Letters in Applied Microbiology 2000, 30, 375ÿ378

Secondary structure analysis of the dissimilatory sulphite

reductase in Desulfovibrio desulfuricans
R. Morse, G.R. Gibson and M.D. Collins
Department of Food Science and Technology, The University of Reading, Reading, UK

78/1/2000: received 4 January 2000 and accepted 28 January 2000

The complete sequences of the dsrA and dsrB

R . M O R S E , G . R . G I B S O N A N D M . D . C O L L I N S . 2000.
genes coding for the aÿ and bÿsubunits, respectively, of the sulphite reductase enzyme in
Desulfovibrio desulfuricans were determined. Analyses of the amino acid sequences indicated a
number of serohaem/Fe4S4 binding consensus sequences whilst predictive secondary structure
analysis revealed a similar pattern of aÿhelix and bÿstrand structures between the two
subunits which was indicative of gene duplication.

INTRODUCTION and sequenced the two genes (dsrA and dsrB) coding for the
aÿ and bÿsubunits of sulphite reductase.
Sulphite reductase catalyses the reduction of bisulphite to
sulphide and forms part of the dissimilatory sulphate reduc-
tion pathway. The enzyme from the sulphate-reducing bac- MATERIALS AND METHODS
teria (SRB) of the Desulfovibrio genus is a hexamer consisting
Desulfovibrio desulfuricans wild type strain Essex 6 (ATCC
of three di¡erent subunits (a2b2g2). Sulphate-reducing bac-
29577) was used in this study and cultured in lactate-sulphate
teria occur in the gut £ora of about 50 % of healthy persons
medium as previously described (Rapp and Wall 1987). DNA
where they metabolize H2 and low molecular weight organic
preparation, polymerase chain reaction (PCR), DNA
compounds (Gibson et al. 1991). The production of highly
sequencing and computational analysis were all carried out as
toxic sulphide from Desulfovibrio desulfuricans has been
previously described (Morse et al. 1996). Two primers
implicated in the onset of a chronic in£ammatory large bowel
(ATGGCNAAG/ACAC/TGCNACNCC and TAA/GCAG/
disease, ulcerative colitis (Babidge et al. 1998), patients with
ATTNCCA/GCAA/GTACATA/GCA) were used to gener-
this disease showing elevated levels of sulphide production
ate a PCR fragment that included parts of the dsrA and dsrB
and a universal carriage rate of SRB (Gibson et al. 1991).This
genes. The DNA sequence of this fragment was determined
species is also now being increasingly used for the removal of
and further primers were designed and used in inverse
sulphate and organic substances from industrial wastewater
PCR to generate fragments containing the 50 end of the
(Kosinska and Miskiewicz 1999) as well as for the selective
dsrA gene (CCNCCG/ATGC/TTTCCAG/ATGNGT and
removal of uranium contamination by reductive precipitation
CACCCGCACCATGTCCATCAC) and the 30 end of the
(Ganesh et al. 1999). Therefore, it would be desirable to be
dsrB gene (TTC/TTTNCCC/TTCC/TCCATCCACCA
able to both reduce and enhance the activity of this enzyme
and TGT/CATGTAT/CTGT/CGGNAAC/TTGT/CTA).
by biochemical and/or genetic means which require a
DNA sequencing was performed by using the dideoxynu-
detailed knowledge of the enzyme structure. However, only
cleotide chain termination method on both positive and
limited polypeptide sequences for the N-terminals of the aÿ
negative strands of each cloned PCR product. Four indepen-
and bÿsubunits of the sulphite reductase from this species
dent PCR products were sequenced for each gene to check
have been determined (Steuber et al. 1995) and even the cel-
Ampli2Taq (Perkin Elmer, Warrington, UK) polymerase
lular location of the enzyme complex is in doubt (Steuber
¢delity. The sequence data reported in this paper have been
et al. 1994; Molitor et al. 1998).Therefore, in the course of an
submitted to the EMBL/GenBank Libraries under the
investigation of dissimilatory sulphate reduction in D. desul-
accession number AJ249777.
furicans and its involvement in the aetiology and/or mainte-
nance of the debilitating ulcerative colitis, we have cloned
RESULTS AND DISCUSSION
The dsrA and dsrB genes code for proteins of molecular
Correspondence to: R. Morse, Department of Food Science and Technology,
weight 49 and 43  kDa, respectively, which are in approximate
The University of Reading, Whiteknights, PO Box 226, Reading RG6 6AP, agreement with previously determined values of 50 and 45  
UK (e-mail: r.morse@reading.ac.uk). kDa, respectively, for gel-puri¢ed subunits (Steuber et al.
= 2000 The Society for Applied Microbiology
376 R . M O R S E E T A L .

Fig.  1 Comparison of the amino acid sequences and secondary structures of the aÿ (Dda) and bÿ (Ddb) subunits of sulphite reductase
from Desulfovibrio desulfuricans. (a) Comparison of the amino acid sequences of the a- and b-subunits showing identical residues (H) and
those of comparison values of 0
5 and above (:) or of 0
1^0
5 (.). Gaps (-  -) have been introduced into the sequences to aid alignment.
Predictions for both a-helix (a) and b-strand (b) secondary structures are indicated above and below the sequences (ö) and are numbered to
highlight their duplication between the two subunits in a manner previously employed for the assimilatory sulphite reductase haemoprotein
from Escherichia coli (Crane et al.1995). (b) Schematic diagram showing the secondary structure predictions for the a- and b-subunits
arranged to highlight their duplication between the two subunits

1994). The deduced N-terminal sequence for the DsrA pro-
tein is in full accordance with that determined by N-terminal
polypeptide sequencing of puri¢ed DsrA protein although
the deduced N-terminal sequence of the DsrB protein
(AFISSGYNP) di¡ers from that determined by N-terminal
polypeptide sequencing (AFIPTGYNP) (Steuber et al.1995).
The sulphite reductase from D. desulfuricans is known to con-
tain 24  þ  3 Fe atoms and 18  þ  3 labile sulphide ions per hex-
amer (Steuber et al. 1995) in the form of sirohaem and iron^
= 2000 The Society for Applied Microbiology, Letters in Applied Microbiology, 30, 375ÿ378
sulphur clusters of the type Fe4S4, as found in other sulphite
reductases (Dahl et al. 1993). The aÿsubunit contains a
sequence (amino acids 177^225) matching the sirohaem-
binding consensus C-X5 -C-Xn -C-X3 -C (Dahl et al. 1993)
whilst an equivalent sequence in the b-subunit (145^193) has
the initial cysteine residue missing, indicating that only the
a-subunit may bind sirohaem (Fig. 1  a). Both subunits contain
close approximations (a, 220^236; b, 188^203) to the iron/
sulphur binding site consensus GC-X3 -C-X6 -D/E-L/I/V/

M/F-G/A/T-L/I/V/M/F (Prosite document PDOC00314;
Bairoch et al. 1997) with the initial G being replaced by a C in
DsvB whilst the second spacer in DsvA is X7 rather than X6.
The aÿsubunit contains an Fe4S4 binding site of consensus
CP-Xn -C-X2 -C-X2 -C (284^309) and the bÿsubunit one of
consensus C-X2 -C-X2 -C-X3 -CP (258^269) (Dahl et al.
1993).
The aÿ and bÿsubunits of the D. desulfuricans enzyme
show 20 % identity and 46% similarity with one another
(Fig. 1  a), indicating that gene duplication may have taken
place. Using the secondary structure prediction program
PHDsec (Rost and Sander 1993), this duplication was
re£ected in the alignment of aÿhelix and bÿstrand struc-
tures between the two subunits (Fig. 1  a) in the consensus
order b1a1b2a2a3b3b4b5b6a 4a5 (Fig. 1  b). Crystal structure
determination of the assimilatory sulphite reductase haemo-
protein of Escherichia coli also showed this twofold structural
symmetry which was thought to have arisen through the
fusion of two homologous proteins (Crane et al. 1995). The
two symmetry regions in this protein are separated by a linker
region (H5) that is thought to be a structural mimic for
ligand-bound serohaem and, as such, associates with siro-
haem-binding residues in the N-terminal half of the protein
(Crane et al. 1995). A sequence (342^346) matching the con-
sensus sequence of H5 (E/D-K/R-I-G-f, where f is an aro-
matic amino acid) is found in the DsrB protein from D.
desulfuricans indicating that only one sirohaem^Fe4S4 cluster
may actually be bound to each abÿdimer. It has been sug-
gested that the sulphite reductase from D. desulfuricans is a
membrane-rather than cytoplasmic-associated enzyme
(Steuber et al. 1994) although some doubt has been cast on
the puri¢cation procedure used to demonstrate this (Molitor
et al. 1998). Hydropathy analyses (Kyte and Doolittle 1982) of
the DsrA and DsrB proteins from D. desulfuricans did not
reveal any long (20 amino acids and above) hydrophobic
regions characteristic of membrane-bound proteins (Esposti
et al. 1990). However, as previously postulated (Steuber and
Kroneck 1998), the transmembrane helix prediction program
PHDhtm (Rost et al. 1995) highlighted a possible transmem-
brane helix in DsrB (inner core helix
186LACCINMCGAVHC198) but it has been shown (Rost
et al. 1995) that globular, water-soluble proteins such as sul-
phite reductase that contain highly hydrophobic bÿchains in
their core can often give false-positive results with this pro-
gram and therefore this prediction should be viewed with
caution. It has subsequently been suggested that the require-
ments for sulphite reductase to be membrane bound, such as
to acquire electrons from the electron transport chain located
nearby, may be circumvented by electron transfer from a
potential transmembrane redox protein complex (Rossi et al.
1993). The complete dsrA and dsrB gene sequences of D.
desulfuricans as determined in this study will allow for the
mutational analysis of sulphite reduction in this species and
= 2000 The Society for Applied Microbiology, Letters in Applied Microbiology, 30, 375ÿ378
DESULFOVIBRIO SULPHITE REDUCTASE 377
the role it plays in the aetiology of ulcerative colitis, as well as
optimizing sulphite reduction for industrial processes.
REFERENCES
Babidge, W., Millard, S. and Roediger, W. (1998) Sul¢des impair
short chain fatty acid b-oxidation at acyl-CoA dehydrogenase
level in colonocytes: Implications for ulcerative colitis. Molecular
and Cellular Biochemistry 181, 117^124.
Bairoch, A., Bucher, P. and Hofmann, K. (1997) The PROSITE
database, its status in1997. Nucleic Acids Research 25, 217^221.
Crane, B.R., Siegel, L.M. and Getzo¡, E.D. (1995) Sul¢te reductase
³  : evolution and catalysis for reduction of inor-
structure at 1.6 A
ganic anions. Science 270, 59^67.
Dahl, C., Kredich, N.M., Deutzmann, R. and Tru«per, H.G. (1993)
Dissimilatory sulphite reductase from Archaeoglobus fulgidus: phy-
sico-chemical properties of the enzyme and cloning, sequencing
and analysis of the reductase genes. Journal of General
Microbiology 139, 1817^1828.
Esposti, M.D., Crimi, M. and Venturoli, G. (1990) A critical evalua-
tion of the hydropathy pro¢le of membrane proteins. European
Journal of Biochemistry 190, 207^219.
Ganesh, R., Robinson, K.G., Chu, L.L., Kucsmas, D. and Reed,
G.D. (1999) Reductive precipitation of uranium by Desulfovibrio
desulfuricans: Evaluation of cocontaminant e¡ects and selective
removal. Water Research 33, 3447^3458.
Gibson, G.R., Cummings, J.H. and Macfarlane, G.T. (1991)
Growth and activities of sulphate-reducing bacteria in gut con-
tents of healthy subjects and patients with ulcerative colitis.
FEMS Microbiology Ecology 86, 103^112.
Kosinska, K. and Miskiewicz, T. (1999) Upgrading the e¤ciency of
dissimilatory sulfate reduction by Desulfovibrio desulfuricans via
adjustment of the COD/SO4 ratio. Biotechnology Letters 21, 299^
302.
Kyte, J. and Doolittle, R.F. (1982) A simple method for displaying
the hydropathic character of a protein. Journal of Molecular
Biology 157, 105^132.
Molitor, M., Dahl, C., Molitor, I., Scha« fer, U., Spiech, N., Huber,
R., Deutzmann, R. and Tru«per, H.G. (1998) A dissimilatory siro-
haem-sul¢te-reductase-type protein from the hyperthermophilic
archaeon Pyrobaculum islandicum. Microbiology 144, 529^541.
Morse, R., Collins, M.D., O'Hanlon, K., Wallbanks, S. and
Richardson, P.T. (1996) Analysis of the b0 subunit of DNA-depen-
dent RNA polymerase does not support the hypothesis inferred
from 16S rRNA analysis that Oenococcus oeni (formerly Leuconostoc
oenos) is a tachytelic (fast-evolving) bacterium. International
Journal of Systematic Bacteriology 46, 1004^1009.
Rapp, B.J. and Wall, J.D. (1987) Genetic transfer in Desulfovibrio
desulfuricans. Proceedings of the National Academy of Sciences of
the USA 84, 9128^9130.
Rossi, M., Pollock, W.B.R., Reij, M.W., Keon, R.G., Fu, R. and
Voordouw, G. (1993) The hmc operon of Desulfovibrio vulgaris
subsp. vulgaris Hildenborough encodes a potential transmem-
brane redox protein complex. Journal of Bacteriology 175, 4699^
4711.
378 R . M O R S E E T A L .
Rost, B., Casadio, R., Fariselli, P. and Sander, C. (1995)
Transmembrane helices predicted at 95% accuracy. Protein
Science 4, 521^533.
Rost, B. and Sander, C. (1993) Prediction of protein secondary struc-
ture at better than 70 % accuracy. Journal of Molecular Biology
232, 584^599.
Steuber, J., Arendsen, A.F., Hagen, W.R. and Kroneck, P.M.H.
(1995) Molecular properties of the dissimilatory sul¢te reductase
from Desulfovibrio desulfuricans (Essex) and comparison with the
enzyme from Desulfovibrio vulgaris (Hildenborough). European
Journal of Biochemistry 233, 873^879.
= 2000 The Society for Applied Microbiology, Letters in Applied Microbiology, 30, 375ÿ378
Steuber, J. and Kroneck, P.M.H. (1998) Desulfoviridin, the dissimi-
latory sul¢te reductase from Desulfovibrio desulfuricans (Essex):
new structural and functional aspects of the membranous
enzyme. Inorganica Chimica Acta 276, 52^57.
Steuber, J., Cypionka, H. and Kroneck, P.M.H. (1994) Mechanism
of dissimilatory sul¢te reduction by Desulfovibrio desulfuricans:
puri¢cation of a membrane-bound sul¢te reductase and coupling
with cytochrome c3 and hydrogenase. Archives of Microbiology
162, 255^260.