for
20 min, then inoculated with a 2-mL spore suspension (105-106 spores / mL).
For submerged cultures, the same medium as just described was
employed using 7.5 gil of yeast extract and 2 gil of ammonium sulfate,
as nitrogen sources. The pH was adjusted to 6.5 before sterilization. Erlen-
meyer flasks (250 mL) containing 50 mL of medium were inoculated with
a 1-mL spore suspension (105-106 spores/mL) and incubated at 30 0 e in a
rotatory shaker (120 rpm). At periodic intervals, the filtrate obtained was
assayed for enzyme activity.
Enzyme Extraction
The solid-state culture in each flask was picked up at different time
intervals. Water containing 0.1 % Tween-80 was added to make the volume
in flask equivalent to 100 mL. The flask's contents were stirred for 1.5 hours
on a magnetic stirrer at laboratory temperature and filtrated. The superna-
tant filtrates were used as the enzyme source.
Enzyme Assays
Xylanase activity was measured according to Bailey et al. (20) using
1% birchwood xylan as substrate; reducing sugars were assayed by a
dinitrosalicylic acid method with xylose as the standard (21). One unit of
enzyme activity is defined as the amount of sugar (in micromoles) pro-
duced per minute of reaction and per milliliter of enzyme solution, in the
assay conditions.
Results and Discussion
Effect of Different Lignocellulosic Materials on Xylanase Production
In the first experiments, we examined the effect of different lignocel-
lulosic materials-wheat bran, beet pulp, soja meal, and wheat straw
(treated with NaOH and untreated)-as carbon sources on xylanase pro-
duction. We observed that maximum enzyme activity was obtained by
using untreated wheat straw (Table 1). Table 1 shows that the time of
cultivation needed to obtain maximum enzyme (7448 U / g) production on
this substrate was 12 d. This substrate was used for further studies. Wheat
bran, beet pulp, and soja meal culture filtrates exhibited moderate activi-
ties. It has been reported that the ratio of cellulose to xylan of the growth
Applied Biochemistry and Biotechnology Vol. 105-108,2003
740 Bakri et a/.
Table 1
Production of Xylanase by P. canescens
in Solid Cultures on Various Lignocelluloses
Substrate (5 g) Day Xylanase (U / g)
Untreated wheat straw 4 2702
6 3024
8 3598
10 5628
12 7448
14 6398
Treated wheat straw 4 1134
6 1792
8 2282
10 2954
12 3332
14 3192
Wheat bran 4 1470
6 1582
8 1414
10 896
12 574
14 294
Pulp beet 4 714
6 938
8 1764
10 1792
12 1512
14 1148
Soja meal 4 1400
6 1932
8 1832
10 1610
12 1372
14 1274
9000
10000
-
......
E 20 .Xylan
Xylan+Glucose
2- 15 • Glucose
<II
C/I
(II
c(II
10
n ~
>. 5
><
0 ~
0 48 72 96 120
Time (h)
10000
i
l:'!:
8000
-(/I
~-
-III
UQI 6000
1II..c:
QI~
• Glucose
(/1_
~o 4000 • xylose
11101
>''''
><8- 2000
2-
0
o 2 4 6 8 10
Sugar concentration (Ok)
Fig. 4. Effect of glucose and xylose concentrations added to wheat straw on xylanase
production by P. canescens in solid-state fermentation.
Conclusion
One of the factors determining the large-scale use of xylanases will
certainly be the cost of xylan-degrading enzyme preparation. The cost of
the carbon source, as well as the additional medium components, plays a
major role in the economics of xylanase production. The use of the purified
inducing substrate xylan for large production scale is far too expensive.
Alternatively, less costly carbon sources can be lignocellulosic biomass,
which is and will continue to be available in large quantities, as well as
residual products from industrial processing of lignocellulose. The results
Applied Biochemistry and Biotechnology Vol. 105-108,2003
Xylanase Production by P. canescens 745
Table 2
Effect of Nitrogen Sources on Xylanase Production
Nitrogen Quantity Xylanase
source (g/5 g wheat straw) (U/g)
Yeast extract 0.5 5404
Peptone 0.39 3878
(NH4)2S04 0.24 1820
NaN0 3 0.32 2226
NH4N03 0.15 2072
NH4Cl 0.2 1848
Table 3
Effect of Yeast Extract Combined with Nitrogen
Sources on Xylanase Production
Nitrogen source Xylanase
(105 mgl5 g wheat straw) (U/g)
Yeast extract 4088
Yeast extract + peptone 8932
Yeast extract + (NH4hS04 6720
Yeast extract + NaN0 3 6006
Yeast extract + NH 4N03 5880
Yeast extract + NH4Cl 6916
Acknowledgments
The authors thank the Atomic Energy Commission Syria (AECS) for
their financial support.
References
1. Poutanen, K., Ratto, M., Puls, J., and Viikari, L. (1987), J. Biotechnol. 6,49-60.
2. Buchert, J., Tenkanen, M., Kantelinen, A., and Viikari, L. (1994), Bioresour. Technol. 50,
65-72.
3. Wong, K. K. L., James, c. S., and Campion, S. H. (2000), J. Pulp Paper Sci. 26,377-383.
4. Si, J. Q. (1995), Patent Cooperation Treaty (PCT), International patent application no.
WO 95/23515 AI.
5. Medel, P., Baucells, F., Gracia, M.I., BIas, c., and Mateos, G. G. (2002), Anim. Feed Sci.
Technol. 95, 113-122.
6. Gilbert, H. J. and Hazlewood, G. P. (1993), J. Gen. Microbiol. 139, 187-194.
7. Gokhale, D. V., Patil, S. G., and Bastawde, K. B. (1998), Bioresour. Technol. 63,
187-191.
8. Coughlan, M. P. and Hazlewood, G. P. (1993), Biotechnol. Appl. Biochem.17, 259-289.
9. Abdel-Sater, M. A. and El-Said, A. H. M. (2001), Intern. Biodeterior. Biodegrad. 47, 15-21.
10. Haltrich, D., Nidetzky, B., Kulbe, K. D., Steiner, W., and ZupanCic, S. (1996), Bioresour.
Technol. 58,137-161.
11. Sachslehner, A., Haltrich, D., Nidetzky, B., and Kulbe, K. D. (1997), Appl. Biochem.
Biotechnol. 63-65, 189-201.
12. Kvesitadze, E., Adeishvili, E., Gomarteli, M., Kvachadze, L., and Kvesitadze, G.
(1999), Intern. Biodeterior. Biodegrad. 43, 189-196.
13. Jain, A. (1995), Process Biochem. 30, 705-709.
14. Lemos,J. L. S., Fontes, M. C. A., and Pereira, N. J. (2001), Appl. Biochem. Biotechnol. 91-
93,681-689.
15. Pandey, A., Soccol, C. R., Nigam, P., and Soccol, V. T. (2000), Bioresour. Technol. 74,
69-80.
16. Cannel, E. and Moo-Young, M. (1980), Process Biochem. 15,2-7.
17. Durand, A. (1998), Biofutur 181, 41-43.
18. Weiland, P. (1986), in Treatment of Lignocellulosics with White Rot Fungi, Zadrazil, F.
and Reiniger, P., eds., Elsevier Applied Science, London, England, UK, pp. 64-76.
19. Ferreira, G., Boer, C. G., and Peralta, R. M. (1999), FEMS Microbiol. Lett. 173,335-339.
20. Bailey, M. J., Biely, P., and Poutanen, K. (1992), J. Biotechnol. 23,257-270.
21. Miller, G. L. (1959), Anal. Chem. 31,426-428.
22. Haltrich, D. and Steiner, W. (1994), Enzyme Microb. Technol. 16,229-235.
23. Ghanem, N. B., Yusef, H. H., and Mahrouse, H. K. (2000), Bioresour. Technol. 73,113-121.
24. Kalogeris, E., Christakopoulos, P., Kekos, D., and Macris, B. J. (1998), J. Biotechnol. 60,
155-163.
25. Biswas, S. R., Mishra, A. K., and Nanda, G. (1988), Biotechnol. Bioeng. 31, 613-616.
26. Dubeau, H., Chahal, D. 5., and Ishaque, M. (1986), Biotechnol. Lett. 8,445-448.
27. Xia, L. and Cen, P. (1999), Process Biochem. 34,909-912.
28. Archana, A. and Satyanarayana, T. (1997), Enzyme Microb. Technol. 21,12-17.
29. Gawande, P. V. and Kamat, M. Y. (1999), J. Appl. Microbiol. 87,511-519.
30. Abdulah, A. L., Tengerdy, R. P., and Murphy, V. G. (1985), Biotechnol. Bioeng. 27,20-27.
31. Dechamps,F.,Giuliano,c., Asther,M.,Huet,M.C.,andRoussos, S.( 1985),Biotechnol.
Bioeng. 27, 1385-1388.
32. Gaspar, A., Cosson, T., Roques, c., and Thonart, P. (1997), Appl. Biochem. Biotechnol.
67,45-58.
33. Kadowaki, M. K., Souza, C. G. M., Simao, R. c., and Peralta, R. M. (1997), Appl.
Biochem. Biotechnol. 66,97-106.
34. Souza, D. F., Souza, C. G. M., and Peralta, R. M. (2001), Process Biochem. 36,835-838.
Abstract
Streptomyces are important microorganisms because of their capacity to
produce numerous bioactive molecules. In the present work protease pro-
duction, by Streptomyces sp. 594 isolated from a Brazilian Cerrado soil, was
maximized by optimizing a low-cost culture medium composition (casitone
and sugarcane molasses) using statistical experimental design. The final
protease activity (56 U /mL) was 2.8-fold and 58-fold higher than that
obtained in the beginning of this study, and in a previous work, using an
actinomycete selection medium, respectively. Protease production, not
growth associated, appeared to be modulated by an inducer system,
whereby the C/N ratio seemed to playa significant role.
Introduction
The streptomycetes, abundantly found in soils, are a well-known bac-
terial group that are especially important because of their capacity to pro-
duce antibiotics and several classes of enzymes and enzyme inhibitors (1).
Brazilian soils under cerrado vegetation are very peculiar tropical soils that
are not sufficiently explored and probably rich in new actinomycete species
*Author to whom all correspondence and reprint requests should be addressed.
(2). These soils may constitute an excellent source for the discovery of new
enzymes, including proteases, which are of considerable commercial value
for use in food, pharmaceutical, detergent, and tanning industries (3). Sug-
arcane molasses has not yet been reported in the literature as an adequate
substrate for protease production, but it is a very abundant byproduct of
the sugar industry in Brazil, and therefore is an attractive substrate.
The aim of the present work was to maximize the production of pro-
teases by an actinomycete, Streptomyces sp. strain 594, isolated from a Bra-
zilian cerrado soil. The optimization of casitone and sugarcane molasses
concentrations in the culture medium was performed using a central com-
posite experimental design. The kinetics of microbial growth and protease
production were also investigated.
Table 1
Optimization of Sugarcane Molasses and Casitone Concentration
(Xl and X2, respectively) for Protease Production by Streptomyces sp. 594a
Xl Normalized X2 Normalized Protease activity
Run (%w/v) Xl (% W/v) X2 (U/mL)
1 0.30 0 0.30 0 15.3
2 0.30 0 0.50 +1 12.2
3 0.10 -1 0.30 0 5.51
4 0.44 +0.71 0.44 +0.71 18.2
5 0.16 -0.71 0.44 +0.71 6.53
6 0.30 0 0.30 0 15.6
7 0.16 -0.71 0.16 -0.71 6.89
8 0.30 0 0.10 -1 6.27
9 0.44 +0.71 0.16 -0.71 14.5
10 0.5 +1 0.30 0 21.1
11 0.30 0 0.30 0 16.4
aA central composite design was used, and results are from fermentation experiments
carried out at 30°C for 96 h.
Analytical Methods
Determination of Biomass
Culture samples were withdrawn daily. Samples were filtered using
0.45-~m membranes, and microbial growth was measured by dry weight
determination. Biomass concentration was expressed as milligrams of dry
cells per milliliter of medium.
Reducing Sugar and Total Nitrogen
Reducing sugar and total nitrogen data were determined from fil-
tered samples according to the methods of Somogyi (7) and Bremner (8),
respectively.
Proteolytic Activity
Extracellular protease activity in filtered samples was determined by
azocasein (2%) assay in 50 mM phosphate buffer, pH 7.0 at 60°C (9). One
unit of proteolytic activity was defined as the amount of protease required
to produce an absorbance increase of 0.01 at 440 nm.
. 20-25 3
• 15-20 .€
2-
a 10-15 .~
.?:
a 5-10 '0
III
D 0·5 CI)
III 1,0
III
e
CI)
0...
Normalized casitone
concentration (.)
Fig. 1. Theoretical response surface plot obtained from central composite design for
protease production by Streptomyces sp. 594 as a function of normalized sugarcane
molasses and casitone levels. Experiments were carried out at 30°C for 96 h.
3
c/N - 15.95
1:
C>
'CD :J' 2
~E
Nl>
'OE
=~
CI)
u
0
0 .5 1.0 2 .0 3 .0
Molasses concentration (%. wlv)
40
3 B
~ 30
.~
>
""III0 20
CI)
CIl
III
CI)
10
(5
It 0
0 .5 1.0 2 .0 3 .0
Molasses concentration (%, wlv)
Fig. 2. Effect of higher sugarcane molasses concentrations on (A) cell dry weight and
(B) protease production by Streptomyces sp. 594 using 0.3% (w Iv) casitone in shake-
flask fermentations (170 rpm) carried out for 96 h at 30(C and pH 7.0.
o+--__.,;;;...=~-____r--__.___-_+O
o 24 48 72 96 120
Fermentation time (h)
Fig. 3. Typical time course for cell growth, protease production, pH, and sugar
content in Streptomyces sp. 594 shake-flask fermentations (200 rpm, 30°C) using the
optimized medium (0.3% casitone and 1% molasses, pH 7.0) and an inoculum of 105
CFU/mL.
Fermentation Kinetics
The fermentation time course for protease production by Streptomy-
ces sp. 594 at 200 rpm is shown in Fig. 3. The maximum proteolytic activity
(56 U ImL) was observed after 96 h of cultivation, and its production was
shown to be not growth associated, occurring at the middle of the station-
ary phase (Fig. 3). Bascaran et a1. (13) and Porto et a1. (14) observed that
maximum protease production by S. clavuligerus occurred at the end of
exponential and beginning of stationary growth phase. Different results
were obtained by Kim and Lee (15), who observed protease production by
a strain of S. exfoliates in batch submerged fermentations as being associ-
ated with mycelium growth.
According to Fig. 3, sugar and nitrogen contents in the medium
decreased slowly but were not completely consumed along all growth
phases. Similar results for protease production by S. clavuligerus were
observed after nutritional shiftdown, indicating that the beginning of
protease production decreased with nutrient availability (13). By con-
trast, Aretz et a1. (16) and Brabban and Edwards (17), working with some
Streptomyces species, observed that sugars were rapidly consumed from
lag to exponential phase, and then fell to undetectable levels. The mecha-
nism by which control of protease production is achieved in many
prokaryotes systems is not known yet (16).
Employing the optimized medium (0.3% [w Iv] casitone and 1.0%
[w Iv] molasses), the maximum protease activity obtained (56 U ImL; Yp/x
=40 U Img) was 2.8-fold higher, when compared to previous experiments
(data not shown) employing molasses and casitone at a 0.5% (w Iv) con-
centration. When compared to protease activities obtained in a previous
work, using starch casein salt medium (18), a common medium for actino-
mycetes, a 58-fold increase in protease activity was obtained. Lower levels
Abstract
The production of monoglyceride emulsifiers commonly employed in the
food, cosmetic, and pharmaceutical industries can be catalyzed by lipases,
biocatalysts that are becoming increasingly attractive in the enzyme market.
The aim of this study was to produce monocaprin utilizing a commercial
immobilized lipase (Lipozyme 1M 20) through the direct esterification of
capric acid and glyceroL Experiments were performed for 6 h in an open
reactor and the products were analyzed by gas chromatography. The param-
eters investigated were the amount of enzyme, temperature, and molar ratio
between the reagents (capric acid/ glycerol). The experimental runs followed
an experimental design generated using Statistica® software. The results
showed that all the parameters were significant and that monocaprin pro-
duction was enhanced at the lower ranges of the tested variables. The best
conditions established were 55°C, 3% (w /w) enzyme concentration, and
molar ratio of 1. The final product, obtained after 6 h of reaction, was 61.3%
monocaprin, 19.9% dicaprin, and 18.8% capric acid. This composition satis-
fies the directives of the World Health Organization food emulsifiers, which
requires that these mixtures have at least 70% mono- plus diglyceride, and
a minimum of 30% monoacylglyceroL
Index Entries: Lipase; monocaprin; capric acid; glycerol; monoglycerides;
molar ratio; n-hexane; t-butanoL
Introduction
The lipases (Ee 3.1.1.3) constitute a group of enzymes, that is becom-
ing increasingly attractive for the oil industry. Stability and especially
selectivity are the properties that are responsible for their success in
"Author to whom all correspondence and reprint requests should be addressed.
Esterification Experiments
All experiments were performed in duplicate in a 20-mL open-batch
reactor with constant stirring and temperature control. The reaction system
contained a mixture of capric acid and glycerol and the biocatalyst
Lipozyme IM-20. In some experiments, a 1:1 mixture of n-hexane:t-butanol
was added to the reaction medium at different volumes (2.0, 4.0, and 6.0
mL), corresponding to 24,38, and 48% of the reaction volume, respectively.
The reaction's progress was followed by withdrawing 20-JA.L aliquots at
various time intervals and analyzing them by Ge, as previously described.
Experimental Design
The effects of different variables on a process can be determined using
experimental design methodology, which employs a reduced but meaning-
ful number of experiments (13). A 23 factorial design with central point was
used to analyze the effects of temperature (n, capric acid/glycerol molar
ratio (R), and enzyme concentration (E) on the selectivity of monocaprin. The
studied values for each variable are given in Table 1. The variables and levels
were chosen as reported in the literature and by preliminary studies (14).
Molecular Sieves
Several tests under the addition of 3-A molecular sieves (0.07 g/mL)
were performed in order to evaluate the effect of water removal on the reac-
tion medium. The'reactions were performed at 55°C with a stoichiometric
molar ratio of the reagents and enzyme concentrations of 3 and 5% (w /w).
~ 40
20
Glycerol Addition
To test the influence of the reagent molar ratio, glycerol was added to
the reaction medium in a fed-batch mode. For the reactions performed with
capric acid/glycerol ratios of 0.5 and 1.0, 50% of the necessary glycerol
mass was added atthe beginning of the reaction (t =0 min), 25% after 30 min
of reaction, and the remaining 25% after 1 h of reaction.
Results and Discussion
Experimental Design
The results of the enzymatic synthesis of monocaprin were expressed
as a molar fraction of the components in the nonpolar phase (capric acid,
monocaprin, dicaprin, and tricaprin). The selectivity parameter, chosen to
define the best reaction conditions, was defined as the ratio of monocaprin
concentration to the sum of the concentration of the reaction products
(mono-, di-, and tricaprin). The results for the reactions are presented in
Fig. 1. As can be seen, the best results in terms of molar fraction (61 %) and
selectivity (70%) of monocaprin were obtained at 55°C, with a reagent molar
ratio of 1 and an enzyme concentration of 5% (w /w).
After 4 h of reaction, equilibrium was attained, so the influence of
variables on monocaprin selectivity was analyzed at this reaction time. The
results were analyzed using Statistica® for Windows, release 5.5, produced
by Statsoft. The main effects on selectivity in monocaprin and interactions
between factors were determined. Table 2 shows the regression coefficients,
standard errors, and effects. Most effects were negative, which agrees with
the decrease in monocaprin selectivity observed when the higher level (+ 1)
of each variable (T, R, E) was used (Fig. 1).
To evaluate whether the effects of the variables and their interactions
were statistically significant, a student's t-testwas employed. In Fig. 2, these
Table 2
Statistical Parameters for Design 23
Experimental with Central Point
Factor Coefficient SE Effect
Average 65.495 1.066 65.495
(1) T -4.319 1.192 -8.638
(2) R -6.894 1.192 -13.787
(3) E -3.669 1.192 -7.338
TxR -0.369 1.192 -0.738
TxE -0.581 1.192 -1.162
RxE -2.744 1.192 -5.488
TxRxE -4.519 1.192 -9.038
p=,05
(2)RATIO
'·2"3
(I)TEMP
(3)ENZYME
2by3
I~
I~
·1 0 2 3
Fig. 2. Pareto's graphic showing different effects of variables and their interactions
on monocaprin selectivity after 4 h of reaction.
evaluations are illustrated using a Pareto chart. The vertical line indicates
the magnitude of the minimum statistically significant effect for a confi-
dence level of 95%. Values shown in the horizontal columns are student's
t-test values for each effect. It can be observed that the molar ratio of the
reagents is the most significant variable influencing monocaprin selectivity.
Temperature, enzyme concentration, the interaction between Rand E, and
the interaction between the three variables (T, R, E) are also statistically
important. The results showed that all the parameters tested were signifi-
cant and favored monocaprin production at lower levels. This was further
confirmed in the subsequent experiments with varying temperature, molar
ratio of reagents, and enzyme concentration.
Applied Biochemistry and Biotechnology Vol. 105-108,2003
762 da Silva et al.
1,2 .,-_ _ _ _ _ _ _ _ _ _ _ _----::---. 70
60
50
.~ 0,8
u:: 4O;?
:i: 0,6 !?-
30 ~
C 0,4
20
:>
~2 10
o+---+---~--~--~--_+o
40 45 50 55 60
Temperature ~C)
Fig. 3. Effect of temperature on monocaprin molar fraction (%) and on initial veloc-
ity (% MF / min) of monocaprin's production after 6 h of reaction using E = 5% (w /w)
andR=l.
Effect of Temperature
Increased temperature depressed the synthesis of monocaprin, as can
be observed in the reactions performed for 40 and 70°C (Fig. 1) and in the
statistical analysis. The temperature increase enhanced the synthesis of
di- and tricaprin, decreasing monocaprin molar fraction and selectivity.
Therefore, the influence of this parameter was studied at a lower range (40-
60°C), using an enzyme concentration of 5% (w /w) and the stoichiometric
molar ratio of the reagents (Fig. 3).
According to Fig. 3, the best condition for synthesizing monocaprin
was obtained at 55°C (63.25%), decreased at higher temperatures. How-
ever, the initial speed of monocaprin formation (Vi) increased with elevated
reaction temperature in the whole range tested (until 60°C). Thus, in spite
of the higher initial rate of monocaprin formation at 60°C, the final molar
fraction of the monoglyceride was lower at this temperature. This was
probably caused by di- and tricaprin formation during the reaction.
The optimum temperature (55°C) was not consistent with the data of
Kwon et al. (15), who found that R. miehei lipase (Lipozyme IM-20) was not
as active over 40°C on the synthesis of medium-chain glycerides (tri-, di-,
and monocaprin) in isooctane. They reported that during the esterification
of fatty acid and glycerol, water is Ploduced from condensation of the two
groups; this might act as a bridge for the exchange of ionization groups.
Thus, the conformation of lipase may not be so rigid that the structure of
lipase can be destroyed at high temperature. Therefore, considering the
results obtained in our work, it can be concluded that the use of a solvent-
free system in an open-batch reactor at 55°C was effective at eliminating the
water produced in the reaction.
Effect of Enzyme Concentration
As observed in the Pareto chart (Fig. 2), enzyme concentration influ-
ences monocaprin synthesis. Therefore, several experiments with different
Applied Biochemistry and Biotechnology Vol. 705-708,2003
Synthesis of Monocaprin Catalyzed by Lipase 763
80~ ________________________________--,
60
~ 40
20
o
3 5 7 9
Enzyme concentration (% wlw)
80 ~-----------------------------------,
60
~40
20
80
60
t
.,u
c:
0
40 _ 3"10
~
-0-- 3%(with molecular sieves)
co
'0 20
::E - . - 5"10
-t:r-- 5%(with molecular sieves)
3 4 5 6 7
Time (h)
hibit the activity of the enzyme. During this experiment, high volumes of
glycerol caused high solubility of enzyme in glycerol and thus decreased the
lipase concentration at the interface, probably decreasing the reaction rate.
Effect of Addition of Molecular Sieves
Molecular sieves have been used to lower the water activity in the reac-
tion medium, thus shifting the equilibrium toward the synthesis of esters
(17). Thus, molecular sieves were used in our work to evaluate the efficiency
of water removal from the reaction medium in comparison with the free
evaporation method. The results showed that monocaprin production was
not significantly affected by adding molecular sieves to the reaction medium.
Figure 6 presents the reaction progress curves for the two conditions (free
evaporation and addition of molecular sieves). The use of molecular sieves
for water removal, although effective, did not offer a significant advantage
over the simple evaporation technique (open batch stirred reactor at 55°C).
OOr---------------------------------,
60
~ 40
20
o
Rl . E3% Rl . E5% Rl. E3%(s) R1. E5%(s)
Fig. 7. Effect of adding solvent on monocaprin selectivity and molar fraction at 55°C
with R = 1 at Lipozyme IM-20 concentrations of 3 and 5% (w /w) after 6 h. (s) = utili-
zation of 2.0 mL of the mixture of 1:1 n-hexane/t-butanol.
0
0 2 3 4 5 6 7
Time (h)
Fig. 8. Time course for monocapin synthesis carries out at 55°C, with a capric
acid/ glycerol molar ratio of 1 and 3% (w /w) Lipozyme.
Conclusion
The factorial design identified the most important parameters deter-
mining monocaprin selectivity under the tested conditions. The three
parameters studied (temperature, molar ratio of reagents, enzyme con-
centration) have statistical significance and the synthesis of monocaprin
was favored at lower values of these parameters. Using molecular sieves
for water removal, although effective, was not better than the simple
evaporation technique.
Applied Biochemistry and Biotechnology Vol. 105-108,2003
Synthesis of Monocaprin Catalyzed by Lipase 767
The results obtained in the present work indicate that monocaprin pro-
duction was feasible in a solvent-free medium. This reaction system avoids
the problems of separation, toxicity, and flammability of organic solvents,
lowering the cost of the final product and allowing product recovery without
further purification steps. The final composition obtained after 6 h of reaction
at 55°C with an enzyme concentration of 3% (w /w) and capric acid/ glycerol
molar ratio of 1 was 61.3% monocaprin, 19.9% dicaprin, and 18.8% capric
acid. This composition agrees with the directives of the World Health Orga-
nization (20) for use as food emulsifiers, which requires that these mixtures
have at least 70% mono- plus diglyceride, a minimum of 30% mono-
acylglycerol, and quantities of glycerol and triglycerides below 10%. The
development of monoglyceride production by lipases can be more competi-
tive than the chemical process, because less energy is consumed; simple
reaction media are used; and higher productivity, higher selectivity, and
higher-quality products are obtained in the bioprocess.
Acknowledgments
This project was financed in part by Funda~ao Carlos Chagas Filho de
Amparo aPesquisa do Estado do Rio de Janeiro (FAPERJ) (projects E-26/
170.731/2000 and E-26/150.356/2002), Funda~ao Universitaria Jose
Bonifacio (FUJB), and Coordena~ao de Aperfei~oamento de Pessoal de
Nivel Superior (CAPES).
References
1. Gao, X. G., Cao, S. G., and Zhang, K. C. (2000), Enzyme Microb. Technol. 27, 74-82.
2. Fevrier, P., Guegan, P., Yvergnaux, F., Callegari, J. P., Dufosse, L., and Binet, A.
(2001), J. Mol. Catal. B: Enzymatic 11, 445-453.
3. Otero, c., Arcos, J. A., Berrendero, M. A., and Torres, C. (2001), J. Mol. Catal. B:
Enzymatic 11, 883-892.
4. Ahmed, F. U. (1990), J. Am. Oil Chem. Soc. 67(1),8-15.
5. Kristmundsd6ttir, T., Arnad6ttir, S. G., Bergsson, G., and Thomar, H. (1999), J. Pharm.
Sci. 88(10), 1011-1015.
6. Bergsson,G., Steingrisson, 0., and Thomar, H. (1990), Antimicrob. Agric. Chem. 43(11),
2790-2792.
7. Isaacs, C. E., Litov, R. E., and Thomar, H. (1995), J. Nutr. Biochem. 6(7),362-366.
8. Petschow, B. W., Batema, R. P., Talbott, R. D., and Ford, L.L. (1998), J. Med.-Microbiol.
47(5), 383-389.
9. Berger, M. and Scheneider, M. P. (1992), J. Am. Oil Chem. Soc. 69,961-965.
10. B6rjesson, I. E. and HarrOd, M. (1999), J. Am. Oil Chem. Soc. 76(6),701-707.
11. Bornscheuer, U. T.(1995), Enzyme Microb. Technol. 17,578-586.
12. Langone, M. A. P. and Sant'anna, G. L. Jr. (1999), Appl. Biochem. Biotechnol. 77-79,
759-770.
13. Montgomery, D. C. (1997), Design and Analysis of Experiments, 4th ed., John Wiley &
Sons, New York, NY.
14. Langone, M. A. P., Abreu, M. E., Rezende, M. J. c., and Sant'Anna, G. L. Jr. (2002),
Appl. Biochem. Biotechnol. 98-100,987-996.
15. Kwon, D. Y., Song, H. N., and Yoon, S. H. (1996),J. Am. Oil Chem. Soc. 73(11), 1521-1525.
16. Wong, W. c., Basri, M., Razak, C. N. A., and Salleh, A. B. (2000), J. Am. Oil Chem. Soc.
77(1), 85-88.
Abstract
Pulps obtained from the ethanol/ water cooking of sugarcane bagasse were
bleached with the xylanase enzyme obtained from the fungus Thermomyces
lanuginosus IOC-4145 and with the commercial enzyme Cartazyme HS from
Sandoz. By changing the enzyme dose from 4.3 to 36 IU/g of pulp, kappa
number and viscosity were maintained when the xylanase from T.lanuginosus
was used. On the other hand, by using Cartazyme HS, kappa number de-
creased by 17%, reaching 35.5. This pulp was further extracted with NaOH
without a decrease in viscosity (10 cP), and pulp with a kappa number of 13
was obtained. X ylanases had no significant effect on the ethanol/ water pulps.
Index Entries: Organosolv pulping; sugarcane bagasse; ethanol/water
pulp; xylanase bleaching.
Introduction
Because of the increasing environmental need to eliminate the use of
chlorine in pulp-bleaching plants, the development of bleaching processes
that maintain the economic advantages of pulps has been intensively stud-
ied. An alternative method used in the bleaching process is the enzyme
treatment already studied for kraft pulps (1-3).
The use of enzymes (e.g., xylanases) for pulp treatment offers the ben-
efits, of environmental protection and improved pulp quality. Among the
various enzymes of interest to the paper industry, the hemicellulolytic
xylanases have been found to be commercially feasible for pulp bleaching (4).
Xylanase pretreatment facilitates chemical extraction of lignin from
pulp, reducing consumption of bleaching chemicals and the discharge of
toxic compounds into the environment (4). Xylanases catalyze the hydroly-
sis of xylose-xylose bonds within the xylan chain and solubilize only a
fraction of the total xylan present (5).
*Author to whom all correspondence and reprint requests should be addressed.
Conclusion
The kappa number, viscosity, and hydrolysis values obtained were
close for the two enzymes. For the ethanol/ water pulps, a cumulative effect
of the alkaline extraction with the enzymatic treatment was not observed.
A kappa number of 13 was the limit reached with the ethanol/water pulp
after alkaline extraction with or without xylanase treatment. In future work
to elucidate the action of xylanase on ethanol! water pulps, the parameters
will be better evaluated at lower severity.
Acknowledgments
We acknowledge financial support from Funda~ao de Amparo a
Pesquisa do Estado de Sao Paulo and ConselhoNacional de Desenvolvimento
Cientifico e Tecnol6gico.
References
1. Valchev, I., Yotova, L., and Valcheva, E. (1998), Bioresour. Technol. 65, p. 57-60.
2. Farrel, R. L., Viikari, L., and Senior, D. (1996), in Pulp Bleaching: Principles and Practice,
Dence, C. W. and Reeve, D. W., eds., Tappi, Atlanta, GA, pp. 365-375.
3. Ni, Y. and Heiningen, A.R.P.V. (1998), TAPPI J. 81(4), 141-144.
4. Prasad, D. Y., Rajesh, K. 5., Praburaj, T., Mohan Rao, N. R., and Joyce, T. W. (1996),
Cellulose Chem. Technol. 30, 463-472.
5. Bajpai, P. and Bajpai, P. K. (1996), TAPPI J. 79(4),225-230.
Abstract
A eDNA, designated celF, encoding a cellulase (CeIF) was isolated from the
anaerobic fungus Orpinomyces PC-2. The open reading frame contains regions
coding for a signal peptide, a carbohydrate-binding module (CBM), a linker,
and a catalytic domain. The catalytic domain was homologous to those of
CelA and CelC of the same fungus and to that of the Neocallimastix patriciarum
CELA, but CelF lacks a docking domain, characteristic for enzymes
of cellulosomes. It was also homologous to the cellobiohydrolase lIs
and endoglucanases of aerobic organisms. The gene has a Ill-bp intron,
located within the CBM-coding region. Some biochemical properties of the
purified recombinant enzyme are described.
Index Entries: Cellulase; anaerobic fungi; Orpinomyces; cellulose-binding
module; carbohydrate-binding module.
tNames are necessary to report factually on available data; however, the USDA neither
guarantees nor warrants the standard of the product, and the use of the name by USDA
implies no approval of the product to the exclusion of others that may also be suitable.
Introduction
Anaerobic fungi are part of the natural microflora of the alimentary tract
of many herbivorous animals. Since the discovery of the first anaerobic fun-
gus, Neocallimastix frontalis, by Orpin in 1975 from the rumen of sheep (1), at
least 17 different species of anaerobic fungi have been isolated from ruminant
and nonruminant herbivores. Anaerobic fungi produce highly active hydro-
lytic enzymes (2), such as endoglucanases, xylanases, lichenase, and esterases.
The fungi physically associate with the lignocellulosic tissue of plant frag-
ments. The hydrolytic enzymes exist as high molecular mass complexes
and as individual molecules (3,4). Several genes coding for the hydrolytic
enzymes have been cloned and sequenced from the monocentric fungi
N. patriciarum (5-8), N. frontalis (9), and Piromyces sp. (10,11) and from the
polycentric fungi Orpinomyces PC-2 (12-15) and Orpinomyces joyonii (16).
Analyses of the primary structures of endoglucanases, xylanases, and
lichenase from the anaerobic fungi have revealed that there are substantial
sequence similarities between them from the rumen anaerobic fungi and from
bacteria of the rumen, which suggests that these genes may have bacterial
origin (5,7,8,12-14). However, recently several family 6 cellulase genes have
been isolated from N. patriciarum (17) and Orpinomyces PC-2 (15), and their
amino acid sequences are homologous to enzymes of aerobic fungi. An eno-
lase gene from N. frontalis containing an intron (18) and a cyclophilin gene
from Orpinomyces PC-2 that is heavily interrupted by introns (3,19) have been
reported. So far no intronhas been found in any of the sequenced genes coding
for plant cell wall-degrading enzymes of the anaerobic fungi. Here we report
the cloning and sequencing of a cDNA (ceIF) encoding a family 6 cellulase
(CeIF) from Orpinomyces PC-2 and characterization of the cellulase obtained
by expression in Escherichia coli. Analysis of genomic DNA of the gene celF
revealed that there is an intron, indicating that celF has a fungal origin. This
appears as the first report for an intron-containing gene coding for an enzyme
from an anaerobic fungus involved in plant cell wall degradation.
,.
< •
I •
-
14 •
Fig. 1. 50S-PAGE and zymogram of the recombinant CeIF. (A) Coomassie brilliant
blue staining of505-PAG; (B) cellulase zymogram gel. Lane 5, protein molecular mass
standards; lane I, crude E. coli proteins (50 flg); lane 2, the purified CelF (2 flg).
(12-15). The codon usage for celF is similar to that of other Orpinomyces
PC-2 cellulase, xylanase, and lichenase genes.
Enzyme Characterization
The purified recombinant CelF appeared as a single band on sodium
dodecylsulfate polyacrylamide gel electrophoresis (SDS-PAGE) (Fig. 1).
Zymogram analysis showed that the apparent molecular mass of CelF
produced in E. coli was approx 45.5 kDa (Fig. 1), which appears to be
consistent with the deduced molecular mass of the mature CelF lacking
the proposed signal peptide of 20 amino acid residues. No other activity
band with lower molecular mass was detected in the crude cell extracts,
Table 1
Substrate Specificity of Orpinomyces CelF Produced in E. eolia
Substrateb Specific activity (U /mg protein)
Avicel 0.039
Acid-swollen cellulose 83.1
CMC 120.0
Barley j3-glucan 1001.5
Lichenin 724.6
"Assays were performed at 40°C and pH 6.0 (50 mM sodium citrate)
for 10 min (PNP-~-glycosides), 15 min (oat spelt xylan, barley ~-glucan,
and lichenin), 30 min (CMC), and 4 h (Avicel), respectively.
"The activities with pNP-~-D-glucoside, pNP-~-D-cellobioside, oat spelt
xylan, or pNP-~-D-xyloside as substrate were < 1.0% of that against CMC.
Table 2
HPLC Analysis of Products of Cellooligosaccharide
and Polysaccharide Hydrolysis by Celpa
Products or residual substrates (Ilmol/mL)
Substrate G1 G2 G3 G4
Cellotriose (G3) 0.30 0.20 2.7
Cellotetraose (G4) 5.8
Cellopentaose 0.20 3.3 2.7
Avicel 0.20 0.11
Acid-swollen cellulose 0.037 0.72 0.34
CMC 0.017 0.31 0.12
"Reaction mixtures contained 0.25 VlmL of enzyme (CMC as sub-
strate) and 3 mM cellooligosaccharides, 0.7% (w Iv) CMC, or 0.5% (w Iv)
acid-swollen cellulose in 20 mM sodium citrate. Reactions were at pH 6.0
and 40°C for 4 h. In the case of Avice!, 1.0 U/mL of enzyme (CMC as
substrate) and 1% (w Iv) Avicel were combined and reactions wereatpH
6.0 and 40°C for 16 h.
Immediately after the signal sequence, amino acid residues 22-57 consti-
tute a typical fungal carbohydrate-binding module (CBM) (17,24). The
catalytic domain is located at the C-terminus (amino acid residues 106-
432). It is separated from the CBM by an extremely Asn-rich linker (amino
acid residues 67-105).According to classification of CBMs (24), the CBM
of CelF should be placed in family I, which is exclusive to fungal hydro-
lases. It has a high degree of similarity with the CBM of CBHII from
T. reesei (86% similarity and 53% identity). Six cysteine residues (nos. 22,
29,39,40,46, and 56) forming three disulfide bridges that stabilize the
polypeptide are conserved in CelF (25,26). Three highly conserved aro-
matic residues (Tyr26, Trp52, and Tyr53), which are conspicuous build-
ing blocks of the flat-face binding to the cellulose surface (23), are present
Applied Biochemistry and Biotechnology Vol. 105-108,2003
782 Chen et al.
in the CBM. Moreover, three invariant amino acids (Gln28, Asn50, and
Gln55) in suitable positions for hydrogen bonding with the cellulose sur-
face are also present in the CBM (23). The presence of a CBM in CelF is
consistent with the fact that about 80% of the cellulase activity of the
purified CelF adsorbed onto Avicel.
The deduced amino acid sequence of CelF of Orpinomyces PC-2 when
compared with protein sequences in the SWISS PROT and GP data banks
was homologous to several CBHIIs and endoglucanases belonging to fam-
ily 6 glycosyl hydrolases (27). The highest identity was with CELA of
N. patriciarum (17). The identity with it was 82.9% when the complete
sequences including signal peptide, CBM, linker, and catalytic domain were
compared. One deletion and/ or insertion between these two enzymes was
found in the linker region (after residue 86 in CeIF), whereas five amino
acids (residues 345-349) present at the carboxyl terminus of Orpinomyces
PC-2 CelF were not found in N. patriciarum CELA. The catalytic domain of
CelF of Orpinomyces PC -2 is homologous with the ca talytic domains of CelA
(75.2% similarity, 64.8% identity) and CelC (74.9% similarity, 63.6% iden-
tity) of the same organism (15). It also has substantial similarity with the
CBHIIs of T. reesei (52.6% similarity, 37.2% identity) (26) and Fusarium
oxysporum (54.7% similarity, 38.9% identity) (28), Cellulomonas fimi CENA
(49.2% similarity, 32.0% identity) (29), Streptomyces halstedii CELA1 (51.6%
similarity, 31.2% identity) (3D), and Thermomonospora fusca CELE2 (50.3%
similarity, 26.5% identity) (31).
The three-dimensional structures of the catalytic domains of T. reesei
CBHII (32) and T. fusca CELE2 have been determined (33). Mutagenesis
studies of T. reesei CBHII have shown that Asp245 is the likely proton
donor in the catalytic event and that the neighboring Asp199 is charged,
ensuring the protonation of Asp245. A function of the Tyr193 is to modu-
late the protonation states of the interacting carboxylates of Asp199 and
245 (34). These three amino acid residues are conserved in family 6 gly-
cosyl hydrolases and are present in the catalytic domain of CelF (Asp 181,
Asp223, and TyrI75), CelA, and CelC (15). Family 6 glycosyl hydrolases
contain both CBHIIs and endoglucanases. Endo- or exo-type activity
depends on whether the enzyme contains loops that form a tunnel active
site (32,34) or an open cleft (endoglucanase) (33). Compared with T. reesei
CBHII exoglucanase, there are deletions of two amino acids correspond-
ing to the carboxyl terminal loop (from Ser391 to Gly409) and four amino
acids corresponding to the second loop (from Pro178 to Ala191) for CelF
of Orpinomyces PC-2, which suggests that the loops might only partially
enclose the tunnel of the active site (15). This indicates that the loops of
CeIF, like those of CelA and CeIC, are distinct from those of CBHIIs and
endoglucanases in the same family, which may result in CelF having both
CBHII and endoglucanase activities (15).
Although the catalytic domain of CelF is very similar to those of CelA
and CelC, CelF has a CBM, whereas CelA and CelC contain a dockerin,
which is involved in neither catalysis nor cellulose binding (5,7,15). It has
Applied Biochemistry and Biotechnology Vol. 705-708, 2003
Orpinomyces Celf 783
I( 1 2 )
4.07
'.05 _.
2..04 -
1.U .
1.02 ..
0.51 -
B
GTATGGATATTTTATTTTTATAATTTAGGAAATAAATACTT
TTAAATAATTTAATTTAAGTATTGATTATTTTAAATTATTA
TATTACTTATAACAAATTAAGATATATAG
Acknowledgments
We thank Dr. Mike Cotta for critical comments and Marsha Ebener for
executive help. This work was supported by grants from the US Depart-
ment of Energy (DE-FG02-93ER20l2) and from the Consortium for Plant
Biotechnology Research, Georgia Research Alliance, and Aureozyme, Inc.
References
1. Orpin, G. C. (1975), J. Gen. Microbiol. 91,249-262.
2. Borneman, W. S., Akin, D. E., and Ljungdahl, L. G. (1989), Appl. Environ. Microbiol. 55,
1066-1073.
3. Ljungdahl, L. G., Li, X.-L., and Chen, H. (1998), in Thermophiles-The Keys to Molecular
Evolution and the Origin of Life, Wiegel, J. and Adams, M., eds., Taylor & Francis,
London, UK, pp. 187-197.
4. Steenbakkers, P. J. M., Li, X.-L., Ximenes, E. A., Arts, J. G., Chen, H., Ljungdahl, L. G.,
and Op Den Camp, H. J. M. (2001), J. Bacteriol. 183,5325-5333.
5. Black, G. W., Hazlewood, G. P., Xue, G.-P., Orpin, C. G., and Gilbert, H. J. (1994),
Biochem. J. 299, 381-387.
6. Dalrymple, B. P., Cybinski, H. D., Layton, I., McSweeney, C. S., Xue, G.-P., Swadling,
S. J., and Lowry, J. B. (1997), Microbiology 143, 2605-2614.
7. Gilbert, H. J., Hazlewood, G. P., Laurie, J. I., Orpin, C. G., and Xue, G.-P. (1992), Mol.
Microbiol. 6, 2065-2072.
8. Zhou, L, Xue, G.-P., arpin, C G., Black, G. W., Gilbert, H. J., and Hazlewood, G. P.
(1994), Biochem. J. 297,359-364.
9. Durand, R., Rascle, C, and Fevre, M. (1996), Curro Genet. 30,531-540.
10. Fanutti, C, Ponyi, T., Black, G. W., Hazlewood, G. P., and Gilbert, H. J. (1995), J. Bioi.
Chem. 270,29,314-29,322.
11. Millward-Sadler, S. J., Hall, J., Black, G. W., Hazlewood, G. P., and Gilbert, H. J.
(1996), FEMS Microbiol. Lett. 141, 183-188.
12. Chen, H., Li, X.-L., and Ljungdahl, L. G. (1997), J. Bacteriol. 179,6028-6034.
13. Chen, H., Li, X.-L., Blum, D. L., and Ljungdahl, L. G. (1998), FEMS Microbiol. Lett. 159,
63-68.
14. Li, X.-L., Chen, H., and Ljungdahl, L. G. (1997), Appl. Environ. Microbiol. 63,628-635.
15. Li, x.-L., Chen, H., and Ljungdahl, L. G. (1997), Appl. Environ. Microbiol. 63,4721-4728.
16. Liu, J.-H., Selinger, L. B., Hu, Y.-J., Moloney, M. M., Cheng, K.-J., and Beauchemin,
K. A (1997), Can. J. Microbiol. 43,477-485.
17. Denman, S., Xue, G.-P., and Patel, B. (1996), Appl. Environ. Microbiol. 62,1889-1896.
18. Durand, R., Fischer, M., Rascle, C, and Fevre, M. (1995), Microbiology 141, 1301-1308.
19. Chen, H., Li, X.-L., and Ljungdahl, L. G. (1995),Proc. Natl. Acad. Sci. USA 92,2587-259l.
20. Miller, G. L. (1959), Anal. Chem. 31,426-428.
21. Bradford, M. M. (1976), Anal. Biochem. 72,248-254.
22. Harjunpaa, V., Teleman, A., Koivula, A, Ruohonen, L., Teeri, T. T., Teleman, a., and
Drakenberg, T. (1996), Eur. J. Biochem. 240, 584-59l.
23. Von Heijne, G. (1986), Nucleic Acids Res. 14,4683-4690.
24. Tomme, P., Warren, R. A. J., Miller, R. C Jr., Kilburn, D. J., and Gilkes, N. R. (1995),
in Enzymatic Degradation of Insoluble Carbohydrates, Saddler, J. N. and Penner, M. H.,
eds., ACS Symposium Series 618, American Chemical Society, Washington, DC
25. Hoffren, A-M., Teeri, T. T, and Teleman, O. (1995), Protein Eng. 8,443-450.
26. Teeri, T. T., Lehtovaara, P., Kauppinen, S., Salovuori, 1., and Knowles, J. (1987), Gene
51,43-52.
27. Henrissat, B. and Bairoch, A (1993), Biochem. J. 293,781-788.
28. Sheppard, P. a., Grant, F. J., Oort, P. J., Sprecher, C A., Foster, D. C, Hagen, F. S.,
Upshall, A, McKnight, G. L., and O'Hara, P. J. (1994), Gene 150, 163-167.
29. Wong, W. K., Gerhard, D. C, Guo, Z. M., Kilburn, D. G., Warren, R. A J., and Miller,
R. C Jr. (1986), Gene 44, 315-324.
30. Fernandez-Abalos, J. M., Sanchez, P., ColI, P. M., Villanueva, J. R., Perez, P., and
Santamaria, R. 1. (1992), J. Bacteriol. 174,6368-6376.
31. Lao, G., Ghangas, G. S., Jung, E. D., and Wilson, D. B. (1991), J. Bacteriol.173,3397-3407.
32. Rouvinen,I., Bergfors, T., Teeri, T. T.,Knowles,I. K. C,andJones, T. A. (1990), Science
249,380-386.
33. Spezio, M., Wilson, D. B., and Karplus, P. A (1993), Biochemistry 32, 9906-9916.
34. Koivula, A, Reinkainen, T., Rouhonen, L., Valkeajarvi, A, Claeyssens, M., Teleman,
a., Kleywegt, G. J., Szardenings, M., Rouvinen, J., Jones, T. A, and Teeri, T. T. (1996),
Protein Eng. 9, 691-699.
35. Choi, S.-K. and Ljungdahl, L. G. (1996), Biochemistry 35, 4906-4910.
36. Pages, S., Belaich, A., Belaich, J. P., Morag, E., Lamed, R., Shoham, Y., and Bayer, E.
A (1997), Proteins 29, 517-527.
37. Li, X.-L., Chen, H., He, H., Blum, D. L., and Ljungdahl, L. G. (1997), in Abstracts of the
97th General Meeting of the American Society for Microbiology, American Society for
Microbiology, Washington, DC, p. 424.
38. Dijkerman,R., Vervuren,M. B.F.,Op DenCamp,H.J.M.,and vander Drift,C (1996),
Appl. Environ. Microbiol. 62, 20-25.
39. Gurr, S. J., Unkles, S. E., and Kinghorn, J. R. (1987), in Gene Structure in Eukaryotic
Microbes, Kinghorn, J. R., ed., IRL, Oxford, England, UK, pp. 93-139.
40. Felsenstein, J. (1989), Cladistics 5, 164-166.
Abstract
This study dealt with the partition behavior and partial purification of
hexokinase (HK) from baker's yeast by liquid-liquid extraction using aque-
ous two-phase polyethylene glycol (PEG)/citrate systems. First, we investi-
gated the effect of agitation type (vortex and 8 rpm rotation) on the stability
of the system, and then the effects of sodium citrate concentration, PEG con-
centration, and molar mass of PEG on the partition coefficient of this enzyme
by using a 25 factorial experimental design. The results of this factorial experi-
ment showed the possibility of a partial purification of HK by using two
extraction steps, since the enzyme preferentially migrated to the top phase
and the total proteins (mainly contaminants) remained in the bottom phase.
The purification factor (PurTOP ) of the enzyme in the top phase was 1.87, and
the partition coefficient of the total proteins (K prot ) was 0.47.
Index Entries: Hexokinase; liquid-liquid extraction; aqueous two-phase
systems; Saccharomyces cerevisiae.
Introduction
Hexokinase (HK) (Ee 2.7.1.1) is the first enzyme of glycolysis to cata-
lyze the phosphorylation of glucose into glucose 6-phosphate (G6P). G6P,
in turn, is a key intermediate for several pathways such as g]uconeogen-
esis, shunt of pentoses, and glycogen metabolism. The same enzyme is
sensitive to the catabolic repression and plays an important role in the
*Author to whom all correspondence and reprint requests should be addressed.
Level of variables
target enzyme (cell homogenate or pure enzyme; Sigma, St. Louis, MO) was
mixed with PEG (stock solution) and sodium citrate (solid). Deionized
water was then added to the mixture in order to adjust the final concentra-
tion desired for the components (system of 10 g). Next, the mixture was
agitated in vortex (1 min), rotated (8 rpm/20 min), and centrifuged (1500g /
10 min) to separate the phases from each other. Samples of the phases (top
and bottom) were removed and analyzed to verify the enzymatic activity,
total protein concentration, pH, and volume. During all the experiments,
the temperature was maintained at 25°C.
The factors and levels used for the HK extraction are provided in
Table 1 and were statistically analyzed by means of the program
5tatgraphics Plus 6.0 (Statsoft) according to the method of experimental
design proposed by Box et al. (16). After all the experiments, which con-
sisted of a 23 factorial experimental design with three repetitions in the
central point (totaling 11 extractions), the effect of molar mass of PEG
(MMPEG, g/ mol), PEG concentration (% [w /w]), and citrate concentration
(% [w / w]) were used to optimize the partition coefficient of the enzyme. For
each of the three factors, high (coded value: +1), central (coded value: 0), and
low (coded value: -1) set points were selected (Table 1).
Analytical Methods
HK activity was determined by spectrophotometric analysis (340 nm)
of reduced NADP+ at30°C, according to the method described by Bergmeyer
(2). One unit of HK was defined as the amount of enzyme that catalyzes the
reduction of 1 mmol ofNADP+ / min in the conditions of the experiment. The
concentration of total proteins was determined according to Bradford (17),
using patterns of bovine serum albumin (Sigma). The partition coefficient of
the enzyme (K) was calculated as the ratio between the HK enzymatic activi-
ties of the top and bottom phases (Eq. 1), and the partition coefficient of the
proteins (Kprot ) was calculated as the ratio between the total protein concen-
tration of the top and bottom phases (Eq. 2). Selectivity (5) was calculated as
the ratio between the partition coefficient of HK and the partition coefficient
of the total proteins (Eq. 3). The increase in purity in the top phase (PurTOP )
was obtained from the relationship between the specific activity of the
enzyme (U/mgprot) before extraction and after extraction (Eq. 4). The yield
PEG 400
40
10
O+-------~------r_------r_----_,,_--~~======~
o 5 10 15 20 25 30
Citrate concentration (% w/w)
Fig. 1. Binodal curves obtained in PEG 400, 600,1000,1500, and 4000, and citrate (pH
8.5, 25°C) systems.
of extraction (%R) was obtained from the relationship between the total
proteins (mg) or total activity of the enzyme (U) in the phases obtained after
and before the extraction, using the volume of each phase:
HK TOP
K=-- (1)
HK BOT
ProtTop
K Prot --=---
- Prot (2)
BOT
s=~ (3)
K pmt
P ur
TOp = U TOp/mg Prot (4)
U initialmg Prot
Type of homogenization
Studies of Equilibrium
Extractions in PEG / citrate systems with cell homogenate presented
cellular fragments occupying a large space between the top and bottom
phases of aqueous two-phase systems. This volume, according to
Genevieve et al. (19), can be called interface volume or be considered as
a third phase of the system, harming not only the transfer of proteins
between the phases (20), but also the total solubility of the citrate salt in
the system. For this reason, studies of equilibrium of the PEG/citrate
system were carried out in order to define extraction conditions precisely
with small or no interface volume. The results (Table 2) showed that the
association between vortex and rotation (vortex for 1 min + 8 rpm/20
min) makes it possible to decrease the interface volume as well as the total
dissolution of the citrate salt.
Experiments were conducted with another enzyme (G6PDH) to verify
the partition coefficient as a function of different times of rest of the PEG/
citrate system after its homogenization and centrifugation. The results
showed that only after 6 h of rest was the PEG / citrate system stable, which
is in agreement with the findings of Jain and Johri (21) in relation to the use
of different times of rest after the homogenization of the aqueous two-
phrase system.
Liquid-Liquid Extraction in PEG/Citrate System: HK
After obtaining the binodal curves and evaluating the equilibrium of
the PEG / citrate system, we conducted experiments to verify the effects of
citrate concentration (%citrate), PEG concentration (%PEG), and MMPEG
on the partition coefficient (K) of pure HK enzyme (Sigma). The statistical
analysis of the results employing t-tests and variance analysis showed
that MMPEG and %citrate were significant variables in the extraction
process, with 95% confidence. A negative effect of MMPEG and a positive
effect of %citrate on the response variable (K) were observed. This means
1AOO
1~OO
1000
aOO
1- 600
Table 3
Partition Coefficient (K) of HK as Function
of MM PEG, %PEG, and %citrate, at pH 8.5 and 25°C
that the lowest MMPEG and the highest citrate concentration provided
the highest values of K, as observed in the response surface (Fig. 2). For
the purpose of statistical analysis, the values of the partition coefficients
obtained in experiments 6 and 8 (Table 3), which did not form two-phase
systems, were considered null (K = 0).
'""'
~ 20
~
~
Q
0
15
'p
~
!:l
t::
CI) 10
()
t::
0
()
c:J 5
III
~
0
8 10 12 14 16 18 20
Citrate concentration (% w/w)
Fig. 3. Binodal curve built with PEG 1500 and citrate salt (pH 8.5 and 25°C). The
points represented by the triangles were used for the initial extractions of the system
PEG 1500/citrate in two stages.
genate, but also the formation of such a system when pure enzyme was
used (Table 4, experiment 3).
Experiments aiming the reduction of the system viscosity were per-
formed with a higher %citrate (significant variable on the value of K) and
a lower PEG concentration, until a close point to the binodal curve, because,
according to the results of the experimental design, this variable (%PEG)
does not interfere with the response of the system. These extraction condi-
tions and the systems in which there were separations of the phases pro-
vided a high value of enzymatic partition coefficient. However, the values
of protein partition coefficient were high, and the purification factor was
low. From this result it is possible to conclude that the system (12% [w / w]
PEG 400 and 25% [w /w] citrate, pH 8.5, and 25°C) prepared with cell
homogenate and following the homogenization procedures can be used to
prepurify the enzyme. However, to improve the purification factor of the
enzyme, new experiments were conducted. A second extraction stage was
performed and the top phase obtained in the first stage was used as the
initial medium and source of HK.
Second Stage of Extraction
The top phase obtained after the first extraction was added to the
second stage (PEG IS00/Citrate). This new stage of HK extraction was
performed in different concentrations of PEG and citrate, and these con-
centrations were defined as a function of the binodal (Fig. 3). The extrac-
tions were performed with the lowest concentrations of PEG and citrate,
but above the binodal curve. The results of the experiments are presented
in Table 5.
The results showed that to reach higher enzyme purity (PUYTOP ) and
partition coefficients (K), additional experiments should be performed.
Conclusion
The extraction of proteins by the aqueous PEG/ citrate system was
effective, with quite simple reagents and stages of process. Its use in the
partial purification of HK in two extraction steps is viable. In the first step,
using 12% (w /w) PEG 400 and 25% (w /w) citrate atpH 8.5 and 25°C, high
enzymatic recovery was obtained in the top phase of the system with high
values of partition coefficient. In the second step of extraction, performed
with 13.5% (w /w) PEG 1500 and 17.5% (w /w) citrate, a good purification
factor was obtained in the top phase (PurTOp = 1.87). This indicates a ten-
dency of the HK to stay in this phase in comparison with the undesirable
proteins (K prot = 0.47), which show a higher migration to the bottom phase
of the system. The exclusion effect, caused by the PEG with high molar
mass, did not allow the transference of the enzyme to the top phase. Fur-
thermore, the effect of salting out can also explain the transference of the
enzyme to the top phase of the system, because under high concentrations
of citrate the enzyme is expelled from the bottom phase. The results also
Acknowledgments
We thank Funda<;ao de Amparo a Pesquisa do Estado de Sao Paulo
(FAPESP) and Conselho Nacional de Desenvolvimento Cientifico e
Tecnol6gico (CNPq) for financial support, and Maria Eunice M. Coelho for
assistance in writing the manuscript.
References
1. Kovak, L.,Nelson, B. D., and Ernster, L. (1986), Biochem. Biophys. Res. Commum.134(1),
285-291.
2. Bergmeyer, H. (1984), Methods of Enzymatic Analysis, 3nd ed., Verlag Chimie,
Weinheim, Germany.
3. Chenault, H. K., Mandes, R F., and Hornberger, K. R (1997), J. Org. Chern. 62,331-336.
4. Whitaker, J. R (1991), in Food Enzymology, vol. 2, Fox, P. F., ed., Elsevier, New York,
NY.
5. Godfrey, T. and West, S. (1996) Industrial Enzymology, MacMillan, London,
England, UK.
6. Rodrigues, E. M. G., Pessoa-Jr., A., and Milagres, A. M. F. (1999), Appl. Biochem.
Biotechnol. 78, 779-788.
7. Rodrigues, E.M.G., Milagres, A.M.F., and Pessoa-Jr., A. (1999), Process Biochem. 34,
121-125.
8. Diamond, A. D. and Hsu, J. T. (1992), Adv. Biochem. Eng. Biotechnol. 47,89-135.
9. Costa, S. A., Pessoa Jr., A., and Roberto, 1. C. (1998), Appl. Biochem. Biotechnol. 70/72,
629-639.
10. Gaikar, G. V., Bodhankar, S. S., and Latha, V. J. (1996), J. Chern. Technol. Biotechnol. 67,
329-332.
11. Coimbra,J. S. R, Thommes,J.,Meirelles,A. J. A., and Kula,M. R (1995), Bioseparation
5,259-268.
12. Coimbra, J. S. R, Thommes, J., and Kula, M. R (1994), J. Chromatogr. 668,85-94.
13. Coimbra, J. S. R, Mojola, F., and Meirelles, A. J. A. (1998), J. Chern. Eng. Japan 31,
277-285.
14. Schmidt, A. S., Venton, A. M., and Asenjo, J. A. (1994), Enzyme Microb. Technol. 16,
131-142.
15. Albertsson, P. A. (1986), Partition of Cell Particles and Macromolecules, John Wiley,
New York, NY.
16. Box,G.P.,Hunter, W. G., and Hunter,J. S. (1978)Statisticsfor Experimenters,John Wiley,
New York, NY.
U. Bradford, M. A. (1976), Anal. Biochem. 72, 248-254.
18. Vernau, J. and Kula, M. R (1990), Biotechnol. Appl. Biochem. 12,397-404.
19. Genevieve,M.F., Walker,S. G., and Lyddiatt,A. (2000),J. Chromatogr. B743(1),409-419.
20. Cascone, 0., Andrews, B. A., and Asenjo, J. A. (1991), Enzyme Microb. Techno!. 13,
629-635.
21. Jain, A and Johri, B. N. (1999), Bioresour. Technol. 67,205-207.
22. Mom~, D. J., Mom~, D. M. (2000), J. Chromatography B 743,369-376.
23. Rito-Palomares, M. and Cueto, L. (2000), J. Chromatogr. B 743, 5-12.
Abstract
The effect of aeration on lignin peroxidase production by Streptomyces
viridosporus T7A was studied in a bench-scale bioreactor using a previously
optimized growth medium (0.65% yeast extract and 0.1 % corn oil, pH 7.0) at
37°C and natural pH. Airflow rates of 0.3,1.0, and 1.5 vvm and a fixed agita-
tion of 200 rpm were initially studied followed by 1.0 vvm and 200, 300, 400,
and 500 rpm. The use of 1.0 vvm and 400 rpm increased enzyme concentration
1.8-fold (100-180 U IL) and process productivity 4.8-fold (1.4-6.7 U I [L·h]) in
comparison with the use of 200 rpm and 0.3 vvm. The inexpensive corn oil,
used as carbon source, besides its antifoam properties, proved to be
nonrepressive for enzyme production.
Index Entries: Streptomyces viridosporus; lignin peroxidase production;
aeration; productivity; corn oil.
Introduction
Since World War II, human activity has introduced a great variety of
xenobiotic chemicals into the environment on a large scale. Every year some
1000 new chemicals are introduced on the market, many of them displaying
a rather poor biodegradability (1). Lignin peroxidase (LiP), which in nature
is responsible for lignin degradation in the presence of hydrogen peroxide
(2), also presents the ability to oxidize, besides lignin, a larger number of
aromatic substances, including highly polluting and recalcitrant com-
pounds, such as azo dye and pesticides (3,4). Although such properties
make LiP potentially useful in environmental pollution control (5), this
application in an industrial scale requires its production at low cost.
A OJ ~----------------------------T10
~~~~~~~~~~~~~~~:
0.6
~ 0.5
= 6
~...
...as"'-
0.4
0.3
5 :a
4
:§ 0.2 \a.-~~~::-ioOiiiJl 3
Ql
U 2
0.1
1
-=~~~~~~-r~~~~~~~0
20 40 60 80
Time (h)
B 180
160 -+--0.3
_ _ 1.0
140
~...
--1.5
120
,~ 100
;:
'<.I
as 80
~ 60
40
20
0
0 20 40 60 80
Time (h)
Fig. 1. Cellular protein (ptn), pH variation (A) and extracellular LiP activity (B)
profiles of S. viridosporus T7A grown in agitated submerged culture at 37°C, 200 rpm
using different airflow rates.
and enzyme production to the increase in aeration rate, maximum liP activ-
ity was also anticipated in 24 h in both cases. These results corroborate those
found in the literatpre; both lignin mineralization and LiP synthesis were
increased in cultures grown under high oxygen tension (14, 22).
The pH increased in all fermentations, reaching maximal values within
the range of 8.5-9.5 (Fig. lA). Enzyme titers decreased after 48 h of fermen-
tation with the use of 1.0 and 1.5 vvm, probably owing to pH inactivation
since previous work indicated pH 8.0 as a threshold value for enzyme
stability (8).
B 200
180
,-.. 160
g 140
'-' 120
f 100
'tCIS 80
~ 60
...:l
40
20
0
0 20 40 60 80
Time (h)
Fig. 2. Cellular protein (ptn), pH variation (A) and extracellular liP activity (B)
profiles of S. viridosporus T7A grown in agitated submerged culture at 37°C, 1.0 vvm
using different agitation rates.
4000 TlC======~---------------'
• 200rpm/O.3vvm
.-. 3500 .200rpm/1.Ovvm
c:
.! 3000 .200rpm/1.5vvm
o
Q. 2500 .300rpm/l.Ovvm
. 400rpm/l.Ovvm
] 2000
2.
CI
1500
~ 1000
::J
> 500
0 +---,--
o 8 24 32 48 56 72 80
Time (h)
7 ~====~--~----------------~
• 200rpm/O.3wm
6 .200rpm/l.0wm
~ 5 • 200rpm/l.Swm
::J .300rpm/1.Owm
;: 4 . 400rpm/1.Owm
:c
~ 3 • 500rpm/1.Owm
::s
'8.... 2
0..
1
o +-----,--
o 8 24 32 48 56 72 80
Time (h)
protein) was obtained for the aeration I agitation resulting from the use of
400 rpm and 1.0 vvm within 56 h of fermentation (Fig. 3). The maximum
value of liP productivity (6.7 U I [L·h]) was also obtained in the same con-
dition within 24 h of fermentation (Fig. 4).
Table 1 summarizes the maximum liP activity (U IL), maximum
biomass accumulation (gcell protein/L of culture), productivity (U I [L·h])
and maximum normalized liP production (U I g of cell protein) in the six
conditions studied. When the airflow rate increased from 0.3 vvm/200
rpm to 1.0 vvm/400 rpm, a 4.8-fold increase in productivity (from 1.4 to
Applied Biochemistry and Biotechnology Vol. 105-108, 2003
806 Gottschalk et al.
6.7 u I [L·h]) and a 7.2-fold increase in normalized LiP activity (518-3750
U I g) were observed, suggesting an improvement in cell physiology
toward enzyme biosynthesis. Although an airflow rate of 1.5 vvm/200
rpm also favored LiP production (170 U IL), the normalized production
was lower (1034 U I g of cell protein). Thus, the higher cell growth, result-
ing from the better culture medium mix, allowing oxygen and nutrients
more accessible for the microorganism, had detrimental effects on
enzyme production, and by extension, on the normalized LiP production
data (16,29).
The increase in agitation rate from 400 to 500 rpm resulted in a severe
fall in normalized enzyme production (3750 to 2333 U I g of cell protein),
most probably owing to the negative effect of the shearing effects on the
mycelium's integrity. Productivity increased 2.7-fold when the agitation
rate increased from 200 to 400 rpm and decreased (6.7 to 5.4 U I [L·h]) when
it increased from 400 to 500 rpm, confirming that the best condition for LiP
production was 1.0 vvm and 400 rpm.
Conclusion
We studied in a bench-scale bioreactor the effect of aeration and agita-
tion on S. viridosporus LiP production using the nonrepressive, although
immiscible, com oil as carbon source and CaC03 to induce a more filamen-
tous cell morphology and, by extension, to improve nutrients and oxygen
mass transfer. Cell growth, enzyme production, and productivity responded
positively to the increase in aeration rate from 0.3 to 1.0 and 1.5 vvm. The
increase in agitation rate from 200 to 500 rpm using a fixed 1 vvm airflow rate
resulted in a consistent decrease in biomass accumulation; however,
enzyme production was positively affected. It was possible to increase en-
zyme levels 1.8-fold (100-180 U IL), productivity 4.8-fold (1.4-6.7 U I [L·h]),
and normalized enzyme production 7.2-fold (518-3750 U I g of cell protein)
using 1.0 vvm and 400 rpm in comparison with 0.3 vvm and 200 rpm. The
inexpensive com oil, used as carbon source, besides its antifoam properties
also proved to be nonrepressive for enzyme production.
Acknowledgments
This work was supported by the Brazilian Research Agency Conselho
Nacional de Desenvolvimento Cientffico e Tecnol6gico (CNPq) and Rio de
Janeiro Research Foundation (FAPERJ).
References
1. Miserez, K.,Philips, 5., and Verstraete, W. (1999), Water Sci. Technol.40(415), 137-144.
2. Odier, E. and Artaud, I. (1992), in Microbial Degradation of Natural Products,
Winkelmann, G., ed., VCH, Germany, pp. 161-191.
3. Pasti-Grigsby, M. B., Paszczynski,A., Goszczynski,S., Crawford, D. L., and Crawford,
R. L. (1992), Appl. Environ. Microbiol. 58, 3605-3613.
4. Goszczynski,S., Paszczynski, A., Pasti-Grigsby, M. B., Crawford, R. L., and Crawford,
D. L. (1994), J. Bacteriol. 176, 1339-1347.
Abstract
An experimental design with factorial planning was used for the immobi-
lization of the enzyme cyclodextringlycosyltransferase (CGTase) from
Bacillus firmus (strain no. 37) to select the best combination of support, method
of immobilization, and conditions that gives primarily higher average
values for the specific immobilized enzyme activity, and secondarily, higher
average values for the percentage of protein fixation. The experimental
design factors were as follows: supports-controlled-pore silica, chitosan,
and alumina; immobilization methods-adsorption, and two covalent
bonding methods, either with y-aminopropyltriethoxysilane or hexa-
methylenediamine (HEMDA); conditions-7°C without agitation and 26°C
with stirring. The best combination of factors that lead to higher average
values of the response variables was obtained with immobilization of CGTase
in silica with HEMDA at 7°C. However, immobilization in chitosan at 7°C
gave the highest immobilized CGTase specific activity, 0.25 Ilmole of ~-CD /
(min·mg protein). Physical adsorption gave low specific enzyme activities,
and, in general, a high load of enzyme leads to lower specific enzyme activity.
Index Entries: Cyclodextringlycosyltransferase; immobilized enzyme;
controlled-pore silica; alumina; chitosan.
Introduction
Immobilized Enzymes
Enzymes are largely used as biocatalysts in the chemical, pharma-
ceutical,and food industries, and also as specific ligands in chemical and
*Author to whom all correspondence and reprint requests should be addressed.
study various supports and enzyme immobilization methods for the CGTase
from Bacillus firmus (strain no. 37), seeking the most appropriate combination
of support, method of immobilization, and conditions that give primarily
higher average values for the specific immobilized enzyme activity, and,
secondarily, higher average values for the percentage of protein fixation.
Materials and Methods
Enzyme
CGTase from B. firm us (strain no. 37) was produced according to the
methodology of Matioli et a1. (11). The enzyme was cultivated at 37°C, pH
10.0, and 150 rpm, in 750 mL ofliqu,id medium containing: 1.0 (w I v) soluble
starch, 0.5 (w Iv) polypeptone, 0.5 (w Iv) yeast extract, 0.1 (w Iv) potassium
phosphate, 0.02 (w Iv) magnesium sulfate, and 1.0 (w Iv) sodium carbon-
ate. The cell-free culture medium had a specific enzyme activity of 5.1 !lmol
of ~-CD I (min·mg), determined as given in the section CGTase Activity.
Supports
Chitosan of pharmaceutical grade was obtained from Farmacon
(Maringa, PR, Brazil), with a particle diameter in the range of 0.212-0.425
mm. Controlled-pore silica (0.35-nm mean pore diameter) was supplied by
Sucrerie Vanciennes (Crepy in Vallois, France) with a mean diameter of
0.42 mm. Alumina (Aluminum oxide 90, acid activated) was supplied by
Merck (Darmstadt, Germany) as a fine powder.
lized enzyme were washed 10 times with distilled water and the filtrates
were collected for later protein analysis. After the last washing, the immo-
bilized enzyme was vacuum-dried for 20 min. A sample of the vacuum
dried solids was taken and dried 15 h at 105°C for determination of the
immobilized enzyme humidity. The value of protein concentration in all
filtrates was used for determination of the amount of protein that was not
fixed in the support, and from it, the percentage of protein fixation in the
immobilization procedure.
Immobilization by CB-y-APTS
Support Silanization
Silica and alumina supports were silanized with a 0.5% (v Iv) solution
of y-APTS, pH 3.0 to 4.0, added in the proportion of 3 mL of solution/ g of
support. The solids and solution were agitated for 5 min at room tempera-
ture and then kept at 75°C for 3 h. Later, the silanized support was vacuum
washed with distilled water to remove excess y-APTS and dried at 105°C
for 15 h. Chitosan, being an organic support, was not silanized.
Support Activation
Silanized supports were activated with a glutaraldehyde solution
(2.5% [v Iv] in 0.1 M sodium hydrogen phosphate buffer, pH 7.0; 3 mL of
solution/ g of solid). Support solids were kept under vacuum for 15 min,
and still under vacuum, the glutaraldehyde solution was added slowly
up to complete immersion of the solid. For chitosan, 15 mL of glutaralde-
hyde solution/ g of solid was used instead. The mixture of support and
activating solution was agitated at 26°C for 1 h. Then the solids were
washed with distilled water up to neutral pH to eliminate excess glutaral-
dehyde and vacuum dried for 20 min. CGTase was immobilized with the
same procedure as described in the section Immobilization by Adsorp-
tion. The humidity of the immobilized enzyme was determined by drying
a sample at 105°C for 15 h (5).
Immobilization by Covalent Bonding with Hexamethylenediamine
Approximately 2.5 g of cleaned and hydrated support was kept
under vacuum for 15 min and then a solution of Hexamethylenediamine
(HEMDA) (2.0% [w Iv]) was added under vacuum in the proportion of
12.8 mL of solution/ g of solid. The mixture was kept under agitation for
2 h at 40°C. Later, the liquid was decanted and an equal volume of glut-
araldehyde solution (3% [w Iv] in 0.1 M sodium hydrogen phosphate
buffer, pH 7.0) was added. The mixture was agitated for 15 min at 26°C.
Next, the suspension was transferred to a Buchner funnel and washed up
to neutral pH (10 successive washes of 12.8 mL of distilled water / g of
support), and the solids were vacuum dried for 15 min. A sample of the
immobilized enzyme was dried for 15 h at 105°C to determine humidity
(12). CGTase was then immobilized with the same procedure as described
in the section Immobilization by Adsorption.
Applied Biochemistry and Biotechnology Vol. 105-108,2003
Methods for Immobilization of CGTase 813
CGTase Activity
The activity of the free enzyme was determined at 50°C by assaying
the initial reaction rate of ~-CD production using the method of initial
velocities (13). The enzyme substrate was 10 gil of maltodextrin (Fluka,
Sigma-Aldrich, Buchs, Switzerland) in Tris-HCl buffer (pH 8.0), 0.01 M and
50 mM CaCI2• The substrate solution (1.5 mL) was warmed to reaction
temperature and mixed with an equal volume of enzyme solution. The
reaction was allowed to proceed for 30 min, and tubes were taken out of
the thermostatic bath each 5 min. The enzyme was inactivated by boiling
for 5 min, and the tubes were stocked at 4°C for later ~-CD assay (5).
The activity of the immobilized CGTase was also determined by
assaying the initial reaction rate of ~-CD production using the method of
initial velocities (13). However, in this case, a batch reactor fitted with a
stainless steel basket was used to hold the immobilized enzyme. The reac-
tion was carried out at 50°C with 50 mL of the same substrate solution just
described. After the substrate solution reached the reaction temperature,
a 1.5-mL sample was taken, this being the time zero point of the test, and
the basket containing about 1.5 g of immobilized enzyme particles was
introduced into the reactor. Samples of 1.5 mL were taken at 3-min inter-
vals up to 18 min. Then the basket was removed from the reactor and two
more samples were collected, at time 21 and 28 min, respectively. All
samples were treated as described for the free enzyme.
~-CD Assay
The concentration of ~-CD was determined by the dye extinction colo-
rimetric method with phenolphthalein, described by Vikmon (14), and
modified by Hamon and Moraes (15).
Protein Assay
The protein concentration of all enzyme solutions and collected fil-
trates was determined by the Bradford (16) method, usingCoomassie Blue
G-250, and bovine serum albumin as the standard protein.
Experimental Design
Evaluation of Supports and Immobilization Methods for CGTase
For evaluation of support/method influence on the immobilization
of CGTase, we chose a complete (32 x 21) factorial experimental design
with two qualitative factors (support and method) and one quantitative
factor (temperature). The factors and their levels were as follows: support
(factor Xl)-silica (level I), chitosan (level 0), and alumina (level -1);
methods (factor X2)-physical adsorption (level 1), CB-y-APTS (level 0),
and CB-HEMDA (level-I); and temperature (factor X3)-7°C without
agitation (level 1) and 26°C with stirring (level-I). The response variables
chosen were the percentage of protein fixation into the support used for
Applied Biochemistry and Biotechnology Vol. 105-108, 2003
814 Sobra/ et at.
Table 1
Matrix for Full Factorial Design in Immobilization of Enzyme CGTase
Factor level code" Real factor level
Run Xl X2 X3 Support Method Temperature (DC)
1 1 1 1 Silica Physical Adsorption 26
2 1 1 -1 Silica Physical Adsorption 7
3 1 0 1 Silica CB-y-APTS 26
4 1 0 ~1 Silica CB-y-APTS 7
5 1 -1 1 Silica CB-HEMDA 26
6 1 -1 -1 Silica CB-HEMDA 7
7 0 1 1 Chitosan Physical Adsorption 26
8 0 1 -1 Chitosan Physical Adsorption 7
9 0 0 1 Chitosan CB-y-APTS 26
10 0 0 -1 Chitosan CB-y-APTS 7
11 0 -1 1 Chitosan CB-HEMDA 26
12 0 -1 -1 Chitosan CB-HEMDA 7
13 -1 1 1 Alumina Physical Adsorption 26
14 -1 1 -1 Alumina Physical Adsorption 7
15 -1 0 1 Alumina CB-y-APTS 26
16 -1 0 -1 Alumina CB-y-APTS 7
17 -1 -1 1 Alumina CB-HEMDA 26
18 -1 -1 -1 Alumina CB-HEMDA 7
'XI, support, X2, method, X3, temperature.
Table 2
Matrix of Experimental Results from Experimental Design
Applied to Immobilization of Enzyme CGTase
Experimental conditions Results for ICGTase
Protein Specific
Temperature fixation activity
Run Support Method CC) (%) (U Img of protein)
support, and temperature that led to the single highest ICGTase specific
activity was the immobilization of CGTase in chitosan by covalent bonding
with HEMDA (CB-HEMDA) at 7°C. For this condition, the ICGTase spe-
cific activity was 0.25 U fmg of protein and the percentage of protein fixa-
tion was high, 87.57%.
However, since the goal of our study was to determine the level of
factors that gives primarily higher average values of the ICGTase specific
activity, we applied the analysis of variance (ANOVA) to the full model
using the software SAS for Windows® version 6.12. The results for the effect
of each factor and their interactions on the response variable ICGTase spe-
cific activity are presented in Table 3. Because the immobilization of CGTase
in chitosan by CB-y-APTS did not produce significant results, the set of data
resulting from this combination was removed from this analysis.
Allowing a level of statistical significance (p value) of 0.05, the results
of the ANOV A shown in Table 3 allow us to conclude that the significant
factors for attaining higher ICGTase specific activity are support (Xl) and
temperature (X3), which gave p values of 0.0057 and 0.0006, respectively.
Table 4
Comparison of Difference Between Average Values of Response Variable
ICGTase Specific Activity for Factors Whose Levels are Statistically Significant
Difference between average values of ICGTase
Factors Levels specific activity (u/mg of protein)
Support 1 and-1 0.050
Temperature -1 and 1 0.048
According to this analysis, and within the range of the factorial design,
the choice of immobilization method is not significant to obtain high
ICGTase specific activity, but its interaction with the support is (Xl· X2;
P = 0.0022). The other interactions were not statistically significant.
The average values of the response variable (ICGTase specific activ-
ity) were analyzed next, for the levels of the factors that were of significance
(support and temperature), to determine whether there were significant
differences between response variable average values. Tukey test, with a
level of significance of 5%, was used and the results are shown in Table 4.
As Table 4 shows, the average values of ICGTase specific activity
differ with statistical significance when alumina (support, level 1) is
changed to silica (support, level-1), the difference being 0.050. In addi-
tion, when the temperature level 1 (26°C) is changed to temperature level
-1 (7°C), there was also a significant difference, 0.0483. Hence, the choice
of silica as support and the temperature of immobilization of 7°C, without
agitation, led to high average values of ICGTase specific activity. In rela-
tion to the immobilization method, there was not a significant difference
Applied Biochemistry and Biotechnology Vol. 105-108,2003
Methods for Immobilization of CGTase 817
Table 5
Average Value of Response Variables Specific Activity
of ICGTase and Percentage of Protein Fixation for All Levels and Factors
of Experimental Design Applied to Immobilization of Enzyme CGTase
Average values for ICGTase Average values for
specific activity (U / mg of protein) protein fixation (%)
Level Support Method Temperature Support Method Temperature
1 0.164 0.147 0.12 64.44 57.49 68.87
0 0.152 0.128 56.82 58.82
-1 0.114 0.148 0.17 73.87 78.82 61.22
between the average values of ICGTase specific activity for the different
immobilization methods used.
To proceed in the selection of the most appropriate factors, the choice
of immobilization method was based on the second response variable: the
percentage of protein fixation. Table 5 shows the average values for the
response variables for each level of all factors. The immobilization method
that led to the highest average value for the percentage of protein fixation
(78.82%) was CB- HEMDA (immobilization method,level-1).
Therefore, the statistical analysis showed that the combination of fac-
tors including immobilization of CGTase in silica at 7°C by CB-HEMDA
results both in higher average values for the ICGTase specific activity, and
in higher average values for the percentage of protein fixation.
Further analysis of the data displayed in Table 1 shows that a too high
percentage of protein fixation is correlated with a lower ICGTase specific
activity. This is probably the result of steric hindrance of the active site of
ICGTase, because multiple enzyme layers may be formed, or excessive
crowding of the enzyme molecules into the support pores, making access
to the active sites difficult. In addition, the higher temperature (26°C) with
agitation that leads, in general, to higher percentage of protein fixation is
also associated with lower ICGTase specific activity. These two results
indicate the importance of extending this study to a range of lower enzyme
to support mass ratio, below 2.0 mg of protein/ g of support. A problem of
major concern, however, is the fact that for all factor combinations of this
study, the recovery of enzymatic activity for the ICGTase was lower than
5%, i.e., maximum ICGTase specific activity / free enzyme specific activity
x 100 < 5%. This may be the result of not using a sufficiently purified
enzyme, but it could also indicate that for greater activity recovery, a con-
trolled-pore structure with larger pores should be used. The latter hypoth-
esis is founded on the facts that CDs are large molecules, some linear
maltooligosaccharides synthesized by CGTase are of large chain size (17),
and the molecule of CGTase from B. firm us has a mol wt of 75 kDa (11).
Conclusion
Statistical analysis of the experimental design data indicates that the
most important factors for guaranteeing, primarily, higher average val-
ues for the immobilized CGTase enzyme specific activities and, second-
arily, higher average values for the percentage of protein fixation is the
immobilization of CGTase in silica by the method of CB-HEMDA at 7°C,
without agitation. However, the highest ICGTase enzyme specific activ-
ity, 0.25 U / mg of protein, occurred for immobilization in chitosan by the
method of CB-HEMDA at 7°C, without agitation.
Further immobilization studies with CGTase should explore lower
enzyme-to-support mass ratios « 2 mg of enzyme/ g of support), supports
with larger controlled-pore sizes (> 0.35 nm), and new immobilization
methods seeking higher recovery of the free enzyme activity.
Acknowledgments
We are thankful for the financial support from Coordenacao de
Aperfei~oamento de Pessoal de Nivel Superior (CAPES), Conselho
Nacional de Desenvolvimento Cientifico e Tecnol6gico (CNPq), Funda~ao
Araucaria, and State University of Maringa.
References
1. Bulmus, v., Kesenci, K., and Piskin, E. (1998), Reactive Funct. Polym. 38, 1-9.
2. Wojcik, A, Lobarzewski, J., and Blaszczynska, T. (1990), J. Chem. Technol. Biotechnol.
90,287.
3. Hayashi, T., Hirayama, c., and Iwatsuki, M. (1992), J. Appl. Polym. Sci. 44, 143.
4. Hayashi, T. and Ikada, Y. (1994), J. Appl. Polym. Sci. 42,85.
5. Tardioli, P. W., Zanin, G. M., and Moraes, F. F. (2000), App!. Biochem. Biotechnol. 84-86,
1003-1019.
6. Bekers, 0., Uijtendaal, E. V., Beijnen, J. H., Bult, A., and Underberg, W. J. M. (1991),
Drug Dev. Ind. Pharm. 17, 1503-1549.
7. Korokolvas, A (1991), ENLACE Farmalab 2, 6-15.
8. Yang, C. P. and Su, C. S. (1989), J. Chem. Technol. Biotechnol. 46,283-294.
9. Abdel-Naby, M. A (1999), Process Biochem. 34,399-405.
10. Szejtli, J. (1988), in Cydodextrin Technology, Szejtli, J., ed., KIuwer, Dordrecht, The
Netherlands, pp. 79-185.
11. Matioli, G., Zanin G. M., Guimaraes, F., and Moraes, F. F. (1998), Appl. Biochem.
Biotechnol. 70-72,267-275.
12. Pereira, E. B. (1999), MS thesis, UEM, Maringa, PR, Brazil.
13. Dixon, M. and Webb, E. c., (1979), Enzymes, 3rd ed., Chap. 7, Longman Group, Lon-
don, UK, pp. 7-22.
14. Vikmon, M. (1982), in The First International Symposium on Cydodextrin, Szejtli, J., ed.,
D. Reidel Publishing Company, Dordrecht, The Netherlands, pp. 60-74.
Abstract
Cellulase hyperproducers of Trichoderma reesei can be constructed using
autopolyploidization and haploidization techniques. To increase the effi-
ciency of this method, the active nuclear shuffling system in a swollen
conidium was effective. A dried mature green conidium of a model strain,
T. reesei QM6a (lFO 31326), was swollen to make room for a larger autopoly-
ploid nucleus. After colchicine treatment, a larger autopolyploid nucleus
was produced in such a swollen conidium. Benomyl treatment of swollen
conidia generated multiple smaller nuclei from one larger autopolyploid
nucleus. Those smaller nuclei were transported through conidia to mycelia
after germination. This system could contribute to increasing the efficiency
of genetic shuffling.
Index Entries: Trichoderma reesei; cellulase; colchicine; cellulose; benomyl.
Introduction
Trichoderma is a well-known cellulolytic fungus (1). For the purpose of
breeding this fungus, chemical mutation and genetic engineering tech-
niques have been mainly applied (2,3). Therefore, we attempted to create
a new breeding technique using autopolyploid nucleus. Previously we
demonstrated that autopolyploidization and genetic recombination can
be carried out on this fungus using a mitotic arrester, colchicine, and a
haploidizing reagent, benomyl (4). Moreover, we reported the selection
system of cellulase hyperproducers using a double-layer selection medium
from conidia as genetic recombinants (5). In this article, we present our
"Author to whom all correspondence and reprint requests should be addressed.
Table 1
Comparison of Number of White Colonies
No. of white colonies No. of green colonies
Experiment A-
I 1 904
2 0 885
3 1 923
4 3 954
Experiment Bb
1 7 948
2 11 908
3 9 865
4 15 981
aBenomyl treatment of treated swollen conidia in the solid medium.
bBenomyl treatment of treated swollen conidia in the liquid medium.
Since it was also stained with DAPI solution, this Giemsa-stained portion
was regarded as an autopolyploid nucleus.
The swollen conidia containing autopolyploid nuclei were spread on
the solid medium for benomyl treatment for 10 d at 28°C (experiment A).
PDA medium containing 0.1% (v Iv) Triton X-100 (polyoxyethylene-
octylphenylether) (Wako) and 0.6 Ilg/mL ofbenomyl(l-[butylcarbamoyl]-
2-benzimidazolecarbamate) (Sigma) was used.
Benomyl is a fungicide that deletes chromosomes from the polyploid
nucleus with or without chromosomal recombination (8). Therefore,
benomyl treatment was carried out in this experiment. Triton X-100 was
used for restraining mycelial elongation for ease of colony counting. After
incubation, the number of colonies that generated white conidia (white
colony) was counted. PDA medium containing 0.1 % Triton X-lOO (pH 6.0)
was used. The number of white colonies generated after incubation is given
in Table 1. It was suspected that the white colonies were produced through
genetic recombination. Thus, they were used for estimation of genetic shuf-
fling frequency.
Finally, benomyl treatment of swollen conidia in the liquid medium
was carried out (experiment B). Mandel's medium containing 1.0% (w Iv)
glucose,O.5% (w Iv) peptone, and 0.4 Ilg/mLofbenomyl (pH 6.0) was used.
Five loopfuls of swollen conidia containing autopolyploid nuclei were
added to 20 mL of the liquid medium in a 50-mL Erlenmeyer flask for
haploidization followed by incubation for 2 wk at 28°C under stationary
conditions. When the benomyl-treated swollen conidia were stained with
Giemsa solution, various types of smaller nuclei were observed in a swol-
len conidium. When such swollen conidia containing smaller nuclei were
incubated in Mandel's medium containing 1.0% glucose and 0.5% peptone
at 28°C, germination occurred and such smaller nuclei were transported
Applied Biochemistry and Biotechnology Vol. 105-108,2003
824 Toyama et al.
Table 2
Comparison of Frequency of White Colonies
White colonies/ Frequency of white
Total colonies colonies (%)
Experiment A 5/3671 0.14
Experiment B 42/3744 1.12
through mycelia. It was suspected that those smaller nuclei are transported
to conidia like the original nuclei.
The benomyl-treated swollen conidia were washed with sterilized
water and spread on the medium for counting the number of colonies and
incubated for 10 d at 28°C followed by the white colony count. As a result,
it appeared thatthe occurrence of white colonies was almost 10 times higher
than that in the solid medium containing benomyl (experiment A), as shown
in Tables 1 and 2.
Conclusion
From these results, we considered that a higher frequency of genetic
shuffling could be obtained by benomyl treatment in the liquid medium.
Consequently, such a technique was named "active nuclear shuffling,"
which we concluded can contribute to obtaining a higher frequency of
genetic recombination in T. reesei.
References
1. Reese, E. T. and Mandels, M. (1980), Biotechnol. Bioeng. 20(A2), 323-335.
2. Morikawa, Y., Kawamori, M., Shinsha, Y., Oda, F., Takasawa, S., and Ado, Y. (1985),
Agric.Biol. Chem. 49, 1869-187l.
3. Durand, H., Clanet, M., and Tiraby, G. (1985), Bioenergy 84, 246-253.
4. Toyama, H. and Toyama, N. (2000), Appl. Biochem. Biotechnol. 84-86,419-429.
5. Toyama, H., Yamagishi, N., and Toyama, N. (2002), Appl. Biochem. Biotechnol. 98/100,
257-263.
6. Rosen, D., Edelman, M., Galun, E., and Danon, D. (1974), J. Gen. Mirobiol. 83,31-49.
7. Yamada, M., Matsumoto, Y., Hamada, S., Fujita, S., and Yoshida, Y. (1986), Zbl. Bakt.
Hyg. 86, 6503-6507.
8. Bilinski, CA., Sills, A. M., and Stewart, G.G. (1984), Appl. Environ. Microbiol. 48,
813-817.
Phenylboronate-Chitosan Resins
for Adsorption of ~-Amylase
from Soybean Extracts
UCDB, CP. 1~O, CEP 79117-900, Campo Grande, MS, Brazil; and
2School of Chemical Engineering, DPB, UN/CAMP, CP. 6066,
CEP 13083-970, Campinas, SP, Brazil; E-mail: santana@feq.unicainp.br
Abstract
Isolation and purification of bioproducts from crude extracts can be
obtained by affinity methods based on reversible binding of a specific mol-
ecule to ligand immobilized in a porous matrix. In the present work,
nicrospheres based on chitosan matrix, which incorporated aminophenyl-
boronic acid as a derivative, were prepared and characterized, aimed at
developing a fJ-amylase adsorption process. Kinetic curves and adsorption
isotheriru of the crude extracts as well as the breakthrough curves for
a frontal chromatographic separation method of a commercial sample of
fJ-amylase from soybean are presented. These results were compared to simi-
lar data obtained with a comercial microspheres gel based-on agarose.
Index Entries: Purification; ~-amylase; soybean; phenylboronate; chitosan.
Introduction
Interest in bioproducts has been increasing as a result of biotechno-
logical development. Industrial demands for new applications, specific-
ity, and renewability of products have also increased dramatically. Because
of the expansion of downstream processing in biotechnology, the methods
aimed at concentration and purification of enzymes and biopolymers after
their production from a variety of sources require new advances (1-3).
~-Amylase (~-l,4-glucanmaltohydrolase, Ee 3.2.1.2) is an exoenzyrne that
removes units of nonreduced maltose terminals from polysaccharide
chains, producing ~-maltose and ~-limit dextrins. There is a considerable
industrial interest in this enzyme for the production of syrups rich in mal-
Campinas, Brazil). When the liquid was fed into the nozzle with a peristal-
tic pump, atomization occurred owing to the force of the compressed air,
separating the liquid into small droplets. The product was then collected.
Under standard conditions, the temperature, spray flow, and compressed
spray airflow (represented as the volume of air input per unit of time) were
set at 25°C, 6 mL/min, and 10 L/min, respectively (10). Noncrosslinked
chitosan atmospheres were prepared using a spray method by adding
2.5% (w /w) chitosan solution in 0.75 N acetic acid to 1 N NaOH and were
left to stand for 15 min. The micro spheres prepared in this way were highly
spherical and had a smooth but distorted surface morphology. Prepara-
tion conditions also had some influence on particle size. Porosity is a very
important property of chitosan matrices and can be changed using differ-
ent experimental conditions during preparation (stirring, ratio of chitosan
solution in AcOH/NaOH, temperature, stabilizer, and crosslinking).
Synthesis was carried out in three stages: preparation of the matrix,
activation, and derivatization (with reduction). Preparation of the matrix
was a process of obtaining porous particles from commercial chitosan.
Crosslinking and activation of the matrix involved reaction with a
dialdehyde agent. The derivatization was a reaction between aldehyde
groups in the matrix and amine groups in the ligand, 3-aninophenylboronic
acid, under mild conditions and the final reduction to eliminate unsatur-
ated sites. The resulting microparticulate gel (beaded noncrosslinked
chitosan) was conditioned overnight in 50 mM phosphate buffer at pH 8.0
and crosslinked and activated for 6 h at 4°C, using a ratio 0.45 mol/mol
aldehyde/ amino groups ratio. The activated matrix was washed with
phosphate buffer. Then a solution containing 16 Ilmol ofboronic acid/mL
was added, and the ligand was immobilized for 72 h at 4°C under stirring
(175 rpm). The immobilization density of the ligand in the chitosan matrix
was evaluated using ultraviolet (UV) absorption at 280 nm through the
determination of ligand concentration in solution before and after immo-
bilization (11). The PBC resin obtained was washed with distilled water
and reduced with sodium borohydride at 4°C.
Characterization of Adsorbent and Batch Experiments
Particle size distribution of the PBC adsorbent was obtained through
the light-scattering method using Malvern Mastersize equipment. The
total micropore and mesopore volumes of the dried and crosslinked
chitosan matrix were determined by nitrogen adsorption (Brunauer,
Emmet, and Teller [BET] method) and desorption methods. Batch adsorp-
tion experiments were carried out in Eppendorf tubes to characterize the
effects of pH and ionic strength on adsorption capacity.
Extraction of B-Amylase from Soybean
To verify the extraction efficiency and the content of ~-amylase in soy-
bean (PL-1/IAC, Brazil), extraction procedures developed by Smith et al. (12)
and Rai et al. (13,14) were used. Extraction was done with 1 g of defatted
Applied Biochemistry and Biotechnology Vol. 105-108,2003
832 Arruda and Santana
soybean flour, and diluted with buffer to obtain a protein solution used in
capillary electrophoresis.
Capillary Electrophoresis
The equipment used was Beckman P / ACE model 5010 in CGE mode
with an uncoated, fused silica capillary tube (47 cm x 75 J.tm). Samples were
dissolved in 120mMTris-HC1 buffer,pH6.6,containing 1% (w/w) sodium
dodecyl sulfate. Beckman provided the run gel buffer. Voltage was 14.1 kV
at 20°C. The extracts were lyophilized for further use.
Determination of Protein
The total protein content was determined by the Bradford (15) method,
using bovine serum albumin as a reference.
Determination of ~-Amylase Activity
~-amylase activity in the extracts was determined by the Bernfeld (16)
method, in 125 mM acetate buffer, pH 5.0. One unit of ~-amy1ase (activity
unit [AU]) was defined as the amount of enzyme that catalyzed formation
of 1 J.tIDol of maltose per minute using 1 mL of enzyme solution under given
conditions. In a typical batch determination, 400 J.tL of 2.5% (w /w) starch
solution was added to 400 J.tL of 125 mM acetate buffer, pH 5, with 200 J.tL
of the enzyme solution and the solution was immediately incubated at 60°C
for 30 min. After 4 mL of reagent DNS was added, the reagent was mixed
vigorously and boiled for 15 min in a bath, and the resulting sample was
collected in an ice bath. The UV absorbance was measured at 640 nm against
a blank with the same component mixture without the enzymatic solution.
The calibration curve of maltose (0.2-2 mg/mL) was prepared for
conversion of spectrophotometiic readings of the enzyme activity. The
specific activity was expressed as the activity of ~-amylase/mg of total
protein.
Kinetic Curves and Adsorption Isotherms
The experimental procedures for determination of both the kinetic
and isotherm curves were similar. Setups containing syringes and dispos-
able pistons with retention were used. Samples with the adsorbent and the
enzyme solution were placed in the syringes and conditioned in 25 mM
phosphate buffer, pH 6.8, containing o. 1 M NaCI (adsorption buffer) for 1
h with temperature controL In those experiments, I mL of the enzyme so-
lution mixed with the adsorbent and 15 mg of the lyophilized extract di-
luted in 50 mL of phosphate buffer were added and placed on a rotation
device (10 rpm). The revolution simulates an agitated tank and allows dis-
persion and homogenization of the suspension. Samples were withdrawn
at a few minutes' intervals for determination of the adsorption kinetics and
after 180 min for acquisition of the adsorption equilibrium data. The super-
natant was evaluated in tern of total protein and activity as the amount of
total protein or activity. For each concentration, the capacity was deter-
mined as the amount of total protein or activity (protein mg, or AU) con-
Applied Biochemistry and Biotechnology Vol. 105-108,2003
PBC Resins for Adsorption of~-Amylase 833
tained in 1 g of the adsorbent. The equilibrium data were fitted with the
Langmuir model (17).
Chromatographic Experiments
Isocratic Elution
The PBC and phenylboronate-agarose (Matrix gel PBA-30; Amicon)
adsorbents were conditioned in a column and tested. A Pharmacia HR 5/
5 column (0.5-cm diameter) was used and coupled to a Shimadzu high-
performance liquid chromatography system and a data acquisition system.
The tests were carried out with 0.85 g of each adsorbent (ie., 6 cm of the
adsorbent bed in the column) at a flow rate of 0.25 mL/min. A sample of a
prepurifled and dialyzed soybean ~-amylase was injected into the column
and preequilibrated with 25 mM phosphate buffer (pH 6.8). The same buffer
was used for isocratic elution with 0.1 M sorbitol and 0.1 M NaC1, or 0.5 M
NaCI for PBA-30 and PBC, respectively, at a flow rate of 0.25 mL/min. The
eluted phase was collected in 1-mL fractions and samples were analyzed
for protein concentration and activity.
Frontal Analysis
In the fixed-bed adsorption experiments, soybean extract was con-
tinuously fed into the column containing the solid phase, formed by beads
of the PBC adsorbent. The feed was maintained until the desired product
(~-amylase) appeared in the effluent at the feed concentration. The column
was packed with 0.5 g of the adsorbent beads and had a diameter of 0.5 cm,
a length of 2 cm, and a constant operational flow rate of 0.5 mL/min.
..
- 0 - RI 0.30
- 0 - R2 D,4S
1.0 - 6 - R3 Cl,!IS
-v- R4 1.45
'to -0-
a
~ 4~
-e- R6 S.so
~
I
- 0.5
~
j
0.0+--..--.......,...................---.-......-.,......,..........~....4--.-........
1 10 100
Pore diameter ( am)
2.5.,..----------------...,
~'MIW ..... (-CIIOI_MI,)
i
D··· R1 0,30
2.0 o· R2 CI,4'
6,.. R3 CI,95
9
'1
V R.4 I,~
... ~.. IS 2,IS ;\<>
1.5 •... R6 ,,,.
~~~o
e
£ 0.5
..
O.O~. . . . ._.~::::.____..........~~..___._.......I
1 10 100
Pore diameter <DID)
evaluated (Figs. 3 and 4), Figure 3 shows the effect of ionic strength on total
protein adsorption capacity and activity in terms of NaCI content at a fixed
pH 6.S. A similar behavior was observed for PBC, with a minimum capac-
ity at an NaCI concentration of about 0.5 M, in terms of both total protein
and activity. For PBA-30 there was a continuous increase in both capacities
with increasing ionic strength. Evaluation of the adsorbents in relation to
pH showed a typical behavior for the adsorption of ~-amylase at the iso-
electric point of the molecule and in its vicinity. As can be seen in Fig. 4, the
PBC adsorbent had an optimum pH value for adsorption for both total
protein and activity of about 5.5, which is equivalent to the isoelectric
point of soybean ~-amylase. For the PBA-30 adsorbent, minimum adsorp-
tion capacity of total protein occurred at a pH of 7.0, while a capacity in
terms of activity decreased continually with an increase in pH. The differ-
1J
2S
. .....
-a-PDC
700 1 J
1 2.0 .. ·e· PBA 30 600 ..1
C'
-I•
:',
C'2.00
I ......... 600';a
\-Q\
c
j
-:. 1.7S
.J
iel. SO
.~~. 3OO~
p
i
r.~_
i l.2S
2001u
1 •
•
~ 1.00 • 0 -c-PBC 100 •
eo •• ·0 P8A30
0
eo
.;
i
ow 3 4 S 6 7 8 9 10 11 ~
~
pH
(1)
~
:; 0.010
'f
:i
.D
....: 0.005
0.000 +-......~-r-.....-,,.....-.-.-r-"'-,-~....-......--.--t
o 5 10 15 20 25 30 35 40 45
MIgration time (minutes)
Fig. 5. Electrophoretogram for two soybean extracts obtained with extraction meth-
ods described.
6....-----------------------------~
A_rIMa..
5 -.-PBA30
-o-PBC
~---I':"I---,---
o~~~~~~~~~~
o 50 100 150 200 250 300 350 400
Migration time (minutes)
Fig. 6. Kinetic curves for PBA-30 and PBC adsorbents measured in batch experiments.
in which q' (mg/ g) is the total protein adsorbed per g of the adsorbent, c'
(mg/mL) is the concentration of the protein in the solution, qm (mg/ g) is
the maximum capacity of the adsorbent, and kd (mg/mL) is the dissocia-
tion constant. A fitting to experimental data was obtained by nonlinear
regression for the PBA-30 and PBC adsorbents for both the crude and
dialyzed extracts. Table 1 gives the parameters calculated for the iso-
therms obtained with the crude extract, and Table 2 displays the results
for the dialyzed soybean extract. The values of the parameters obtained
indicate that the adsorbents have similar adsorption capacities and PBC
has greater affinity characteristics than PBA-30.
4
)'2000
e. lSOO
I
.. 1000
<
f~
O~~~~~--~-r--~-r--r--r~
o 100 200 300 400 SOO CiOO 700 100 900 1000
AcIivIly (au BIL-1)
Fig. 7. Activity isotherms at 25°C, pH 6.8, and ionic strength of O. 1 M NaCI carried
out in batch. Langmuir parameters for crude extracts for PBA-30 are: qm =1617 AU /
g, kd = 75.92 AU /mL; and for PBC are qm = 1626 AU / g, kd = 59.32 AU /mL. For dialyzed
extracts for PBA-30 they are: qm =2865 AU / g, kd =86.23 AU /mL; and for PBC are qm =
3082 AU/g, kd = 72.22 AU/mL.
Table 1
Langmuir Parameters of Adsorption Isotherms with Crude Extract
Total protein Total activity
qm kd qm kd
Adsorbent (mg/g) (mg/mL) R2 (AU/g) (AU/mL) R2
PBA-30 9.83 0.61 0.96 1.617 75.92 0.98
PBC 12.62 0.43 0.95 1.625 59.32 0.97
Table 2
Langmuir Parameters of Adsorption Isothern with Dialysed Extract
Total protein Total activity
qm kd qm kd
Adsorbent (mg/g) (mg/mL) R2 (AU/g) (AU/mL) R2
PBA-30 39.18 1.54 0.95 2.865 86.23 0.99
PBC 39.02 0.68 0.97 3.083 72.22 0.97
Breakthrough Curves
Figures 8 and 9 display the breakthrough curves for PBA-30 and PBC
adsorbents, determined in frontal chromatographic experiments. Curves
of total protein concentration and fl-amylase activities are shown for crude
and prepurified systems to demonstrate the effect of contaminants on com-
.jIljll
.e
a I d I
Pnteia 30
~
..
100 - without dialysis
£ ----0- with dialysis 20
~
i<
cJ Adivity
~ ~
/ -e- without dialysis 10
- 0 - with dialysis
0
I
0
0 10 20 30 40
Injected Volume (mL)
Fig. 8. Breakthrough curves for crude soybean extracts flowing through PBA30.
Column height is 2 cm, and column diameter is 0.5 cm. Mass of adsorbent is 0.5 g and
flow rate is 0.5 mL/min.
180 60
.r"'
~160 .-
so "I
.! 140
'I
II
1 120 40 i
! 100
..... i
•l
.! 80 30 ~
~
f
- Without dialyIia
60 20
~- Wdh dialysis
i 40
~ Actmty
_ Without dialyIia 10 <II!
20
- < l - With dialysis
0 0
0 5 10 20 2S 30 35
15 40 45
IDJeded Volume (mL)
Fig. 9. Breakthrough curves for PBC. Column height is 2 cm, and column diameter
is 0.5 cm. Mass of absorbent is 0.5 g and flow rate is 0.5 mL/min ..
n
S 100 -D-PBC
.s...u '..:I
. 60BS
II( PBA 30 ... lIE- ..
0
80 Actlylty
Do
. -.-PBC 50 =-
WI
...,
:l. ~
··.·PBA 30 5
.s.a 60 4O;:J
-
~
~
e 40 ~ 30.t>
~
~
...
ii
0 20
it! 20i
<
Eo< 10
o 0
o 5 10 15 20 25 30 35 40 45 50
Injeded Volume (mL)
Fig. 10. Comparison of elution curves of prepurified soybean extracts for PBA-30
and PBe. Isocratic elution was done with 0.1 M sorbitol and 0.1 M of 0.5 M NaCl,
respectively, and a flow rate of 0.25 mL/min.
injected into the columns filled with PBA-30 and PBC, respectively, both
the same adsorbent and bed height described in the procedures above. As
shown in Fig. 10, after elution, fractions of the eluted peak had a purifica-
tion factor at a specific activity of approx 5 for both PBA-30 and PBC.
For the pool of fractions eluted, the enrichment in specific activity was 4
(12.2%) and 4 (41.7%), respectively. The isocratic elution of the enzyme in
the column of PBA-30 showed a well-defined peak. The different behavior
of PBA-30 in the process of adsorption of the soybean proteins cannot be
explained only by the difference in density of the ligands of the adsorbents,
because the matrix and spacer are different. For the same matrix and spacer
the specificity of the adsorbent with pheny1boronate depends first on the
quality of the ligand, and second on ligand density (20).
To verify the contribution of each step in the whole purification pro-
cess, total protein content and activity were observed dialyzed extract all
the prepurification (concentration) and purification steps. Figure 11 dis-
plays a flow sheet of the complete purification scheme, including the
prepurification and adsorption steps. Table 3 shows the evolution of those
variables in the prepurification steps. The purification factor in these pre-
liminary schemes reached a value of 25. The results of the adsorption
experiments applied to the prepurification steps, presented in Table 4,
indicate a further 4-fold enrichment of the enzyme's specific activity, lead-
ing to a 97-fold enrichment in the overall enzyme purification process.
Conclusion
The affinity PEC adsorbent, which was synthesized with up to 100
flmol/ mL, was compared with the commercial phenylboronate-agarose
adsorbent (PBA-30), containing 51 flmol/mL with precipitated extract of
commercial soy and dialysate with ~-amylase. Both adsorbents showed
Applied Biochemistry and Biotechnology Vol. 105-108,2003
PBC Resins for Adsorption of ~-Amylase 841
t
Acetone-precipitate redissolved Diafiltration
in phosphate buffer (MW cut off 30 kDa)
Table 3
Prepurification Steps Starting from Deffated Soybean Flour
Total Specific
Volume Protein Activity activity activity Yield Purification
Fraction (mL) (mg/mL) (AU/mL) (AU) (AU/mg) (%) (fold)
Buffer extract 12.0 15.70 134.4 1,61 8.6 100 1
Ethanol-soluble 12.0 1.08 105.0 1,26 96.7 78.1 11
proteins
Diafiltration 8.6 0.86 139.0 1,19 161.6 74.1 19
(mol wt cutoff
of 30 kDa)
Acetone precipi- 1.0 4.67 1,00 1,00 215.2 62.3 25
tate redissolved a
a Acetone precipitate = prepurified soybean extract.
Table 4
Adsorption Steps Applied to Prepurified Extract
Total Specific
Volume Protein Activity activity activity Yield Purification
Fraction (mL) (mg/mL) (AU/mL) (AU) (AU/mg) (%) (fold)
Acetone 0.20 4.67 900 180 192 100 1
precipitation
PEA-30 1 0.029 22 22 759 12.2 3.9
PBC 1 0.100 75.1 75.1 752 41.7 3.9
Acknowledgments
We gratefully acknowledge financial support from Coordenacao de
Aperfei<;oamento de Pessoal de Nivel Superior (CAPES)/Programa
Institucional de Desenvolvimento Cientifico e Tecnol6gico (PICDT), Brazil;
and Dom Bosco Catholic University (UCDB), Campo Grande, Brazil.
References
1. Paws, c., Fraguas, L. F., and Batista-Viera, F. (1994), Chromatographia 38,232-234.
2. Brena, B. M., Paws, c., Fraguas, L. F., and Batista-Viera, F. (1996), J. Chromatogr. B 684,
217-237.
3. Pazos, C. Fraguas, L. F., and Batista-Viera, F. (1998), Chromatographia 48, 209-214.
4. Bouriots, V., Galpin, 1. J., and Dean., P. D. G. (1981), J. Chromatogr. 210,267-278.
5. Shahidi, F., ArachchiJ. K V., and Jeon, Y. J. (1999), Trends Food Sci. Technol.10, 37-51.
6. Beppu, M, M, Arruda, E. J., and Santana, C. C. (1999), Polimeros: Ciencia e Tecnologia
9,163-169.
7. Kimura, T.,Yoshida, M, Oishi, K , Ogata M., and Nakakuki, T. (1989), Agric. BioI.
Chern. 53,1843-1848.
8. Miranda, E. A. and Bergiund, K A. (1990, Biotechnol. Prog. 6,214-219.
9. Batista-Viera, F., Barragan, F. B. B., and Busto, B. L. (1988), Biotechnol. Bioeng. 31,
711-713.
10. Davis, P. R S. S. and Illuni, L. (1999), Int. J. Pharm. 187,53-65.
11. Amoncita, R, Pneto, J. R., Kuelin, G. D., and Hageman, J. R (1980),J. Chromatogr. 189,
225-231.
12. Smith, A. K, Nash, A. M., Eldridge, A. c., and Wolf, W. J. (1962), Agric. Food Chern.
10(4), 302-304.
13. Ren, H., Madison, 1. T., and Thompson, J. F. (1993), Phytochemistry 33,535-539.
14. Ren, H., Madison, J. T., and Thompson, J. F. (1993), Phytochemistry 33, 541-545.
15. Bradford, M. (1976), Anal. Biochem. 72,248-254.
16. Bernfeld, P. (1955), in Methods in Enzymology, Colowick, S. P. and Kaplan, N. 0., eds.,
Academic Press, New York, NY, pp. 145-150.
17. Langmuir,1. (1916), J. Am. Chern. Soc. 30,2263-2295.
18. Brena, B. M, Batista-Viera, F., Ryden, L., and Porath, J. (1992),J. Chromatogr. 604,109-
115.
19. El-Kak, A, Manjmi, S., and Vijayalakshmi, M (1992), J. Chromatogr. 60,29-37.
20. Amicon (1981), in Operating Instructions, Amicon Corporation, Danvers, MA, pp. 1-46.
Abstract
Bench-scale research demonstrated that using an efficient esterification
step to integrate an ethanol with a carboxylic acid fermentation stream
offers potential for producing valuable ester feedstocks and fuels. Polar organic
acids from bacterial fermentations are difficult to extract and purify, but for-
mation of the ammonium salts and their conversion to esters facilitates the
purifications. An improved esterification procedure gave high yields of
esters, and this method will lower the cost of ester production. Fuel character-
istics have been determined for a number of ester-gasoline blends with prom-
ising results for lowering Reid vapor pressure and raising octane numbers.
Index Entries: Biorefinery; esters; esterification; alcohols; ammonium.
Introduction
New opportunities for enhancing the value of agricultural products
and improving their utilization require the development of innovative
processes that are highly efficient, economically competitive, and environ-
mentally acceptable. Potential applications in improved fiber and film tech-
nologies, safer biodegradable solvents, and less polluting oxygenate
additives for fuels are ripe for commercialization, except that processing
costs for the biobased esters that are the foundation of these applications
are currently high. The development of refineries to conduct this process-
ing of renewable resources will provide rural agricultural communities
with an opportunity to diversify their economies and shift the dependence
on petroleum-based chemical, polymer, and fuel markets.
Dual-Fermentation Biorefinery
Process
Condenser
ffRC fQ,Q,47COR
Acknowledgment
This work was supported by the Cooperative State Research, Educa-
tion, and Extension Service, USDA, under agreement no. 00-38819-8989.
References
1. Filachione, E. M. and Fisher, C. H. (1946), Ind. Eng. Chern. 38,228.
2. Baniel, A. M., Eyal, A. M., Mizrahi, J., Hazan, B., Fisher, R R, Kolstad, J. J., and
Stewart, B. F. (2000), US patent no. 6087532.
3. Husson, S. M. and King, C. J. (1998), Eng. Chern. Res. 37,2996-3005.
4. Datta, Rand Tsai, S.-P. (1998), US patent no. 5723639.
5. Filachione, E. M. and Costello, E. J. (1952), Ind. Eng. Chern. 44, 2189.
6. Filachione, E. M., Costello, E. J., and Fisher, C. H. (1951), J. Am. Chern. Soc. 73,5265.
7. Delzer, G. c., Zogoski, J. S., Lopes, T. J., and Bosshart, R 1. (1996), Water Resources
Investigations Report No. 96-4145, US Geological Survey, Rapid City, SD.
8. Squillace, P. J., Zogorski, J. S., Wilber, W. G., and Price, C. V. (1996), Environ. Sci.
Technol. 37,394-397.
9. Health Effects Institute (1996), Special report, Health Effects Institute Oxygenates
Evaluation Committee, Cambridge, MA.
10. Chang, T. (2001), Oil Gas J.
11. Meister, J. M.; Black, S. M., et al. (2000), Hydrocarbon Processing.
12. Beuther, H. and Kobylinski, T. P. (1982), in Proceedings of the Symposium on Chemistry
of Oxygenates in Fuels, American Chemical Society Kansas City Meeting.
Purification of Glucose-6-Phosphate
Dehydrogenase from Baker's Yeast
in Aqueous Two-Phase Systems
with Free Triazine Dyes as Affinity Ligands
Abstract
To improve the selectivity of glucose-6-phosphate dehydrogenase
(G6PDH) extraction by an aqueous two-phase system, a simple and inexpen-
sive affinity aqueous two-phase system using unbound reactive triazine dyes
as ligands was introduced. In a polyethylene glycol (PEG)/hydroxypropyl
starch (PES) system, the unbound free triazine dyes, Cibacron Blue F3GA
and Procion Red HE3B, partitioned unevenly in the top PEG-rich phase and
thus showed an affinity effect on G6PDH, but no influence on hexokinase.
The various parameters investigated were pH of the system, buffers, molecu-
lar weight of PEG, and ligand type and concentration. A two-step affinity
extraction process was established for the purification of G6PDH from
baker's yeast. The total yield of G6PDH was 66.9% and purification factor
was 2.35.
Index Entries: Aqueous two-phase systems; affinity partitioning; triazine
dyes; glucose-6-phosphate dehydrogenase; baker's yeast.
Introduction
Several procedures for the rapid purification of enzymes from yeast
and other microorganisms have been developed, mainly to avoid undesir-
able proteolytic degradation of the target enzymes in the course of their
*Author to whom all correspondence and reprint requests should be addressed.
Table 1
Effect of pH on Partitioning of Dyes
in PEG3000 (12.5% [w fwD/Phosphate (10% [w /wD System
Table 2
Effect of Molecular Weight of PEG
on Partitioning of Dyes in PEG3000 (12.5% [w /wD/
Ammonium Sulfate (10% [w/wD Systems
Molecular
wt (Daltons) Cibacron Blue F3GA Procion Red HE3B
16
12
...J
~ 8
0
2 4 6 8
pH
Fig. 1. Effect of pH on partitioning of Cibacron Blue F3GA (1) and Procion Red HE3B
(2) in PEG3000 (8.3% [w /w])/PESlOO (15% [w /w]) system: phosphate buffer (2.67%
[w/w]).
~
:~
3 --+------~-
2
1
0+---~----~----~--_4
o 5 10 15 20
C (mM)
Fig. 2. Effect ofTris-HCl buffer on partitioning of blue dye in PEG6000 (8.3% [w /wD/
PESI00 (15% [w /wD system: pH 7.5.
Although the higher partition coefficient was needed for affinity par-
titioning, the pH should not exceed 7.5 because of the instability of the
enzymes. The influence of Tris-HCl buffer (pH 7.5) on the partitioning of
Cibacron Blue F3GA in the PEG/PES system was investigated (Fig. 2). At
the beginning, the increase in Tris-HCl concentration decreased the parti-
tion coefficient of the blue dye. A further increase had almost no effect on
the blue dye partitioning.
2.0
1.5
1.0
0.5
o +----.---.---r---,---~
2,000 3,000 4,000 5,000 6,000 7,000
,
6
5
4
~ 3
2
1
0
: :
0 5 10 15
C (mM)
Table 3
Effect of Molecular Weight of PEG on Partition Coefficient
of G6PDH in PEG/PESI00 Systema
Molecular Ke
wt (Daltons) No dye Cibacron Blue F3GA <pb
1.6
1.2
Q)
:x::
0.8
0.4
0
0 0.02 0.04 0.06 0.08
C (%)
GBPOH
2.0
1.5
1.0
HK
0.5
0
0 0.05 0.10 0.15
C(%)
Fig. 6. Effect of Procion Red HE3B concentration on the extraction of G6PDH from
baker's yeast in PEG3000 (8.3% [w fwDfPESI00 (15% [w fwD system: 9 mM Tris-HCl,
pH 7.5. HK, hexokinase.
Table 4
Effect of Triazine-Reactive Dyes on Partitioning of G6PDH"
No dye 0.54
Red 8.35 1.64 3.0
Red derivative 8.34 1.60 3.0
Blue 3.90 1.42 2.6
Blue derivative 3.93 1.44 2.7
'PEG6000 (8.3% [w /wD/PESI00 (15% [w /wD system; 9 mMTris-HCl,
pH 7.5, 0.033% dyes.
bRatio of partition coefficient in the presence of dye to that in the
absence of dye.
Table 5
Effect of Triazine-Reactive Dyes on Partitioning of Enzymesa
Ke <ph
The affinity effect of triazine dye ligands and their ammonia deriva-
tives on the partitioning of G6PDH and hexokinase in the PEG3000 /PESI00
system is summarized in Table 5. The ligands could enhance the partition
coefficient of G6PDH greatly. Without the dye ligand, the G6PDH was
concentrated in the bottom phase (Ke =0.017). With the red dye ligand, most
ofthe G6PDH partitioned into the top phase (Ke =1.9), but for pure G6PDH,
the partition coefficient changed from 0.54 to 1.64 by the red dye ligand
(Table 4).
To elucidate the mechanism (different effect of different dye ligands-
blue and red) of affinity aqueous two-phase partitioning of proteins
(G6PDH and hexokinase), Flanagan and Barondes (22) had proposed a
thermodynamic model (Eq. 1). This model describes the distribution equi-
librium of proteins in the affinity aqueous two-phase systems. It relates the
partition coefficient of proteins in the presence of affinity ligands with the
partition coefficient in the absence of affinity ligands, and partition coeffi-
cient of ligands and the dissociation constants of ligands with protein
molecules in the top and bottom phases. The equation was deduced from
Gibbs' free energy in equilibrium state:
K = Ko (KLKibl Kitt (1)
in which K and Ko are the partition coefficients of proteins in the presence
and absence of the ligand, respectively; KL is the partition coefficient of the
ligand polymer; Kit and Kib are the dissociation constants of the ligand with
protein molecule in the top and bottom phases, respectively; and a is the
number of ligand polymer molecules bound per protein molecule.
The binding strength of G6PDH to the dye ligands was similar (similar
K i) in the top and bottom phases (Table 6), but most of the dye partitioned
in the top PEG phase, so G6PDH could be brought from the bottom to the
top phase by the ligand. The KL of red dye was higher than that of blue dye,
and therefore the affinity effect was stronger. The binding strength of hex-
okinase to blue dye ligand was weaker than that of G6PDH (larger Ki value),
Applied Biochemistry and Biotechnology Vol. 105-108,2003
Purification of G6POH by Affinity Extraction 863
Table 6
Inhibition Constants of G6PDH and Hexokinase
in Disrupted Cell Supernatant by Triazine Dyes"
K; (104 mM)
Cibacron Blue F3GA Procion Red HE3B
In presence In presence In presence In presence
Enzyme of top phase of bottom phase of top phase of bottom phase
G6PDH 5.22 4.56 3.99 1.41
Hexakinase 193 236 71.3 3.20
"In top or bottom phase ofPEG3000 (8.3% [w/w])/ PESlOO (15% [w/w]) system; 9mM
Iris-HCl, pH 7.5.
Table 7
Partitioning of G6PDH in PEG3000 (12.5% [w fwDf
Phosphate (10% [w fwD System"
Dye
Cibacron Blue F3GA 0.0043
Procion Red HE3B 0.0040
'pH 7.48; 0.05% dyes.
so the affinity effect was weakened. For red dye ligand, the binding strength
of hexokinase in the bottom phase was stronger than that in the top phase,
and no affinity effect was observed.
Two-Step Method for Purification of G6PDH from Baker's Yeast
Table 7 lists the partition coefficients of G6PDH in the PEG3000 / phos-
phate system in the presence of the dye ligands. Although the dyes were
concentrated in the PEG-rich top phase (Table 1), the enzyme stayed in the
salt-rich bottom phase. The dyes and the G6PDH could be separated in
the PEG/phosphate system, indicating that no covalent linkage formed in
the experimental condition.
To achieve purification of G6PDH from baker's yeast, a two-step pro-
cedure based on the aforementioned results was developed (Fig. 7). The
experiment was performed in a separatory funnel and the system was
enlarged to 15 g.
The disrupted cell supernatant was added into the PEG3000/PESlOO
system (first step). G6PDH was extracted into the top PEG phase by Procion
Red HE3B ligand. After phase separation, the top PEG phase was combined
with phosphate solution, forming a PEG/phosphate two-phase system
(second step). The enzyme was recovered in the phosphate-rich bottom
phase. After the "two-step" extraction, the total recovery of G6PDH was
66.9% with a purification factor of 2.35.
Applied Biochemistry and Biotechnology Vol. 105-108,2003
864 Xu et al.
Cell disruption
B
Red dye supernatant Phosphate
~
PEG
~
PES Ph
System 1 System 2
Fig. 7. Diagram of two-step method for purification of G6PDH from baker's yeast:
System 1: PEG3000 (8.3% [w /wD/PESI00 (15% [w /wD, 9 mM Tris-Hel, pH 75; sys-
tem 2: PEG3000 (11% [w fwD/phosphate (18% [w /wD, pH 7.3.
Conclusions
The partitioning of G6PDH and hexokinase in PEG/PES and PEG/
phosphate aqueous two-phase systems was investigated with free triazine
dyes, Cibacron Blue F3GA and Procion Red HE3B, as their affinity ligands.
The dyes, not bound to phase-forming polymers, were concentrated
in top PEG phase in PEG/phosphate and PEG/ammonium sulfate sys-
tems. In the PEG/PES system, although the partition coefficients were
smaller than in the PEG / salt system, most of the dyes still partitioned in the
top PEG phase, which is the fundamental requirement for the affinity par-
titioning of the enzymes.
In the PEG/phosphate system, the dyes and enzyme were concen-
trated in the top PEG and bottom PES phase, respectively. In the PEG /PES
system, Procion Red HE3B changed the partition coefficient of pure
G6PDH from 0.54 to 1.64 with Tris-HCl buffer. For G6PDH in disrupted
cell supernatant, the partition coefficient increased from 0.017 to 1.9 with
the red ligand. The enzyme was transferred from the PES-rich bottom
phase to the PEG-rich top phase. To purify G6PDH from baker's yeast, a
two-step procedure was proposed. The total yield was 66.9% with a puri-
fication factor of 2.35. Thus, a simple, effective affinity partitioning method,
with the free dye as ligand for the purification of G6PDH from baker's
yeast was developed.
Acknowledgments
We thank Luis Fernando Peffi Ferreira and Luiz Carlos Martins das
Neves for their assistance in some of the experiments. This work was sup-
ported by Fundac;ao de Amparo a Pesquisa do Estado de Sao Paulo, Brazil.
References
1. Dean, P. D. G. and Watson, D. H. (1979), J. Chromatogr. 165,301-319.
2. Kopperschlager, G. and Johansson, G. (1982), Anal. Biochem. 124, 117-124.
3. Albertsson, P.-A. (1986), Partition of Cell Particles and Macromolecules, 3rd ed., John
Wiley, New York, NY.
Abstract
Adsorption kinetics and equilibrium data of clavulanic acid, a ~-lactam
antibiotic, on ion-exchange resin Amberlite IRA 400 were utilized to carry
out the modeling and simulation of a continuous adsorption process. These
simulations allowed the estimation of yield, concentration, and purification
factors of the process utilizing the product final concentration. Experimental
runs of this process were carried out using the conditions pointed out by
simulation studies. Comparison of the experimental results and those calcu-
lated by the proposed model showed that the model could describe very well
the main features of the continuous process.
Index Entries: Clavulanic acid; continuous adsorption; purification process.
Introduction
The inhibitory activity of clavulanic acid (CA) against p-Iactamases,
enzymes that catalyze the p-Iactam ring hydrolysis reaction, have been
detected in cultures of the bacteria Streptomyces clavuligerus. The discovery
of this p-Iactam antibiotic was first reported in 1976 by Beecham (1). Nowa-
days the combination of CA with amoxicillin is the most successful example
of the use of a ~-lactam antibiotic sensitive to ~-lactamase together with an
inhibitor of these enzymes.
Primary extraction of CA from the clarified broth can be done either
by extraction from acidified broth into a water-immiscible organic solvent
or by adsorption in an anion-exchange resin followed by elution from the
resin with an aqueous salt solution (2). However, this antibiotic has no
strong hydrophobic groups and presents high degradation rates, which
leads to low recovery yields during the purification process. This antibiotic
~~l F! CEol F2
Frel qlCEI
kl k3
---+ Cn
---+
~ 2 FrC2 q2 CE2
Fl CEI Cr2 F2 CE2
Ct Cn C2 Cr2
Waste Product
first stage and 2% NaCl in the second. The temperature in the first reactor
was controlled at lOOC and in the second stage at 30°C. The outflowing
solutions of each reactor were independent during the runs. The concentra-
tions of CA with time were obtained by analyzing the samples in the exit
stream of each stage.
Analytical Methods
The clavulanic acid concentrations were determined by high-perfor-
mance liquid chromatography (HPLC), as described by Foulstone and
Reading (9) by reaction with imidazole solution, pH 6.8. The HPLC equip-
ment was operated at 28°C, with a flow rate of 2.5 mL/min. The mobile
phase was composed of a 0.1 M KH2P04 buffer solution containing 6% of
methanol and phosphoric acid, which brings the pH to 3.2. Contaminants
(CT) concentration were determined by spectrophotometer at 280 nm.
Mathematical Modelling
The basic principles of the theoretical model, previously described by
Rodrigues et a1. (7) for enzyme purification, were used. In the present work,
the model incorporates external liquid film mass transfer coefficient, pore
diffusion, and kinetic equations for adsorption and desorption in each stage.
It also accounts for the presence of inert contaminants in the CA feed stream.
These contaminants can be considered as usual fermentation broth compo-
nents such as sugars, pigments, amino acids, and proteins in solution.
The mathematical model of the process was obtained essentially by
accomplishing a mass balance in each reactor including the adsorption/
desorption equations. A schematic view of this process is illustrated in
Fig. 1. The process operates as follows: The sample is fed continuously to
the first reactor, the adsorbing stage, where it contacts the ionic adsorbent
beads and is adsorbed. The beads, with the adsorbed product, are then
pumped to the desorbing stage in the second reactor, where the addition
of the eluent (NaCl solution) causes the desorption of the antibiotic. The
spent beads are then recycled to the adsorption stage, while the antibiotic
is removed. Both reactors are well agitated.
Applied Biochemistry and Biotechnology Vol. 105-708, 2003
870 Almeida et al.
To reduce the number of variables, four global variables were previ-
ouslydefined, as shown by Eqs.l-4, for reactor residence time (8'1 and 8'2)
and solids residence time (88 1 and 882),
VI
8r 1 = - - - (1)
Fl + Fr Erl
(2)
(3)
(4)
The reactor residence time is the ratio between the liquid total volume
and the global liquid feeding rate. The solids residence time is the ratio of
the amount of resin in the reactor by the out flow rate of the resin from the
reactor. The values of the flow rates (Fl' F2I and Fr), as they are presented,
are calculated based on the established reactor residence times and solids
residence times, as described by Eqs. 1-4.
The differential equations representing the system behavior, in both
stages, are described next.
First Stage
CA BALANCE
iNTRAPARTICLE DIFFUSION
aCi!
- =D (a-2-Ci!+ - ac-i1 ) -
2 - ( ) aqil
p a2
r ar
E
pat eft
E l-E
p
-
at (5)
r
dqil
dt = kl eil (qml - qil) - k2 qil (6)
(9)
LIQUID PHASE
SOLID PHASE
(11)
Here, iT 1 and Clare the mean value calculated by the weights of the Radau
quadrature (Eqs. 12 and 13) with contour in the surface of the solid or
Gaussian quadrature (Eq. 14) when some contour is not considered in the
surface (10).
(12)
_ N
~ C.Wo
C 1 = wo·C ]o( r--1) + j=l ] ]
(13)
N
q1=~qowo
j=l ] ]
(14)
in which N is the number of collocation points and Wj are the weights of the
Radau quadrature (Eqs. 12 and 13) or Gauss (Eq. 14).
C 1 can be easily calculated using the principle of the Eq. 13. In the
present study, iT 1 and iT 2 were obtained by Eq. 14.
ELUENT BALANCE
(15)
(16)
Second Stage
CA BALANCE
INTRAPARTICLE DIFFUSION
aC=i2 D
- (a-2-ci2+ -
2-ac-i2 ) - ( ) aqj2
E
p at ef2
E
p ar 2 r ar l-E
p
-
at (17)
(18)
(21)
LIQUID PHASE
SOLID PHASE
d7h 1 (7i -) k-
Tt= 8s 2 '11-Q2 - 3Q2 (23)
(24)
dC T2 CT2 (8s 2 - 8r 2 ) 1
dt = (8s 2 8r 2 ) + 8s 2 (Cn - CT2 ) (25)
Table 1
Simulation Parameters
Co 8r I 8r 2 8s I 8s 2 Erl Er2 VI V2
Run (g/L) (min) (min) (min) (min) (-) (-) (mL) (mL)
1 0.100 71.3 44.1 108.0 154.8 0.86 0.60 130 130
2 0.100 71.3 44.1 108.0 107.2 0.86 0.60 130 90
3 0.100 81.0 30.6 101.1 100.7 0.86 0.60 130 90
4 0.100 81.0 30.6 101.1 65.2 0.86 0.60 200 90
Table 2
Operation Conditions
Run FI (mL/min) F2 (mL/min) Fr (mL/min)
1 0.62 2.10 1.39
2 0.62 1.20 1.39
3 0.32 2.04 1.49
4 0.49 1.56 2.30
Table 4
Equilibrium Parameters
Parameter pH KD (giL)
Isotherm 10 6.2 1.14 X 10-2 7.90 X 10-2
Transport and kinetic parameters (Def' ks, kl1 k2, and k3) were deter-
mined by simulations of kinetic studies in batch runs for both adsorption
and desorption stages. These parameters are given in Table 3. Equilibrium
parameters of the Langmuir model are presented in Table 4. With the data
of Tables I, 3, and 4 the continuous adsorption process of CA on resin
Amberlite IRA 400 was simulated.
Figures 2A-D shows the CA and contaminants concentration profiles
in the exit stream from each stage for runs 1-4, respectively. CA was
adsorbed on the resin Amberlite IRA 400 in the first reactor and was des-
orbed by NaCl solution in the second one. Contaminants were present in
both stages and this fact may result in a low purification factor. Figure 2
shows that CF in all runs was very low because CA concentration at the
desorption stage was lower than at the adsorption stage. The process equi-
librium time was 5 h.
The performance parameters Y, PF, and CF were determined for all
runs and are presented in Table 5. This proposed process was able to fur-
nish a high yield but it was not able to give a concentrated product, as
shown by the low values of CF at all runs. It was observed that CA concen-
tration in the exit of the second stage was higher than contaminants concen-
tration, giving a PF >1. Recently, Mayer et a1. (11) reported values of Y of
about 60%, CF of about 2.0, and PF of approx 1.4 in a CA recovery process
in fixed-bed columns on the same adsorbent. Good CF values were found,
but PF values were in the same range and the Y values were quite low
compared with the results presented in Table 5.
Comparison of the yields of runs 4 (VI = 200 mL) and 3 (VI = 130 mL)
in Table 5 reveals that the highest yield was obtained utilizing a higher
volume at the first reactor. The same reactor residence time and solid resi-
dence time were used at both runs, but at run 4 the yield was 12% higher
than at run 3. For the second reactor, it was better to utilize a smaller vol-
ume, as shown by comparing runs 1 (V2 = 130 mL) and 2 (V2 = 90 mL).
0,2
0,1
2 2 4
Time (hours) Time (hours)
0,7 C A ~ ".".
0,7 0
"",,,,,, ...a~
0, 0,6
Run3
_CA (lsI stage) Run 4
0,5
_CA (2nd stage) _CA (lsI stage)
_ _ CT (lsI stage)
_ _ CT (2nd slage) 8°,4 -+-CA (2nd stage)
........ CT (lsI stage)
_ _ CT (2nd stage)
0, 0,3
0, 0,2
0,1
O,O-f---r--"""'T----,-.--r---r--I O,0f-----r---r--"""'T-""""'f--r--I
Time (hours) Time (hours)
Fig. 2, Simulations of CA adsorption continuous process: (A) run 1; (B) run 2; (C) run
3; (D) run 4.
Table 5
Simulated Results of Y, PF, and CF
The best results of Y, PF, and CF were obtained at run 4, but it is not
possible to say that run 4 had the optimum parameters because the process
used is multivariable. Optimum conditions can be obtained utilizing opti-
mization techniques included in the model. However, the optimization tech-
niques can lead to constrained optimum values of Y, CF, and PF, requiring
further pilot-plant and economical studies for a definite conclusion.
Experimental runs were carried out using the operation conditions
of the simulated runs 2 and 4 (Table 2) in order to validate the model. The
conditions of runs 2 and 4 are presented in Figs. 3 and 4, respectively.
Applied Biochemistry and Biotechnology Vol, 105-108,2003
876 Almeida et al.
Ao.s. B O•6
• CA (Exp.)
....
• CA(EXP'l
a ," _CA(Sim.
Q 0.3. • I Q CT(Exp.)
() I __ CT(Sim.)
0.2 0.2 - - - , . . -II"" - ..
0.1 0.1
0.01-:to~~lr-~""!'2~-jr-~'-
4~-r~
Time (hours) Time (hours)
Ao.6
0.51. ~ q. ...JJ.r"'a r
. .. -a -
..
a- ; - 'D ....
B o.
• CA (Exp.)
_CA(Sim.)
0.4
V ; ~
~ .. • CA (Exp.)
Ig CT (Exp.)
__ CT(Sim.)
_CA(Sim.)
gO.3 J D CT (Exp.)
- - CT(Sim.)
a
~
..... - ... " , __
O.
J
- -
0.2 1 a lit
a a- -0"'11'.
0.1
O.O+-_"'Il_ _ ~_""~
_ _ _~_ _.,......I~ o. 1 2 4 5
Figure 4 shows that the fits of CA and CT in both stages were good, but
Fig. 3 it shows that the model fitted CA data well in the adsorption reactor
but not in the desorption one. Since the volume of the first reactor in run
2 was lower than in run 4, it was expected that in run 2 a lower concentra-
tion than in run 4 in the desorption step would be achieved, around 0.25,
like simulation. However, the concentration was equal to run 4 and, con-
sequently, higher than obtained in the simulation. Further experiments,
in different conditions, will be necessary to elucidate this behavior. Fig-
ures 3 and 4 also shown that CA concentration in the second reactor was
lower than in the first, so, like the model predicted, a low CF was also
obtained in the experimental runs.
The parameters Y, PF, and CF were calculated for experimental runs
and are shown in Table 6, together with the parameters obtained by simu-
lation and the difference between the experimental and the simulated
results. The data in Table 6 show that the model predicted the performance
parameters with the differences between experimental and simulated data
lower than 17%. These differences can be related to some operational prob-
Table 6
Simulated and Experimental Results of Y, PF, and CF
and Difference Between Experimental and Simulated Results (e)
Y (%) PF (-) CF (-)
Run Exp. Sim. e (%) Exp. Sim. e (%) Exp. Sim. e (%)
2 58.10 48.00 17 1.48 1.23 17 0.30 0.25 17
4 96.90 90.00 7 1.69 1.57 7 0.31 0.28 9
"Exp., experimental; Sim., simulated.
Conclusion
Based on the CF, PF, and Y, the process performance was evaluated.
The experimental and simulated data of these parameters were compared,
and the differences between them were, in most cases,lower than 17%. This
fact shows the good agreement of the model with the experimental data:
A model of a continuous process for CA separation was described,
incorporating a kinetic model. This validated model, together with key
experimental data, can be a powerful tool to optimize and scale up this
purification process.
Nomenclature
Ck = CA concentration in the solution (giL)
Cik = CA concentration inside the particles (giL)
Applied Biochemistry and Biotechnology Vol. 105-108,2003
878 Almeida et al.
CSk = CA concentration at particle surface (g/L)
CEk = NaCl concentration (%)
CTk = contaminant concentration (g/L)
Defk = effective diffusivity of CA (cm2/ s)
e = difference between simulated and experimental data (%)
Fk = flow rate of feeding (mL/min)
Fr = flow rate of recycle (mL/min)
KD = Langmuir equilibrium constant (g/L)
KSk = mass transfer coefficient (cm/s)
Subscripts
k = 0 = initial
k = 1 = first stage
k = 2 = second stage
Acknowledgment
We wish to acknowledge Funda<;ao de Amparo aPesquisa do Estado
de Sao Paulo (Process No. 99/07693-2, 99/03279-7, and 98/11596-0) for
financial support.
References
1. Brown, A. G., Butterworth, D., Cole, M., Hanscomb, G., Hood, J. D., Reading, c., and
Rolinson, G. N. (1976), J. Antibiot. 29,668-669.
2. Butterworth, D. (1984), in Biotechnology of Industrial Antibiotics, vol. 6, Vandamme, E.
J., ed., Marcel Dekker, New York, NY, pp. 225-235.
3. Haginaka, J., Nakagawa, T., and Uno, T. (1981), Chem. Pharm. Bull. 29,3334-3341.
4. Mayer, A. F., Hartmann, R., and Deckwer, W. D. (1997), Chem. Eng. Sci. 52,4561-4568.
5. Pungor, E., Afeyan, N. B., Gordon, N. F., and Cooney, C. L. (1987), Bio/Technology 5,
604-609.
6. Afeyan, N. B., Gordon, N. F., and Cooney, C. L. (1989), J. Chromatogr. 47, 1-19.
7. Rodrigues, M. I., Zaror, C. A., Maugeri, F., and Asenjo, J. A, (1992), Chem. Eng. Sci.
47(1),263-269.
8. Barboza,M., Hokka,C. 0., and Maugeri,F. (2002),Bioprocess Biosystem Eng. 25,193-203.
9. Foulstone, M. and Reading, C. (1982), Antimicrob. Agents Chemother. 22, 753-762.
Abstract
Milk thistle contains compounds that display hepatoxic protection prop-
erties. We examined the batch extraction of silymarin compounds from milk
thistle seed meal in 50,70,85, and 100°C water as a function of time. After
210 min of extraction at 100°C, the yield of taxifolin was 1.2 mg/ g of seed,
a 6.2-fold increase over the results obtained in a Soxhlet extraction with
ethanol on pretreated (defatted) seeds. Similarly, the yield of silychristin
was 5.0 mg/ g of seed, a 3.8-fold increase. The yields of silybinin A and
silybinin B were 1.8 and 3.3 mg/ g of seed, respectively, or roughly 30% of
the Soxhlet yield. The ratios of the extracted compounds, and particularly
the ratios at long extraction times, showed that the more polar compounds
(taxifolin and silychristin) were preferentially extracted at 85°C, while the
less polar silybinin was favored at lOO°e.
Index Entries: Milk thistle; extraction; water; silymarin; flavanolignans.
Introduction
Milk thistle (Silybum marianum) is an annual or a biennial plant native
to the Mediterranean and North Africa. It grows wild throughout Europe,
North Africa, the Americas, and Australia but can also be cultivated (1).
The plants can reach a height of 10 ft with dark and shiny leaves, and purple
to reddish flowers. Milk thistle has an indeterminate growth habitat, result-
ing in staggered flowering and maturity (2). The seeds of the plant contain
a group of flavanoid compounds commonly named silymarin (3).
The term silymarin usually encompasses the dihydroflavonol-
taxifolin-and the flavanolignans-silybinin, isosilybinin, silydianin, and
*Author to whom all correspondence and reprint requests should be addressed.
aI~O'~
o ~)6(Yt°""
~O
"'WO~,r6r~
O:~
,oK
(Ii
OCH,
~~i§X:
TXF
'"m'~
~
ISBN
.
silychristin (Fig. 1). Some studies suggest that silybinin reduces the biliary
cholesterol concentration (4). It has also been demonstrated that silybinin is
useful in the intervention of hormone refractory human prostate cancer (5).
Furthermore, the combination of silybinin and silychristin has been found
helpful in decreasing the nephritic effects of chemical-induced injury (6).
The Deutsches Arzneibuch procedure for silymarin extraction is a
two-step process in which seeds are first defatted in a Soxhlet extraction
with petrol for 4 h, followed by a second Soxhlet extraction with methanol
for 5 h (7). Using this procedure, Benthin et a1. (8) reported silybinin yields
of 11 mg of silybinin/ g of seed. These investigators also extracted milk
thistle using pressurized liquid extraction techniques, in which 12 mg of
silybinin/ g of seed was obtained. In extracting OA-mm particle-size milk
thistle seed meal in a Soxhlet with petrol for 24 h, followed by an ethanol
Soxhlet for 4 h, Wallace et a1. (9) reported a silybinin yield of 16 mg/g of
seed meal. The differences in the results obtained by Wallace et a1. (9) and
Benthin et a1. (8) may not be significant, since the silybinin content of seed
batches varies significantly (2).
Wallace et a1. (9) reported the analysis of three off-the-shelf milk thistle
products, of which only two products contained silymarin compounds.
Inconsistency between herbal supplement label and product content is not
uncommon. For example, an analysis of ephedra products (10) showed a
broad range of ephedra alkaloid content, pointing most likely to manufactur-
ing problems. The lack of consistency among products can be owing in part
to the extraction step, where the desired molecules diffuse from the bulk herb
to a solvent phase, usually ethanol, methanol, acetone, hexane, or petroleum
ether. To increase the quality of products, the extraction step should be well
characterized, in terms of both rates and appropriate solvents.
The use of hot liquid water as an extraction solvent has recently caught
the attention of some researchers (11,12). Water is very useful in extracting
polar compounds and may also be useful in extracting polar compounds
from plant material without prior defatting. In increasing the water tem-
,.il
i\
o
~ ~~ Il'~~~ ~~ .
0.00 ._. __ J._, ..-._.__.
i i i i
5.00
'
"--,H~~~;..~\.ll!l ~j,)jJ!- . J!-
j • I
10.00
• • iii
...
15.00
' i , ii'
20.00
, i • I i i ' -r--,--r--r-""T"'"" ,
25.00 30.00
i
35.00
' i •
700C
2 -r---------, 1
5"-
• •
:co E
.. ;.1 1••
cao
• Satch 1 J:oo .Satch 1
.Satch2 S'a, .aatch2
o 100 200
ASatch3
300
S
0
E
0
0
••• 100 200 300
ASatch3
Tme,rrin Tme,nin
8SOC 100'C
.1 ·I.·
1
5_
A
5-
•
6
5 •
S4
:COB
go ....... 1 .Satch 1
i8 'a,~
:co
• Batch 1
:1-
S'a, .Satch2 .Batch2
5E ASatch3 E1 •• A Batch 3
0
0 01
0 100 200 300 0 100 200 300
Tme, nin Tme,rrin
Taxlfolin Silychristin
• • • ••
..----------,r----i
•
1.5 6
• •••
••
.SO"C • WC
-a
•••
"i E4
=:
• .70"C
-;:2
.70"C
•
-;: 0.5 .. 85°C .. as"C
E .'00"C E .'00"C
100 200 300 300
TIme,mln TIme, min
SIIybIninA SlIyblnln B
••
••
"
• • •••
.wc
• ••
1:
•••
.70"C
J!I .. as"C
eo 1
0
• . . . . ill , • • .'00"C
o 100 200 0 100 200 300
TIme. min Time. min
taxifolin after 210 min was 720%, while the percentage yields of silychristin,
silybinin A, and silybinin B were 480, 30, and 33%, respectively. Note that
the extraction yields of the polar compounds ta'Xifolin and silychristin were
significantly higher than the extraction yields in ethanol, indicating that
water is a better solvent for extracting polar compounds from milk thistle.
After 300 min of extraction, the yields of taxifolin, silychristin, silybinin A,
and silybinin B were 0.92 (550% of Soxhlet results), 4.7 (440%), 1.8 (30%),
and 3.4 (34%) mg/g of seed, respectively (data not shown). A slight
decrease in the yield of taxifolin was observed after 150 min, perhaps indi-
cating the onset of decomposition. Overall, water extraction at lOoDe
yielded about 65% of the amount of the total silymarins obtained in the two-
step Soxhlet extraction (with defatting) performed by Wallace et a1. (9).
The ratios of the concentrations of taxifolin, silychristin, and silybinin
A to the concentration of silybinin B at 85 and lOoDe as a function of time
are shown in Fig. 5. These temperatures were chosen because the silymarin
concentrations were not as large at temperatures below 85 C. As noted in D
g/ g and then held constant at that level. At lOODC, the ratio reached a
maximum of 0.65 g/ g and then gradually fell with time to 0.35 g/ g. This
reduction in the ratio at lOODC shows that the taxifolin concentration
reached its maximum faster than silybinin B. A similar behavior for the
ratio of silychristin to silybinin B is noted in Fig. 5B. At 85 e, the ratio D
A TAlSB B SiIyISB
0.8 2.5
2.0
0.6
m m 1.5 ......-esc
~ 0.4 ......-85C
.~ 1.0
_100C _100C
I- 0.2 ti) 0.5
0 0.0
0 100 200 300 0 100 200 300
Tme,nin Tme,nil
C SAlSB
rr
0.8
1 0.6
0.4
----~-- ......-85C
rn _100C
0.2
0.0
0 100 200 300
Tme,nin
Fig. 5. Compound ratio as function of time for 85 and 100°C experiments. (A) Taxifolin
to silybinin Bratio; (B) silychristin to silybinin B; ratio. (C) silybinin A to silybinin Bratio.
rapidly rose to just above 2.0 g/ g and then gradually increased before
leveling out at 2.2 g/ g. At 100°C, the ratio increased to a maximum of 2.0
g/ g and then gradually fell to 1.5 g/ g. Figure 5C shows that, excluding an
initial sharp increase, the ratio of silybinin A to silybinin B at 85°C was
constant at 0.65 g/ g. At 100°C, the ratio was constant at about 0.6 g/ g, again
excluding the initial period of sharp increase.
These ratios, and particularly the ratios at long extraction times, show
that the more polar compounds (taxifolin and silychristin) are preferen-
tially extracted at 85°C, while the less polar compounds (silybinin A and B)
are more easily extracted at 100°C (see also the data in Table 1). The data
reported by Wallace et al. (9) showed that the ratios of taxifolin to silybinin
B, silychristin to silybinin B, and silybinin A to silybinin B were 0.02, 0.1,
and 0.6, respectively. Thus, the ratios of extraction products using water at
100°C more closely resemble the Soxhlet extraction results than the water
extractions at temperatures below 85°C. More dramatic differences in polar
and nonpolar compound extraction with water are expected as the tem-
perature of liquid water is further increased, thereby lowering the dielec-
tric constant.
Although the yields of taxifolin, silychristin, silybinin A, and
silybinin B using water were less than what is reported in ethanol (9), this
technology shows promise because of the omission of the defatting step.
An oil-removal step was found necessary in the extraction procedures
proposed by Kahol et al. (15) and Benthin et al. (8). It is hoped that the
Applied Biochemistry and Biotechnology Vol. 105-108,2003
888 Barreto et al.
Table 1
Calculated Ratios of Compound/Silybinin B as Function of Temperature"
Water Dielectric Ratio of compound to SBb
temperature (0C) constant E Taxifolin/SB Silychristin/5B 5ilybinin A/5B
50 70 0.916 2.006 0.615
70 ·64 0.594 1.869 0.639
85 60 0.661 2.237 0.630
100 56 0.352 1.546 0.551
"These ratios were calculated at the last sampling point.
"SB, silybinin B.
Conclusions
Water is not only an interesting alternative solvent because of its low
operating and disposal costs, but is also effective in extracting the more
polar silymarin compounds from milk thistle seed. For each of the com-
pounds, extraction with 100°C water gave the highest yield and concen-
tration. After 210 min of extraction at 100°C, the yield of taxifolin was 1.2
mg/ g of seed, a 6.2-fold increase over Soxhlet extraction of pretreated
seeds with ethanol, while the yield of silychristin was 5.0 mg/ g of seed,
a 3.8-fold increase. The yields of silybinin A and silybinin B were 1.8 and
3.3 mg/ g of seed, respectively, or roughly 30% of the yield in the Soxhlet
extraction. The ratios of the extracted compounds, and particularly the
ratios at long extraction times, showed that the more polar compounds
(taxifolin and silychristin) were preferentially extracted at 85°C, while
the less polar compounds (silybinin A and B) were favored at 100°C.
References
1. Hamid,S., Sabir, A., Khan,S., and Aziz, P. (1983), Pakistan J. Sci. Ind. Res. 26,244-246.
2. Carrier, D. J., Crowe, T., Sokhansanj, 5., Katrusiak, A., Whahab, J., and Barl, B. (2003),
J. Herbs, Spices Med. Plants, 10(3), in press.
3. Tittle, G. and Wagner, H. (1978), J. Chromatogr. 153,227-232.
4. Duke, J. (1999), J. Med. Food 2, 73-76.
5. Zi, X. and Agarwal, R. (1999), Proc. Natl. Acad. Sci. USA 96, 7490-7495.
6. Sonnenbichler, J., Scalera, F., Sonnenbichler,l., and Weyhenmeyer, R. (1999), J. Pharm.
Exp. Ther. 290, 1375-1383.
7. DAB 9 (1986) Deutsches Arzneibuch, 9th ed., Deutscher Apotheker-Verlag,
Stuttgart.
8. Benthin, B., Danz, H., and Hamburger, M. (1999), J. Chromatogr. A 837, 211-219.
9. Wallace,S., Carrier, D. J., Beitle, B., Clausen, E., and Griffis, C. (2002), J. Nutraceut.
Funct. Med. Foods, submitted.
Extraction of Nutraceuticals
from Milk Thistle
Part II. Extraction with Organic Solvents
1Department
of Biological and Agricultural Engineering,
University of Arkansas, 203 Engineering Hall, Fayetteville, AR 72701; and
2Department of Chemical Engineering, University of Arkansas,
3202 Bell Engineering Center, Fayetteville, AR 72701,
E-mail: eclause@engr.uark.edu
Abstract
Seeds from milk thistle (Silybum marianum Gaert L.) contain flavanolignan
and dihydroflavanol compounds that have interesting and important thera-
peutic activities. The recovery of these silymarin compounds generally
involves a two-step defatting and extraction process using organic solvents.
This study examined the batch, single-stage extraction of whole and defatted
seeds using ethanol, methanol, acetonitrile, and acetone as the solvents. In
extracting defatted milk thistle seeds with organic solvents, extraction with
ethanol resulted in the highest silymarin yield, although some potential deg-
radation was observed. The maximum yields of taxifolin, silychristin,
silydianin, silybinin A, and silybinin B in ethanol were 0.6, 4.0, 0.4, 4.0, and
7.0 mg/ g of defatted seed, respectively. However, if silybinin A were the
diastereoisomer of choice, methanol would be the preferred extraction sol-
vent because it yielded the highest silybinin A to silybinin B ratio. Interest-
ingly, lipid removal is an important extraction step, because defatted material
yields twice the silymarin concentration.
Index Entries: Milk thistle; extraction; ethanol; methanol; silymarin;
acetone; acetonitrile.
Introduction
Seeds from milk thistle (Silybum marianum Gaert L.) contain flavano-
lignan and dihydroflavanol compounds that have interesting and impor-
tant therapeutic activities. Milk thistle flavanolignan and dihydroflavanol
Milk thistle seeds were purchased from Frontier Herbs (Norway, IA)
and ground with a coffee grinder to an average particle size of 0.4 mm.
Extraction experiments were conducted at the normal boiling point of
the respective solvent (methanol, ethanol, acetonitrile, or acetone). For all
experiments, 2 g of seed (contained in a cheesecloth bag) was extracted in
200 mL of the corresponding solvent. The boiling flask was heated in an
electric mantel, and water was used to condense the vapor.
Extraction samples were taken in triplicate every 30 min, including
time zero, using a 1 mL pipet. Time zero was set as the time when the
solvent started boiling. The aliquots were placed in preweighed test tubes
and weighed to determine aliquot weight. Subsequently, the aliquots
were evaporated to dryness under a stream of nitrogen. To the dried
sample, 1 mL of methanol was added, after which the solution was
vortexed and centrifuged (lOg). The supernatant was filtered and ana-
lyzed, as described next.
Chemical Analysis
Silymarin concentrations were determined by high-performance liq-
uid chromatography (HPLC) using a Waters system (Milford, MA) com-
posed of an Alliance 2690 separations module and a 996 Photo diode
Array, controlled with Millennium32 chromatography software. Silymarin
compounds were separated using a Symmetry® (Waters) C I8 precolumn
placed in series with a Symmetry (Waters) C I8 column (150 x 4.6 mm, 5
!-tm), both at 40°C. A 10-!-tL sample volume was injected. Solvent A was
20:80 methanol:water, while solvent B consisted of 80:20 methanol:water.
The gradient program was initiated with 85:15 solvent A:solvent B flow-
ing for 5 min, followed by a linear gradient of 45:55 solvent A:solvent B
for 15 min. The proportions of 45:55 solvent A:solvent B were then held
constant for 20 min and brought back to 85:15 solvent A:solvent B over 10
min. The flow rate was 0.75 !-tL/min, and the silymarin compounds were
monitored at 290 nm. Peak identification was confirmed by mass spec-
trometry (Pharmalytics, Saskatoon, Saskatchewan, Canada). Calibration
curves were prepared with silybinin from Sigma (St. Louis, MO), taxifolin
from Extrasynthese (Lyon, France), and silychristin and silydianin from
PhytoLab (Hamburg, Germany). No standard was available for iso-
silybinin, and thus this compound was excluded from the analysis. The
silybinin standard obtained from Sigma contained two distinct peaks,
which are further referred to as silybinin A (first peak) and silybinin B
(second peak). Sample chromatograms from the extraction of whole and
defatted milk thistle seeds are shown in Fig. 1, in which the HPLC proce-
dure was previously described (5).
t:~~~~~~~~,.,.
......
'_,-,- ,,-,--.-.' ~,.,.-..--,--,r-r-I
5,00 10.00 15.00 20.00 25.00 30.00 315.00 40.00 045.00 !II.OO
Fig. 1. Typical chromatogram of milk thistle seed extract: (A) whole seeds; (B)
defatted seeds. Retention times of taxifolin, silychristin, silydianin, silybinin A, and
silybinin B were 8.7,15.4,17.6,22.9, and 23.8 min, respectively. Note thatthis particular
seed lot contained miniscule amounts of silydianin.
C»
1..0
V1 Aceton itrile 0 Acetone
C
4.5 3.0
" 4.0
2.5
! 3.5 "! .
"i 3.0 • 2.0
• 1\
• • • ~ • .- ,..
~co 2.5 • • • S.t :.. • • • :!co • •
1.S /' , :. -.
" 2.0 • • Batch 2
I~Batch ~I
Batch 3
'" •• "~ 1.0
•• • •
t1.5 • E
" 1.0
"-;>: 0.5
•
~ 0.5
~ 0.0 0.0
0 200 400 600 800 0 200 400 600 800
~ Tlme(min) n"", (min)
a
,0>
a
""' Fig. 2. Silybinin B yield (mg of compound/ g of defatted seed) as function of time in ethanol, methanol, acetone, and acetonitrile at their
3 normal boiling points. Results show all the batches for all of the solvents. (A) Ethanol; (B) methanol; (C) acetonitrile; (D) acetone.
896 Wallace et al.
A Taxlfolln
"t:I 0.7
do
do
<II 0.6 •
"t:I
E o.s
do
•
do
0.4 • •
. Ethanol
.-..". -.
"t:I
C)
• Methanol
Acetonitrile
.~a~ •• •-
~ 0.3
D\cetone
'; 0.2
E
•
"t:I 0.' t:t t:t
t:t t:t
a;
:;:: o.
0 200 400 600 800
TIme (min)
B Silychristin
"t:I
4.5
,,
•
do
do
<I>
4
"t:I
do
!
3.S
• •
a•
. Ethanol
do
"t:I
2.5 • Methanol
C)
Z
U
2 • Acetonitrile
cet one
!II 1.5
C)
E
"t:I
a; 0.5
:;::
200 400 600 800
limo ( mi n)
C SlIydlanln
"t:I 0.6
g:
••
<II
O.S
a1 a
~do 0.4 a a . Ethanol
"t:I t t:t
• - Methanol
• :.. m
~ 0.3 f\ Acetonitrile
z
5l a IPAcetone
• •• • •
0.2
C) t3
E 0.'
"t:I ~.
a;
>= o•
0 100 200 300 400 500 600 700
n me (min)
0 Silyb inin A
al 4.5
:
. 4.0 •
•
'tI
3.5
:§. 3.0 • . Ethanol
'tI
~
2.5 • • Methanol
-
2.0 Acetonitrile
cI:
Z t:¥.cetone
CD 1.S
-
(/)
CI 1.0
E
'tI 0.5
iii
0.0
>=
0 200 400 600 800
Time ( min)
E S lIyb lnl n B
'tI
$ 8.0
co
'tI
!!!
7.0
•
.
~ 6.0
S.O • • . Ethanol
•
'tI
~ 4.0 - Methanol
til Acetonitrile
z 3.0 cet one
til
(/)
CI 2.0
E 1.0
'tI
iii 0.0
>= 0 200 400 600 800
Time (min)
Fig. 3. Continued from previous page. (0) silyhinin A (SBNA); (E) silyhinin B (SBNB).
00
<..0 Silybinin A I Silybinin B
00 C Silydianin I Silybinin B 0
CD 0.12 CD 1.2
z z
(I
ID •• •
In 0.1 VI I
VI .-
• en 1 • Ethanol
• Ethanol 1.: 1 =...
~ 0.08 • • •,. <!< • E
p¥ 0.8 .i · • Methanol
,- • Methanol c
~.,
~
- 0.06
Acetonitrile
-
z
ID
0,6 ~.~N"'7"'i".H~""jj .... ,..
Acetonitrile
VI
~ 0.04 • en 0.4
, Acetone Acetone
a
E
0.02
..... ".. . g 0.2
3
ii 0
0
ia:
6- a:
:- 0 200 400 600 800 0 200 400 600 800
A Taxlfolln
-
0.7
CI
0,6 •
~
0,5 •
..
I-~
Clal
EO 0 ,4
~
• • , . Defatted - Ethanol
!5al
;:::: 0.3 • Whole - Ethanol
• ••• •
.....
~~
;'C
-0
0.2
U
!5
()
0.1
••
,
• • •
0
0 200 400 600 800
TIme (mn)
B Silychrlatin
4.5
•
CI
4.0
z
() 3,5
• •
•
rn~
e>al
EGO
~ . 3.0
2.5
•• • , . Delatted - Ethanol ,
--;'C
§~
~.;
2.0
1.5
•
•••
•••• • • • Whole- Elhlnol
u
1.0
••
!5
()
0,5
0.0
0 200 400 600 800
TIme (min)
C SlIydlanln
-
0 ,6
e>
z
c
rn~
O.S
••
~
e>il
EGO . 0.4
• , . Defatted - Ethanol ,
!5al
-::
10 to
0 ,3
• • Whole- Ethanol
_~-GO 0 ,2
;'C
• • ••• • ••
• .. ,. •• • •
u 0.1
!5
()
0
0 200 400 600 800
TIme (min)
Fig. 5. Comparison between ethanol extraction of whole and defatted milk thistle
seeds. Silymarin yields are expressed as milligrams of compound/ gram of defatted
seed as a function of time. (A) taxifolin; (B) silychristin; (C) silydianin.
Continued on next page.
D SlIyblnln A
4.5
•
CJ>
4 .0
<
Z 3.5
•
•
III "0
(/)a> 3.0
CIa>
Em 2.5 • 1~ Defaned - Eth.1 nol
..
-;;"5: 2_0
••
•••• •• ••
0:::: • Whole- Ethanol
•
.:•
;:.,
fa; 1.5
E"O 1.0
a>
<>
c
0
0.5 •
U 0_0
0 200 400 600 800
TIme (min)
E SlIyblnln B
-
8.0
CI
CD
7,0
•
•
Z
CD 6.0
•
(1)"0
CI: 5.0
Em
• I.Defa ned - Etha nol
.. 4.0
~"O
•• •
ca> • Whole - Ethanol
0::::
.,-a>
;: 3.0
• •• • • • •
••••• •
~
E"O 2.0
'c<>" 1.0 •
0
u 0.0 •
0 200 400 600 800
TIme (min)
Conclusions
In extracting defatted milk thistle seeds with organic solvents, extrac-
tion with ethanol resulted in the highest silymarin yield, although some
potential degradation was observed. The maximum yields of taxifolin,
silychristin, silydianin, silybinin A, and silybinin B in ethanol were 0.6, 4.0,
004,4.0, and 7.0 mg/ g of defatted seed, respectively. However, if silybinin
A were the diastereoisomer of choice, methanol would be the preferred
extraction solvent because it yielded the highest silybinin A-t<rSilybinin B
ratio. Interestingly, lipid removal is an important extraction step, because
defatted material yields twice the silymarin concentration.
Future work in extracting silymarins from milk thistle with organic
solvents will focus on temperatures below the normal boiling point. Less
compound degradation should occur as the temperature is lowered. Multi-
stage extraction will also be considered in an effort to improve silymarin
yields.
References
1. Duke, J. (1999), J. Med. Food 2,73-76.
2. Zi, X. and Agarwal, R. (1999), Proc. NatI. Acad. Sci. USA 96, 7490-7495.
3. Sonnenbichler, J., Scalera, F., Sonnenbichler, I., and Weyhenmeyer, R. (1999),
J. Pharmacol. Exp. Ther. 290, 1375-1383.
4. "Top US Selling Herbs in 1999 and 2000," Nutrition Business Journal, San Diego, CA
5. Wallace, S., Carrier, D. J., Beitle, R., Clausen, E. and Griffis, C. (2002), Journal of
Nutraceutricals, Functional and Medical Foods, submitted.
6. Baker, A., Brymer, c., and Borrie, M. (2002), Geriatr. Today 5,13-16.
7. Gurley, B., Gardner, S., and Hubbard, M. (2000), Am. J. Health-Syst. Pharm. 57,
963-969.
8. Hamid, S., Sabir, A, Khan, S., and Aziz, P. (1983), Pakistan J. Sci. Ind. Res. 26,244-246.
9. Benthin, B., Danz, H., and Hamburger, M. (1999), J. Chromatogr. A 837, 211-219.
10. Kahol, A, Singh, K., Tandon, S., and Kumar, S. (2001), Indian patent no. 06309678.
11. Basile, A, Jimenez-Carmona, M. M., and Clifford, A A (1998), J. Agric. Food Chern. 46,
5205-5209.
12. Goto, M., Sato, M., and Hirose, T. (1993), J. Chern. Eng. Jpn 26(4),401-407.
Abstract
Foam fractionation is a simple separation process that can remove and
concentrate hydrophobic molecules such as proteins, surfactants, and or-
ganic wastes from an aqueous solution. Bovine serum albumin and ovalbu-
min have been widely used as model proteins due to their strong foaming
potential and low price. Here, we study the effect of lidocaine on albumin
foam, since drugs like lidocaine are known to bind with albumin. We ob-
served that lidocaine not only enhances the amount of foam produced but
also the stability of that foam as well. The foam stability was evaluated as the
decay rate constant of the foam, determined from a change in height (or
volume) of the foam over a given time period.
Index Entries: Foam; egg albumin; ovalbumin; lidocaine; foam stability.
Introduction
Foam fractionation has been in use in some forms since the early 1960s.
Its practical application was for the removal of surfactants in waste treat-
ment plants. The underlying process is the removal of surfactant molecules.
Another possible application for foam fractionation is to produce a stable
foam for extinguishing fires while providing a medium for breathable
oxygen. Du et a1. (1) describe the process as follows:
Foam is a gas-liquid dispersion system in which liquid is considered the
continuous phase while gas bubbles are the noncontinuous phase. Foam
fractionation is a separation technique based on the surface activity of
solutes in a solution. Foam fractionation is carried out in a column that
consists of two parts separated by a distinct interface during foaming.
"Author to whom all correspondence and reprint requests should be addressed.
Foam Oecay
An ovalbumin solution of 60 mg/L was made by dissolving 240 mg of
ovalbumin in 4000 mL of water. The ovalbumin solution was then added
to the glass column. The stopcock at the bottom of the column was kept
closed until air was fed to the system. Once the solution was added, the inlet
airflow rate was set at 85 L/ min and the stopcock was turned to the" open"
position. For consistency, the foam was generated for 3 min. At 3 min, the
height was measured with a ruler. With no aeration, height measurements
were then taken every minute as the foam collapsed. When the foam
reached approx 4 cm, the foam decay process was stopped. This procedure
was repeated for various levels of lidocaine over the range of 0-1.6 mL from
a 20 mg/mL stock solution over 0.125-mL increments for a constant oval-
bumin concentration (60 mg/L).
Foam decay experiments were then conducted in a 1-L polypropylene
graduated cylinder using egg albumin. The albumin solution of 60 mg/L
was made by dissolving 240 mg of egg albumin in 4000 mL of water. To
create a foam in the closed-bottom polypropylene cylinder, a sparger con-
nected to the air hose was inserted from the top of the cylinder (like in a fish
Applied Biochemistry and Biotechnology Vol. 105-108,2003
908 Burapatana et al.
80
70
• Egg Albumin (100 mgfL)
60 -------i
GI
E 50 - - - - - - - i • Egg-Albumin + 1ml
:::0
;§! Udocaine HCI
.
.!!
40
o Water + 1ml Udocaine
..
E 30
0
'"- 20
- - - - - - - i HCI added
- - - - - - - i • Water + 2mIUdocaine
HCladded
10
0
Solution Composit ion
Fig. 1. The bar graphs show the effect of adding lidocaine to 100 mg/L of albumin
solution before foam is formed .
tank). For each run, 200 mL of albumin solution was used. After foaming
up to the BOO-mL mark in the cylinder, the air was turned off. Foam height
measurements were taken at approx 1 min intervals to monitor the foam
decreases in height.
Measurement of Surface Tension
The surface tension of egg albumin was directly determined using a
KSV Sigma 70 surface tension/contact angle meter. This device is fully
computer controlled. The measurements made in this experimentation
were based on the Wilhelmy plate method (4).
Fig. 2. Change in surface tension with added lidocaine. Initially, 60 mg/L of oval-
bumin was present.
25.00
20.00
e '~
". ..
." ,- ..
.e. 15.00 .. 0 ml lidocaine added
E
g
iii
~ "" .,.\ • 0 50 mllidocalno added
I'- ~\ • 1.00 mllidocaino added
o 10.00 ~ • • .. 1.50 ml lidocaloo added
•
~
.. ,
0>
~
~
,~
..
~
5.00
\. .. I- ... "lI.
I
0.00
o 200 400 600 800 1000 1200 1400 1600
nme(aeconda)
smaller the rate constant, the longer the foam remained in the column and,
hence, the more stable the foam. The decay rate profile appears to have
three characterizing intervals. The first interval is from 0 to 0.4 mL of
lidocaine added. In this interval, the decay rate is constantly decreasing.
The second interval is from 0.4 to 1.2 mL of lidocaine added. Here, the decay
rate seems to stabilize and hold constant. In this interval, the solution
seemed to be "saturated" with the amount of lidocaine added. A different
effect is observed in the third interval (from 1.2 to 1.6 mL of lidocaine
added). The foam is most stable when 0.375 mL of lidocaine is added. The
decay rate was used instead of the leveling time because the leveling time
Applied Biochemistry and Biotechnology Vol. 105-108, 2003
910 Burapatana et at.
0.0060
~
0.0050
0.0040 \ rj \
.....
~
...
\
C
I:
!1!III
0.0030
1\ It
I:
~
0
0
>-
\ r ~... J
III
CJ
0.0020
«II ~~
0
0.0010 /
~ ~
0.0000
0.000 0.200 0.400 0.600 0.800 1.000 1.200 1.400 1.600 1.800
Lidocaine added (ml)
29
.
28 • w/o lidocaine
E • • I
-
27 • w/1 mllidocaine
26
,£. •
~ 25
Ai 24 • •
l: 23
E
~ 22 •
II.
21 •
20
o 5 10 15 20
Tlme(mln)
Fig. 5. Foam decay time in polypropylene column. The egg albumin concentration
was at 60 mg/L. One milliliter of lidocaine was added. The decay rate constant for the
foam without lidocaine addition was 0.0956/ s, and for the foam with 1 mL oflidocaine
added was 0.0125/s, indicating a 7.6-fold enhancement in foam stability.
was taken from only one data point. The leveling time is defined as the time
it takes for the foam height to decrease by 63% (1 - 1/ e). Because of the
random collapsing pattern of the foam, one point would not be a good
representation of the foam-decaying behavior. Figure 5 shows the effect of
lidocaine on foam decay in a polypropylene column. The foam with
lidocaine took about six times longer to reach the same height as the foam
without lidocaine.
Applied Biochemistry and Biotechnology Vol. 705-108, 2003
Effect of Lidocaine on Foam Stability 911
For the purposes of this experiment, the foam collapse rates were fit
to first-order decay curves. Each set of data fit first-order decay curves
with R2 values >0.95. In addition, a new variable, L, or foam-leveling time
was defined. In the glass column part of the experiment, it was observed
that after one duplicated run, the error in measuring foam decay time was
80%. In the plastic column, the data also had a lot of uncertainty. The decay
rate varied about 30% from the mean value. The plastic column diameter
was 2.7 times smaller than the glass column. In both columns, the foam-
collapsing pattern was random. The level of the foam initially decreased
at a constant rate. Then, the random pattern started to have a very strong
effect. Although the height might not change as fast, the number of bubbles
was decreasing. The liquid fraction of the foam was also an important
factor. Wetness of the foam is a function of liquid fraction of the foam.
From the experiment, the wet foam (high liquid fraction) tended to stick
less to the wall. The dry foam (low liquid fraction) created many problems
during the experiment because it would form a layer around the wall. The
addition of lidocaine increased the foam decay time. The foam from
60 mg/L egg albumin solution usually took about 3 min to decrease
200 mL (out of 800 mL initial foam). The foam from 60 mg/L initial albumin
solution with the addition of 1 mL of lidocaine took 18 min to decrease the
volume by 200 mL. The addition of lidocaine decreased the surface tension
of the solution; therefore, it was much easier to foam. At the same gas
velocity, the foam with lidocaine had smaller bubbles. Smaller bubbles
suggested that the foam contained more water. Wet foam was more stable
than dry foam.
Conclusions
The addition of lidocaine to ovalbumin and egg albumin aqueous
solutions not only created much more foam, but this wetter foam was more
stable. There appears to be a peak in foam stability at a lidocaine concentra-
tion (0.375 mL of lidocaine added) where the foam decay rate constant
reached a minimum. For both glass and polypropylene columns, the
lidocaine generally stabilizes the foam by creating smaller bubbles at cer-
tain concentrations (0.375 mL of lidocaine added) of lidocaine while larger
bubbles were seen at other concentrations.
References
1. Du, L. P., Prokop, A., and Tanner, R. D. (2002), Appl. Biochem. Biotechnol. 98, 1075-1O9l.
2. Goldstein, A., Aronow, L., and Kalman, S. M. (1974), in Principles of Drug Action: The
Basis of Pharmacology, 2nd ed., John Wiley & Sons, New York, NY.
3. SMCM (2002) Foam Fractionation: The Ins and Outs, St. Mary's College of Maryland, St.
Mary'S City, MD; (Website: www.smcm.edu/academics/smp/archive/plauger/
berlin.htm). Accessed December 17, 2002.
4. (1997) KSV Sigma 70 Experiments Reference, August I, 1997, p. 17. (Also at Website:
http://www.KSVLTD.Fi/Products/Surface%20chemistry /Sigma70 / sigma70.html)
Departamento de Biotecnologia,
Faculdade de Engenharia Qufmica de Lorena, CP 116, 12.600-000,
Lorena, SP, Brazil, E-mail: scoliveira@debiq.faenquil.br
Abstract
Understanding the main phenomena involved in the controlled-release
kinetics of herbicides in a water bath is a very important requisite for dif-
fusive-parameter estimation, because, some mathematical models based
on Pick's second law for diffusion have been developed to describe the
controlled-release kinetic data. However, the validity of these models is
restricted to the following assumptions: (1) the formulation is an isother-
mal slab; (2) the release occurs through the two faces of the slab; (3) the
herbicide is dissolved in the water contained in the slab pores at a concen-
tration less than the saturation concentration (Cis); (4) the total sum of the
individual volumes of the pores is EAL (E is the slab porosity, A is the slab
area, and L is the slab thickness); and (5) the initial concentration of herbi-
cide in the pores is Mol EAL (Mo is the initial amount of herbicide in the
matrix). The fourth assumption may be invalid for mathematical descrip-
tion of systems in which the herbicide concentration in the slab may be
above the saturation concentration. If this were true, the final assumption
would also be invalid, because the initial concentration of herbicide in the
pores is Cjs in this case. This work presents a study of the solubility effect on
the controlled-release kinetics of herbicides from lignin matrices.
Index Entries: Mathematical modeling; controlled-release; lignin; herbi-
cide; diffusion; solubility.
Introduction
The technology of controlled-release of herbicides is proving to be
very attractive as a solution to the problems with defensive application and
The initial and boundary conditions are given by Eqs. 3 and 4, respectively.
Ciw (x,t =0) =Cis (3)
MO(=
c" VD"k tanh[I n;-]+~ f
2D "2,2 (1-exp{-[k+{2n+l)2D"]t}) ]l (5)
[{2n+l}
V D" Jt n=O {k+{2n + 1)2D }
in which C* =2eAL Cis/(3tMO) and D' =3t2Deff/U. The D', k, and C* parameters
were estimated using the Marquardt's (7) method.
0.7 +
0.005
..
0.6 1& +- +-
i
1 +-
::I
~
0.5 r
::ii 11.4 0 l'
0.3
-0.005 • +-.... + ++
l' oj.
0.2 -0.01
0.1 1'+
0 -0.015
0 100 200 300 400 500 0 100 200 300 400 500
Fig. 1. Plot of experimental (exp) data vs model (mod) predictions and residual
values (residual = experimental value - predicted value) for CRF7.
Student's t-test. The estimated values of D* (1.70 x 1O~ d-1) and C* (approx
1.0 x 10-4) were close for diuron formulation assayed in both static and
dynamic systems. This result indicates that the model has a physical mean-
ing, because these parameters correlate only with the formulation, inde-
pendently of the assay type. This result was not observed in previous works
using the models based on Eq. 1 (2-5).
The k parameter estimated for CRF7 (5.6 x 10-4 d-1) is lesser than for
CRF7d (1.0 x 10-3 d-1). This can be explained by the fact that in the static-bath
system, the volume of water changed daily was less than in the dynamic
bath system. Thus, the concentration of herbicide in the static bath medium
was higher than that in the dynamic bath, and the dissolution rate in the
static system was less than that in the dynamic system.
For the CRF containing the herbicide ametryn (intermediate solubil-
ity in water-18S ppm), the fit of the mathematical model was very good
according to Fisher test and provided significant parameters according to
student's t-test.
Figures 1-3 present plots of the experimental data versus model pre-
dictions, and the distribution of the residual values for CRF7, CRF7d' and
CRF8d • A good fit of the model to the experimental data was observed for
these formulations. Moreover, the residuals distribution obtained for CRF7,
CRF7d, and CRF8d indicate a randomized behavior.
Conclusion
The model considering the solubility effect on the controlled-release
of herbicide in a water bath was able to describe the experimental data for
formulations containing herbicides with intermediate (ametryn) and low
(diuron) solubilities in water. One important result obtained in this work
was the estimation of an equal diffusivity parameter for the diuron formu-
lation assayed in two different water bath systems.
Fig. 2. Plot of experimental (exp) data vs model (mod) predictions and residual
values (residual = experimental value - predicted value) for CRF7d•
1 0.02
0.9 0.015 ....
'+" '"
0.8
0.01 1'1'
0.7
0.6 0.005 f"
.... 1"+
~ 0.5
0.4 -0.005
0
l'
0.3
-0.01
0.2
0.1 -0.015
0 -0.02
0 5 10 15 20 25 30 35 40 0 5 10 15 20 25 30 35 40
lime (clays) lime (days)
Fig. 3. Plot of experimental (exp) data vs model (mod) predictions and residual
values (residual = experimental value - predicted value) for CRF8d •
For the herbicide with high solubility in water (2,4-D), the parameter
estimates obtained were not statistically significant according to student's
t-test. This fact may be ascribed to the high solubility of 2,4-D, rendering a
herbicide concentration in the matrix less than its solubility in water.
The next step in the validation of the current model is determination
of the volume of the matrix pores (EAL), in order to obtain an experimental
value for C. With the use of an experimental value for C in the model, the
estimation of D* and k will be more accurate.
Acknowledgments
This work was supported by Funda<;ao de Amparo a Pesquisa do
Estado de Sao Paulo, under process no. 99/05002-2 and by Conselho
Nacional de Desenvolvimento CientHico e Tecnol6gico.
References
1. Wilkins, R. M. (1990), in Biodegradable Polymer Methods, Controlled Delivery of Crop-
Protection Agents, Wilkins, R M., ed., Taylor & Francis, London, UK, pp. 149-165.
2. Pereira, F. M. (2001), MS thesis, Faculdade de Engenharia Quimica de Lorena,
Departamento de Biotecnologia, Lorena, Brazil.
3. Pereira, F. M., Gon"alves, A R, Ferraz, A, Silva, F. T., and Oliveira, S. C. (2002),Appl.
Biochem. Biotechnol. 98-100, 101-107.
4. Pereira, F. M., Gon"alves, A R, Ferraz, A, Silva, F. T., and Oliveira, S. C. (2001),Appl.
Biochem. Biotechnol. 91-93, 563-572.
5. Oliveira, S. c., Pereira, F. M., Ferraz, A, Silva, F. T., and Gon"alves, A R (2000),Appl.
Biochem. Biotechnol. 84-86,595-615.
6. Siegel, R A (1989), in Controlled-Release of Drugs: Polymers and Aggregate Systems,
Rosoff, M., ed., VCH, New York, NY, pp. 9-11
7. Marquardt, D. W. (1963), J. Soc. Ind. Appl. Math. 11(2),431-441.
o s
oligomers, 179, 337, 515 saccharification, 247
Organosolv pulping, 769 Saccharomyces cerevisiae, 265,787
Orpinomyces, 775 selective harvest, 43
ovalbumin, 905 separate hydrolysis and fermentation, 127
oxygen shrinking-bed reactor, 593
sensitivity,303 silica, 43, 205
transfer, 471 controlled-pore, 809
oxygenases, 725 silymarin, 881, 891
simultaneous saccharification and
p fermentation, 127, 637
slagging, 205
Panax ginseng, 493 softwood, 127
paper sludge, 557 solubility, 179,913
partial least squares, 437 soybean, 829
Penicillium canescens, 737 sporulation, 287
petroleum contamination, 725 starch-based packing peanuts, 375
phenylboronate, 829 statistical experimental design, 403
phenylpropanoids, 649 steam explosion, 87, 219
Pichia stipitis, 547 straw composite, 423
pilot scale, 69 Streptomyces, 749
piperonal, 649 viridosporus, 799
W z
waste activated sludge, 567 Zymomonas mobilis, 457