Antonie van Leeuwenhoek

DOI 10.1007/s10482-015-0464-9

ORIGINAL PAPER

Comparative 16S rRNA signatures and multilocus sequence

analysis for the genus Salinicola and description
of Salinicola acroporae sp. nov., isolated from coral
Acropora digitifera
Rinchen T. Lepcha . Abhijit Poddar .
Peter Schumann . Subrata K. Das

Received: 7 February 2015 / Accepted: 24 April 2015

Ó Springer International Publishing Switzerland 2015

Abstract A novel Gram-negative, aerobic, motile
marine bacterium, strain S4-41T, was isolated from
mucus of the coral Acropora digitifera from the
Andaman Sea. Heterotrophic growth was observed in
0–25 % NaCl, at 15–45 °C and pH 4.5–9. In phylo-
genetic trees, strain S4-41T was grouped within the
genus Salinicola but formed a separate branch distant
from a cluster composed of Salinicola salarius M27T
and Salinicola socius SMB35T. DNA–DNA related-
ness between strain S4-41T and these reference strains
were well below 70 %. Q-9 was the sole respiratory
quinone. The DNA G?C content was determined to be
63.6 mol%. Based on a polyphasic analysis, strain S4-
41T is concluded to represent a novel species in the
genus Salinicola for which the name Salinicola
acroporae sp. nov. is proposed. The type strain is
S4-41T (=JCM 30412T = LMG 28587T). Com-
parative 16S rRNA analysis of the genera Salinicola,
Kushneria, Chromohalobacter and Cobetia revealed
the presence of genus specific sequence signatures.
Multilocus sequence analysis based on concatenated
sequences of rRNAs (16S and 23S) and four protein
coding housekeeping genes (atpA, gyrB, secA, rpoD)
was found to be unnecessary for phylogenetic studies
of the genus Salinicola.
Keywords Salinicola acroporae sp. nov. 
Halomonadaceae  16S rRNA signatures  Split
decomposition analysis  Multilocus sequence
analysis  Polar lipid
Abbreviations
NJ Neighbour joining
ML Maximum likelihood
MP Maximum parsimony

Electronic supplementary material The online version of
this article (doi:10.1007/s10482-015-0464-9) contains supple-
mentary material, which is available to authorized users.
R. T. Lepcha  A. Poddar  S. K. Das (&)
Department of Biotechnology, Institute of Life Sciences,
Nalco Square, Bhubaneswar 751 023, India
e-mail: subratkdas@hotmail.com; subrata@ils.res.in
P. Schumann
Leibniz Institute DSMZ-German Collection of
Microorganisms and Cell Cultures, Inhoffenstrasse 7B,
38124 Brunswick, Germany
Introduction
The family Halomonadaceae was first proposed by
Franzmann et al. (1988) with two moderately halophilic
and marine genera of gammaproteobacteria, Halomo-
nas and Deleya. The family has now been expanded to
include 11 genera among which Halomonas is the
phylogenetically heterogeneous and largest genus
with 82 validly named species, whereas the genera
Aidingimonas, Carnimonas, Halotalea, Modicisal-
ibacter and Zymobacter are currently monophyletic

123

(http://www.bacterio.net/halomonadaceae.html) (Parte
2014). Three previously described genera, i.e. Deleya,
Halovibrio and Volcaniella, were found to form a co-
herent monophyletic group with the genus Halomonas
in 16S rRNA phylogeny and also exhibited similar
phenotypic and chemotaxonomic features and so these
genera have been unified into the single genus Halo-
monas to avoid taxonomic ambiguity (Dobson and
Franzmann 1996; Mellado et al. 1995). Furthermore,
due to the poor taxonomic resolution in 16S rRNA gene
phylogeny in the description of members of the family
Halomonadaceae (de la Haba et al. 2010a), nearly full
length 23S rRNA has been used extensively for taxo-
nomic delineation of members belonging to this family.
More recently, a robust multilocus sequence analysis
scheme has been proposed by de la Haba et al. (2012),
in which intrageneric and intergeneric similarities
based on individual and concatenated gene sequences
for the nine genera has been studied using four house-
keeping genes (i.e. atpA, gyrB, rpoD and secA) and two
rRNAs (16S and 23S).
The genus Salinicola is the 9th member introduced
into the family Halomonadaceae, with Salinicola so-
cius as the type species (Anańina et al. 2007).
Following its description, the phylogeny of the genus
has been reanalysed several times using 16S rRNA
and 23S rRNA sequence analysis. This has led to the
transfer of the species Halomonas salaria and Chro-
mohalobacter salarius to the genus Salinicola, as
Salinicola salarius comb. nov. and Salinicola halo-
philus nom. nov., respectively (de la Haba et al.
2010b). At present the genus Salinicola contain four
species that prefer moderate to extreme halophilic
conditions for growth, although S. salarius M27T
(Kim et al. 2007) and Salinicola peritrichatus DY22T
(Huo et al. 2013) also exhibit growth at 0 % NaCl. All
Salinicola strains are aerobic, Gram negative, motile
rods and have been reported from saline environments
in different geographical locations, including seawater
(Kim et al. 2007), deep sea sediment (Huo et al. 2013),
salt mines (Anańina et al. 2007) and a solar saltern
(Aguilera et al. 2007).
In this study, the phylogeny of the family Halomon-
adaceae has been revisited with screening of genus
specific 16S rRNA gene signatures and split decom-
position analysis using concatenated gene sequences
of the six genetic loci proposed by de la Haba et al.
(2012). Furthermore, strain S4-41T has been isolated
from mucus of the coral Acropora digitifera from the
123
Antonie van Leeuwenhoek
Andaman Sea. The strain has been characterized
following the recommended minimal standards for the
description of new taxa of the family Halomon-
adaceae (Arahal et al. 2007). Based on phenotypic,
genomic and chemotaxonomic observations, strain
S4-41T is concluded to represent a novel species of the
genus Salinicola, for which the name Salinicola
acroporae sp. nov. is proposed.
Materials and methods
Isolation and maintenance of strains
The coral A. digitifera was collected by diving at sea
near North Bay island, Andaman (Coordinates:
11°420 17.400 N; 92°450 01.500 E) in November 2010.
Collection of coral mucus and isolation of the strain
was performed according to methods described earlier
(Kumari et al. 2014a). The culture was streaked on
marine agar 2216 (MA; Difco) and stored at 4 °C for
short term preservation, and for long term preservation
the culture was stored at -80 °C in 15 % glycerol. For
comparative polyphasic analyses under the same
laboratory conditions, type strains of the genus
Salinicola were obtained from the Leibnitz-Institut
DSMZ-Deutsche Sammlung von Mikroorganismen
und Zellkulturen GmbH, Germany (S. salarius DSM
18044T and S. socius DSM 19940T), BCCM/LMG
Bacteria collection, Universiteit Gent, Belgium (S.
halophilus LMG 23626T) and the RIKEN Bio-Re-
source Center (S. peritrichatus JCM 18795T). Strains
were maintained on MA at 30 °C and preserved as
described above.
Phenotypic characterization
Cell morphology, motility and Gram stain character-
istics were examined by using a bright field confocal
microscope (Leica, TCS SP5). Growth physiology at
different pH (3.3-10; in steps of 0.5 pH unit),
temperature (5–50 °C; in steps of 5 °C) was deter-
mined in SW10 medium (Ventosa et al. 1982). The
requirement of NaCl for growth was determined in
MM63 minimal media (Jiang et al. 2014) supplement-
ed with 0, 0.5, 2, 3, 5, 7.5, 10, 15, 20, 25 and 30 % w/v
NaCl. Anaerobic growth was tested on MA using the
BD GasPakTM EZ system (Becton–Dickinson).
Phenotypic characteristics such as indole, methyl
Antonie van Leeuwenhoek
red, Voges Proskauer’s test, H2S production, nitrate
reduction, citrate utilisation, activities of catalase,
oxidase, lysine decarboxylase, ornithine decarboxy-
lase, arginine dihydrolase, urease, phenylalanine
deaminase and hydrolysis of esculin, casein, DNA,
gelatin, starch and Tween 20 and 80 were tested
according to Mata et al. (2002). Utilisation of carbo-
hydrates, alcohols, organic acids as sole source of
carbon and energy were determined following the
recommendations of Arahal et al. (2007) in SW10
medium at 30 °C where the final substrate concentra-
tion was 0.5 % (w/v). Apart from classical tests,
phenotypic characterisation was also performed using
API 50CH, API 20 NE, API 20E, API ZYM
(bioMérieux) and Biolog GNII microplates according
to manufacturers’ instruction with a minor modifica-
tion. Cultures were suspended in basal medium (i.e.
the salt solution used in SW10 medium) for inocula-
tion of API strips. Phenol red was used as an indicator
for API 50CH tests. For Biolog plates, the cultures
were suspended in inoculation fluid adjusted with
sterile NaCl stock solution to make a final NaCl
concentration of 8 %.
Susceptibility to different antimicrobials were
determined by the disc diffusion method on MA using
the following antimicrobial discs (lg/disc): ampicillin
(10), chloramphenicol (30), erythromycin (15),
nalidixic acid (30), rifampicin (30), tetracycline (30),
vancomycin (30), kanamycin (30), streptomycin (10),
ciprofloxacin (5), spectinomycin (100), gentamycin
(120), sulfamethoxazole (23.75), trimethoprim (1.25),
sulfamethoxazole/trimethoprim (23.75/1.25) Suscep-
tibility to antimicrobials was recorded after 24 h of
incubation and measuring the mean inhibition zone
diameter.
16S rRNA gene based phylogeny and multilocus
sequence analysis
Genomic DNA was isolated following the standard
protocol in Sambrook and Russell (2001) and used for
amplification of rRNAs and protein coding genes.
Amplification, sequencing and secondary structure
based analysis of 16S rRNA were performed as
described by Poddar et al. (2014) where the 16S
rRNA of Esherichia coli (accession no J01695) was
used as the reference secondary structure template.
The primer and PCR conditions for amplification of
16S rRNA were adapted from de la Haba et al.
(2010a). Phylogenetic trees were constructed using the
neighbour joining (NJ), maximum likelihood (ML)
and maximum parsimony (MP) algorithms imple-
mented in MEGA 5 and significance of branch points
was calculated by 1000 bootstrap re-samplings of the
data (Felsenstein 1985). Furthermore, intragenus (be-
tween S4-41T and the members of the genus Salinico-
la) and intergeneric (among the genera Salinicola,
Chromohalobacter, Kushneria and Cobetia) 16S
rRNA signatures were determined based on reference
base position and helix numbering according to E. coli
16S rRNA template information obtained from the
Comparative RNA Website (www.rna.icmb.utexas.
edu) (Cannone et al. 2002).
Similarly, 23S rRNA and other protein coding
genes of S4-41T were amplified following a protocol
described earlier (de la Haba et al. 2012) except genus
specific conserved primers were designed for rpoD,
gyrB and atpA genes to obtain amplicons for S.
acroporiae S4-41T, S. socius DSM 19940T and S.
peritrichatus JCM 18795T. The amplicons were gel
purified using a NucleoSpin Gel & PCR Clean-up kit
(Macherey–Nagel, Germany) and sequenced using an
eight capillary DNA analyser (model number 3500,
Applied Biosystems) following the sequencing proto-
col of the manufacturer. Accession numbers for the
genes and the sequences of primers used for different
phylogenetic studies are presented in Tables S1 and 1
respectively. The nucleotide sequences were com-
pared with those in GenBank using the nucleotide
BLAST algorithm (Altschul et al. 1997) searching the
nucleotide collection (nr/nt) database and optimized
for highly similar sequences (megablast). Sequences
were aligned using the default parameters of the
Clustal program of MEGA5 (Tamura et al. 2011),
refined manually and trimmed to a common length.
Pair-wise similarities for each gene of S4-41T and the
type strains of the genus Salinicola were determined
by using the ClustalW2 score matrix. Multilocus gene
sequence based phylogeny was prepared using
SplitsTree (version 4.13.1) (Huson and Bryant 2006)
following Split Decomposition Analysis with a neigh-
bour net drawing and Jukes-Cantor correction.
DNA G?C content and DNA–DNA hybridization
studies
The DNA G?C content of strain S4-41T was deter-
mined by a reverse phase HPLC method. For this,
123
 Antonie van Leeuwenhoek

Table 1 Primers used for amplification and sequencing of different genes in this study
Gene Primer name Sequence Used for Strains Ref

16S 16F27 AGAGTTTGATCMTGGCTCAG Amplification S. acroporae S4-41T de la Haba

16R1488 CGGTTACCTTGTTAGGACTTCACC and et al.
sequencing (2010a)
gyrB gyrB216F GARGTBATCATGACSGTGCT Amplification S. acroporae S4-41T, S. de la Haba
gyrB1419R GCRTCSGTCATGATGATSAY and peritrichatus JCM 18795T et al.
sequencing (2012)
secA secA555F CTACCTGCGCGACAAYATGG Amplification S. acroporae S4-41T, S. de la Haba
secA1131R ACAGGCGGAARTARTTCTGG and peritrichatus JCM 18795T et al.
sequencing (2012)
23S 23SppioFw TTSGGGTTATAKGGTCAAG Amplification de la Haba
985R CCGGTCCTCTCGTACT et al.
(2010a)
992IRry97 TTCCCTCACRGTACT Sequencing S. acroporae S4-41T, S.
1020IRrmz98 TCTGGGYTGTTYCCCT peritrichatus JCM 18795T
1018Fw GGGGGTAGAGCACTGTTT
1037IRrm97 CTTACCCGACAAGGAATTTCG
1027VIR AAACCGACACAGGTRG
328IRvm97 TCCTAAGGTAGCGAAATTCCTTG
1042GPHI GTTTGGCACCTCGATGTCGRCTC
Sp 23S-1F GAGTGAAATAGATCCTGAAAC Sequencing S. peritrichatus JCM 18795T This study
Sp23S-1R TTA AGCTCGCCACTGAATATA
Sp23S-2F GTTACCAACCCGAGGCAAACT
Sp23S-2R TGTCAGCATTCGCACTCGTGA
Sp23S-3F CTATCTGCCGTGGGCGTTGGA
Sp23S-3R AGTACACGTTAGCTCAACGCC
gyrB gyrB salF GTCTCGGTGGTCAACGC Amplification S. socius DSM 19940T This study
gyrB salR GTAGAGCTCGGAGAGGC and
sequencing
atpA atpA SalF ATCATTGGTGACCGCCAGAT Amplification S. acroporae S4-41T; S. This study
atpA SalR GGAACGAACGCGGAGACG and peritrichatus JCM 18795T
sequencing
rpoD rpoD SalF TACATGCGCGAGATGGG Amplification S. acroporae S4-41T; S. socius This study
rpoD SalR ATCGCCTGACGAATCCACCA and DSM 19940T; S. peritrichatus
sequencing JCM 18795T

DNA was degraded enzymatically into nucleosides as
described by Mesbah et al. (1989). The obtained
nucleoside mixture was then separated by HPLC
(Shimadzu) using an analytical column (Kinetex XB-
C18, 2.6 lm, 100 9 4.6 mm) equipped with a C18
guard column. Non-methylated lambda phage DNA
(Sigma) and three DNAs with known genome se-
quences (Bacillus subtilis DSM 402T, Xanthomonas
campestris pv. campestris DSM 3586T and Strepto-
myces violaceoruber DSM 40783T) were used as
calibration references.
For species delineation, dot blot DNA–DNA
hybridisation was performed with 40 ng of high
quality DNA samples per dot (A260/A280 = 1.8–2.0)
on Hybond-N? nylon membrane (GE Healthcare)
following the standard procedure of high stringency
hybridisation (65 °C) described by Sambrook and
Russell (2001). The DNA probe for each strain was
labeled with [a-32P]-CTP (BRIT) using the NEBlot-
kit (New England Biolabs). Autoradiographs were
digitized and densitometric analysis was performed
using ImageLab 5.1 (BioRad) implemented with

123
Antonie van Leeuwenhoek
ChemiDoc XRS ? system (BioRad). Experiments
were performed in duplicate and mean ± variance
hybridisation values were considered.
Fatty acid, polar lipids and quinone analysis
The cellular fatty acids of strain S4-41T and related
type strains were analysed simultaneously from
stationary phase cells grown on MA plates at 30 °C
for 3 days. Preparation of fatty acid methyl esters, gas
chromatographic separation, analysis and identifica-
tion of peaks were performed by a method described
earlier (Kumari et al. 2014b). Polar lipids were
extracted from 200 mg freeze dried cells following
the method described by Bligh and Dyer (1959),
separated by two dimensional TLC on silica gel 60
F254 plate (Merck, Germany) and analyzed by spray-
ing with appropriate solvents (Poddar et al. 2014).
Solvent systems used in this study were taken from
Kumari et al. (2014a). Quinones were extracted from
200 mg freeze dried cells (Hiraishi et al. 1992) and
analyzed by TLC on cellulose plates (Merck, Ger-
many) using n-hexane: methanol (9:1, v/v) as solvent.
The UV absorbing (254 nm) band was recovered from
the plate, dissolved in methanol and further analysed
by reverse phase HPLC (Waters) using methanol:
isopropanol (60:40, v/v) as eluant at a flow rate of
1 ml/min and quinones were detected at 269 nm.
Results and discussion
Morphological and phenotypic properties
Strain S4-41T was observed to be non-sporulating,
Gram negative, aerobic, motile, short rods of width
0.3–0.6 lm and length 1.0–1.4 lm. The strain was
observed to form cream, circular colonies having
diameters of 0.5- 1 mm after 2 day of incubation at
30 °C. Strain S4-41T cannot grow at 10 °C and above
pH 9.0. The strain was found to be negative for nitrate
reduction, Voges Proskauer test, indole production and
a-glucosidase activity. Strain S4-41T is positive for
oxidase, esterase (C 4), esterase lipase (C 8) and lipase
(C 14) activities. The strain was found to be susceptible
to (lg/disc) erythromycin (15), nalidixic acid (30),
kanamycin (30), streptomycin (10), spectinomycin
(100) and sulfamethoxazole/trimethoprim (23.75/
1.25), whereas the reference strains showed differential
responses. Discrimination between strain S4-41T and
other type strains of the genus Salinicola can be
achieved based on differentiating physiological and
phenotypic characteristics listed in Table 2. However,
all strains shared many phenotypic similarities suggest-
ing their relatedness and placement in a single genus.
Phenotypic similarities among strain S4-41T and the
members of the genus Salinicola are listed in Table S2.
Analysis of 16S rRNA gene and determination
of genus specific signatures
Analysis of the phylogeny of the family Halomon-
adaceae has been largely focused on the analysis of
16S rRNA gene sequences following their clustering
in NJ, MP and ML trees and determination of 19
family specific 16S rRNA signatures i.e. 18 residues
and one 6 bp stem (position 76–93) located in the 16S
rRNA primary structure (Arahal et al. 2002; Dobson
and Franzmann 1996). In this study, we have deter-
mined the position of signature residues in the 16S
rRNA secondary structure to provide greater phylo-
genetic insight. Out of 18 signatures, six residues were
unpaired and occupied non-helix regions and 12
residues were base-paired and distributed in different
helices (Table S3). A majority of the signatures were
confined in helix 1399 that may indicate some
evolutionary significance of this helix for this family.
Interestingly, for position 76–93, the genus Salinicola
contained a genus specific signature and hence
differed significantly from other genera of this family.
Based on our observation, we propose the members of
the family Halomonadaceae to contain the18 signa-
ture bases in their 16S rRNA gene primary structure
described earlier or 15 signature positions in their 16S
rRNA gene secondary structure. Furthermore, the
members of the genera Salinicola, Chromohalobacter,
Kushneria and Cobetia contain genus specific 16S
rRNA gene signatures distributed either unpaired or in
different helices. The members of the genus Salinico-
la, Chromohalobacter, Kushneria and Cobetia can be
defined based on 31, 23, 26 and 28 signature locations
respectively (Table 3). Such genus specific 16S rRNA
signatures will aid the taxonomic placement of
new species in their respective genus. However 16S
rRNA signatures for the monospecific genera Aidingi-
monas, Carnimonas, Halotalea, Modicisalibacter,
123
 Antonie van Leeuwenhoek

Table 2 Characteristics features that differentiate Salinicola acroporae S4-41T from type strains of the genus Salinicola. All data
were obtained in this study unless indicated
Characteristics 1 2 3 4 5

Growth characteristics
At 10 °C - ? ? - ?
At 45 °C ? ? ? ? -
Above pH 9 - ? - - -
At 0 % NaCl ? ? ? - ?
At 25 % NaCl ? ? ? ? -
NaCl optimum 5–10 10–20 3–10 7.5–10 0.5–2
(%)
Biochemical tests (classical, API 20E, API 20NE)
Nitrate reduction - ? - ? ?
Oxidase ? ? - - -
Indole - - - - ?
production
Methyl red ? ? ? ? -
Voges Proskauer - ? - - ?
Enzymatic activity (API ZYM)
Esterase (C 4) 1 - 1 1 1
Esterase lipase 1 - 1 - 1
(C 8)
Lipase (C 14) 1 - - - -
a-Glucosidase - - - - 1
Acid production from (classical, API 50CH)
L-rhamnose - 1 - 1 1
D-mannitol 1 1 1 - -
Gentibiose - - 1 1 -
D-trehalose 1 1 - - 1
Hydrolysis of
Starch - - ? ? -
Tween 20 - - - ? ?
Tween 80 - - ? - -
Ubiquinone Q9 Q9 (major), Q8 Q9*2 Q9 (major), Q10, Q8 Q9*4
(minor)*1 (minor)*3
Polar lipids PG, PE,DPG, AL1- PG, PE,DPG, AL1- PG, PE, DPG, AL1- PG, PE,DPG, AL1-4, PG, PE,DPG, AL1-
6, L1-4 4, L1-3 3, L1-6 L1-5 4, L1-4
G?C content 63.6 58.8*1 63*2 63.6*3 59.6*4
(mol%)
Strains 1 Salinicola acroporae S4-41T; 2 Salinicola salarius DSM 18044T; 3 Salinicola socius DSM 19940T; 4 Salinicola halophilus
LMG 23626T; 5 Salinicola peritrichatus JCM 18795T
Data from *1Kim et al. 2007; *2Anańina et al. 2007; *3Aguilera et al. 2007; *4Huo et al. 2013
- negative, ? positive, R resistant, S sensitive, PG phosphatidylglycerol, DPG diphosphatidylglycerol, PE
phosphatidylethanolamine, AL aminolipid, L unknown lipid

Zymobacter were not identifiable; However, with Pair-wise 16S rRNA sequence similarity using a
increase in number of species in these genera, such global alignment algorithm (Myers and Miller 1988)
signatures may be identified later. implemented at the EzTaxon server (http://www.

123
Antonie van Leeuwenhoek

Table 3 16S rRNA signatures specific for the genus Salinicola, Chromohalobacter, Kushneria and Cobetia
Helix Position Salinicola Chromohalobacter Kushneria Cobetia

61 48 – – – U
70–98 CG – – –
74–96 AU – – –
75–95 CG – – –
79–90 GC – – –
76–93 GU – – –
72 G – – –
150 – – – C
122 126–235 – – GC GC
141–222 – CG – –
155–166 – – CG –
198 200–217 GC GC AU –
205 – C A –
240 – – U –
264 C – – –
278 G – – –
279 A – – –
316 317–336 UA – – –
369 379–384 CG CG – –
406 419–424 UG UG CG –
441 445–489 – – GC –
460–472 – CG – G(C/U)
462–470 – – – AU
453 A – G –
480 – C G –
546 G – –
576 – – G –
577 586–755 UA – – UA
588 591–648 – – – AU
592–647 – – – AU
593–646 GC UG – GC
596–644 CG CG –
602–636 – GU – GU
615–625 – – GC –
595 – – – C
647 – – – U
648 – – – U
655 662–743 GC – – –
821 824–876 AU
827 U U C
829 838–848 AA – CG –
839–847 CG CG – –
841 U – – –
843 U – – –
844 A – – –
834–852 – – CG –

123
 Antonie van Leeuwenhoek

Table 3 continued
Helix Position Salinicola Chromohalobacter Kushneria Cobetia

885 895–904 – GC –
984 987–1218 – – GC
989–1216 – CG –
996 1000–1040 – UA – AU
1002–1038 – – – AU
1004 – – – G
1006 1006–1023 – – UA
1008–1021 – CG –
1009–1020 – GC –
1010–1019 – GC –
1011–1018 – AU –
1020 A
1025 1025–1036 – UG –
1113 1115–1185 – – CG CG
1118 1121–1152 – – CG UA
1134–1140 – – GC
1136 A U C A
1137 – – – A
1138 – – – U
1241 1242–1295 GC – GC –
1243–1194 CG – CG
1244–1293 – – – AU
1245–1292 – – – AU
1260 – – – A
1262 – A A U
1274 G A A –
1278 G – C –
1303 1308–1329 – – – UA
1350 1356–1366 AU CG – –

– No signature present

ezbiocloud.net/eztaxon) (Kim et al. 2012) revealed
that strain S4-41T showed 99 % similarity with S.
salarius M27T, 98.6 % with S. socius SMB35T, 98 %
with S. halophilus CG4.1T and 97.2 % with S. per-
itrichatus DY22T. The 16S rRNA gene sequence
contains 16S rRNA signatures identical to those of the
members of the genus Salinicola (Table 3), confirm-
ing it to be a member of this genus, although in-
traspecies separation was confirmed by 48 species
specific signatures (Table S4). Helix 441 contained
more than an average number of variations (seven out
of 48 signatures) indicating hypervariability of the
helix. In the phylogenetic tree, strain S4-41T also
clustered in the radiation of the genus Salinicola but
distinctly separated from a cluster formed by S. sal-
arius M27T and S. socius SMB35T with 100 % boot-
strap confidence (Fig. 1). Trees prepared with the NJ
and ML algorithms were found to be nearly identical
although the ML tree has topological variations, an
observation which is in good agreement with the re-
sults of de la Haba et al. (2012).
Multilocus gene sequence analysis
The nearly full length 23S rRNA has been considered
as a good tool for taxonomic resolution in phylogenetic

123
Antonie van Leeuwenhoek

Fig. 1 16S rRNA based

neighbour-joining
phylogenetic tree showing
the phylogenetic
relationship of the strain S4-
41T with other related
Halomonadaceae taxa.
Bootstrap values expressed
as percentages of 1000
replications are given at
branch points. Accession
numbers are given in
parentheses. Bar 1
substitution per 100
nucleotide position. Filled
triangle branches were
recovered in Maximum
Likelihood tree; filled circle
branches were recovered in
Maximum Parsimony tree

studies of this family (Arahal et al. 2002; de la Haba
et al. 2010a) and has been used as a source of
supplementary phylogenetic information to the 16S
rRNA gene. More recently, de la Haba et al. (2012)
have proposed inclusion of the multilocus sequence
analysis methodology for taxonomic delineation of
members of the family Halomonadaceae by incorpo-
rating sequences of four protein coding genes in
addition to 16S and 23S rRNA genes allowing robust
phylogenetic study with enhanced resolution. We have
analysed the genus Salinicola following multilocus
sequence analysis and tested phylogenetic resolution
using split decomposition analysis of different gene
combinations. However, using the primer pairs pro-
posed by de la Haba et al. (2012) for the amplification
of housekeeping genes rpoD, gyrB and atpA, no
amplicons were obtained for S. acroporiae S4-41T, S.
socius DSM 19940T and S. peritrichatus JCM 18795T
which necessitated the design of genus specific con-
served primers (Table 1). A similar observation was
made by de la Haba et al. (2012) when the authors
failed to detect rpoD and gyrB genes in S. socius DSM

123

Fig. 2 Split tree based on concatenated sequences of rRNAs (16S and 23S) and four protein coding housekeeping genes
19940T. With the newly synthesized primers, ampli-
cons of sizes varying between 552–831, 564–771, and
480 bp were obtained for rpoD, gyrB, atpA genes
respectively. For the genera Salinicola, Kushneria and
Chromohalobacter, split tree topologies prepared with
either the six gene concatenation (Fig. 2) or with four
protein coding genes only (Fig. 3) remained nearly
unaffected indicating these genetic markers have little
significance for the phylogeny of these genera. How-
ever, for the genus Halomonas, the split tree generated
through six gene concatenations has significant resolu-
tion especially for delineation of Halomonas rRNA
group 1 from the ungrouped Halomonas (Fig. 2).
Halomonas rRNA group 2 is a phylogenetically
distinct cluster but the rRNA group 1 was found to
123
Antonie van Leeuwenhoek
have a significant genetic link with ungrouped
Halomonas and separated later in the phylogeny by
forming a closed cluster. Such resolution was not found
in the split tree generated with four protein coding
genes only and hence supports the concept of using the
six gene multilocus sequence analysis.
In the phylogenetic group of Salinicola, strain
S4-41T is clearly separated from a cluster composed of
S. salarius M27T and S. socius SMB35T and is
distantly related to S. peritrichatus DY22T and S.
halophilus CG4.1T. This confirms that in the genus
Salinicola, strain S4-41T has emerged from a lineage
that has later separated into two branches, one
occupied by S4-41T and another one composed of S.
salarius M27T and S. socius SMB35T. Both Figs. 2
Antonie van Leeuwenhoek
Fig. 3 Split tree based on concatenated sequences of four protein coding housekeeping genes
and 3 support this hypothesis and confirm that strain
S4-41T represents a novel species of this genus.
Based on multilocus gene sequence analysis, the
intragenus similarity varies between 93 and 97 %
(Table S5) and strain S4-41T is most closely related to
S. salarius M27T with 96 % similarity. Similarly,
based on partial shared lengths of 23S (2499 bp), atpA
(369 bp), gyrB (471 bp), rpoD (288 bp), secA
(540 bp) gene sequences, the intragenus similarity
varies between 95–99, 90–96, 86–93, 80–90 and
82–90 % respectively (Table S5). The intrageneric
and intergeneric similarity (%) is in good agreement
with the data presented by de la Haba et al. (2012).
Based on 23S rRNA gene sequence analysis, S4-41T
was found to be closely related to S. salarius M27T,
having 99.20 % similarity. Based on the atpA (369 bp)
and secA (540 bp) gene sequences, S4-41T is closely
related to S. socius SMB35T having 93.77 and
89.26 % similarity respectively. For the gyrB
(471 bp) and rpoD (288 bp) gene sequences, S.
peritrichatus DY22T was found to be the closest
relative of strain S4-41T, having 90.23 and 86.11 %
similarity respectively.
DNA G?C content and DNA–DNA hybridization
study
The G?C content of the genus Salinicola has been
reported to range between 58 and 64 mol% (Table 2).
Strain S4-41T has a G?C content of 63.6 mol%, a
123
 Antonie van Leeuwenhoek

value close to the G?C value of S. halophilus LMG Table 4 Fatty acid profiles of Salinicola acroporae strain
23626T and S. socius DSM 19940T but higher that the S4-41T and the type strains of the genus Salinicola
G?C value of S. salarius DSM 18044T and S. Peak name 1 2 3 4 5
peritrichatus JCM 18795T.
Using DNA of strain S4-41T as labeled probe, the C10:0 – 1.1 tr 1.2 tr
mean DNA–DNA hybridization values were 30 ± C12:0 4.4 1.8 2.8 3.1 3.1
6 % with S. salarius DSM 18044T, 35 ± 1 % with S. C14:0 8.6 tr tr 1.1 tr
halophilus LMG 23626T, 25 ± 3 % with S. per- C16:0 35.4 26.1 23.9 21.2 21.6
itrichatus JCM 18795T and 19 ± 5 % with S. socius C17:0 1.1 tr tr tr tr
DSM 19940T. These hybridization values are sig- C18:0 tr 1.2 tr 3.9 1.3
nificantly lower than 70 %, the recommended value Iso-C15:0 tr tr – 1.0 tr
for bacterial species delineation (Wayne et al. 1987), Iso-C16:0 – tr 1.9 tr tr
suggesting S4-41T should be considered a novel Anteiso-C14:0 tr tr tr 1.7 tr
member of the genus Salinicola. Anteiso-C15:0 tr tr tr 2.5 tr
Anteiso-C17:0 tr tr tr 1.3 tr
Chemotaxonomic analysis C12:0 2OH – 1.5 2.1 1.7 1.3
C12:0 3OH tr 5.6 8.0 5.4 8.0
Comparative analysis of fatty acids among strain S4- C14:0 3OH/isoI-C16:1 7.0 – 2.4 1.8 tr
41T and type strains of the genus Salinicola are C14:1 x5c – tr – 1.1 –
presented in Table 4. All strains consistently contain C16:1 x7c/C16:1 x6c 2.5 1.3 3.1 5.6 3.1
C12:0, C16:0, C16:1 x7c/C16:1 x6c, C18:1x7c, cyclo- C18:1 x7c 1.7 5.0 17.1 22.5 10.8
C19:0x8c indicating that these fatty acids may be C18:1 x9c tr – – 1.1 Tr
considered as signature fatty acids for the genus C18:1 x7c 11-methyl tr tr tr 1.4 Tr
Salinicola. Compared to other type strains of the genus C19:1 x6c/x7c/19cy – tr 1.4 Tr tr
Salinicola, strain S4-41T contained lower amounts of C20:2 x6,9c tr tr tr 1.4 tr
C18:1 x7c and cyclo-C19:0x8c and higher amounts of Cyclo-C17:0 24.4 5.8 6.6 tr 8.4
C14:0, C14:0 3OH/isoI-C16:1 and cyclo-C17:0. More- Cyclo-C19:0 x8c 6.1 42.7 23.8 10.3 33.4
over, strain S4-41T contained no C12:0 2OH, which Cyclo-C19:0 x10c – – 1.4 – –
was consistently found to be present in the other C12:0 aldehyde 7.0 tr 2.4 1.8 tr
species. Q-9 was found to be the major respiratory
Fatty acids were extracted from stationary phase cells grown
quinone for the members of the genus Salinicola on marine agar at 30 °C for 3 days. All data in the table are
(Table 2). Strain S4-41T was found to contain Q-9 as from the present study. Fatty acids amounting to less than
sole respiratory quinone and so differed from S. 0.5 % of the total fatty acids not mentioned in this table
salarius M27T and S. halophilus CG4.1T that con- Strains 1 Salinicola acroporae S4-41T; 2 Salinicola salarius
tained Q-8 and Q-8, Q-10 respectively as minor DSM 18044T; 3 Salinicola socius DSM 19940T; 4 Salinicola
halophilus LMG 23626T; 5 Salinicola peritrichatus JCM
quinones.
18795T
Phosphatidylglycerol, diphosphatidylgylcerol and
tr trace (\1 %), – not detected
phosphatidylethanolamine were identified as the ma-
jor polar lipids of the members of the genus Salinicola
(Fig. 4). In addition, several unidentified aminolipids Conclusion
and unidentified lipids were found to vary among the
different species of the genus Salinicola. Hence, polar For the genera Salinicola, Chromohalobacter and
lipid profiles can be used as a taxonomic tool for the Kushneria, 16S rRNA gene based phylogenetic
separation of species of the genus Salinicola. The analysis has significant taxonomic resolution. The
distribution and number of unidentified aminolipids in description of intragenus and intergenus 16S rRNA
S4-41T was observed to be different from those of signatures is helpful and provides phylogenetic insight
other type strains, consistent with the conclusion that for the description of species of these genera.
the strain represents a novel species of the genus Multilocus sequence analysis has the potential of
Salinicola. addressing intragenus heterogeneity as evidenced

123
Antonie van Leeuwenhoek
Fig. 4 Polar lipid profile of
strain S4-41T and type
strains of the genus
Salinicola
from the study of the genus Halomonas, yet it is not a
requirement for the genus Salinicola considering the
lower number of species. With the incorporation of
more new species in this family, it will likely become
essential to consider such multilocus sequence analy-
sis for robust taxonomic investigations. Polar lipid
profiles were found to be is a good taxonomic tool for
species discrimination for the genus Salinicola.
Strain S4-41T has some phenotypic characteristics,
G?C content and 16S rRNA signatures identical to
those of the members of the genus Salinicola.
However, it is phylogenetically distinct from the type
species of the genus Salinicola as supported by species
specific 16S rRNA signatures and extensive multilo-
cus sequence analysis data. Combined with these,
phenotypic variations, polar lipids and fatty acid
composition, low level of genetic relatedness as
evidenced from DNA–DNA hybridization results all
strongly support the proposal of a novel species of the
genus Salinicola for which the name Salinicola
acroporae sp. nov. is proposed.
Description of Salinicola acroporae sp. nov
Salinicola acroporae (acro’po.rae. N.L. gen. n.
acroporae of Acropora, referring to the isolation of
the type strain from the coral A. digitifera).
Cells are Gram negative, non-sporulating, motile,
short rods of size 0.3–0.6 lm 9 1.0–1.4 lm and
occur singly or in pairs. Does not grow anaerobically.
On marine agar, forms cream circular colonies of
diameter 0.5–1 mm after 2 days at 30 °C.
Heterotrophic growth occurs at 15–45 °C and pH
4.5–9. Grows in the presence of 0–25 % NaCl.
Optimum growth occurs in 5–10 % NaCl at 30 °C
and pH 5–6. Oxidase and catalase tests are positive but
negative for o-nitrophenyl-b-D-galactopyranosidase,
arginine dihydrolase, ornithine decarboxylase, lysine
decarboxylase, tryptophan deaminase, phenylalanime
demaminase and nitrate reductase activity. Positive for
methyl red test and hydrolysis of DNA and negative
for Voges–Proskauer test, H2S production and hy-
drolysis of gelatin, urea, esculin, starch, Tween 20,
Tween 40, Tween 80. As sole source of carbon and
energy, positive for utilisation and acid production
from D-glucose, citrate, D-melibiose, amygdalin, L-
arabinose, D-mannose, D-mannitol, potassium glu-
conate, malic acid, trisodium citrate, phenylacetic
acid and negative for utilisation and acid production
from inositol, D-sorbitol, D-saccharose. In APIZYM
test, positive for activity of alkaline phosphatase,
leucine arylamidase, valine arylamidase, acid phos-
phatase, napthol-AS-BI-phosphohydrolase, esterase
(C 4), esterase Lipase (C 8), Lipase (C 14) and
negative for a-glucosidase, cystine arylamidase,
123

trypsin, a-chymotrypsin, a-galactosidase, b-galactosi-
dase, b-glucuronidase, b-glucosidase, N-acetyl-b-glu-
cosaminidase, a-mannosidase and a-fucosidase
activity. In API 50CH tests, acid is produced from
glycerol, erythritol, D-arabinose, L-arabinose, D-ribose,
D-xylose, D-galactose, D-glucose, D-fructose, D-man-
nose, D-mannitol, D-cellobiose, D-maltose, D-lactose,
D-melibiose, D-trehalose, D-lyxose, D-fucose and D-
arabitol and negative for acid production from L-
xylose, D-adonitol, methyl-b-D-xylopyranoside, L-sor-
bose, L-rhamnose, dulcitol, inositol, D-sorbitol,
methyl-a-D-mannopyranoside, methyl-a-D-glucopy-
ranoside, N-acetylglucosamine, amygdalin, arbutin,
esculin, salicin, D-sucrose, inulin, D-melezitose, D-
raffinose, starch, glycogen, xylitol, gentiobiose, D-
turanose, D-tagatose, L-fucose, L-arabitol, potassium
gluconate, potassium 2-ketogluconate, potassium
5-ketogluconate. In Biology GNII microplates, posi-
tive for oxidation of a-cyclodextrin, dextrin, glycogen,
N-acetyl-D-galactosamine, N-acetyl-D-glucosamine,
adonitol, D-arabitol, D-cellobiose, i-erythritol, a-D-
glucose, L-fucose, D-galactose, D-fructose, a-D-lactose,
lactulose, maltose, D-mannitol, D-mannose, D-meli-
biose, b-methyl-D-glucoside, D-psicose, sucrose, D-
trehalose, xylitol, mono-methyl-succinate, acetic acid,
cis-aconitic acid, citric acid, formic acid, D-galactonic
acid lactone, D-galacturonic acid, D-gluconic acid, D-
glucosaminic acid, D-glucuronic acid, b-hydroxy bu-
tyric acid, c-hydroxy butyric acid, itaconic acid, a-
keto glutaric acid, D,L-lactic acid, malonic acid, quinic
acid, D-saccharic acid, succinic acid, bromo succinic
acid, succinamic acid, glucuronamide, L-alaninamide,
D-alanine, L-alanine, L-alanyl-glycine, L-asparagine, L-
aspartic acid, L-glutamic acid, glycyl-L-aspartic acid,
L-serine, L-leucine, L-ornithine, L-phenylalanine, L-
proline, L-pyroglutamic acid, glycyl-L-glutamic acid,
c-amino butyric acid, urocanic acid, inosine, uridine,
thymidine, putrescine,2,3-butanediol, glycerol, D,L-a–
glycerol phosphate, glucose-6-phosphate and negative
for oxidation of Tween 40, Tween 80, L-arabinose,
gentiobiose, m-inositol, D-raffinose, L-rhamnose, D-
sorbitol, turanose, methyl pyruvate, a-hydroxy butyric
acid, p-hydroxy phenylacetic acid, a-keto butyric acid,
a-keto valeric acid, propionic acid, sebacic acid, L-
histidine, hydroxy-L-proline, L-threonine, D-serine,
D,L-carnitine, phenyethylamine, 2-aminoethanol and
glucose-1-phosphate. The predominant fatty acids
include C16:0, C14:0, cyclo-C17:0, C14:03OH/isoI-
C16:1, C12:0 aldehyde, cyclo-C19:0x8c, C12:0,
123
Antonie van Leeuwenhoek
C16:1x7c/C16:1 x6c, C18:1x7c and C17:0. The iso-
prenoid ubiquinone is Q-9. Polar lipids include
phosphatidylglycerol, diphosphatidylglycerol, phos-
phatidylethanolamine, six unidentified aminolipids
and four unidentified lipids. The DNA G?C content
of the type strain is 63.6 mol% (HPLC method).
The type strain, S4-41T (=JCM 30412T = LMG
28587T) was isolated from mucus of coral A. digitifera
from Andaman Sea. The GenBank/EMBL/DDBJ
accession numbers for the 16S rRNA, 23S rRNA,
atpA, gyrB, rpoD and secA genes of strain S4-41T are
KM200719, KP241690, KM280699, KM280696,
KM280706 and KM280701, respectively.
Acknowledgments We are thankful to Prof. B. Schink
(Universitaet Konstanz, Germany) for etymological advice.
We are grateful to Chief Conservator of Forests (Wild life),
Andaman and Nicobar Islands, Port Blair officially allowing us
to collect samples from the Andaman Sea. This work was
supported by the funding received from Ministry of Earth
Sciences, Government of India (MoES/11-MRDF/1/59/P/08) to
SKD. DNA sequencing was performed by core sequencing
facility at ILS. The authors, RL and AP acknowledge the
Department of Biotechnology, and Council of Scientific and
Industrial Research (CSIR), Government of India, New Delhi,
respectively for providing the research fellowship.
References
Aguilera M, Cabrera A, Incerti C, Fuentes S, Russell NJ,
Ramos-Cormenzana A, Monteoliva-Sánchez M (2007)
Chromohalobacter salaries sp. nov, moderately halophilic
bacterium isolated from a solar saltern in Cabo deGata,
Almeria, southern Spain. Int J Syst Evol Microbiol
57:1238–1242
Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z,
Miller W, Lipman DJ (1997) Gapped BLAST and PSI-
BLAST: a new generation of protein database search pro-
grams. Nucleic Acids Res 25:3389–3402
Anańina LN, Plotnikova EG, Gavrish E, Demakov VA, Ev-
tushenko LI (2007) Salinicola socius gen. nov., sp. nov., a
moderately halophilic bacterium from a naphthalene-uti-
lizing microbial association. Microbiology 76:324–330
Arahal DR, Ludwig W, Schleifer KH, Ventosa A (2002) Phy-
logeny of the family Halomonadaceae based on 23S and
16S rDNA sequence analyses. Int J Syst Evol Microbiol
52:241–249
Arahal DR, Vreeland RH, Litchfield CD, Mormile MR, Tindall
BJ, Oren A, Bejar V, Quesada E, Ventosa A (2007) Rec-
ommended minimal standards for describing new taxa of
the family Halomonadaceae. Int J Syst Evol Microbiol
57:2436–2446
Bligh EG, Dyer WJ (1959) A rapid method of total lipid ex-
traction and purification. Can J Biochem Physiol
37:911–917
Antonie van Leeuwenhoek
Cannone JJ, Subramanian S, Schnare MN, Collett JR, D’Souza
LM, Du Y, Feng B, Lin N, Madabusi LV, Müller KM,
Pande N, Shang Z, Yu N, Gutell RR (2002) The com-
parative RNA web (CRW) site: an online database of
comparative sequence and structure information for ribo-
somal, intron, and other RNAs. BMC Bioinform 3:2
de la Haba RR, Arahal DR, Márquez MC, Ventosa A (2010a)
Phylogenetic relationships within the family Halomon-
adaceae based on comparative 23S and 16S rRNA gene
sequence analysis. Int J Syst Evol Microbiol 60:737–748
de la Haba RR, Sánchez-Porro C, Márquez MC, Ventosa A
(2010b) Taxonomic study of the genus Salinicola: transfer
of Halomonas salaria and Chromohalobacter salarius to
the genus Salinicola as Salinicola salarius comb. nov. and
Salinicola halophilus nom. nov., respectively. Int J Syst
Evol Microbiol 60:63–71
de la Haba RR, Márquez MC, Papke RT, Ventosa A (2012)
Multilocus sequence analysis of the family Halomon-
adaceae. Int J Syst Evol Microbiol 62:520–538
Dobson SJ, Franzmann PD (1996) Unification of the genera
Deleya (Baumann et al.1983), Halomonas (Vreeland et al.
1980), and Halovibrio (Fendrich 1988) and the species
Paracoccus halodenitrificans (Robinson and Gibbons
1952) into a single genus, Halomonas, and placement of
the genus Zymobacter in the family Halomonadaceae. Int J
Syst Bacteriol 46:550–558
Felsenstein J (1985) Confidence limits on phylogenies: an ap-
proach using the bootstrap. Evolution 39:83–791
Franzmann PD, Wehmeyer U, Stackerbrandt E (1988)
Halomonadaceae fam. nov., a new family of the class
Proteobacteria to accommodate the genera Halomonas
and Deleya. Syst Appl Microbiol 11:16–19
Hiraishi A, Shin YK, Sugiyama J (1992) Rapid profiling of
bacterial quinones by two-dimensional thin-layer chro-
matography. Lett Appl Microbiol 14:170–173
Huo YY, Meng FX, Xu L, Wang CS, Xu XW (2013) Salinicola
peritrichatus sp. nov., isolated from deep-sea sediment.
Antonie Van Leeuwenhoek 104:55–62
Huson DH, Bryant D (2006) Application of phylogenetic net-
works in evolutionary studies. Mol Biol Evol 23:254–267
Jiang J, Pan Y, Hu S, Zhang X, Hu B, Huang H, Hong S, Meng J,
Li C, Wang K (2014) Halomonas songnenensis sp. nov., a
moderately halophilic bacterium isolated from saline and
alkaline soils. Int J Syst Evol Microbiol 64:1662–1669
Kim KK, Jin L, Yang HC, Lee ST (2007) Halomonas gom-
seomensis sp. nov., Halomonas janggokensis sp. nov.,
Halomonas salaria sp. nov. and Halomonas denitrificans
sp. nov., moderately halophilic bacteria isolated from sal-
ine water. Int J Syst Evol Microbiol 57:675–681
Kim OS, Cho YJ, Lee K, Yoon SH, Kim M, Na H, Park SC, Jeon
YS, Lee JH, Yi H, Won S, Chun J (2012) Introducing
EzTaxon-e: a prokaryotic 16S rRNA gene sequence
database with phylotypes that represent uncultured species.
Int J Syst Evol Microbiol 62:716–721
Kumari P, Poddar A, Das SK (2014a) Marinomonas fungiae sp.
nov., isolated from the coral Fungia echinata from the
Andaman Sea. Int J Syst Evol Microbiol 64:487–494
Kumari P, Poddar A, Schumann P, Das SK (2014b) Vibrio
panuliri sp. nov., a marine bacterium isolated from spiny
lobster, Panulirus penicillatus and transfer of Vibrio pon-
ticus from Scophthalmi clade to the newly proposed Pon-
ticus clade. Res Microbiol 165:826–835
Mata JA, Martınez-Cánovas J, Quesada E, Béjar V (2002) A
detailed phenotypic characterisation of the type strains of
Halomonas species. Syst Appl Microbiol 25:360–375
Mellado E, Moore ERB, Nieto JJ, Ventosa A (1995) Phyloge-
netic inferences and taxonomic consequences of 16S ri-
bosomal DNA sequence comparison of Chromohalobacter
marismortui, Volcaniella eurihalina, and Deleya salina
and reclassification of V. eurihalina as Halomonas euri-
halina comb. nov. Int J Syst Bacteriol 45:712–716
Mesbah M, Premachandran U, Whitman WB (1989) Precise
measurement of the G?C content of deoxyribonucleic acid
by high performance liquid chromatography. Int J Syst
Bacteriol 39:159–167
Myers EW, Miller W (1988) Optimal alignments in linear space.
Comput Appl Biosci 4:11–17
Parte AC (2014) LPSN—list of prokaryotic names with standing
in nomenclature. Nucleic Acids Res 42(D1):D613–D616
Poddar A, Lepcha RT, Das SK (2014) Taxonomic study of the
genus Tepidiphilus: transfer of Petrobacter succinatiman-
dens to the genus Tepidiphilus as Tepidiphilus succinati-
mandens comb. nov., emended description of the genus
Tepidiphilus and description of Tepidiphilus thermophilus
sp. nov., isolated from a terrestrial hot spring. Int J Syst
Evol Microbiol 64:228–235
Sambrook J, Russell DW (2001) Molecular cloning: a labora-
tory manual, 3rd edn. Cold Spring Harbor Laboratory, Cold
Spring Harbor
Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S
(2011) MEGA 5: molecular evolutionary genetics analysis
using maximum likelihood, evolutionary distance, and
maximum parsimony methods. Mol Biol Evol
10:2731–2739
Ventosa A, Quesada E, Rodriguez-Valera F, Ruiz-Berraquero F,
Ramos-Cormenzana A (1982) Numerical taxonomy of
moderately halophilic Gram-negative rods. J Gen Micro-
biol 128:1959–1968
Wayne LG, Brenner DJ, Colwell RR, Grimont PAD, Kandler O,
Krichevsky MI, Moore LH, Moore WEC, Murray RGE,
Stackebrandt E, Starr MP, Truper HG (1987) International
Committee on Systematic Bacteriology. Report of the ad
hoc committee on reconciliation of approaches to bacterial
systematics. Int J Syst Bacteriol 37:463–464
123