Professional Documents
Culture Documents
Abstract
Introduction: An ideal root canal sealer creates a Key Words
bacteria-resistant seal and exhibits antimicrobial activ- Anti-inflammatory, biocompatibility, osteogenic differentiation, sealer
ity, biocompatibility, and osteoconductivity. The aim of
this study was to assess the effects of 3 root canal
sealers on cell viability, inflammatory response, and
osteogenic potential in MC3T3-E1 cells. Methods: AH
T he final step of end-
odontic treatment is
filling of the root canal sys-
Significance
Calcium silicate–based sealers have the ability to
Plus (Dentsply Caulk, Milford, DE), MTA Fillapex reduce inflammation and induce osteogenic differ-
tem to prevent bacteria
(Angelus Solucxoes Odontologicas, Londrina, Brazil), entiation and mineralization in preosteoblasts.
and bacterial elements
and EndoSequence BC (Brasseler, Savannah, GA) Clinically, it will be a great help to use calcium
from the canal system
were mixed according to the manufacturer’s instruc- silicate–based sealers for healing of periapical tis-
entering the periapical
tions, and samples were prepared as extraction media sues.
area, thereby ensuring
(final dilution: 1/10). Lipopolysaccharide (LPS) the success of root canal
(100 ng/mL) treatment was used to induce an inflam- treatment (1–3). Root canal sealer is essential to seal the space between the dentin
matory response in this study. Cell viability was eval- wall and root canal filling material and is also used as a lubricant to fill the root
uated using the Water soluble tetrazolium-1 (WST-1) canal (4). According to Grossman (4), the properties of an ideal root canal sealer
assay. The levels of inflammatory mediators (inter- include slow setting, insolubility in tissue fluid, radiopacity, easy mixing, nonshrinkage,
leukin 6 and tumor necrosis factor alpha) and osteo- bacteriostatic effect, lack of discoloration, and solubility in common solvents if neces-
genic marker genes (ALP and OCN) were measured sary to remove the root canal filling.
by reverse-transcription polymerase chain reaction AH Plus (Dentsply Caulk, Milford, DE) is an epoxy/amine resin–based sealer con-
and real-time polymerase chain reaction. Osteogenic sisting of a paste-paste system, which is delivered in 2 tubes, epoxide paste and amine
potential was evaluated by alkaline phosphatase paste. AH Plus shows excellent properties when compared with conventional sealers,
staining and alizarin red staining. Results: Calcium including radiopacity, limited polymerization shrinkage, insolubility, adhesion to
silicate–based sealers such as MTA Fillapex and Endo- dentin, and adequate sealing ability (5). Therefore, AH Plus is considered as the
Sequence BC showed strong cell viability compared gold standard in dentistry (5).
with AH Plus. AH Plus, MTA Fillapex, and EndoSe- Recently, new calcium silicate–based endodontic sealers have been introduced.
quence BC decreased the levels of LPS-induced inflam- MTA Fillapex (Angelus Solucxoes Odontologicas, Londrina, Brazil) is a mineral trioxide
matory mediators (P < .05). The expression of aggregate (MTA)-based root canal sealer and is composed of salicylates, diluting and
osteogenic marker genes, alkaline phosphatase activ- natural resins, nanoresins, bismuth trioxide, and MTA. MTA-based sealers are biocom-
ity, and mineralized nodule formation decreased with patible and stimulate mineralization (6). A recent study suggested that the cytotoxicity of
LPS treatment. However, AH Plus and calcium silicate– MTA Fillapex decreases after setting, suggesting bioactivity to stimulate hydroxyapatite
based sealers increased the osteogenic potential crystal nucleation (7).
reduced by LPS treatment (P < .05). Conclusions: Cal- EndoSequence BC (Brasseler, Savannah, GA) is another newly developed sealer,
cium silicate–based sealers exhibit anti-inflammatory which is a type of calcium phosphate silicate–based bioceramic sealer. It contains tri-
effects and induce osteogenic differentiation in calcium silicate, dicalcium silicate, calcium phosphates, colloidal silica, calcium hy-
MC3T3-E1 cells. (J Endod 2019;45:73–78) droxide, and zirconium oxide as the radiopacifier (8, 9). According to recent
From the *Department of Conservative Dentistry, School of Dentistry, Dental Science Research Institute, Chonnam National University, Gwangju, Korea;
†
Department of Conservative Dentistry, School of Dentistry, Kyung Hee University, Seoul, Korea; and ‡Research Center for Biomineralization Disorders, Chonnam Na-
tional University, Gwangju, Korea.
Address requests for reprints to Dr Won-Mann Oh, Department of Conservative Dentistry, School of Dentistry, Chonnam National University, Young-bong ro 77,
Bukgu, Gwangju, Korea. E-mail address: wmoh@chonnam.ac.kr
0099-2399/$ - see front matter
Copyright ª 2018 American Association of Endodontists.
https://doi.org/10.1016/j.joen.2018.09.006
JOE — Volume 45, Number 1, January 2019 Calcium Silicate–based Root Canal Sealers 73
Basic Research—Technology
studies, EndoSequence BC shows good biocompatibility without any 30 seconds, and the final extension at 72 C for 20 seconds. The primer
cytotoxic effects and forms a chemical bond with dentin walls (10, 11). sequences for polymerase chain reaction (PCR) were as listed in
Despite the several studies of root canal sealers to date, the Table 1. All the primers were synthesized from Bioneer Co (Taejeon,
biocompatibility, anti-inflammatory, and osteogenic differentiation of Korea). PCR analysis was performed within 30 cycles with a relatively
newly developed sealers is not fully known. The aim of this study was high linearity. Each PCR product was loaded on 1.5% agarose gels by
to evaluate the in vitro cytotoxicity, inflammatory response, and osteo- electrophoresis and visualized by ethidium bromide staining.
genic potential of AH Plus, MTA Fillapex, and EndoSequence BC in Quantitative real-time PCR was conducted using the QuantiTect
mouse-derived preosteoblasts. SYBR Green PCR Kit (Qiagen, Valencia, CA) in triplicate with the
Rotor-Gene 6000 (Corbett Research, Sydney, Australia). The thermal
Materials and Methods cycling conditions were as follows: 15 minutes at 95 C followed by
Cell Culture and Sample Preparation 40 cycles of 95 C for 10 seconds, 58 C for 15 seconds, and 72 C for
MC3T3-E1 cells were cultured in a medium comprising alpha- 20 seconds. All quantitation was normalized to an endogenous control
minimum essential medium (a-MEM; Gibco Invitrogen, Grand Island, beta-actin. Relative gene expression values were analyzed using the 2^Ct
NY) with 10% fetal bovine serum (FBS, Gibco Invitrogen) and antibi- method (12).
otics (100 U/mL penicillin and 100 mg/mL streptomycin, Gibco Invitro-
gen) at 37 C in a humidified atmosphere containing 5% CO2. In this Alkaline Phosphatase Staining
study, untreated MC3T3-E1 (medium only) cells were used as a control. MC3T3-E1 cells were seeded in 24-well plates and preincubated in
AH Plus, MTA Fillapex, and EndoSequence BC were mixed accord- a-MEM containing 10% FBS and antibiotics for 24 hours. First, the cells
ing to the manufacturers’ instructions under aseptic conditions. These were cultured in the presence of various concentrations of LPS (10, 50,
samples were fabricated as discs (total sample weight = 2 g, size = 5- and 100 ng/mL) or without LPS for 24 hours. Furthermore, the cells
mm diameter and 3-mm height). Each sample was allowed to set for were treated with LPS (50 ng/mL) or without LPS for 24 hours in ma-
24 hours at 37 C in a humidified atmosphere with 5% CO2. After setting, terial extracts (dilution 1/10). Determination of alkaline phosphatase
the disc was sterilized by ultraviolet radiation for 1 hour on each sur- (ALP) activity was performed after 7 days of incubation, changing the
face. The discs were transferred to conical centrifuge tubes containing medium or material extracts every 3 days. After 7 days, the medium
40 mL fresh a-MEM and antibiotics for 7 days in a humidified atmo- was removed, and the cultured cells were fixed in 70% ethanol for
sphere at 37 C and 5% CO2. Supernatant from this preparation was 1 hour followed by rinsing with distilled water 3 times. Fixed cells
filtered using 0.20-mm filters (Minisart; Sartorius Stedim Biotech, Goet- were treated with 300 mL ALP staining reagent (1-step NBT/BCIP solu-
tingen, Germany). tion; Thermo Fisher Scientific Inc, Rockford, IL) per well for 15 mi-
nutes. The staining reagent was removed and photographed using an
Cell Viability Officejet Pro L7580 scanner (HP, Palo Alto, CA). To quantitatively eval-
The MC3T3-E1 cells were seeded in 96-well culture plates and uate the staining results, the stain was treated with 10% cetylpyridinium
preincubated in a-MEM containing 10% FBS and antibiotics for chloride (pH = 7.0) for 30 minutes followed by measuring the absor-
24 hours. The medium was replaced with the material extracts in the bance at 562 nm on a spectrophotometer (VERSAmax Multiplate
experiment groups (AH Plus, MTA Fillapex, and EndoSequence BC). Reader).
To compare dose-response relationships, the material extracts were
gradually diluted with medium to obtain 5 dilutions (1, 1/5, 1/10, 1/ Alizarin Red Staining
50, and 1/100). After 24 hours, cell viability was analyzed using the The MC3T3-E1 cells were seeded in 24-well culture plates and
EZ-Cytox–enhanced cell viability assay kit (Daeil Lab Service, Seoul, Ko- preincubated in a-MEM containing 10% FBS and antibiotics for
rea). Briefly, 10 mL EZ-Cytox reagent was added to each well of the 96- 24 hours. First, the cells were cultured in the presence of various con-
well plate and incubated at 37 C for 4 hours. Optical densities were centrations of LPS (10, 50, 100, and 200 ng/mL) or without LPS for
measured at 420 nm using a multiwell spectrophotometer (VERSAmax 24 hours. In addition, the cells were treated with LPS (200 ng/mL),
Multiplate Reader; Molecular Devices, Sunnyvale, CA). The relative cell or without LPS for 24 hours in material extracts diluted 1/10. The deter-
viability was calculated for each test material as a percentage of the mination of mineralization activity was performed after 14 days of incu-
mean of the control. bation, changing the medium or material extracts every 3 days. After
14 days, the cells were stained with 2% alizarin red stain solution (LIFE-
Reverse-transcription Polymerase Chain Reaction and LINE Cell Tech, Frederick, MD) for 20 minutes and washed 5 times with
Real-time Polymerase Chain Reaction sterile water. Analysis of the results was repeated as in ALP staining.
The MC3T3-E1 cells were seeded in 6-well culture plates and pre-
incubated in a-MEM containing 10% FBS and antibiotics for 24 hours.
To induce the inflammatory response, we used Escherichia coli lipo- TABLE 1. Sequences of the Primers Used for Reverse-transcription Polymerase
Chain Reaction and Real-time Polymerase Chain Reaction
polysaccharide (LPS) (InvivoGen, San Diego, CA). The cells were
treated with LPS (100 ng/mL) for 24 hours, and the medium was re- Primer sequences (50 -30 )
placed by the material extract in the experiment groups for 0, 1, and Interleukin-6 Forward: GAGACTTCCATCCAGTTGCC
2 days. The cells from each group were collected, and the RNA was ex- Reverse: TACTCCAGAAGACCAGAGG
tracted using TRIzol reagent (Gibco Invitrogen) according to the man- Tumor necrosis Forward: GGGACAGTGACCTGGACTGT
factor alpha Reverse: GCAGAGGTTCAGTGATGTAG
ufacturer’s protocol. Complementary DNA was synthesized using Alkaline Forward: TACATTCCCCATGTGATGGC
random primers (Promega Biotech, Piscataway, NJ) and the Access- phosphatase Reverse: ACCTCTCCCTTGAGTGTGGG
QuickTM reverse-transcription polymerase chain reaction (RT-PCR) Osteocalcin Forward: CTCCTGAGTCTGACAAAGCC
system (Promega, Madison, WI). The thermal cycling conditions Reverse: TTGCGCAGTTAGCAATAGCA
were set as follows: 5 minutes at 95 C, denaturation at 95 C for 5 sec- Beta-actin Forward: TGGATGGCTACGTACATGGCTGGG
Reverse: TTCTTTGCAGCTCCTTCGTTGCCG
onds, annealing at a temperature optimized for each primer pair for
JOE — Volume 45, Number 1, January 2019 Calcium Silicate–based Root Canal Sealers 75
Basic Research—Technology
Figure 1. The cell viability of sealers and LPS. The relative cell viability of (A) AH Plus, (B) MTA Fillapex, (C) EndoSequence BC, and (D) LPS (*P < .05). The
effects of LPS on (E and G) ALP activity and (F and H) mineralization. Different letters represent statistically significant differences between the test materials
(P < .05).
then induce osteoblasts to produce and mineralize the new bone via In conclusion, calcium silicate–based sealers such as MTA Filla-
deposition of apatite crystals (32). Thus, calcium release from MTA pex and EndoSequence BC exhibit anti-inflammatory activity and pro-
Fillapex and EndoSequence BC is thought to promote osteoblastic differ- mote osteogenic differentiation, suggesting that these sealers may be
entiation and calcium nodule formation. used for successful endodontic treatment. However, further studies
Figure 2. The expression profiles of inflammatory mediators and osteogenic markers treated with LPS and sealer extracts assayed by RT-PCR and real-time PCR.
The mRNA expression of the following inflammatory mediators: (A) RT-PCR, (B) IL-6, and (C) TNF-a. The mRNA expression of the following osteogenic markers:
(D) RT-PCR, (E) ALP, and (F) OCN. #Statistically significant differences between the control and the LPS-only group (P < .05). *Statistically significant differences
comparing the LPS-only group with the experimental groups (P < .05).
JOE — Volume 45, Number 1, January 2019 Calcium Silicate–based Root Canal Sealers 77
Basic Research—Technology
Figure 3. The effects of sealers on (A and C) ALP activity and (B and D) mineralization. #Statistically significant differences comparing the control and the LPS-only
group (P < .05). *Statistically significant difference comparing the LPS-only group with the experimental groups (P < .05).
are needed to elucidate the mechanisms by which MTA Fillapex and En- 13. Ørstavik D, Pitt Ford T. Apical periodontitis: microbial infection and host responses.
doSequence BC sealers manifest anti-inflammatory effects and induce In: Essential Endodontology: Prevention and Treatment of Apical Periodontitis.
Oxford: Blackwell Science; 1998:1–8.
osteogenic differentiation. 14. Chavez De Paz L, Dahlen G, Molander A, et al. Bacteria recovered from teeth with
apical periodontitis after antimicrobial endodontic treatment. Int Endod J 2003;
36:500–8.
Acknowledgments 15. Gomes B, Pinheiro E, Gad^e-Neto C, et al. Microbiological examination of infected
dental root canals. Oral Microbiol Immunol 2004;19:71–6.
Bin-Na Lee and Ji-Uk Hong contributed equally to this study. 16. Berridge MV, Herst PM, Tan AS. Tetrazolium dyes as tools in cell biology: new in-
Supported by a grant from Chonnam National University Hos- sights into their cellular reduction. Biotechnol Annu Rev 2005;11:127–52.
pital Biomedical Research Institute, South Korea (no. CRI 18029-1) 17. Lee JK, Kwak SW, Ha JH, et al. Physicochemical properties of epoxy resin-based and
bioceramic-based root canal sealers. Bioinorg Chem Appl 2017;2017:2582849.
and the National Research Foundation of Korea grant funded by the 18. Dahlen G, Magnusson BC, M€oller A. Histological and histochemical study of the in-
Korean government, South Korea (no. 2016R1C1B1012703). fluence of lipopolysaccharide extracted from Fusobacterium nucleatum on the peri-
The authors deny any conflicts of interest related to this study. apical tissues in the monkey Macaca fascicularis. Arch Oral Biol 1981;26:591–8.
19. Listgarten MA. Pathogenesis of periodontitis. J Clin Periodontol 1986;13:418–25.
20. Bezerra MC, Carvalho JF, Prokopowitsch AS, Pereira RM. RANK, RANKL and osteo-
protegerin in arthritic bone loss. Braz J Med Biol Res 2005;38:161–70.
References 21. Kadono H, Kido J, Kataoka M, et al. Inhibition of osteoblastic cell differentiation by
1. Ng YL, Mann V, Rahbaran S, et al. Outcome of primary root canal treatment: system- lipopolysaccharide extract from Porphyromonas gingivalis. Infect Immun 1999;67:
atic review of the literature–part 2. Influence of clinical factors. Int Endod J 2008; 2841–6.
41:6–31. 22. Xing Q, Ye Q, Fan M, et al. Porphyromonas gingivalis lipopolysaccharide inhibits the
2. Grossman LI, Oliet S, Del Rio CE. Endodontic Practice. Philadelphia: Lea & Febiger; osteoblastic differentiation of preosteoblasts by activating Notch1 signaling. J Cell
1988. Physiol 2010;225:106–14.
3. Sundqvist G, Figdor D, Persson S, Sj€ogren U. Microbiologic analysis of teeth with 23. Guo C, Yuan L, Wang JG, et al. Lipopolysaccharide (LPS) induces the apoptosis and
failed endodontic treatment and the outcome of conservative re-treatment. Oral inhibits osteoblast differentiation through JNK pathway in MC3T3-E1 cells. Inflam-
Surg Oral Med Oral Pathol Oral Radiol Endod 1998;85:86–93. mation 2014;37:621–31.
4. Grossman LI. An improved root canal cement. J Am Dent Assoc 1958;56:381–5. 24. Yasuda Y, Ogawa M, Arakawa T, et al. The effect of mineral trioxide aggregate on the
5. Tyagi S, Mishra P, Tyagi P. Evolution of root canal sealers: an insight story. Eur J Gen mineralization ability of rat dental pulp cells: an in vitro study. J Endod 2008;34:
Dent 2013;2:199. 1057–60.
6. Gomes-Filho JE, Watanabe S, Bernabe PF, de Moraes Costa MT. A mineral trioxide 25. Min KS, Yang SH, Kim EC. The combined effect of mineral trioxide aggregate and
aggregate sealer stimulated mineralization. J Endod 2009;35:256–60. enamel matrix derivative on odontoblastic differentiation in human dental pulp
7. Salles LP, Gomes-Cornelio AL, Guimaraes FC, et al. Mineral trioxide aggregate– cells. J Endod 2009;35:847–51.
based endodontic sealer stimulates hydroxyapatite nucleation in human 26. Masuda-Murakami Y, Kobayashi M, Wang X, et al. Effects of mineral trioxide aggre-
osteoblast-like cell culture. J Endod 2012;38:971–6. gate on the differentiation of rat dental pulp cells. Acta Histochem 2010;112:452–8.
8. Takagi S, Chow LC, Hirayama S, Eichmiller FC. Properties of elastomeric calcium 27. Peng W, Liu W, Zhai W, et al. Effect of tricalcium silicate on the proliferation and
phosphate cement–chitosan composites. Dent Mater 2003;19:797–804. odontogenic differentiation of human dental pulp cells. J Endod 2011;37:1240–6.
9. Yang Q, Lu D. Premixed biological hydraulic cement paste composition and using 28. Jung GY, Park YJ, Han JS. Effects of HA released calcium ion on osteoblast differen-
the same. Google Patents; 2013. Available at: https://patents.google.com/patent/ tiation. J Mater Sci Mater Med 2010;21:1649–54.
US8475811B2/en. Accessed December 13, 2018. 29. Schr€oder U. Effects of calcium hydroxide-containing pulp-capping agents on pulp
10. De-Deus G, Canabarro A, Alves G, et al. Cytocompatibility of the ready-to-use bio- cell migration, proliferation, and differentiation. J Dent Res 1985;64:541–8.
ceramic putty repair cement iRoot BP Plus with primary human osteoblasts. Int En- 30. Lopez-Cazaux S, Bluteau G, Magne D, et al. Culture medium modulates the behaviour
dod J 2012;45:508–13. of human dental pulp-derived cells: technical note. Eur Cell Mater 2006;11:35–42.
11. Zhang W, Li Z, Peng B. Assessment of a new root canal sealer’s apical sealing ability. 31. Gandolfi M, Taddei P, Tinti A, Prati C. Apatite-forming ability (bioactivity) of ProRoot
Oral Surg Oral Med Oral Pathol Oral Radiol Endod 2009;107:e79–82. MTA. Int Endod J 2010;43:917–29.
12. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time 32. Tay FR, Pashley DH. Guided tissue remineralisation of partially demineralised hu-
quantitative PCR and the 2 DDCT method. Methods 2001;25:402–8. man dentine. Biomaterials 2008;29:1127–37.