AJB Advance Article published on July 26, 2010, as 10.3732/ajb.1000170.

The latest version is at http://www.amjbot.org/cgi/doi/10.3732/ajb.1000170

American Journal of Botany: e000–e000. 2010.

AJB Primer Notes & Protocols in the Plant Sciences

DEVELOPMENT OF MICROSATELLITE MARKERS IN LUPINUS

LUTEUS (FABACEAE) AND CROSS-SPECIES AMPLIFICATION
IN OTHER LUPINE SPECIES1

Lorena B. Parra Gonzalez2, Shannon C. K. Straub3, Jeff J. Doyle3,

Paula E. Mora Ortega2, Haroldo E. Salvo Garrido2,4, and Iván J. Maureira Butler2,5
2Agro Aquaculture Nutritional Genomic Center (CGNA), Plant Biotechnology Unit INIA-Carillanca P.O. Box 58-D, Temuco,
Chile; 3L.H. Bailey Hortorium, Department of Plant Biology, Cornell University, 412 Mann Library, Ithaca, New York 14853
USA; 4Institute of Agricultural Research (INIA), P.O. Box 58-D, Temuco, Chile

• Premise of the study: Microsatellite primers were developed in Lupinus luteus L., an emerging temperate protein crop, to in-
vestigate genetic diversity, population structure, and to facilitate the generation of better yellow lupine varieties.
• Methods and Results: Thirteen polymorphic primer sets were evaluated in a European and Eastern European accession collec-
tion of L. luteus. The primers amplified di-, tri-, and tetranucleotide repeats with 2–4 alleles per locus. These revealed a moder-
ate to low level of genetic variation, as indicated by an average observed heterozygosity of 0.0126. Select loci also amplified
successfully in the closely related species L. hispanicus Boiss. & Reut. and in the New World species L. mutabilis Sweet.
• Conclusions: These results indicate the utility of primers for the study of genetic diversity across L. luteus populations and
related lupine species. The use of these microsatellite markers will facilitate the implementation of several molecular breeding
strategies in yellow lupine.

Key words: Lupinus hispanicus; Lupinus luteus; Lupinus mutabilis; protein crop.

Lupinus luteus L. (Fabaceae) belongs to a large and diverse
genus comprising more than 200 annual and perennial herba-
ceous species growing in a wide range of climatic and soil con-
ditions (Drummond, 2008). It is widely distributed across the
Mediterranean region, but it is not clear how much of this range
is native, and how much involves naturalization due to human
cultivation (Petterson et al., 1998). Lupinus luteus possesses a
mixed mating system with outcrossing rates of up to 40%
(Wallace et al., 1954). Several Lupinus species are cultivated
and used as human food or animal feed. The major cultivated
species are the narrow-leaved lupine (L. angustifolius L.), white
lupine (L. albus L.), yellow lupine (L. luteus), and tarwi or cho-
cho (L. mutabilis Sweet) (Petterson et al., 1998). Yellow lupine
seeds have the highest protein content and twice the cysteine
and methionine content of most other lupines (Glencross et al.,
2004). However, despite its highly nutritional qualities, there is
a lack of genetic and molecular tools to aid the genetic breeding
of this species.
Microsatellite (simple sequence repeats, SSR) markers
are well known for their versatility as molecular tools for
genetic analysis. Their high reproducibility, low cost, and
1 were lysed and 1 ml used as a template for cycle sequencing using BigDye
Manuscript received 13 May 2010; revision accepted 12 June 2010.
The authors thank Steven M. Bogdanowicz, Evolutionary Genetics
Core Facility, Department of Ecology and Evolutionary Biology, Cornell
University, for his academic and technical support during the repeat-
enriched L. luteus library construction. This research was funded by
the National Commission for Scientific & Technological Research
(FONDECYT Project No.1080520), Chile.
5 Author for correspondence: ivan.maureira.butler@cgna.cl
doi:10.3732/ajb.1000170
abundance in plant genomes make them an ideal marker sys-
tem for high throughput genotyping and germplasm charac-
terization (Varshney et al., 2005). To date, few studies have
reported the use of molecular markers in lupine species.
Most of the efforts have been focused on the generation of
molecular markers and genetic maps of L. angustifolius
(Nelson et al., 2006) and L. albus (Phan et al., 2007). There
are no reports of development and use of molecular markers
in populations of L. luteus, L. hispanicus Boiss. & Reut. (the
closest and still interfertile sister species of yellow lupine;
Swiecicki et al., 1999), and L. mutabilis (the only lupine cul-
tivated in the New World; Petterson et al., 1998). In this study,
we report the isolation and characterization of 14 polymor-
phic SSR loci (13 sets of primers) generated from the ge-
nome of L. luteus. Additionally, these loci were tested for
cross-amplification in L. hispanicus and L. mutabilis.
METHODS AND RESULTS
Genomic DNA from one L. luteus individual was used to construct a DNA
library enriched for various di-, tri-, and tetranucleotide repeats following
Dopman et al. (2004). Colonies positive for a microsatellite-containing insert
Terminator v3.1 chemistry (Applied Biosystems, Carlsbad, CA). Products puri-
fied by ethanol precipitation were sequenced on 3730 DNA Analyzers (Applied
Biosystems) at the Life Sciences Core Laboratories Center at Cornell University.
Sequences were visualized and unique microsatellite containing sequences
identified using Sequencher 4.7 (Gene Codes, Ann Arbor, MI). Flanking prim-
ers were designed for each microsatellite using the program Primer 3 Version
3.12 (Rozen and Skaletsky, 2000) and oligonucleotides were synthesized by
Sigma Genosys (Sigma Aldrich, St. Louis, MO).
Eighty-five individuals belonging to a Lupinus luteus core collection were
used for microsatellite genotyping. The collection includes accessions for Poland,

American Journal of Botany: e1–e3, 2010; http://www.amjbot.org/ © 2010 Botanical Society of America
e1

Copyright 2010 by the Botanical Society of America

e2 American Journal of Botany [Vol. 0

Table 1. Characteristics of 13 genomic microsatellite primers developed in Lupinus luteus. Shown for each primer pair are the forward and reverse
sequence, repeat type, allele range size (bp), number of alleles (and cross-amplification), annealing temperature when run individually (Ta), observed
heterozygosity, and the GenBank accession number. All values are based on 85 samples representing European and Eastern European accessions.

Allele range Observed

Primer Sequence Repeat size (bp) No. of allelesb Ta(C) heterozygosity GenBank

Lup_P1A11 F: TCAATCAAGGAACCAAATAATGC (CAA)5 263–266 2 55 0.0235 HM193909

R: CTTTCAAATGTAATCAACTCCAAT
Lup_P1B02 F: ATTGATAAATTGCAAGGAAGATGG (CAA)6 281–284 2 h(2),m 50 0.0000 HM193910
R: AACCACTATGCATCATTTATATTATA
Lup_P1C01 F: TTCTCCTCACGCCCTATTACATGA (GAA)7 333–339 2 60 0.0118 HM193911
R: CGAAAATATATTGCAGAAGGTGG
Lup_P1C02 F: GTTTCCACCAAATTCATCATAACT (GAA)9 320–329 3 55 0.0235 HM193912
R: CAAATTTAAAAACAAAATCTCACATACA
Lup_P1D05 F: TTGACGTGACCCACTTCATTGT (GTT)6 gtggttgct 358–361 2 h(2),m 55 0.0000 HM193913
R: GAGAGCGTTAAAGCAAGGGCTG (GTT)6
Lup_P2C09 F: CATATGCTTTTAACCAACAAG (GAA)9 ggagaagga 365–371 3 h(1) 55 0.0000 HM193914
R: AAACAACCTCTCCACTTGC (GAA)19
Lup_P2D05 F: GAACTGGGTTGGATTAGTAG (CAA)5 283–286 2 h(1),m 55 0.0000 HM193915
R: GGTTCAAGAATTCACTGG
Lup_P8C06 F: CTATTGCCCTCCCGCTGTTC (CAA)6 138–141 2 h(1),m 60 0.0000 HM193916
R: CAATGTCGAATCATCAGACCC
Lup_CT067 F: GTTTCCACACTCCATTTCAG (AT)10 gca (CT)16 168–172 3 55 0.0471 HM193917
R: CATATCCATGAAAACATAGCC
Lup_CT156 F: CCACAAAATCCATTCATTCTC (TA)2 ttca (TA)6 266–270 2 h(1) 55 0.0000 HM193918
R: GGTTCCAAGTTTAATCCCA
Lup_CT38Aa F: GTCACATTCTGATTGTAGC (CAA)20 257–260 2 h,m 55 0.0235 HM193919
Lup_CT38Ba R: TCCAACTTCTTTTGGTCC 247–253 3 h,m 0.0118
Lup_CT12760 F: TGACACAATCCTCAACGCTC (AAAC)5 198–266 4 60 0.0000 HM193920
R: GGAACGATCTAAGCCATCCA
Lup_CT20380 F: ATACACTTTCCCATCGCCAC (CAT)6 ggtgttcatg 162–192 3h 60 0.0353 HM193921
R: GCTGCAGAAAGTGAGCAGAA (ATC)6
a Marker Lup_CT38 amplified two distinct bands and were annotated as loci A and B.
b Positive cross-amplification using L. hispanicus and L. mutabilis samples are denoted by the letters h and m, respectively. Number of DNA fragments
(band size) shared between L. luteus and L. hispanicus are shown within parentheses.

Ukraine, the former Soviet Union, Spain, Germany, Morocco, Belarus, Portugal,
Netherlands, Israel, and Hungary. Polish accessions were kindly provided by
W. K. Swiecicki, Institute of Plant Genetics, Polish Academy of Sciences, Poznan,
Poland. The rest were obtained from the Western Regional PI Station, USDA,
ARS, WRPIS, Washington State University, Regional Plant Introduction Station,
Pullman, Washington, USA (Appendix S1). The cross-amplification of these
SSR primer pairs was determined with six accessions each of L. hispanicus and
L. mutabilis, all obtained from the Western Regional PI Station, USDA, ARS,
WRPIS. DNA was extracted using CTAB buffer according to the method of
Doyle and Doyle (1987). The extracted DNA was quantified using a Synergy HT
Multimode Microplate Reader (Biotek Instruments, Winooski, VT) and diluted to
50 ng/μl by microliter in TE buffer (10 mM TRIS, 1 mM EDTA pH 7,5).
Amplification of SSR regions was performed in 20-μl PCR reactions containing
100 ng of genomic DNA, 0.2 mM dNTPs, 2 mM MgCl2, 1× PCR buffer, 2.5%
DMSO, 1 U Taq polymerase (Agilent Technologies (formerly Stratagene), Santa
Clara, CA) and 5 pmoles of each reverse and forward SSR primer. PCRs were
performed in a Peltier thermal cycler (MJ Research, St. Bruno, Quebec, Canada)
using a touchdown protocol as follows: 94°C for 5 min; 5 cycles of 1 min at 94°C,
1 min at 55–65°C decreasing 1°C per cycle, 2 min at 72°C followed by 35 cycles of
1 min at 94°C, 1 min at 50–60°C and 2 min at 72°C. A final extension at 72°C was
performed for 10 min. PCR products were separated on 6% denaturing polyacryl-
amide gels, run in TBE buffer at 60 watts for 3–4 hours and visualized using silver
stain procedures. Standard population genetics metrics were calculated using Pop-
Gene version 1.32 (http://www.ualberta.ca/~fyeh/index.htm).
From 271 positive clones, 99 clearly showed microsatellite inserts. Ninety-
two primer pairs were designed and initially screened using eight L. luteus
accessions and two accessions each for L. hispanicus and L. mutabilis represent-
ing diversity across their geographic ranges. Only 13 (14%) SSR markers were
polymorphic among the L. luteus accessions. One marker, Lup_CT38, amplified
two independent fragments and was scored as two polymorphic loci (Lup_CT38A
and Lup_CT38B). All polymorphic markers were screened against the 85 L. lu-
teus accessions and six accessions each of L. hispanicus and L. mutabilis.
All 14 analyzed loci showed allelic frequencies significantly deviating from ex-
pected Hardy–Weinberg proportions (P < 0.001). The 14 SSR loci were also tested
for cross-amplification in two other Lupinus species. Nine loci amplified in L. his-
panicus, and several DNA fragments showed similar or identical allele sizes to
those observed in L. luteus (Table 1). Only six loci amplified in L. mutabilis. The
lower success rate for amplification in L. mutabilis vs. L. hispanicus might have
been predicted given the close genetic relationship between L. luteus and L. hispani-
cus and the earlier divergence between New and Old World lupines (Drummond,
2008). The low proportion of polymorphic SSR markers revealed low levels of
genetic variation for L. luteus. This behavior has been reported before in other lu-
pine species such as L. angustifolius (Annicchiarico and Carroni, 2009) and L. poly-
phyllus Lindl. (Käss and Wink, 1997).
CONCLUSIONS
The development of SSR markers is an important step in un-
derstanding the genetic makeup of L. luteus. Assessment and uti-
lization of the variation contained within this species will facilitate
the breeding of better yielding varieties with higher nutritional
value. Cross-species amplification in L. hispanicus and L. muta-
bilis has opened an opportunity for comparative studies among
these and other lupine species. In addition, the use of these mark-
ers will facilitate the follow up introgression of favorable varia-
tion from L. hispanicus (e.g., resistance to waterlogging, cold,
and diseases) into L. luteus.
LITERATURE CITED
Annicchiarico, P., and A. M. Carroni. 2009. Diversity of white and
narrow-leafed lupin genotype adaptive response across climatically-
contrasting Italian environments and implications for selection.
Euphytica 166: 71–81.
August 2010] AJB Primer Notes & Protocols—LUPINUS LUTEUS genomic microsatellites
Dopman, E. B., S. M. Bogdanowicz, and R. G. Harrison. 2004.
Genetic mapping of sexual isolation between E and Z pheromone
strains of the European corn borer (Ostrinia nubilalis). Genetics 167:
301–309.
Doyle, J. J., and J. L. Doyle. 1987. A rapid isolation procedure for small
quantities of fresh leaf tissue. Phytochemical Bulletin 19: 11–15.
Drummond, C. S. 2008. Diversification of Lupinus (Leguminosae) in
the western New World: Derived evolution of perennial life history
and colonization of montane habitats. Molecular Phylogenetics and
Evolution 48: 408–421.
Glencross, B. D., C. G. Carter, N. Duijster, D. R. Evans, K. Dods,
P. McCafferty, W. E. Hawkins, et al. 2004. A comparison of
the digestibility of a range of lupin and soybean protein products
when fed to either Atlantic salmon (Salmo salar) or rainbow trout
(Oncorhynchus mykiss). Aquaculture (Amsterdam, Netherlands) 237:
333–346.
Käss, E., and M. Wink. 1997. Phylogenetic relationships in the
Papilionoideae (family Leguminosae) based on nucleotide sequences
of cpDNA (rbcL) and ncDNA (ITS 1 and 2). Molecular Phylogenetics
and Evolution 8: 65–88.
Nelson, M. N., H. T. Phan, S. R. Ellwood, P. N. Moolhuijzen, J.
Hane, A. Williams, C. E. O’Lone, et al. 2006. The first gene-
based map of Lupinus angustifolius L.—Location of domestication
e3
genes and conserved synteny with Medicago truncatula. Theoretical
and Applied Genetics 113: 225–238.
Petterson, D. S. 1998. Composition and food uses of lupins. In J. S.
Gladstones, C. A. Atkins, J. Hamblin [eds.], Lupins as crop plants:
Biology, production and utilization, 353–384. CAB International,
London, UK.
Phan, H. T., S. R. Ellwood, K. Adhikari, M. N. Nelson, and R. P.
Oliver. 2007. The first genetic and comparative map of white lupin
(Lupinus albus L.): Identification of QTLs for anthracnose resistance
and flowering time, and a locus for alkaloid content. DNA Research
14: 59–70.
Rozen, S., and H. J. Skaletsky. 2000. Primer3 on the WWW for general
users and for biologist programmers. In S. Krawetz and S. Misener
[eds.], Bioinformatics methods and protocols: Methods in molecular
biology, 365–386. Humana Press, Totowa, New York, USA.
Swiecicki, W., W. K. Swiecicki, and T. Nijaki. 1999. Lupinus ×his-
panicoluteus—An interspecific hybrid of Old World lupins. Acta
Societatis Botanicorum Poloniae 68: 217–220.
Varshney, R. K., A. Graner, and M. E. Sorrels. 2005. Genetic
microsatellite markers in plants: Features and applications. Trends in
Biotechnology 23: 48–55.
Wallace, A. T., W. T. Hanson, and P. Decker. 1954. Natural crosspol-
lination in blue and yellow lupines. Agronomy Journal 46: 59–60.